International Nuclear Information System (INIS)
Schneider, J.F.; Schoeller, D.A.; Nemchausky, B.; Bayer, J.L.; Klein, P.
1978-01-01
Interval sampling of expired breath as a simple, non-invasive assessment of the effect of liver disease upon hepatic microsomal drug metabolism, has been demonstrated with [ 14 C] dimethylaminoantipyrine (aminopyrine). In order to eliminate radiation risk the authors have validated the use of aminopyrine labeled with the stable, non-radioactive isotope 13 C. Simultaneous oral administration of both [ 14 C]- and [ 13 C] aminopyrine to five adult subjects without liver disease as well as five patients with known liver disease, resulted in the excretion of label at nearly identical rates in both individual time collections (r=0.94) as well as cumulative excretion for three hours (r=0.97). An oral dose of 2-mg/kg of [ 13 C) aminopyrine resulted in rates of production of 13 CO 2 significantly greater than baseline variations in 13 CO 2 production in the fasting, resting subject. Measurements of a single peak value at one half hour correlated closely with the determination of cumulative appearance over three hours (r=0.96). A consistent reproducible increase in the peak production of 13 CO 2 was observed when five patients received phenobarbital. Stable isotope labeled aminopyrine may be used to detect the effects of disease and treatment upon hepatic N-demethylation activity in human subjects without incurring any risk from radiation. Furthermore, the availability of another isotopic carbon label should make possible the study of direct drug-drug interaction utilizing CO 2 analysis. (Auth.)
Impairment of aminopyrine clearance in aspirin-damaged canine gastric mucosa
International Nuclear Information System (INIS)
Miller, T.A.; Henagan, J.M.; Loy, T.M.
1983-01-01
Using an in vivo canine chambered stomach preparation, the clearance of [ 14 C]aminopyrine across mucosa when intravenously infused and the back-diffusion of this substance from gastric lumen to mucosa when topically applied to gastric epithelium were evaluated in aspirin-damaged gastric epithelium. In mucosa damaged by either 20 mM or 40 mM aspirin, the recovery of [ 14 C]aminopyrine, when topically mixed with acid (pH . 1.1) perfusate solution, was not significantly different from nondamaged control mucosa. In addition, the degree of ''trapping'' of this substance from back-diffusion was not different in damaged mucosa from that observed in nondamaged epithelium. In contrast, when [ 14 C]aminopyrine was intravenously infused, its clearance was significantly impaired in aspirin-damaged mucosa when compared with control studies, as evidenced by the increased ''trapping'' of this substance in injured epithelium. These findings indicate that movement of aminopyrine from plasma to gastric lumen is impaired in damaged epithelium, making the aminopyrine clearance technique an unreliable method to accurately measure absolute gastric blood flow in this experimental setting
International Nuclear Information System (INIS)
Reinicke, C.; Hippius, M.
1983-01-01
The 14 C-aminopyrine breath test is a simple procedure for the non-invasive determination of the microsomal function of the liver. After oral administration of 74 kBq 14 C-aminopyrine the 14 CO 2 activity of the expired breath air is determined in hourly intervals. There is a close correlation between its decrease and the elimination of aminopyrine from the plasma. Both the elimination constant of 14 CO 2 and the maximal specific 14 CO 2 activity are useful quantitative parameters of the test. They allow conclusions as to the hepatic demethylation capacity. Both parameters were significantly lower in 15 patients with liver cirrhosis than in 12 control patients. The non-steroidal anti-inflammatory drug diclofenac-sodium did not significantly influence the demethylation of 14 C-aminopyrine in 5 patients with rheumatic diseases and in 2 healthy probands. Further experience with the breath test is necessary, especially with respect to its suitability for prospective investigation. (author)
Wutzke, Klaus D; Wigger, Marianne
2009-09-01
The aim of this study was to investigate the hepatic microsomal and cytosolic functions by using the 13CO2 breath test in healthy subjects either before or after consumption of red wine. Twelve adults received [13C2]aminopyrine and L-[1-13C]phenylalanine together with a standardised dinner. Expired air samples were taken over 6 h. After a wash-out period, the subjects consumed 0.4 ml ethanol per kg per day together with dinner over a 7.5-day period on average. Thereafter, 13C-tracer administration was repeated under identical conditions. The 13CO2 enrichments were measured by isotope ratio mass spectrometry. The mean cumulative percentage 13C-dose recovery after administration of [13C2]aminopyrine and L-[1-13C]phenylalanine either without or with red wine consumption amounted to 17.0+/-4.4 vs. 14.7+/-3.1% (p=0.170) and 14.0+/-2.8 vs. 11.5+/-3.9% (p=0.084), respectively. Moderate alcohol consumption does not induce significant short-term changes of the microsomal and the cytosolic function of the human liver in healthy subjects.
Assessment of the (/sup 14/C) aminopyrine breath test in liver disease
Energy Technology Data Exchange (ETDEWEB)
Galizzi, J; Long, R G; Billing, B H; Sherlock, S [Royal Free Hospital, London (UK)
1978-01-01
Different methods of performing the (/sup 14/C) aminopyrine breath test have been assessed. A tracer dose of 2 ..mu..Ci without a loading dose and with a single breath collection at two hours was the method selected, since it gave the best discrimination between patients with hepatocellular diseases and normal subjects (5.2 +- 0.2%, mean - SEM). Reduced values occurred in patients with chronic active hepatitis (with and without cirrhosis) (1.5 +- 0.2%), alcoholic cirrhosis (1.7 +- 0.4%) and hepatitis (2.5 +- 0.3%), and late primary biliary cirrhosis suggesting defective microsomal function with respect to demethylation. Normal results were common in early primary biliary cirrhosis. Two weeks of prednisolone therapy caused some improvement in the breath test in nine of ten patients with chronic active hepatitis. It is concluded that the (/sup 14/C) aminopyrine breath test is a simple test for detecting hepatocellular dysfunction, but has no obvious diagnostic advantage over the determination of serum aspartate transaminase and two hour post-prandial bile-acids.
Breath 14CO2 after intravenous administration of [14C]aminopyrine in liver diseases
International Nuclear Information System (INIS)
Pauwels, S.; Geubel, A.P.; Dive, C.; Beckers, C.
1982-01-01
The determination of of 14 CO2 in breath after oral administration of [ 14 C]aminopyrine has been proposed as a quantitative liver function test. In order to shorten the procedure and avoid misinterpretations related to variable rates of intestinal absorption, the [ 14 C]aminopyrine breath test (ABT) was performed after intravenous administration of [ 14 C]aminopyrine in 21 controls and 89 patients with biopsy-proven liver disease. The specific activity of the first hour sample corrected for body weight (SA1) was the most discriminant expression of breath data. The SA1 value, expressed as the percentage of the administered dose, was 0.86 +/- 0.1% (mean +/- SD) in controls and significantly less in patients (0.46 +/- 0.31%). Low values were observed in patients with untreated chronic active hepatitis (0.16 +/- 0.13%), alcoholic cirrhosis (0.2 +/ 0.15%0, and untreated postnecrotic cirrhosis (0.47 +/- 0.17%). In contrast, normal values were obtained in chronic persistent hepatitis (0.86 +/- 0.13%) and 58% of noncirrhotic alcoholic liver diseases (0.83 +/- 0.27%). The results of duplicate studies were reproducible and SA1 correlated with other conventional liver function tests, including 45-min BSP retention. Among these, ABT was the most sensitive screening test for the presence of cirrhosis, especially in alcoholic patients, where it allowed a sharp distinction between cirrhotic and noncirrhotic cases. The results obtained in chronic hepatitis suggested that ABT may provide a reliable index of the activity of the disease. In our hands, intravenous ABT, performed over a 1-hr period, was a fast, sensitive, and discriminant liver function test
Energy Technology Data Exchange (ETDEWEB)
Caspary, W F; Schaffer, J
1978-01-01
D-galactose metabolism and demethylation of aminopyrine by healthy controls and patients with chronic active hepatitis (CAH) and cirrhosis (Ci), were assessed by a breath analysis technique measuring /sup 14/CO2 exhalation after oral ingestion of /sup 14/C-D-galactose or /sup 14/C-aminopyrine. Patients with CAH and Ci exhibited decreased /sup 14/CO2-exhalation rates following /sup 14/-D-galactose or /sup 14/C-aminopyrine. D-galactose oxidation capacity of the liver can be assessed by a breath analysis technique in analogy to the demethylating function for aminopyrine. The ordinary oral D-galactose tolerance test seems, however, superior in comparison to the /sup 14/C-D-galactose tolerance test, in discriminating between healthy controls and patients with chronic liver disease.
Predicting outcome of paracetamol poisoning by using 14C-aminopyrine breath test
International Nuclear Information System (INIS)
Saunders, J.B.; Wright, N.; Lewis, K.O.
1980-01-01
The 14 C-aminopyrine ( 14 C-amidopyrine) breath test, carried out within 24 to 36 hours of an overdosage of paracetamol, was used to predict the extent of liver damage in 30 seriously poisoned patients. Mean 14 C0 2 excretion was 4.4% in 20 healthy control subjects; 5.5% in six patients who escaped injury; and 2.9%, 1.5%, and 0.2% in those with mild to moderate (12 patients), severe (eight patients), and fatal (four patients) liver damage respectively. This test proved to be a more reliable predictor of the extent of liver damage than plasma paracetamol concentration or half life or the results of conventional liver function tests and may enable treatment of hepatic failure to be started at an early stage. (author)
Tumor induction in rats by feeding aminopyrine or oxytetracycline with nitrite
Energy Technology Data Exchange (ETDEWEB)
Taylor, H W; Luinsky, W
1975-01-01
Sprague-Dawley rats were given combinations of aminopyrine or oxytetracycline and sodium nitrite in drinking water. Of 30 animals receiving 0.1 percent (1,000 ppm) of aminopyrine and sodium nitrite for 30 weeks, 29 died with hemangioendothelial sarcomas of the liver. The same tumor caused death in 26 of 30 animals that received 0.025 percent (250 ppm) of both aminopyrine and sodium nitrite for 50 weeks. No animals in a control group of the same size that received 0.1 percent aminopyrine for 30 weeks developed this tumor, although one-half of them were still alive 2 years after the experiment was begun. After feeding a comparable dose (0.1 percent) of oxytetracycline and sodium nitrite for 60 weeks, liver tumors were present in 4 of 30 rats (3 hepatocellular tumors and 1 cholangioma). Since aminopyrine has been widely used for medicinal purposes in the human population, it is possible that many people have been exposed to a potent carcinogen (dimethylnitrosamine) by its formation in vivo. It is not certain whether the result of feeding oxytetracycline and sodium nitrite indicates significant carcinogenicity of this combination. (auth)
International Nuclear Information System (INIS)
Lawrence, Paul; Conderino, Joseph S.; Rieder, Elizabeth
2014-01-01
Previously, RNA helicase A (RHA) re-localization from the nucleus to the cytoplasm in foot-and-mouth disease virus (FMDV) infected cells was shown to coincide with loss of RHA methylated arginine residues at its C-terminus. The potential interaction between RHA and Jumonji C-domain (JmjC) protein 6 (JMJD6) arginine demethylase in infected cells was investigated. Treatment with N-oxalylglycine (NOG) inhibitor of JmjC demethylases prevented FMDV-induced RHA demethylation and re-localization, and also decreased viral protein synthesis and virus titers. Physical interaction between JMJD6 and RHA was demonstrated via reciprocal co-immunoprecipitation, where RHA preferentially bound JMJD6 monomers. Nuclear efflux of demethylated RHA (DM-RHA) coincided with nuclear influx of JMJD6, which was not observed using another picornavirus. A modified biochemical assay demonstrated JMJD6 induced dose-dependent demethylation of RHA and two RHA-derived isoforms, which could be inhibited by NOG. We propose a role for JMJD6 in RHA demethylation stimulated by FMDV, that appears to facilitate virus replication. - Highlights: • We examined the role of JMJD6 in FMDV-induced RHA demethylation process. • Using an arginine demethylation assay showed that JMJD6 is involved in RHA demethylation. • A demethylases inhibitor reduced cytoplasmic accumulation of RHA and FMDV titers
Energy Technology Data Exchange (ETDEWEB)
Lawrence, Paul; Conderino, Joseph S.; Rieder, Elizabeth, E-mail: elizabeth.rieder@ars.usda.gov
2014-03-15
Previously, RNA helicase A (RHA) re-localization from the nucleus to the cytoplasm in foot-and-mouth disease virus (FMDV) infected cells was shown to coincide with loss of RHA methylated arginine residues at its C-terminus. The potential interaction between RHA and Jumonji C-domain (JmjC) protein 6 (JMJD6) arginine demethylase in infected cells was investigated. Treatment with N-oxalylglycine (NOG) inhibitor of JmjC demethylases prevented FMDV-induced RHA demethylation and re-localization, and also decreased viral protein synthesis and virus titers. Physical interaction between JMJD6 and RHA was demonstrated via reciprocal co-immunoprecipitation, where RHA preferentially bound JMJD6 monomers. Nuclear efflux of demethylated RHA (DM-RHA) coincided with nuclear influx of JMJD6, which was not observed using another picornavirus. A modified biochemical assay demonstrated JMJD6 induced dose-dependent demethylation of RHA and two RHA-derived isoforms, which could be inhibited by NOG. We propose a role for JMJD6 in RHA demethylation stimulated by FMDV, that appears to facilitate virus replication. - Highlights: • We examined the role of JMJD6 in FMDV-induced RHA demethylation process. • Using an arginine demethylation assay showed that JMJD6 is involved in RHA demethylation. • A demethylases inhibitor reduced cytoplasmic accumulation of RHA and FMDV titers.
In vivo effects of Faizol Ubat Batuk, a herbal product on aminopyrine metabolism in rat hepatocytes
Directory of Open Access Journals (Sweden)
Abas Hj Hussin
2011-09-01
Full Text Available Traditional medicines, in particular herbal products, have been used abundantly over the years in curing several diseases. Pharmacological interactions of herbal products with modern drugs, however, remain to some extent unknown. Herein, we examined whether co-administration of Faizol Ubat Batuk (FUB, a mixture of aqueous extract of different plants, modifies the metabolism of aminopyrine, a conventional analgesic drug, in rat liver. We used rat hepatocytes outfitted by collagenase perfusion technique. Determination of aminopyrine n-demethylase activity was performed using the Nash colorimetric method, by measuring the amount of formaldehyde produced. Compared to control treatment, FUB significantly increased the hepatic metabolism of aminopyrine in healthy adult male rats. In contrast, the hepatic metabolism of aminopyrine in adult female rats was decreased. Besides, a biphasic effect in n-demethylase activity was observed in young male rats treated with FUB. In a subsequent experiment, FUB did not change the metabolism of aminopyrine in streptozotocin (STZ-diabetic adult male rats. In conclusion, administration of FUB could affect phase I aminopyrine metabolism in rat heptocytes. In addition, the effects of FUB on hepatic n-demethylase activity were gender and disease dependent.
Synthesis of ring-13C-labelled and ring-demethylated retinals
International Nuclear Information System (INIS)
Courtin, J.M.L.
1988-01-01
Efficient synthetic schemes are described for the preparation of the required mono- and di- 13 C labelled retinals based on simple 13 C labelled starting materials. Results from solid-state 13 C-NMR spectroscopic studies of the various ring- 13 C labelled bacteriorhodopsins and rhodopsins are discussed. 404 refs.; 74 figs.; 16 tabs
International Nuclear Information System (INIS)
Schmidt, H.
1982-01-01
Albino mice were subcutaneously injected with carbon 14 dimethyl aminopyrines, the methyl group of which can be metabolised in the organism into carbon dioxide 14. The following results were obtained: In the carbon dioxide 14 exhalation of neonate, young and adult animals after administration of carbon 14 aminopyrine, distinct differences were noted. The maximum of elimination via the lungs occurs after 20-30 minutes in grown-up mice, in neonates or young animals distinctly later (60-90 min). The carbon dioxide 14 exhalation was also measured after additional subcutaneous application of methrotrexate. In mice aged 8 and 10 days a distinct decrease in carbon dioxide 14 exhalation was found. By contrast, a rise in carbon dioxide 14 exhaled was found in mice aged 2 days. The orientating experiments with folic acid and carbon 14 dimethyl aminopyrine show that leucovorin leads to a distinct increase in carbon dioxide 14 exhalation during the first 30 minutes. As a cause of the different degrees of stimulation respectively inhibition of demethylation, different biochemical ways of formaldehyde formation are pointed out. One of these probably includes the folate-dependent reaction. (orig./MG) [de
Monkey liver cytochrome P450 2C9 is involved in caffeine 7-N-demethylation to form theophylline.
Utoh, Masahiro; Murayama, Norie; Uno, Yasuhiro; Onose, Yui; Hosaka, Shinya; Fujino, Hideki; Shimizu, Makiko; Iwasaki, Kazuhide; Yamazaki, Hiroshi
2013-12-01
Caffeine (1,3,7-trimethylxanthine) is a phenotyping substrate for human cytochrome P450 1A2. 3-N-Demethylation of caffeine is the main human metabolic pathway, whereas monkeys extensively mediate the 7-N-demethylation of caffeine to form pharmacological active theophylline. Roles of monkey P450 enzymes in theophylline formation from caffeine were investigated using individual monkey liver microsomes and 14 recombinantly expressed monkey P450 enzymes, and the results were compared with those for human P450 enzymes. Caffeine 7-N-demethylation activity in microsomes from 20 monkey livers was not strongly inhibited by α-naphthoflavone, quinidine or ketoconazole, and was roughly correlated with diclofenac 4'-hydroxylation activities. Monkey P450 2C9 had the highest activity for caffeine 7-N-demethylation. Kinetic analysis revealed that monkey P450 2C9 had a high Vmax/Km value for caffeine 7-N-demethylation, comparable to low Km value for monkey liver microsomes. Caffeine could dock favorably with monkey P450 2C9 modeled for 7-N-demethylation and with human P450 1A2 for 3-N-demethylation. The primary metabolite theophylline was oxidized to 8-hydroxytheophylline in similar ways by liver microsomes and by recombinant P450s in both humans and monkeys. These results collectively suggest a high activity for monkey liver P450 2C9 toward caffeine 7-N-demethylation, whereas, in humans, P450 1A2-mediated caffeine 3-N-demethylation is dominant.
Gadd45a promotes DNA demethylation through TDG
Li, Zheng; Gu, Tian-Peng; Weber, Alain R.; Shen, Jia-Zhen; Li, Bin-Zhong; Xie, Zhi-Guo; Yin, Ruichuan; Guo, Fan; Liu, Xiaomeng; Tang, Fuchou; Wang, Hailin; Sch?r, Primo; Xu, Guo-Liang
2015-01-01
Growth arrest and DNA-damage-inducible protein 45 (Gadd45) family members have been implicated in DNA demethylation in vertebrates. However, it remained unclear how they contribute to the demethylation process. Here, we demonstrate that Gadd45a promotes active DNA demethylation through thymine DNA glycosylase (TDG) which has recently been shown to excise 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) generated in Ten-eleven-translocation (Tet)?initiated oxidative demethylation. The conn...
Cho, Bongsup P; Yang, Tianle; Blankenship, Lonnie R; Moody, Joanna D; Churchwell, Mona; Beland, Frederick A; Culp, Sandra J
2003-03-01
Malachite green (MG), a triphenylmethane dye used to treat fungal and protozoan infections in fish, undergoes sequential oxidation to produce various N-demethylated derivatives (monodes-, dides(sym)-, dides(unsym)-, trides-, and tetrades-) both before and after reduction to leucomalachite green (LMG). The close structure resemblance of the metabolites with aromatic amine carcinogens implicates a potential genotoxicity from exposure to MG. The availability of the synthetic standards is important for metabolic and DNA adduct studies of MG. This paper describes a simple and versatile method for the synthesis of MG, LMG, and their N-demethylated metabolites. The synthesis involves a coupling of 4-(dimethylamino)benzophenone or 4-nitrobenzophenone with the aryllithium reagents derived from appropriately substituted 4-bromoaniline derivatives, followed by treatment with HCl in methanol. The resulting cationic MG and their leuco analogues showed systematic UV/vis spectral and tandem mass fragmentation patterns consistent with sequential N-demethylation. The extensive (1)H and (13)C spectral assignments of the metabolites were aided by the availability of (13)C(7)-labeled MG and LMG. The results indicate the existence of a resonance structure with the cationic charge located in the central methane carbon (C(7)). The synthetic procedure is general in scope so that it can be extended to the preparation of N-demethylated metabolites of other structurally related N-methylated triphenylmethane dyes.
Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11
International Nuclear Information System (INIS)
Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma
2010-01-01
Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further
Fast Curing Bio-Based Phenolic Resins via Lignin Demethylated under Mild Reaction Condition
Directory of Open Access Journals (Sweden)
Jiongjiong Li
2017-09-01
Full Text Available Demethylation technique has been used to enhance lignin reactivity for preparation of phenolic resins. However, the demethylation efficiency and the demethylated lignin (DL reactivity were still unsatisfactory. To improve the demethylation efficiency, alkali lignin was demethylated under different mild conditions using sodium sulfite as a catalyst. Lignin and DL were characterized by 1H-NMR (nuclear magnetic resonance and Fourier transform infrared (FT-IR spectroscopy to determine the demethylation mechanism. With the demethylation of lignin, the methoxyl group content decreased from 1.93 m mol/g to 1.09 m mol/g, and the phenolic hydroxyl group content increased from 0.56 m mol/g to 0.82 m mol/g. These results revealed that methoxyl groups were attacked by SO32−, and some methoxyl groups were converted to phenolic hydroxyl groups by a nucleophilic substitution reaction, generating DL with high reactivity. The chemical properties of lignin-based phenolic resins were studied by 13C-NMR and FT-IR spectroscopy, and their physical properties were also investigated. The results indicated that lignin-based phenolic resins exhibited faster curing rate and shorter gel time. In addition, the bonding strength increased from 0.92 MPa to 1.07 MPa, and the formaldehyde emission decreased from 0.58 mg/L to 0.22 mg/L after lignin demethylated at the optimum condition.
Vitamin C induces specific demethylation of H3K9me2 in mouse embryonic stem cells via Kdm3a/b.
Ebata, Kevin T; Mesh, Kathryn; Liu, Shichong; Bilenky, Misha; Fekete, Alexander; Acker, Michael G; Hirst, Martin; Garcia, Benjamin A; Ramalho-Santos, Miguel
2017-01-01
Histone methylation patterns regulate gene expression and are highly dynamic during development. The erasure of histone methylation is carried out by histone demethylase enzymes. We had previously shown that vitamin C enhances the activity of Tet enzymes in embryonic stem (ES) cells, leading to DNA demethylation and activation of germline genes. We report here that vitamin C induces a remarkably specific demethylation of histone H3 lysine 9 dimethylation (H3K9me2) in naïve ES cells. Vitamin C treatment reduces global levels of H3K9me2, but not other histone methylation marks analyzed, as measured by western blot, immunofluorescence and mass spectrometry. Vitamin C leads to widespread loss of H3K9me2 at large chromosomal domains as well as gene promoters and repeat elements. Vitamin C-induced loss of H3K9me2 occurs rapidly within 24 h and is reversible. Importantly, we found that the histone demethylases Kdm3a and Kdm3b are required for vitamin C-induced demethylation of H3K9me2. Moreover, we show that vitamin C-induced Kdm3a/b-mediated H3K9me2 demethylation and Tet-mediated DNA demethylation are independent processes at specific loci. Lastly, we document Kdm3a/b are partially required for the upregulation of germline genes by vitamin C. These results reveal a specific role for vitamin C in histone demethylation in ES cells and document that DNA methylation and H3K9me2 cooperate to silence germline genes in pluripotent cells.
Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito
2014-01-01
Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Simultaneous hyperpolarized 13C-pyruvate MRI and 18F-FDG-PET in cancer (hyperPET)
DEFF Research Database (Denmark)
Gutte, Henrik; Hansen, Adam E.; Henriksen, Sarah T.
2015-01-01
named this concept hyper PET. Intravenous injection of the hyperpolarized 13C-pyruvate results in an increase of 13C-lactate, 13C-alanine and 13CCO2 (13C-HCO3) resonance peaks relative to the tissue, disease and the metabolic state probed. Accordingly, with dynamic nuclear polarization (DNP) and use......In this paper we demonstrate, for the first time, the feasibility of a new imaging concept - combined hyperpolarized 13C-pyruvate magnetic resonance spectroscopic imaging (MRSI) and 18F-FDG-PET imaging. This procedure was performed in a clinical PET/MRI scanner with a canine cancer patient. We have...... of 13C-pyruvate it is now possible to directly study the Warburg Effect through the rate of conversion of 13C-pyruvate to 13C-lactate. In this study, we combined it with 18F-FDG-PET that studies uptake of glucose in the cells. A canine cancer patient with a histology verified local recurrence...
The autoradiolytic and the γ-induced demethylation of solid thymine-(methyl-14C)
International Nuclear Information System (INIS)
Merwitz, O.
1980-01-01
The autoradiolytic and the γ-induced demethylation of solid thymine were measured qualitatively and quantitatively for the first time with specially purified thymine-(methyl- 14 C). Analogous experiments with thymine-(methyl- 3 H) and radio-gaschromatographic analysis provided proof for the formation of molecular hydrogen and methane. Ethane was not detected. The results are discussed in connection with e.s.r.-spectroscopic studies. (author)
Spatial control of protein phosphatase 2A (de)methylation
International Nuclear Information System (INIS)
Longin, Sari; Zwaenepoel, Karen; Martens, Ellen; Louis, Justin V.; Rondelez, Evelien; Goris, Jozef; Janssens, Veerle
2008-01-01
Reversible methylation of the protein phosphatase 2A catalytic subunit (PP2A C ) is an important regulatory mechanism playing a crucial role in the selective recruitment of regulatory B subunits. Here, we investigated the subcellular localization of leucine carboxyl methyltransferase (LCMT1) and protein phosphatase methylesterase (PME-1), the two enzymes catalyzing this process. The results show that PME-1 is predominantly localized in the nucleus and harbors a functional nuclear localization signal, whereas LCMT1 is underrepresented in the nucleus and mainly localizes to the cytoplasm, Golgi region and late endosomes. Indirect immunofluorescence with methylation-sensitive anti-PP2A C antibodies revealed a good correlation with the methylation status of PP2A C , demethylated PP2A C being substantially nuclear. Throughout mitosis, demethylated PP2A C is associated with the mitotic spindle and during cytokinesis with the cleavage furrow. Overexpression of PME-1, but not of an inactive mutant, results in increased demethylation of PP2A C in the nucleus, whereas overexpression of a cytoplasmic PME-1 mutant lacking the NLS results in increased demethylation in the cytoplasm-in all cases, however, without any obvious functional consequences. PME-1 associates with an inactive PP2A population, regardless of its esterase activity or localization. We propose that stabilization of this inactive, nuclear PP2A pool is a major in vivo function of PME-1
Simultaneous hyperpolarized 13C-pyruvate MRI and 18F-FDG-PET in cancer (hyperPET)
DEFF Research Database (Denmark)
Borgwardt, Henrik Gutte; Hansen, Adam Espe; Henriksen, Sarah T.
2015-01-01
have named this concept hyper PET. Intravenous injection of the hyperpolarized (13)C-pyruvate results in an increase of (13)C-lactate, (13)C-alanine and (13)C-CO2 ((13)C-HCO3) resonance peaks relative to the tissue, disease and the metabolic state probed. Accordingly, with dynamic nuclear polarization......In this paper we demonstrate, for the first time, the feasibility of a new imaging concept - combined hyperpolarized (13)C-pyruvate magnetic resonance spectroscopic imaging (MRSI) and (18)F-FDG-PET imaging. This procedure was performed in a clinical PET/MRI scanner with a canine cancer patient. We...... (DNP) and use of (13)C-pyruvate it is now possible to directly study the Warburg Effect through the rate of conversion of (13)C-pyruvate to (13)C-lactate. In this study, we combined it with (18)F-FDG-PET that studies uptake of glucose in the cells. A canine cancer patient with a histology verified...
Demethylating agent, 5-azacytidine, reverses differentiation of embryonic stem cells
International Nuclear Information System (INIS)
Tsuji-Takayama, Kazue; Inoue, Toshiya; Ijiri, Yoshihiro; Otani, Takeshi; Motoda, Ryuichi; Nakamura, Shuji; Orita, Kunzo
2004-01-01
The de novo methylation activity is essential for embryonic development as well as embryonic stem (ES) cell differentiation, where the intensive and extensive DNA methylation was detected. In this study, we investigated the effects of a demethylating agent, 5-azacytidine (5-AzaC), on differentiated ES cells in order to study the possibility of reversing the differentiation process. We first induced differentiation of ES cells by forming embryoid bodies, and then the cells were treated with 5-AzaC. The cells showed some undifferentiated features such as stem cell-like morphology with unclear cell-to-cell boundary and proliferative responsiveness to LIF. Moreover, 5-AzaC increased the expressions of ES specific markers, SSEA-1, and alkaline phosphatase activity as well as ES specific genes, Oct4, Nanog, and Sox2. We also found that 5-AzaC demethylated the promoter region of H19 gene, a typical methylated gene during embryonic differentiation. These results indicate that 5-AzaC reverses differentiation state of ES cells through its DNA demethylating activity to differentiation related genes
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Oxidative demethylation of monomethylmercury in sediments
International Nuclear Information System (INIS)
Oremland, R.S.
1991-01-01
Previous studies suggested that demethylation of monomethylmercury proceeds in nature by a simple organo-mercury lyase reaction resulting in the production of CH 4 and Hg 2+ , which is further reduced to Hg 0 . Addition of 14 CH 3 HgI to sediments resulted in the production of mainly 14 CO 2 and some 14 CH 4 . In the case of estuarine sediments, production of both these gases was only observed under anaerobiosis, and was totally inhibited by MoO 4 2- , which indicated the involvement of sulfate-reducing bacteria. In the case of anaerobic freshwater sediments, results with inhibitors indicated that both methanogens and sulfate reducers were involved in this oxidative demethylation. Aerobic incubation of estuarine sediments resulted in the production of only 14 CH 4 , indicating the importance of the organo-mercurial lyase reaction under this condition. However, in freshwater sediments, this reaction was not observed, and the oxidative demethylation reaction was predominant either under aerobic or anaerobic conditions. A methylotrophic methanogen (GS-16) was able to form traces of 14 CH 4 and 14 CO 2 from 14 CH 3 HgI, and some strains of sulfate-reducers formed traces of 14 CH 4 . Addition of methanol to anaerobic freshwater sediments partially inhibited production of 14 CH 4 and 14 CO 2 , but not CH 4 . These results suggest that oxidative demethylation proceeds by an established pathway for C-1 metabolism
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production
Nuno Carinhas; Daniel A. M. Pais; Alexey Koshkin; Paulo Fernandes; Ana S. Coroadinha; Manuel J. T. Carrondo; Paula M. Alves; Ana P. Teixeira
2016-01-01
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-13C]glucose and [U-13C]glutamine, we apply for the first time 13C-Metabolic flux analysis (13C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells meta...
Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies
Directory of Open Access Journals (Sweden)
R Puentes
2012-09-01
Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.
Arsenic Demethylation by a C·As Lyase in Cyanobacterium Nostoc sp. PCC 7120.
Yan, Yu; Ye, Jun; Xue, Xi-Mei; Zhu, Yong-Guan
2015-12-15
Arsenic, a ubiquitous toxic substance, exists mainly as inorganic forms in the environment. It is perceived that organoarsenicals can be demethylated and degraded into inorganic arsenic by microorganisms. Few studies have focused on the mechanism of arsenic demethylation in bacteria. Here, we investigated arsenic demethylation in a typical freshwater cyanobacterium Nostoc sp. PCC 7120. This bacterium was able to demethylate monomethylarsenite [MAs(III)] rapidly to arsenite [As(III)] and also had the ability to demethylate monomethylarsenate [MAs(V)] to As(III). The NsarsI encoding a C·As lyase responsible for MAs(III) demethylation was cloned from Nostoc sp. PCC 7120 and heterologously expressed in an As-hypersensitive strain Escherichia coli AW3110 (ΔarsRBC). Expression of NsarsI was shown to confer MAs(III) resistance through arsenic demethylation. The purified NsArsI was further identified and functionally characterized in vitro. NsArsI existed mainly as the trimeric state, and the kinetic data were well-fit to the Hill equation with K0.5 = 7.55 ± 0.33 μM for MAs(III), Vmax = 0.79 ± 0.02 μM min(-1), and h = 2.7. Both of the NsArsI truncated derivatives lacking the C-terminal 10 residues (ArsI10) or 23 residues (ArsI23) had a reduced ability of MAs(III) demethylation. These results provide new insights for understanding the important role of cyanobacteria in arsenic biogeochemical cycling in the environment.
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.
Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P
2016-03-23
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.
First detection of canine parvovirus type 2c in Brazil.
Streck, André Felipe; Souza, Carine Kunzler; Gonçalves, K. R.; Zang, Luciana; Pinto, Luciane Dubina; Canal, Cláudio Wageck
2009-01-01
The presence of canine parvovirus type 2 (CPV-2), 2a and 2b has been described in Brazil, however, the type 2c had not been reported until now. In the current study, seven out of nine samples from dogs with diarrhea were characterized as CPV-2c, indicating that this virus is already circulating in the Brazilian canine population.No Brasil, a presença do parvovírus canino do tipo 2 (CPV-2), 2a e 2b já havia sido descrita, contudo, ainda não havia sido verificada a presença do tipo 2c. No prese...
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Measurement of plasma canine C peptide by radioimmunoassay
Energy Technology Data Exchange (ETDEWEB)
Besch, W; Woltanski, K P; Fischer, U; Kohnert, K D; Ziegler, M
1985-12-01
A sensitive radioimmunoassay for canine C peptide (CCP) was established using synthetic CCP, a specific antiserum, and rabbit anti-guinea pig serum. Radioiodination was performed according to a modified chloramine T method. Tracer preparations have been used for 6 weeks after iodination. The standard curve ranges from 0.028 to 3.0 nmol/l. The intra-assay coefficient of variation (CV) was 3-5% and the inter-assay CV was 6-9% in the optimal range between 0.3 and 0.8 nmol/l. The average recovery of CCP added to plasma samples was 100.6% (n = 9). Canine insulin, porcine proinsulin, bovine proinsulin, and human C peptide exhibited no cross-reactivity. The mean fasting plasma CCP concentration was 0.089 +- 0.021 nmol/l in normal dogs and -0.005 +- 0.007 nmol/l (mean +- SEM) in diabetic dogs, respectively.
Nicotine demethylation in Nicotiana cell suspension cultures: N'-formylnornicotine is not involved.
Bartholomeusz, Trixie Ann; Bhogal, Ramneek K; Molinié, Roland; Felpin, François-Xavier; Mathé-Allainmat, Monique; Meier, Anna-Carolin; Dräger, Birgit; Lebreton, Jacques; Roscher, Albrecht; Robins, Richard J; Mesnard, François
2005-10-01
Nicotine or nornicotine enriched with stable isotopes in either the N'-methyl group or the pyrrolidine-N were fed to Nicotiana plumbaginifolia suspension cell cultures that do not form endogenous nicotine. The metabolism of these compounds was investigated by analysing the incorporation of isotope into other alkaloids using gas chromatography-mass spectroscopy (GC-MS). Nicotine metabolism primarily resulted in the accumulation of nornicotine, the N'-demethylation product. In addition, six minor metabolites appeared during the course of nicotine metabolism, four of which were identified as cotinine, myosmine, N'-formylnornicotine and N'-carboethoxynornicotine. While cotinine was formed from [(13)C,(2)H(3)-methyl]nicotine without dilution of label, N'-formylnornicotine was labelled at only about 6% of the level of nicotine and N'-carboethoxynornicotine was unlabelled. Feeding with [1'-(15)N]nornicotine resulted in incorporation without dilution of label into both N'-formylnornicotine and N'-carboethoxynornicotine. This pattern strongly indicates that, while nornicotine and cotinine are derived directly from nicotine, N'-formylnornicotine and N'-carboethoxynornicotine are metabolites of nornicotine. Thus, it is directly demonstrated that N'-formylnornicotine is not an intermediate in nicotine demethylation.
Biochemical background of toxic interaction between tiamulin and monensin.
Szucs, Gyula; Tamási, Viola; Laczay, Péter; Monostory, Katalin
2004-03-15
Tiamulin, a diterpene antibiotic, is used for treatment of pulmonary and gastrointestinal infections in swine and poultry. Combined administration of tiamulin and ionophores (e.g. monensin) to farm animals may lead to intoxication manifested in severe clinical symptoms. Tiamulin metabolite complex with cytochrome P450 has been suggested to be the basis of drug-interactions. However, the formation of metabolic intermediate complex is questionable. The effect of tiamulin-treatment on cytochrome P450 activities was investigated in rats. Ethylmorphine and aminopyrine N-demethylation activities as well as monensin metabolism (O-demethylation) increased in liver microsomes of tiamulin-treated (200 mg/kg) animals. CYP3A1 induction caused by tiamulin was confirmed by the results of Western blot analysis. To test metabolic intermediate complex formation as a result of tiamulin treatment, cytochrome P450 activities were also determined in the presence of potassium ferricyanide. The findings together with those of in vitro complex formation suggested that formation of metabolic intermediate complexes of tiamulin with cytochrome P450 could be excluded. On the other hand, the results of inhibition studies showed significant decrease of ethylmorphine or aminopyrine as well as monensin demethylation in the presence of tiamulin. Our results proved that tiamulin has dual effect on cytochromes P450. It is able to induce and directly inhibit CYP3A enzymes, which are predominantly responsible for monensin O-demethylation. The direct effect of tiamulin as an inhibitor might play a more important role in toxicity than its putative effect as a chemical inducer of CYP3A enzymes.
A phylogenetic study of canine parvovirus type 2c in midwestern Brazil
Directory of Open Access Journals (Sweden)
Danúbia S. Fontana
2013-02-01
Full Text Available Since the late 1970s, canine parvovirus type 2 (CPV-2 has emerged as a causative agent of fatal severe acute hemorrhagic enteritis in dogs. To date, three antigenic types of CPV-2 were described worldwide (CPV-2a/b/c. This study was conducted to determine the variants of CPV-2 circulating in dogs from the Cuiabá Municipality in Midwestern Brazil. Out of 50 fecal samples, collected between 2009 and 2011, 27 tested positive for CPV-2. A 583 bp fragment of the VP2 gene was amplified by PCR, 13 representative samples were analyzed further by DNA sequencing. All strains were characterized as CPV-2c, displayed a low genetic variability although observed several amino acid substitution. These findings indicated that CPV-2c has been circulating in dogs from the Cuiabá Municipality in Midwestern Brazil.
DEFF Research Database (Denmark)
Gutte, Henrik; Hansen, Adam E; Larsen, Majbrit M E
2015-01-01
In this communication the mismatch between simultaneous (18)F-FDG-PET and a (13)C-lactate imaging (hyperPET) in a biopsy verified squamous cell carcinoma in the right tonsil of a canine cancer patient is shown. The results demonstrate that (18)F-FDG-PET may not always reflect the Warburg effect...
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Correlation between the 12C+12C, 12C+13C, and 13C+13C fusion cross sections
Notani, M.; Esbensen, H.; Fang, X.; Bucher, B.; Davies, P.; Jiang, C. L.; Lamm, L.; Lin, C. J.; Ma, C.; Martin, E.; Rehm, K. E.; Tan, W. P.; Thomas, S.; Tang, X. D.; Brown, E.
2012-01-01
The fusion cross section for 12C+13C has been measured down to Ec.m.=2.6 MeV, at which the cross section is of the order of 20 nb. By comparing the cross sections for the three carbon isotope systems, 12C+12C, 12C+13C, and 13C+13C, it is found that the cross sections for 12C+13C and 13C+13C provide an upper limit for the fusion cross section of 12C+12C over a wide energy range. After calibrating the effective nuclear potential for 12C+12C using the 12C+13C and 13C+13C fusion cross sections, it is found that a coupled-channels calculation with the ingoing wave boundary condition (IWBC) is capable of predicting the major peak cross sections in 12C+12C. A qualitative explanation for this upper limit is provided by the Nogami-Imanishi model and by level density differences among the compound nuclei. It is found that the strong resonance found at 2.14 MeV in 12C+12C exceeds this upper limit by a factor of more than 20. The preliminary result from the most recent measurement shows a much smaller cross section at this energy, which agrees with our predicted upper limit.
Directory of Open Access Journals (Sweden)
Henrik Gutte
2015-06-01
Full Text Available In this communication the mismatch between simultaneous 18F-FDG-PET and a 13C-lactate imaging (hyperPET in a biopsy verified squamous cell carcinoma in the right tonsil of a canine cancer patient is shown. The results demonstrate that 18F-FDG-PET may not always reflect the Warburg effect in all tumors.
[Immunomodulators with an 8-azasteroid structure as inducers of liver cytochrome P-450].
Kuz'mitskiĭ, B B; Dad'kov, I G; Mashkovich, A E; Stoma, O V; Slepneva, L M
1990-01-01
Two structural analogues of D-homo-8-azasteroids, both an immunostimulant and an immunodepressant, are inductors of the liver cytochrome P-450 in animals. This capability was shown by means of both a decrease of the hexenal sleep duration in the pharmacological test and an increase of the quantity of cytochrome P-450 and the rate of N-demethylation of aminopyrine in the biochemical assays.
Fast Curing Bio-Based Phenolic Resins via Lignin Demethylated under Mild Reaction Condition
Jiongjiong Li; Jizhi Zhang; Shifeng Zhang; Qiang Gao; Jianzhang Li; Wei Zhang
2017-01-01
Demethylation technique has been used to enhance lignin reactivity for preparation of phenolic resins. However, the demethylation efficiency and the demethylated lignin (DL) reactivity were still unsatisfactory. To improve the demethylation efficiency, alkali lignin was demethylated under different mild conditions using sodium sulfite as a catalyst. Lignin and DL were characterized by 1H-NMR (nuclear magnetic resonance) and Fourier transform infrared (FT-IR) spectroscopy to determine the deme...
Gender Differences in Global but Not Targeted Demethylation in iPSC Reprogramming
Directory of Open Access Journals (Sweden)
Inês Milagre
2017-01-01
Full Text Available Global DNA demethylation is an integral part of reprogramming processes in vivo and in vitro, but whether it occurs in the derivation of induced pluripotent stem cells (iPSCs is not known. Here, we show that iPSC reprogramming involves both global and targeted demethylation, which are separable mechanistically and by their biological outcomes. Cells at intermediate-late stages of reprogramming undergo transient genome-wide demethylation, which is more pronounced in female cells. Global demethylation requires activation-induced cytidine deaminase (AID-mediated downregulation of UHRF1 protein, and abolishing demethylation leaves thousands of hypermethylated regions in the iPSC genome. Independently of AID and global demethylation, regulatory regions, particularly ESC enhancers and super-enhancers, are specifically targeted for hypomethylation in association with transcription of the pluripotency network. Our results show that global and targeted DNA demethylation are conserved and distinct reprogramming processes, presumably because of their respective roles in epigenetic memory erasure and in the establishment of cell identity.
Demethylation of arsenic limits its volatilization in fungi
International Nuclear Information System (INIS)
Su, Shiming; Zeng, Xibai; Feng, Qiufen; Bai, Lingyu; Zhang, Lili; Jiang, Sheng; Li, Aiguo; Duan, Ran; Wang, Xiurong; Wu, Cuixia; Wang, Yanan
2015-01-01
Arsenic (As) biomethylation is increasingly being regarded as a promising method to volatize As from the environment; however, the As volatilization efficiency of most microorganisms is low. Here, the speciation transformation of dimethylarsinic acid (DMA) as an important methylation intermediate in the cells of Fusarium oxysporum CZ-8F1, Penicillium janthinellum SM-12F4, and Trichoderma asperellum SM-12F1 were investigated. These fungal strains have been certified to volatilize As from As-loaded environment. In situ X-ray absorption near edge structure (XANES) indicated that demethylation of DMA with methylarsonic acid (MMA), arsenate [As(V)], and arsenite [As(III)] as intermediates or products occurred in fungal cells after exposure to DMA for 15 days. 36.7–55.7% of the original DMA could lose one or two methyl groups and be changed into MMA or inorganic As. Chromatographic separation of the cell lysates also supported these findings. Thus it comes that demethylation might be a remarkable internal factor limiting As volatilization efficiency. - Highlights: • XAS and chromatographic separation were used to study the speciation change of DMA. • DMA demethylation with MMA, As(V), and As(III) as products occurred in fungal cells. • Demethylation might be responsible for the limited volatilization efficiency of As. - Demethylation might be responsible for the limited methylation efficiency of As
Milk C-reactive protein in canine mastitis.
Vasiu, Iosif; Dąbrowski, Roman; Martinez-Subiela, Silvia; Ceron, Jose J; Wdowiak, Anna; Pop, Raul Alexandru; Brudaşcă, Florinel Gheorghe; Pastor, Josep; Tvarijonaviciute, Asta
2017-04-01
Presence of mastitis in lactating bitches can become life threatening for both the bitch and pups. The aim of the present study was to evaluate a possible utility of C-reactive protein (CRP) in both milk and serum for canine mastitis diagnosis. Our study showed that milk CRP levels ranged between 0.1 and 4.9μg/mL and from 0.3 to 40.0μg/mL in healthy and diseased bitches (Pcanine mastitis. Copyright © 2017 Elsevier B.V. All rights reserved.
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Directory of Open Access Journals (Sweden)
Silvia de Oliveira Hübner
2010-06-01
Full Text Available The exposure of 13 Brazilian free-ranging nondomestic canids (five pampas fox - Pseudalopex gymnocercus and eight crab-eating fox -Cerdocyon thous from Southern region of Brazil, to Canine distemper virus (CDV, canine parvovirus (CPV and Canine coronavirus (CCoV was investigated. Antibodies against CDV were detected in 38.5% (5/13 of the samples. There were anti-CDV antibodies in 60% (3/5 of P. gymnocercus and in 25% (2/8 of C. thous. The frequency was higher among the adults and males. Eleven canids (84.6% presented antibodies against CPV, 80% (4/5 were from P. gymnocercus and 87.5% (7/8 were from C. thous. There was no difference in positivity rate against CPV between gender and age. Antibodies against CCoV were detected in 38.5% (5/13 of the samples, with 60% (3/5 of positivity in P. gymnocercus and 25% (2/8 in C. thous. The frequency of antibodies against CCoV was higher among the adults and males. The study showed that these canids were exposed to CDV, CPV and CCoV.Foi investigada a ocorrência de exposição em 13 canídeos não domésticos de vida livre (cinco graxains-do-campo - Pseudalopex gymnocercus e oito graxains-do-mato - Cerdocyon thous da região sul do Brasil ao vírus da cinomose canina (CDV, parvovírus canino (CPV e coronavírus canino (CCoV. Anticorpos contra o CDV foram detectados em 38,5% (5/13 das amostras. Haviam anticorpos anti-CDV em 60% (3/5 dos P. gymnocercus e em 25% (2/8 dos C. thous. A freqüência foi maior entre machos e adultos. Para CPV, 11 canídeos (84,6% apresentaram anticorpos, 80% (4/5 eram da espécie P. gymnocercus e 87,5% (7/8 eram C. thous. Não houve diferença de positividade para o CPV entre sexos e idades. Anticorpos contra o CCoV foram detectados em 38,5% (5/13 das amostras, sendo 60% (3/5 de positividade entre os P. gymnocercus e 25% (2/8 entre os C. thous. A freqüência de anticorpos para CCoV foi maior entre os machos e adultos. O estudo revelou que estes canídeos foram expostos ao CDV, CPV
Theoretical study on the N-demethylation mechanism of theobromine catalyzed by P450 isoenzyme 1A2.
Tao, Jing; Kang, Yuan; Xue, Zhiyu; Wang, Yongting; Zhang, Yan; Chen, Qiu; Chen, Zeqin; Xue, Ying
2015-09-01
Theobromine, a widely consumed pharmacological active substance, can cause undesirable muscle stiffness, nausea and anorexia in high doses ingestion. The main N-demethylation metabolic mechanism of theobromine catalyzed by P450 isoenzyme 1A2 (CYP1A2) has been explored in this work using the unrestricted hybrid density functional method UB3LYP in conjunction with the LACVP(Fe)/6-31G (H, C, N, O, S, Cl) basis set. Single-point calculations including empirical dispersion corrections were carried out at the higher 6-311++G** basis set. Two N-demethylation pathways were characterized, i.e., 3-N and 7-N demethylations, which involve the initial N-methyl hydroxylation to form carbinolamines and the subsequent carbinolamines decomposition to yield monomethylxanthines and formaldehydes. Our results have shown that the rate-limiting N-methyl hydroxylation occurs via a hydrogen atom transfer (HAT) mechanism, which proceeds in a spin-selective mechanism (SSM) in the gas phase. The carbinolamines generated are prone to decomposition via the contiguous heteroatom-assisted proton-transfer. Strikingly, 3-N demethylation is more favorable than 7-N demethylation due to its lower free energy barrier and 7-methylxanthine therefore is the optimum product reported for the demethylation of theobromine catalyzed by CYP1A2, which are in good agreement with the experimental observation. This work has first revealed the detail N-demethylation mechanisms of theobromine at the theoretical level. It can offer more significant information for the metabolism of purine alkaloid. Copyright © 2015 Elsevier Inc. All rights reserved.
Targeted DNA demethylation of the Arabidopsis genome using the human TET1 catalytic domain
Gallego-Bartolomé, Javier; Gardiner, Jason; Liu, Wanlu; Papikian, Ashot; Ghoshal, Basudev; Kuo, Hsuan Yu; Zhao, Jenny Miao-Chi; Jacobsen, Steven E.
2018-01-01
DNA methylation is an important epigenetic modification involved in gene regulation and transposable element silencing. Changes in DNA methylation can be heritable and, thus, can lead to the formation of stable epialleles. A well-characterized example of a stable epiallele in plants is fwa, which consists of the loss of DNA cytosine methylation (5mC) in the promoter of the FLOWERING WAGENINGEN (FWA) gene, causing up-regulation of FWA and a heritable late-flowering phenotype. Here we demonstrate that a fusion between the catalytic domain of the human demethylase TEN-ELEVEN TRANSLOCATION1 (TET1cd) and an artificial zinc finger (ZF) designed to target the FWA promoter can cause highly efficient targeted demethylation, FWA up-regulation, and a heritable late-flowering phenotype. Additional ZF–TET1cd fusions designed to target methylated regions of the CACTA1 transposon also caused targeted demethylation and changes in expression. Finally, we have developed a CRISPR/dCas9-based targeted demethylation system using the TET1cd and a modified SunTag system. Similar to the ZF–TET1cd fusions, the SunTag–TET1cd system is able to target demethylation and activate gene expression when directed to the FWA or CACTA1 loci. Our study provides tools for targeted removal of 5mC at specific loci in the genome with high specificity and minimal off-target effects. These tools provide the opportunity to develop new epialleles for traits of interest, and to reactivate expression of previously silenced genes, transgenes, or transposons. PMID:29444862
Early de novo DNA methylation and prolonged demethylation in the muscle lineage.
Tsumagari, Koji; Baribault, Carl; Terragni, Jolyon; Varley, Katherine E; Gertz, Jason; Pradhan, Sirharsa; Badoo, Melody; Crain, Charlene M; Song, Lingyun; Crawford, Gregory E; Myers, Richard M; Lacey, Michelle; Ehrlich, Melanie
2013-03-01
Myogenic cell cultures derived from muscle biopsies are excellent models for human cell differentiation. We report the first comprehensive analysis of myogenesis-specific DNA hyper- and hypo-methylation throughout the genome for human muscle progenitor cells (both myoblasts and myotubes) and skeletal muscle tissue vs. 30 non-muscle samples using reduced representation bisulfite sequencing. We also focused on four genes with extensive hyper- or hypo-methylation in the muscle lineage (PAX3, TBX1, MYH7B/MIR499 and OBSCN) to compare DNA methylation, DNaseI hypersensitivity, histone modification, and CTCF binding profiles. We found that myogenic hypermethylation was strongly associated with homeobox or T-box genes and muscle hypomethylation with contractile fiber genes. Nonetheless, there was no simple relationship between differential gene expression and myogenic differential methylation, rather only for subsets of these genes, such as contractile fiber genes. Skeletal muscle retained ~30% of the hypomethylated sites but only ~3% of hypermethylated sites seen in myogenic progenitor cells. By enzymatic assays, skeletal muscle was 2-fold enriched globally in genomic 5-hydroxymethylcytosine (5-hmC) vs. myoblasts or myotubes and was the only sample type enriched in 5-hmC at tested myogenic hypermethylated sites in PAX3/CCDC140 andTBX1. TET1 and TET2 RNAs, which are involved in generation of 5-hmC and DNA demethylation, were strongly upregulated in myoblasts and myotubes. Our findings implicate de novo methylation predominantly before the myoblast stage and demethylation before and after the myotube stage in control of transcription and co-transcriptional RNA processing. They also suggest that, in muscle, TET1 or TET2 are involved in active demethylation and in formation of stable 5-hmC residues.
Detection of the Canine Parvovirus 2c Subtype in Australian Dogs.
Woolford, Lucy; Crocker, Paul; Bobrowski, Hannah; Baker, Trevor; Hemmatzadeh, Farhid
2017-06-01
Canine parvovirus (CPV-2) is an important cause of hemorrhagic enteritis in dogs. In Australia the disease has been associated with CPV-2a and CPV-2b variants. A third more recently emerged variant overseas, CPV-2c, has not been detected in surveys of the Australian dog population. In this study, we report three cases of canine parvoviral enteritis associated with CPV-2c infection; case 1 occurred in an 8-week-old puppy that died following acute hemorrhagic enteritis. Cases 2 and 3 were an 11-month-old female entire Saint Bernard and a 9-month-old male entire Siberian husky, respectively, both which had completed vaccination schedules and presented with vomiting or mild diarrhea only. Full genomic sequencing of parvoviral DNA from cases 1, 2, and 3 revealed greater than 99% homology to known CPV-2c variants and predicted protein sequences from the VP2 region of viral DNA from all three cases identified; glutamic acid residues at the 426 amino acid residue, characteristic of the CPV-2c variant. Veterinary professionals should be aware that CPV-2c is now present in Australia, detected in a puppy and vaccinated young adult dogs in this study. Further characterization of CPV-2c-associated disease and its prevalence in Australian dogs requires additional research.
Biochemistry and occurrence of O-demethylation in plant metabolism
Directory of Open Access Journals (Sweden)
Jillian Hagel
2010-07-01
Full Text Available Demethylases play a pivitol role in numerous biological processes from covalent histone modification and DNA repair to specialized metabolism in plants and microorganisms. Enzymes that catalyze O- and N-demethylation include 2-oxoglutarate (2OG/Fe(II-dependent dioxygenases, cytochromes P450, Rieske-domain proteins and flavin adenine dinucleotide (FAD-dependent oxidases. Proposed mechanisms for demethylation by 2OG/Fe(II-dependent enzymes involve hydroxylation at the O- or N-linked methyl group followed by formaldehyde elimination. Members of this enzyme family catalyze a wide variety of reactions in diverse plant metabolic pathways. Recently, we showed that 2OG/Fe(II-dependent dioxygenases catalyze the unique O-demethylation steps of morphine biosynthesis in opium poppy, which provides a rational basis for the widespread occurrence of demethylases in benzylisoquinoline alkaloid metabolism.
Goemans, Anne F; Spence, Susanna J; Ramsey, Ian K
2017-06-01
Hemoglobin A1c (HbA1c) provides a reliable measure of glycemic control over 2-3 months in human diabetes mellitus. In dogs, presence of HbA1c has been demonstrated, but there are no validated commercial assays. The purpose of the study was to validate a commercially available automated immunoturbidimetric assay for canine HbA1c and determine an RI in a hospital population. The specificity of the assay was assessed by inducing glycosylation in vitro using isolated canine hemoglobin, repeatability by measuring canine samples 5 times in succession, long term inter-assay imprecision by measuring supplied control materials, stability using samples stored at 4°C over 5 days and -20°C over 8 weeks, linearity by mixing samples of known HbA1c in differing proportions, and the effect of anticoagulants with paired samples. An RI was determined using EDTA-anticoagulated blood samples from 60 nondiabetic hospitalized animals of various ages and breeds. Hemoglobin A1c was also measured in 10 diabetic dogs. The concentration of HbA1c increased proportionally with glucose concentration in vitro. For repeat measurements, the CV was 4.08% (range 1.16-6.10%). Samples were stable for 5 days at 4°C. The assay was linear within the assessed range. Heparin- and EDTA-anticoagulated blood provided comparable results. The RI for HbA1c was 9-18.5 mmol/mol. There was no apparent effect of age or breed on HbA1c. In diabetic dogs, HbA1c ranged from 14 to 48 mmol/mol. The assay provides a reliable method for canine HbA1c measurement with good analytic performance. © 2017 American Society for Veterinary Clinical Pathology.
International Nuclear Information System (INIS)
Shafiee, A.; Trzaskos, J.M.; Paik, Y.K.; Gaylor, J.L.
1986-01-01
With [ 3 H-24,25]-dihydrolanosterol as substrate, large-scale metabolic formation of intermediates of lanosterol demethylation was carried out to identify all compounds in the metabolic process. Utilizing knowledge of electron transport of lanosterol demethylation, we interrupted the demethylation reaction allowing accumulation and confirmation of the structure of the oxygenated intermediates lanost-8-en-3 beta,32-diol and 3 beta-hydroxylanost-8-en-32-al, as well as the demethylation product 4,4-dimethyl-cholesta-8,14-dien-3 beta-ol. Further metabolism of the delta 8.14-diene intermediate to a single product 4,4-dimethyl-cholest-8-en-3 beta-ol occurs under interruption conditions in the presence of 0.5 mM CN-1. With authentic compounds, each intermediate has been rigorously characterized by high performance liquid chromatography and gas-liquid chromatography plus mass spectral analysis of isolated and derivatized sterols. Intermediates that accumulated in greater abundance were further characterized by ultraviolet, 1 H-NMR, and infrared spectroscopy of the isolated sterols
Dimethylformamide as a cryoprotectant for canine semen diluted and frozen in ACP-106C.
Mota Filho, A C; Teles, C H A; Jucá, R P; Cardoso, J F S; Uchoa, D C; Campello, C C; Silva, A R; Silva, L D M
2011-10-15
The objective was to assess the effect of adding various concentrations of dimethylformamide on characteristics of canine semen diluted in powdered coconut water (ACP-106C; ACP Biotecnologia, Fortaleza, CE, Brazil) and frozen at -196°C. Fifteen ejaculates were collected by manual stimulation from five adult Boxer dogs. The sperm-rich fraction was diluted in ACP-106C (ACP Biotecnologia) containing 10% egg yolk and divided into four aliquots. The cryoprotectants used for each aliquot were 6% glycerol (control group; CG) or 2%, 4%, or 6% dimethylformamide (DF2, DF4, and DF6, respectively). After thawing, total motility (mean ± SEM) for CG (58.4 ± 24.6) was higher (P Biotecnologia) and 10% egg yolk as a diluent, yielded unsatisfactory in vitro results for freezing canine semen. Copyright © 2011 Elsevier Inc. All rights reserved.
In vitro metabolism of testosterone-4-14C by canine salivary glands
International Nuclear Information System (INIS)
Mosadomi, A.; Ofner, P.
1976-01-01
Testosterone-4- 14 C (2430 pmol, 048 μM) was incubated aerobically in 67 mM phosphate buffer pH 7.4 with homogenates and minces of salivary glands from male dogs. Extracted radiosteroids were resolved by thin-layer chromatography on silica gel, removed and quantitated. Substantially higher NADsup(+)-dependent 17 β-hydroxy-C 19 -steroid oxidoreductase activity was found in submaxillary gland homogenates than in similar parotid-gland preparations. Preliminary evidence is presented that the enzyme activity per unit wet weight of the minced submaxillary gland is decreased in the 2-week male castrate, in the absence of any recognizable histologic changes in the gland. Testosterone metabolism by canine salivary glands is thus oxidative contrasting with the reductive 17 β-hydroxysteroid pathway characteristic of androgen-dependent organs such as the prostate, and is more extensive than in this accessory sex tissue. Our findings suggest that the canine salivary glands are not target organs for circulating male hormone. (author); LATING M
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Kwon, Yun; Park, Sunghyouk; Shin, Jongheon; Oh, Dong-Chan
2014-08-01
The elucidation of the structures of complex natural products bearing many quaternary carbons remains challenging, even in this advanced spectroscopic era. (13)C-(13)C COSY NMR spectroscopy shows direct couplings between (13)C and (13)C, which comprise the backbone of a natural product. Thus, this type of experiment is particularly useful for natural products bearing consecutive quaternary carbons. However, the low sensitivity of (13)C-based NMR experiments, due to the low natural abundance of the (13)C nucleus, is problematic when applying these techniques. Our efforts in the (13)C labeling of a microbial natural product, cyclopiazonic acid (1), by feeding (13)C-labeled glucose to the fungal culture, enabled us to acquire (13)C-(13)C COSY NMR spectra on a milligram scale that clearly show the carbon backbone of the compound. This is the first application of (13)C-(13)C COSY NMR experiments for a natural product. The results suggest that (13)C-(13)C COSY NMR spectroscopy can be routinely used for the structure determination of microbial natural products by (13)C-enrichment of a compound with (13)C-glucose.
Chemical groups and structural characterization of lignin via thiol-mediated demethylation
Lihong Hu; Hui Pan; Yonghong Zhou; Chung-Yun Hse; Chengguo Liu; Baofang Zhang; Bin Xu
2014-01-01
A new approach to increase the reactivity of lignin by thiol-mediated demethylation was investigated in this study. Demethylated lignin was characterized by the changes in its hydroxyl and methoxyl groups, molecular weight, and other properties using titration and spectroscopy methods including FT-IR, 1H NMR, UV,and GPC. The total...
International Nuclear Information System (INIS)
Porwoll, J.P.; Leete, E.
1985-01-01
Potential advanced intermediates in the biosynthesis of delta 9 -tetrahydrocannabinol, the major psychoactive principle of marijuana, have been synthesized labeled with two contiguous 13 C atoms and 14 C. Methyl [5,6- 13 C 2 , 1- 14 C]olivetolate was prepared from lithium [ 13 C 2 ]acetylide and dimethyl [2- 14 C]malonate. Reaction with geranyl bromide afforded methyl [5,6- 13 C 2 , 1- 14 C]cannabigerolate, and hydrolysis of these methyl esters with lithium propyl mercaptide yielded the corresponding labeled acids. The 13 C- 13 C couplings observable in the 13 C NMR spectra of these 13 C-enriched compounds and their synthetic precursors are recorded. Methyl [1'- 14 C]olivetolate was prepared from 13 CO 2 to confirm assignments of the 13 C chemical shifts in the pentyl side chain of these compounds. (author)
Enhanced photo(geno)toxicity of demethylated chlorpromazine metabolites
Energy Technology Data Exchange (ETDEWEB)
Palumbo, Fabrizio [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); Garcia-Lainez, Guillermo [Instituto de Investigación Sanitaria (IIS) La Fe, Hospital Universitari i Politècnic La Fe, Avenida de Fernando Abril Martorell 106, 46026 Valencia (Spain); Limones-Herrero, Daniel [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); Coloma, M. Dolores; Escobar, Javier [Instituto de Investigación Sanitaria (IIS) La Fe, Hospital Universitari i Politècnic La Fe, Avenida de Fernando Abril Martorell 106, 46026 Valencia (Spain); Jiménez, M. Consuelo [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); Miranda, Miguel A., E-mail: mmiranda@qim.upv.es [Instituto de Tecnología Química UPV-CSIC/Departamento de Química, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia (Spain); and others
2016-12-15
Chlorpromazine (CPZ) is an anti-psychotic drug widely used to treat disorders such as schizophrenia or manic-depression. Unfortunately, CPZ exhibits undesirable side effects such as phototoxic and photoallergic reactions in humans. In general, the influence of drug metabolism on this type of reactions has not been previously considered in photosafety testing. Thus, the present work aims to investigate the possible photo(geno)toxic potential of drug metabolites, using CPZ as an established reference compound. In this case, the metabolites selected for the study are demethylchlorpromazine (DMCPZ), didemethylchlorpromazine (DDMCPZ) and chlorpromazine sulfoxide (CPZSO). The demethylated CPZ metabolites DMCPZ and DDMCPZ maintain identical chromophore to the parent drug. In this work, it has been found that the nature of the aminoalkyl side chain modulates the hydrophobicity and the photochemical properties (for instance, the excited state lifetimes), but it does not change the photoreactivity pattern, which is characterized by reductive photodehalogenation, triggered by homolytic carbon-chlorine bond cleavage with formation of highly reactive aryl radical intermediates. Accordingly, these metabolites are phototoxic to cells, as revealed by the 3T3 NRU assay; their photo-irritation factors are even higher than that of CPZ. The same trend is observed in photogenotoxicity studies, both with isolated and with cellular DNA, where DMCPZ and DDMCPZ are more active than CPZ itself. In summary, side-chain demethylation of CPZ, as a consequence of Phase I biotransformation, does not result a photodetoxification. Instead, it leads to metabolites that exhibit in an even enhanced photo(geno)toxicity. - Highlights: • Demethylated CPZ metabolites are phototoxic to cells, as revealed by the NRU assay. • Single cell electrophoresis (Comet Assay) confirms the photodamage to cellular DNA. • DNA single strand breaks formation is observed on agarose gel electrophoresis.
Enhanced photo(geno)toxicity of demethylated chlorpromazine metabolites
International Nuclear Information System (INIS)
Palumbo, Fabrizio; Garcia-Lainez, Guillermo; Limones-Herrero, Daniel; Coloma, M. Dolores; Escobar, Javier; Jiménez, M. Consuelo; Miranda, Miguel A.
2016-01-01
Chlorpromazine (CPZ) is an anti-psychotic drug widely used to treat disorders such as schizophrenia or manic-depression. Unfortunately, CPZ exhibits undesirable side effects such as phototoxic and photoallergic reactions in humans. In general, the influence of drug metabolism on this type of reactions has not been previously considered in photosafety testing. Thus, the present work aims to investigate the possible photo(geno)toxic potential of drug metabolites, using CPZ as an established reference compound. In this case, the metabolites selected for the study are demethylchlorpromazine (DMCPZ), didemethylchlorpromazine (DDMCPZ) and chlorpromazine sulfoxide (CPZSO). The demethylated CPZ metabolites DMCPZ and DDMCPZ maintain identical chromophore to the parent drug. In this work, it has been found that the nature of the aminoalkyl side chain modulates the hydrophobicity and the photochemical properties (for instance, the excited state lifetimes), but it does not change the photoreactivity pattern, which is characterized by reductive photodehalogenation, triggered by homolytic carbon-chlorine bond cleavage with formation of highly reactive aryl radical intermediates. Accordingly, these metabolites are phototoxic to cells, as revealed by the 3T3 NRU assay; their photo-irritation factors are even higher than that of CPZ. The same trend is observed in photogenotoxicity studies, both with isolated and with cellular DNA, where DMCPZ and DDMCPZ are more active than CPZ itself. In summary, side-chain demethylation of CPZ, as a consequence of Phase I biotransformation, does not result a photodetoxification. Instead, it leads to metabolites that exhibit in an even enhanced photo(geno)toxicity. - Highlights: • Demethylated CPZ metabolites are phototoxic to cells, as revealed by the NRU assay. • Single cell electrophoresis (Comet Assay) confirms the photodamage to cellular DNA. • DNA single strand breaks formation is observed on agarose gel electrophoresis.
Wei, Shu; Hua, Hai-Rong; Chen, Qian-Quan; Zhang, Ying; Chen, Fei; Li, Shu-Qing; Li, Fan; Li, Jia-Li
2017-03-18
Brain development and aging are associated with alterations in multiple epigenetic systems, including DNA methylation and demethylation patterns. Here, we observed that the levels of the 5-hydroxymethylcytosine (5hmC) ten-eleven translocation (TET) enzyme-mediated active DNA demethylation products were dynamically changed and involved in postnatal brain development and aging in tree shrews ( Tupaia belangeri chinensis ). The levels of 5hmC in multiple anatomic structures showed a gradual increase throughout postnatal development, whereas a significant decrease in 5hmC was found in several brain regions in aged tree shrews, including in the prefrontal cortex and hippocampus, but not the cerebellum. Active changes in Tet mRNA levels indicated that TET2 and TET3 predominantly contributed to the changes in 5hmC levels. Our findings provide new insight into the dynamic changes in 5hmC levels in tree shrew brains during postnatal development and aging processes.
Armour, Micki D; Broome, Michael; Dell'Anna, Giuseppe; Blades, Natalie J; Esson, Douglas W
2011-07-01
To review the distribution of orbital and intracranial disease in canine and feline patients undergoing magnetic resonance imaging (MRI) following referral to a veterinary ophthalmologist and to correlate results of MRI with pathologic conditions including neoplasia, suspected optic neuritis (ON) and orbital cellulitis. Recognized and emerging imaging techniques are reviewed. Medical records of 79 canine and 13 feline patients were reviewed. Neoplasia was diagnosed in 53/92 (57.6%) of patients. The most prevalent types of neoplasia were carcinoma (16/53, 30.1%), sarcoma (11/53, 20.8%), lymphoma (8/53, 15.1%) and presumptive meningioma (9/53, 17.0%). Carcinomas and sarcomas were characterized by bony lysis and intracranial/sinonasal extension. Lymphoma was generally unilateral, less invasive and originated from the ventromedial orbit. Intracranial masses representing presumptive meningiomas frequently exhibited a 'dural tail' sign. Diagnosis of suspected ON was made in 13 of 92 (14.1%) patients. Results of MRI in patients with suspected ON included unilateral optic nerve hyperintensity (3/13, 23.0%), bilateral optic nerve hyperintensity (1/13, 7.7%) and optic chiasmal hyperintensity (3/13, 23.0%). Seven suspected ON patients demonstrated intracranial multifocal patchy contrast enhancement (7/13, 53.8%). Diagnosis of orbital cellulitis was made in 12/92 (13.0%) patients. Orbital neoplasia was the most common pathologic condition detected. Essential Roentgen characteristics are helpful when diagnosing pathologic processes and providing prognoses in cases of orbital or intracranial disease. Magnetic resonance imaging comprises an important diagnostic component in cases of suspected ON. Emerging contrast and functional MRI techniques as well as SI data may increase our ability to characterize disease processes. © 2011 American College of Veterinary Ophthalmologists.
Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J
2005-08-01
The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.
Expression of hepatocyte growth factor and the proto-oncogenic receptor c-Met in canine osteosarcoma
Fieten, H; Spee, B; Ijzer, J; Kik, M J; Penning, L C; Kirpensteijn, J
Hepatocyte growth factor (HGF) and the proto-oncogenic receptor c-Met are implicated in growth, invasion, and metastasis in human cancer. Little information is available on the expression and role of both gene products in canine osteosarcoma. We hypothesized that the expression of c-Met is
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
International Nuclear Information System (INIS)
Kato, Toshiro; Kawase, Yasuo
1976-01-01
A direct evidence of the inhibitory effect in a cell-free system of S. cerevisiae was experimentally studied, and the site of action of Denmert (S-n-butyl S'-p-tert-butylbenzyl N-3-pyridyldithiocarbon-imidate) in sterol biosynthesis was examined. 14 C-labeled lanosterol and 14-desmethyl-lanosterol were biosynthetically prepared. DL-mevalonate-2- 14 C was incubated with yeast cell-free homogenates for 3 hr at 28 deg C while being shaked vigorously in atmospheric oxygen. The resultant 14 C-labeled sterol was extracted and chromatographed on a silicic acid-Hyflo Super Cel column. 4,4-dimethyl sterol thus obtained was acetylated with acetic anhydride and pyridine. The separation of lanosteryl acetate and 14-desmethyl lanosteryl acetate was accomplished on alumina thin-layer plates. After the saponification of each steryl acetate, the quantity of the sterol was assessed by gas chromatography with cholesterol as an internal standard. The incubation of the 14 C-labeled sterol was achieved under the same conditions as those for the DL-mevalonate-2- 14 C except the addition of the substrate which was dispersed in 0.1M phosphate buffer. Denmert inhibited the conversion of 14 C-labeled lanosterol to 4-desmethyl sterol, while the conversion of 14 C-labeled 14-desmethyl lanosterol to 4-desmethyl sterol was hardly affected by the fungicide. Therefore, Denmert is a potent selective inhibitor of the demethylation at the C-14 position in ergosterol biosynthesis. The fungicide, triarimol, exhibited the same effect on sterol biosynthesis as that of Denmert. (Iwakiri, K.)
C-kit expression in canine mucosal melanomas.
Newman, S J; Jankovsky, J M; Rohrbach, B W; LeBlanc, A K
2012-09-01
The c-kit receptor is responsible for transmission of promigration signals to melanocytes; its downregulation may be involved in malignant progression of human melanocytic neoplasms. Expression of this receptor has not been examined in normal or neoplastic melanocytes from dogs. In this study, 14 benign dermal and 61 malignant mucosal melanocytic tumors were examined for c-kit (KIT) expression. Sites of the mucosal melanomas were gingiva (not further specified; n = 30), buccal gingiva (n = 6), soft palate (n = 4), hard palate (n = 5), tongue (n = 7), lip (n = 6), and conjunctiva (n = 3). Melan A was expressed in all 14 dermal melanocytomas and in 59 of 61 (96.7%) tumors from oral or conjunctival mucosa, confirming melanocytic origin. C-kit receptor expression was strong and diffuse throughout the cytoplasm in all 14 dermal melanocytomas and was identified in basilar mucosal melanocytes over submucosal neoplasms (27 of 61, 44.3%), junctional (neoplastic) melanocytes (17 of 61, 27.9%), and, less commonly, neoplastic melanocytes of the subepithelial tumors (6 of 61, 9.8%). KIT expression anywhere within the resected melanomas correlated with significantly longer survival. These results suggest that c-kit receptor expression may be altered in canine melanomas and may have potential as a prognostic indicator for mucosal melanomas.
DEFF Research Database (Denmark)
Hansen, Adam E.; Gutte, Henrik; Holst, Pernille
2018-01-01
13C Magnetic Resonance Spectroscopy (MRS) using hyperpolarized 13C-labeled pyruvate as a substrate offers a measure of pyruvate-lactate interconversion and is thereby a marker of the elevated aerobic glycolysis (Warburg effect) generally exhibited by cancer cells. Here, we aim to compare hyperpol......13C Magnetic Resonance Spectroscopy (MRS) using hyperpolarized 13C-labeled pyruvate as a substrate offers a measure of pyruvate-lactate interconversion and is thereby a marker of the elevated aerobic glycolysis (Warburg effect) generally exhibited by cancer cells. Here, we aim to compare...
Demethylation of methylmercury in growing rice plants: An evidence of self-detoxification
International Nuclear Information System (INIS)
Xu, Xiaohan; Zhao, Jiating; Li, Yunyun; Fan, Yuqin; Zhu, Nali; Gao, Yuxi; Li, Bai; Liu, Hanyu; Li, Yu-Feng
2016-01-01
Mercury (Hg) is a global pollutant that poses a serious threat to human and the environment. Rice was found as an important source for human exposure to Hg in some areas. In this study, the transportation and transformation of IHg and MeHg in rice plants exposed to IHg or MeHg were investigated. The IHg and MeHg concentrations in rice roots and shoots collected every five days were analyzed by HPLC-ICP-MS and SR-XANES. When exposed to MeHg, the percent of IHg in rice roots and shoots increased while MeHg decreased significantly, suggesting prominent demethylation of MeHg occurred. However no notable MeHg was found in both roots and shoots of rice plant when exposed to IHg. SR-XANES analysis further confirmed the demethylation of MeHg with rice. This study provides a new finding that demethylation of MeHg could occur in growing rice, which may be a self-defense process of rice plant. - Graphical abstract: Inorganic mercury in Rice (Oryza sativa L.) plants exposed to methylmercury was detected: An evidence of rice plant against methylmercury phytotoxicity. Display Omitted - Highlights: • Demethylation of MeHg in rice plant was found in rice root. • Hg in rice roots mainly present as MeHg-SR or RS-Hg-SR form. • MeHg-SR in roots can be gradually transformed to RS-Hg-SR with rice growth. - Demethylation of MeHg in growing rice.
Directory of Open Access Journals (Sweden)
André Felipe Streck
2009-09-01
Full Text Available The presence of canine parvovirus type 2 (CPV-2, 2a and 2b has been described in Brazil, however, the type 2c had not been reported until now. In the current study, seven out of nine samples from dogs with diarrhea were characterized as CPV-2c, indicating that this virus is already circulating in the Brazilian canine population.No Brasil, a presença do parvovírus canino do tipo 2 (CPV-2, 2a e 2b já havia sido descrita, contudo, ainda não havia sido verificada a presença do tipo 2c. No presente trabalho, sete de nove amostras de cães com diarréia foram caracterizadas como CPV-2c, indicando que este vírus já está circulando na população canina no Brasil.
Fourier spectroscopy of the 12C2, 13C2, and 12C13C (0-0) swan bands
International Nuclear Information System (INIS)
Amiot, C.
1983-01-01
The (0-0) band of the C 2 Swan electronic system d 3 Pi/sub g/→a 3 Pi/sub u/ has been recorded by Fourier spectroscopy. The three isotopes species 12 C 2 , 13 C 2 , and 12 C 13 C were investigated. The observed wavenumbers were reduced to molecular parameters using a nonlinear least-square fitting procedure. Well-known perturbations at N' = 47 and N' = 51 again observed in the e 12 C 2 d 3 Pi/sub g/ (v = 0) level. Perturbations of the same kind are present in the 13 C 2 spectrum at N' = 34 and N' = 44,48,52. The 12 C 13 C spectrum exhibits in the observed spectral range a unique perturbation for N' = 41
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
Energy Technology Data Exchange (ETDEWEB)
Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)
2012-07-06
Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
International Nuclear Information System (INIS)
Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi
2012-01-01
Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the
Ferguson, Daniel C; Cheng, Qiuying; Blanco, Javier G
2015-07-01
The anthracyclines doxorubicin and daunorubicin are used in the treatment of various human and canine cancers, but anthracycline-related cardiotoxicity limits their clinical utility. The formation of anthracycline C-13 alcohol metabolites (e.g., doxorubicinol and daunorubicinol) contributes to the development of anthracycline-related cardiotoxicity. The enzymes responsible for the synthesis of anthracycline C-13 alcohol metabolites in canines remain to be elucidated. We hypothesized that canine carbonyl reductase 1 (cbr1), the homolog of the prominent anthracycline reductase human CBR1, would have anthracycline reductase activity. Recombinant canine cbr1 (molecular weight: 32.8 kDa) was purified from Escherichia coli. The enzyme kinetics of "wild-type" canine cbr1 (cbr1 D218) and a variant isoform (cbr1 V218) were characterized with the substrates daunorubicin and menadione, as well as the flavonoid inhibitor rutin. Canine cbr1 catalyzes the reduction of daunorubicin to daunorubicinol, with cbr1 D218 and cbr1 V218 displaying different kinetic parameters (cbr1 D218 Km: 188 ± 144 μM versus cbr1 V218 Km: 527 ± 136 μM, P < 0.05, and cbr1 D218 Vmax: 6446 ± 3615 nmol/min per milligram versus cbr1 V218 Vmax: 15539 ± 2623 nmol/min per milligram, P < 0.01). Canine cbr1 also metabolized menadione (cbr1 D218 Km: 104 ± 50 μM, Vmax: 2034 ± 307 nmol/min per milligram). Rutin acted as a competitive inhibitor for the reduction of daunorubicin (cbr1 D218 Ki: 1.84 ± 1.02 μM, cbr1 V218 Ki: 1.38 ± 0.47 μM). These studies show that canine cbr1 metabolizes daunorubicin and provide the necessary foundation to characterize the role of cbr1 in the variable pharmacodynamics of anthracyclines in canine cancer patients. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.
International Nuclear Information System (INIS)
Narayan, R.; Chang, C-j.
1982-01-01
[2- 13 C, 2- 14 C]2-Aminoethanol hydrochloride was prepared in good yield from Na*CN in a two step sequence by first converting the Na*CN to OHCH 2 *CN and then reducing the nitrile directly with a solution of borane-tetrahydrofuran complex. The reaction procedure was simple and the pure product could be obtained readily. Using this specifically labelled precursor, the synthesis of [1- 13 C, 1- 14 C]2-chloroethylamine hydrochloride, N-([1- 13 C, 1- 14 C]2-chloroethyl)-N-nitrosourea(CNU) and N,N'-bis([1- 13 C, 1- 14 C]2-chloroethyl)-N-nitrosourea(BCNU) in good yield without isotope scrambling was also reported. (author)
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
International Nuclear Information System (INIS)
Katsumi Iida
2013-01-01
The biosynthetic pathways leading to δ-aminolevulinic acid (ALA) from the Shemin precursor glycine via the C5 pathway in Arthrobacter hyalinus were quantitatively evaluated by means of feeding experiments with [2- 13 C]glycine, sodium [1- 13 C]acetate, and sodium [2- 13 C]acetate, followed by analysis of the labeling patterns of coproporphyrinogen III (Copro'gen III) (biosynthesized from ALA) using 13 C NMR spectroscopy. Two biosynthetic pathways leading to ALA from glycine via the C5 pathway were identified: i.e., transformation of glycine to l-serine catalyzed by glycine hydroxymethyltransferase, and glycine synthase-catalyzed catabolism of glycine to N 5 , N 10 -methylene-tetrahydrofolic acid (THF), which reacts with another molecule of glycine to afford l-serine. l-Serine is transformed to acetyl-CoA via pyruvic acid. Acetyl-CoA enters the tricarboxylic acid cycle, affording 2-oxoglutaric acid, which in turn is transformed to l-glutamic acid. The l-glutamic acid enters the C5 pathway, affording ALA in A. hyalinus. A 13 C NMR spectroscopic comparison of the labeling patterns of Copro'gen III obtained after feeding of [2- 13 C]glycine, sodium [1- 13 C]acetate, and sodium [2- 13 C]acetate showed that [2- 13 C]glycine transformation and [2- 13 C]glycine catabolism in A. hyalinus proceed in the ratio of 52 and 48 %. The reaction of [2- 13 C]glycine and N 5 , N 10 -methylene-THF, that of glycine and N 5 , N 10 -[methylene- 13 C]methylene-THF generated from the [2- 13 C]glycine catabolism, and that of [2- 13 C]glycine and N 5 , N 10 -[methylene- 13 C]methylene-THF transformed the fed [2- 13 C]glycine to [1- 13 C]acetyl-CoA, [2- 13 C]acetyl-CoA, and [1,2- 13 C 2 ]acetyl-CoA in the ratios of 42, 37, and 21 %, respectively. These labeled acetyl-CoAs were then incorporated into ALA. Our results provide a quantitative picture of the pathways of biosynthetic transformation to ALA from glycine in A. hyalinus. (author)
Energy Technology Data Exchange (ETDEWEB)
Porwoll, J P; Leete, E [Minnesota Univ., Minneapolis (USA). Dept. of Chemistry
1985-03-01
Potential advanced intermediates in the biosynthesis of delta/sup 9/-tetrahydrocannabinol, the major psychoactive principle of marijuana, have been synthesized labeled with two contiguous /sup 13/C atoms and /sup 14/C. Methyl (5,6-/sup 13/C/sub 2/, 1-/sup 14/C)olivetolate was prepared from lithium (/sup 13/C/sub 2/)acetylide and dimethyl (2-/sup 14/C)malonate. Reaction with geranyl bromide afforded methyl (5,6-/sup 13/C/sub 2/, 1-/sup 14/C)cannabigerolate, and hydrolysis of these methyl esters with lithium propyl mercaptide yielded the corresponding labeled acids. The /sup 13/C-/sup 13/C couplings observable in the /sup 13/C NMR spectra of these /sup 13/C-enriched compounds and their synthetic precursors are recorded. Methyl (1'-/sup 14/C)olivetolate was prepared from /sup 13/CO/sub 2/ to confirm assignments of the /sup 13/C chemical shifts in the pentyl side chain of these compounds.
Synthesis of C-13 labeled vitamin E, [4' a-13C]all-rac-α-tocopherol
International Nuclear Information System (INIS)
Urano, Shiro; Muto, Riko; Matsuo, Mitsuyoshi
1985-01-01
Vitamin E with a 13 C-labeled isoprenoid side chain, [4' a- 13 C]-all-rac-α-tocopherol, was synthesized by the coupling reaction of 6-4-methoxymethoxy-2-([methyl- 13 C]5-bromo-4-methyl-pent-1-yl)chroman (8) with 3,7-dimethyl-1-(thiazolin-2-yl)thio-2,6-octadiene. Compound 8 was prepared using 2-(4,4-di-ethoxycarbonylbut-1-yl)-6-methoxymethoxy-2,5,7,8-tetramethyl-chroman as a key intermediate and [ 13 C]methyl iodide as a 13 C source. The total yield of the labeled α-tocopherol based on [ 13 C]methyl iodide was 58.7%. (author)
Wu, Huifang; Thatcher, Linn N; Bernard, Denzil; Parrish, Damon A; Deschamps, Jeffrey R; Rice, Kenner C; MacKerell, Alexander D; Coop, Andrew
2005-06-23
[reaction: see text] L-Selectride is an efficient agent for the 3-O-demethylation of opioids and is known to cleave the least hindered methoxyl group in a molecule. The treatment of a 3,4-dimethoxymorphinan containing a 6-ketal with L-Selectride gave selective 4-O-demethylation, rather than cleavage of the less hindered 3-methoxyl. In contrast, a 3,4-dimethoxymorphinan lacking a 6-ketal gave selective 3-O-demethylation, suggesting that the regiochemistry of L-Selectride-mediated O-demethylation can be manipulated through altering the position of coordination of the lithium ion.
Ligand Binding Affinities of Arctigenin and Its Demethylated Metabolites to Estrogen Receptor Alpha
Directory of Open Access Journals (Sweden)
Masao Hattori
2013-01-01
Full Text Available Phytoestrogens are defined as plant-derived compounds with estrogen-like activities according to their chemical structures and activities. Plant lignans are generally categorized as phytoestrogens. It was reported that (−-arctigenin, the aglycone of arctiin, was demethylated to (−-dihydroxyenterolactone (DHENL by Eubacterium (E. sp. ARC-2. Through stepwise demethylation, E. sp. ARC-2 produced six intermediates, three mono-desmethylarctigenins and three di-desmethylarctigenins. In the present study, ligand binding affinities of (−-arctigenin and its seven metabolites, including DHENL, were investigated for an estrogen receptor alpha, and found that demethylated metabolites had stronger binding affinities than (−-arctigenin using a ligand binding screen assay method. The IC50 value of (2R,3R-2-(4-hydroxy-3-methoxybenzyl-3-(3,4-dihydroxybenzyl-butyrolactone was 7.9 × 10−4 M.
Energy Technology Data Exchange (ETDEWEB)
Porwoll, J.P.; Leete, E. (Minnesota Univ., Minneapolis (USA). Dept. of Chemistry)
1985-03-01
Potential advanced intermediates in the biosynthesis of delta/sup 9/-tetrahydrocannabinol, the major psychoactive principle of marijuana, have been synthesized labeled with two contiguous /sup 13/C atoms and /sup 14/C. Methyl (5,6-/sup 13/C/sub 2/, 1-/sup 14/C)olivetolate was prepared from lithium (/sup 13/C/sub 2/)acetylide and dimethyl (2-/sup 14/C)malonate. Reaction with geranyl bromide afforded methyl (5,6-/sup 13/C/sub 2/, 1-/sup 14/C)cannabigerolate, and hydrolysis of these methyl esters with lithium propyl mercaptide yielded the corresponding labeled acids. The /sup 13/C-/sup 13/C couplings observable in the /sup 13/C NMR spectra of these /sup 13/C-enriched compounds and their synthetic precursors are recorded. Methyl (1'-/sup 14/C)olivetolate was prepared from /sup 13/CO/sub 2/ to confirm assignments of the /sup 13/C chemical shifts in the pentyl side chain of these compounds.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.
Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum
2014-04-01
Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.
Synthesis of 1-13C-1-indanone and 2-13C-1,2,3,4-tetrahydroquinoline
International Nuclear Information System (INIS)
Pickering, R.E.; Wysocki, M.A.; Eisenbraun, E.J.
1985-01-01
The synthesis of 2- 13 C-1,2,3,4-tetrahydroquinoline (5) via 1- 13 C-3-phenylpropanoic acid (1), 1- 13 C-1-indanone (2), 1- 13 C-1-indanone hydrazone (3) and 2- 13 C-3,4-dihydro-2(1H)-quinolinone (4) proceeded in 78, 96, 95, 79, and 85% individual yields respectively for 1, 2, 3, 4, 5 and 61% overall yield of the latter from 1. (author)
2013-01-01
A litter of recently-vaccinated puppies in Sweden experienced signs of severe haemorrhagic gastroenteritis. Canine parvovirus (CPV) was suspected as the cause of this outbreak on the basis of the clinical signs and the presence of parvoviral antigen in the faeces from one of the affected pups - confirmed using a commercial in-clinic faecal antigen ELISA test kit. A concern was raised about whether the vaccine (which contained a live, attenuated strain of CPV) could have caused the disease and so further faecal samples from the affected pups were submitted for laboratory virus isolation and identification. On cell culture, two out of four faecal samples were found to be virus-positive. This was confirmed as being canine parvovirus by immuno-staining with CPV specific monoclonal antibody. The virus was then tested using a series of PCR probes designed to confirm the identity of CPV and to distinguish the unique vaccine strain from field virus. This confirmed that the virus was indeed CPV but that it was not vaccine strain. The virus was then typed by sequencing the 426 amino acid region of the capsid gene which revealed this to be a type 2c virus. Since its emergence in the late 1970s, canine parvovirus 2 (CPV2) has spread worldwide and is recognised as an important canine pathogen in all countries. The original CPV2 rapidly evolved into two antigenic variants, CPV2a and CPV2b, which progressively replaced the original CPV2. More recently a new antigenic variant, CPV2c, has appeared. To date this variant has been identified in many countries worldwide but there have been no reports yet of its presence in any Scandinavian countries. This case report therefore represents the first published evidence of the involvement of CPV2c in a severe outbreak of typical haemorrhagic gastroenteritis in a susceptible litter of pups in Scandinavia. PMID:24016358
Sutton, David; Vinberg, Carina; Gustafsson, Agneta; Pearce, Jacqueline; Greenwood, Neil
2013-09-10
A litter of recently-vaccinated puppies in Sweden experienced signs of severe haemorrhagic gastroenteritis. Canine parvovirus (CPV) was suspected as the cause of this outbreak on the basis of the clinical signs and the presence of parvoviral antigen in the faeces from one of the affected pups - confirmed using a commercial in-clinic faecal antigen ELISA test kit. A concern was raised about whether the vaccine (which contained a live, attenuated strain of CPV) could have caused the disease and so further faecal samples from the affected pups were submitted for laboratory virus isolation and identification.On cell culture, two out of four faecal samples were found to be virus-positive. This was confirmed as being canine parvovirus by immuno-staining with CPV specific monoclonal antibody. The virus was then tested using a series of PCR probes designed to confirm the identity of CPV and to distinguish the unique vaccine strain from field virus. This confirmed that the virus was indeed CPV but that it was not vaccine strain. The virus was then typed by sequencing the 426 amino acid region of the capsid gene which revealed this to be a type 2c virus.Since its emergence in the late 1970s, canine parvovirus 2 (CPV2) has spread worldwide and is recognised as an important canine pathogen in all countries. The original CPV2 rapidly evolved into two antigenic variants, CPV2a and CPV2b, which progressively replaced the original CPV2. More recently a new antigenic variant, CPV2c, has appeared. To date this variant has been identified in many countries worldwide but there have been no reports yet of its presence in any Scandinavian countries. This case report therefore represents the first published evidence of the involvement of CPV2c in a severe outbreak of typical haemorrhagic gastroenteritis in a susceptible litter of pups in Scandinavia.
Chondrogenic potential of canine articular cartilage derived cells (cACCs
Directory of Open Access Journals (Sweden)
Nowak Urszula
2016-01-01
Full Text Available In the present paper, the potential of canine articular cartilage-derived cells (cACCs for chondrogenic differentiation was evaluated. The effectiveness of cACCs’ lineage commitment was analyzed after 14 days of culture in chondorgenic and non-chondrogenic conditions. Formation of proteoglycan-rich extracellular matrix was assessed using histochemical staining – Alcian Blue and Safranin-O, while elemental composition was determined by means of SEM-EDX. Additionally, ultrastructure of cACCs was evaluated using TEM. The expression of genes involved in chondrogenesis was monitored with quantitative Real Time PCR. Results obtained indicate that the potential of cACCs for cartilagous extracellular matrix formation may be maintained only in chondrogenic cultures. The formation of specific chondro-nodules was not observed in a non-chondrogenic culture environment. The analysis of cACCs’ ultrastructure, both in non-chondrogenic and chondrogenic cultures, revealed well-developed rough endoplasmatic reticulum and presence of mitochondria. The cACCs in chondrogenic medium shed an increased number of microvesicles. Furthermore, it was shown that the extracellular matrix of cACCs in chondrogenic cultures is rich in potassium and molybdenum. Additionally, it was determined that gene expression of collagen type II, aggrecan and SOX-9 was significantly increased during chondrogenic differentiation of cACCs. Results obtained indicate that the culture environment may significantly influence the cartilage phenotype of cACCs during long term culture.
Hu, Xiangang; Mu, Li; Lu, Kaicheng; Kang, Jia; Zhou, Qixing
2014-06-25
The demethylation of methylmercury has received substantial attention. Here, a novel chemical method for the demethylation of methylmercury is proposed. The low-toxicity graphene-fulvic acid (FA, a ubiquitous material in the environment) was synthesized without the use of a chemical reagent. The hybridized graphene-FA presented an indirect open band gap of 2.25-2.87 eV as well as adequate aqueous dispersion. More importantly, the hybridized graphene-FA exhibited 6- and 10-fold higher photocatalytic efficiencies for the demethylation of methylmercury than FA and free FA with graphene, respectively. This result implies that immobilized, rather than free, FA accelerated the catalysis. Furthermore, inorganic mercuric ion, elemental mercury, and mercuric oxide were identified as the primary demethylation products. For free FA with graphene, graphene quenches the excited-state FA, inhibiting the demethylation by electron transfer. In contrast, the graphene of the self-assembled graphene-FA serves as an electron reservoir, causing electron-hole pair separation. Graphene-FA showed a negligible toxicity toward microalgae compared to graphene. The above results reveal that the green synthesis of graphene and organic molecules is a convenient strategy for obtaining effective cocatalysts.
International Nuclear Information System (INIS)
Lee, Kwan Soo; Kim, Kee D.
2010-01-01
We have developed a new and efficient method for the demethylation of various types of aryl methyl ethers using readily available, stable, and easily handled magnesium iodide in [BMIM]BF 4 ionic liquid. Owing to its simplicity and mild reaction conditions the protocol reported herein may serve as a useful alternative to the existing methods for the deprotection of aryl methyl ethers to the corresponding phenolic derivatives. Demethylation of aryl methyl ethers to the corresponding phenols are very important reactions in organic synthesis. A number of methods have been reported for the cleavage of highly stable aryl methyl ethers utilizing strong acids or bases such as aluminum chloride, boron tribromide, cerium chloride, alkaline thiolate, methyl magnesium iodide, and L-Selectride. However, all of these methods invariably suffered from one or more drawbacks such as harsh reaction conditions, long reaction times, difficulty of manipulation, use of exotic reagents, and low reaction yields. Furthermore, in the most of known methods for demethylation of aryl methyl ethers, use of large excess amounts of demethylating agents have been generally required. Thus, it is highly desirable to develop an improved convenient and efficient procedure for demethylation reactions of aryl methyl ethers
Energy Technology Data Exchange (ETDEWEB)
Lee, Kwan Soo [KAIST, Daejeon (Korea, Republic of); Kim, Kee D. [Sangji University, Wonju (Korea, Republic of)
2010-12-15
We have developed a new and efficient method for the demethylation of various types of aryl methyl ethers using readily available, stable, and easily handled magnesium iodide in [BMIM]BF{sub 4} ionic liquid. Owing to its simplicity and mild reaction conditions the protocol reported herein may serve as a useful alternative to the existing methods for the deprotection of aryl methyl ethers to the corresponding phenolic derivatives. Demethylation of aryl methyl ethers to the corresponding phenols are very important reactions in organic synthesis. A number of methods have been reported for the cleavage of highly stable aryl methyl ethers utilizing strong acids or bases such as aluminum chloride, boron tribromide, cerium chloride, alkaline thiolate, methyl magnesium iodide, and L-Selectride. However, all of these methods invariably suffered from one or more drawbacks such as harsh reaction conditions, long reaction times, difficulty of manipulation, use of exotic reagents, and low reaction yields. Furthermore, in the most of known methods for demethylation of aryl methyl ethers, use of large excess amounts of demethylating agents have been generally required. Thus, it is highly desirable to develop an improved convenient and efficient procedure for demethylation reactions of aryl methyl ethers.
International Nuclear Information System (INIS)
Oremland, R.S.; Culbertson, C.W.; Winfrey, M.R.
1991-01-01
The biogeochemical cycling of mercury has received considerable attention because of the toxicity of methylmercury, its bioaccumulation in biota, and its biomagnification in aquatic food chains. The formation of methylmercury is mediated primarily by microorganisms. Demethylation of monomethylmercury in freshwater and estuarine sediments and in bacterial cultures was investigated with 14 CH 3 HgI. Under anaerobiosis, results with inhibitors indicated partial involvement of both sulfate reducers and methanogens, the former dominated estuarine sediments, while both were active in freshwaters. Aerobes were the most significant demethylators in estuarine sediments, but were unimportant in freshwater sediments. Products of anaerobic demthylation were mainly 14 CO 2 as well as lesser amounts of 14 CH 4 . Acetogenic activity resulted in fixation of some 14 CO 2 produced from 14 CH 3 HgI into acetate. Aerobic demethylation in estuarine sediments produced only 14 CH 4 , while aerobic demethylation in freshwater sediments produced small amounts of both 14 CH 4 and 14 CO 2 . Two species of Desulfovibrio produced only traces of 14 CH 4 from 14 CH 3 HgI, while a culture of a methylotrophic methanogen formed traces of 14 CO 2 and 14 CH 4 when grown on trimethylamine in the presence of the 14 CH 3 HgI. These results indicate that both aerobes and anaerobes demethylate mercury in sediments, but that either group may dominate in a particular sediment type. Aerobic demethylation in the estuarine sediments appeared to proceed by the previously characterized organomercurial-lyase pathway, because methane was the sole product. This indicates the presence of an oxidative pathway, possibly one in which methylmercury serves as an analog of one-carbon substrates
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
Base-oxidant promoted metal-free N-demethylation of arylamines
Indian Academy of Sciences (India)
A metal-free oxidative N-demethylation of arylamines with triethylamine as a base and tert-butyl hydroperoxide (TBHP) as oxidant is reported in this paper. The reaction is general, practical, inexpensive, non-toxic, and the method followed is environmentally benign, with moderate to good yields.
Determination of urea 13C in urea 13C mixed powder by HPLC
International Nuclear Information System (INIS)
Zhong Jianguo; Song Tianqi
2006-01-01
A HPLC method is developed for determination of Urea 13 C in Urea 13 C Mixed Powder. A Alltech Econosphere NH2 column (250 mm x 4.6 mm, 5 μm)is used as stationary phrase, a mixture of V(acetonitrile): V(methanol): V(water) = 900 : 100: 10 is used as mobile phase and the flow rate is l mL·min -1 , UV detection wavelength is performed at 200 nm. The calibration curve shows good linearity in the range of 0.2-1.0 g·L -1 of Urea 13 C, y=2.548 x 10 6 x + 4.005 x 10 4 , r=0.9999, and the averaged recovery is 100.6%. The method is simple and accurate, and can be used for the quality control of Urea 13C Mixed Powder. (authors)
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
International Nuclear Information System (INIS)
Imanishi, B.; Denisov, V.; Motobayashi, T.
1996-10-01
The charge-symmetric scattering systems, 12 C+ 13 N and 12 C+ 13 C have been investigated by using the orthogonalized coupled-reaction-channel (OCRC) method with the basis functions of the elastic, inelastic and transfer channels defined by the single-particle states, 1p1/2, 2s1/2, 1d5/2 and 1d3/2 of the valence nucleon in 13 N or 13 C. The data of the elastic scattering of 13 N on 12 C measured by Lienard et al. have been explained consistently with the data of the elastic and inelastic scattering of the 12 C+ 13 C system. The CRC effects both on the above systems are very strong, although those on the 12 C+ 13 N system are fairly weaker than the 12 C+ 13 C system. The role of the highly excited single-particle states 1d3/2 is particularly important in the formation of a specific CRC scheme, i.e., the formation of the covalent molecules due to the hybridization caused by the mixing of the different parity single-particle states. The fusion cross sections of the 12 C+ 13 C system at energies below the Coulomb barrier are strongly enhanced as a result of the strong CRC effects as compared with those of the 12 C+ 12 C system, while in 12 C+ 13 N system the enhancement of the sub-barrier fusion has not been observed. The above absorption mechanism for the 12 C+ 13 C system explains the lack of the molecular-resonance phenomena observed in the 12 C+ 12 C system. We check the effects of the dipole (E1) transition of the valence nucleon in 13 N (and also in 13 C) due to the core-core Coulomb interaction in the scattering at sub-barrier energies. The effects are not appreciable. (author)
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Äijö, Tarmo; Huang, Yun; Mannerström, Henrik; Chavez, Lukas; Tsagaratou, Ageliki; Rao, Anjana; Lähdesmäki, Harri
2016-03-14
We present a generative model, Lux, to quantify DNA methylation modifications from any combination of bisulfite sequencing approaches, including reduced, oxidative, TET-assisted, chemical-modification assisted, and methylase-assisted bisulfite sequencing data. Lux models all cytosine modifications (C, 5mC, 5hmC, 5fC, and 5caC) simultaneously together with experimental parameters, including bisulfite conversion and oxidation efficiencies, as well as various chemical labeling and protection steps. We show that Lux improves the quantification and comparison of cytosine modification levels and that Lux can process any oxidized methylcytosine sequencing data sets to quantify all cytosine modifications. Analysis of targeted data from Tet2-knockdown embryonic stem cells and T cells during development demonstrates DNA modification quantification at unprecedented detail, quantifies active demethylation pathways and reveals 5hmC localization in putative regulatory regions.
Multisite Kinetic Modeling of 13C Metabolic MR Using [1-13C]Pyruvate
Directory of Open Access Journals (Sweden)
Pedro A. Gómez Damián
2014-01-01
Full Text Available Hyperpolarized 13C imaging allows real-time in vivo measurements of metabolite levels. Quantification of metabolite conversion between [1-13C]pyruvate and downstream metabolites [1-13C]alanine, [1-13C]lactate, and [13C]bicarbonate can be achieved through kinetic modeling. Since pyruvate interacts dynamically and simultaneously with its downstream metabolites, the purpose of this work is the determination of parameter values through a multisite, dynamic model involving possible biochemical pathways present in MR spectroscopy. Kinetic modeling parameters were determined by fitting the multisite model to time-domain dynamic metabolite data. The results for different pyruvate doses were compared with those of different two-site models to evaluate the hypothesis that for identical data the uncertainty of a model and the signal-to-noise ratio determine the sensitivity in detecting small physiological differences in the target metabolism. In comparison to the two-site exchange models, the multisite model yielded metabolic conversion rates with smaller bias and smaller standard deviation, as demonstrated in simulations with different signal-to-noise ratio. Pyruvate dose effects observed previously were confirmed and quantified through metabolic conversion rate values. Parameter interdependency allowed an accurate quantification and can therefore be useful for monitoring metabolic activity in different tissues.
To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.
Malik, Pooja; Rana, Vivek; Rehani, Usha
2012-01-01
The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.
Directory of Open Access Journals (Sweden)
T.X. Castro
2010-12-01
Full Text Available Canine parvovirus (CPV is the most important enteric virus for dogs and it seems to be undergoing continuous evolution, generating new genetic and antigenic variants throughout the world. The aim of this study was to analyze the distribution of CPV variants from 1995 to 2009 and to investigate the circulation of the new variant CPV-2c in Rio de Janeiro, Brazil. In addition, the clinical features of CPV infection were also reported. After CPV laboratorial confirmation by HA/HI and PCR, thirty-two fecal samples were analyzed by sequencing a 583-bp fragment of the VP2 gene. One sample, collected in 2008 was typed as the new type CPV-2c. All samples from 1995 to 2003 were identified as "new CPV-2a". From 2004 to 2006, both "new CPV-2a" and CPV-2b were observed. From 2006 to 2009, most of the samples were characterized as CPV-2b. The classical signs of CPV enteritis were observed in 16/18 CPV-2a and 5/13 CPV-2b infected puppies. These results show that continuous epidemiological surveillance of CPV strain distribution is essential for studying the patterns of CPV-2a and 2b spread and for determining whether the new variant CPV-2c has become permanently established in Brazilian canine population.
International Nuclear Information System (INIS)
Viswanatha, V.; Larsen, B.; Hruby, V.J.
1979-01-01
DL-[2- 13 C]Leucine was prepared by condensing the sodium salt of ethyl acetamido-[2- 13 C]cyanoacetate with isobutylbromide in hexamethylphosphoroustriamide followed by acid hydrolysis. N-BOC-DL-[2- 13 C]Leucine was prepared and incorporated into [8-DL-[2- 13 C]leucine]oxytocin by total synthesis. The 13 C-labeled hormone derivative [8-[2- 13 C]leucine]oxytocin was separated from its 8-position diastereoisomer by partition chromatography. The specifically 13 C-labeled peptide hormone diastereoisomeric analog [3-DL-[2- 13 C]leucine]oxytocin also was prepared by solid phase peptide synthesis. No suitable solvent system for partition chromatography separation of the latter diastereoisomeric peptide mixture could be found. However an excellent preparative separation of the diastereoisomers could be obtained by reverse phase high pressure liquid chromatography on a partisil 10 M9 ODS column using the solvent system 0.05 M ammonium acetate (pH 4.0), acetonitrile (81:19, v/v) to give pure [3-[2- 13 C]leucine]oxytocin and [3-D-[2- 13 C]leucine]oxytocin. An excellent separation of [8-[2- 13 C]leucine]oxytocin and the corresponding delata-D-leucine diastereoisomer derivative could also be accomplished by high pressure liquid chromatography. (author)
International Nuclear Information System (INIS)
Mossman, David; Kim, Kyu-Tae; Scott, Rodney J
2010-01-01
DNA methylation and histone acetylation are epigenetic modifications that act as regulators of gene expression. Aberrant epigenetic gene silencing in tumours is a frequent event, yet the factors which dictate which genes are targeted for inactivation are unknown. DNA methylation and histone acetylation can be modified with the chemical agents 5-aza-2'-deoxycytidine (5-aza-dC) and Trichostatin A (TSA) respectively. The aim of this study was to analyse de-methylation and re-methylation and its affect on gene expression in colorectal cancer cell lines treated with 5-aza-dC alone and in combination with TSA. We also sought to identify methylation patterns associated with long term reactivation of previously silenced genes. Colorectal cancer cell lines were treated with 5-aza-dC, with and without TSA, to analyse global methylation decreases by High Performance Liquid Chromatography (HPLC). Re-methylation was observed with removal of drug treatments. Expression arrays identified silenced genes with differing patterns of expression after treatment, such as short term reactivation or long term reactivation. Sodium bisulfite sequencing was performed on the CpG island associated with these genes and expression was verified with real time PCR. Treatment with 5-aza-dC was found to affect genomic methylation and to a lesser extent gene specific methylation. Reactivated genes which remained expressed 10 days post 5-aza-dC treatment featured hypomethylated CpG sites adjacent to the transcription start site (TSS). In contrast, genes with uniformly hypermethylated CpG islands were only temporarily reactivated. These results imply that 5-aza-dC induces strong de-methylation of the genome and initiates reactivation of transcriptionally inactive genes, but this does not require gene associated CpG island de-methylation to occur. In addition, for three of our selected genes, hypomethylation at the TSS of an epigenetically silenced gene is associated with the long term reversion of
In vivo dynamic turnover of cerebral 13C isotopomers from [U- 13C]glucose
Xu, Su; Shen, Jun
2006-10-01
An INEPT-based 13C MRS method and a cost-effective and widely available 11.7 Tesla 89-mm bore vertical magnet were used to detect dynamic 13C isotopomer turnover from intravenously infused [U- 13C]glucose in a 211 μL voxel located in the adult rat brain. The INEPT-based 1H → 13C polarization transfer method is mostly adiabatic and therefore minimizes signal loss due to B 1 inhomogeneity of the surface coils used. High quality and reproducible data were acquired as a result of combined use of outer volume suppression, ISIS, and the single-shot three-dimensional localization scheme built in the INEPT pulse sequence. Isotopomer patterns of both glutamate C4 at 34.00 ppm and glutamine C4 at 31.38 ppm are dominated first by a doublet originated from labeling at C4 and C5 but not at C3 (with 1JC4C5 = 51 Hz) and then by a quartet originated from labeling at C3, C4, and C5 (with 1JC3C4 = 35 Hz). A lag in the transition of glutamine C4 pattern from doublet-dominance to quartet dominance as compared to glutamate C4 was observed, which provides an independent verification of the precursor-product relationship between neuronal glutamate and glial glutamine and a significant intercompartmental cerebral glutamate-glutamine cycle between neurons and glial cells.
A New Synthetic Route to Dihydrobenzopyran Via Tandem Demethylation Cyclisation
Directory of Open Access Journals (Sweden)
G. Shanmugam
2000-06-01
Full Text Available A tandem demethylation-cyclisation reaction resulting in the formation of pyran rings using AlCl3/EtSH reagent under mild reaction conditions is reported. X-ray diffraction studies on the intermediate support the suggested mechanism.
Directory of Open Access Journals (Sweden)
Crístian Bacelar Santos
2003-08-01
Full Text Available O objetivo deste trabalho foi a produção de adesivos para madeira a partir de creosoto desmetilado. Para isto, foram sintetizadas diferentes formulações de adesivos para madeira a partir de creosoto desmetilado e paraformaldeído, variando-se o pH inicial da formulação (12,00, 12,25, 12,50, 12,75, 13,00, 13,25 e 13,50 e a temperatura de síntese (60 e 70 °C, para possibilitar a verificação dos melhores pHs e da melhor temperatura para elaboração do adesivo. Foi verificado, por meio da avaliação do gel time, que a melhor temperatura de síntese foi 70 °C. Foram realizadas, então, análises por DSC (calorimetria diferencial exploratória, para obtenção dos parâmetros cinéticos e caracterização das formulações adesivas de creosoto desmetilado sintetizadas a 70 °C. Os adesivos foram utilizados para colagem, a quente (160 °C e sob pressão (12 kgf/cm², de lâminas de Araucaria angustifolia. Após a colagem, foram realizados os ensaios de resistência mecânica ao cisalhamento por tração, para condição seca e úmida. Verificou-se que a resistência da linha de cola e a porcentagem de falha na madeira para os adesivos de creosoto desmetilado sintetizados a 70 °C foram inferiores às do adesivo de fenol-formaldeído sintetizado em laboratório, que foi utilizado como padrão.The objective of this work was the production of adhesives based on demethylated creosote for bonding of wood. Different formulations of demethylated wood bcreosote/formaldehyde were evaluated aiming at improving their bonding properties. The initial pH value and the synthesis temperature were varied in order to obtain the best values for producing the adhesives. Thus, seven pH values (12.00, 12.25, 12.50, 12.75, 13.00, 13.25, and 13.50 and two different temperatures (60 °C and 70 °C were applied. It was observed by gel time evaluation that the best synthesis temperature was 70 °C. The kinetic parameters were obtained through DSC analysis
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Directory of Open Access Journals (Sweden)
Benitez-Bribiesca Luis
2006-08-01
Full Text Available Abstract Background The development of resistance to cytotoxic chemotherapy continues to be a major obstacle for successful anticancer therapy. It has been shown that cells exposed to toxic concentrations of commonly used cancer chemotherapy agents develop DNA hypermetylation. Hence, demethylating agents could play a role in overcoming drug resistance. Methods MCF-7 cells were rendered adriamycin-resistant by weekly treatment with adriamycin. Wild-type and the resulting MCF-7/Adr cells were analyzed for global DNA methylation. DNA methyltransferase activity and DNA methyltransferase (dnmt gene expression were also determined. MCF-7/Adr cells were then subjected to antisense targeting of dnmt1, -3a, and -b genes and to treatment with the DNA methylation inhibitor hydralazine to investigate whether DNA demethylation restores sensitivity to adriamycin. Results MCF-7/Adr cells exhibited the multi-drug resistant phenotype as demonstrated by adriamycin resistance, mdr1 gene over-expression, decreased intracellular accumulation of adriamycin, and cross-resistance to paclitaxel. The mdr phenotype was accompanied by global DNA hypermetylation, over-expression of dnmt genes, and increased DNA methyltransferase activity as compared with wild-type MCF-7 cells. DNA demethylation through antisense targeting of dnmts or hydralazine restored adriamycin sensitivity of MCF-7/Adr cells to a greater extent than verapamil, a known inhibitor of mdr protein, suggesting that DNA demethylation interferes with the epigenetic reprogramming that participates in the drug-resistant phenotype. Conclusion We provide evidence that DNA hypermethylation is at least partly responsible for development of the multidrug-resistant phenotype in the MCF-7/Adr model and that hydralazine, a known DNA demethylating agent, can revert the resistant phenotype.
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
Directory of Open Access Journals (Sweden)
Andrea Blanc Pintos
2011-08-01
Full Text Available This research reports the first CPV-2c isolation in cell culture (canine fibroma cell line A-72 in Uruguay. The isolates were obtained from 13 rectal swabs of Uruguayan dogs with parvovirosis. Samples were submitted to PCR with two sets of primers, restriction fragment length polymorphism (RFLP, partial sequencing of the gene encoding for VP2 capsid protein and phylogenetic characterization. The strain isolated was confirmed as CPV-2c. These results contribute to a better knowledge of CPV strains circulating in Uruguay and promote an evaluation of the efficacy of heterologous vaccines used to protect against the circulating strains.Este trabalho relata o primeiro isolamento do CPV-2c em cultura de células (linhagem celular de fibroma canino A-72, no Uruguai. Os isolados foram obtidos a partir de 13 suabes retais de cães uruguaios com parvovirose. As amostras foram submetidas à reação em cadeia da polimerase (PCR com dois pares de primers, polimorfismo de comprimento de fragmentos de restrição (RFLP, sequenciamento parcial do gene que codifica a proteína capsidial VP2 e caracterização filogenética. A cepa isolada foi confirmada como CPV-2c. Os resultados contribuem para um melhor conhecimento das cepas do CPV circulantes no Uruguai e incitam uma maior investigação sobre a eficácia das vacinas produzidas com cepas heterólogas utilizadas atualmente para proteger contra cepas circulantes.
Multi site Kinetic Modeling of 13C Metabolic MR Using [1-13C]Pyruvate
International Nuclear Information System (INIS)
Damian, P.A.G.; Sperl, J.I.; Janich, M.A.; Wiesinger, F.; Schulte, R.F.; Menzel, M.I.; Damian, P.A.G.; Damian, P.A.G.; Haase, A.; Janich, M.A.; Schwaiger, M.; Janich, M.A.; Khegai, O.; Glaser, S.J.
2014-01-01
Hyperpolarized 13 C imaging allows real-time in vivo measurements of metabolite levels. Quantification of metabolite conversion between [1- 13 C]pyruvate and downstream metabolites [1- 13 C]alanine, [1- 13 C]lactate, and [ 13 C] bicarbonate can be achieved through kinetic modeling. Since pyruvate interacts dynamically and simultaneously with its downstream metabolites, the purpose of this work is the determination of parameter values through a multi site, dynamic model involving possible biochemical pathways present in MR spectroscopy. Kinetic modeling parameters were determined by fitting the multi site model to time-domain dynamic metabolite data. The results for different pyruvate doses were compared with those of different two-site models to evaluate the hypothesis that for identical data the uncertainty of a model and the signal-to-noise ratio determine the sensitivity in detecting small physiological differences in the target metabolism. In comparison to the two-site exchange models, the multi site model yielded metabolic conversion rates with smaller bias and smaller standard deviation, as demonstrated in simulations with different signal-to-noise ratio. Pyruvate dose effects observed previously were confirmed and quantified through metabolic conversion rate values. Parameter interdependency allowed an accurate quantification and can therefore be useful for monitoring metabolic activity in different tissues
Enzyme induction in neonates after fetal exposure to antiepileptic drugs
International Nuclear Information System (INIS)
Rating, D.; Jaeger-Roman, E.; Nau, H.; Kuhnz, W.; Helge, H.
1983-01-01
The 13 C-AP breath test is shown to be a convenient, noninvasive method to monitor velocity and capacity of P450-dependent AP N-demethylation in infancy and childhood. According to 13 C-AP breath tests, neonates have a very low capacity to eliminate 13 CO 2 , which is only 15 to 21% of the activity in adults. During the first year of life AP N-demethylation increases to reach its maximum at about 2 years; afterwards a slight decrease occurs. In 25 neonates exposed prenatally to different antiepileptic drugs 13 C-AP breath test was efficiently used to prove that cytochrome AP N-demethylation was considerably stimulated. After primidone/phenobarbitone, especially in combination with phenytoin, 13 C elimination reaches and even surpasses the range for older children. Valproate exposure during fetal life is not consistently followed by a significant increase in AP N-demethylation. The enzyme induction demonstrated by 13 C-AP breath test was often accompanied by accelerated metabolic clearance and shortened half-life times of transplacentally acquired antiepileptic drugs. There was good agreement between 13 C-AP breath tests and pharmacokinetic data for primidone/phenobarbitone but not for phenytoin. In contrast, in the case of phenytoin exposure during pregnancy the pharmacokinetic parameters and the 13 C breath test data will transport very different informations about enzyme induction in these neonates
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Synthesis of [21-13C]-cholesterol
International Nuclear Information System (INIS)
Caballero, G.M.; Gros, E.G.
1994-01-01
The synthesis of [21- 13 C]-cholesterol from 3β-O-(t-butyldimethylsilyl)-17β-cyano-androst-5-ene is described. Labelled carbon-atom was introduced by Grignard reaction of nitrile derivative with [ 13 C]-methylmagnesium iodide. Location of label was confirmed by 13 C-NMR spectroscopy. (author)
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
International Nuclear Information System (INIS)
Wang, Jingzhu; Yang, Rui; Yang, Wenning; Liu, Xin; Xing, Yanyi; Xu, Youxuan
2014-01-01
Highlights: • 13 C labeled testosterone can be used to adjust the isotope ratio of testosterone. • The novel testosterone cannot be detected by the regular IRMS method in doping test. • A method was explored to remove the labeled 13 C. • The established method can be used to detect the manipulated testosterone. - Abstract: Isotope ratio mass spectrometry (IRMS) is applied to confirm testosterone (T) abuse by determining the carbon isotope ratios (δ 13 C value). However, 13 C labeled standards can be used to control the δ 13 C value and produce manipulated T which cannot be detected by the current method. A method was explored to remove the 13 C labeled atom at C-3 from the molecule of androsterone (Andro), the metabolite of T in urine, to produce the resultant (A-nor-5α-androstane-2,17-dione, ANAD). The difference in δ 13 C values between Andro and ANAD (Δδ 13 C Andro–ANAD , ‰) would change significantly in case manipulated T is abused. Twenty-one volunteers administered T manipulated with different 13 C labeled standards. The collected urine samples were analyzed with the established method, and the maximum value of Δδ 13 C Andro–ANAD post ingestion ranged from 3.0‰ to 8.8‰. Based on the population reference, the cut-off value of Δδ 13 C Andro–ANAD for positive result was suggested as 1.2‰. The developed method could be used to detect T manipulated with 3- 13 C labeled standards
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Canine C-peptide for characterization of experimental diabetes in dogs
International Nuclear Information System (INIS)
Fischer, U.; Besch, W.; Freyse, E.-J.
1985-01-01
Radioimmunoassay of canine C-peptide (CCP) was developed for the characterization of endogenous beta cell function in experimentally diabetic dogs. The animals were rendered diabetic by subtotal pancreatectomy and intrasurgical infusion of 2 mg/kg streptozotocin into the superior pancreaticoduodenal artery. After an average duration of diabetes of 5 months the animals showed zero peripheral venous fasting CCP levels with no response to feeding, OGTT/i.v. glucagon loading or i.v. glucose tolerance testing. The data on CCP levels entirely coincided with simultaneously measured plasma IRI levels. In non-diabetic control animals clear-cut CCP increases were observed after all stimuli. The experimental model provided an IDDM-type diabetes without toxic symptoms but with a sufficient exocrine pancreatic function. The comparison showed that plasma IRI analyses would also allow reliable characterization of insulinogenic functions in these animals. (author)
Energy Technology Data Exchange (ETDEWEB)
Suarez, C; Diaz, A; Paz, D; Jimeno, M L
1992-07-01
The main bio radioactive degradation products from catalytic hydrogen exchange of gentamicin C, (C1 + C2 + Cla) in basic form, are generated by N-demethylation in 3{sup -}N and 6-N positions. Their structures were confirmed by 1HNMR and 13CNMR. These derivatives were fractionated by chromatography on silica gel. Antibacterial activities were similar to those of the parent antibiotics. Tritium exchange, under vacuum or nitrogen, is highly increased (4:1) when gentamicin are in basic form. In contrast with gentamicin sulfate, hydrolytic sub products as gramine, genta mines, garosamine and purpurosamines are practically absent. To properly optimize the exchange process, the composition of the gentamicin C complex must be taken into account. The exchange decreases in the order C2 > C1> Cla. Because of 6'-N-demethyl gentamicin C1 is C2, the radiochemical yield of C2 appears enhanced in the H2O-3H exchange of a mixture of them. Radioactivity distribution among the components and subunits of these three gentamicin were studied by strong and mild hydrolysis, and by methanolysis. (Author) 18 refs.
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Whole-core analysis by 13C NMR
International Nuclear Information System (INIS)
Vinegar, H.J.; Tutunjian, P.N.; Edelstein, W.A.; Roemer, P.B.
1991-01-01
This paper reports on a whole-core nuclear magnetic resonance (NMR) system that was used to obtain natural abundance 13 C spectra. The system enables rapid, nondestructive measurements of bulk volume of movable oil, aliphatic/aromatic ratio, oil viscosity, and organic vs. carbonate carbon. 13 C NMR can be used in cores where the 1 H NMR spectrum is too broad to resolve oil and water resonances separately. A 5 1/4-in. 13 C/ 1 H NMR coil was installed on a General Electric (GE) CSI-2T NMR imager/spectrometer. With a 4-in.-OD whole core, good 13 C signal/noise ratio (SNR) is obtained within minutes, while 1 H spectra are obtained in seconds. NMR measurements have been made of the 13 C and 1 H density of crude oils with a wide range of API gravities. For light- and medium-gravity oils, the 13 C and 1 H signal per unit volume is constant within about 3.5%. For heavy crudes, the 13 C and 1 H density measured by NMR is reduced by the shortening of spin-spin relaxation time. 13 C and 1 H NMR spin-lattice relaxation times were measured on a suite of Cannon viscosity standards, crude oils (4 to 60 degrees API), and alkanes (C 5 through C 16 ) with viscosities at 77 degrees F ranging from 0.5 cp to 2.5 x 10 7 cp. The 13 C and 1 H relaxation times show a similar correlation with viscosity from which oil viscosity can be estimated accurately for viscosities up to 100 cp. The 13 C surface relaxation rate for oils on water-wet rocks is very low. Nonproton decoupled 13 C NMR is shown to be insensitive to kerogen; thus, 13 C NMR measures only the movable hydrocarbon content of the cores. In carbonates, the 13 C spectrum also contains a carbonate powder pattern useful in quantifying inorganic carbon and distinguishing organic from carbonate carbon
A micromethod for the assay of cellular secretory physiology: Application to rabbit parietal cells
International Nuclear Information System (INIS)
Adrian, T.E.; Goldenring, J.R.; Oddsdottir, M.; Zdon, M.J.; Zucker, K.A.; Lewis, J.J.; Modlin, I.M.
1989-01-01
A micromethod for investigating secretory physiology in isolated cells was evaluated. The method utilized a specially designed polycarbonate incubation chamber to provide constant oxygenation to cells incubating in a 96-well microtiter plate. Cells were rapidly separated from media by vacuum filtration. Isolated parietal cells were utilized to demonstrate the versatility of the method for assay of intracellular accumulation of [ 14 C]-aminopyrine, secretion of intrinsic factor into the medium, and assay of intracellular cAMP. Histamine stimulated the uptake of [ 14 C]aminopyrine and intrinsic factor secretion in a sustained and linear fashion. At the end of the 2-h period uptake of aminopyrine and secretion of intrinsic factor were increased 17- and 5-fold, respectively. This response to histamine was accompanied by a rapid and sustained 3-fold rise in intracellular cyclic AMP. In contrast, carbamylcholine caused a transient increase in [ 14 C]aminopyrine accumulation and intrinsic factor secretion which was most pronounced during the first 10 min and had almost ceased by 30 min. Carbamylcholine had no effect on intracellular cAMP levels. This new method, which can handle 400 replicates using parietal cells from the fundic mucosa of a single rabbit, is suitable for studying the time course of intracellular events which accompany general secretory processes
Tet1 and Tet2 maintain mesenchymal stem cell homeostasis via demethylation of the P2rX7 promoter.
Yang, Ruili; Yu, Tingting; Kou, Xiaoxing; Gao, Xiang; Chen, Chider; Liu, Dawei; Zhou, Yanheng; Shi, Songtao
2018-06-01
Ten-eleven translocation (Tet) family-mediated DNA oxidation represents an epigenetic modification capable of converting 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), which regulates various biological processes. However, it is unknown whether Tet family affects mesenchymal stem cells (MSCs) or the skeletal system. Here we show that depletion of Tet1 and Tet2 results in impaired self-renewal and differentiation of bone marrow MSCs (BMMSCs) and a significant osteopenia phenotype. Tet1 and Tet2 deficiency reduces demethylation of the P2rX7 promoter and downregulates exosome release, leading to intracellular accumulation of miR-297a-5p, miR-297b-5p, and miR-297c-5p. These miRNAs inhibit Runx2 signaling to impair BMMSC function. We show that overexpression of P2rX7 rescues the impaired BMMSCs and osteoporotic phenotype in Tet1 and Tet2 double knockout mice. These results indicate that Tet1 and Tet2 play a critical role in maintaining BMMSC and bone homeostasis through demethylation of P2rX7 to control exosome and miRNA release. This Tet/P2rX7/Runx2 cascade may serve as a target for the development of novel therapies for osteopenia disorders.
Wang, Jingzhu; Yang, Rui; Yang, Wenning; Liu, Xin; Xing, Yanyi; Xu, Youxuan
2014-12-10
Isotope ratio mass spectrometry (IRMS) is applied to confirm testosterone (T) abuse by determining the carbon isotope ratios (δ(13)C value). However, (13)C labeled standards can be used to control the δ(13)C value and produce manipulated T which cannot be detected by the current method. A method was explored to remove the (13)C labeled atom at C-3 from the molecule of androsterone (Andro), the metabolite of T in urine, to produce the resultant (A-nor-5α-androstane-2,17-dione, ANAD). The difference in δ(13)C values between Andro and ANAD (Δδ(13)CAndro-ANAD, ‰) would change significantly in case manipulated T is abused. Twenty-one volunteers administered T manipulated with different (13)C labeled standards. The collected urine samples were analyzed with the established method, and the maximum value of Δδ(13)CAndro-ANAD post ingestion ranged from 3.0‰ to 8.8‰. Based on the population reference, the cut-off value of Δδ(13)CAndro-ANAD for positive result was suggested as 1.2‰. The developed method could be used to detect T manipulated with 3-(13)C labeled standards. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Krividin, L.B.; Kalabin, G.A.
1985-08-10
The authors measure the direct geminal and vicinal spinspin coupling constants between the C-13 nuclei of the phenyl group in the series of alkyl phenyl sulfides C/sub 6/H/sub 5/SR. It was shown that the variation in most of the discussed constants is determined by the ratio of the planar and orthogonal conformers. Linear relationships were obtained between the C-13-C-13 constants and the fractions of the planar conformer. The C-13-C-13 spin-spin coupling constants in the planar and orthogonal conformers of the compounds were calculated by means of empirical relationships.
Directory of Open Access Journals (Sweden)
Danúbia S. Fontana
2013-02-01
Full Text Available Since the late 1970s, canine parvovirus type 2 (CPV-2 has emerged as a causative agent of fatal severe acute hemorrhagic enteritis in dogs. To date, three antigenic types of CPV-2 were described worldwide (CPV-2a/b/c. This study was conducted to determine the variants of CPV-2 circulating in dogs from the Cuiabá Municipality in Midwestern Brazil. Out of 50 fecal samples, collected between 2009 and 2011, 27 tested positive for CPV-2. A 583 bp fragment of the VP2 gene was amplified by PCR, 13 representative samples were analyzed further by DNA sequencing. All strains were characterized as CPV-2c, displayed a low genetic variability although observed several amino acid substitution. These findings indicated that CPV-2c has been circulating in dogs from the Cuiabá Municipality in Midwestern Brazil.Desde o final dos anos de 1970, o parvovírus canino tipo 2 (CPV-2 tem emergido como agente de severa e fatal enterite hemorrágica, principalmente em cães com idade inferior a seis meses. Três variantes antigênicas de CPV-2 foram descritas mundialmente (CPV-2a/b/c. O objetivo do estudo foi determinar a presença do CPV-2 e suas variantes circulantes em cães no Município de Cuiabá, Centro-oeste, Brasil. Das 50 amostras fecais, coletadas entre 2009 e 2011, 27 foram positivas para CPV-2 na PCR, sendo 13 analisadas pelo sequenciamento de um fragmento de 583 pares de base do gene VP2. Todas as cepas foram caracterizadas como CPV-2c e apresentaram baixa variabilidade genética. Estes achados indicaram que o CPV-2c está circulando na população canina do Município de Cuiabá, Região Centro-Oeste do Brasil.
International Nuclear Information System (INIS)
Suarez, C.; Diaz, A.; Paz, D.; Jimeno, M. L.
1992-01-01
The main bio radioactive degradation products from catalytic hydrogen exchange of gentamicin C, (C1 + C2 + Cla) in basic form, are generated by N-demethylation in 3 - N and 6-N positions. Their structures were confirmed by 1HNMR and 13CNMR. These derivatives were fractionated by chromatography on silica gel. Antibacterial activities were similar to those of the parent antibiotics. Tritium exchange, under vacuum or nitrogen, is highly increased (4:1) when gentamicin are in basic form. In contrast with gentamicin sulfate, hydrolytic sub products as gramine, genta mines, garosamine and purpurosamines are practically absent. To properly optimize the exchange process, the composition of the gentamicin C complex must be taken into account. The exchange decreases in the order C2 > C1> Cla. Because of 6'-N-demethyl gentamicin C1 is C2, the radiochemical yield of C2 appears enhanced in the H2O-3H exchange of a mixture of them. Radioactivity distribution among the components and subunits of these three gentamicin were studied by strong and mild hydrolysis, and by methanolysis. (Author) 18 refs
Yamanaka, Nodoka; Yamada, Taiichi; Hiyama, Emiko; Funaki, Yasuro
2017-06-01
We calculate for the first time the electric dipole moment (EDM) of 13C generated by the isovector charge conjugation-parity (CP)-odd pion exchange nuclear force in the α -cluster model, which describes well the structures of low-lying states of the 13C nucleus. The linear dependence of the EDM of 13C on the neutron EDM and the isovector CP-odd nuclear coupling is found to be d13C=-0.33 dn-0.0020 G¯π(1 ) . The linear enhancement factor of the CP-odd nuclear coupling is smaller than that of the deuteron, due to the difference of the structure between the 1 /21- state and the opposite-parity (1 /2+ ) states. We clarify the role of the structure played in the enhancement of the EDM. This result provides good guiding principles to search for other nuclei with large enhancement factor. We also mention the role of the EDM of 13C in determining the new physics beyond the standard model.
Characterization of methacetin-methoxy-"1"3C
International Nuclear Information System (INIS)
Lu Weijing; Lu Hao; Yang Weicheng; Liu Weixia; Li Shuai; Xu Zhongjie; Guan Liang; Zhu Chengmo; Chen Suyun; Jiang Lei
2010-01-01
Methacetin-methoxy-"1"3C was synthesized by using methanol-"1"3C with a novel method, and the characterization of it was performed using HPLC, LC-MS and "1HMNR. The results indicated that the synthetic was right. And the yield of methacetin-methoxy-"1"3C was 70.0% with 99% "1"3C abundance and 99.8% purity. Compared with the classical method, there was more benefit. The methacetin "1"3C-breath test was performed with the synthetic on the live mice, which showed a precise reflection of alteration of liver function in liver injury and functional recovery. (authors)
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
13C/12C ratios in human urine concrementes
International Nuclear Information System (INIS)
Hoefs, J.; Armbruster, T.
1978-01-01
Oxalate, uric acid, and phosphate stones have been analyzed for their carbon isotope composition. The oxalate stones show delta 13 C values between -17.0 and -19.5 pro mille, the uric acid stones between -14.9 and -19.4 pro mille, and the phosphate stones between -13.0 and -23.9 pro mille. It is proposed that endogenic rather than exogenic sources are responsible for the 13 C/ 12 C ratios of the stones. The isotopic composition of the phosphate stones seems to be influenced primarily by bacterial activity. (orig.) [de
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Stereoselective synthesis of L-[4-13C]carnitine
International Nuclear Information System (INIS)
Unkefer, C.J.; Ehler, D.S.
1991-01-01
The stereoselective synthesis of L-[4- 13 C]carnitine was achieved in 5 steps. The label was introduced from K 13 CN into an easily separated diastereomeric pair of 3-deoxy-D-[1- 13 C]aldohexoses. Reductive amination of the labeled aldohexose yielded the corresponding D-1-(dimethylamino)[1- 13 C]alditol which was oxidized in two steps and alkylated with iodomethane to yield L-[4- 13 C]carnitine. The stereochemical integrity at C-2 of the 3-deoxy-D-[1- 13 C]glucose precursor was maintained throughout the synthesis of L-[4- 13 C]carnitine. (author)
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M. L.; Sérandour, Aurélien A.; Carroll, Jason S.; Beaudoin, Claude; Vanacker, Jean-Marc
2017-01-01
Lysine Specific Demethylase 1 (LSD1) removes mono- and dimethyl groups from lysine 4 of histone H3 (H3K4) or H3K9, resulting in repressive or activating (respectively) transcriptional histone marks. The mechanisms that control the balance between these two antagonist activities are not understood. We here show that LSD1 and the orphan nuclear receptor estrogen-related receptor α (ERRα) display commonly activated genes. Transcriptional activation by LSD1 and ERRα involves H3K9 demethylation at the transcriptional start site (TSS). Strikingly, ERRα is sufficient to induce LSD1 to demethylate H3K9 in vitro. The relevance of this mechanism is highlighted by functional data. LSD1 and ERRα coregulate several target genes involved in cell migration, including the MMP1 matrix metallo-protease, also activated through H3K9 demethylation at the TSS. Depletion of LSD1 or ERRα reduces the cellular capacity to invade the extracellular matrix, a phenomenon that is rescued by MMP1 reexpression. Altogether our results identify a regulatory network involving a direct switch in the biochemical activities of a histone demethylase, leading to increased cell invasion. PMID:28348226
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion.
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M L; Sérandour, Aurélien A; Carroll, Jason S; Beaudoin, Claude; Vanacker, Jean-Marc
2017-04-11
Lysine Specific Demethylase 1 (LSD1) removes mono- and dimethyl groups from lysine 4 of histone H3 (H3K4) or H3K9, resulting in repressive or activating (respectively) transcriptional histone marks. The mechanisms that control the balance between these two antagonist activities are not understood. We here show that LSD1 and the orphan nuclear receptor estrogen-related receptor α (ERRα) display commonly activated genes. Transcriptional activation by LSD1 and ERRα involves H3K9 demethylation at the transcriptional start site (TSS). Strikingly, ERRα is sufficient to induce LSD1 to demethylate H3K9 in vitro. The relevance of this mechanism is highlighted by functional data. LSD1 and ERRα coregulate several target genes involved in cell migration, including the MMP1 matrix metallo-protease, also activated through H3K9 demethylation at the TSS. Depletion of LSD1 or ERRα reduces the cellular capacity to invade the extracellular matrix, a phenomenon that is rescued by MMP1 reexpression. Altogether our results identify a regulatory network involving a direct switch in the biochemical activities of a histone demethylase, leading to increased cell invasion.
International Nuclear Information System (INIS)
Ibraimi, Filiz; Kriz, Kirstin; Merin, Henrik; Kriz, Dario
2009-01-01
We describe an one-step 11-min magnetic permeability based two-site immunoassay for C-reactive protein (CRP) utilizing polyclonal anti-canine CRP antibody conjugated dextran iron oxide nanoparticles (79 nm) as superparamagnetic labels and polyclonal anti-canine CRP conjugated silica microparticles (15 to 40 μm) as carriers. An inductance based magnetic permeability reader was used to detect the target analyte, CRP, in 10 μL whole blood samples, by measuring the magnetic permeability increase of the silica microparticle sediment due to immuno complex superparamagnetic nanoparticles. Measurements on standards showed a linear response between 0 and 17.5 mg/L CRP. Measurements performed on 16 whole blood samples from mixed breeds showed good correlation with a commercially available ELISA assay.
DEFF Research Database (Denmark)
McClure, Vanessa; van Schoor, Mirinda; Thompson, Peter N.
2013-01-01
Objective-To evaluate associations of serum C-reactive protein (CRP) concentration with duration of hospitalization and with outcome in puppies with canine parvoviral enteritis. Design-Prospective observational study. Animals-79 client-owned puppies with naturally acquired canine parvovirus...... infection. Procedures-All puppies received supportive care. Serum CRP concentration was measured at the time of admission, approximately every 10 to 12 hours for the first 48 hours, and then every 24 hours until discharge from the hospital or death. Associations between outcome and CRP concentration...... at various time points or changes in CRP concentration over time were assessed via multiple logistic regression. Associations of CRP concentration with survival time and duration of hospitalization among survivors were estimated with Cox proportional hazards regression. Use of CRP concentration to predict...
Lee, Seung-Tae; Wiemels, Joseph L
2016-02-18
The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Anne Wöhlke
2011-10-01
Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.
Energy Technology Data Exchange (ETDEWEB)
Krivdin, L.B.; Shcherbakov, V.V.; Bzhezovskii, V.M.; Kalabin, G.A.
1986-10-10
The /sup 13/C-/sup 13/C spin-spin coupling constants between the carbon nuclei of the vinyl group were measured for a series of vinyl ethers. It was established that the unshared electron pairs of the oxygen atom can make a substantial stereospecific contribution to the direct /sup 13/C-/sup 13/C constants of the adjacent nuclei. The observed effect was used to establish the conformational structure of the compounds.
Luengo, Catherine; Azzout-Marniche, Dalila; Fromentin, Claire; Piedcoq, Julien; Lemosquet, Sophie; Tomé, Daniel; Gaudichon, Claire
2009-11-01
We developed a complete method to measure low [(13)C] enrichments in glycogen. Fourteen rats were fed a control diet. Six of them also ingested either [U-(13)C] glucose (n=2) or a mixture of 20 [U-(13)C] amino acids (n=4). Hepatic glycogen was extracted, digested to glucose and purified on anion-cation exchange resins. After the optimization of methylboronic acid derivatization using GC-MS, [(13)C] enrichment of extracted glucose was measured by GC-C-IRMS. The accuracy was addressed by measuring the enrichment excess of a calibration curve, which observed values were in good agreement with the expected values (R=0.9979). Corrected delta values were -15.6+/-1.6 delta(13)C (per thousand) for control rats (n=8) and increased to -5 to 8 delta(13)C (per thousand) per thousand and 12-14 delta(13)C (per thousand) per thousand after the ingestion of [U-(13)C] amino acids or [U-(13)C] glucose as oral tracers, respectively. The method enabled the determination of dietary substrate transfer into glycogen. The sequestration of dietary glucose in liver glycogen 4 h after the meal was 35% of the ingested dose whereas the transfer of carbon skeletons from amino acids was only 0.25 to 1%.
Energy Technology Data Exchange (ETDEWEB)
Martinez, Rodolfo A. (Santa Fe, NM), Unkefer; Clifford J. (Los Alamos, NM), Alvarez; Marc, A [Santa Fe, NM
2012-06-12
The present invention is directed to the labeled compounds, ##STR00001## wherein C* is each either .sup.13C and .sup.12C where at least one C* is .sup.13C, each hydrogen of the methylene group is hydrogen or deuterium, the methyl group includes either zero or three deuterium atoms, Q is sulfide, sulfinyl, or sulfone, Z is an aryl group such as 1-naphthyl, substituted 1-naphthyl, 2-naphthyl, substituted 2-naphthyl, or a phenyl group ##STR00002## wherein R.sub.1, R.sub.2, R.sub.3, R.sub.4 and R.sub.5 are each independently either hydrogen, a C.sub.1-C.sub.4 lower alkyl, a halogen, and an amino group such as NH.sub.2, NHR and NRR' where R and R' are each independently either a C.sub.1-C.sub.4 lower alkyl, a phenyl, and an alkoxy group, and the methyl group can include either zero or three deuterium atoms. The present invention is also directed to the labeled compounds ##STR00003##
Response of canine esophagus to intraoperative electron beam radiotherapy
International Nuclear Information System (INIS)
Sindelar, W.F.; Hoekstra, H.J.; Kinsella, T.J.; Barnes, M.; DeLuca, A.M.; Tochner, Z.; Pass, H.I.; Kranda, K.C.; Terrill, R.E.
1988-01-01
Tolerance of esophagus to intraoperative radiotherapy (IORT) was investigated in dogs. Thirteen adult foxhounds were subjected to right thoractomy, mobilization of the intrathoracic esophagus, and IORT to a 6 cm full-thickness esophageal segment using 9 MeV electrons at doses of 0, 2,000, or 3,000 cGy. Dogs were followed clinically and were evaluated at regular intervals after treatment with fiberoptic esophagoscopy, barium swallows, and postmortem histologic evaluations. One sham-irradiated control dog showed no abnormalities during follow-up of 24 months. Seven dogs receiving 2,000 cGy IORT showed transient mild dysphagia and mild esophagitis, but no clinically or pathologically significant complications. Five dogs receiving 3,000 cGy demonstrated severe ulcerative esophagitis within 6 weeks of treatment which progressed to chronic ulcerative esophagitis with stricture formation by 9 months following IORT. One 3,000 cGy dog died at 13 months from an esophageal perforation. On the basis of a pilot experience using 13 experimental animals, it was concluded that intact canine esophagus tolerates IORT well to doses of 2,000 cGy, but doses of 3,000 cGy pose serious and potentially lethal risks. The clinical application of IORT to the treatment of human intrathoracic neoplasms requiring esophageal irradiation should be approached with caution, particularly at doses exceeding 2,000 cGy
International Nuclear Information System (INIS)
Spudich, E.N.; Takahashi, T.; Spudich, J.L.
1989-01-01
This work demonstrates that phototaxis stimuli in the archaebacterium Halobacterium halobium control a methylation/demethylation system in vivo through photoactivation of sensory rhodopsin I (SR-I) in either its attractant or repellent signaling form as well as through the repellent receptor sensory rhodopsin II (SR-II, also called phoborhodopsin). The effects of positive stimuli that suppress swimming reversals (i.e., an increase in attractant or decrease in repellent light) and negative stimuli that induce swimming reversals (i.e., a decrease in attractant or increase in repellent light) through each photoreceptor were monitored by assaying release of volatile [3H]methyl groups. This assay has been used to measure [3H]methanol produced during the process of adaptation to chemotactic stimuli in eubacteria. In H. halobium positive photostimuli produce a transient increase in the rate of demethylation followed by a decrease below the unstimulated value, whereas negative photostimuli cause an increase followed by a rate similar to that of the unstimulated value. Photoactivation of the SR-I attractant and simultaneous photoactivation of the SR-II repellent receptors cancel in their effects on demethylation, demonstrating the methylation system is regulated by an integrated signal. Analysis of mutants indicates that the source for the volatile methyl groups is intrinsic membrane proteins distinct from the chromoproteins that share the membrane. A methyl-accepting protein (94 kDa) previously correlated in amount with the SR-I chromoprotein (25 kDa) is shown here to be missing in a recently isolated SR-I-SR-II+ mutant (Flx3b), thus confirming the association of this protein with SR-I. Photoactivated SR-II in mutant Flx3b controls demethylation, predicting the existence of a photomodulated methyl-accepting component distinct from the 94-kDa protein of SR-I
Energy Technology Data Exchange (ETDEWEB)
Suarez, C.; Diaz, A.; Paz, D.; Jimeno, M. L.
1992-07-01
The main bio radioactive degradation products from catalytic hydrogen exchange of gentamicin C, (C1 + C2 + Cla) in basic form, are generated by N-demethylation in 3{sup -}N and 6-N positions. Their structures were confirmed by 1HNMR and 13CNMR. These derivatives were fractionated by chromatography on silica gel. Antibacterial activities were similar to those of the parent antibiotics. Tritium exchange, under vacuum or nitrogen, is highly increased (4:1) when gentamicin are in basic form. In contrast with gentamicin sulfate, hydrolytic sub products as gramine, genta mines, garosamine and purpurosamines are practically absent. To properly optimize the exchange process, the composition of the gentamicin C complex must be taken into account. The exchange decreases in the order C2 > C1> Cla. Because of 6'-N-demethyl gentamicin C1 is C2, the radiochemical yield of C2 appears enhanced in the H2O-3H exchange of a mixture of them. Radioactivity distribution among the components and subunits of these three gentamicin were studied by strong and mild hydrolysis, and by methanolysis. (Author) 18 refs.
Phylodynamic and Genetic Diversity of Canine Parvovirus Type 2c in Taiwan
Directory of Open Access Journals (Sweden)
Yung-Cheng Lin
2017-12-01
Full Text Available Canine parvovirus type 2c (CPV-2c emerged in 2000 and is known for causing a more severe disease than other CPV-2 variants in puppies. In 2015, the emerging CPV-2c variant was isolated in Taiwan and it subsequently became the predominant variant. To trace the evolution of Taiwanese CPV-2c, we compared complete VP2 genes of CPV-2c from Taiwan and sequences obtained from GenBank. The evolutionary rate of CPV-2c was estimated to be 4.586 × 10−4 substitutions per site per year (95% highest posterior density (HPD was 3.284–6.076 × 10−4. The time to the most recent common ancestor (TMRCA dated to 1990 (95% HPD: 1984–1996 and 2011 (95% HPD: 2010–2013 for the CPV-2c variant and Taiwanese isolates, respectively. The CPV-2c variant isolated from Taiwan was clustered with CPV-2c from China. This phylogenetic clade began to branch off in approximately 2010 (95% HPD was 3.823–6.497. Notably, two unique mutations of Taiwanese CPV-2c were found, Q383R and P410L. In summary, this is the first report on the genome evolution of CPV-2c in Taiwan, revealing that this CPV-2c variant shares a common evolutionary origin with strains from China. The demographic history inferred by the Bayesian skyline plot showed that the effective population of CPV-2c increased until 2006 and then slowly declined until 2011.
40 CFR 721.6505 - Polymers of C13C15 oxoalcohol ethoxolates.
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Polymers of C13C15 oxoalcohol... Specific Chemical Substances § 721.6505 Polymers of C13C15 oxoalcohol ethoxolates. (a) Chemical substance... polymers of C13C15 oxoalcohol ethoxolates (PMNs P-96-950/951) are subject to reporting under this section...
A non-heme iron-mediated chemical demethylation in DNA and RNA.
Yi, Chengqi; Yang, Cai-Guang; He, Chuan
2009-04-21
DNA methylation is arguably one of the most important chemical signals in biology. However, aberrant DNA methylation can lead to cytotoxic or mutagenic consequences. A DNA repair protein in Escherichia coli, AlkB, corrects some of the unwanted methylations of DNA bases by a unique oxidative demethylation in which the methyl carbon is liberated as formaldehyde. The enzyme also repairs exocyclic DNA lesions--that is, derivatives in which the base is augmented with an additional heterocyclic subunit--by a similar mechanism. Two proteins in humans that are homologous to AlkB, ABH2 and ABH3, repair the same spectrum of lesions; another human homologue of AlkB, FTO, is linked to obesity. In this Account, we describe our studies of AlkB, ABH2, and ABH3, including our development of a general strategy to trap homogeneous protein-DNA complexes through active-site disulfide cross-linking. AlkB uses a non-heme mononuclear iron(II) and the cofactors 2-ketoglutarate (2KG) and dioxygen to effect oxidative demethylation of the DNA base lesions 1-methyladenine (1-meA), 3-methylcytosine (3-meC), 1-methylguanine (1-meG), and 3-methylthymine (3-meT). ABH3, like AlkB, works better on single-stranded DNA (ssDNA) and is capable of repairing damaged bases in RNA. Conversely, ABH2 primarily repairs lesions in double-stranded DNA (dsDNA); it is the main housekeeping enzyme that protects the mammalian genome from 1-meA base damage. The AlkB-family proteins have moderate affinities for their substrates and bind DNA in a non-sequence-specific manner. Knowing that these proteins flip the damaged base out from the duplex DNA and insert it into the active site for further processing, we first engineered a disulfide cross-link in the active site to stabilize the Michaelis complex. Based on the detailed structural information afforded by the active-site cross-linked structures, we can readily install a cross-link away from the active site to obtain the native-like structures of these complexes
Synthesis of edatrexate (2-13C-glutamate)
International Nuclear Information System (INIS)
DeGraw, J.I.; Colwell, W.T.; Jue, Thomas
1997-01-01
The experimental antitumor drug Edatrexate, labeled with 99% 13 C at the 2-position of the glutamate acid group was required for 13 C-magnetic resonance spectroscopy studies in biological media. Coupling of 2,4-diamino-4-deoxy-10-ethyl-10-deazapteroic acid with diethyl L-2- 13 C-glutamate as promoted by BOP reagent afforded Edatrexate (2- 13 C-glu) diethyl ester in 60% yield following purification by column chromatography. Saponification by aqueous NaOH in 2-methoxyethanol gave the target molecule in 44% yield or 26% overall. (author)
The C-12/C-13 abundance ratio in Comet Halley
International Nuclear Information System (INIS)
Wyckoff, S.; Lindholm, E.; Wehinger, P.A.; Peterson, B.A.; Zucconi, J.M.
1989-01-01
The individual (C-13)N rotational lines in Comet Halley are resolved using high-resolution spectra of the CN B2Sigma(+)-X2Sigma(+) (0,0) band. The observe C-12/C-13 abundance ratio excludes a site of origin for the comet near Uranus and Neptune and suggests a condensation environment quite distinct from other solar system bodies. Two theories are presented for the origin of Comet Halley. One theory suggest that the comet originated 4.5 Gyr ago in an inner Oort cloud at a heliocentric distance greater than 100 AU where chemical fractionation led to the C-13 enrichment in the CN parent molecule prior to condensation of the comet nucleus. According to the other, more plausible theory, the comet nucleus condensed relatively recently from the interstellar medium which has become enriches in C-13 and was subsequently gravitationally captured by the solar system. 107 refs
Demethylation of host-cell DNA at the site of avian retrovirus integration
Czech Academy of Sciences Publication Activity Database
Hejnar, Jiří; Elleder, Daniel; Hájková, P.; Walter, J.; Blažková, Jana; Svoboda, Jan
2003-01-01
Roč. 2003, č. 311 (2003), s. 641-648 ISSN 0006-291X Institutional research plan: CEZ:AV0Z5052915 Keywords : DNA methylation and demethylation * integration of retroviruses * gene silencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.836, year: 2003
Energy Technology Data Exchange (ETDEWEB)
Wang, Jingzhu, E-mail: wangjingzhu@chinada.cn [National Anti-Doping Laboratory, China Anti-Doping Agency, Beijing (China); Yang, Rui [Sport Science College, Beijing Sport University Beijing, Beijing (China); Yang, Wenning [School of Pharmacy, Beijing University of Chinese Medicine, Beijing (China); Liu, Xin; Xing, Yanyi; Xu, Youxuan [National Anti-Doping Laboratory, China Anti-Doping Agency, Beijing (China)
2014-12-10
Highlights: • {sup 13}C labeled testosterone can be used to adjust the isotope ratio of testosterone. • The novel testosterone cannot be detected by the regular IRMS method in doping test. • A method was explored to remove the labeled {sup 13}C. • The established method can be used to detect the manipulated testosterone. - Abstract: Isotope ratio mass spectrometry (IRMS) is applied to confirm testosterone (T) abuse by determining the carbon isotope ratios (δ{sup 13}C value). However, {sup 13}C labeled standards can be used to control the δ{sup 13}C value and produce manipulated T which cannot be detected by the current method. A method was explored to remove the {sup 13}C labeled atom at C-3 from the molecule of androsterone (Andro), the metabolite of T in urine, to produce the resultant (A-nor-5α-androstane-2,17-dione, ANAD). The difference in δ{sup 13}C values between Andro and ANAD (Δδ{sup 13}C{sub Andro–ANAD}, ‰) would change significantly in case manipulated T is abused. Twenty-one volunteers administered T manipulated with different {sup 13}C labeled standards. The collected urine samples were analyzed with the established method, and the maximum value of Δδ{sup 13}C{sub Andro–ANAD} post ingestion ranged from 3.0‰ to 8.8‰. Based on the population reference, the cut-off value of Δδ{sup 13}C{sub Andro–ANAD} for positive result was suggested as 1.2‰. The developed method could be used to detect T manipulated with 3-{sup 13}C labeled standards.
International Nuclear Information System (INIS)
Chaintreau, Alain; Fieber, Wolfgang; Sommer, Horst; Gilbert, Alexis; Yamada, Keita; Yoshida, Naohiro; Pagelot, Alain; Moskau, Detlef; Moreno, Aitor; Schleucher, Jürgen; Reniero, Fabiano; Holland, Margaret; Guillou, Claude; Silvestre, Virginie; Akoka, Serge; Remaud, Gérald S.
2013-01-01
Graphical abstract: -- Highlights: •First ring test on isotopic 13 C NMR spectrometry. •Evaluation of the intra- and inter-variability of the NMR spectrometers used. •Definition of a protocol for qualification of the performance of the spectrometer. -- Abstract: Isotopic 13 C NMR spectrometry, which is able to measure intra-molecular 13 C composition, is of emerging demand because of the new information provided by the 13 C site-specific content of a given molecule. A systematic evaluation of instrumental behaviour is of importance to envisage isotopic 13 C NMR as a routine tool. This paper describes the first collaborative study of intra-molecular 13 C composition by NMR. The main goals of the ring test were to establish intra- and inter-variability of the spectrometer response. Eight instruments with different configuration were retained for the exercise on the basis of a qualification test. Reproducibility at the natural abundance of isotopic 13 C NMR was then assessed on vanillin from three different origins associated with specific δ 13 C i profiles. The standard deviation was, on average, between 0.9 and 1.2‰ for intra-variability. The highest standard deviation for inter-variability was 2.1‰. This is significantly higher than the internal precision but could be considered good in respect of a first ring test on a new analytical method. The standard deviation of δ 13 C i in vanillin was not homogeneous over the eight carbons, with no trend either for the carbon position or for the configuration of the spectrometer. However, since the repeatability for each instrument was satisfactory, correction factors for each carbon in vanillin could be calculated to harmonize the results
Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.
Directory of Open Access Journals (Sweden)
Michelle E White
Full Text Available Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests. After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13 was evident between a region of canine chromosome 13 (CFA13 and alanine aminotransferase (ALT, explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.
Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.
White, Michelle E; Hayward, Jessica J; Stokol, Tracy; Boyko, Adam R
2015-01-01
Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS) at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests). After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13) was evident between a region of canine chromosome 13 (CFA13) and alanine aminotransferase (ALT), explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.
Caffeine demethylation measured by breath analysis in experimental liver injury in the rat
Energy Technology Data Exchange (ETDEWEB)
Schaad, H.J.; Renner, E.L.; Wietholtz, H.; Preisig, R. [University of Berne, Department of Clinical Pharmaceology, Berne (Switzerland); Arnaud, M.J. [Nestle Research Center, Nestec Ltd., Vevey (Switzerland)
1995-01-01
To assess the effect of experimental liver injury on caffeine metabolism, 1 {mu}{sup C}i/kg b.w. of [3-methyl{sup 14}C]-caffeine (together with 5 mg/kg b.w. of the cold compound) was injected i.p. to four different experimental groups and respective controls of unanesthetized male Sprague-Dawley rats. Exhaled {sup 14}CO{sub 2} was completely collected during 4 h and peak exhalation rate and fraction of dose recovered were calculated. 1/3 hepatectomy affected {sup 14}CO{sub 2} exhalation to a limited extent, decreasing solely peak exhalation rate (p<0.05 compared to sham-operated control). 2/3 hepatectomy, on the other hand, resulted in significant reduction (p<0.01) in both peak exhalation rate (by 59%) and fraction of dose recovered (by 47%), that were proportionate to the loss of liver mass (50%). End-to-side portocaval shunt led to the well-documented hepatic `atrophy`, liver weight being diminished on average to 50% within 2 weeks of surgery; however, reductions in peak exhalation rate (by 75%) and fraction of dose recovered (by 64%) were even more pronounced. Finally, 48 h bile duct ligation was equivalent to `functional 2/3 hepatectomy`, peak exhalation rate (by 65%) and fraction of dose recovered (by 56%) being markedly diminished despite increased liver weight. These results indicate that {sup 14}CO{sub 2} exhalation curves following administration of specifically labelled caffeine are quantitative indicators of acute or chronic loss of functioning liver mass. In addition, the 3-demethylation pathway appears to be particularly sensitive to the inhibitory effects of cholestasis on microsomal function. (au) (30 refs.).
Synthesis and purification of 13C labelled xanthine derivatives
International Nuclear Information System (INIS)
Boukraa, M.S.; Deruaz, D.; Bannier, A.; Desage, M.; Brazier, J.L.
1995-01-01
3-[Methyl- 13 )C]xanthine, 7-[Methyl- 13 )C]xanthine, 1,3-[Dimethyl- 13 )C 2 ]xanthine (theophylline-1,3-[ 13 )CH 3 ] 2 ), 1,7-[Dimethyl- 13 )C 2 ]xanthine (paraxanthine-1,7[ 13 )CH 3 ] 2 ), and 3,7-[Dimethyl- 13 )C 2 ]xanthine (theobromine-3,7-[ 13 )CH 3 ] 2 were synthesized by nucleophilic substitution reaction(SN 2 ) from xanthine (X) and iodomethane-[ 13 C]. The 3-isobutylparaxanthine-7-[ 13 CH 3 ] was prepared from 3-isobutyl-1-methylxanthine (IBMX). The compounds were purified by reverse phase semipreparative liquid chromatography and their chemical structure and purity verified by GC-MS. (Author)
International Nuclear Information System (INIS)
Long, A.; Leavitt, S.W.
1982-07-01
Analysis of delta 13 C in tree rings offers the potential for reconstructing changes in delta 13 C of atmospheric CO 2 , which combined with 14 C trends will be important in evaluating the past and present role of the biosphere as a net carbon dioxide source or sink. One problem with such tree-ring delta 13 C records is that in addition to changes in atmospheric delta 13 C, climatic factors may influence the isotopic composition of the rings. This study examines delta 13 C in cellulose of five-year intervals of juniper tree rings. The sampling sites were near weather stations for which climate data are readily available. delta 13 C vs winter climate relationships were derived from those sites not under the influence of local pollution sources. These relationships facilitated development of a delta 13 C record from which climate effects have been factored out. The resulting 1930-1979 delta 13 C reconstruction shows a pronounced delta 13 C decrease from 1930 to 1960 and then a post-1960 flattening of the curve. We interpret this trend as representing an increasing role of biospheric CO 2 sinks relative to sources, although other interpretations may be possible within the limits of precision of data analysis. Research with this technique is continuing with pinyon pine and dendroclimatological reconstructions to verify these results and to develop a climate-free delta 13 C chronology back to pre-industrial time
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Molecular Epidemiology of Canine Parvovirus, Europe
Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio
2007-01-01
Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097
The canine is the most important large animal model for testing novel hemophilia A(HA) treatment. It is often necessary to use canine factor VIII (cFIII) gene or protein for the evaluation of HA treatment in the canine model. However, the different biological properties between cFVIII and human FVII...
TET1 promotes cisplatin-resistance via demethylating the vimentin promoter in ovarian cancer.
Han, Xi; Zhou, Yuanyuan; You, Yuanyi; Lu, Jiaojiao; Wang, Lijie; Hou, Huilian; Li, Jing; Chen, Wei; Zhao, Le; Li, Xu
2017-04-01
The development of chemo-resistance impairs the outcome of the first line platinum-based chemotherapies for ovarian cancer. Deregulation of DNA methylation/demethylation provides a critical mechanism for the occurrence of chemo-resistance. The ten-eleven translocation (TET) family of dioxygenases including TET1/2/3 plays an important part in DNA demethylation, but their roles in cisplatin resistance have not been elucidated. Using cisplatin-sensitive and cisplatin-resistant ovarian cancer cell models, we found that TET1 was significantly upregulated in cisplatin-resistant CP70 cells compared with that in cisplatin-sensitive A2780 cells. Ectopic expression of TET1 in A2780 cells promoted cisplatin resistance and decreased cytotoxicity induced by cisplatin, while inhibition of TET1 by siRNA transfection in CP70 cells attenuated cisplatin resistance and enhanced cytotoxicity of cisplatin. Increased TET1 induced re-expression of vimentin through active DNA demethylation, and cause partial epithelial-to-mesenchymal (EMT) in A2780 cells. Contrarily, knocking down of TET1 in CP70 cells reduced vimentin expression and reversed EMT process. Immunohistochemical analysis of TET1 in human ovarian cancer tissues revealed that TET1 existed in nucleus and cytoplasm in ovarian cancer tissues. And the expression of nuclear TET1 was positively correlated with residual tumor and chemotherapeutic response. Thus, TET1 expression causes resistance to cisplatin and one of the targets of TET1 action is vimentin in ovarian cancer. © 2017 International Federation for Cell Biology.
International Nuclear Information System (INIS)
Pahl-Wostl, C.; Seelig, J.
1986-01-01
The hormonal regulation of ketogenesis in the liver of living rat has been studied noninvasively with 13 C nuclear magnetic resonance. The spatial selection for the liver was better than 90%, with extrahepatic adipose tissue contribution only a very small amount of signal. The metabolic activities of the liver were investigated by infusion of 13 C-labeled butyrate in the jugular vein of the anesthetized rat. The rate of butyrate infusion was chosen to be close to the maximum oxidative capacity of the rat liver, and the 13 C signal intensities were enhanced by using doubly labeled [1,3- 13 C]butyrate as a substrate. Different 13 C NMR spectra and hence different metabolites were observed depending on the hormonal state of the animal. The 13 C NMR studies demonstrate that even when rate of acetyl-CoA production are high, the disposal of this compound is not identical in fasted and diabetic animals. This supports previous suggestions that the redox state of the mitochondrion represents the most important factor in regulation. For a given metabolic state of the animal, different signal intensities were obtained depending on whether butyrate was labeled at C-1, C-3, or C-1,3. From the ratios of incorporation of 13 C label into the carbons of 3-hydroxybutyrate, it could be estimated that a large fraction of butyrate evaded β-oxidation to acetyl-CoA but was converted directly to acetoacetyl-CoA. 13 C-labeled glucose could be detected in vivo in the liver of diabetic rats
International Nuclear Information System (INIS)
Gopher, A.; Lapidot, A.; Vaisman, N.; Mandel, H.
1990-01-01
An inborn deficiency in the ability of aldolase B to split fructose 1-phosphate is found in humans with hereditary fructose intolerance (HFI). A stable isotope procedure to elucidate the mechanism of conversion of fructose to glucose in normal children and in HFI children has been developed. A constant infusion of D-[U- 13 C]fructose was given nasogastrically to control and to HFI children. Hepatic fructose conversion to glucose was estimated by examination of 13 C NMR spectra of plasma glucose. Significantly lower values (∼3-fold) for fructose conversion to glucose were obtained for the HFI patients as compared to the controls. A quantitative determination of the metabolic pathways of fructose conversion to glucose was derived from 13 C NMR measurement of plasma [ 13 C]glucose isotopomer populations. The finding of isotopomer populations of three adjacent 13 C atoms at glucose C-4 ( 13 C 3 - 13 C 4 - 13 C 5 ) suggests that there is a direct pathway from fructose, by-passing fructose-1-phosphate aldolase, to fructose 1,6-bisphosphate. The metabolism of fructose by fructose-1-phosphate aldolase activity accounts for only ∼50% of the total amount of hepatic fructose conversion to glucose. In view of the marked decline by 67% in synthesis of glucose from fructose in HFI subjects found in this study, the extent of [ 13 C]glucose formation from a trace amount of [U- 13 C]fructose infused into the patient can be used as a safe and noninvasive diagnostic test for inherent faulty fructose metabolism
Non-stationary (13)C-metabolic flux ratio analysis.
Hörl, Manuel; Schnidder, Julian; Sauer, Uwe; Zamboni, Nicola
2013-12-01
(13)C-metabolic flux analysis ((13)C-MFA) has become a key method for metabolic engineering and systems biology. In the most common methodology, fluxes are calculated by global isotopomer balancing and iterative fitting to stationary (13)C-labeling data. This approach requires a closed carbon balance, long-lasting metabolic steady state, and the detection of (13)C-patterns in a large number of metabolites. These restrictions mostly reduced the application of (13)C-MFA to the central carbon metabolism of well-studied model organisms grown in minimal media with a single carbon source. Here we introduce non-stationary (13)C-metabolic flux ratio analysis as a novel method for (13)C-MFA to allow estimating local, relative fluxes from ultra-short (13)C-labeling experiments and without the need for global isotopomer balancing. The approach relies on the acquisition of non-stationary (13)C-labeling data exclusively for metabolites in the proximity of a node of converging fluxes and a local parameter estimation with a system of ordinary differential equations. We developed a generalized workflow that takes into account reaction types and the availability of mass spectrometric data on molecular ions or fragments for data processing, modeling, parameter and error estimation. We demonstrated the approach by analyzing three key nodes of converging fluxes in central metabolism of Bacillus subtilis. We obtained flux estimates that are in agreement with published results obtained from steady state experiments, but reduced the duration of the necessary (13)C-labeling experiment to less than a minute. These results show that our strategy enables to formally estimate relative pathway fluxes on extremely short time scale, neglecting cellular carbon balancing. Hence this approach paves the road to targeted (13)C-MFA in dynamic systems with multiple carbon sources and towards rich media. © 2013 Wiley Periodicals, Inc.
Adoptive cancer immunotherapy using DNA-demethylated T helper cells as antigen-presenting cells
DEFF Research Database (Denmark)
Kirkin, Alexei F.; Dzhandzhugazyan, Karine N.; Guldberg, Per
2018-01-01
In cancer cells, cancer/testis (CT) antigens become epigenetically derepressed through DNA demethylation and constitute attractive targets for cancer immunotherapy. Here we report that activated CD4+ T helper cells treated with a DNA-demethylating agent express a broad repertoire of endogenous CT...... antigens and can be used as antigen-presenting cells to generate autologous cytotoxic T lymphocytes (CTLs) and natural killer cells. In vitro, activated CTLs induce HLA-restricted lysis of tumor cells of different histological types, as well as cells expressing single CT antigens. In a phase 1 trial of 25...... patients with recurrent glioblastoma multiforme, cytotoxic lymphocytes homed to the tumor, with tumor regression ongoing in three patients for 14, 22, and 27 months, respectively. No treatment-related adverse effects were observed. This proof-of-principle study shows that tumor-reactive effector cells can...
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Masuda, Tsuyoshi; Tako, Yasuhiro; Matsushita, Kensaku; Takeda, Hiroshi; Endo, Masahiro; Nakamura, Yuji; Hisamatsu, Shun'ichi
2016-09-01
The retention of 13 C in the human body after oral administration of 13 C-labeled glucose was studied in three healthy volunteer subjects to estimate the 50 year cumulative body burden for 13 C as an index of the committed dose of the radioisotope 14 C. After administration of 13 C-labeled glucose, the volunteers ingested controlled diets with a fixed number of calories for 112 d. Samples of breath and urine were collected up to 112 d after administration. Samples of feces were collected up to 14 d after administration. Hair samples were obtained at 119 d after administration and analyzed as a representative index of the rate of excretion of organic 13 C via pathways such as skin cell exfoliation and mucus secretion. All samples were analyzed for 13 C/ 12 C atomic ratio to determine the rate of excretion via each pathway. We then constructed a metabolic model with a total of four pathways (breath, urine, feces, and other) comprising seven compartments. We determined the values of the biokinetic parameters in the model by using the obtained excretion data. From 74% to 94% of the 13 C administered was excreted in breath, whereas 0.1). In addition, the dataset for one of the three subjects was markedly different from those of the other two. When we estimated the 50 year cumulative body burden for 13 C by using our model and we included non-statistically significant parameters, a considerable cumulative body burden was found in the compartments excreting to the other pathway. Although our results on the cumulative body burden of 13 C from orally administered carbon as glucose were inconclusive, we found that the compartments excreting to the other pathway had a markedly long residence time and therefore should be studied further to clarify the fate of carbon in the human body. In addition to excreta, data for serum and blood cell samples were also collected from the subjects to examine the metabolism of 13 C in human body.
12C(d,p) 13C reaction at Esub(d) = 30 MeV to the positive-parity states in 13C
International Nuclear Information System (INIS)
Ohnuma, H.; Hoshino, N.; Mikoshiba, O.
1985-07-01
The 12 C(d, p) 13 C reaction has been studied at Esub(d) = 30 MeV. All the known positive-parity states of 13 C below 10 MeV in excitation energy, including the 7/2 + and 9/2 + states, are observed in this reaction. The angular distributions for these positive-parity bound and unbound states are analyzed in CCBA frame work. The 13 C wave functions, which reproduce the resonant and non-resonant scattering of neutrons from 12 C, also give good accounts of the experimentally observed angular distributions and energy spectra of outgoing protons in the 12 C(d, p) 13 C reaction. In most cases the cross section magnitude and the angular distribution shape are primarily determined by the 0 + x j component, even if it is only a small fraction of the total wave function. An exception is the 7/2 + state, where the main contribution comes from the 2 + x dsub(5/2) component. The inclusion of the 4 + state in 12 C and the gsub(9/2) and gsub(7/2) neutron components in the n + 12 C system has very small effects on the low-spin states, but is indispensable for a good fit to the 7/2 + and 9/2 + angular distributions. The transitions to the negative-parity states, 1/2 1 - , 3/2 1 - , 5/2 - , 7/2 - and 1/2 3 - , are also observed experimentally, and analyzed by DWBA. (author)
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Excitation functions of the systems 12C+14C and 13C+12C
International Nuclear Information System (INIS)
Haindl, E.
1975-01-01
The excitation functions of the systems 12 C+ 14 C and 13 C+ 12 C are investigated for different exit channels. The excitation functions measured do not show correlated structures as in the system 12 C+ 12 C. (WL/AK) [de
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Evidence for immunisation failure in vaccinated adult dogs infected with canine parvovirus type 2c.
Decaro, Nicola; Desario, Costantina; Elia, Gabriella; Martella, Vito; Mari, Viviana; Lavazza, Antonio; Nardi, Manuela; Buonavoglia, Canio
2008-01-01
An outbreak of canine parvovirus type 2c (CPV-2c) infection in vaccinated adult dogs is reported. The disease occurred in a breeding kennel in Italy and affected 11 dogs aged between 6 months and 2.5 years, that had been repeatedly administered vaccines containing a type 2 (old type) CPV strain. CPV infection was demonstrated in all diseased dogs by an immunochromatographic test. A CPV strain was isolated from the intestinal content of a 20-month-old pregnant Bernese mountain bitch that underwent a fatal outcome. The strain was characterised as CPV-2c by means of real-time PCR assays using minor groove binder probes. The present report provides further concerns about the real efficacy of type 2-based vaccines against the antigenic variants of CPV and stresses the need for developing new vaccines prepared with the variants currently circulating in the dog population.
International Nuclear Information System (INIS)
Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko
2011-01-01
Highlights: → Genistein (GEN) is a phytoestrogen found in soy products. → GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. → GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. → A high-resolution melting assay was used to screen for epigenetic change. → We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Energy Technology Data Exchange (ETDEWEB)
Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun [Division of Cellular and Molecular Toxicology, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Muramatsu, Masaaki [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Sudo, Katsuko [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Animal Research Center, Tokyo Medical University, 6-1-1 Shinjuku, Shinjuku-ku, Tokyo 160-8402 (Japan); Sato, Noriko, E-mail: nsato.epi@tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan)
2011-08-26
Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Inference of past atmospheric delta13C and P/sub CO2/ from 13C/12C measurements in tree rings
International Nuclear Information System (INIS)
Leavitt, S.W.
1982-01-01
Carbon dioxide release from fossil-fuel burning is significant enough that we may soon experience perceptible changes in climate with important human consequences. An accurate reconstruction of past 13 C/ 12 C ratios of atmospheric CO 2 may provide key constraints on the historical activity of the biosphere as CO 2 source or sink. Tree rings appear to be a repository of this information but there is much noise in the collection of previous reconstructions, presumably associated with site selection, radial variability, choice of representative wood chemical constituent, and subtle effects of climate on fractionation. This study attempts to avoid these pitfalls and develop a 50-yr delta 13 C/sub ATM/ record from juniper trees (genus Juniperus), in fact, by taking advantage of the influence of climate on fractionation. Trees were harvested from suitable sites in close proximity to weather stations with monthly records of temperature and precipitation. The most useful relationships for at most 7 of the 10 sites were delta 13 C with December temperature or precipitation, because the coefficients were nearly constant from one interval to the next and the intercepts differed. Local pollution effects are believed responsible for the three anomalous sites. The separation of these regression lines of different intervals is interpreted as the response of the trees to the changing delta 13 C of atmospheric CO 2 so that delta 13 C/sub ATM/ curves are constructed from this spacing. The shape of the best-fit reconstruction suggests the biosphere has acted as CO 2 source to about 1965 and may now be a net sink
Xuan, X; Maeda, K; Mikami, T; Otsuka, H
1996-12-01
The gene encoding the canine herpesvirus (CHV) glycoprotein C (gC) homologue has been identified by sequence homology analyses with other well studied herpesviruses. Previously, we have identified three CHV glycoproteins, gp145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gC, a recombinant baculovirus which contains the putative CHV gC structural gene under the baculovirus polyhedrin promoter was constructed. The recombinant baculovirus expressed gC-related polypeptides (44-62 kDa), which reacted only with MAbs against CHV gp80, indicating that the previously identified CHV gp80 is the translation product of the gC gene. The baculovirus expressed gC was glycosylated and transported to the surface of infected cells. At least seven neutralizing epitopes were conserved on the gC produced in insect cells. It was found that the recombinant baculovirus infected cells adsorbed murine erythrocytes as is the case for CHV-infected cells. The hemadsorption activity was inhibited by heparin, indicating that the CHV gC binds to heparan sulfate on the surface of murine erythrocytes. Mice immunized with the recombinant gC produced strong neutralizing antibodies. Our results suggest that CHV gC produced in insect cells may be useful as a subunit vaccine to control CHV infections.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Synthesis and applications of 13C glycerol
International Nuclear Information System (INIS)
Stocking, E.; Khalsa, O.; Martinez, R.; Silks, L.A. III
1994-01-01
The authors are currently developing new synthetic routes to the various isotopomers of glycerol. Labeled glycerol is useful for 13 C enrichment of biomolecules. However, traditional methods of glycerol synthesis are not easily adapted for isotopic enrichment or have poor overall yields (12-15%). In addition, the use of glycerol for enrichment can be prohibitively expensive and its availability depends on the level of demand. The authors have developed a short de novo synthesis of [U- 13 C]glycerol from carbon dioxide (∼53% overall yield for four steps) and are currently examining the feasibility of synthesizing site-specific 13 C labeled glycerol and dihydroxyacetone (DHA) from methanol and carbon dioxide. The authors have examined the enzymatic conversion of [U- 13 C]glycerol to glyceraldehyde-3-monophosphate or dihydroxyacetone monophosphate (DHAP) with yields ranging from 25-50% (as determined by NMR spectroscopy). The authors are also pursuing the chemical conversion of 13 C labeled DHA to DHAP and the results are presented. Labeled DHAP is a possible enzymatic precursor for both labeled 2-deoxyribose and 2-deoxyribonucleic acids
Laboratory spectra of C-13 ethane
Kurtz, Joe; Reuter, Dennis C.; Jennings, Donald E.; Hillman, John J.
1991-01-01
The laboratory infrared spectrum of C-13 monosubstituted ethane has been obtained at high resolution (0.0025/cm) using the McMath Fourier transform spectrometer at Kitt Peak National Observatory in May 1990. A preliminary analysis of the nu12 rQ0 branch (substituted species) suggests that its intensity is 1.15 + or - 0.05 times stronger than the equivalent nu9 branch in the normal (C-12)2H6 species. This result leads to a correction of a previously published estimate for the C-12/C-13 ratio in the atmosphere of Jupiter from about 94 to about 106.
Huang, Z H; Gage, D A; Bieber, L L; Sweeley, C C
1991-11-15
A novel approach to the analysis of acylcarnitines has been developed. It involves a direct esterification using propyl chloroformate in aqueous propanol followed by ion-pair extraction with potassium iodide into chloroform and subsequent on-column N-demethylation of the resulting acylcarnitine propyl ester iodides. The products, acyl N-demethylcarnitine propyl esters, are volatile and are easily analyzed by gas chromatography-chemical ionization mass spectrometry. For medium-chain-length (C4-C12) acylcarnitine standards, detection limits are demonstrated to be well below 1 ng starting material using selected ion monitoring. Well-separated gas chromatographic peaks and structure-specific mass spectra are obtained with samples of synthetic and biological origin. Seven acylcarnitines have been characterized in the urine of a patient suffering from medium-chain acyl-CoA dehydrogenase deficiency.
Energy Technology Data Exchange (ETDEWEB)
Kalabin, G.A. (Siberian Branch of the Academy of Sciences of the USSR); Krivdin, L.B.; Trofimov, B.A.
1982-07-20
In order to elucidate the /sup 13/C-/sup 13/-C SSCC (spin-spin coupling constants) segment with the electronic excitations induced by the R group, a series of phenyl alkyl ethers, PhOAlk, where Alk = Me(I), Et(II), i-Pr(III), and t-Bu(IV), were studied. This series was chosen because in studying the /sup 13/C CS in monosubstituted benzenes it was observed that the intensity of the ..pi..-electron interaction of the unshared electron pairs of oxygen with the ..pi.. system of the benzene ring was practically the same in some compounds, but increased by 30% in others. This is related to the fact that the latter is characterized by an average noncoplanar conformation, with a dihedral angle between the benzene-ring plane and the C-O-C bond of approx. 45/sup 0/, whereas some compounds have an angle < 20/sup 0/. The reason for the difference is significant steric interaction of the alkyl hydrogens with the o-position of the ring. Thus, consideration of the /sup 13/C-/sup 13/C SSCC of a series of quite similar compounds, especially when compared to the whole set of such SSCC for other monosubstituted benzenes, shows that their relationship to the structure of the substituent R is extremely complex.
Probing the possibility of a C-12/C-13 galactic abundance gradient
International Nuclear Information System (INIS)
Hawkins, I.
1990-01-01
High S/N (equal to or greater than 500) observations of interstellar CH+ with the 3.0 m telescope were performed at Lick Observatory and with the 4.0 m telescope at CTIO, of the reddened, early-type stars HD 183143, HD 24432, and HD 157038 in an effort to probe the existence of a C-12/C-13 abundance gradient in our Galaxy. Previous very high quality optical observations of interstellar CH+ toward five stars within 1 kpc of the Sun have yielded a precise weighted mean C-12/C-13 isotope ratio of 43 plus or minus 4 (1 sigma) (Hawkins, Jura, and Meyer 1985; Hawkins and Jura 1987). The isotope ratios derived toward four lines of sight in the local ISM are uniform within 12 percent. The similarity among these carbon isotope ratios determined in diffuse clouds possessing different physical conditions precludes the possibility that the CH+ molecule is suffering from isotope selective effects in these regions. The precise C-12/C-13 derivable from high quality observations of (12)CH+ and (13)CH+ provide the unique opportunity to probe the homogeneity of the ISM in a large scale and the history of nucleosynthesis in our Galaxy. Since CH+ seems to be the most sensitive probe of C-12/C-13 in the diffuse ISM, observations toward more distant stars located up to 2.5 kpc from the Sun are the best way to study the possibility of a Galactic (C-12/C-13) abundance gradient. The researcher obtained 4232 angstrom data toward all three of the stars mentioned above, 3957 angstrom data toward HD 183143 and HD 157038, and 3745 angstrom data toward HD 157038. Because of the poorer quality of the HD 24432 spectrum, and its weaker CH+ absorption lines, the satellite (13)CH+ line was not detected, and thus only a lower limit on the C-12/C-13 ratio toward this star was obtained. The results obtained from careful reduction and analysis of the data toward these stars in the Northern and Southern Hemispheres are presented
SRS-sensor 13C/12C isotops measurements for detecting Helicobacter Pylori
Grishkanich, Aleksandr; Chubchenko, Yan; Elizarov, Valentin; Zhevlakov, Aleksandr; Konopelko, Leonid
2018-02-01
We developed SRS-sensor 13C/12C isotops measurements detecting Helicobacter Pylori for medical diagnostics of human health. Measuring of absolute 13C/12C isotope amount ratios allows to explore the topical problems of the modern world, alcoholic beverages and tobacco, medical diagnostics of human health. SRS method is used to measure the ratio of carbon isotopes in the exhaled carbon dioxide, which is used to diagnose the human infection of Helicobacter pylori and the influence of the Helicobacter pylori bacterium on the occurrence of gastritis, gastric and duodenal ulcers. A method for the analysis of human infection with Helicobacter pylori was developed on the basis of measurements of the ratio of 13C / 12C carbon isotopes in human exhaled air with a high level of measurement accuracy. The article reviews the work in the field of provision comparability of absolute 13C/12C isotope amount ratios in the environment and food. The analysis of the technical and metrological characteristics of traditional and perspective instruments for measuring isotope ratios is presented. The provision of comparability of absolute 13C/12C isotope amount ratios is carried by gravimetrically prepared reference standards. The key features and emerging issues are discussed.
DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model
Directory of Open Access Journals (Sweden)
Huimin eCao
2016-01-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.
Cai, Mei-Quan; Feng, Li; Zhang, Li-Qiu
2017-03-01
Aminopyrine (AMP) has been frequently detected in the aquatic environment. In this study, the transformation mechanism of AMP by free available chlorine (FAC) oxidation was investigated. The results showed that FAC reacted with AMP rapidly, and a 74% elimination was achieved for 1.30 μM AMP after 2 min at 14.08 μM FAC dose. AMP chlorination was strongly pH-dependent, and its reaction included second- and third-order kinetic processes. Three active FAC species, including chlorine monoxide (Cl 2 O), molecular chlorine (Cl 2 ), and hypochlorous acid (HOCl), were observed to contribute to AMP degradation. The intrinsic rate constants of each FAC species with neutral (AMP 0 ) and cation (AMP + ) species were obtained by kinetic fitting. Cl 2 O exhibited the highest reactivity with AMP 0 (k AMP0, Cl2O = (4.33 ± 1.4) × 10 9 M -1 s -1 ). In addition, Cl 2 showed high reactivity (10 6 -10 7 M -1 s -1 ) in the presence of chloride, compared with HOCl (k AMP+, HOCl = (5.73 ± 0.23) × 10 2 M -1 s -1 , k AMP0, HOCl = (9.68 ± 0.96) × 10 2 M -1 s -1 ). At pH 6.15 and 14.08 μM FAC dose without chloride addition, the contribution of Cl 2 O reached to the maximum (33.3%), but in the whole pH range, HOCl was the main contributor (>66.6%) for AMP degradation. The significance of Cl 2 was noticeable in water containing chloride. Moreover, 11 transformation products were identified, and the main transformation pathways included pyrazole ring breakage, hydroxylation, dehydrogenation, and halogenation. Copyright © 2016 Elsevier Ltd. All rights reserved.
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Israeli, I; Steiner, J; Segev, G; Kass, P H; Suchodolski, J S; Sattasathuchana, P; Bruchim, Y; Yudelevitch, S; Aroch, I
2012-01-01
Pepsinogens are proenzymes secreted by gastric chief cells. In humans, their serum concentrations reflect gastric mucosal morphological and functional status. To evaluate serum canine pepsinogen-A (cPG-A), C-reactive protein (CRP), and canine pancreatic lipase immunoreactivity (cPLI) concentrations in dogs with gastric dilatation-volvulus (GDV). Sixty-six dogs presented with GDV and 79 healthy controls. Blood was collected prospectively, and records retrospectively reviewed. Median cPG-A concentration was higher in GDV dogs (median, 397 μg/L; range, 37-5,410) compared to controls (median, cPG-A 304 μg/L; range, 18-848; P = .07). Mortality rate in GDV dogs was 22.7%. In nonsurvivors of GDV, median cPG-A was higher compared to survivors (median, 746 μg/L; range, 128-5,409 versus median, 346; range, 36-1,575, respectively; P = .003). The proportion of dogs with increased cPG-A increased with gastric wall damage score (P = .007). An ROC analysis of cPG-A as a predictor of death showed an area under the curve (AUC) of 0.75, higher than lactate (AUC 0.66), and corresponded to a sensitivity and specificity of 53% and 88%, respectively. CRP was increased in 48 dogs (75%), cPLI was >200 μg/L in 26 dogs (39.4%) and >400 μg/L in 12 dogs (18.2%) but both analytes had no association with outcome. Presurgical cPG-A concentration was positively and significantly associated with gastric wall lesion severity, but, based on ROC analysis, it was only a moderate outcome predictor. CRP and cPLI were commonly increased in dogs with GDV. Copyright © 2012 by the American College of Veterinary Internal Medicine.
Synthesis and applications of 13C glycerol
International Nuclear Information System (INIS)
Stocking, E.; Khalsa, O.; Martinez, R.A.; Silks, L.A. III
1994-01-01
Due in part to the use of labeled glycerol for the 13 C enrichment of biomolecules, we are currently developing new synthetic routes to various isotopomers of glycerol. Judging from our experience, traditional methods of glycerol synthesis are not easily adapted for isotopic enrichment and/or have poor overall yields (12 to 15%). Furthermore, the use of glycerol for enrichment can be prohibitively expensive and its availability is limited by the level of demand. We are presently developing a short de novo synthesis of glycerol from carbon dioxide (∼53% overall yield for four steps) and are examining the feasibility of synthesizing site-specific 13 C-labeled glycerol and dihydroxyacetone (DHA) from labeled methanol and carbon dioxide. One application of 13 C glycerol we have examined is enzymatic conversion of glycerol to glyceraldehyde-3-monophosphate or dihydroxyacetone monophosphate (DHAP) with yields ranging from 25 to 50% (as determined by NMR spectroscopy). We are also pursuing the chemical conversion of 13 C-labeled DHA to DHAP. We are especially interested in 13 C-labeled DHAP because we are investigating its use as a chemo-enzymatic precursor for both labeled 2-deoxyribose and 2-deoxyribonucleic acids
Neutron orbital radii in {sup 13} C; Radios orbitales neutronicos en {sup 13} C
Energy Technology Data Exchange (ETDEWEB)
Aguilera R, E.F.; Murillo, G.; Ramirez, J.J.; Avila, O.L. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)
1988-01-15
In this work its were carried out experimental measurements of the reaction {sup 12}C(d,p) {sup 13}C at low energy. Preliminary results of a DWBA analysis of the data are presented, and the possibility of using this reaction to obtain the orbital radius of the transferred neutron is investigated. (Author)
NMR structure analysis of uniformly 13C-labeled carbohydrates.
Fontana, Carolina; Kovacs, Helena; Widmalm, Göran
2014-06-01
In this study, a set of nuclear magnetic resonance experiments, some of them commonly used in the study of (13)C-labeled proteins and/or nucleic acids, is applied for the structure determination of uniformly (13)C-enriched carbohydrates. Two model substances were employed: one compound of low molecular weight [(UL-(13)C)-sucrose, 342 Da] and one compound of medium molecular weight ((13)C-enriched O-antigenic polysaccharide isolated from Escherichia coli O142, ~10 kDa). The first step in this approach involves the assignment of the carbon resonances in each monosaccharide spin system using the anomeric carbon signal as the starting point. The (13)C resonances are traced using (13)C-(13)C correlations from homonuclear experiments, such as (H)CC-CT-COSY, (H)CC-NOESY, CC-CT-TOCSY and/or virtually decoupled (H)CC-TOCSY. Based on the assignment of the (13)C resonances, the (1)H chemical shifts are derived in a straightforward manner using one-bond (1)H-(13)C correlations from heteronuclear experiments (HC-CT-HSQC). In order to avoid the (1) J CC splitting of the (13)C resonances and to improve the resolution, either constant-time (CT) in the indirect dimension or virtual decoupling in the direct dimension were used. The monosaccharide sequence and linkage positions in oligosaccharides were determined using either (13)C or (1)H detected experiments, namely CC-CT-COSY, band-selective (H)CC-TOCSY, HC-CT-HSQC-NOESY or long-range HC-CT-HSQC. However, due to the short T2 relaxation time associated with larger polysaccharides, the sequential information in the O-antigen polysaccharide from E. coli O142 could only be elucidated using the (1)H-detected experiments. Exchanging protons of hydroxyl groups and N-acetyl amides in the (13)C-enriched polysaccharide were assigned by using HC-H2BC spectra. The assignment of the N-acetyl groups with (15)N at natural abundance was completed by using HN-SOFAST-HMQC, HNCA, HNCO and (13)C-detected (H)CACO spectra.
Directory of Open Access Journals (Sweden)
Nick Van Laeken
Full Text Available This first-in-dog study evaluates the use of the PET-radioligand [11C]DASB to image the density and availability of the serotonin transporter (SERT in the canine brain. Imaging the serotonergic system could improve diagnosis and therapy of multiple canine behavioural disorders. Furthermore, as many similarities are reported between several human neuropsychiatric conditions and naturally occurring canine behavioural disorders, making this tracer available for use in dogs also provide researchers an interesting non-primate animal model to investigate human disorders. Five adult beagles underwent a 90 minutes dynamic PET scan and arterial whole blood was sampled throughout the scan. For each ROI, the distribution volume (VT, obtained via the one- and two- tissue compartment model (1-TC, 2-TC and the Logan Plot, was calculated and the goodness-of-fit was evaluated by the Akaike Information Criterion (AIC. For the preferred compartmental model BPND values were estimated and compared with those derived by four reference tissue models: 4-parameter RTM, SRTM2, MRTM2 and the Logan reference tissue model. The 2-TC model indicated in 61% of the ROIs a better fit compared to the 1-TC model. The Logan plot produced almost identical VT values and can be used as an alternative. Compared with the 2-TC model, all investigated reference tissue models showed high correlations but small underestimations of the BPND-parameter. The highest correlation was achieved with the Logan reference tissue model (Y = 0.9266 x + 0.0257; R2 = 0.9722. Therefore, this model can be put forward as a non-invasive standard model for future PET-experiments with [11C]DASB in dogs.
Directory of Open Access Journals (Sweden)
Zixun Chen
2017-07-01
Full Text Available Previous studies have suggested foliar δ13C generally increases with altitude. However, some observations reported no changes or even decreased trends in foliar δ13C. We noted that all the studies in which δ13C increased with elevation were conducted in the human regions, whereas those investigations in which δ13C did not vary or decreased were conducted in areas with water stress. Thus, we proposed that the pattern of increasing δ13C with elevation is not a general one, and that δ13C may remain unchanged or decrease in plants grown in arid environments. To test the hypothesis, we sampled plants along altitude gradients on the shady and sunny slopes of Mount Tianshan characterized by arid and semiarid climates. The measurements of foliar δ13C showed no altitudinal trends for the plants grown on either of the slopes. Therefore, this study supported our hypothesis. In addition, the present study addressed the effect of atmospheric pressure on plant δ13C by accounting for the effects of temperature and precipitation on δ13C. This study found that the residual foliar δ13C increased with increasing altitude, suggesting that atmospheric pressure played a negative role in foliar δ13C.
Wutzke, Klaus D; Forberger, Anke; Wigger, Marianne
2008-06-01
The aim of this study was to investigate the hepatic microsomal and mitochondrial functions by using the 13CO2-breath test in healthy subjects either before or after the consumption of red wine. Fourteen adults received [13C]methacetin and [methyl-13C]methionine together with a standardised dinner. Expired air samples were taken over 6 h. After a wash-out period, the subjects consumed 0.4 ml ethanol/kg/day together with dinner over a 10-day period. Thereafter, 13C-tracer administration was repeated under identical conditions. The 13CO2-enrichments were measured by isotope ratio mass spectrometry. The mean cumulative percentage 13C-dose recovery (CPDR) after administration of [13C]methacetin and [methyl-13C]methionine either without or with red wine consumption amounted to 38.2+/-6.3 vs. 36.3+/-6.7% (p=0.363) and 9.5+/-3.3 vs. 8.8+/-2.5% (p=0.47), respectively. Moderate alcohol consumption does not induce significant short-term changes of the microsomal and the mitochondrial functions of the human liver in healthy subjects.
Ethane's 12C/13C Ratio in Titan: Implications for Methane Replenishment
Jennings, Donald E.; Nixon, C. A.; Romani, P. N.; Bjoraker, G. L.; Sada, P. V.; Lunsford, A. W.; Boyle, R. J.; Hesman, B. E.; McCabe, G. H.
2009-01-01
As the .main destination of carbon in the destruction of methane in the atmosphere of Titan, ethane provides information about the carbon isotopic composition of the reservoir from which methane is replenished. If the amount of methane entering the atmosphere is presently equal to the amount converted to ethane, the 12C/13C ratio in ethane should be close to the ratio in the reservoir. We have measured the 12C/13C ratio in ethane both with Cassini CIRS(exp 1) and from the ground and find that it is very close to the telluric standard and outer planet values (89), consistent with a primordial origin for the methane reservoir. The lower 12C/13C ratio measured for methane by Huygens GCMS (82.3) can be explained if the conversion of CH4 to CH3 (and C2H6) favors 12C over 13C with a carbon kinetic isotope effect of 1.08. The time required for the atmospheric methane to reach equilibrium, i.e., for replenishment to equal destruction, is approximately 5 methane atmospheric lifetimes.
Genomic organization of the canine herpesvirus US region.
Haanes, E J; Tomlinson, C C
1998-02-01
Canine herpesvirus (CHV) is an alpha-herpesvirus of limited pathogenicity in healthy adult dogs and infectivity of the virus appears to be largely limited to cells of canine origin. CHV's low virulence and species specificity make it an attractive candidate for a recombinant vaccine vector to protect dogs against a variety of pathogens. As part of the analysis of the CHV genome, the authors determined the complete nucleotide sequence of the CHV US region as well as portions of the flanking inverted repeats. Seven full open reading frames (ORFs) encoding proteins larger than 100 amino acids were identified within, or partially within the CHV US: cUS2, cUS3, cUS4, cUS6, cUS7, cUS8 and cUS9; which are homologs of the herpes simplex virus type-1 US2; protein kinase; gG, gD, gI, gE; and US9 genes, respectively. An eighth ORF was identified in the inverted repeat region, cIR6, a homolog of the equine herpesvirus type-1 IR6 gene. The authors identified and mapped most of the major transcripts for the predicted CHV US ORFs by Northern analysis.
Energy Technology Data Exchange (ETDEWEB)
Chaintreau, Alain; Fieber, Wolfgang; Sommer, Horst [Firmenich SA, Corporate R and D Division, P.O. Box 239, 1211 Geneva 8 (Switzerland); Gilbert, Alexis; Yamada, Keita [Department of Environmental Chemistry and Engineering, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503 (Japan); Yoshida, Naohiro [Department of Environmental Chemistry and Engineering, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503 (Japan); Earth-Life Science Institute, Tokyo Institute of Technology, Meguro, Tokyo 152-8551 (Japan); Pagelot, Alain [Bruker Biospin SAS, 34 rue de l‘Industrie, 67166 Wissembourg Cedex (France); Moskau, Detlef; Moreno, Aitor [Bruker Biospin AG, Industriestrasse 26, 8117 Fällanden (Switzerland); Schleucher, Jürgen [Department of Medical Biochemistry and Biophysics, Umeå University, S-90187 Umeå (Sweden); Reniero, Fabiano; Holland, Margaret; Guillou, Claude [European Commission, Joint Research Centre – Institute for Health and Consumer Protection, via E. Fermi 2749, I-21027 Ispra (Italy); Silvestre, Virginie; Akoka, Serge [EBSI team, Interdisciplinary Chemistry: Synthesis, Analysis, Modelling (CEISAM), University of Nantes-CNRS UMR 6230, 2 rue de la Houssinière, BP 92208, F-44322 Nantes cedex 3 (France); Remaud, Gérald S., E-mail: gerald.remaud@univ-nantes.fr [EBSI team, Interdisciplinary Chemistry: Synthesis, Analysis, Modelling (CEISAM), University of Nantes-CNRS UMR 6230, 2 rue de la Houssinière, BP 92208, F-44322 Nantes cedex 3 (France)
2013-07-25
Graphical abstract: -- Highlights: •First ring test on isotopic {sup 13}C NMR spectrometry. •Evaluation of the intra- and inter-variability of the NMR spectrometers used. •Definition of a protocol for qualification of the performance of the spectrometer. -- Abstract: Isotopic {sup 13}C NMR spectrometry, which is able to measure intra-molecular {sup 13}C composition, is of emerging demand because of the new information provided by the {sup 13}C site-specific content of a given molecule. A systematic evaluation of instrumental behaviour is of importance to envisage isotopic {sup 13}C NMR as a routine tool. This paper describes the first collaborative study of intra-molecular {sup 13}C composition by NMR. The main goals of the ring test were to establish intra- and inter-variability of the spectrometer response. Eight instruments with different configuration were retained for the exercise on the basis of a qualification test. Reproducibility at the natural abundance of isotopic {sup 13}C NMR was then assessed on vanillin from three different origins associated with specific δ{sup 13}C{sub i} profiles. The standard deviation was, on average, between 0.9 and 1.2‰ for intra-variability. The highest standard deviation for inter-variability was 2.1‰. This is significantly higher than the internal precision but could be considered good in respect of a first ring test on a new analytical method. The standard deviation of δ{sup 13}C{sub i} in vanillin was not homogeneous over the eight carbons, with no trend either for the carbon position or for the configuration of the spectrometer. However, since the repeatability for each instrument was satisfactory, correction factors for each carbon in vanillin could be calculated to harmonize the results.
IMPROVED LINE DATA FOR THE SWAN SYSTEM 12C13C ISOTOPOLOGUE
International Nuclear Information System (INIS)
Ram, Ram S.; Brooke, James S. A.; Bernath, Peter F.; Sneden, Christopher; Lucatello, Sara
2014-01-01
We present new, accurate predictions for rotational line positions, excitation energies, and transition probabilities of the 12 C 13 C isotopologue Swan d 3 Π-a 3 Π system 0-0, 0–1, 0–2, 1–0, 1–1, 1–2, 2–0, 2–1, and 2–2 vibrational bands. The line positions and energy levels were predicted through new analyses of published laboratory data for the 12 C 13 C lines. Transition probabilities were derived from recent computations of transition dipole moments and related quantities. The 12 C 13 C line data were combined with similar data for 12 C 2, reported in a companion paper, and applied to produce synthetic spectra of carbon-rich metal-poor stars that have strong C 2 Swan bands. The matches between synthesized and observed spectra were used to estimate band head positions for a few of the 12 C 13 C vibrational bands and to verify that the new computed line data match observed spectra. The much weaker C 2 lines of the bright red giant Arcturus were also synthesized in the band head regions
Grozdanic, Sinisa D; Kecova, Helga; Lazic, Tatjana
2013-09-01
To develop fast and reliable testing routines for diagnosing retina and optic nerve diseases in canine cataract patients based on chromatic properties of the pupillary light reflex response. Seventy-seven canine patients with a history of cataract and decreased vision (43 patients with cataracts and no evidence of retina or optic nerve disease, 21 patients with cataracts and retinal degeneration [RD], 13 patients with cataracts and retinal detachment [RDT]), 11 canine patients with optic neuritis (ON) and 23 healthy dogs were examined using chromatic pupillary light reflex (cPLR) analysis with red and blue light and electroretinography. Electroretinography analysis showed statistically significant deficits in a- and b-wave amplitudes in dogs with cataracts and RD, or cataracts and RDT, when compared to dogs with cataracts without evidence of retinal abnormalities. Evaluation of b-wave amplitudes showed that presence of 78.5-μV (or lower) amplitudes had high sensitivity of 100% (95% CI: 87.2-100%) and high specificity of 96.7% (95% CI: 88.4-100%) in RD and RDT. Evaluation of cPLR responses using red light showed that presence of the pupil end constriction diameter of 5.5 mm (or higher) had moderately high sensitivity of 76.5% (95% CI: 50.1-93.2%) and high specificity of 100% (95% CI: 91.2-100%) in detecting RD and RDT. Optic neuritis patients had absent cPLR responses, regardless of the visual status. Chromatic evaluation of the pupillary light reflex is a rapid and accurate test for diagnosing retina and optic nerve diseases in canine patients. © 2012 American College of Veterinary Ophthalmologists.
Moran, Nancy E.; Rogers, Randy B.; Lu, Chi-Hua; Conlon, Lauren E.; Lila, Mary Ann; Clinton, Steven K.; Erdman, John W.
2013-01-01
While putative disease-preventing lycopene metabolites are found in both tomato (Solanum lycopersicum) products and in their consumers, mammalian lycopene metabolism is poorly understood. Advances in tomato cell culturing techniques offer an economical tool for generation of highly-enriched 13C-lycopene for human bioavailability and metabolism studies. To enhance the 13C-enrichment and yields of labeled lycopene from the hp-1 tomato cell line, cultures were first grown in 13C-glucose media for three serial batches and produced increasing proportions of uniformly labeled lycopene (14.3 +/− 1.2 %, 39.6 +/− 0.5 %, and 48.9 +/− 1.5% with consistent yields (from 5.8 to 9 mg/L). An optimized 9-day-long 13C-loading and 18-day-long labeling strategy developed based on glucose utilization and lycopene yields, yielded 13C-lycopene with 93% 13C isotopic purity, and 55% of isotopomers were uniformly labeled. Furthermore, an optimized acetone and hexane extraction led to a four-fold increase in lycopene recovery from cultures compared to a standard extraction. PMID:23561155
Energy Technology Data Exchange (ETDEWEB)
Okamoto, K.; Tsukada, Y. [Toshiba Corp., Tokyo (Japan)
1998-10-10
Carbon-13 magnetic resonance spectroscopy ({sup 13}C-MRS) and research and development efforts for brain metabolism measurement are described. Brain metabolism is a process characterized in that it not only extracts energy by disintegrating grape sugar that is the practically sole source of energy into H2O, CO2, etc., but also vigorously synthesizes amino acids that perform important functions in neural transmission, such as glutamic acid, glutamine, and {gamma}-amino acid. MRS is a technique that utilizes the magnetic resonance, which is generated when an atomic nucleus with a spin is placed in a magnetic field, for the isolation and identification of chemicals in a living body through examining the delicate difference in the magnetic resonance frequencies of the nuclei under observation. Since the signals from {sup 13}C are low in intensity as compared with those from other nuclides, a method was contrived around 1980, which observes {sup 1}H combined with {sup 13}C in grape sugar and amino acids, named the HSQC (heteronuclear single quantum coherence) method. The author et al., combining gradient magnetic pulses with HSQC, actually measure Homo sapiens brain metabolism using {sup 13}C-MRS, and now believe that the technology will be put to practical application. 7 refs., 10 figs., 1 tab.
Automated 13CO2 analyzing system for the 13C breath test
International Nuclear Information System (INIS)
Suehiro, Makiko; Kuroda, Akira; Maeda, Masahiro; Hinaga, Kou; Watanabe, Hiroyuki.
1987-01-01
An automated 13 CO 2 analyzing system for the 13 C breath test was designed, built and evaluated. The system, which was designed to be controlled by a micro-computer, includes CO 2 purification, 13 CO 2 abundance measurement, data processing and data filing. This article gives the description of the whole system with flow charts. This system has proved to work well and it has become feasible to dispose of 5 to 6 CO 2 samples per hour. With such a system, the 13 C breath test will be carried out much more easily and will obtain much greater popularity. (author)
Molecular characterization of canine parvovirus in Vientiane, Laos.
Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn
2017-05-01
The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.
Potential hazard of zoonotic parasites present in canine feces in Puerto Escondido, Oaxaca
Directory of Open Access Journals (Sweden)
León Vélez-Hernández
2014-11-01
Full Text Available Objective. To estimate the zoonotic parasites prevalence in feral dog feces in Puerto Escondido. Material and methods. The fecalism frecuency was estimated in ten zones. To identify the parasites parasitological flotation and direct smear methods were used. The parasitic prevalence was estimated in the canine feces. Results. All the zones presented canine fecalism. The parasitic prevalence in the feces was 73.33%. The parasites with the highest prevalence were Toxocara canis (47.78%, Ancylostoma caninum (17.88%, and Dipylidium caninum (13.89%. Conclusion. Canine fecalism comes from strayed and owned dogs. 66.66% of the parasites found in the dog feces are zoonotics. The factors associated to this problem are the suburban habitat, waste mishandling and nil tenure of stray dogs.
Canine urothelial carcinoma: genomically aberrant and comparatively relevant.
Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M
2015-06-01
Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes
Li, Shizhe; An, Li; Yu, Shao; Ferraris Araneta, Maria; Johnson, Christopher S; Wang, Shumin; Shen, Jun
2016-03-01
Carbon-13 ((13)C) MR spectroscopy (MRS) of the human brain at 7 Tesla (T) may pose patient safety issues due to high radiofrequency (RF) power deposition for proton decoupling. The purpose of present work is to study the feasibility of in vivo (13)C MRS of human brain at 7 T using broadband low RF power proton decoupling. Carboxylic/amide (13)C MRS of human brain by broadband stochastic proton decoupling was demonstrated on a 7 T scanner. RF safety was evaluated using the finite-difference time-domain method. (13)C signal enhancement by nuclear Overhauser effect (NOE) and proton decoupling was evaluated in both phantoms and in vivo. At 7 T, the peak amplitude of carboxylic/amide (13)C signals was increased by a factor of greater than 4 due to the combined effects of NOE and proton decoupling. The 7 T (13)C MRS technique used decoupling power and average transmit power of less than 35 watts (W) and 3.6 W, respectively. In vivo (13)C MRS studies of human brain can be performed at 7 T, well below the RF safety threshold, by detecting carboxylic/amide carbons with broadband stochastic proton decoupling. © 2015 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Putnik, Milica, E-mail: milica.putnik@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden); Zhao, Chunyan, E-mail: chunyan.zhao@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden); Gustafsson, Jan-Ake, E-mail: jan-ake.gustafsson@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden); Department of Biology and Biochemistry, Science and Engineering Research Center Bldg, University of Houston, Houston, TX 77204-5056 (United States); Dahlman-Wright, Karin, E-mail: karin.dahlman-wright@ki.se [Department of Biosciences and Nutrition, Novum, Karolinska Institutet, Huddinge S-14183 (Sweden)
2012-09-14
Highlights: Black-Right-Pointing-Pointer Estrogen signaling and demethylation can both control gene expression in breast cancers. Black-Right-Pointing-Pointer Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. Black-Right-Pointing-Pointer 137 genes are influenced by both 17{beta}-estradiol and demethylating agent 5-aza-2 Prime -deoxycytidine. Black-Right-Pointing-Pointer A set of genes is identified as targets of both estrogen signaling and demethylation. Black-Right-Pointing-Pointer There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17{beta}-estradiol (E2) and a demethylating agent 5-aza-2 Prime -deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of
International Nuclear Information System (INIS)
Putnik, Milica; Zhao, Chunyan; Gustafsson, Jan-Åke; Dahlman-Wright, Karin
2012-01-01
Highlights: ► Estrogen signaling and demethylation can both control gene expression in breast cancers. ► Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. ► 137 genes are influenced by both 17β-estradiol and demethylating agent 5-aza-2′-deoxycytidine. ► A set of genes is identified as targets of both estrogen signaling and demethylation. ► There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17β-estradiol (E2) and a demethylating agent 5-aza-2′-deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment
de Scally, M P; Leisewitz, A L; Lobetti, R G; Thompson, P N
2006-12-01
Pigmented serum, usually due to free haemoglobin and/or bilirubin, is a common finding in dogs with babesiosis, resulting in interference with all biochemical tests that rely on photochemistry. This is particularly true of urea and creatinine determinations, complicating the diagnosis of acute renal failure, which is a serious complication of babesiosis. A disproportionately raised serum urea concentration of unknown origin occurs in severely anaemic canine babesiosis patients and gives rise to an increased serum urea:creatinine ratio. The assay for cystatin-C, an excellent measure of glomerular filtration rate, is unaffected by free serum haemoglobin, and due to its different intrinsic origins, is free of influence by the metabolic derangements and organ pathology, other than renal disease, encountered in canine babesiosis. Serum cystatin-C was used to compare the concentrations of serum urea and serum creatinine in dogs with the severely anaemic form of canine babesiosis as well as a canine babesiosis-free reference group. Mean serum urea and mean serum urea:creatinine ratio were significantly elevated in the babesia-infected group relative to the reference population in this study. Mean serum creatinine and mean serum cystatin-C were within the reference ranges. Therefore an elevated urea:creatinine ratio in canine babesiosis in the presence of a normal serum creatinine concentration is considered to be caused by an elevated serum urea concentration and is most likely of non-renal origin. Serum creatinine was therefore as specific a measure of renal function as serum cystatin-C in canine babesiosis in this study. The sensitivity of serum creatinine as a measure of renal function was not established by this study. Serum urea, however, proved to be of little use compared to serum cystatin-C and serum creatinine. Serum urea should therefore not be used to diagnose renal failure in canine babesiosis.
13C-NMR assignment, structure, and dynamics of deoxyoligonucleotides
International Nuclear Information System (INIS)
Zanatta, N.; Borer, P.N.; Levy, G.C.
1986-01-01
The unique spectral properties of 13 C-NMR for studying nucleic acids and some of the important features of 13 C-NMR in oligonucleotide studies are demostrated. The main difficulty in studying oligonucleotides by 13 C-NMR and recent improvements in NMR instrumentation and advances in oligonucleotide synthesis are presented. The high resolution 13 C-NMR spectra, T 1 relaxation times and NOEs were measured for duplex of the self-complementary oligo-DNAs: d(CG) 3 and d(GGTATACC) are studied. The target of this study is to developed a systematic 13 C-NMR spectral assignment and to investigate the structure and dynamics of these two sequences by this techniques. (M.J.C.) [pt
Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia
2012-11-04
To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P vaccine.
Suzuki, Toshikazu; Farrar, Jason E; Yegnasubramanian, Srinivasan; Zahed, Muhammed; Suzuki, Nobuo; Arceci, Robert J
2008-09-01
Demethylation of 5-methylcytosine in genomic DNA is believed to be one of the mechanisms underlying replicative life-span of mammalian cells. Both proliferation associated SNF2-like gene (PASG, also termed Lsh) and DNA methyltransferase 3B (Dnmt3b) knockout mice result in embryonic genomic hypomethylation and a replicative senescent phenotype. However, it is unclear whether gradual demethylation of DNA during somatic cell division is directly involved in senescence. In this study, we retrovirally transduced TIG-7 human fibroblasts with a shRNA against PASG and compared the rate of change in DNA methylation as well as the replicative life-span to control cells under low (3%) and ambient (20%) oxygen. Expression of PASG protein was decreased by approximately 80% compared to control cells following transduction of PASG shRNA gene. The rate of cell growth was the same in both control and PASG-suppressed cells. The rate of demethylation of DNA was significantly increased in PASG-suppressed cells as compared control cells. However, decreased PASG expression did not shorten the replicative life-span of TIG-7 cells. Culture under low oxygen extended the life-span of TIG-7 cells but did not alter the rate of DNA demethylation. While knockout of PASG during development results in genomic hypomethylation and premature senescence, our results show that while downregulation of PASG expression in a somatic cell also leads to DNA hypomethylation, there is no associated senescent phenotype. These results suggest differences in cellular consequences of hypomethylation mediated by PASG during development compared to that in somatic cells.
Synthesis of {sup 14}C-labeled levamisole and {sup 13}C-labeled tetramisole
Energy Technology Data Exchange (ETDEWEB)
Feil, V.J. [US Department of Agriculture, Agricultural Research Service, Biosciences Research Lab., Fargo, ND (United States)
1996-12-01
The syntheses of {sup 14}C-ring labeled levamisole ([-]-2,3,5,6-tetrahydro-6-phenyl [{sup 14}C]-UL imidazo[2,1-b]thiazole) from acetophenone-ring-UL-{sup 14}C in 5 steps plus resolution with a 7.5% overall yield, and {sup 13}C{sub 6}-ring labeled tetramisole ([{+-}]-2,3,5,6-tetrahydro-6-phenyl [{sup 13}C{sub 6}]imidazo[2,1-b]thiazole) from benzene-{sup 13}C{sub 6} in 6 steps with a 9.0% overall yield are described. (author).
DEFF Research Database (Denmark)
Vistisen, Bodil; Høy, Carl-Erik
2004-01-01
the transport of dietary C-13-labelled fatty acids in rat plasma to compare the chylomicron fatty acid metabolism after administration of specific structured, long chain and medium chain triacylglycerols. Rats were fed ML*M, M*LM*, L*L*L* or M*M*M* (L=linoleic acid, 18:2n-6, M=caprylic acid, 8:0, * = C-13......-labelled fatty acid) by gavage. A maximum transport of 0.5% of the administered C-13-labelled 18:2n-6 was observed in 1mL rat plasma both after administration of L*L*L* and ML*M, while approximately 0.04% of the administered C-13-labelled 8:0 was detected in 1mL plasma following administration of M......*M*M* or M*LM*. After L*L*L* administration C-13-labelled 20:4n-6 was observed in plasma, probably formed by elongation and desaturation of 18:2n-6 in the enterocyte or liver cells. Furthermore, C-13-labelled 16:0, 48:0, 18: 1n-9 and 20:4n-6 were observed in plasma of rats fed M*M*M* and M*LM* due...
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Site-selective 13C labeling of proteins using erythrose
International Nuclear Information System (INIS)
Weininger, Ulrich
2017-01-01
NMR-spectroscopy enables unique experimental studies on protein dynamics at atomic resolution. In order to obtain a full atom view on protein dynamics, and to study specific local processes like ring-flips, proton-transfer, or tautomerization, one has to perform studies on amino-acid side chains. A key requirement for these studies is site-selective labeling with 13 C and/or 1 H, which is achieved in the most general way by using site-selectively 13 C-enriched glucose (1- and 2- 13 C) as the carbon source in bacterial expression systems. Using this strategy, multiple sites in side chains, including aromatics, become site-selectively labeled and suitable for relaxation studies. Here we systematically investigate the use of site-selectively 13 C-enriched erythrose (1-, 2-, 3- and 4- 13 C) as a suitable precursor for 13 C labeled aromatic side chains. We quantify 13 C incorporation in nearly all sites in all 20 amino acids and compare the results to glucose based labeling. In general the erythrose approach results in more selective labeling. While there is only a minor gain for phenylalanine and tyrosine side-chains, the 13 C incorporation level for tryptophan is at least doubled. Additionally, the Phe ζ and Trp η2 positions become labeled. In the aliphatic side chains, labeling using erythrose yields isolated 13 C labels for certain positions, like Ile β and His β, making these sites suitable for dynamics studies. Using erythrose instead of glucose as a source for site-selective 13 C labeling enables unique or superior labeling for certain positions and is thereby expanding the toolbox for customized isotope labeling of amino-acid side-chains.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Synthesis and characterization of "1"3C_3-tristearin
International Nuclear Information System (INIS)
Wu Hangyu; Lin Lin; Li Lei; Chen Dazhou
2011-01-01
A highly efficient synthesis of "1"3C_3 labeled triglycerides of stearic acids from "1"3C_3-glycerol and stearic acids, by immobilized lipase-catalyzed in solvent-free medium was described. The structure of the product were characterized by fourier transform infrared spectrum (FT-IR), nuclear magnetic resonance (NMR), mass spectra (MS). The results showed that triglycerides of stearic acids contained three "1"3C atoms. The isotope abundance of "1"3C_3-tristearin was more than 99% and the yield was 80% of "1"3C_3-tristearin through calculation. Chemical purity (> 98%) was obtained by differential scanning calorimetry (DSC). (authors)
International Nuclear Information System (INIS)
Cohen, S.M.
1987-01-01
The metabolism of 13 C-labeled substrates was followed by 13 C and 31 P NMR in perfused liver from the streptozotocin-treated rat model of insulin-dependent diabetes. Comparison was made with perfused liver from untreated littermates, fasted either 24 or 12 h. The major routes of pyruvate metabolism were followed by a 13 C NMR approach that provided for the determination of the metabolic fate of several substances simultaneously. The rate of gluconeogenesis was 2-4-fold greater and β-hydroxybutyrate production was 50% greater in liver from the chronically diabetic rats as compared with the control groups. Large differences in the distribution of 13 C label in hepatic alanine were measured between diabetic and control groups. The biosyntheses of 13 C-labeled glutathione and N-carbamoylaspartate were monitored in time-resolved 13 C NMR spectra of perfused liver. Assignments for the resonances of glutathione and N-carbamoylaspartate were made with the aid of 13 C NMR studies of perchloric acid extracts of the freeze-clamped livers. 13 C NMR spectroscopy of the perfusates provided a convenient, rapid assay of the rate of oxidation of [2- 13 C]ethanol, the hepatic output of [2- 13 ]acetaldehyde, and the accumulation of [2- 13 C]acetate in the perfusate. By 31 P NMR spectroscopy, carbamoyl phosphate was measured in all diabetic livers and an unusual P,P'-diesterified pyrophosphate was observed in one-fourth of the diabetic livers examined. Neither of these phosphorylated metabolites was detected in control liver. Both 13 C and 31 P NMR were useful in defining changes in hepatic metabolism in experimental diabetes
Mucedero, M; Pezzuto, C; Rozzi, M; Ricchiuti, M R; Cozza, P
2016-01-01
Young adult patient treated for impaction of two maxillary canines. C.S., 15 years, female. Diagnostic evaluation by clinical and radiographic examinations shows permanent dentition with persistence of 5.3 and 6.3, impaction of 1.3 and 2.3, dento-skeletal Cl I malocclusion, normodivergence of bone bases. Analysis of TC dentalscan confirms the palatal impaction of 1.3 and 2.3. The treatment plan provided an orthodontic-surgical approach for adequate space management in dental arch, evaluation of eruption movements, choice of anchorage device, surgical exposure and application of the brackets. Deciduous canines have been extracted and an edgewise appliance with rigid rectangular full thickness archwires has been used to align the arches and to obtain maximum anchorage during the forced traction. The surgical phase, for exposure of 1.3 and 2.3 respectively, performed an open technique by excisional uncovering and a close technique by a repositioned flap. The case has been finalized for the achievement of the right occlusal keys. The possibility to choose the surgical technique depending on the intraosseous position of impacted teeth in association to the edgewise therapy with full thickness arches allows to realize an effectiveness surgical-orthodontic approach for the forced traction of impacted teeth in a favourable position.
DEFF Research Database (Denmark)
Junghans, Peter; Larsson, Caroline; Jensen, Rasmus Bovbjerg
2015-01-01
2 production calculated by the (13)C-BM, RaCO2((13)C) is compared to the result from the indirect calorimetry, RCO2(IC). In an interspecies comparison (dog, goat, horse, cattle, children, adult human; body mass ranging from 15 to 350 kg, resting and fasting conditions) we found an excellent...
International Nuclear Information System (INIS)
Siegel, R.; Stos, W.; Dyras, M.; Urbanik, A.; Wojciechowski, W.; Sztuk, S.
2009-01-01
Background: The relations of the crowns of impacted maxillary canines and the roots of adjacent incisors are difficult to evaluate on conventional radiographs due to superimposition of shadows of these structures. The aim of this study was to analyse the relations between the crowns of impacted canines and the roots of adjacent incisors with the use of computed tomography. Material/Methods: The study involved a group of 65 patients suspicious for an impacted maxillary permanent canine. All the patients underwent pantomography. In 44 individuals in the age of 13-31 years (mean age 17.1 ± 4.5) the examination revealed shadows of the impacted crowns superimposed on the roots of incisors. These patients were subjected to CT. On the basis of those CT examinations (including multiplanar and three-dimensional reconstructions) we defined the location of the impacted canines as buccal, palatal and horizontal. Likewise, the relations between the crowns of impacted canines and the roots of lateral or/and central incisors were studied. Results: From among 54 impacted maxillary canines, 41 (75.9%) were located palatally, 10 (18.5%) buccally, and 3 (5.6%) horizontally. In 14 cases (29.5%), the impacted canine remained in various kind of contact with both adjacent incisors. In addition to those aforementioned 14 cases, the impacted maxillary canine remained in contact with adjacent root of the lateral incisor in 34 cases (in total: 48 cases of contact). We found 17 cases (35.4%) of adherence without features of root resorption and 31 cases (64.4%) of resorption. Among the cases of resorption, there were 18 instances of deep resorption (58.1%) and 13 instances of light resorption (41.9%). There were also 18 cases (33.3%) of contact between the impacted canine and the root of the central incisor, including 10 instances (55.6%) of adjacency without root resorption and 8 cases (44.4%) of resorption. Conclusions: Computed tomography allows for a precise localisation of the impacted
Characterization of Canine parvovirus 2 variants circulating in Greece.
Ntafis, Vasileios; Xylouri, Eftychia; Kalli, Iris; Desario, Costantina; Mari, Viviana; Decaro, Nicola; Buonavoglia, Canio
2010-09-01
The aim of the present study was to characterize Canine parvovirus 2 (CPV-2) variants currently circulating in Greece. Between March 2008 and March 2009, 167 fecal samples were collected from diarrheic dogs from different regions of Greece. Canine parvovirus 2 was detected by standard polymerase chain reaction, whereas minor groove binder probe assays were used to distinguish genetic variants and discriminate between vaccine and field strains. Of 84 CPV-2-positive samples, 81 CPV-2a, 1 CPV-2b, and 2 CPV-2c were detected. Vaccine strains were not detected in any sample. Sequence analysis of the VP2 gene of the 2 CPV-2c viruses revealed up to 100% amino acid identity with the CPV-2c strains previously detected in Europe. The results indicated that, unlike other European countries, CPV-2a remains the most common variant in Greece, and that the CPV-2c variant found in Europe is also present in Greece.
Directory of Open Access Journals (Sweden)
Joselli S Silva
Full Text Available Visceral leishmaniasis is associated with atrophy and histological disorganization of splenic compartments. In this paper, we compared organized and disorganized splenic lymphoid tissue from dogs naturally infected with Leishmania infantum assessing the size of the white pulp compartments, the distribution of T, B and S100+ dendritic cells, using immunohistochemistry and morphometry and the expression of CCR7 and the cytokines, CXCL13, lymphotoxin (LT-α, LT-β, CCL19, CCL21, TNF-α, IL-10, IFN-γ and TGF-β, using by real time RT-PCR. The lymphoid follicles and marginal zones were smaller (3.2 and 1.9 times, respectively; Mann-Whitney, P<0.02 in animals with disorganized splenic tissue in comparison to those with organized splenic lymphoid tissue. In spleens with disorganized lymphoid tissue, the numbers of T cells and S100+ dendritic cells were decreased in the follicles, and the numbers of B cells were reduced in both the follicles and marginal zones. CXCL13 mRNA expression was lower in animals with disorganized lymphoid tissue (0.5±0.4 compared to those with organized lymphoid tissue (2.7±2.9, both relative to 18S expression, P = 0.01. These changes in the spleen were associated with higher frequency of severe disease (7/12 in the animals with disorganized than in animals with organized (2/13, Chi-square, P = 0.01 splenic lymphoid tissue. The data presented herein suggest that natural infection with Leishmania infantum is associated with the impairment of follicular dendritic cells, CXCL13 expression, B cell migration and germinal center formation and associates these changes with severe clinical forms of visceral leishmaniasis. Furthermore the fact that this work uses dogs naturally infected with Leishmania infantum emphasizes the relevance of the data presented herein for the knowledge on the canine and human visceral leishmaniasis.
The 12C/ 13C isotopic ratio in Titan hydrocarbons from Cassini/CIRS infrared spectra
Nixon, C. A.; Achterberg, R. K.; Vinatier, S.; Bézard, B.; Coustenis, A.; Irwin, P. G. J.; Teanby, N. A.; de Kok, R.; Romani, P. N.; Jennings, D. E.; Bjoraker, G. L.; Flasar, F. M.
2008-06-01
We have analyzed infrared spectra of Titan recorded by the Cassini Composite Infrared Spectrometer (CIRS) to measure the isotopic ratio 12C/ 13C in each of three chemical species in Titan's stratosphere: CH 4, C 2H 2 and C 2H 6. This is the first measurement of 12C/ 13C in any C 2 molecule on Titan, and the first measurement of 12CH 4/ 13CH 4 (non-deuterated) on Titan by remote sensing. Our spectra cover five widely-spaced latitudes, 65° S to 71° N and we have searched for both latitude variability of 12C/ 13C within a given species, and also for differences between the 12C/ 13C in the three gases. For CH 4 alone, we find C12/C13=76.6±2.7 (1- σ), essentially in agreement with the 12CH 4/ 13CH 4 measured by the Huygens Gas Chromatograph/Mass Spectrometer instrument (GCMS) [Niemann, H.B., and 17 colleagues, 2005. Nature 438, 779-784]: 82.3±1.0, and also with measured values in H 13CN and 13CH 3D by CIRS at lower precision [Bézard, B., Nixon, C., Kleiner, I., Jennings, D., 2007. Icarus 191, 397-400; Vinatier, S., Bézard, B., Nixon, C., 2007. Icarus 191, 712-721]. For the C 2 species, we find C12/C13=84.8±3.2 in C 2H 2 and 89.8±7.3 in C 2H 6, a possible trend of increasingly value with molecular mass, although these values are both compatible with the Huygens GCMS value to within error bars. There are no convincing trends in latitude. Combining all fifteen measurements, we obtain a value of C12/C13=80.8±2.0, also compatible with GCMS. Therefore, the evidence is mounting that 12C/ 13C is some 8% lower on Titan than on the Earth (88.9, inorganic standard), and lower than typical for the outer planets ( 88±7 [Sada, P.V., McCabe, G.H., Bjoraker, G.L., Jennings, D.E., Reuter, D.C., 1996. Astrophys. J. 472, 903-907]). There is no current model for this enrichment, and we discuss several mechanisms that may be at work.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Energy Technology Data Exchange (ETDEWEB)
Takeuchi, Koh [National Institute of Advanced Industrial Science and Technology (AIST), Biomedicinal Information Research Center (BIRC) (Japan); Frueh, Dominique P.; Sun, Zhen-Yu J.; Hiller, Sebastian; Wagner, Gerhard, E-mail: gerhard_wagner@hms.harvard.ed [Harvard Medical School, Department of Biological Chemistry and Molecular Pharmacology (United States)
2010-05-15
We present a {sup 13}C direct detection CACA-TOCSY experiment for samples with alternate {sup 13}C-{sup 12}C labeling. It provides inter-residue correlations between {sup 13}C{sup {alpha}} resonances of residue i and adjacent C{sup {alpha}s} at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C{sup {alpha}} nuclei separated by more than one residue. The experiment also provides C{sup {alpha}}-to-side chain correlations, some amino acid type identifications and estimates for {psi} dihedral angles. The power of the experiment derives from the alternate {sup 13}C-{sup 12}C labeling with [1,3-{sup 13}C] glycerol or [2-{sup 13}C] glycerol, which allows utilizing the small scalar {sup 3}J{sub CC} couplings that are masked by strong {sup 1}J{sub CC} couplings in uniformly {sup 13}C labeled samples.
13C separation by IRMPD of halogenated difluoromethanes
International Nuclear Information System (INIS)
Ma Peihua; Chen Guancheng; Wu Bin; Liu Julin; Jing Yan; Chu Minxiong; Arai, Shigeyoshi.
1995-01-01
Isotopically-selective consecutive two-stage infrared multiphoton dissociation (IRMPD) of halogenated difluoromethanes in the presence of scavengers produces carbon-13 over 95 %. The reaction mechanism for the IRMPD of mixture of CHClF 2 and HI can be explained by a series of first-order dissociation reactions and followed radical-scavenger reactions occurred in a continuous irradiation procedure. Furthermore, 13 C enrichment at laboratory scaling-up level by the 13 C selective IRMPD of CHClF 2 /Br 2 mixture has been investigated in a flow reactor. The 13 C production rates, 13 C atomic fractions in the CBr 2 F 2 products and 13 C depletions in the CHClF 2 reactants at different flow rates and laser repetition frequencies were examined to optimize the parameters suitable for large-scale production of carbon isotope. The data obtained from the flow tests demonstrated a 40 mg h -1 production rate for CB 2 F 2 at 65 % carbon-13 by using a 40 W (4J, 10 Hz) laser beam focused with a lens of focal length 120 cm. If a reliable TEA CO 2 laser can be operated with 100 W (10 J, 10 Hz) output, the production rate of CBr 2 F 2 for carbon-13 at 60 % can attain 200 mg h -1 . The measurements of spatial profile of focused laser beam imply a 2 g h -1 production rate for the 60 % carbon-13 product for an incident power of 200 W (20 J, 10 Hz). (author)
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
26 CFR 1.381(c)(13)-1 - Involuntary conversions.
2010-04-01
... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Involuntary conversions. 1.381(c)(13)-1 Section 1.381(c)(13)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Insolvency Reorganizations § 1.381(c)(13)-1 Involuntary conversions...
Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula
2006-02-15
Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
International Nuclear Information System (INIS)
Li, Yan; Ohms, Stephen J.; Shannon, Frances M.; Sun, Chao; Fan, Jun Y.
2012-01-01
Highlights: ► DNA methylation is dynamic and flexible and changes rapidly upon cell activation. ► DNA methylation controls the inducible gene expression in a given cell type. ► Some enzymes are involved in maintaining the methylation profile of immune cells. -- Abstract: DNA demethylation has been found to occur at the promoters of a number of actively expressed cytokines and is believed to play a critical role in transcriptional regulation. While many DNA demethylation studies have focused on T cell activation, proliferation and differentiation, changes in DNA methylation in other types of immune cells are less well studied. We found that the expression of two cytokines (IL-2 and GM-CSF) responded differently to activation in three types of immune cells: EL4, A20 and RAW264.7 cells. Using the McrBC and MeDIP approaches, we observed decreases in DNA methylation at a genome-wide level and at the promoters of the genes of these cytokines. The expression of several potential enzymes/co-enzymes involved in the DNA demethylation pathways seemed to be associated with immune cell activation.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Lirk, P.; Hollmann, M. W.; Fleischer, M.; Weber, N. C.; Fiegl, H.
2014-01-01
Lidocaine demethylates deoxyribonucleic acid (DNA) in breast cancer cells. This modification of epigenetic information may be of therapeutic relevance in the perioperative period, because a decrease in methylation can reactivate tumour suppressor genes and inhibit tumour growth. The objectives of
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Directory of Open Access Journals (Sweden)
Syeh Brata Wijaya
2014-09-01
Full Text Available Background: Impacted tooth is often unidentified because there is no symptom. It is found when patient is examined by dentist. The maxillary canine should be retained for strength masticatory function, esthetics and child development. Purpose: The article was aimed to report treatment options of impacted canine in the 13 years old child. Case: Thirteen years-old girl came to the Universitas Gadjah Mada Dental Hospital with complaints of the upper right permanent canine had not erupted, with no history of pain. Periapical radiograph showed the impacted position of tooth #13 mesioangular. The shift sketch technique radiograph showed the impacted canine located at the palatal site. Case management: surgical exposure the upper right maxillary canine was done, followed by orthodontic treatment to direct tooth position into occlusal line. Fixed orthodontic appliance used was Roth bracket with straight wire technique. After surgery and orthodontic treatment, #13 was in normal occlusion. Conclusion: The surgical exposure followed by orthodontic treatment could be done successfully with special consideration to the patient’s age, the dental space, location of dental crowns, dental inclination, the apical root form of impacted tooth and patient cooperation.Latar belakang: Terjadinya gigi impaksi biasanya diketahui setelah melakukan pemeriksaan ke dokter gigi karena jarang menimbulkan keluhan. Gigi caninus rahang atas sebaiknya dipertahankan untuk kekuatan fungsi pengunyahan, estetik dan tumbuh kembang anak. Tujuan: Artikel ini bertujuan untuk melaporkan perawatan impaksi gigi kaninus atas pada anak 13 tahun. Kasus: Anak perempuan usia 13 tahun datang ke Rumah sakit Gigi dan Mulut Fakultas Kedokteran Gigi Universitas Gadjah Mada dengan keluhan gigi kaninus permanen kanan atas yang belum erupsi, tanpa ada riwayat sakit di area tersebut. Hasil radiografi periapikal menunjukkan posisi gigi #13 impaksi mesioangular. Hasil radiografi dengan teknik shift
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
[2,4-(13)C]β-hydroxybutyrate metabolism in astrocytes and C6 glioblastoma cells.
Eloqayli, Haytham; Melø, Torun M; Haukvik, Anne; Sonnewald, Ursula
2011-08-01
This study was undertaken to determine if the ketogenic diet could be useful for glioblastoma patients. The hypothesis tested was whether glioblastoma cells can metabolize ketone bodies. Cerebellar astrocytes and C6 glioblastoma cells were incubated in glutamine and serum free medium containing [2,4-(13)C]β-hydroxybutyrate (BHB) with and without glucose. Furthermore, C6 cells were incubated with [1-(13)C]glucose in the presence and absence of BHB. Cell extracts were analyzed by mass spectrometry and media by (1)H magnetic resonance spectroscopy and HPLC. Using [2,4-(13)C]BHB and [1-(13)C]glucose it could be shown that C6 cells, in analogy to astrocytes, had efficient mitochondrial activity, evidenced by (13)C labeling of glutamate, glutamine and aspartate. However, in the presence of glucose, astrocytes were able to produce and release glutamine, whereas this was not accomplished by the C6 cells, suggesting lack of anaplerosis in the latter. We hypothesize that glioblastoma cells kill neurons by not supplying the necessary glutamine, and by releasing glutamate.
International Nuclear Information System (INIS)
Takeuchi, Koh; Frueh, Dominique P.; Sun, Zhen-Yu J.; Hiller, Sebastian; Wagner, Gerhard
2010-01-01
We present a 13 C direct detection CACA-TOCSY experiment for samples with alternate 13 C- 12 C labeling. It provides inter-residue correlations between 13 C α resonances of residue i and adjacent C α s at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C α nuclei separated by more than one residue. The experiment also provides C α -to-sidechain correlations, some amino acid type identifications and estimates for ψ dihedral angles. The power of the experiment derives from the alternate 13 C- 12 C labeling with [1,3- 13 C] glycerol or [2- 13 C] glycerol, which allows utilizing the small scalar 3 J CC couplings that are masked by strong 1 J CC couplings in uniformly 13 C labeled samples.
13C, 1H spin-spin coupling constants. Pt. 4
International Nuclear Information System (INIS)
Aydin, R.; Guenther, H.
1979-01-01
One-bond, geminal, and vicinal 13 C, 1 H coupling constants have been determined for adamantane using α-and β-[D]adamantane and the relation sup(n)J( 13 C, 1 H)=6,5144sup(n)J( 13 C, 2 H) for the conversion of the measured sup(n)J( 13 C, 2 H) values. It is shown that the magnitude of 3 Jsub(trans) is strongly influenced by the substitution pattern. Relative H,D isotope effects for 13 C chemical shifts are given. (orig.) [de
Canine specific ELISA for coagulation factor VII
DEFF Research Database (Denmark)
Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael
2011-01-01
available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Synthesis and applications of {sup 13}C glycerol
Energy Technology Data Exchange (ETDEWEB)
Stocking, E.; Khalsa, O.; Martinez, R.A.; Silks, L.A. III [Los Alamos National Laboratory, NM (United States)
1994-12-01
Due in part to the use of labeled glycerol for the {sup 13}C enrichment of biomolecules, we are currently developing new synthetic routes to various isotopomers of glycerol. Judging from our experience, traditional methods of glycerol synthesis are not easily adapted for isotopic enrichment and/or have poor overall yields (12 to 15%). Furthermore, the use of glycerol for enrichment can be prohibitively expensive and its availability is limited by the level of demand. We are presently developing a short de novo synthesis of glycerol from carbon dioxide ({approximately}53% overall yield for four steps) and are examining the feasibility of synthesizing site-specific {sup 13}C-labeled glycerol and dihydroxyacetone (DHA) from labeled methanol and carbon dioxide. One application of {sup 13}C glycerol we have examined is enzymatic conversion of glycerol to glyceraldehyde-3-monophosphate or dihydroxyacetone monophosphate (DHAP) with yields ranging from 25 to 50% (as determined by NMR spectroscopy). We are also pursuing the chemical conversion of {sup 13}C-labeled DHA to DHAP. We are especially interested in {sup 13}C-labeled DHAP because we are investigating its use as a chemo-enzymatic precursor for both labeled 2-deoxyribose and 2-deoxyribonucleic acids.
Synthetic Swan band profile of (1,0) of 12C12C and (0,0) of 12C12C and 12C13C in comets
International Nuclear Information System (INIS)
Swamy, K.S.K.
1987-01-01
The statistical equilibrium calculations of the 12 C 13 C molecule based on the resonance fluorescence process give similar results to those of the normal molecule. Therefore the assumption that the observed intensities of bands of the normal and the isotopic molecule differ only by their abundance ratio is reasonable. The synthetic profile of the (1,0) Swan band of 12 C 13 C (0,0) band of 12 C 12 C and 12 C 13 C have been calculated. The relative merits of using the rotational structure of the (1,0) or (0,0) band for the determination of the isotopic ratio 12 C/ 13 C is discussed briefly. (author)
In vitro evaluation of canine leukocytes radiolabeled in whole blood with 99mTc stannous colloid
International Nuclear Information System (INIS)
Abushhiwa, Mohamed H.; Salehi, Nouria S.; Whitton, Robert C.; Charles, Jennifer A.; Finnin, Peter J.; Lording, Peter M.; Caple, Ivan W.; Parry, Bruce W.
2008-01-01
Introduction: Technetium-99m stannous colloid ( 99m TcSnC)-labeled leukocytes are used to investigate a variety of inflammatory diseases in human medicine. The present study investigates the in vitro behavior of canine leukocytes labeled in whole blood with 99m TcSnC. Methods: Blood samples from 10 healthy dogs were labeled with 99m TcSnC using a standard procedure. The distribution of radioactivity among blood components (plasma, leukocyte layers and erythrocytes) was measured following separation of the radiolabeled samples across Histopaque density gradients. Phagocytic function of labeled and unlabeled leukocytes was estimated using zymosan particles. Labeling retention by leukocytes was determined at 1, 3, 4 and 7 h postlabeling. Results: The mean±standard error percentage of radioactivity associated with plasma, erythrocyte and leukocyte fractions was 2.0±0.21%, 55.5±0.60% and 42.5±0.54%, respectively (the last comprising 70.2±0.83% in polymorphonuclear leukocytes and 29.8±0.83% in mononuclear leukocytes). Labeled canine leukocytes had a phagocytic activity of 91.3±0.28% (control, 91.7±0.26%). The radiolabeled canine leukocytes retained 94.1±0.30% of radioactivity at 7 h postlabeling. Conclusions: Radiolabeling of canine leukocytes in whole blood with 99m TcSnC has minor adverse effect on their phagocytic function. The radiolabeled canine leukocytes retained a large percentage of radioactivity for at least 7 h postlabeling
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
DEFF Research Database (Denmark)
Kristensen, D G; Nielsen, J E; Jørgensen, Anne
2014-01-01
cells were assessed by quantitative measurements. The expression of TET1, TET2, APOBEC1, MBD4, APEX1, PARP1, DNMT1, DNMT3A, DNMT3B and DNMT3L in adult testis specimens with CIS and in human fetal testis was investigated by immunohistochemistry and immunofluorescence.Results:DNA from micro-dissected CIS...... cells contained very low levels of 5hmC produced by ten eleven translocation (TET) enzymes. CIS cells and fetal germ cells expressed the suggested initiator of active demethylation, APOBEC1, and the base excision repair proteins MBD4, APEX1 and PARP1, whereas TETs - the alternative initiators were...
Directory of Open Access Journals (Sweden)
Sihui Li
2018-04-01
Full Text Available Summary: The arginine methylation status of histones dynamically changes during many cellular processes, including hematopoietic stem/progenitor cell (HSPC development. The arginine methyltransferases and the readers that transduce the histone codes have been defined. However, whether arginine demethylation actively occurs in cells and what enzyme demethylates the methylarginine residues during various cellular processes are unknown. We report that JMJD1B, previously identified as a lysine demethylase for H3K9me2, mediates arginine demethylation of H4R3me2s and its intermediate, H4R3me1. We show that demethylation of H4R3me2s and H3K9me2s in promoter regions is correlated with active gene expression. Furthermore, knockout of JMJD1B blocks demethylation of H4R3me2s and/or H3K9me2 at distinct clusters of genes and impairs the activation of genes important for HSPC differentiation and development. Consequently, JMJD1B−/− mice show defects in hematopoiesis. Altogether, our study demonstrates that demethylase-mediated active arginine demethylation process exists in eukaryotes and that JMJD1B demethylates both H4R3me2s and H3K9me2 for epigenetic programming during hematopoiesis. : Li et al. identify the arginine demethylase (RDM activity of JMJD1B, a known lysine demethylase (KDM. They reveal that JMJD1B actively mediates demethylation of histone markers H4R3me2s and H3K9me2 in hematopoietic stem/progenitor cells (HSPCs. Keywords: JMJD1B, KDM3B, PRMT5, arginine demethylase, histone, epigenetic programming, gene expression, hematopoiesis
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Takeuchi, Koh; Frueh, Dominique P; Sun, Zhen-Yu J; Hiller, Sebastian; Wagner, Gerhard
2010-05-01
We present a (13)C direct detection CACA-TOCSY experiment for samples with alternate (13)C-(12)C labeling. It provides inter-residue correlations between (13)C(alpha) resonances of residue i and adjacent C(alpha)s at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C(alpha) nuclei separated by more than one residue. The experiment also provides C(alpha)-to-sidechain correlations, some amino acid type identifications and estimates for psi dihedral angles. The power of the experiment derives from the alternate (13)C-(12)C labeling with [1,3-(13)C] glycerol or [2-(13)C] glycerol, which allows utilizing the small scalar (3)J(CC) couplings that are masked by strong (1)J(CC) couplings in uniformly (13)C labeled samples.
International Nuclear Information System (INIS)
Kalderon, B.; Korman, S.H.; Gutman, A.; Lapidot, A.
1989-01-01
A stable isotope procedure to estimate hepatic glucose carbon recycling and thereby elucidate the mechanism by which glucose is produced in patients lacking glucose 6-phosphatase is described. A total of 10 studies was performed in children with glycogen storage disease type I (GSD-I) and type III (GSD-III) and control subjects. A primed dose-constant nasogastric infusion of D-[U- 13 C]glucose or an infusion diluted with nonlabeled glucose solution was administered following different periods of fasting. Hepatic glucose carbon recycling was estimated from 13 C NMR spectra. The values obtained for GSD-I patients coincided with the standard [U- 13 C]glucose dilution curve. These results indicate that the plasma glucose of GSD-I subjects comprises only a mixture of 99% 13 C-enriched D-[U- 13 C]glucose and unlabeled glucose but lacks any recycled glucose. Significantly different glucose carbon recycling values were obtained for two GSD-III patients in comparison to GSD-I patients. The results eliminate a mechanism for glucose production in GSD-I children involving gluconeogenesis. However, glucose release by amylo-1,6-glucosidase activity would result in endogenous glucose production of non- 13 C-labeled and nonrecycled glucose carbon, as was found in this study. In GSD-III patients gluconeogenesis is suggested as the major route for endogenous glucose synthesis. The contribution of the triose-phosphate pathway in these patients has been determined
Delta /sup 13/C fractionation in Tarbela dam fish
International Nuclear Information System (INIS)
Latif, Z.; Sajjad, M.I.; Bilal, R.; Tasneem, M.A.; Khan, I.H.; Ali, M.
1998-01-01
The paper focuses on the study of naturally occurring /sup 13/C fractionation in Tarbela dam fish. Craig noted that gamma /sup 13/C values for animal tissues fall in the range as their food supply. DeNiro and Epstein demonstrated clearly that the carbon isotope composition of an animal greatly depends on its diet. The above mentioned statements were observed while studying the isotopic composition of carbon in different parts of the fish. Living fish was purchased from the Haripur side of the Tarbela lake. Different portions were separated and fish diet was collected from the fish stomach. Samples were dried in the oven at 40-50 deg. C for five days. Ground, homogenized and ignited with research grade oxygen at 900-1000 deg. C. CO and CO /sub 2/ were produced and CO was converted to CO/sub 2/ by circulation over CuO gauge furnace at 900 deg. C. CO/sub 2/ was purified using 70 deg. C slush and analyzed on Varian Mat (GD-150) mass spectrometer for gamma /sup 13/C measurements. The results show that fish flesh sup/13 C value is nearly similar to fish diet gamma /sup 13/C. gamma /sup 13/C values to different parts of the fish departed from that of the diet in the sequence: fish swim bladder (-22.04) >ribs (2-22.26)>skin (122.91)>diet (123.22)>flesh (-23.40)> vertebral column (-24.07). It is concluded that diet is easily metabolized in the fish flesh and skin tissues through blood streams without causing any pronounced fractionation. Fractionation was observed in the fish endo skeleton system due to which fish ribs become enriched in gamma /sup 13/C than vertebral column. Fractionation was also detected in visceral muscles (swim bladder) of the fish as comparison with somatic axial trunk muscle (fish flesh). (author)
Energy Technology Data Exchange (ETDEWEB)
Li, Yan [College of Animal Science and Technology, Northwest A and F University, Yangling, Shaanxi 712100 (China); Department of Genome Biology, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia); Ohms, Stephen J. [ACRF Biomolecular Resource Facility, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia); Shannon, Frances M. [Department of Genome Biology, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia); The University of Canberra, ACT 2602 (Australia); Sun, Chao, E-mail: sunchao2775@163.com [College of Animal Science and Technology, Northwest A and F University, Yangling, Shaanxi 712100 (China); Fan, Jun Y., E-mail: jun.fan@anu.edu.au [Department of Genome Biology, John Curtin School of Medical Research, The Australian National University, ACT 2601 (Australia)
2012-03-23
Highlights: Black-Right-Pointing-Pointer DNA methylation is dynamic and flexible and changes rapidly upon cell activation. Black-Right-Pointing-Pointer DNA methylation controls the inducible gene expression in a given cell type. Black-Right-Pointing-Pointer Some enzymes are involved in maintaining the methylation profile of immune cells. -- Abstract: DNA demethylation has been found to occur at the promoters of a number of actively expressed cytokines and is believed to play a critical role in transcriptional regulation. While many DNA demethylation studies have focused on T cell activation, proliferation and differentiation, changes in DNA methylation in other types of immune cells are less well studied. We found that the expression of two cytokines (IL-2 and GM-CSF) responded differently to activation in three types of immune cells: EL4, A20 and RAW264.7 cells. Using the McrBC and MeDIP approaches, we observed decreases in DNA methylation at a genome-wide level and at the promoters of the genes of these cytokines. The expression of several potential enzymes/co-enzymes involved in the DNA demethylation pathways seemed to be associated with immune cell activation.
Directory of Open Access Journals (Sweden)
Pamela M. Ortiz
2018-01-01
Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.
PEDOGENIC CARBONATE δ13C AND ENVIRONMENTAL PRECIPITATION CONDITIONS
Directory of Open Access Journals (Sweden)
Marcella Catoni
2011-12-01
Full Text Available Carbon isotopic analysis is a useful tool for investigating paleoenvironments, as the pedogenic carbonate δ13C is related to δ13CSOM and to the proportions of C3/C4 plants. In this work we interpreted the paleoenvironmental conditions at the time of carbonate precipitation in soils formed under different climates and during different geological ages. Samples were taken from a Bk (PR1, Holocene and from two Bkm horizons (PR2 and PR3, Pleistocene. When the mean δ13C plant values and the most plausible paleotemperatures were used in the evaluation, PR1 showed a lower percentage of C4 plants (48% than Pleistocene soils (~53%, in agreement with paleoclimate changes. When instead the δ13C values of current plants were used for PR1, C4 plants ranged from 59 (12°C to 66% (18°C, suggesting two possible interpretations: either plant species changed during the Holocene, or the plant mean values normally used in the literature are not suitable for Pleistocene reconstructions
Late pleistocene-recent atmospheric δ13C record in C4 grasses
International Nuclear Information System (INIS)
Toolin, L.J.; Eastoe, C.
1993-01-01
Samples of Setaria species from packrat middens, herbarium specimens and modern plants preserve a record of δ 13 C of atmospheric CO 2 from 12,600 Bp to the present. No secular trend is detected between 12,600 and 1,800 Bp, when the mean value of δ 13 C during that period was -6.5 ± 0.1 per-thousand (the error is the standard deviation of the mean). The value agrees with δ 13 C averages of pre-industrial CO 2 from polar ice cores, and differs significantly from modern regional (-8.2 ± 0.1 per-thousand) and global (-7.7 per-thousand) values, which are higher because of fossil fuel burning
Detection of interstellar (C-13)N toward Zeta Ophiuchi
International Nuclear Information System (INIS)
Crane, P.; Hegyi, D.J.
1988-01-01
Observations of a diffuse interstellar cloud toward Zeta Oph, obtained with resolution 100,000-150,000 near the 3874.608-A R(0) line of (C-12)N using a coude echelle spectrograph on the 1.4-m telescope at ESO during 1984 and 1985, are reported. Data from 54 20-min runs were fitted to Gaussian line shapes using the line center, depth, and width of the R(0) and R(1) lines of (C-12)N and the line center and depth of the R(0) line of (C-13)N as fitting parameters. The (C-13)N R(0) line, with equivalent width 0.190 + or - 0.020 mA, was detected 173.7 + or - 0.8 mA to the red of (C-12)N R(0); the corresponding isotope abundance ratio, (C-12)N/(C-13)N = 47.3 + 5.5 or -4.4, is shown to be in good agreement with previous measurements for CH(+) (Hawkins et al., 1985). 13 references
Optoacoustic 13C-breath test analyzer
Harde, Hermann; Helmrich, Günther; Wolff, Marcus
2010-02-01
The composition and concentration of exhaled volatile gases reflects the physical ability of a patient. Therefore, a breath analysis allows to recognize an infectious disease in an organ or even to identify a tumor. One of the most prominent breath tests is the 13C-urea-breath test, applied to ascertain the presence of the bacterium helicobacter pylori in the stomach wall as an indication of a gastric ulcer. In this contribution we present a new optical analyzer that employs a compact and simple set-up based on photoacoustic spectroscopy. It consists of two identical photoacoustic cells containing two breath samples, one taken before and one after capturing an isotope-marked substrate, where the most common isotope 12C is replaced to a large extent by 13C. The analyzer measures simultaneously the relative CO2 isotopologue concentrations in both samples by exciting the molecules on specially selected absorption lines with a semiconductor laser operating at a wavelength of 2.744 μm. For a reliable diagnosis changes of the 13CO2 concentration of 1% in the exhaled breath have to be detected at a concentration level of this isotope in the breath of about 500 ppm.
The synthesis of Org 3770 labelled with 3H, 13C and 14C
International Nuclear Information System (INIS)
Kaspersen, F.M.; Rooij, F.A.M. van; Sperling, E.G.M.; Wieringa, J.H.
1989-01-01
The syntheses of 1,2,3,4,10,14b-hexahydro-2-methylpyrazino[2,1-a]pyrido[2,3-c][2]benazepine (Org 3770) labelled with 3 H (and 2 H), 13 C and 14 C are described. Tritiated Org 3770 was prepared either by exchange under alkaline conditions with tritiated water or catalytic reductive dehalogenation of a chloro analogue with 3 H 2 . 13 C-labelled material was obtained in a seven-step synthesis starting from 13 C-labelled benzene whereas 14 C-Org 3770 was prepared in a three-step synthesis starting with 14 CO 2 . All labelled compounds were analyzed by TLC, HPLC, MS and NMR. (author)
Site-selective {sup 13}C labeling of proteins using erythrose
Energy Technology Data Exchange (ETDEWEB)
Weininger, Ulrich, E-mail: ulrich.weininger@physik.uni-halle.de [Lund University, Department of Biophysical Chemistry, Center for Molecular Protein Science (Sweden)
2017-03-15
NMR-spectroscopy enables unique experimental studies on protein dynamics at atomic resolution. In order to obtain a full atom view on protein dynamics, and to study specific local processes like ring-flips, proton-transfer, or tautomerization, one has to perform studies on amino-acid side chains. A key requirement for these studies is site-selective labeling with {sup 13}C and/or {sup 1}H, which is achieved in the most general way by using site-selectively {sup 13}C-enriched glucose (1- and 2-{sup 13}C) as the carbon source in bacterial expression systems. Using this strategy, multiple sites in side chains, including aromatics, become site-selectively labeled and suitable for relaxation studies. Here we systematically investigate the use of site-selectively {sup 13}C-enriched erythrose (1-, 2-, 3- and 4-{sup 13}C) as a suitable precursor for {sup 13}C labeled aromatic side chains. We quantify {sup 13}C incorporation in nearly all sites in all 20 amino acids and compare the results to glucose based labeling. In general the erythrose approach results in more selective labeling. While there is only a minor gain for phenylalanine and tyrosine side-chains, the {sup 13}C incorporation level for tryptophan is at least doubled. Additionally, the Phe ζ and Trp η2 positions become labeled. In the aliphatic side chains, labeling using erythrose yields isolated {sup 13}C labels for certain positions, like Ile β and His β, making these sites suitable for dynamics studies. Using erythrose instead of glucose as a source for site-selective {sup 13}C labeling enables unique or superior labeling for certain positions and is thereby expanding the toolbox for customized isotope labeling of amino-acid side-chains.
Kim, S-J; Kwon, Y-H; Hwang, C-J
2016-05-01
The objective of this study was to compare the biomechanical characteristics between two types of self-ligating brackets and conventional metal brackets using finite element analysis of a vertically displaced canine model focusing on the desired force on the canine and undesirable forces on adjacent teeth. Three-dimensional finite element models of the maxillary dentition with 1-mm, 2-mm, and 3-mm vertically displaced canines were constructed. Two different self-ligating brackets (In-Ovation C and Smart clip) and a conventional metal bracket (Micro-arch) were modeled. After a 0.016-inch NiTi (0.40 mm, round) wire was engaged, the displacement of each tooth was calculated using x-, y-, and z-coordinates, and the tensile and compressive stresses were calculated. The extrusion and maximal tensile stress of the canine differed little between the three brackets, but the intrusion and minimal compressive stress values of the adjacent teeth differed considerably and were highest in the Smart clip and least in the In-Ovation C. The extrusion and maximal tensile stress of the canine in the 3-mm displacement model was less than that in the 2-mm displacement model, and the intrusion and minimal compressive stress of the adjacent teeth increased with the degree of displacement. Self-ligating brackets were not superior to conventional brackets in leveling a vertically displaced canine. A continuous arch wire may not be recommended for leveling of severely displaced canines whether using self-ligating or conventional brackets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A negative search of acute canine distemper virus infection in DogSLAM transgenic C57BL/6 mice
Directory of Open Access Journals (Sweden)
Somporn Techangamsuwan
2010-12-01
Full Text Available Canine distemper is a highly contagious and immunosuppressive viral disease caused by canine distemper virus(CDV, an enveloped RNA virus of the family Paramyxoviridae. The susceptible host spectrum of CDV is broad andincludes all families of the order Carnivora. To accomplish the infection, CDV requires an expression of signaling lymphocyteactivation molecule (SLAM functioning as a cellular receptor which generally presents in a variety of different lymphoid cellsubpopulations, including immature thymocytes, primary B cells, activated T cells, memory T cells, macrophages and maturedendritic cells. The distribution of SLAM-presenting cells is in accordance with the lymphotropism and immunosuppressionfollowing morbillivirus infection. In the present study, the C57BL/6 mice engrafted with dog-specific SLAM sequence(DogSLAM were used. The weanling (3-week-old transgenic offspring C57BL/6 mice were infected with CDV Snyder Hill(CDV-SH strain via the intranasal (n=6, intracerebral (n=6 and intraperitoneal (n=5 routes. Clinical signs, hematology,histopathology, immunohistochemistry, virus isolation and RT-PCR were observed for two weeks post infection. Resultsshowed that CDV-SH-inoculated transgenic mice displayed mild-to-moderate congestion of various organs (brain, lung,spleen, kidney, lymph node, and adrenal gland. By means of immunohistochemistry, virus isolation and RT-PCR, CDV couldnot be detected. The evidence of CDV infection in this study could not be demonstrated in acute phase. Even though thetransgenic mouse is not a suitable animal model for CDV, or a longer incubation period is prerequisite, it needs to be clarifiedin a future study.
Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub
2016-01-01
This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.
Olah, George A; Prakash, G K Surya; Rasul, Golam
2016-01-05
The rearrangement pathways of the equilibrating tertiary carbocations, 2,3-dimethyl-2-butyl cation (C6H13(+), 1), 2,3,3-trimethyl-2-butyl cation (C7H15(+), 5) and 2,3-dimethyl-2-pentyl cation (C7H15(+), 8 and 9) were investigated using the ab initio/GIAO-CCSD(T) (13)C NMR method. Comparing the calculated and experimental (13)C NMR chemical shifts of a series of carbocations indicates that excellent prediction of δ(13)C could be achieved through scaling. In the case of symmetrical equilibrating cations (1 and 5) the Wagner-Meerwein 1,2-hydride and 1,2-methide shifts, respectively, produce the same structure. This indicates that the overall (13)C NMR chemical shifts are conserved and independent of temperature. However, in the case of unsymmetrical equilibrating cations (8 and 9) the Wagner-Meerwein shift produces different tertiary structures, which have slightly different thermodynamic stabilities and, thus, different spectra. At the MP4(SDTQ)/cc-pVTZ//MP2/cc-pVTZ + ZPE level structure 8 is only 90 calories/mol more stable than structure 9. Based on computed (13)C NMR chemical shift calculations, mole fractions of these isomers were determined by assuming the observed chemical shifts are due to the weighted average of the chemical shifts of the static ions. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Selwyn Arlington Headley
2003-12-01
Full Text Available Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a dual infection of canine distemper virus and canine parvovirus.Descreve-se a infecção simultânea de cinomose e parvovirose associada à degeneração e necrose do miocárdio em um cão. Clinicamente, o cão apresentou mioclonias, nistagmo, hipoplasia do esmalte dentário, pústulas abdominais e ulceração bilateral da córnea. Foram observadas encefalite desmielinzante, degeneração e necrose do miocárdio com mineralização, e necrose, hemorragia e fusão das vilosidades intestinais. As lesões observadas neste cão são características com uma infecção pelos vírus da cinomose e da parvovirose.
uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS
Directory of Open Access Journals (Sweden)
Mariana Rodrigues Faleiro
2013-06-01
Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
International Nuclear Information System (INIS)
Zielinski, M.; Czarnota, G.; Papiernik-Zielinska, H.
1992-01-01
The 13 C kinetic isotope fractionation in the decarbonylation of lactic acid of natural isotopic composition by sulfuric acid has been studied in the temperature range of 20-80 deg C. The 13 C (1) isotope separation in the decarbonylation of lactic acid by concentrated sulfuric acid depends strongly on the temperature above 40 deg C. Below this temperature the 13 C isotope effect in the decarbonylation of lactic acid by concentrated sulfuric acid is normal similarly as has been found in the decarbonylation of lactic [1- 14 C] acid. The experimental values of k (12C) /k (13C) ratios of isotopic rate constants for 12 C and 13 C are close to, but slightly higher than theoretical 13 C-kinetic isotope effects calculated (neglecting tunneling) under the asumption that the C (1) -OH bond is broken in the rate-controlling step of the dehydration reaction. Dilution of concentrated sulfuric acid with water up to 1.4 molar (H 2 O)/(H 2 SO 4 ) ratio caused the increase of the 13 C isotope fractionation from 1.0273 found in concentrated sulfuric acid at 80.5 deg C to 1.0536±0.0008 (at 80.6 deg C). A discussion of the abnormally high temperature dependence of 14 C and 13 C isotope fractionation in this reaction and the discussion of the problem of relative 14 C/ 13 C kinetic isotope effects is given. (author) 18 refs.; 2 tabs
The 12C/13C Isotopic Ratio in Planetary Nebulae as Deduced from IUE Data
Miskey, C. L.; Feibelman, W. A.; Bruhweiler, F. C.
2000-05-01
The relative abundances of C, N, and O and the isotopic ratio of 12C/13C represent tracers of nucleosynthesis in intermediate stars with main-sequence masses between 0.6 and 8.0 solar masses in our Galaxy. Determining these abundances and the isotopic 12C/13C ratio in planetary nebulae (PNe) represent perhaps the best means to discern exactly how the ISM is enriched by CNO stellar nucleosynthesis. Walsh et al. (1996) and Clegg et al. (1997), using the Hubble Space Telescope, have derived the isotopic 12C/13C abundance ratio in the galactic carbon-rich PN, NGC 3918, and placed marginal constraints on it for the Magellanic PNe, N2 (SMC) and N122 (LMC). This was done using the well-known 12C 3P-1S (J=1-0 and J=2-0) transitions of C+2 at 1906.68 Angstroms and 1908.77 Angstroms and a J=0-0 transition at 1909.6 Angstroms, which is strictly forbidden in 12C. The finite nuclear spin of 13C (I=1/2) permits a corresponding F=1/2-1/2 electric dipole transition not seen in 12C. Since the 1909.6 Angstroms line is well separated from the other two 12C transitions, it provides an important means of determining 12C/13C in planetary nebulae. We have just completed a search of archival International Ultraviolet Explorer (IUE) high-dispersion spectra of approximately three dozen PNe, and derived 12C/13C ratios of 39 and 23 for the galactic PNe, NGC 2440 and NGC 6302, respectively. These are values much lower than the solar value of 89. In the other objects, the limited S/N of the IUE data indicate 12C/13C ratio upper limits much higher than 50. The implications of these results and their pertinence to stellar evolution are discussed.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
International Nuclear Information System (INIS)
Rodrigues, M. R. D.; Borello-Lewin, T.; Horodynski-Matsushigue, L. B.; Duarte, J. L. M.; Rodrigues, C. L.; Souza, M. A.; Miyake, H.; Cunsolo, A.; Cappuzzello, F.; Ukita, G. M.
2011-01-01
The 9 Be( 6 Li,d) 13 C reaction was used to investigate alpha resonant states in 13 C up to 15 MeV of excitation. The reaction was measured at a bombarding energy of 25.5 MeV employing the Sao Paulo Pelletron-Enge-Spectrograph facility and the nuclear emulsion detection technique. An energy resolution of 50 keV was obtained. Several narrow alpha resonant states not previously measured were detected, in particular the one at the (3α+n) threshold populated by an L = 2 transfer, revealing a 9 Be+α component for the 1/2 - cluster state candidate at this threshold. Experimental angular distributions are presented in comparison with DWBA predictions.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Directory of Open Access Journals (Sweden)
Leonard MJ
2014-10-01
Full Text Available McGee J Leonard,1 Catherine Bresee,2 Andrew Cruikshank1 1Animal Specialty and Emergency Center, Los Angeles, CA, USA; 2The Biostatistics and Bioinformatics Research Center, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: This is a retrospective multicenter study (2006–2012 examining a population of dogs with moderate to severe crotalid envenomation for protective effects of the canine rattlesnake vaccine. Five nonacademic emergency and referral veterinary hospitals in Southern California were involved in the study and contributed records regarding a total of 82 client-owned dogs that were treated for naturally occurring rattlesnake envenomation. All dogs received antivenin (Crotalidae polyvalent, with dosages ranging from one to three vials (mean: 1.3±0.6. Fourteen dogs (17% had a history of prior vaccination against crotalid venom. In univariate logistic regression modeling, cases with lower body weight (P=0.0001 or higher snakebite severity scores (P<0.0001 were associated with greater morbidity. No statistically significant difference in morbidity or mortality between vaccinated and unvaccinated dogs was found. The findings of this study did not identify a significantly protective effect of previous vaccination in the cases of moderate to severe rattlesnake envenomation that require treatment with antivenin. Keywords: rattlesnake envenomation, vaccine, antivenin, canine
Preparation of 15N-13C-fulminic acid
International Nuclear Information System (INIS)
Wilmes, R.; Winnewisser, M.
1993-01-01
The precursor for the title compound was prepared in a three-step synthesis. The 13 C-label was incorporated in the first step employing 2- 13 C-ethyl acetate and the 15 N-label in the last step, using 15 N-sodium nitrite. Upon pyrolysis the precursor forms three fragments, one of them being the title compound. (Author)
Polymeric proanthocyanidins 13C NMR studies of procyanidins
Lawrence J. Porter; Roger H. Newman; Lai Yeap Foo; Herbert Wong; Richard W. Hemingway
1982-01-01
Proanthocyanidin polymers have been shown to consist entirely of flavan-3-ol units by a combination of techniques including 13C n.m.r. spectroscopy. The 13C n.m.r. spectra of the polymers and related molecules are now considered in more detail. Prior to this study UC n.m.r. data has been published of procyanidins and...
Laurent, C E; Cardinal, R; Rousseau, G; Vermeulen, M; Bouchard, C; Wilkinson, M; Armour, J A; Bouvier, M
2001-02-01
To corroborate alterations in the functional responses to beta-adrenergic receptor (beta-AR) stimulation with changes in beta-AR signaling in failing cardiomyocytes, contractile and L-type Ca(2+) current responses to isoproterenol along with stimulated cAMP generation were compared among cardiomyocytes isolated from canines with tachycardia-induced heart failure or healthy hearts. The magnitude of shortening of failing cardiomyocytes was significantly depressed (by 22 +/- 4.4%) under basal conditions, and the maximal response to isoproterenol was significantly reduced (by 45 +/- 18%). Similar results were obtained when the responses in the rate of contraction and rate of relaxation to isoproterenol were considered. The L-type Ca(2+) current amplitude measured in failing cardiomyocytes under basal conditions was unchanged, but the responses to isoproterenol were significantly reduced compared with healthy cells. Isoproterenol-stimulated cAMP generation was similar in sarcolemmal membranes derived from the homogenates of failing (45 +/- 6.8) and healthy cardiomyocytes (52 +/- 8.5 pmol cAMP. mg protein(-1). min(-1)). However, stimulated cAMP generation was found to be significantly reduced when the membranes were derived from the homogenates of whole tissue (failing: 67 +/- 8.1 vs. healthy: 140 +/- 27.8 pmol cAMP. mg protein(-1). min(-1)). Total beta-AR density was not reduced in membranes derived from either whole tissue or isolated cardiomyocyte homogenates, but the beta(1)/beta(2) ratio was significantly reduced in the former (failing: 45/55 vs. healthy: 72/28) without being altered in the latter (failing: 72/28, healthy: 77/23). We thus conclude that, in tachycardia-induced heart failure, reduction in the functional responses of isolated cardiomyocytes to beta-AR stimulation may be attributed to alterations in the excitation-contraction machinery rather than to limitation of cAMP generation.
Czech Academy of Sciences Publication Activity Database
Marschner, Karel; Musil, Stanislav; Dědina, Jiří
2016-01-01
Roč. 88, č. 12 (2016), s. 6366-6373 ISSN 0003-2700 R&D Projects: GA ČR GA14-23532S Institutional support: RVO:68081715 Keywords : arsenic speciation analysis * hydride generation * demethylation Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 6.320, year: 2016
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
FOXP3 Expression in GARP-Transduced Helper T Cells Is Not Associated with FOXP3 TSDR Demethylation.
Kehrmann, Jan; Zeschnigk, Michael; Buer, Jan; Probst-Kepper, Michael
2011-10-01
AIM: Glycoprotein A repetitions predominant (GARP or LRRC32) represents a human regulatory CD4+ CD25(hi) FOXP3+ T (T(reg)) cell-specific receptor that controls FOXP3. Ectopic expression of GARP in helper T (T(h)) cells has been shown to be sufficient for the induction of FOXP3 and generation of a stable regulatory phenotype. Since expression of FOXP3 in Treg cells is epigenetically controlled by a conserved motif, the so-called T(reg)-specific demethylated region (TSDR), we asked whether GARP-mediated upregulation of FOXP3 in Th cells is similarly accompanied by demethylation of the TSDR. METHODS: DNA methylation of the FOXP3 TSDR was analyzed by direct sequencing of polymerase chain reaction (PCR) products from bisulfite-treated genomic DNA. RESULTS: Although GARP-transduced T(h) cells exhibit constitutive FOXP3 expression and a regulatory phenotype, the FOXP3 TSDR is completely methylated as in naive T(h) cells. GARP-mediated FOXP3 upregulation in T(h) cells is not associated with T(reg)-specific demethylation of the FOXP3 TSDR. CONCLUSION: Although GARP-engineered T(h) cells exhibit stable FOXP3 expression and a phenotypic reprogramming towards T(reg) cells in vitro, these cells do not completely mimic the epigenotype of natural T(reg) cells. Thus, concepts based on the genetic modification of T(h) cells as cellular therapies to treat autoimmune diseases or to control transplantation tolerance should be critically tested before any clinical application.
Evaluation of carbon transfers in cattle and humans using 13C
International Nuclear Information System (INIS)
Masuda, Tsuyoshi; Tako, Yasuhiro; Nakamura, Yuji
2010-01-01
In the safety assessment made around the spent nuclear fuel reprocessing plant in Rokkasho, Aomori, among radioactive nuclides released from the plant, 14 C is expected to be the largest contributor to radiation dose received by the neighboring population through agricultural and dairy products. The objectives of this study are to clarify the transfer of 14 C from grass to beef and milk and its metabolism in the human body experimentally. (1) 13 C-labeled grass was fed for 28 days to beef cattle and cows. 13 C isotopic ratio was measured in serum and other samples including muscle of beef cattle and milk of dairy cow. The 13 C rations in milk, breath air, urine and feces decreased very rapidly within 3 day after cessation of the administration of 13 C-labeled feed. However, a slow decrease in 13 C ratio was observed in muscle and serum. (2) 13 C isotopic ratios were measured in breath air, urine, feces and serum over 16 weeks in humans who were orally administered of 13 C labeled leucine, palmitic acid, glucose, boiled rice and soymilk, respectively. Residual 13 C in their bodies experimentally observed were lower than the estimates by the ICRP metabolic model for organic carbon ingestion. (author)
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
DEFF Research Database (Denmark)
Brekke, Eva Marie; Walls, Anne Byriel; Schousboe, Arne
2012-01-01
is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism...
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
McNair, Laura F; Kornfelt, Rasmus; Walls, Anne B; Andersen, Jens V; Aldana, Blanca I; Nissen, Jakob D; Schousboe, Arne; Waagepetersen, Helle S
2017-03-01
Brain slice preparations from rats, mice and guinea pigs have served as important tools for studies of neurotransmission and metabolism. While hippocampal slices routinely have been used for electrophysiology studies, metabolic processes have mostly been studied in cerebral cortical slices. Few comparative characterization studies exist for acute hippocampal and cerebral cortical slices, hence, the aim of the current study was to characterize and compare glucose and acetate metabolism in these slice preparations in a newly established incubation design. Cerebral cortical and hippocampal slices prepared from 16 to 18-week-old mice were incubated for 15-90 min with unlabeled glucose in combination with [U- 13 C]glucose or [1,2- 13 C]acetate. Our newly developed incubation apparatus allows accurate control of temperature and is designed to avoid evaporation of the incubation medium. Subsequent to incubation, slices were extracted and extracts analyzed for 13 C-labeling (%) and total amino acid contents (µmol/mg protein) using gas chromatography-mass spectrometry and high performance liquid chromatography, respectively. Release of lactate from the slices was quantified by analysis of the incubation media. Based on the measured 13 C-labeling (%), total amino acid contents and relative activity of metabolic enzymes/pathways, we conclude that the slice preparations in the current incubation apparatus exhibited a high degree of metabolic integrity. Comparison of 13 C-labeling observed with [U- 13 C]glucose in slices from cerebral cortex and hippocampus revealed no significant regional differences regarding glycolytic or total TCA cycle activities. On the contrary, results from the incubations with [1,2- 13 C]acetate suggest a higher capacity of the astrocytic TCA cycle in hippocampus compared to cerebral cortex. Finally, we propose a new approach for assessing compartmentation of metabolite pools between astrocytes and neurons using 13 C-labeling (%) data obtained from
Demethylation of Circulating Estrogen Receptor Alpha Gene in Cerebral Ischemic Stroke.
Directory of Open Access Journals (Sweden)
Hsiu-Fen Lin
Full Text Available Estrogen is involved in neuron plasticity and can promote neuronal survival in stroke. Its actions are mostly exerted via estrogen receptor alpha (ERα. Previous animal studies have shown that ERα is upregulated by DNA demethylation following ischemic injury. This study investigated the methylation levels in the ERα promoter in the peripheral blood of ischemic stroke patients.The study included 201 ischemic stroke patients, and 217 age- and sex-comparable healthy controls. The quantitative methylation level in the 14 CpG sites of the ERα promoter was measured by pyrosequencing in each participant. Multivariate regression model was used to adjust for stroke traditional risk factors. Stroke subtypes and sex-specific analysis were also conducted.The results demonstrated that the stroke cases had a lower ERα methylation level than controls in all 14 CpG sites, and site 13 and site 14 had significant adjusted p-values of 0.035 and 0.026, respectively. Stroke subtypes analysis showed that large-artery atherosclerosis and cardio-embolic subtypes had significantly lower methylation levels than the healthy controls at CpG site 5, site 9, site 12, site 13 and site 14 with adjusted p = 0.039, 0.009, 0.025, 0.046 and 0.027 respectively. However, the methylation level for the patients with small vessel subtype was not significant. We combined the methylation data from the above five sites for further sex-specific analysis. The results showed that the significant association only existed in women (adjusted p = 0.011, but not in men (adjusted p = 0.300.Female stroke cases have lower ERα methylation levels than those in the controls, especially in large-artery and cardio-embolic stroke subtypes. The study implies that women suffering from ischemic stroke of specific subtype may undergo different protective mechanisms to reduce the brain injury.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Vitamin C - A new player in regulation of the cancer epigenome
DEFF Research Database (Denmark)
Gillberg, Linn; Ørskov, Andreas D.; Liu, Minmin
2017-01-01
of pharmacological doses of vitamin C injected intravenously to selectively kill tumor cells. This review will focus on the potential of vitamin C to optimize the outcome of epigenetic therapy in cancer patients and alternatively to act as a therapeutic at high doses.......Over the past few years it has become clear that vitamin C, as a provider of reduced iron, is an essential factor for the function of epigenetic regulators that initiate the demethylation of DNA and histones. Vitamin C deficiency is rare in the general population, but is frequently observed...... of care. Recent in vitro studies suggest that vitamin C at physiological concentrations, combined with hypomethylating agents may act synergistically to cause DNA demethylation through active and passive mechanisms, respectively. Additionally, several recent studies have renewed interest in the use...
Edwards, H. G. M.; Munshi, T.; Anstis, M.
2005-05-01
The FT Raman spectrum of caffeine was analysed along with that of its demethylated analogues, theobromine and theophylline. The similar but not identical structures of these three compounds allowed a more detailed assignment of the Raman bands. Noticeable differences in the Raman spectra of these compounds were apparent and key marker bands have been identified for the spectroscopic identification of these three compounds.
Characterization and modulation of canine mast cell derived eicosanoids
Lin, Tzu-Yin; London, Cheryl A.
2013-01-01
Mast cells play an important role in both innate and acquired immunity as well as several pathological conditions including allergy, arthritis and neoplasia. They influence these processes by producing a variety of mediators including cytokines, chemokines and eicosanoids. Very little is currently known about the spectrum of inflammatory mediators, particularly eicosanoids (prostaglandins and leukotrienes), produced by canine mast cells. This is important since modulating mast cell derived eicosanoids may help in the treatment of autoimmune and inflammatory disorders. The purpose of this study was to investigate the spectrum of eicosanoids produced by normal canine mast cells and to evaluate the effects of cytokines and non-steroidal anti-inflammatory mediators (NSAIDS) on eicosanoid production and release. Canine bone marrow derived cultured mast cells (cBMCMCs) expressed COX-1, COX-2, and 5-LOX and synthesized and released PGD2, PGE2, LTB4, and LTC4 following activation by a variety of stimuli. The selective COX-2 NSAIDs carprofen (Rimadyl®) and deracoxib (Deramaxx®) inhibited PGD2 and PGE2 production but only slightly inhibited LTB4 and LTC4. The mixed COX-1/COX-2 inhibitor piroxicam blocked PGD2 and PGE2 production, but upregulated LTC4 following treatment while tepoxilan (Zubrin®), a pan COX/LOX inhibitor, markedly reduced the production of all eicosanoids. The LOX inhibitor nordihydroguaiaretic acid (NDGA) prevented LTB4/LTC4 release and BMBMC degranulation. Pre-incubation of cBMCMCs with IL-4 and SCF sensitized these cells to degranulation in response to substance P. In conclusion, canine BMCMCs produce an array of eicosanoids similar to those produced by mast cells from other species. Tepoxilan appeared to be the most effective NSAID for blocking eicosanoid production and thus may be useful for modulating mast cell mediated responses in dogs. PMID:20036014
{sup 13}C relaxation in an RNA hairpin
Energy Technology Data Exchange (ETDEWEB)
King, G.C. [Univ. of South Wales, Kensington (Australia)]|[Rice Univ., Houston, TX (United States); Akratos, C. [Univ. of South Wales, Kensington (Australia); Xi, Z.; Michnica, M.J. [Rice Univ., Houston, TX (United States)
1994-12-01
This initial survey of {sup 13}C relaxation in the {triangle}TAR RNA element has generated a number of interesting results that should prove generally useful for future studies. The most readily comparable study in the literature monitored {sup 13}C relaxation of the methyl groups from unusual bases in tRNA{sup Phe}. The study, which used T{sub 1} and NOE data only, reported order parameters for the methyl group axis that ranged between 0.51 and 0.97-a range similar to that observed here. However, they reported a breakdown of the standard order parameter analysis at higher (118-MHz {sup 13}C) frequencies, which should serve to emphasize the need for a thorough exploration of suitable motional models.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Freshwater Mussel Shell δ13C Values as a Proxy for δ13CDIC in a Polluted, Temperate River
Graniero, L. E.; Gillikin, D. P.; Surge, D. M.
2017-12-01
Freshwater mussel shell δ13C values have been examined as an indicator of ambient δ13C composition of dissolved inorganic carbon (DIC) in temperate rivers. However, shell δ13C values may be obscured by the assimilation of respired, metabolic carbon (CM) derived from the organism's diet. Water δ18O and δ13CDIC values were collected fortnightly from August 2015 through July 2017 from three sites (one agricultural, one downstream of a wastewater treatment plant, one urban) in the Neuse River, NC to test the reliability of Elliptio complanata shell δ13C values as a proxy for δ13CDIC values. Muscle, mantle, gill, and stomach δ13C values were analyzed to approximate the %CM incorporated into the shell. All tissue δ13C values were within 2‰ of each other, which equates to a ±1% difference in calculated %CM. As such, muscle tissue δ13C values will be used for calculating the %CM, because they have the slowest turnover rate of the tissues sampled. Water temperature and δ18O values were used to calculate predicted aragonite shell δ18O values (δ18Oar) based on the aragonite-water fractionation relationship. To assign dates to each shell microsample, predicted δ18Oar values were compared to high-resolution serially sampled shell values. Consistent with previous studies, E. complanata cease growth in winter when temperatures are below about 12ºC. Preliminary results indicate that during the growing season, shell δ13C values are lower than expected equilibrium values, reflecting the assimilation of 15% CM, on average. Shell δ13C values are not significantly different than δ13CDIC values, but do not capture the full range of δ13CDIC values during each growing season. Thus, δ13C values of E. complanata shells can be used to reliably reconstruct past δ13CDIC values within 2‰ of coeval values. Further research will investigate how differing land-use affects the relationship between shell δ13C, CM, and δ13CDIC values.
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
International Nuclear Information System (INIS)
Rana, J.; Robins, D.J.
1985-01-01
The labelling patterns in (+)-lupanine, (+)-13-hydroxylupanine, and (+)-angustifoline derived biosynthetically from [1-amino- 15 N,1- 13 C]-1,5-diaminopentane (cadaverine) have been established by 13 C n.m.r. spectroscopy. Three cadaverine units are incorporated to about the same extent into each of these three alkaloids. The presence of two doublets due to 13 C- 15 N coupling in the 13 C brace 1 H brace n.m.r. spectra associated with C-2 and C-15 of lupanine and 13-hydroxylupanine, and one 13 C- 15 N doublet at C-2 of angustifoline, indicate that two of the cadaverine units are converted into the outer rings of the tetracyclic quinolizidine alkaloids in a specific fashion. (author)
Villalpando, Salvador; Del Prado, Martha; Cienfuego, Edith; Morales, Pedro
2014-01-01
C4 plants (e.g. corn and sugar cane) have greater (13)C enrichment than C3 plants (e.g. wheat and sugar beet). To assess whether (13)C enrichment of CO2 in the breath and breast milk of women on diets based on C3 and C4 foods changes from one diet to the other. Six breast-feeding women were studied at 5-6 months postpartum. They ate a controlled C4 diet on days 1 and 2 followed by a C3 diet on days 3 and 4. Diet duplicates, breast milk on days 2 and 4 and hourly breath samples were collected over 4 days. (13)C enrichment was measured by isotope-ratio mass spectrometry. Values of δ(13)C were calculated from the international PDBV standard (δ(13)CPDBV). Differences between means were compared by paired t test or t test for repeated measurements. δ(13)CPDBV values were significantly higher in the C4 diet than in the C3 diet composites (p value was greater on days 1 and 2 (range -15.4 to -13.2, respectively) and declined on days 3 and 4 (range -20.0 to -21.8, respectively, p value in the breath and breast milk fractions, which diminish rapidly on a C3 diet. Further studies focusing on individual nutrients are warranted.
Synthesis of C-9-14C-1,8-dihydroxy-3-carboxyanthraquinone
International Nuclear Information System (INIS)
De Witte, P.; Lemli, J.
1988-01-01
The synthesis of C-9- 14 C-rhein is reported using 14 CO 2 as a 14 C-source. After preparing 14 C-1, 8-dimethoxy-3-methylanthraquinone by a condensation reaction, the product is demethylated and the 3-methyl group converted to the corresponding 3-carboxy group. The radio-active yield of the total synthesis, starting with 1 Ci 14 CO 2 is 6,9% (6, 9 mCi); 352 mg 14 rhein is produced with a specific activity of 55,7 mCi/mmol. (author)
Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.
Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H
1997-01-01
The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.
Scharf, Valery F; Farese, James P; Coomer, Alastair R; Milner, Rowan J; Taylor, David P; Salute, Marc E; Chang, Myron N; Neal, Dan; Siemann, Dietmar W
2013-05-01
Objective-To investigate the effects of bevacizumab, a human monoclonal antibody against vascular endothelial growth factor, on the angiogenesis and growth of canine osteosarcoma cells xenografted in mice. Animals-27 athymic nude mice. Procedures-To each mouse, highly metastasizing parent osteosarcoma cells of canine origin were injected into the left gastrocnemius muscle. Each mouse was then randomly allocated to 1 of 3 treatment groups: high-dose bevacizumab (4 mg/kg, IP), low-dose bevacizumab (2 mg/kg, IP), or control (no treatment). Tumor growth (the number of days required for the tumor to grow from 8 to 13 mm), vasculature, histomorphology, necrosis, and pulmonary metastasis were evaluated. Results-Mice in the high-dose bevacizumab group had significantly delayed tumor growth (mean ± SD, 13.4 ± 3.8 days; range, 9 to 21 days), compared with that for mice in the low-dose bevacizumab group (mean ± SD, 9.4 ± 1.5 days; range, 7 to 11 days) or control group (mean ± SD, 7. 2 ± 1.5 days; range, 4 to 9 days). Mice in the low-dose bevacizumab group also had significantly delayed tumor growth, compared with that for mice in the control group. Conclusions and Clinical Relevance-Results indicated that bevacizumab inhibited growth of canine osteosarcoma cells xenografted in mice, which suggested that vascular endothelial growth factor inhibitors may be clinically useful for the treatment of osteosarcoma in dogs. Impact for Human Medicine-Canine osteosarcoma is used as a research model for human osteosarcoma; therefore, bevacizumab may be clinically beneficial for the treatment of osteosarcoma in humans.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
The 12C/13C ratio in stellar atmospheres. VI. Five luminous cool stars
International Nuclear Information System (INIS)
Hinkle, K.H.; Lambert, D.L.; Snell, R.L.
1976-01-01
The isotopic abundance ratio, 12 C/ 13 C, is derived from the CO vibration rotation lines at 1.6 and 2.3 μ for five cool luminous stars by a simple curve-of-growth technique. A new analysis of CN lines at 8000 A is also described for α Sco and α Ori. Results derived independently from CO and CN are in agreement. Final results are 12 C/ 13 C=7 +- 2(α Ori), 12 +- 3(α Sco), 7 +- 3(β Peg), 25 +- 7(chi Cyg), 17 +- 4(α Her), and 7 +- 1.5(α Boo). The α Boo analysis provides a check on the CO curve-of-growth technique; the 12 C/ 13 C ratio from the 2.3 μ CO lines is in good agreement with the previously determined ratio from CN and CH lines
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
Energy Technology Data Exchange (ETDEWEB)
Bayle, Kevin [EBSI Team, Interdisciplinary Chemistry: Synthesis, Analysis, Modelling (CEISAM), University of Nantes-CNRS UMR 6230, 2 Rue de la Houssinière, BP 92208, F-44322, Nantes Cedex 3 (France); Gilbert, Alexis [Department of Environmental Chemistry and Engineering, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503 (Japan); Earth–Life Science Institute, Tokyo Institute of Technology, Meguro, Tokyo 152-8551 (Japan); Julien, Maxime [EBSI Team, Interdisciplinary Chemistry: Synthesis, Analysis, Modelling (CEISAM), University of Nantes-CNRS UMR 6230, 2 Rue de la Houssinière, BP 92208, F-44322, Nantes Cedex 3 (France); Yamada, Keita [Department of Environmental Chemistry and Engineering, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503 (Japan); Silvestre, Virginie; Robins, Richard J.; Akoka, Serge [EBSI Team, Interdisciplinary Chemistry: Synthesis, Analysis, Modelling (CEISAM), University of Nantes-CNRS UMR 6230, 2 Rue de la Houssinière, BP 92208, F-44322, Nantes Cedex 3 (France); Yoshida, Naohiro [Department of Environmental Chemistry and Engineering, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503 (Japan); Earth–Life Science Institute, Tokyo Institute of Technology, Meguro, Tokyo 152-8551 (Japan); Remaud, Gérald S., E-mail: gerald.remaud@univ-nantes.fr [EBSI Team, Interdisciplinary Chemistry: Synthesis, Analysis, Modelling (CEISAM), University of Nantes-CNRS UMR 6230, 2 Rue de la Houssinière, BP 92208, F-44322, Nantes Cedex 3 (France)
2014-10-10
Highlights: • Evaluation of the trueness and precision criteria of isotopic {sup 13}C NMR spectrometry. • Use of bi-labelled [1,2-{sup 13}C{sub 2}]acetic acid to determine the performance of the instrumental response. • Inter-calibration of the {sup 13}C intramolecular composition of acetic acid using the technique GC-Py–irm-MS. - Abstract: Intramolecular {sup 13}C composition gives access to new information on the (bio) synthetic history of a given molecule. Isotopic {sup 13}C NMR spectrometry provides a general tool for measuring the position-specific {sup 13}C content. As an emerging technique, some aspects of its performance are not yet fully delineated. This paper reports on (i) the conditions required to obtain satisfactory trueness and precision for the determination of the internal {sup 13}C distribution, and (ii) an approach to determining the “absolute” position-specific {sup 13}C content. In relation to (i), a precision of <1% can be obtained whatever the molecule on any spectrometer, once quantitative conditions are met, in particular appropriate proton decoupling efficiency. This performance is a prerequisite to the measurement of isotope fractionation either on the transformed or residual compound when a chemical reaction or process is being studied. The study of the trueness has revealed that the response of the spectrometer depends on the {sup 13}C frequency range of the studied molecule, i.e. the chemical shift range. The “absolute value” and, therefore, the trueness of the {sup 13}C NMR measurements has been assessed on acetic acid and by comparison to the results obtained on the fragments from COOH and CH{sub 3} by isotopic mass spectrometry coupled to a pyrolysis device (GC-Py–irm-MS), this technique being the reference method for acetic acid. Of the two NMR spectrometers used in this work, one gave values that corresponded to those obtained by GC-Py–irm-MS (thus, the “true” value) while the other showed a bias, which was
Hyperpolarized C-13 MRS Cardiac Metabolism Studies in Pigs
DEFF Research Database (Denmark)
Giovannetti, G.; Hartwig, V.; Frijia, F.
2012-01-01
Cardiac metabolism assessment with hyperpolarized 13C magnetic resonance spectroscopy in pig models requires the design of dedicated coils capable of providing large field of view with high signal-to-noise ratio (SNR) data. This work presents a comparison between a commercial 13C quadrature...
New Insights into 5hmC DNA Modification: Generation, Distribution and Function
Directory of Open Access Journals (Sweden)
Dong-Qiao Shi
2017-07-01
Full Text Available Dynamic DNA modifications, such as methylation/demethylation on cytosine, are major epigenetic mechanisms to modulate gene expression in both eukaryotes and prokaryotes. In addition to the common methylation on the 5th position of the pyrimidine ring of cytosine (5mC, other types of modifications at the same position, such as 5-hydroxymethyl (5hmC, 5-formyl (5fC, and 5-carboxyl (5caC, are also important. Recently, 5hmC, a product of 5mC demethylation by the Ten-Eleven Translocation family proteins, was shown to regulate many cellular and developmental processes, including the pluripotency of embryonic stem cells, neuron development, and tumorigenesis in mammals. Here, we review recent advances on the generation, distribution, and function of 5hmC modification in mammals and discuss its potential roles in plants.
International Nuclear Information System (INIS)
Antusch, Stefan; Gross, Christian; Maurer, Vinzenz; Sluka, Constantin
2013-01-01
The recent observations of the leptonic mixing angle θ 13 PMNS are consistent with θ 13 PMNS =θ C /√(2) (with θ C being the Cabibbo angle θ 12 CKM ). We discuss how this relation can emerge in Grand Unified Theories (GUTs) via charged lepton corrections. The key ingredient is that in GUTs the down-type quark Yukawa matrix and the charged lepton Yukawa matrix are generated from the same set of GUT operators, which implies that the resulting entries are linked and differ only by group-theoretical Clebsch factors. This allows a link θ 12 e ≈θ C to be established, which can induce θ 13 PMNS ≈θ C /√(2) provided that the 1–3 mixing in the neutrino mass matrix is much smaller than θ C . We find simple conditions under which θ 13 PMNS ≈θ C /√(2) can arise via this link in SU(5) GUTs and Pati–Salam models. We also discuss possible corrections to the exact relation. Using lepton mixing sum rules different neutrino mixing patterns can be distinguished by their predictions for the Dirac CP phase δ PMNS .
A lower limit on the surface C-12/C-13 ratio in Alpha Orionis
Gautier, T. N., III; Fink, U.; Larson, H. P.; Thompson, R. I.
1976-01-01
The second overtone CO bands near 1.6 microns were analyzed in Alpha Ori using synthetic spectra. No firm identification of (C-13)O was made, which allowed a lower limit of 20 to be set on the C-12/C-13 ratio. A rather low microturbulent velocity of 2 km/s was found to match the spectrum of Alpha Ori best.
Evaluation of [14C] and [13C]Sucrose as Blood-Brain Barrier Permeability Markers.
Miah, Mohammad K; Chowdhury, Ekram A; Bickel, Ulrich; Mehvar, Reza
2017-06-01
Nonspecific quantitation of [ 14 C]sucrose in blood and brain has been routinely used as a quantitative measure of the in vivo blood-brain barrier (BBB) integrity. However, the reported apparent brain uptake clearance (K in ) of the marker varies widely (∼100-fold). We investigated the accuracy of the use of the marker in comparison with a stable isotope of sucrose ([ 13 C]sucrose) measured by a specific liquid chromatography-tandem mass spectrometry method. Rats received single doses of each marker, and the K in values were determined. Surprisingly, the K in value of [ 13 C]sucrose was 6- to 7-fold lower than that of [ 14 C]sucrose. Chromatographic fractionation after in vivo administration of [ 14 C]sucrose indicated that the majority of the brain content of radioactivity belonged to compounds other than the intact [ 14 C]sucrose. However, mechanistic studies failed to reveal any substantial metabolism of the marker. The octanol:water partition coefficient of [ 14 C]sucrose was >2-fold higher than that of [ 13 C]sucrose, indicating the presence of lipid-soluble impurities in the [ 14 C]sucrose solution. Our data indicate that [ 14 C]sucrose overestimates the true BBB permeability to sucrose. We suggest that specific quantitation of the stable isotope ( 13 C) of sucrose is a more accurate alternative to the current widespread use of the radioactive sucrose as a BBB marker. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Catalytic dehydration of ethanol for poly 13 C compounds synthesis
International Nuclear Information System (INIS)
Almasan, Valer; Marginean, Petru; Lazar, Mihaela; Tusa, Florina
2003-01-01
Classical methods for the synthesis of organic compounds are not very well applied in the case of 13 C labeled compounds. One of the principal demands is to find the best method to transform a small quantity of isotopic reagent with a very high yield. In this case to obtain 13 C 2 chloroethanol from 13 C 2 ethanol there are two synthesis steps: - catalytic dehydration of ethanol to ethylene; - ethylene double bounding saturation: either via ethylene oxide (30% yield) or in diluted solution of chlorine. For the first step of synthesis we choose the thermal dehydration over alumina catalyst at 400 deg C. There were tested 2 samples of g alumina with 255 m 2 /g and 355 m 2 /g with very good results. In the second step of the synthesis we used the chlorine addition to ethylene in very diluted water solution. We have built a reactor which combined the two steps of this synthesis method to produce 13 C 2 chloroethanol from 13 C 2 ethanol. The global yield of method was 42%. (authors)
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Deelchand, Dinesh K.; Nelson, Christopher; Shestov, Alexander A.; Uğurbil, Kâmil; Henry, Pierre-Gilles
2009-02-01
In this work the feasibility of measuring neuronal-glial metabolism in rat brain in vivo using co-infusion of [1,6- 13C 2]glucose and [1,2- 13C 2]acetate was investigated. Time courses of 13C spectra were measured in vivo while infusing both 13C-labeled substrates simultaneously. Individual 13C isotopomers (singlets and multiplets observed in 13C spectra) were quantified automatically using LCModel. The distinct 13C spectral pattern observed in glutamate and glutamine directly reflected the fact that glucose was metabolized primarily in the neuronal compartment and acetate in the glial compartment. Time courses of concentration of singly and multiply-labeled isotopomers of glutamate and glutamine were obtained with a temporal resolution of 11 min. Although dynamic metabolic modeling of these 13C isotopomer data will require further work and is not reported here, we expect that these new data will allow more precise determination of metabolic rates as is currently possible when using either glucose or acetate as the sole 13C-labeled substrate.
Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho
2010-01-01
Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Holm, René; Porter, Christopher J H; Edwards, Glenn A
2003-01-01
The potential for lipidic self-microemulsifying drug delivery systems (SMEDDS) containing triglycerides with a defined structure, where the different fatty acids on the glycerol backbone exhibit different metabolic fate, to improve the lymphatic transport and the portal absorption of a poorly water......-soluble drug, halofantrine, were investigated in fasted lymph cannulated canines. Two different structured triglycerides were incorporated into the SMEDDS; 1,3-dioctanoyl-2-linoleyl-sn-glycerol (C8:0-C18:2-C8:0) (MLM) and 1,3-dilinoyl-2-octanoyl-sn-glycerol (C18:2-C8:0-C18:2) (LML). A previously optimised...... availability was affected by the triglyceride incorporated into the multi-component delivery system and availabilities of 56.9% (MLM) and 37.2% (LML) were found. These data indicate that the pharmaceutical scientist can use the structure of the lipid to affect the relative contribution of the two absorption...
DEFF Research Database (Denmark)
Sperlich, Peter
Ice core records of δ13C-CH4 reflect the variability of CH4 biogeochemistry in response to climate change and show this system is far more complex than expected. The first part of this work is concerned with the development of analytical techniques that allow 1) precise referencing and 2) measure......Ice core records of δ13C-CH4 reflect the variability of CH4 biogeochemistry in response to climate change and show this system is far more complex than expected. The first part of this work is concerned with the development of analytical techniques that allow 1) precise referencing and 2......) measurements of δ13C-CH4 in ice core samples as is required when δ13C-CH4 records that are measured in several laboratories are merged for analysis. Both the referencing and measurement techniques have been compared to further laboratories which proofed the accuracy of the analytical systems. The second part...
Directory of Open Access Journals (Sweden)
AS Carrijo
2000-09-01
Full Text Available Os isótopos estáveis do carbono que eram utilizados em estudos ecológicos e paleoecológicos apresentaram um incremento nos últimos trinta anos, na utilização em estudos dietéticos em animais. Entretanto, existem poucas informações sobre o padrão metabólico e sobre as taxas de turnover do 13C em aves. O presente experimento estabeleceu curvas de substituição e taxas de movimentação do 13C no ovo e no fígado de aves de postura adultas, pela substituição da ração comercial por dietas compostas de grãos dos ciclos fotossintéticos C3 e C4, durante 50 dias. A diferença no conteúdo isotópico do delta per mil do carbono-13 (delta‰ 13C entre as duas dietas foi de 16,13‰. A taxa de substituição do 13C das dietas, nos tecidos, adequou-se num modelo exponencial, descrevendo o turnover do carbono nos tecidos analisados. As taxas de movimentação do 13C, nas aves alimentadas com dieta baseada em grãos C3, foi maior no fígado em relação ao ovo, com valores para a meia-vida de 2,9 e 3,7 dias, respectivamente. As aves que receberam ração com grãos C4 apresentaram uma taxa de turnover no ovo superior àquela obtida para o fígado, com meia-vida de 4,0 e 5,3 dias, respectivamente. Os valores do delta‰13C observados para ovo e fígado diferiram em aproximadamente 2‰ daqueles referentes às dietas.The stable carbon isotopes used in ecology and paleoecology during the last 30 years has now been used in dietary studies of animals. However, there are not enough studies on the metabolism patterns and turnover rates of the 13C in avian. This experiment established the turnover rates of the 13C in egg and liver tissues of adult laying hens through the substitution of commercial diets by diets containing C3 and C4 photosynthetic cycle grains for 50 days. The delta‰13C difference in two diets contents was 16.13‰. The diets 13C turnover rates in tissues were adapted in an exponential model that describes the isotopic carbon
14C and 13C in the atmosphere and soil air at two localities of Slovakia
International Nuclear Information System (INIS)
Sivo, A.; Simon, J.; Richtarikova, M.; Holy, K.; Polaskova, A.; Bulko, M.; Hola, O.
2006-01-01
In this paper there are presented the long-term measurements of 13 R and 14 R in urban and countryside atmosphere. The different conditions and particularities of both the localities which influence on the mentioned characteristics are pointed out. The existence of δ 13 C and δ 14 C variations and their phase correlation were confirmed as well as their origin were qualitatively explained. By means of the non-linear regression and harmonic analysis the trends of δ 13 C and δ 14 C variations was found. The study of δ 13 C and δ 14 C courses has shown that it can be used as an effective tool to determine the level of the anthropogenic CO 2 pollution of the atmosphere. (authors)
Tumor-promoting phorbol esters effect alkalinization of canine renal proximal tubular cells
International Nuclear Information System (INIS)
Mellas, J.; Hammerman, M.R.
1986-01-01
We have demonstrated the presence of specific receptors for tumor-promoting phorbol esters in the plasma membrane of the canine renal proximal tubular cell. These compounds affect proximal tubular metabolism in vitro. For example, we have shown that they inhibit gluconeogenesis in canine renal proximal tubular segments. Tumor-promoting phorbol esters have been shown to effect alkalinization of non-renal cells, by enhancing Na + -H + exchange across the plasma membrane. To determine whether the actions of tumor-promoting phorbol esters in proximal tubular segments might be mediated by a similar process, we incubated suspensions of segments from dog kidney with these compounds and measured changes in intracellular pH using [ 14 C]-5,5-dimethoxazoladine-2-4-dione (DMO) and flow dialysis. Incubation of segments with phorbol 12,13 dibutyrate, but not inactive phorbol ester, 4 γ phorbol, effected alkalinization of cells within the segments in a concentration-dependent manner. Alkalinization was dependent upon the presence of extracellular [Na + ] > intracellular [Na + ], was prevented by amiloride and was demonstrable in the presence of SITS. Our findings suggest that tumor-promoting esters stimulate the Na + -H + exchanger known to be present in the brush border membrane of the renal proximal tubular cell. It is possible that the stimulation reflects a mechanism by which phorbol esters affect metabolic processes in these cells
Directory of Open Access Journals (Sweden)
Christopher A Hamm
Full Text Available Abnormal patterns of DNA methylation are observed in several types of human cancer. While localized DNA methylation of CpG islands has been associated with gene silencing, the effect that genome-wide loss of methylation has on tumorigenesis is not completely known. To examine its effect on tumorigenesis, we induced DNA demethylation in a rat model of human chondrosarcoma using 5-aza-2-deoxycytidine. Rat specific pyrosequencing assays were utilized to assess the methylation levels in both LINEs and satellite DNA sequences following 5-aza-2-deoxycytidine treatment. Loss of DNA methylation was accompanied by an increase in invasiveness of the rat chondrosarcoma cells, in vitro, as well as by an increase in tumor growth in vivo. Subsequent microarray analysis provided insight into the gene expression changes that result from 5-aza-2-deoxycytidine induced DNA demethylation. In particular, two genes that may function in tumorigenesis, sox-2 and midkine, were expressed at low levels in control cells but upon 5-aza-2-deoxycytidine treatment these genes became overexpressed. Promoter region DNA analysis revealed that these genes were methylated in control cells but became demethylated following 5-aza-2-deoxycytidine treatment. Following withdrawal of 5-aza-2-deoxycytidine, the rat chondrosarcoma cells reestablished global DNA methylation levels that were comparable to that of control cells. Concurrently, invasiveness of the rat chondrosarcoma cells, in vitro, decreased to a level indistinguishable to that of control cells. Taken together these experiments demonstrate that global DNA hypomethylation induced by 5-aza-2-deoxycytidine may promote specific aspects of tumorigenesis in rat chondrosarcoma cells.
Breit, S; Künzel, W
2004-08-01
Vertebral and inter-vertebral parameters obtained in large breeds (n = 74), small breeds (n = 35), and Dachshunds (n = 30) were compared to reveal potential differences in the range of motion of the cervical spine between these three groups of breeds. Body size normalized dimensions of vertebral and inter-vertebral parameters and correlations between these indicate large canine breeds to have a tendency towards higher range of motion in sagittal rotation and lateral bending compared with Dachshunds and small breeds. Higher mobility in large breeds is based on significantly (P inter-vertebral discs, wider but shorter cranial and caudal articular surfaces, larger differences in width between caudal and cranial joining facets (compared with Dachshunds from C3/4 to C6/7, compared with small breeds from C4/5 to C5/6), and larger differences in length between caudal and cranial joining facets. Large differences in width between caudal and cranial joining facets were associated with small distances between the most medial (C3/4 to C6/7) and lateral (C3/4 to C5/6) aspects of the articular surfaces as well as with small differences in length between caudal and cranial joining facets (C3/4 to C5/6). This suggests that from C3/4 to C5/6 a higher range of motion in lateral bending is coupled to a lower range of motion in sagittal rotation. The present findings contribute also to explain the higher incidence of degenerative lesions of the cervical spine in large dogs.
Antitumor effects of celecoxib in COX-2 expressing and non-expressing canine melanoma cell lines.
Seo, Kyoung-Won; Coh, Ye-Rin; Rebhun, Robert B; Ahn, Jin-Ok; Han, Sei-Myung; Lee, Hee-Woo; Youn, Hwa-Young
2014-06-01
Cyclooxygenase-2 (COX-2) is a potential target for chemoprevention and cancer therapy. Celecoxib, a selective COX-2 inhibitor, inhibits cell growth of various types of human cancer including malignant melanoma. In dogs, oral malignant melanoma represents the most common oral tumor and is often a fatal disease. Therefore, there is a desperate need to develop additional therapeutic strategies. The purpose of this study was to investigate the anticancer effects of celecoxib on canine malignant melanoma cell lines that express varying levels of COX-2. Celecoxib induced a significant anti-proliferative effect in both LMeC and CMeC-1 cells. In the CMeC cells, treatment of 50 μM celecoxib caused an increase in cells in the G0/G1 and a decreased proportion of cells in G-2 phase. In the LMeC cells, 50 μM of celecoxib led to an increase in the percentage of cells in the sub-G1 phase and a significant activation of caspase-3 when compared to CMeC-1 cells. In conclusion, these results demonstrate that celecoxib exhibits antitumor effects on canine melanoma LMeC and CMeC-1 cells by induction of G1-S cell cycle arrest and apoptosis. Our data suggest that celecoxib might be effective as a chemotherapeutic agent against canine malignant melanoma. Copyright © 2014. Published by Elsevier Ltd.
Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.
Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen
2016-01-01
The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.
Park, Jae Mo; Josan, Sonal; Jang, Taichang; Merchant, Milton; Watkins, Ron; Hurd, Ralph E; Recht, Lawrence D; Mayer, Dirk; Spielman, Daniel M
2016-03-01
MRS of hyperpolarized [2-(13)C]pyruvate can be used to assess multiple metabolic pathways within mitochondria as the (13)C label is not lost with the conversion of pyruvate to acetyl-CoA. This study presents the first MR spectroscopic imaging of hyperpolarized [2-(13)C]pyruvate in glioma-bearing brain. Spiral chemical shift imaging with spectrally undersampling scheme (1042 Hz) and a hard-pulse excitation was exploited to simultaneously image [2-(13)C]pyruvate, [2-(13)C]lactate, and [5-(13)C]glutamate, the metabolites known to be produced in brain after an injection of hyperpolarized [2-(13)C]pyruvate, without chemical shift displacement artifacts. A separate undersampling scheme (890 Hz) was also used to image [1-(13)C]acetyl-carnitine. Healthy and C6 glioma-implanted rat brains were imaged at baseline and after dichloroacetate administration, a drug that modulates pyruvate dehydrogenase kinase activity. The baseline metabolite maps showed higher lactate and lower glutamate in tumor as compared to normal-appearing brain. Dichloroacetate led to an increase in glutamate in both tumor and normal-appearing brain. Dichloroacetate-induced %-decrease of lactate/glutamate was comparable to the lactate/bicarbonate decrease from hyperpolarized [1-(13)C]pyruvate studies. Acetyl-carnitine was observed in the muscle/fat tissue surrounding the brain. Robust volumetric imaging with hyperpolarized [2-(13)C]pyruvate and downstream products was performed in glioma-bearing rat brains, demonstrating changes in mitochondrial metabolism with dichloroacetate. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Lai, Marta; Lanz, Bernard; Poitry-Yamate, Carole; Romero, Jackeline F; Berset, Corina M; Cudalbu, Cristina; Gruetter, Rolf
2017-01-01
In vivo 13 C magnetic resonance spectroscopy (MRS) enables the investigation of cerebral metabolic compartmentation while, e.g. infusing 13 C-labeled glucose. Metabolic flux analysis of 13 C turnover previously yielded quantitative information of glutamate and glutamine metabolism in humans and rats, while the application to in vivo mouse brain remains exceedingly challenging. In the present study, 13 C direct detection at 14.1 T provided highly resolved in vivo spectra of the mouse brain while infusing [1,6- 13 C 2 ]glucose for up to 5 h. 13 C incorporation to glutamate and glutamine C4, C3, and C2 and aspartate C3 were detected dynamically and fitted to a two-compartment model: flux estimation of neuron-glial metabolism included tricarboxylic acid cycle (TCA) flux in astrocytes (V g = 0.16 ± 0.03 µmol/g/min) and neurons (V TCA n = 0.56 ± 0.03 µmol/g/min), pyruvate carboxylase activity (V PC = 0.041 ± 0.003 µmol/g/min) and neurotransmission rate (V NT = 0.084 ± 0.008 µmol/g/min), resulting in a cerebral metabolic rate of glucose (CMR glc ) of 0.38 ± 0.02 µmol/g/min, in excellent agreement with that determined with concomitant 18 F-fluorodeoxyglucose positron emission tomography ( 18 FDG PET).We conclude that modeling of neuron-glial metabolism in vivo is accessible in the mouse brain from 13 C direct detection with an unprecedented spatial resolution under [1,6- 13 C 2 ]glucose infusion.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Impact of CYP2C8*3 polymorphism on in vitro metabolism of imatinib to N-desmethyl imatinib.
Khan, Muhammad Suleman; Barratt, Daniel T; Somogyi, Andrew A
2016-01-01
1. Imatinib is metabolized to N-desmethyl imatinib by CYPs 3A4 and 2C8. The effect of CYP2C8*3 genotype on N-desmethyl imatinib formation was unknown. 2. We examined imatinib N-demethylation in human liver microsomes (HLMs) genotyped for CYP2C8*3, in CYP2C8*3/*3 pooled HLMs and in recombinant CYP2C8 and CYP3A4 enzymes. Effects of CYP-selective inhibitors on N-demethylation were also determined. 3. A single-enzyme Michaelis-Menten model with autoinhibition best fitted CYP2C8*1/*1 HLM (n = 5) and recombinant CYP2C8 kinetic data (median ± SD Ki = 139 ± 61 µM and 149 µM, respectively). Recombinant CYP3A4 showed two-site enzyme kinetics with no autoinhibition. Three of four CYP2C8*1/*3 HLMs showed single-enzyme kinetics with no autoinhibition. Binding affinity was higher in CYP2C8*1/*3 than CYP2C8*1/*1 HLM (median ± SD Km = 6 ± 2 versus 11 ± 2 µM, P=0.04). CYP2C8*3/*3 (pooled HLM) also showed high binding affinity (Km = 4 µM) and single-enzyme weak autoinhibition (Ki = 449 µM) kinetics. CYP2C8 inhibitors reduced HLM N-demethylation by 47-75%, compared to 0-30% for CYP3A4 inhibitors. 4. In conclusion, CYP2C8*3 is a gain-of-function polymorphism for imatinib N-demethylation, which appears to be mainly mediated by CYP2C8 and not CYP3A4 in vitro in HLM.
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-09-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.
3D Hyperpolarized C-13 EPI with Calibrationless Parallel Imaging
DEFF Research Database (Denmark)
Gordon, Jeremy W.; Hansen, Rie Beck; Shin, Peter J.
2018-01-01
With the translation of metabolic MRI with hyperpolarized 13C agents into the clinic, imaging approaches will require large volumetric FOVs to support clinical applications. Parallel imaging techniques will be crucial to increasing volumetric scan coverage while minimizing RF requirements and tem...... strategies to accelerate and undersample hyperpolarized 13C data using 3D blipped EPI acquisitions and multichannel receive coils, and demonstrated its application in a human study of [1-13C]pyruvate metabolism....
(13)C MR spectroscopy study of lactate as substrate for rat brain.
Qu, H; Håberg, A; Haraldseth, O; Unsgård, G; Sonnewald, U
2000-01-01
In order to address the question whether lactate in blood can serve as a precursor for cerebral metabolites, fully awake rats were injected intravenously with [U-(13)C]lactate or [U-(13)C]glucose followed 15 min later by decapitation. Incorporation of label from [U-(13)C]glucose was seen mainly in glutamate, GABA, glutamine, aspartate, alanine and lactate. More label was found in glutamate than glutamine, underscoring the predominantly neuronal metabolism of pyruvate from [U-(13)C]glucose. It was estimated that the neuronal metabolism of acetyl CoA from glucose accounts for at least 66% and the glial for no more than 34% of the total glucose consumption. When [U-(13)C]lactate was the precursor, label incorporation was similar to that observed from [U-(13)C]glucose, but much reduced. Plasma analysis revealed the presence of approximately equal amounts of [1,2,3-(13)C]- and [1,2-(13)C]glucose, showing gluconeogenesis from [U-(13)C]lactate. It was thus possible that the labeling seen in the cerebral amino acids originated from labeled glucose, not [U-(13)C]lactate. However, the presence of significantly more label in [U-(13)C]- than in [2,3-(13)C]alanine demonstrated that [U-(13)C]lactate did indeed cross the blood-brain barrier, and was metabolized further in the brain. Furthermore, contributions from pyruvate carboxylase (glial enzyme) were detectable in glutamine, glutamate and GABA, and were comparatively more pronounced in the glucose group. This indicated that relatively more pyruvate from lactate than glucose was metabolized in neurons. Surprisingly, the same amount of lactate was synthesized via the tricarboxylic acid cycle in both groups, indicating transfer of neurotransmitters from the neuronal to the astrocytic compartment, as previous studies have shown that this lactate is synthesized primarily in astrocytes. Taking into consideration that astrocytes take up glutamate more avidly than GABA, it is conceivable that neuronal lactate metabolism was more
13C-NMR of diterpenes with pimarane skeleton
International Nuclear Information System (INIS)
Garcez, W.S.; Pereira, A.L.; Silva Queiroz, P.P. da; Silva, R.S. da; Valente, L.M.M.; Peixoto, E.M.; Cunha Pinto, A. da
1981-01-01
The effect of substituent groups on the chemical shift of carbons using nuclear magnetic resonance spectra of carbon 13 ( 13 C-NMR) is discussed. Diterpenes having pimarane skeleton, isolated from plants of Velloziaceae family are analysed. (ARHC) [pt
Johnson, Robert L.; Anderson, Jason M.; Shanks, Brent H.; Fang, Xiaowen; Hong, Mei; Schmidt-Rohr, Klaus
2013-09-01
Two robust combinations of spectral editing techniques with 2D 13Csbnd 13C NMR have been developed for characterizing the aromatic components of 13C-enriched low-temperature carbon materials. One method (exchange with protonated and nonprotonated spectral editing, EXPANSE) selects cross peaks of protonated and nearby nonprotonated carbons, while the other technique, dipolar-dephased double-quantum/single-quantum (DQ/SQ) NMR, selects signals of bonded nonprotonated carbons. Both spectra are free of a diagonal ridge, which has many advantages: Cross peaks on the diagonal or of small intensity can be detected, and residual spinning sidebands or truncation artifacts associated with the diagonal ridge are avoided. In the DQ/SQ experiment, dipolar dephasing of the double-quantum coherence removes protonated-carbon signals; this approach also eliminates the need for high-power proton decoupling. The initial magnetization is generated with minimal fluctuation by combining direct polarization, cross polarization, and equilibration by 13C spin diffusion. The dipolar dephased DQ/SQ spectrum shows signals from all linkages between aromatic rings, including a distinctive peak from polycondensed aromatics. In EXPANSE NMR, signals of protonated carbons are selected in the first spectral dimension by short cross polarization combined with dipolar dephasing difference. This removes ambiguities of peak assignment to overlapping signals of nonprotonated and protonated aromatic carbons, e.g. near 125 ppm. Spin diffusion is enhanced by dipolar-assisted rotational resonance. Before detection, Csbnd H dipolar dephasing by gated decoupling is applied, which selects signals of nonprotonated carbons. Thus, only cross peaks due to magnetization originating from protonated C and ending on nearby nonprotonated C are retained. Combined with the chemical shifts deduced from the cross-peak position, this double spectral editing defines the bonding environment of aromatic, COO, and Cdbnd O carbons
Typing of Canine Parvovirus Strains Circulating in North-East China.
Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S
2017-04-01
Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.
Iida, K; Hidoh, O; Fukami, J; Kajiwara, M
1991-01-01
Carbon-13 nuclear magnetic resonance spectroscopy has been used to observe the transformations of [1-13C]-D-glucose to [1,1'-13C2]-D-trehalose, and [3-13C]-L-alanine to [2-13C]-L-glutamic acid in the living body of Gryllodes sigillatus. [3-13C]-D-Alanine was not metabolized. The metabolic rate of [1-13C]-D-glucose was found to be altered by prior injection of boric acid.
C-12/C-13 Ratio in Ethane on Titan and Implications for Methane's Replenishment
Jennings, Donald E.; Romani, Paul N.; Bjoraker, Gordon L.; Sada, Pedro V.; Nixon, Conor A.; Lunsford, Allen W.; Boyle, Robert J.; Hesman, Brigette E.; McCabe, George H.
2009-01-01
The C-12/C-13 abundance ratio in ethane in the atmosphere of Titan has been measured at 822 cm(sup -1) from high spectral resolution ground-based observations. The value 89(8), coincides with the telluric standard and also agrees with the ratio seen in the outer planets. It is almost identical to the result for ethane on Titan found by the composite infrared spectrometer (CIRS) on Cassini. The C-12/C-13 ratio for ethane is higher than the ratio measured in atmospheric methane by Cassini/Huygens GCMS, 82.3(l), representing an enrichment of C-12 in the ethane that might be explained by a kinetic isotope effect of approximately 1.1 in the formation of methyl radicals. If methane is being continuously resupplied to balance photochemical destruction, then we expect the isotopic composition in the ethane product to equilibrate at close to the same C-12/C-13 ratio as that in the supply. The telluric value of the ratio in ethane then implies that the methane reservoir is primordial.
Albarracín, Viviana; Teles, Mariana; Meléndez-Lazo, Antonio; Rodón, Jaume; Pastor, Josep
2015-06-01
Animals treated with anticonvulsant drugs may have increased canine pancreas-specific lipase (cPLI) values. Inflammatory conditions and specifically acute pancreatitis are of major concern in these animals. Elevation in C-reactive protein is being associated with inflammatory status in dogs and it has been correlated with the clinical severity of pancreatitis. In the present study, we investigated if there is a correlation between the cPLI increase, changes in C-reactive protein and hepatic enzymes, as well as the incidence of severe acute pancreatitis (AP) in dogs with anticonvulsant treatment (phenobarbital, or potassium bromide or both). Increased values of pancreas-specific lipase were found in 6.8% of the animals in treatment with anticonvulsants, and this increase is correlated with the increase in triglycerides, alkaline phosphatase, and alanine aminotransferase but not with C-reactive protein levels, which suggests a possible induction or release phenomenon rather than a clear severe AP. C-reactive protein levels did not affect cPLI values on the population studied. Only 2 animals had clinical and analytical data suggestive of AP, indicating a low prevalence (0.6%). In conclusion, cPLI may be increased in a low percentage of animals with anticonvulsants treatment and its increase may not be associated with severe AP. It may be induced by the anticonvulsants drugs; however, further studies are advised to rule out other possible causes that increased cPLI. Copyright © 2015 Elsevier Inc. All rights reserved.
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
13C metabolic flux analysis: optimal design of isotopic labeling experiments.
Antoniewicz, Maciek R
2013-12-01
Measuring fluxes by 13C metabolic flux analysis (13C-MFA) has become a key activity in chemical and pharmaceutical biotechnology. Optimal design of isotopic labeling experiments is of central importance to 13C-MFA as it determines the precision with which fluxes can be estimated. Traditional methods for selecting isotopic tracers and labeling measurements did not fully utilize the power of 13C-MFA. Recently, new approaches were developed for optimal design of isotopic labeling experiments based on parallel labeling experiments and algorithms for rational selection of tracers. In addition, advanced isotopic labeling measurements were developed based on tandem mass spectrometry. Combined, these approaches can dramatically improve the quality of 13C-MFA results with important applications in metabolic engineering and biotechnology. Copyright © 2013 Elsevier Ltd. All rights reserved.
Measurement of the natural variation of 13C/12C isotope ratio in organic samples
International Nuclear Information System (INIS)
Ducatti, C.
1977-01-01
The isotopic ratio analysis for 13 C/ 12 C by mass spectrometry using a 'Working standard' allows the study of 13 C natural variation in organic material, with a total analytical error of less than 0,2%. Equations were derived in order to determine 13 C/ 12 C and 18 O/ 16 O ratios related to the 'working standard' CENA-std and to the international standard PDB. Isotope ratio values obtained with samples prepared in two different combustion apparatus were compared; also the values obtained preparing samples by acid decomposition of carbonaceous materials were compared with the values obtained in different international laboratories. Utilizing the methodology proposed, several leaves collected at different heights of different vegetal species, found 'inside' and 'outside' of the Ducke Forest Reserve, located in the Amazon region, are analysed. It is found that the 13 C natural variation depends upon metabolic process and environmental factors, both being factors which may be qualified as parcial influences on the CO 2 cycle in the forest. (author) [pt
Fish Movement and Dietary History Derived from Otolith (delta)13C
Energy Technology Data Exchange (ETDEWEB)
Weber, P K; Finlay, J C; Power, M E; Phillis, C C; Ramon, C E; Eaton, G F; Ingram, B L
2005-09-08
Habitat use and food web linkages are critical data for fish conservation and habitat restoration efforts, particularly for threatened salmonids species. Otolith microchemistry has been shown to be a powerful tool for reconstructing fish movement, but over small distances (kilometers), geology-derived differences in otolith chemistry are rare. Here, we demonstrate that otolith {sup 13}C/{sup 12}C ratio (i.e. {delta}{sup 13}C) of anadromous steelhead trout can be used to distinguish residence in small streams from residence in larger streams and rivers. While previous research has shown that water dissolved inorganic carbon {delta}{sup 13}C is the primary source of carbon in otoliths, the downstream change in food {delta}{sup 13}C in this watershed appears to be the primary control on otolith {delta}{sup 13}C. As a result, this method can also be applied to the problem of reconstructing feeding history at a location.
International Nuclear Information System (INIS)
Zambrano, Pilar; Sandoval, Karina; Trejo-Becerril, Catalina; Chanona-Vilchis, Jose; Duenas-González, Alfonso; Segura-Pacheco, Blanca; Perez-Cardenas, Enrique; Cetina, Lucely; Revilla-Vazquez, Alma; Taja-Chayeb, Lucía; Chavez-Blanco, Alma; Angeles, Enrique; Cabrera, Gustavo
2005-01-01
The antihypertensive compound hydralazine is a known demethylating agent. This phase I study evaluated the tolerability and its effects upon DNA methylation and gene reactivation in patients with untreated cervical cancer. Hydralazine was administered to cohorts of 4 patients at the following dose levels: I) 50 mg/day, II) 75 mg/day, III) 100 mg/day and IV) 150 mg/day. Tumor biopsies and peripheral blood samples were taken the day before and after treatment. The genes APC, MGMT; ER, GSTP1, DAPK, RARβ, FHIT and p16 were evaluated pre and post-treatment for DNA promoter methylation and gene expression by MSP (Methylation-Specific PCR) and RT-PCR respectively in each of the tumor samples. Methylation of the imprinted H19 gene and the 'normally methylated' sequence clone 1.2 was also analyzed. Global DNA methylation was analyzed by capillary electrophoresis and cytosine extension assay. Toxicity was evaluated using the NCI Common Toxicity Criteria. Hydralazine was well tolerated. Toxicities were mild being the most common nausea, dizziness, fatigue, headache and palpitations. Overall, 70% of the pretreatment samples and all the patients had at least one methylated gene. Rates of demethylation at the different dose levels were as follows: 50 mg/day, 40%; 75 mg/day, 52%, 100 mg/day, 43%, and 150 mg/day, 32%. Gene expression analysis showed only 12 informative cases, of these 9 (75%) re-expressed the gene. There was neither change in the methylation status of H19 and clone 1.2 nor changes in global DNA methylation. Hydralazine at doses between 50 and 150 mg/day is well tolerated and effective to demethylate and reactivate the expression of tumor suppressor genes without affecting global DNA methylation
Coller, Janet K; Michalakas, Jennifer R; James, Heather M; Farquharson, Aaron L; Colvill, Joel; White, Jason M; Somogyi, Andrew A
2012-11-01
Management of pain in opioid dependent individuals is problematic due to numerous issues including cross-tolerance to opioids. Hence there is a need to find alternative analgesics to classical opioids and tramadol is potentially one such alternative. Methadone inhibits CYP2D6 in vivo and in vitro. We aimed to investigate the effect of methadone on the pathways of tramadol metabolism: O-demethylation (CYP2D6) to the opioid-active metabolite M1 and N-demethylation (CYP3A4) to M2 in subjects maintained on methadone or buprenorphine as a control. Compared with subjects on buprenorphine, methadone reduced the clearance of tramadol to active O-desmethyl-tramadol (M1) but had no effect on N-desmethyltramadol (M2) formation. Similar to other analgesics whose active metabolites are formed by CYP2D6 such as codeine, reduced formation of O-desmethyltramadol (M1) is likely to result in reduced analgesia for subjects maintained on methadone. Hence alternative analgesics whose metabolism is independent of CYP2D6 should be utilized in this patient population. To compare the O- (CYP2D6 mediated) and N- (CYP3A4 mediated) demethylation metabolism of tramadol between methadone and buprenorphine maintained CYP2D6 extensive metabolizer subjects. METHODS Nine methadone and seven buprenorphine maintained subjects received a single 100 mg dose of tramadol hydrochloride. Blood was collected at 4 h and assayed for tramadol, methadone, buprenorphine and norbuprenorphine (where appropriate) and all urine over 4 h was assayed for tramadol and its M1 and M2 metabolites. The urinary metabolic ratio [median (range)] for O-demethylation (M1) was significantly lower (P= 0.0002, probability score 1.0) in the subjects taking methadone [0.071 (0.012-0.103)] compared with those taking buprenorphine [0.192 (0.108-0.392)], but there was no significant difference (P= 0.21, probability score 0.69) in N-demethylation (M2). The percentage of dose [median (range)] recovered as M1 was significantly lower
Calderon, Marina Gallo; Mattion, Nora; Bucafusco, Danilo; Fogel, Fernando; Remorini, Patricia; La Torre, Jose
2009-08-01
PCR amplification with sequence-specific primers was used to detect canine parvovirus (CPV) DNA in 38 rectal swabs from Argentine domestic dogs with symptoms compatible with parvovirus disease. Twenty-seven out of 38 samples analyzed were CPV positive. The classical CPV2 strain was not detected in any of the samples, but nine samples were identified as CPV2a variant and 18 samples as CPV2b variant. Further sequence analysis revealed a mutation at amino acid 426 of the VP2 gene (Asp426Glu), characteristic of the CPV2c variant, in 14 out of 18 of the samples identified initially by PCR as CPV2b. The appearance of CPV2c variant in Argentina might be dated at least to the year 2003. Three different pathogenic CPV variants circulating currently in the Argentine domestic dog population were identified, with CPV2c being the only variant affecting vaccinated and unvaccinated dogs during the year 2008.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Vokhshoori, N. L.; Larsen, T.; McCarthy, M.
2012-12-01
Compound-specific isotope analysis of amino acids (CSI-AA) is a technique used to decouple trophic enrichment patterns from source changes at the base of the food web. With this new emerging tool, it is possible to precisely determine both trophic position and δ15N or δ13C source values in higher feeding organisms. While most work to date has focused on nitrogen (N) isotopic values, early work has suggested that δ13C CSI-AA has great potential as a new tracer both to a record δ13C values of primary production (unaltered by trophic transfers), and also to "fingerprint" specific carbon source organisms. Since essential amino acids (EAA) cannot be made de novo in metazoans but must be obtained from diet, the δ13C value of the primary producer is preserved through the food web. Therefore, the δ13C values of EAAs act as a unique signature of different primary producers and can be used to fingerprint the dominant carbon (C) source driving primary production at the base of the food web. In littoral ecosystems, such as the California Upwelling System (CUS), the likely dominant C sources of suspended particulate organic matter (POM) pool are kelp, upwelling phytoplankton or estuarine phytoplankton. While bulk isotopes of C and N are used extensively to resolve relative consumer hierarchy or shifting diet in a food web, we found that the δ13C bulk values in mussels cannot distinguish exact source in littoral ecosystems. Here we show 15 sites within the CUS, between Cape Blanco, OR and La Jolla, CA where mussels were sampled and analyzed for both bulk δ13C and CSI-AA. We found no latitudinal trends, but rather average bulk δ13C values for the entire coastal record were highly consistent (-15.7 ± 0.9‰). The bulk record would suggest either nutrient provisioning from kelp or upwelled phytoplankton, but 13C-AA fingerprinting confines these two sources to upwelling. This suggests that mussels are recording integrated coastal phytoplankton values, with the enriched
Poorman, Kelsey; Borst, Luke; Moroff, Scott; Roy, Siddharth; Labelle, Philippe; Motsinger-Reif, Alison; Breen, Matthew
2015-06-01
Melanocytic lesions originating from the oral mucosa or cutaneous epithelium are common in the general dog population, with up to 100,000 diagnoses each year in the USA. Oral melanoma is the most frequent canine neoplasm of the oral cavity, exhibiting a highly aggressive course. Cutaneous melanocytomas occur frequently, but rarely develop into a malignant form. Despite the differential prognosis, it has been assumed that subtypes of melanocytic lesions represent the same disease. To address the relative paucity of information about their genomic status, molecular cytogenetic analysis was performed on the three recognized subtypes of canine melanocytic lesions. Using array comparative genomic hybridization (aCGH) analysis, highly aberrant distinct copy number status across the tumor genome for both of the malignant melanoma subtypes was revealed. The most frequent aberrations included gain of dog chromosome (CFA) 13 and 17 and loss of CFA 22. Melanocytomas possessed fewer genome wide aberrations, yet showed a recurrent gain of CFA 20q15.3-17. A distinctive copy number profile, evident only in oral melanomas, displayed a sigmoidal pattern of copy number loss followed immediately by a gain, around CFA 30q14. Moreover, when assessed by fluorescence in situ hybridization (FISH), copy number aberrations of targeted genes, such as gain of c-MYC (80 % of cases) and loss of CDKN2A (68 % of cases), were observed. This study suggests that in concordance with what is known for human melanomas, canine melanomas of the oral mucosa and cutaneous epithelium are discrete and initiated by different molecular pathways.
Intracellular Route of Canine Parvovirus Entry
Vihinen-Ranta, Maija; Kalela, Anne; Mäkinen, Päivi; Kakkola, Laura; Marjomäki, Varpu; Vuento, Matti
1998-01-01
The present study was designed to investigate the endocytic pathway involved in canine parvovirus (CPV) infection. Reduced temperature (18°C) or the microtubule-depolymerizing drug nocodazole was found to inhibit productive infection of canine A72 cells by CPV and caused CPV to be retained in cytoplasmic vesicles as indicated by immunofluorescence microscopy. Consistent with previously published results, these data indicate that CPV enters a host cell via an endocytic route and further suggest that microtubule-dependent delivery of CPV to late endosomes is required for productive infection. Cytoplasmic microinjection of CPV particles was used to circumvent the endocytosis and membrane fusion steps in the entry process. Microinjection experiments showed that CPV particles which were injected directly into the cytoplasm, thus avoiding the endocytic pathway, were unable to initiate progeny virus production. CPV treated at pH 5.0 prior to microinjection was unable to initiate virus production, showing that factors of the endocytic route other than low pH are necessary for the initiation of infection by CPV. PMID:9420290
International Nuclear Information System (INIS)
Hamelin, Stéphanie; Planas, Dolors; Amyot, Marc
2015-01-01
Wetlands in large rivers are important sites of production of the neurotoxin methylmercury (MeHg), and the periphyton growing on wetland macrophytes are increasingly recognized as key players in this production and transfer in food webs. Information is lacking about mercury methylation (K m ) and demethylation (K d ) rates in periphytic biofilms from the Northern Hemisphere, as well as about the drivers of net MeHg production, hampering ecosystem modeling of Hg cycling. Mercury methylation and demethylation rates were measured in periphytic biofilms growing on submerged plants in a shallow fluvial lake located in a temperate cold region (St. Lawrence River, Quebec, Canada). Incubations were performed in situ within macrophyte beds using low-level spikes of 199 HgO and Me 200 Hg stable isotopes as tracers. A direct relationship was observed between K m (0.002 to 0.137 d −1 ) and [MeHg] in periphyton. A similar relationship was found between K d (0.096 to 0.334 d −1 ) and [inorganic Hg]. Periphyton of Lake St. Pierre reached high levels of net MeHg production that were two orders of magnitude higher than those found in local sediment. This production varied through the plant growing season and was mainly driven by environmental variables such as depth of growth, available light, dissolved oxygen, temperature, plant community structure, and productivity of the habitat. - Highlights: • Periphyton Hg methylation and demethylation were studied in a large fluvial lake. • Addition of stable Hg isotopes was used to obtain in situ rates for these processes. • Net methylation was higher in periphyton than in local sediments. • Methylation and demethylation rates fluctuated during the summer. • Key drivers of rates were depth, light, temperature, and community structure
Energy Technology Data Exchange (ETDEWEB)
Hamelin, Stéphanie; Planas, Dolors [GRIL, Département de sciences biologiques, Université du Québec à Montréal, C.P. 8888, Succursale Centre-Ville, Montreal, Quebec H3C 3P8 (Canada); Amyot, Marc [GRIL, Département de sciences biologiques, Université de Montréal, C.P. 6128, Succursale Centre-Ville, Montréal, Quebec H3C 3J7 (Canada)
2015-04-15
Wetlands in large rivers are important sites of production of the neurotoxin methylmercury (MeHg), and the periphyton growing on wetland macrophytes are increasingly recognized as key players in this production and transfer in food webs. Information is lacking about mercury methylation (K{sub m}) and demethylation (K{sub d}) rates in periphytic biofilms from the Northern Hemisphere, as well as about the drivers of net MeHg production, hampering ecosystem modeling of Hg cycling. Mercury methylation and demethylation rates were measured in periphytic biofilms growing on submerged plants in a shallow fluvial lake located in a temperate cold region (St. Lawrence River, Quebec, Canada). Incubations were performed in situ within macrophyte beds using low-level spikes of {sup 199}HgO and Me{sup 200}Hg stable isotopes as tracers. A direct relationship was observed between K{sub m} (0.002 to 0.137 d{sup −1}) and [MeHg] in periphyton. A similar relationship was found between K{sub d} (0.096 to 0.334 d{sup −1}) and [inorganic Hg]. Periphyton of Lake St. Pierre reached high levels of net MeHg production that were two orders of magnitude higher than those found in local sediment. This production varied through the plant growing season and was mainly driven by environmental variables such as depth of growth, available light, dissolved oxygen, temperature, plant community structure, and productivity of the habitat. - Highlights: • Periphyton Hg methylation and demethylation were studied in a large fluvial lake. • Addition of stable Hg isotopes was used to obtain in situ rates for these processes. • Net methylation was higher in periphyton than in local sediments. • Methylation and demethylation rates fluctuated during the summer. • Key drivers of rates were depth, light, temperature, and community structure.
Directory of Open Access Journals (Sweden)
Roman T Kellenberger
Full Text Available Plants have to fine-tune their signals to optimise the trade-off between herbivore deterrence and pollinator attraction. An important mechanism in mediating plant-insect interactions is the regulation of gene expression via DNA methylation. However, the effect of herbivore-induced DNA methylation changes on pollinator-relevant plant signalling has not been systematically investigated. Here, we assessed the impact of foliar herbivory on DNA methylation and floral traits in the model crop plant Brassica rapa. Methylation-sensitive amplified fragment length polymorphism (MSAP analysis showed that leaf damage by the caterpillar Pieris brassicae was associated with genome-wide methylation changes in both leaves and flowers of B. rapa as well as a downturn in flower number, morphology and scent. A comparison to plants with jasmonic acid-induced defence showed similar demethylation patterns in leaves, but both the floral methylome and phenotype differed significantly from P. brassicae infested plants. Standardised genome-wide demethylation with 5-azacytidine in five different B. rapa full-sib groups further resulted in a genotype-specific downturn of floral morphology and scent, which significantly reduced the attractiveness of the plants to the pollinator bee Bombus terrestris. These results suggest that DNA methylation plays an important role in adjusting plant signalling in response to changing insect communities.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Relationships between tobacco leaf δ"1"3C and physiological characteristics
International Nuclear Information System (INIS)
Wang Yi; Song Pengfei; Yan Kan; Tan Shuwen; Wu Xiaoxiao; Chen Zongyu
2013-01-01
In this paper, the flue-cured tobacco K326 was employed to study the abundance of carbon isotope composition, photosynthetic pigment content, soluble protein content and leaf mass per area (LMA) of tobacco leaf which were grown at four testing sites of different altitude (T_1, T_2, T_3, T_4). The correlations of carbon isotope composition with altitude, leaf position and physiological measures were understood as well. Results showed that δ"1"3C of those samples varied from -27.4‰ to -23.4‰. The δ"1"3C of samples from T_1, T_2and T_3 were increased with rising of the leaf position. δ"1"3C of middle and upper leaves from T_1, T_2and T_3 were positively correlated with altitude. However, δ"1"3C of samples from T_4 ranging from -26.8‰ to -26.4‰ was lower than the values from previous samples. The δ"1"3C also decreased with the increasing of leaf position, and was significantly negatively correlated with chlorophyll content and chlorophyll/carotinoid ratio (P < 0.05). The δ"1"3C was not significantly correlated with carotinoid content and chlorophyll a/b ratio. Meanwhile, it was positively correlated with soluble protein content and LMA significantly (P < 0.01). Generally, our findings indicated that chlorophyll content, chlorophyll/carotenoid ratio, soluble protein content, and LMA had strong relationships with δ"1"3C, whereas the relationship of δ"1"3C with altitude and leaf position was still unclear. (authors)
Synthesis of [21-14C]-fusarin C by enzymic demethylation and remethylation with [14C]-diazomethane
International Nuclear Information System (INIS)
Lu, S.-J.; Li, M.H.
1989-01-01
Fusarin C, a potent mutagen isolated from Fusarium moniliforme culture extracts, has been prepared radiolabeled in two steps by enzymic hydrolysis of the 21-methyl ester group, using phenobarbital induced microsomal preparations, followed by remethylation using [ 14 F]-diazomethane. Yields, based upon fusarin C, were essentially quantitative and approximately 10% of the [ 14 C]-methyl-nitrosourea, converted to diazomethane, reacted to yield [ 14 C]-fusarin C. (author)
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Cherry, Rose L; Smith, Jodi D; Ben-Shlomo, Gil
2018-01-01
Labial mucosa transplantation for the treatment of canine keratoconjunctivitis sicca (KCS) has been reported recently. Postoperative alleviation of clinical signs was noted and assumed to be the result of labial salivary glands providing lubrication to the ocular tissue. The aim of this study was to evaluate the presence of minor salivary glands (MSG) in the canine oral mucosa. Oral mucosal biopsies were collected from six dogs that died (n = 1) or were euthanized (n = 5) for reasons unrelated to this study. The breeds included were two Doberman Pinschers, one Labrador Retriever, one Portuguese Water Dog, one German Shepherd Dog, and one mixed canine. Three were spayed females, and three were castrated males with the median age of 9 years (range, 6-13 years). Samples were obtained by an 8-mm punch biopsy at the following locations of the canine oral cavity: upper rostral labial mucosa at midline, lower rostral labial mucosa at midline, upper labial mucosa near the commissure, lower labial mucosa near the commissure, and buccal mucosa approximately 1 cm caudal to the commissure. Samples were routinely processed with hematoxylin and eosin, and periodic acid-Schiff stains. Samples were evaluated by light microscopy. At the selected locations, no MSG or other secreting cells were detected. Minor salivary glands are not associated with alleviation of canine KCS symptoms following labial mucosa transplantation. Further studies are needed to determine the mechanism leading to the transient improvement of KCS symptoms in canine patients following labial mucosa transplantation. © 2017 American College of Veterinary Ophthalmologists.
Clinical value of 13C-UBT diagnosing infection of the Hp
International Nuclear Information System (INIS)
Xu Changde; Chen Shaoliang; Liu Wenguan
2004-01-01
100 dyspeptic patients are performed an endoscopy with biopsy for histology, rapid urease test, 13 C-urea breath test( 13 C-UBT) and ASSURE TM Hp rapid Test(HpRT). Patients are considered to be infected if both histology and biopsies yield positive results, and not infected when both tests are negative. The pathology and persons responsible for endoscopy, urease test and 13 C-UBT are unaware of the results from the other diagnostic methods. The 13 C-UBT has the following results: sensitivity 96% ,specificity 95%; rapid urease test has the following results: sensitivity 79%, specificity 76%; HpRT has the following results: sensitivity 86%, specificity 88%. 13 C-UBT provides excellent sensitivity and specificity for the diagnosis of Hp. Pylori infected Hp, it can be the first choice for detecting the infection of the Hp. (authors)
Ehling, Sarah; Baynes, Ronald E; Bäumer, Wolfgang
2018-03-01
OBJECTIVE To determine the pharmacokinetics of florfenicol, terbinafine, and betamethasone acetate after topical application to canine auricular skin and the influence of synthetic canine cerumen on pharmacokinetics. SAMPLE Auricular skin from 6 euthanized shelter dogs (3 females and 3 neutered males with no visible signs of otitis externa). PROCEDURES Skin adjacent to the external opening of the ear canal was collected and prepared for use in a 2-compartment flow-through diffusion cell system to evaluate penetration of an otic gel containing florfenicol, terbinafine, and betamethasone acetate over a 24-hour period. Radiolabeled 14 C-terbinafine hydrochloride and 3 H-betamethasone acetate were added to the gel to determine dermal penetration and distribution. Florfenicol absorption was determined by use of high-performance liquid chromatography-UV detection. Additionally, the effect of synthetic canine cerumen on the pharmacokinetics of all compounds was evaluated. RESULTS During the 24-hour experiment, mean ± SD percentage absorption without the presence of synthetic canine cerumen was 0.28 ± 0.09% for 3H-betamethasone acetate, 0.06 ± 0.06% for florfenicol, and 0.06 ± 0.02% for 14C-terbinafine hydrochloride. Absorption profiles revealed no impact of synthetic canine cerumen on skin absorption for all 3 active compounds in the gel or on skin distribution of 3 H-betamethasone acetate and 14 C-terbinafine hydrochloride. CONCLUSIONS AND CLINICAL RELEVANCE 3 H-betamethasone acetate, 14 C-terbinafine hydrochloride, and florfenicol were all absorbed in vitro through healthy auricular skin specimens within the first 24 hours after topical application. Synthetic canine cerumen had no impact on dermal absorption in vitro, but it may serve as a temporary reservoir that prolongs the release of topical drugs.
Energy Technology Data Exchange (ETDEWEB)
Shcherbakov, V.V.; Krivdin, L.B.; Kalabin, G.A.; Trofimov, B.A.
1986-11-20
The authors have previously established that the direct /sup 13/C-/sup 13/C coupling constants are stereospecific relative to the orientation of unshared electron pairs (UEP) of nitrogen and oxygen atoms. Here they show that the nitrogen UEP produces a positive contribution to the direct /sup 13/C-/sup 13/C coupling constant of an adjacent syn-periplanar carbon-carbon bond and not to a negative contribution of the corresponding constant of the anti-periplanar bond. Thus, the observed effect is not a consequence of the interaction of the heteroatom UEP with the anti-bonding orbital of the adjacent anti-periplanar bond (n/sub o-o/* interaction) as in the case of anomeric and related effects.
Directory of Open Access Journals (Sweden)
Murilo Cézar Curti
2012-12-01
Full Text Available The canine distemper is a multisystemic disease highly contagious which can lead to serious consequences and even to death. Different types of tests can be used for the ante mortem diagnosis of canine distemper, however, due to unpredictable course of the disease, the final diagnosis remains uncertain in some cases. We evaluated in 33 dogs with suspected canine distemper, the effectiveness of a commercial test for detection of antigen (Ag of canine distemper, still comparing the frequency of clinical and neurological signs among positive and negative dogs. In 27/33 dogs the material was collected from the ocular mucosa, in 5/33 dogs the test was performed with CSF and in one animal material was collected from the ocular mucosa and CSF. In 14 dogs was performed also the RT-PCR technique. The Ag test was positive in 7/13 confirmed cases of canine distemper, all of them with systemic signs, but in dogs that had only neurologic signs, the antigen test was negative. In six dogs the antigen test was negative, however the RT-PCR was positive. The results of this study showed that the antigen test did not help for the canine distemper diagnosis in many cases with systemic and neurologic signs, still allowing that several cases had false-negative results. A cinomose é uma doença multisistêmica altamente contagiosa, que pode levar a graves sequelas e até ao óbito. Diferentes tipos de exames podem ser usados para o diagnóstico ante mortem da cinomose, entretanto, devido ao curso imprevisível da doença, o diagnóstico final permanece incerto em alguns casos. O objetivo deste trabalho foi avaliar a eficácia do teste comercial de imunoensaio cromatográfico para detecção de antígeno (Ag da cinomose em 33 cães com suspeita de cinomose canina, comparandose ainda a frequência dos sinais clínicos e neurológicos entre cães positivos e negativos. Em 27/33 o material foi coletado da mucosa ocular, em 5/33 foi coletado do LCR e em um animal o
Atopic dermatitis: a restropective study of associated factors in a dermopathic canine population
Directory of Open Access Journals (Sweden)
Cristina Fernandes do Amarante
2015-12-01
Full Text Available ABSTRACT. Amarante C.F., Ramadinha R.R. & Pereira M.J.S. Atopic dermatitis: a restropective study of associated factors in a dermopathic canine population. [Dermatite atópica: um estudo retrospectivo dos fatores associados em uma população canina dermopata.] Revista Brasileira de Medicina Veteriná- ria, 37(Supl.1:13-17, 2015. Curso de Pós-Graduação em Ciências Veterinárias, Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465, Km 7, Seropédica, RJ 23897-970, Brasil. E-mail: cristinaf.amarante@gmail.com Canine atopic dermatitis (AD is a pruriginous inflammatory disease related to the production of IgE antibodies and frequently, diagnosed in the clinical veterinary practice. However, there are many controversies about the predisposing factors. The objective of this study was to analyze the contribution of the sex, age, breed, castration, time of year, the use of perfume and cleaning products as predisposing factors for the occurrence of AD using binomial generalized linear regression model estimating the prevalence ratio as a measure of effect. The clinical records of 2,280 dogs attended by the Section of Dermatology Small Animal Hospital of the Rural Federal University of Rio de Janeiro, between 2005 and 2010, were reviewed and 1,462 dogs were included in the study. Bivariate and multivariate analyses were performed using a generalized binomial linear regression model. Significance was set at a p-value of ≤ 0.05. Atopic dermatitis was diagnosed in 36.1% (528/1462 of the canine population studied and was associated with females [PR= 1.204 (1.048 to 1.384], adults [PR= 2.045 (1.542 to 2.711], the dry season [PR= 0.840 (0.734 to 0.962], the use of perfumes [PR= 1.271 (1.089 to 1.483]. Thus, atopic dermatitis prevalence in the study population was higher in females, adults, in which applied perfumes and in the rainy season. . This study constitutes a new approach to the epidemiological aspects of canine atopic
Liu, Zhaohong; Sivaguru, Paramasivam; Zanoni, Giuseppe; Anderson, Edward A; Bi, Xihe
2018-05-08
A catalyst-dependent chemoselective one-carbon insertion of diazo compounds into the C-C or C-H bonds of 1,3-dicarbonyl species is reported. In the presence of silver(I) triflate, diazo insertion into the C(=O)-C bond of the 1,3-dicarbonyl substrate leads to a 1,4-dicarbonyl product containing an all-carbon α-quaternary center. This reaction constitutes the first example of an insertion of diazo-derived carbenoids into acyclic C-C bonds. When instead scandium(III) triflate was applied as the catalyst, the reaction pathway switched to formal C-H insertion, affording 2-alkylated 1,3-dicarbonyl products. Different reaction pathways are proposed to account for this powerful catalyst-dependent chemoselectivity. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Kuge, Yuji; Kawashima, Hidefumi; Hashimoto, Tadatoshi
2000-01-01
Octanoate is taken up into the brain and is converted in astrocytes to glutamine through the tricarboxylic acid (TCA) cycle after β-oxidation. We speculate that [1- 11 C]octanoate may be used as a tracer for astroglial functions and/or fatty acid metabolism in the brain and may be useful for studying cerebral ischemia. In the present study we investigated brain distribution of [1- 11 C]octanoate and compared it with cerebral blood flow (CBF) by using rat and canine models of middle cerebral artery (MCA) occlusion and a high resolution PET. In rats brain distribution of [ 15 O]H 2 O measured 1-2 h and 5-6 h after insult was compared with that of [1- 11 C]octanoate measured 3-4 h after insult. Radioactivity ratios of lesioned to normal hemispheres determined with [ 15 O]H 2 O were lower than those determined with [1- 11 C]octanoate. These results were confirmed by a study on a canine model of MCA-occlusion. Twenty-four hours after insult, CBF decreased in the MCA-territory of the occluded hemisphere, whereas normal or higher accumulation of [1- 11 C]octanoate was observed in the ischemic regions. The uptake of [1- 11 C]octanoate-derived radioactivity therefore increased relative to CBF in the ischemic regions, indicating that [1- 11 C]octanoate provides functional information different from CBF. In conclusion, we found that [1- 11 C]octanoate is a potential radiopharmaceutical for studying the pathophysiology of cerebral ischemia. (author)
International Nuclear Information System (INIS)
Yang, Rong; Wang, Liqing; Deng, Kunfa; Lv, Mengni; Xu, Yunhua
2016-01-01
The novel Li_2Fe_1_/_3Mn_1_/_3Ni_1_/_3SiO_4/C has been successfully synthesized by a feasible solution process in ternary system. The spherical carbon-coated composites are obtained using a heat treatment in the presence of sucrose. X-ray diffraction (XRD) diffractogram displays that the Li_2Fe_1_/_3Mn_1_/_3Ni_1_/_3SiO_4/C crystallized in an orthorhombic structure with a space group of Pmn21. The energy-dispersive X-ray spectroscopy mappings indicate that Fe, Mn and Ni elements are distributed homogenously in Li_2Fe_1_/_3Mn_1_/_3Ni_1_/_3SiO_4/C nano-spherical particle with size less than 50 nm. The lithium storage capacity and cycling performance of the Li_2Fe_1_/_3Mn_1_/_3Ni_1_/_3SiO_4/C presents good results when tested as cathode materials in lithium cells at room temperature. It delivers an initial discharge capacity of 181.4 mAh g"−"1 and a discharge capacity of 172.9 mAh g"−"1 after 20 cycles at 0.1C in the voltage range of 1.5–4.6V. Furthermore, it also exhibits an excellent rate capability with a capacity under different current densities of about 144.0 mAh g"−"1 (0.2 C), 117.9 mAh g"−"1 (0.5 C), 106.1 mAh g"−"1 (1 C), respectively and a good capacity cycling maintenance of 153.7 mAh g"−"1 after 60 cycles. Above results indicate that the spherical Li_2Fe_1_/_3Mn_1_/_3Ni_1_/_3SiO_4/C becomes a very promising candidate for cathode material in lithium-ion batteries. - Highlights: • Li_2Fe_1_/_3Mn_1_/_3Ni_1_/_3SiO_4/C was obtained by solution process in a ternary system. • The material was pure phase ternary solid solution with tetrahedral morphology. • The spherical particle size was less than 50 nm with graphitized carbon coating. • The nanocomposite revealed high discharge capacity and excellent rate capability.
The use of spiral computed tomography in the localization of impacted maxillary canines
Energy Technology Data Exchange (ETDEWEB)
Preda, L.; La Fianza, A.; Di Maggio, E. [Pavia Univ. (Italy)
1998-02-01
The purpose was to compare spiral CT with conventional radiography in planning the orthodontic treatment of impacted permanent maxillary canines. In conclusion, CT facilitates the treatment of impacted canines especially when the teeth are very oblique to the arch. Root resorption is better demonstrated especially on the palatal and buccal surfaces of the adjacent incisors. Spiral CT reduces examination time and risks of accidental movement, thus optimizing multiplanar quality. Examination at 2:1 pitch enables a significant reduction in radiation exposure without loss of image quality. (N.C.)
The use of spiral computed tomography in the localization of impacted maxillary canines
International Nuclear Information System (INIS)
Preda, L.; La Fianza, A.; Di Maggio, E.
1998-01-01
The purpose was to compare spiral CT with conventional radiography in planning the orthodontic treatment of impacted permanent maxillary canines. In conclusion, CT facilitates the treatment of impacted canines especially when the teeth are very oblique to the arch. Root resorption is better demonstrated especially on the palatal and buccal surfaces of the adjacent incisors. Spiral CT reduces examination time and risks of accidental movement, thus optimizing multiplanar quality. Examination at 2:1 pitch enables a significant reduction in radiation exposure without loss of image quality. (N.C.)
Frison, Giampietro; Favretto, Donata; Vogliardi, Susanna; Terranova, Claudio; Ferrara, Santo Davide
2008-08-01
Citalopram and escitalopram are highly selective serotonin reuptake inhibitors widely used in the treatment of depression. They exhibit adverse drug reactions and side effects, however, and the development of specific methods for their determination is of great interest in clinical and forensic toxicology. A liquid chromatography-tandem mass spectrometry method has been developed and validated for the assay of citalopram, escitalopram, and their demethylated metabolites in 10-mg hair samples. The analytes were extracted by incubation in methanol and liquid/liquid extraction with diethyl ether/dichloromethane. Gradient elution on a narrow bore C18 column was realized using clomipramine-d3 as an internal standard. Positive ion electrospray ionization and tandem mass spectrometry determination by collision-induced dissociation were performed in an ion trap mass spectrometer. The method exhibited a linear range of 25 to 2000 pg/mg, a quantification limit of 25 pg/mg for all analytes, relative standard deviations in the range of 12.10 to 9.80 (intraassay), and 13.80 to 11.78 (interassay), and accuracies (as percent recovery of the spiked standards) in the range of 90% to 110%; it was applied to the determination of citalopram and escitalopram and their metabolites in hair samples of two newborns to document their in utero exposure to the drugs. The method proved suitable for neonatal hair analysis of citalopram or escitalopram and was applied to two real cases of gestational exposure.
Díaz-Trujillo, C.; Chong, P.; Stergiopoulos, I.; Meijer, H.J.G.; Wit, de P.J.G.M.; Kema, G.H.J.
2017-01-01
The Dothideomycete Pseudocercospora fijiensis, previously Mycosphaerella fijiensis, is the causal agent of black Sigatoka, one of the most destructive diseases of bananas and plantains. Disease management depends on fungicide applications with a major share for sterol demethylation-inhibitors
Díaz-Trujillo, C.; Chong, P.; Stergiopoulos, I.; Meijer, H.J.G.; Wit, de P.J.G.M.; Kema, G.H.J.
2018-01-01
The Dothideomycete Pseudocercospora fijiensis, previously Mycosphaerella fijiensis, is the causal agent of black Sigatoka, one of the most destructive diseases of bananas and plantains. Disease management depends on fungicide applications with a major share for sterol demethylation-inhibitors
Matern, Andreas; Pedrolli, Danielle; Großhennig, Stephanie; Johansson, Jörgen; Mack, Matthias
2016-12-01
The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are produced by the bacteria Streptomyces davawensis and Streptomyces cinnabarinus Riboflavin analogs have the potential to be used as broad-spectrum antibiotics, and we therefore studied the metabolism of riboflavin (vitamin B 2 ), RoF, and AF in the human pathogen Listeria monocytogenes, a bacterium which is a riboflavin auxotroph. We show that the L. monocytogenes protein Lmo1945 is responsible for the uptake of riboflavin, RoF, and AF. Following import, these flavins are phosphorylated/adenylylated by the bifunctional flavokinase/flavin adenine dinucleotide (FAD) synthetase Lmo1329 and adenylylated by the unique FAD synthetase Lmo0728, the first monofunctional FAD synthetase to be described in bacteria. Lmo1329 generates the cofactors flavin mononucleotide (FMN) and FAD, whereas Lmo0728 produces FAD only. The combined activities of Lmo1329 and Lmo0728 are responsible for the intracellular formation of the toxic cofactor analogs roseoflavin mononucleotide (RoFMN), roseoflavin adenine dinucleotide (RoFAD), 8-demethyl-8-aminoriboflavin mononucleotide (AFMN), and 8-demethyl-8-aminoriboflavin adenine dinucleotide (AFAD). In vivo reporter gene assays and in vitro transcription/translation experiments show that the L. monocytogenes FMN riboswitch Rli96, which controls expression of the riboflavin transport gene lmo1945, is negatively affected by riboflavin/FMN and RoF/RoFMN but not by AF/AFMN. Treatment of L. monocytogenes with RoF or AF leads to drastically reduced FMN/FAD levels. We suggest that the reduced flavin cofactor levels in combination with concomitant synthesis of inactive cofactor analogs (RoFMN, RoFAD, AFMN, and AFAD) explain why RoF and AF contribute to antibiotic activity in L. monocytogenes IMPORTANCE: The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are small molecules which are produced by Streptomyces davawensis and Streptomyces cinnabarinus
Qi, Haiping; Coplen, Tyler B.; Geilmann, Heike; Brand, Willi A.; Böhlke, J.K.
2003-01-01
Analytical grade L-glutamic acid is chemically stable and has a C/N mole ratio of 5, which is close to that of many of natural biological materials, such as blood and animal tissue. Two L-glutamic acid reference materials with substantially different 13C and 15N abundances have been prepared for use as organic reference materials for C and N isotopic measurements. USGS40 is analytical grade L-glutamic acid and has a δ13C value of −26.24‰ relative to VPDB and a δ15N value of −4.52‰ relative to N2 in air. USGS41 was prepared by dissolving analytical grade L-glutamic acid with L-glutamic acid enriched in 13C and 15N. USGS41 has a δ13C value of +37.76‰ and a δ15N value of +47.57‰. The δ13C and δ15N values of both materials were measured against the international reference materials NBS 19 calcium carbonate (δ13C = +1.95‰), L-SVEC lithium carbonate (δ13C = −46.48‰), IAEA-N-1 ammonium sulfate (δ15N = 0.43‰), and USGS32 potassium nitrate (δ15N = 180‰) by on-line combustion continuous-flow and off-line dual-inlet isotope-ratio mass spectrometry. Both USGS40 and USGS41 are isotopically homogeneous; reproducibility of δ13C is better than 0.13‰, and that of δ15N is better than 0.13‰ in 100-μg amounts. These two isotopic reference materials can be used for (i) calibrating local laboratory reference materials, and (ii) quantifying drift with time, mass-dependent fractionations, and isotope-ratio-scale contraction in the isotopic analysis of various biological materials. Isotopic results presented in this paper yield a δ13C value for NBS 22 oil of −29.91‰, in contrast to the commonly accepted value of −29.78‰ for which off-line blank corrections probably have not been quantified satisfactorily.
Multi-objective experimental design for (13)C-based metabolic flux analysis.
Bouvin, Jeroen; Cajot, Simon; D'Huys, Pieter-Jan; Ampofo-Asiama, Jerry; Anné, Jozef; Van Impe, Jan; Geeraerd, Annemie; Bernaerts, Kristel
2015-10-01
(13)C-based metabolic flux analysis is an excellent technique to resolve fluxes in the central carbon metabolism but costs can be significant when using specialized tracers. This work presents a framework for cost-effective design of (13)C-tracer experiments, illustrated on two different networks. Linear and non-linear optimal input mixtures are computed for networks for Streptomyces lividans and a carcinoma cell line. If only glucose tracers are considered as labeled substrate for a carcinoma cell line or S. lividans, the best parameter estimation accuracy is obtained by mixtures containing high amounts of 1,2-(13)C2 glucose combined with uniformly labeled glucose. Experimental designs are evaluated based on a linear (D-criterion) and non-linear approach (S-criterion). Both approaches generate almost the same input mixture, however, the linear approach is favored due to its low computational effort. The high amount of 1,2-(13)C2 glucose in the optimal designs coincides with a high experimental cost, which is further enhanced when labeling is introduced in glutamine and aspartate tracers. Multi-objective optimization gives the possibility to assess experimental quality and cost at the same time and can reveal excellent compromise experiments. For example, the combination of 100% 1,2-(13)C2 glucose with 100% position one labeled glutamine and the combination of 100% 1,2-(13)C2 glucose with 100% uniformly labeled glutamine perform equally well for the carcinoma cell line, but the first mixture offers a decrease in cost of $ 120 per ml-scale cell culture experiment. We demonstrated the validity of a multi-objective linear approach to perform optimal experimental designs for the non-linear problem of (13)C-metabolic flux analysis. Tools and a workflow are provided to perform multi-objective design. The effortless calculation of the D-criterion can be exploited to perform high-throughput screening of possible (13)C-tracers, while the illustrated benefit of multi
Schulte, Simone Laura; Waha, Andreas; Steiger, Barbara; Denkhaus, Dorota; Dörner, Evelyn; Calaminus, Gabriele; Leuschner, Ivo; Pietsch, Torsten
2016-01-01
CNS germinomas represent a unique germ cell tumor entity characterized by undifferentiated tumor cells and a high response rate to current treatment protocols. Limited information is available on their underlying genomic, epigenetic and biological alterations. We performed a genome-wide analysis of genomic copy number alterations in 49 CNS germinomas by molecular inversion profiling. In addition, CpG dinucleotide methylation was studied by immunohistochemistry for methylated cytosine residues. Mutational analysis was performed by resequencing of candidate genes including KIT and RAS family members. Ras/Erk and Akt pathway activation was analyzed by immunostaining with antibodies against phospho-Erk, phosho-Akt, phospho-mTOR and phospho-S6. All germinomas coexpressed Oct4 and Kit but showed an extensive global DNA demethylation compared to other tumors and normal tissues. Molecular inversion profiling showed predominant genomic instability in all tumors with a high frequency of regional gains and losses including high level gene amplifications. Activating mutations of KIT exons 11, 13, and 17 as well as a case with genomic KIT amplification and activating mutations or amplifications of RAS gene family members including KRAS, NRAS and RRAS2 indicated mutational activation of crucial signaling pathways. Co-activation of Ras/Erk and Akt pathways was present in 83% of germinomas. These data suggest that CNS germinoma cells display a demethylated nuclear DNA similar to primordial germ cells in early development. This finding has a striking coincidence with extensive genomic instability. In addition, mutational activation of Kit-, Ras/Raf/Erk- and Akt- pathways indicate the biological importance of these pathways and their components as potential targets for therapy. PMID:27391150
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
Synthesis and applications of selectively {sup 13}C-labeled RNA
Energy Technology Data Exchange (ETDEWEB)
SantaLucia, J. Jr.; Shen, L.X.; Lewis, H.; Cai, Z.; Tinoci, I. Jr. [Univ. of California, Berkeley, CA (United States)
1994-12-01
Spectral overlap is a substantial problem in NMR studies of RNA molecules >30 nucleotides. To overcome this difficulty, we synthesized selectively {sup 13}C-labeled RNAs and adapted several isotope-edited two- and three-dimensional NMR experiments originally developed for protein studies. We optimized protocols for synthesis of multi-gram quantities of CTP, UTp, ATP, and GTP using a combination of synthetic organic and enzymatic methods. Uracil is prepared in 40 to 50% yield from {sup 13}C-cyanide in two steps. Using acetyl- tribenzoyl-ribose and standard chemistry uracil is then attached to the sugar (90% yield). The tribenzoyl-uridine intermediate is converted into uridine or cytidine quantitatively, depending on the deblocking protocol. Labeled purines are synthesized using simple pyrimidine precursors and reacting with {sup 13}C-formic acid (80% yield). Purine nucleosides are then synthesized using uridine phosphorylase and purine nucleoside phosphorylase. The nucleosides were converted to NMPs by treatment with POC1{sub 3} in triethylphosphate. We converted NMPs to NTPs by standard enzymatic methods. Selectively labeled RNAs were synthesized by run-off transcription using {sup 13}C-labeled NTPs. Several different strategies help solve over-lap problems in larger RNAs. Isotope-edited two-dimensional NMR experiments such as {omega}1-1/2 X-filtered NOESY simplify NMR spectra by dividing the normal NOESY spectrum into two subspectra-one involving NOEs from protons bound to {sup 12}C and one from protons bound to {sup 13}C. For example, we labeled A and U residues of a 34-nucleotide pseudoknot, and the {sup 12}C subspectrum of the 1/2 X-filtered NOESY contained NOEs only from G and C residues (along with adenine 2H); the {sup 13}C subspectrum contained NOEs only from A and U residues. Each subspectrum has less overlap than the NOESY of an unlabeled sample; the editing strategy allows each resonance to be identified by residue type (A, C, G, or U).
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
International Nuclear Information System (INIS)
Liu, Nan; Davis, Andrew M.; Pellin, Michael J.; Gallino, Roberto; Bisterzo, Sara; Savina, Michael R.
2014-01-01
We present postprocess asymptotic giant branch (AGB) nucleosynthesis models with different 13 C-pocket internal structures to better explain zirconium isotope measurements in mainstream presolar SiC grains by Nicolussi et al. and Barzyk et al. We show that higher-than-solar 92 Zr/ 94 Zr ratios can be predicted by adopting a 13 C-pocket with a flat 13 C profile, instead of the previous decreasing-with-depth 13 C profile. The improved agreement between grain data for zirconium isotopes and AGB models provides additional support for a recent proposal of a flat 13 C profile based on barium isotopes in mainstream SiC grains by Liu et al.
International Nuclear Information System (INIS)
Abraham, T.W.; Leete, Edward
1996-01-01
2-Ethoxy-1-methyl-5-pyrrolidinone (1) was reacted with ethyl [3,4- 13 C 2 ]-acetoacetate (2) in the presence of TiCl 4 to give ethyl [3,4- 13 C 2 ]-2-(1'-methyl-5'-oxo-2'-pyrrolidinyl)-3-oxobutanoate (3) in 85% yield. Decarboethoxylation of ethyl [3,4- 13 C 2 ]-2-(1'-methyl-5'-oxo-2'-pyrrolidinyl)-3-oxobutan-oate (3) was accomplished using NaCl and H 2 O in DMSO to give (R,S)-[2,3- 13 C 2 ]-1-(1'-methyl-5'-oxo-2'-pyrrolidinyl)propan-2-o ne (4) in 91% yield. Protection of the ketone as a ketal (ethylene glycol, H + ), followed by reduction of the amide to the amine using LiAlH 4 and subsequent deprotection of the ketal gave (R,S)-[2,3- 13 C 2 ]-1-(1'-methyl-2'-pyrrolidinyl)propan-2-one ((R,s)-[2', 3'- 13 C 2 ]Hygrine) (8) in 78% yield. (61% overall yield from ethyl [3,4- 13 C 2 ]acetoacetate). (Author)
Comparison of soil organic carbon speciation using C NEXAFS and CPMAS 13C NMR spectroscopy.
Prietzel, Jörg; Müller, Svenja; Kögel-Knabner, Ingrid; Thieme, Jürgen; Jaye, Cherno; Fischer, Daniel
2018-07-01
We compared synchrotron-based C near-edge X-ray absorption fine structure (NEXAFS) and CPMAS 13 C nuclear magnetic resonance (NMR) spectroscopy with respect to their precision and accuracy to quantify different organic carbon (OC) species in defined mixtures of soil organic matter source compounds. We also used both methods to quantify different OC species in organic surface horizons of a Histic Leptosol as well as in mineral topsoil and subsoil horizons of two soils with different parent material, stage of pedogenesis, and OC content (Cambisol: 15-30 OC mgg -1 , Podzol: 0.9-7 OC mgg -1 ). CPMAS 13 C NMR spectroscopy was more accurate and precise (mean recovery of different C functional groups 96-103%) than C NEXAFS spectroscopy (mean recovery 92-113%). For organic surface and topsoil samples, NMR spectroscopy consistently yielded larger O-alkyl C percentages and smaller alkyl C percentages than C NEXAFS spectroscopy. For the Cambisol subsoil samples both methods performed well and showed similar C speciation results. NEXAFS spectroscopy yielded excellent spectra with a high signal-to-noise ratio also for OC-poor Podzol subsoil samples, whereas this was not the case for CPMAS 13 C NMR spectroscopy even after sample treatment with HF. Our results confirm the analytical power of CPMAS 13 C NMR spectroscopy for a reliable quantitative OC speciation in soils with >10mgOCg -1 . Moreover, they highlight the potential of synchrotron-based C NEXAFS spectroscopy as fast, non-invasive method to semi-quantify different C functional groups in soils with low C content (0.9-10mgg -1 ). Copyright © 2018 Elsevier B.V. All rights reserved.
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
CO2 and 12C:13C Isotopic Ratios on Phoebe and Iapetus
Clark, R. N.; Brown, R. H.; Cruikshank, D. P.
2016-12-01
Cassini VIMS has obtained spatially resolved 0.35 to 5.1 micron reflectance spectra of Saturn's satellites beginning with the Phoebe fly-by in 2004 and a close fly-by of Iapetus in 2007. Both surfaces contain relatively abundant CO2. The new (2016 RC19) calibration of VIMS has provided a significant increase in the data quality, such that isotopic absorption bands in CO2 are now well defined. CO2 on Saturn's icy satellites is trapped (Cruikshank et al., 2010, Icarus v206 p561; Pinilla-Alonso et al. 2011, Icarus v211, p75i), predominantly in the dark material (Clark et al. 2012, Icarus v218 p831). Clark et al. modeled the CO2 abundance as 2.8% on Iapetus and 3.7% on Phoebe. The main 12CO2 band in VIMS spectra on Iapetus occurs at 4.253 microns and Phoebe at 4.266 microns. The 13CO2 absorption is strong on Phoebe at 4.367 microns and weak on Iapetus at 4.387 microns. Converting the Phoebe, Iapetus, and a lab reflectance spectrum (of trace H2O-CO2 mixture on a diffuse substrate), we derive preliminary values for the ratio of the equivalent widths of the 12C and 13C absorptions as 19±2 on Phoebe, 82±8 on Iapetus, and 98±10 for the laboratory spectrum. These ratios are related to the 12C/13C ratio, but there may be effects due to intra-molecular and inter-molecular coupling that will contribute to systematic errors in the isotopic abundances derived using equivalent-width measurements that we've yet to quantify. We Believe the effects are small, and will be attempting to quantify them in the future. For comparison, the terrestrial value of the 12C/13C ratio is 90.17, and vibrational coupling may explain the slightly high lab mixture result. The local interstellar medium is 69±15 (Boogert et al., 2000, A&A). Because the CO2 bands on Phoebe and Iapetus dark material have different positions, and because the observed 13C absorption strengths are so different, the surface evolutions must be different. The large enrichment in 13C on Phoebe argues for significant
13C NMR for the assessment of human brain glucose metabolism in vivo
International Nuclear Information System (INIS)
Beckman, N.; Seelig, J.; Turkalj, I.; Keller, U.
1991-01-01
Proton-decoupled 13 C NMR spectra of the human head were obtained during hyperglycemic glucose clamping using intravenous infusions of [1- 13 C]glucose in normal volunteers. In addition to 13 C signals of mobile lipids, a variety of new metabolite resonances could be resolved for the first time in the human brain. At an enrichment level of 20% [1- 13 C]glucose, the signals of α- and β-glucose at 92.7 and 96.6 ppm, respectively, could be detected in the human brain after only an infusion period of 15 minutes. The spatial localization of the different regions of interest was confirmed by 13 C NMR spectroscopic imaging with a time resolution of 9 minutes. Increasing the enrichment level to 99% [1- 13 C]glucose not only improved the time resolution but allowed the detection of metabolic breakdown products of [1- 13 C]glucose. The time course of 13 C label incorporation into the C 2 , C 3 , and C 4 resonances of glutamate/glutamine and into lactate could be recorded in the human brain. These results suggest the possibility of obtaining time-resolved, spatially selective, and chemically specific information on the human body
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Synthesis and Physicochemical Properties of [19,20-13C]-17α-Ethinylestradiol
Kraan, G.P.B.; Drayer, N.M.; Kruizinga, W.H.; Vaalburg, W.; Hummelen, J.C.
1989-01-01
13C2-17α-ethinylestradiol (13C2-EE2) was synthesized from estrone and 13C2-C2H2-gas to measure the metabolic clearance rate and the plasma concentration of 17α-ethinylestradiol (EE2) in tall girls, who are treated with high dosages of this estrogen. Interesting characteristics determined by (i) MS:
La, Honggui; Ding, Bo; Mishra, Gyan Prakash; Zhou, Bo; Yang, Hongmei; Bellizzi, Maria Del Rosario; Chen, Songbiao; Meyers, Blake C.; Peng, Zhaohua; Zhu, Jian-Kang; Wang, Guoliang
2011-01-01
DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.
La, Honggui
2011-09-06
DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M. L.; Sérandour, Aurélien A.; Carroll, Jason S.; Beaudoin, Claude; Vanacker, Jean-Marc
2017-01-01
Dynamic demethylation of histone residues plays a crucial role in the regulation of gene expression. Lysine Specific Demethylase 1 (LSD1) can remove both transcriptionally permissive and repressive histone marks. How these activities are controlled is not clearly understood. Here, we show that the estrogen-related receptor α (ERRα) induces LSD1 to erase repressive marks in vitro. Through such a mechanism, LSD1 and ERRα commonly activate a set of transcriptional targets that include genes invo...
Agonists and partial agonists of rhodopsin: retinal polyene methylation affects receptor activation.
Vogel, Reiner; Lüdeke, Steffen; Siebert, Friedrich; Sakmar, Thomas P; Hirshfeld, Amiram; Sheves, Mordechai
2006-02-14
Using Fourier transform infrared (FTIR) difference spectroscopy, we have studied the impact of sites and extent of methylation of the retinal polyene with respect to position and thermodynamic parameters of the conformational equilibrium between the Meta I and Meta II photoproducts of rhodopsin. Deletion of methyl groups to form 9-demethyl and 13-demethyl analogues, as well as addition of a methyl group at C10 or C12, shifted the Meta I/Meta II equilibrium toward Meta I, such that the retinal analogues behaved like partial agonists. This equilibrium shift resulted from an apparent reduction of the entropy gain of the transition of up to 65%, which was only partially offset by a concomitant reduction of the enthalpy increase. The analogues produced Meta II photoproducts with relatively small alterations, while their Meta I states were significantly altered, which accounted for the aberrant transitions to Meta II. Addition of a methyl group at C14 influenced the thermodynamic parameters but had little impact on the position of the Meta I/Meta II equilibrium. Neutralization of the residue 134 in the E134Q opsin mutant increased the Meta II content of the 13-demethyl analogue, but not of the 9-demethyl analogue, indicating a severe impairment of the allosteric coupling between the conserved cytoplasmic ERY motif involved in proton uptake and the Schiff base/Glu 113 microdomain in the 9-demethyl analogue. The 9-methyl group appears therefore essential for the correct positioning of retinal to link protonation of the cytoplasmic motif with protonation of Glu 113 during receptor activation.
13C/12C ratio variations in Pinus longaeva (bristlecone pine) cellulose during the last millennium
International Nuclear Information System (INIS)
Grinsted, M.J.; Wilson, A.T.; Ferguson, C.W.
1979-01-01
Delta 13 C values are presented for cellulose samples prepared from two dendrochronologically dated Pinus longaeva (bristlecone pine) trees which grew during the last 1000 years. Delta 13 C variations for these forest border trees are similar to upper tree line ring-width variations for the same species and English high summer temperature variations for the same time period. However, the delta 13 C variations appear to be unrelated to lower forest border ring-width variations and cellulose deltaD variations for the same specimens. (Auth.)
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Schmalfuss, A; Stenhagen, K R; Tveit, A B; Crossner, C-G; Espelid, I
2016-04-01
This was to determine the prevalence, distribution of affected teeth and severity of MIH in adolescents from Northern Norway. It was part of a cross-sectional health survey Fit Futures including 16-year-olds from two neighbouring municipalities, Tromsø and Balsfjord. The prevalence of MIH was 13.9% (110 of 794). The maxillary first permanent molars (FPMs) were 1.6 times more frequently affected than in the mandible (P MIH. The buccal surfaces were most often affected in FPMs. More severe lesions were found in the mandibular FPMs compared with the maxillary FPMs (P = 0.002). In the lower canines, only opacities were recorded, while in the upper jaw 13.0% of the affected canines showed PEBs. The distribution of MIH in the dentition was not symmetrical. The prevalence of MIH (13.9%) in the study population of 16-year-olds from Northern Norway is consistent with previous Scandinavian reports. The distribution pattern shows that one participant in four with MIH had at least one affected canine. Further studies are needed to describe the localisation of defects on the enamel surface and to relate these findings to enamel thickness and the duration of amelogenesis.
Energy Technology Data Exchange (ETDEWEB)
Cheong, Chang Shin; Jung, Yun Hoa; Cho, Bong Hae [Department of Oral and Maxillofacial Radiology, School of Dentistry, Pusan National University, Pusan (Korea, Republic of)
2010-09-15
The aim of this study was to investigate the timing and sequence of eruption of permanent canine and premolars, and to evaluate tooth calcification stage on emergence in Korean children. The sample was comprised of 1,266 children (male 720, female 546) aged from 7-13 years. Tooth eruption and calcification stages were determined through oral and panoramic radiographic examination, respectively. Probit analysis was used to calculate the timing of tooth eruption and tooth calcification stage from these cross-sectional data. In both males and females, eruption occurred around the time when one third of tooth root or more was formed. The sequence was as follows: first premolar, canine, and second premolar in maxilla, and canine, first premolar and second premolar in mandible. Tooth eruption occurred earlier in girls compared with boys, averaging 0.63 years. Eruption sequence is identical in males and females with a trend for females to erupt earlier than males. Tooth eruption becomes earlier over the past decades in Korean children.
International Nuclear Information System (INIS)
Cheong, Chang Shin; Jung, Yun Hoa; Cho, Bong Hae
2010-01-01
The aim of this study was to investigate the timing and sequence of eruption of permanent canine and premolars, and to evaluate tooth calcification stage on emergence in Korean children. The sample was comprised of 1,266 children (male 720, female 546) aged from 7-13 years. Tooth eruption and calcification stages were determined through oral and panoramic radiographic examination, respectively. Probit analysis was used to calculate the timing of tooth eruption and tooth calcification stage from these cross-sectional data. In both males and females, eruption occurred around the time when one third of tooth root or more was formed. The sequence was as follows: first premolar, canine, and second premolar in maxilla, and canine, first premolar and second premolar in mandible. Tooth eruption occurred earlier in girls compared with boys, averaging 0.63 years. Eruption sequence is identical in males and females with a trend for females to erupt earlier than males. Tooth eruption becomes earlier over the past decades in Korean children.
Duchenne Muscular Dystrophy Gene Therapy in the Canine Model
2015-01-01
Abstract Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Maekawa, Naoya; Konnai, Satoru; Takagi, Satoshi; Kagawa, Yumiko; Okagawa, Tomohiro; Nishimori, Asami; Ikebuchi, Ryoyo; Izumi, Yusuke; Deguchi, Tatsuya; Nakajima, Chie; Kato, Yukinari; Yamamoto, Keiichi; Uemura, Hidetoshi; Suzuki, Yasuhiko; Murata, Shiro; Ohashi, Kazuhiko
2017-08-21
Immunotherapy targeting immune checkpoint molecules, programmed cell death 1 (PD-1) and PD-ligand 1 (PD-L1), using therapeutic antibodies has been widely used for some human malignancies in the last 5 years. A costimulatory receptor, PD-1, is expressed on T cells and suppresses effector functions when it binds to its ligand, PD-L1. Aberrant PD-L1 expression is reported in various human cancers and is considered an immune escape mechanism. Antibodies blocking the PD-1/PD-L1 axis induce antitumour responses in patients with malignant melanoma and other cancers. In dogs, no such clinical studies have been performed to date because of the lack of therapeutic antibodies that can be used in dogs. In this study, the immunomodulatory effects of c4G12, a canine-chimerised anti-PD-L1 monoclonal antibody, were evaluated in vitro, demonstrating significantly enhanced cytokine production and proliferation of dog peripheral blood mononuclear cells. A pilot clinical study was performed on seven dogs with oral malignant melanoma (OMM) and two with undifferentiated sarcoma. Objective antitumour responses were observed in one dog with OMM (14.3%, 1/7) and one with undifferentiated sarcoma (50.0%, 1/2) when c4G12 was given at 2 or 5 mg/kg, every 2 weeks. c4G12 could be a safe and effective treatment option for canine cancers.
International Nuclear Information System (INIS)
Bortiatynski, J.M.; Minard, R.D.; Hatcher, P.G.
1993-01-01
13 C NMR has recently been shown to be a powerful technique for the examination of the covalent binding of pollutants to humic materials when the latter are enriched with 13 C. Enhanced signals are observed for the carbons that are highly enriched with 13 C while the remaining signals due to naturally abundant 13 C form unlabeled pollutant carbons or humic substances are at the baseline noise level. If covalent bonding and/or non covalent associations take place at or near the site of the 13 C label(s), the nature of the bonding or association can be discerned and the adsorption coefficients can be calculated. In this paper, the authors present the results of such binding studies which demonstrate the great potential of this technique
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
Recent trend of δ13C of C4 plant cellulose as an indicator of atmospheric CO2 change
International Nuclear Information System (INIS)
Minagawa, Masao; Egawa, Saho
1993-01-01
Natural carbon isotope composition ( 13 C/ 12 C) of C4 plant have been analyzed to trace the 13 C content of atmospheric carbon dioxide. Cellulose fraction, kernel coat and starch fraction were separated from two group of Zea mays (corn) which were grown and harvested at Hokkaido and Nagano prefecture in Japan during 1963 and 1989, and each component was analyzed for 13 C/ 12 C isotope ratios. The purpose of this study is to assess if these components are useful for tracing 13 C/ 12 C ratio of atmospheric CO 2 and how such isotopic composition of C4 plants can be modified from original isotopic signals of global circulating carbon. (author)
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
13C and 31P NMR studies of myocardial metabolism
International Nuclear Information System (INIS)
Laughlin, M.R.
1988-01-01
The fluxes through two enzyme systems have been measured in perfused or in in vivo heart using NMR: phosphocreatine kinase, and glycogen synthase and phosphorylase. The rates of synthesis and degradation of glycogen were monitored in vivo in fed, fasted, and diabetic rat heart during infusions of 13 C-1-glucose and insulin using proton-decoupled 13 C-NMR at 1.9 and 4.7 tesla. The enzyme activities of glycogen synthase and glycogen phosphorylase were also measured in this tissue which had been freeze clamped at the end of the experiment, for comparison with the synthetic rates. For normal fed, fasted, and diabetic animals, synthesis rates were 0.28, 0.16, and 0.15 μmol/min.gww respectively. Glycogen synthase i activity was 0.23, 0.14, and 0.14 μmol/min.gww in these hearts at the end of the experiment, when measured at appropriate substrate and activator concentrations, and follow activation time courses that are consistent with being the main rate determinant for net synthesis in all cases. Turnover of glycogen was studied by observing the preformed 13 C-1-glycogen signal during infusion of 12 C-glucose and insulin, and was found to be close to zero. Extracted phosphorylase a activity was approximately ten times that of synthase i under these circumstances. In order to fully interpret the turnover studies, glycogenolysis of preformed 13 C-glycogen was observed after a bolus of glucagon. The glycogen had either been synthesized from 13 C-1-glucose for a single hour, or during an hour of 13 C-glucose and a subsequent hour of 12 C-glucose infusion. The author observed that breakdown follows an exponential time course related to the phosphorylase a activation state and that the last synthesized glycogen breaks down at the rate of 2.5 μmol/min.gww, five times faster than that synthesized an hour earlier
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Identification of degradation routes of metamitron in soil microcosms using 13C-isotope labeling.
Wang, Shizong; Miltner, Anja; Nowak, Karolina M
2017-01-01
Metamitron is one of the most commonly used herbicide in sugar beet and flower bulb cultures. Numerous laboratory and field studies on sorption and degradation of metamitron were performed. Detailed biodegradation studies in soil using 13 C-isotope labeling are still missing. Therefore, we aimed at providing a detailed turnover mass balance of 13 C 6 -metamitron in soil microcosms over 80 days. In the biotic system, metamitron mineralized rapidly, and 13 CO 2 finally constituted 60% of the initial 13 C 6 -metamitron equivalents. In abiotic control experiments CO 2 rose to only 7.4% of the initial 13 C 6 -metamitron equivalents. The 13 C label from 13 C 6 -metamitron was incorporated into microbial amino acids that were ultimately stabilized in the soil organic matter forming presumably harmless biogenic residues. Finally, 13 C label from 13 C 6 -metamitron was distributed between the 13 CO 2 and the 13 C-biogenic residues indicating nearly complete biodegradation. The parallel increase of 13 C-alanine, 13 C-glutamate and 13 CO 2 indicates that metamitron was initially biodegraded via the desamino-metamitron route suggesting its relevance in the growth metabolism. In later phases of biodegradation, the "Rhodococcus route" was indicated by the low 13 CO 2 evolution and the high relevance of the pyruvate pathway, which aims at biomolecule synthesis and seems to be related to starvation. This is a first report on the detailed degradation route of metamitron in soil. Copyright © 2016 Elsevier Ltd. All rights reserved.
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Ecosystem differences in the trophic enrichment of 13C in aquatic food webs
International Nuclear Information System (INIS)
France, R.L.; Peters, R.H.
1997-01-01
Data from 35 published studies were collated to examine patterns in the trophic enrichment of 13 C of consumers. Because both δ 13 C and δ 14 N vary systematically across ecosystems, it was necessary to standardize for such differences before combining data from numerous sources. Relationships of these measures of ecosystem-standardized δ 13 C to ecosystem-standardized trophic position (Δδ 15 N) for freshwater, estuarine, coastal, and open-ocean and for all aquatic ecosystems yielded regression equations of low predictive capability (average of 20% explained variance in δ 13 C). However, differences were observed in the slopes between δ 13 C and standardized trophic position when data were examined study-specifically: the average trophic fractionation of 13 C was found to increase from +0.2micron for freshwater to +0.5micron for estuarine to +0.8micron for coastal, and to +1.1micron for open-ocean food webs. This ecosystem-specific gradient in 13 C enrichment for consumers supports previous findings of a similar continuum existing for zooplankton - particulate organic matter differences in δ 13 C. Possible mechanisms to explain these ecosystem-specific patterns in 13 C enrichment may be related to the relative importance of detritus, heterotrophic respiration, partial reliance on alternative food sources, and lipid influences in the different ecosystems. (author)
Absence of hyperfine effects in 13C-graphene spin-valve devices
Wojtaszek, M.; Vera-Marun, I.J.; Whiteway, E.; Hilke, M.; Wees, B.J. van
2014-01-01
The carbon isotope 13C, in contrast to 12C, possesses a nuclear magnetic moment and can induce electron spin dephasing in graphene. This effect is usually neglected due to the low abundance of 13C in natural carbon allotropes (~1%). Chemical vapor deposition (CVD) allows for artificial synthesis of
Metabolic Imaging of Patients with Prostate Cancer Using Hyperpolarized [1-13C]Pyruvate
Nelson, Sarah J.; Kurhanewicz, John; Vigneron, Daniel B.; Larson, Peder E. Z.; Harzstark, Andrea L.; Ferrone, Marcus; van Criekinge, Mark; Chang, Jose W.; Bok, Robert; Park, Ilwoo; Reed, Galen; Carvajal, Lucas; Small, Eric J.; Munster, Pamela; Weinberg, Vivian K.; Ardenkjaer-Larsen, Jan Henrik; Chen, Albert P.; Hurd, Ralph E.; Odegardstuen, Liv-Ingrid; Robb, Fraser J.; Tropp, James; Murray, Jonathan A.
2014-01-01
This first-in-man imaging study evaluated the safety and feasibility of hyperpolarized [1-13C]pyruvate as an agent for noninvasively characterizing alterations in tumor metabolism for patients with prostate cancer. Imaging living systems with hyperpolarized agents can result in more than 10,000-fold enhancement in signal relative to conventional magnetic resonance (MR) imaging. When combined with the rapid acquisition of in vivo 13C MR data, it is possible to evaluate the distribution of agents such as [1-13C]pyruvate and its metabolic products lactate, alanine, and bicarbonate in a matter of seconds. Preclinical studies in cancer models have detected elevated levels of hyperpolarized [1-13C]lactate in tumor, with the ratio of [1-13C]lactate/[1-13C]pyruvate being increased in high-grade tumors and decreased after successful treatment. Translation of this technology into humans was achieved by modifying the instrument that generates the hyperpolarized agent, constructing specialized radio frequency coils to detect 13C nuclei, and developing new pulse sequences to efficiently capture the signal. The study population comprised patients with biopsy-proven prostate cancer, with 31 subjects being injected with hyperpolarized [1-13C]pyruvate. The median time to deliver the agent was 66 s, and uptake was observed about 20 s after injection. No dose-limiting toxicities were observed, and the highest dose (0.43 ml/kg of 230 mM agent) gave the best signal-to-noise ratio for hyperpolarized [1-13C]pyruvate. The results were extremely promising in not only confirming the safety of the agent but also showing elevated [1-13C]lactate/[1-13C]pyruvate in regions of biopsy-proven cancer. These findings will be valuable for noninvasive cancer diagnosis and treatment monitoring in future clinical trials. PMID:23946197
Comparison of three laboratorial tests for diagnosis of canine parvovirus infection
Directory of Open Access Journals (Sweden)
M.M.O. Silva
2013-02-01
Full Text Available The aim of this study was to evaluate the rapid tests currently used for canine parvovirus (CPV diagnosis: hemagglutination test (HA, enzyme immunoassay (EIA and polymerase chain reaction (PCR. A total of 112 fecal samples collected from diarrheic puppies up to one year of age were tested. The EIA was able to detect CPV antigen in 44 samples. By HA, 32 samples tested highly positive with titers >128, eight tested weakly positive (titers 32 and 64 and 72 were negative (titers <16. Using PCR, 57 samples were found positive including 13 EIA-negative and 19 HA-negative samples. The best correlation was observed between EIA and PCR (88.4%. These tests were able to detect all types of CPV, including CPV-2c. Considering that 23%-33% of dogs presenting enteritis did not show infection by EIA nor HA, negative results from the antigen detection tests should be confirmed through molecular methods.
International Nuclear Information System (INIS)
Seed, T.M.; Kaspar, L.V.; Domann, F.; Niiro, G.K.; LeBuis, D.A.
1988-01-01
We report here our initial observations on the growth and morphology, and developmental radiosensitivity of giant, multinucleated, osteoclast-like cells (MN-OS) generated through in vitro cultivation of hematopoietic progenitor-enriched canine bone marrow samples. Maximum cell densities of 5.5 x 10(3) to 6.5 x 10(3) MN-OS per cm2 of growth area were achieved following 10 to 14 days of culture at 37 degrees C. Acute gamma irradiation of the initial marrow inocula resulted in significant, dose-dependent perturbations of MN-OS formation, growth, and development. Attempts to estimate radiosensitivity of MN-OS progenitors from canine marrow yielded a range of Do values from a low of 212 cGy measured at six days of culture to higher values of 405 to 542 cGy following 10 to 22 days of culture. At the intermediate times of culture (10 to 14 days), the radiation-induced responses were clearly biphasic, reflecting either (a) the presence of multiple subpopulations of MN-OS progenitors with varying degrees of radiosensitivity or (b) the inherent biphasic nature of MN-OS development involving early progenitor cell proliferation followed by maturation and subsequent fusion. Morphologically, MN-OS generated from irradiated marrow inocula appeared only marginally altered, with alterations expressed largely in a biphasic, dose-dependent fashion in terms of smaller cell size, reduced number of nuclei, increased expression of both surface microprojections, and a unique set of crystalloid cytoplasmic inclusions. Functionally, MN-OS appeared to be impaired by irradiation of marrow progenitors, as evidenced by failure to initiate resorptive attachments to devitalized bone spicules in vitro
Kjelgaard-Hansen, Mads; Strom, Henriette; Mikkelsen, Lars F; Eriksen, Thomas; Jensen, Asger L; Luntang-Jensen, Michael
2013-09-01
C-reactive protein (CRP) is an established serum marker for the presence of systemic inflammation in dogs. Results from previous experimental and clinical studies suggest that CRP concentrations also quantitatively reflect the degree and progress of an inflammatory process, suggesting its use for inflammation monitoring. The objective was to investigate whether the canine CRP response in serum correlates with the amount of trauma and the consequent inflammatory response after 3 standard aseptic soft-tissue surgical procedures in 3 groups of dogs. A total of 24 client-owned intact female dogs of various breeds were enrolled in a clinical study with random allocation into 2 surgical groups, for either conventional, open-approach ovariohysterectomy (OVH; n = 14) or laparoscopic assisted OVH (n = 10). In addition, a group of 8 male Beagles from a laboratory animal facility underwent vasectomy, serving as the third and mildest surgical trauma group. Serum CRP was measured pre- and at 4, 8, 12, 23, and 27 hours postsurgery. Cumulative concentration over time and point concentrations of CRP were correlated with the surgical trauma impact level. There was a significant surgery trauma-related difference in cumulative CRP concentrations among the 3 groups, and also in the 12 hours postsurgery concentration. The CRP response varied according to the degree of surgical trauma on 3 standardized levels, thus supporting the use of canine serum concentrations of CRP as an inflammatory activity indicator and monitoring marker. © 2013 American Society for Veterinary Clinical Pathology.
Yield and enrichment studies of C-13 isotope by multi-photon ...
Indian Academy of Sciences (India)
Abstract. Multi-photon dissociation of Freon-22 (CF2HCl) at low temperatures has been carried out to separate the C-13 isotope using a TEA CO2 laser. Yield and enrichment of C-13 isotope in the product C2F4 are studied at 9P(22) laser line as a function of temperature (–50°C to 30°C). It is observed that at a given fluence ...
Wilson, S; Stirling, C; Borowski, S; Thomas, A; King, V; Salt, J
2013-06-22
In this study, we determined whether vaccination with Duramune DAPPi+LC containing canine parvovirus (CPV) type 2b protects against challenge with virulent CPV antigenic type 2c. Seven healthy dogs, seronegative for CPV2, were enrolled into two treatment groups; five were vaccinated twice, 21 days apart, with minimum titre vaccine, and two were given saline. Dogs were challenged with CPV 2c three weeks later. Clinical observations, body weight and rectal temperature measurements, blood samples for serology and white blood cell counts and faecal samples for virus excretion were collected. Control dogs remained seronegative until challenge; vaccinated dogs seroconverted and were positive for antibodies to CPV2 from day 21. Four days after challenge, clinical signs associated with parvovirus infection (vomiting, paroxysmal shivering, depression, loose stools) were observed in the control dogs. Both animals were withdrawn from the study for welfare reasons one day later. On day 47, leucopenia was observed in controls, with white blood cell counts less than 50 per cent prechallenge values. No specific clinical sign of parvovirus infection were observed in the vaccinated dogs, nor was (detectable) challenge virus shed in faeces suggesting that antibodies generated contributed sterilising immunity. We conclude that vaccination of dogs with Duramune DAPPi+LC protects against challenge with a virulent field strain of CPV 2c.
Nuclear critical opalescence and the M1 form factors of 12C and 13C
International Nuclear Information System (INIS)
Delorme, J.; Figureau, A.; Guichon, P.
1981-01-01
It is shown that core polarization by the nuclear pion field has opposite effects on the M1 form factors of 12 C(15.11 MeV) and 13 C(g.s.). New data on 13 C are found to agree with this prediction and a common interpretation of the experiments is shown to be possible for the two nuclei in terms of critical opalescence. Discrimination from alternative explanations of the observed anomalies should await further experiments, especially photopion reactions. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Krivdin, L.B.; Shcherbakov, V.V.; Kalabin, G.A.
1988-03-10
The direct spin-spin coupling constants in the vinyl group were measured in 100 mono-substituted ethylene derivatives. The inductive effect of the substituent was found to be the major factor in the variation of this constant and, in some cases, the stereospecific effect of the unshared electron pairs of heteratoms makes a significant contribution to the /sup 13/C-/sup 13/C coupling constants.
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
Dias, Jerry Ray; Gao, Hongwu
2009-12-01
The 13C NMR spectra of over 24 tetracyclic triterpenoid derivatives have been structurally analyzed. The 13C NMR chemical shifts allow one to probe the steric topology of the rigid steroid skeleton and inductive effects of its substituents. Use of deuterium labeling in chemical shift assignment and B-ring aromatic terpenoids are also featured.
Molecular differentiation of three canine and feline hookworms in South China through HRM analysis.
Wang, M W; Yan, X X; Hang, J X; Shi, X L; Fu, Y Q; Zhang, P; Yang, F; Pan, W D; Li, G Q
2018-02-05
To investigate the prevalence of canine and feline hookworms in South China, and to assess the risk of zoonotic hookworms to humans, one pair of primers (HRM-F/HRM-R) was designed to establish a high-resolution melting (HRM) method based on internal transcribed spacer 1 (ITS-1) rDNA for the detection of Ancylostoma ceylanicum, A. caninum and A. tubaeforme infection. The results showed that the HRM for the three hookworms produced different melting-curve profiles, where melting temperature (T m) values were 84.50°C for A. ceylanicum, 82.25°C for A. caninum and 81.73°C for A. tubaeforme, respectively. The reproducibility of intra- and inter-assay melting curves was almost perfect. The lowest concentration detected was about 5.69 ×10-4 g/μl. The HRM detection results from 18 canine and feline hookworm samples were in complete accordance with their sequencing results. The HRM method was more sensitive than the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique in the detection of 98 clinical samples. It is concluded that the HRM method can differentiate between A. ceylanicum, A. caninum, A. tubaeforme and their mixed infections, which may provide important technical support for the zoonotic risk assessment and molecular epidemiological survey of canine and feline hookworms.
Directory of Open Access Journals (Sweden)
Etienne Paubelle
Full Text Available The prognosis of acute myeloid leukemia (AML in elderly (≥65 years patients is poor and treatment remains non-consensual especially for those who are not eligible for intensive therapies. Our group has shown that in vitro the iron chelator deferasirox (DFX synergizes with vitamin D (VD to promote monocyte differentiation in primary AML cells. Herein, we present results from a retrospective case-control study in which the association of DFX (1-2 g/d and 25-hydroxycholecalciferol (100,000 IU/week (DFX/VD was proposed to patients following demethylating agents failure. Median survival of patients treated with DFX/VD combination (n = 17 was significantly increased in comparison with matched patients receiving best supportive care (BSC alone (n = 13 (10.4 versus 4 months respectively. In addition, the only factor associated to an increased overall survival in DFX/VD-treated patients was serum VD levels. We conclude that DFX/VD treatment correlated with increased overall survival of AML patients in this retrospective cohort of elderly patients.
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Yu, Chi-Ho; Yhee, Ji-Young; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang
2010-01-01
Human seminoma is classified as classical seminoma (SE) and spermatocytic seminoma (SS). Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD) being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns) were classified as SE or SS by immunohistochemistry (IHC) using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF) and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS) program was used for various statistical analyses. The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8%) and PLAP-/PAS- SSs were 15/23 (61.2%). All SE cases (8/8, 100%) were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%), 9 diffuse (9/15, 60%), and 4 intratubular/diffuse (4/15, 26.7%) types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels were a correlated vascular parameter. Although
Directory of Open Access Journals (Sweden)
Kim Jong-Hyuk
2010-05-01
Full Text Available Abstract Background Human seminoma is classified as classical seminoma (SE and spermatocytic seminoma (SS. Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Methods Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns were classified as SE or SS by immunohistochemistry (IHC using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS program was used for various statistical analyses. Results The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8% and PLAP-/PAS- SSs were 15/23 (61.2%. All SE cases (8/8, 100% were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%, 9 diffuse (9/15, 60%, and 4 intratubular/diffuse (4/15, 26.7% types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. Conclusion In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels
Energy Technology Data Exchange (ETDEWEB)
Li, Huanhuan [Automotive Engineering Research Institute, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013 (China); Li, Yunxing [School of Material Science and Engineering, Jiangsu University, Zhenjiang 212013 (China); Chen, Long; Jiang, Haobin [Automotive Engineering Research Institute, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013 (China); Wei, Jinping [Institute of New Energy Material Chemistry, Key Laboratory of Advanced Energy Materials Chemistry (Ministry of Education), Nankai University, Tianjin 300071 (China); Wang, Hongbo [China Aviation Lithium Battery Co. Ltd., Luoyang 471003 (China); Wang, Yaping, E-mail: wangyaping@ujs.edu.cn [School of Material Science and Engineering, Jiangsu University, Zhenjiang 212013 (China)
2014-12-25
Highlights: • We firstly report a fast microwave heating way to prepare LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4}/C. • The reversible discharge capacity of LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4}/C is about 169 mA h g{sup −1}. • LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4}/C nanocomposite elucidates excellent cyclic stability. • LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4}/C nanocomposite exhibits attractive rate capability. - Abstract: A microwave assisted method is developed for synthesizing pure LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4} and LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4}/C nanocomposite. Olivine LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4} coated with uniform amorphous carbon film of ∼5 nm in thickness with an average size of ∼200 nm is successfully obtained. Compared with pure LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4}, LiFe{sub 1/3}Mn{sub 1/3}Co{sub 1/3}PO{sub 4}/C composite presents enhanced electrochemical Li-ion intercalation performances. It exhibits a high discharge capacity of 169 mA h g{sup −1} at 0.1 C (theoretical capacity is 170 mA h g{sup −1}). The capacity retention is 99% after 30 cycles. Furthermore, the capacities are still retained 101 at 5 C and 76 mA h g{sup −1} and 20 C, respectively. Carbon coating can significantly improve the Li-ion diffusion, the reversibility of lithium extraction/insertion and electrical conductivity of LiCo{sub 1/3}Mn{sub 1/3}Fe{sub 1/3}PO{sub 4}.
Synthesis of (+-)-[1,1'-15N2, 2'-13C]-trans-3'-methylnicotine
International Nuclear Information System (INIS)
Sirimanne, S.R.; Maggio, V.L.; Patterson, D.G. Jr.
1992-01-01
The synthesis of (±)- [1,1'- 15 N 2 , 2'- 13 C]-trans-3'-methylnicotine is reported. 15 N-3-Bromopyridine obtained from bromination of pyridine was formylated with nBuLi/[carbonyl- 13 C]-methyl formate. The resulting 15 n-Pyridine-3-[ 13 C-carbonyl]-carboxaldehyde was reacted with 15 N-methylamine and then the resulting Schiff's base was condensed with succinic anhydride to give (±)- [1,1'- 15 N 2 , 5'- 13 C]-trans-4'-carboxycotinine. Reduction with lithium aluminum hydride and mesylation followed by reduction with Zn/NaI gave (±)-[1,1'- 15 N 2 , 2'- 13 C]-trans-3'-methylnicotine. (Author)
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
Synthesis of 13C warfarin labelled at the hemiketal carbon, and its resolution
International Nuclear Information System (INIS)
Savell, V.H. Jr.; Valente, E.J.; Eggleston, D.S.
1989-01-01
Warfarin (cyclic hemiketal form: 2-hydroxy-2-methyl-4-phenyl-3,4-dihydro-2H,5H-pyrano[3,2-c][1]benz opyran-5-one) is labeled with 98+% 13 C at the anomeric carbon (C2) and resolved into its enantiomers. Acetone-2- 13 C(98.6%) condenses with benzaldehyde in aqueous base to produce 4-phenyl-3-buten-2-one-2- 13 C(98+%). Michael-type addition of this to 4-hydroxycoumarin in methanol produces the labeled diastereomeric warfarin methyl ketals which on deprotection form racemic warfarin-2- 13 C(98+%). Classical resolution of labeled warfarin with quinidine produces partly resolved (S)-(-)-warfarin-2- 13 C(98+%). Labeled warfarin is a suitable probe for warfarin configuration for which three distinct isomeric forms are known. (Author)
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Deconvolution of the tree ring based delta13C record
International Nuclear Information System (INIS)
Peng, T.; Broecker, W.S.; Freyer, H.D.; Trumbore, S.
1983-01-01
We assumed that the tree-ring based 13 C/ 12 C record constructed by Freyer and Belacy (1983) to be representative of the fossil fuel and forest-soil induced 13 C/ 12 C change for atmospheric CO 2 . Through the use of a modification of the Oeschger et al. ocean model, we have computed the contribution of the combustion of coal, oil, and natural gas to this observed 13 C/ 12 C change. A large residual remains when the tree-ring-based record is corrected for the contribution of fossil fuel CO 2 . A deconvolution was performed on this residual to determine the time history and magnitude of the forest-soil reservoir changes over the past 150 years. Several important conclusions were reached. (1) The magnitude of the integrated CO 2 input from these sources was about 1.6 times that from fossil fuels. (2) The forest-soil contribution reached a broad maximum centered at about 1900. (3) Over the 2 decade period covered by the Mauna Loa atmospheric CO 2 content record, the input from forests and soils was about 30% that from fossil fuels. (4) The 13 C/ 12 C trend over the last 20 years was dominated by the input of fossil fuel CO 2 . (5) The forest-soil release did not contribute significantly to the secular increase in atmospheric CO 2 observed over the last 20 years. (6) The pre-1850 atmospheric p2 values must have been in the range 245 to 270 x 10 -6 atmospheres
13C NMR spectra and bonding situation of the B-C bond in alkynylboranes
International Nuclear Information System (INIS)
Yamamoto, Yoshinori; Moritani, Ichiro
1975-01-01
13 C NMR spectra of boron substituted alkynes reveal that the β-carbon is deshielded by ca. 21 ppm by a B(O-n-C 4 H 9 ) 2 group. This clearly indicates the presence of a B-C π-bonding in alkynylboranes. (auth.)
Martin, Gary E; Hilton, Bruce D; Irish, Patrick A; Blinov, Kirill A; Williams, Antony J
2007-10-01
Utilization of long-range (1)H--(15)N heteronuclear chemical shift correlation has continually grown in importance since the first applications were reported in 1995. More recently, indirect covariance NMR methods have been introduced followed by the development of unsymmetrical indirect covariance processing methods. The latter technique has been shown to allow the calculation of hyphenated 2D NMR data matrices from more readily acquired nonhyphenated 2D NMR spectra. We recently reported the use of unsymmetrical indirect covariance processing to combine (1)H--(13)C GHSQC and (1)H--(15)N GHMBC long-range spectra to yield a (13)C--(15)N HSQC-HMBC chemical shift correlation spectrum that could not be acquired in a reasonable period of time without resorting to (15)N-labeled molecules. We now report the unsymmetrical indirect covariance processing of (1)H--(13)C GHMBC and (1)H--(15)N IMPEACH spectra to afford a (13)C--(15)N HMBC-IMPEACH spectrum that has the potential to span as many as six to eight bonds. Correlations for carbon resonances long-range coupled to a protonated carbon in the (1)H--(13)C HMBC spectrum are transferred via the long-range (1)H--(15)N coupling pathway in the (1)H--(15)N IMPEACH spectrum to afford a much broader range of correlation possibilities in the (13)C--(15)N HMBC-IMPEACH correlation spectrum. The indole alkaloid vincamine is used as a model compound to illustrate the application of the method. (c) 2007 John Wiley & Sons, Ltd.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Gilmour, C. C.; Ghosh, U.; Santillan, E. F. U.; Soren, A.; Bell, J. T.; Butera, D.; McBurney, A. W.; Brown, S.; Henry, E.; Vlassopoulos, D.
2015-12-01
In-situ sorbent amendments are a low-impact approach for remediation of contaminants in sediments, particular in habitats like wetlands that provide important ecosystem services. Laboratory microcosm trials (Gilmour et al. 2013) and early field trials show that activated carbon (AC) can effectively increase partitioning of both inorganic Hg and methylmercury to the solid phase. Sediment-water partitioning can serve as a proxy for Hg and MeHg bioavailability in soils. One consideration in using AC in remediation is its potential impact on organisms. For mercury, a critical consideration is the potential impact on net MeHg accumulation and bioavailability. In this study, we specifically evaluated the impact of AC on rates of methylmercury production and degradation, and on overall microbial activity, in 4 different Hg-contaminated salt marsh soils. The study was done over 28 days in anaerobic, sulfate-reducing slurries. A double label of enriched mercury isotopes (Me199Hg and inorganic 201Hg) was used to separately follow de novo Me201Hg production and Me199Hg degradation. AC amendments decreased both methylation and demethylation rate constants relative to un-amended controls, but the impact on demethylation was stronger. The addition of 5% (dry weight) regenerated AC to soil slurries drove demethylation rate constants to nearly zero; i.e. MeHg sorption to AC almost totally blocked its degradation. The net impact was increased solid phase MeHg concentrations in some of the soil slurries with the highest methylation rate constants. However, the net impact of AC amendments was to increase MeHg (and inorganic Hg) partitioning to the soil phase and decrease concentrations in the aqueous phase. AC significantly decreased aqueous phase inorganic Hg and MeHg concentrations after 28 days. Overall, the efficacy of AC in reducing aqueous MeHg was highest in the soils with the highest MeHg concentrations. The AC addition did not significantly impact microbial activity, as
Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells.
Rici, Rose Eli Grassi; Alcântara, Dayane; Fratini, Paula; Wenceslau, Cristiane Valverde; Ambrósio, Carlos Eduardo; Miglino, Maria Angelica; Maria, Durvanei Augusto
2012-02-22
The bone morphogenetic proteins (BMPs) belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs) and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST) cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs) and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP) stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p53. We propose that rhBMP-2 has great
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T
2015-08-01
Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
13C nuclear magnetic resonance study of the complexation of calcium by taurine
International Nuclear Information System (INIS)
Irving, C.S.; Hammer, B.E.; Danyluk, S.S.; Klein, P.D.
1980-01-01
13 C Nuclear magnetic resonance chemical shifts, 1 J/sub c-c/ scalar coupling constants, spin-lattice relaxation times, and nuclear Overhauser effects were determined for taurine-[1, 2 13 C] and a taurine-[1 13 C] and taurine-[2 13 C] mixture in the presence and absence of calcium. Comparison of taurine titration shifts to values for related compounds reveals some unusual electronic properties of the taurine molecule. Stability constants of 1:1 calcium complexes with taurine zwitterions and anions, as well as their 13 C chemical shifts, were obtained by least squares analysis of titration curves measured in the presence of calcium. The stability constants of calcium-taurine complexes were significantly lower than previous values and led to estimates that only approximately one percent of intracellular calcium of mammalian myocardial cells would exist in a taurine complex
York, Dan; Higgins, Robert J.; LeCouteur, Richard A.; Joshi, Nikhil; Bannasch, Danika
2016-01-01
Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
13C/14C dual isotope breath test measurement of gastric emptying in normal subjects and patients
International Nuclear Information System (INIS)
Chew, G.; Bartholomeusz, F.D.L.; Bellon, M.; Chatterton, B.E.
2000-01-01
Full text: A more flexible alternative to dual isotope scintigraphy for gastric emptying involves measuring breath C0 2 after administration of absorbable tracers. Method: six patients were given 100g hamburger labelled with 25 MBq 99 Tc m sulphur colloid and 74 KBq 14 C octanoic acid, and 150 ml 10% glucose drink labelled with 8 MBq 67 Ga citrate and ISO mg 13 C acetate and seven normals with 14 C and 13 C labels only. Breath was collected at baseline and then regularly for four hours. The 14 CO 2 and 13 CO 2 activity was measured with liquid scintillation counting and mass spectroscopy. The times to maximum 14 CO 2 , and 13 CO 2 , T max, were determined. Results: Comparison was made between 14 CO 2 T max with scintigraphic retention of 99 Tc m at 100 minutes (SR100m) and 13 CO 2 T max with the scintigraphic half-clearance time of 67 Ga (scint T1/2). In conclusion 14 CO 2 T max and 13 CO 2 T max correlate significantly with SR100m and scint T1/2 respectively. The normal threshold is between 165 and 180 minutes for 14 Co 2 T max; probably > 40 minutes for 13 CO 2 T max but overlap exists between normal and abnormal results in this small preliminary study. Recruitment is to continue to better define normal ranges. Copyright (2000) The Australian and New Zealand Society of Nuclear Medicine Inc
Solid-state 13C NMR characterization of polyanilines
International Nuclear Information System (INIS)
Kaplan, S.
1988-01-01
13 C solid-state nuclear magnetic resonance measurements are reported for the leucoemeraldine base, emeraldine base, and emeraldine hydrochloride forms of polyaniline in order to characterize the structures of these three distinct polymers. Chemical shift assignments are facilitated by use of the cross-depolarization technique to distinguish carbons with and without directly bonded hydrogens. Comparison of the spectra of emeraldine base with those of leucoemeraldine base and air-oxidized leucoemeraldine (which partially converts to emeraldine base) establishes that emeraldine base is essentially an alternating copolymer of reduced 1A (-(C 6 H 4 )N(H)(C 6 H 4 )N(H)-) and oxidized 2A (-(C 6 H 4 )N double-bond(C 6 H 4 )double-bond N-) repeat units. The 8-12 ppm spectral line widths measured for both emeraldine base and leucoemeraldine base are attributed to local fluctuations in conformational and configurational geometries, a distribution in chain packing, and compositional defects. 13 C spin-echo measurements establish that the 60 ppM wide line from the conducting emeraldine hydrochloride is inhomogeneously broadened. It is postulated that this line width is due to local variations in charge density along the polymer backbone arising from polymer structural heterogeneity. 47 refs., 5 figs., 1 tab
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh
DEFF Research Database (Denmark)
Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh
2016-01-01
AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...
Canine parvovirus--a review of epidemiological and diagnostic aspects, with emphasis on type 2c.
Decaro, Nicola; Buonavoglia, Canio
2012-02-24
Canine parvovirus type 2 (CPV-2) emerged in late 1970s causing severe epizootics in kennels and dog shelters worldwide. Soon after its emergence, CPV-2 underwent genetic evolution giving rise consecutively to two antigenic variants, CPV-2a and CPV-2b that replaced progressively the original type. In 2000, a new antigenic variant, CPV-2c, was detected in Italy and rapidly spread to several countries. In comparison to the original type CPV-2, the antigenic variants display increased pathogenicity in dogs and extended host range, being able to infect and cause disease in cats. Epidemiological survey indicate that the newest type CPV-2c is becoming prevalent in different geographic regions and is often associated to severe disease in adult dogs and also in dogs that have completed the vaccination protocols. However, the primary cause of failure of CPV vaccination is interference by maternally derived immunity. Diagnosis of CPV infection by traditional methods has been shown to be poorly sensitive, especially in the late stages of infections. New diagnostic approaches based on molecular methods have been developed for sensitive detection of CPV in clinical samples and rapid characterisation of the viral type. Continuous surveillance will help assess whether there is a real need to update currently available vaccines and diagnostic tests. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Salvatore Serravalle
2016-01-01
Full Text Available T-Acute Lymphoblastic Leukemia (T-ALL remains a subgroup of pediatric ALL, with a lower response to standard chemotherapy. Some recent studies established the fundamental role of epigenetic aberrations such as DNA hypermethylation, to influence patients’ outcome and response to chemotherapy. Moreover, L-asparaginase is an important chemotherapeutic agent for treatment of ALL and resistance to this drug has been linked to ASNS expression, which can be silenced through methylation. Therefore, we tested whether the sensitivity of T-ALL cell lines towards L-asparaginase is correlated to the epigenetic status of ASNS gene and whether the sensitivity can be modified by concurrent demethylating treatment. Hence we treated different T-ALL cell lines with L-asparaginase and correlated different responses to the treatment with ASNS expression. Then we demonstrated that the ASNS expression was dependent on the methylation status of the promoter. Finally we showed that, despite the demethylating effect on the ASNS gene expression, the combined treatment with the demethylating agent Decitabine could synergistically improve the L-asparaginase sensitivity in those T-ALL cell lines characterized by hypermethylation of the ASNS gene. In conclusion, this preclinical study identified an unexpected synergistic activity of L-asparaginase and Decitabine in the subgroup of T-ALL with low ASNS expression due to hypermethylation of the ASNS promoter, while it did not restore sensitivity in the resistant cell lines characterized by higher ASNS expression.
Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.
Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z
2015-04-10
The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.
Charest, Mathieu; Bélair, Marc-André
2017-06-01
Helicobacter pylori infection is the leading cause of peptic ulcer disease. The purpose of this study was, first, to assess the difference in the distribution of negative versus positive results between the older 14 C-urea breath test and the newer 13 C-urea breath test and, second, to determine whether use of an indeterminate-results category is still meaningful and what type of results should trigger repeated testing. Methods: A retrospective survey was performed of all consecutive patients referred to our service for urea breath testing. We analyzed 562 patients who had undergone testing with 14 C-urea and 454 patients who had undergone testing with 13 C-urea. Results: In comparison with the wide distribution of negative 14 C results, negative 13 C results were distributed farther from the cutoff and were grouped more tightly around the mean negative value. Distribution analysis of the negative results for 13 C testing, compared with those for 14 C testing, revealed a statistically significant difference between the two. Within the 13 C group, only 1 patient could have been classified as having indeterminate results using the same indeterminate zone as was used for the 14 C group. This is significantly less frequent than what was found for the 14 C group. Discussion: Borderline-negative results do occur with 13 C-urea breath testing, although less frequently than with 14 C-urea breath testing, and we will be carefully monitoring differences falling between 3.0 and 3.5 %Δ. 13 C-urea breath testing is safe and simple for the patient and, in most cases, provides clearer positive or negative results for the clinician. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.
Abou Asa, S
2017-07-01
MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Direct 13C NMR Detection in HPLC Hyphenation Mode
DEFF Research Database (Denmark)
Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils
2012-01-01
Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments...... application of HPLC-SPE-NMR analysis using direct-detected (13)C NMR spectra. HPLC column loading, accumulative SPE trappings, and the effect of different elution solvents were evaluated and optimized. A column loading of approximately 600 mug of a prefractionated triterpenoid mixture, six trappings...
Ishioka, K; Omachi, A; Sagawa, M; Shibata, H; Honjoh, T; Kimura, K; Saito, M
2006-04-01
Adiponectin is a protein synthesized and secreted by adipocytes. Decreased adiponectin is responsible for insulin resistance and atherosclerosis associated with human obesity. We obtained a cDNA clone corresponding to canine adiponectin, whose nucleotide and deduced amino acid sequences were highly identical to those of other species. Adiponectin mRNA was detected in adipose tissues, but not in other tissues, of dogs. When 22 adult beagles were given a high-energy diet for 14 weeks, they became obese, showing heavier body weights, higher plasma leptin concentrations, but lower plasma adiponectin concentrations. The adiponectin concentrations of plasma samples collected from 71 dogs visiting veterinary practices were negatively correlated to plasma leptin concentrations, being lower in obese than non-obese dogs. These results are compatible with those reported in other species, and suggest that adiponectin is an index of adiposity and a target molecule for studies on diseases associated with obesity in dogs.
Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong
2015-06-01
Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.
1985-01-01
Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV
Energy Technology Data Exchange (ETDEWEB)
Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.
1985-02-01
Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.
Migration and deposition of 13C in the full-tungsten ASDEX Upgrade tokamak
International Nuclear Information System (INIS)
Hakola, A; Aho-Mantila, L; Groth, M; Kurki-Suonio, T; Makkonen, T; Likonen, J; Koivuranta, S; Krieger, K; Mayer, M; Mueller, H W; Neu, R; Rohde, V
2010-01-01
The migration of carbon in low-density, low-confinement plasmas of ASDEX Upgrade was studied by injecting 13 C into the main chamber of the torus at the end of the 2007 experimental campaign. A selection of standard tungsten-coated lower-divertor and main-chamber tiles as well as a complete set of lower-divertor tiles with an uncoated poloidal marker stripe were removed from one poloidal cross section and analysed using secondary ion mass spectrometry. The poloidal deposition profiles of 13 C on both the tungsten-coated tiles and on the uncoated graphite areas of the marker tiles were measured and compared. For the W-coated lower-divertor tiles, 13 C was deposited mainly on the high-field side tiles, while barely detectable amounts of 13 C were observed on low-field side samples. In contrast, on the uncoated marker stripes the deposition was equally pronounced in the high-field and low-field side divertor. The marker-tile results are in agreement with those obtained from graphite tiles after the 2003 and 2005 13 C experiments in ASDEX Upgrade. In the case of W-coated tiles, the 13 C measurements were complemented by determining the total amount of deposited carbon ( 12 C) on the tiles, which also shows strong deposition at the inner parts of the lower divertor. The estimated deposition of 13 C on W at the divertor areas was less than 1.5% of the injected amount of 13 C atoms. The 13 C analyses of the main-chamber tiles and small silicon samples mounted in remote areas revealed significant deposition in the upper divertor, in upper parts of the heat shield, in the limiter region close to the injection valve, and below the roof baffle. Approximately 8% of the injected 13 C is estimated to have accumulated in these regions. Possible reasons for the different deposition patterns on W and on graphite in different regions of the torus are discussed.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Tvarijonaviciute, Asta; Martínez-Subiela, Silvia; Ceron, José J
2010-10-01
The aim of this study was to validate 2 commercially available enzyme-linked immunosorbent assays (ELISAs) for adiponectin in dogs, 1 canine-specific and 1 originally designed for measurements in humans. Intra-assay and interassay precision was evaluated by multiple measurements in canine serum samples, and assay accuracy was indirectly determined by linearity under dilution. Interference caused by hemolysis and lipemia was also studied. Both assays were subsequently used for measuring adiponectin concentrations in clinically healthy dogs and those with different grades of obesity. The intra-assay and inter-assay precision was less than 7.5% and 13.5% in serum samples with low and high adiponectin concentrations, respectively. Lipemia and hemolysis did not affect the results of any of the assays. Both assays were able to differentiate lean dogs from those that were overweight or obese on the basis of the measured adiponectin concentrations. From these results it can be concluded that canine adiponectin concentrations can be measured reliably by means of the 2 ELISAs evaluated in this study.
Evaluation of prognostic markers for canine mast cell tumors treated with vinblastine and prednisone
Directory of Open Access Journals (Sweden)
Yuzbasiyan-Gurkan Vilma
2008-08-01
Full Text Available Abstract Background Canine cutaneous mast cell tumor (MCT is a common neoplastic disease associated with a variable biologic behavior. Surgery remains the primary treatment for canine MCT; however, radiation therapy (RT and chemotherapy are commonly used to treat aggressive MCT. The goals of this study were to evaluate the prognostic utility of histologic grade, c-KIT mutations, KIT staining patterns, and the proliferation markers Ki67 and AgNORs in dogs postoperatively treated with vinblastine and prednisone +/- RT, and to compare the outcome of dogs treated with post-operative chemotherapy +/- RT to that of a prognostically matched group treated with surgery alone. Associations between prognostic markers and survival were evaluated. Disease-free intervals (DFI and overall survival times (OS of dogs with similar pretreatment prognostic indices postoperatively treated with chemotherapy were compared to dogs treated with surgery alone. Results Histologic grade 3 MCTs, MCTs with c-KIT mutations, MCTs with increased cytoplasmic KIT, and MCTs with increased Ki67 and AgNOR values were associated with decreased DFI and OS. Dogs with histologic grade 3 MCT had significantly increased DFI and OS when treated with chemotherapy vs. surgery alone. Although not statistically significant due to small sample sizes, MCTs with c-KIT mutations had increased DFI and OS when treated with chemotherapy vs. surgery alone. Conclusion and clinical importance This study confirms the prognostic value of histologic grade, c-KIT mutations, KIT staining patterns, and proliferation analyses for canine MCT. Additionally, the results of this study further define the benefit of postoperative vinblastine and prednisone for histologic grade 3 MCTs.
Rubino, Mauro; Milin, Sylvie; D'Onofrio, Antonio; Signoret, Patrick; Hatté, Christine; Balesdent, Jérôme
2014-01-01
In this study, we evaluated trimethylsilyl (TMS) derivatives as derivatization reagents for the compound-specific stable carbon isotope analysis of soil amino acids by gas chromatography-combustion-isotope ratio mass spectrometry (GC-C-IRMS). We used non-proteinogenic amino acids to show that the extraction-derivatization-analysis procedure provides a reliable method to measure δ(13)C values of amino acids extracted from soil. However, we found a number of drawbacks that significantly increase the final total uncertainty. These include the following: production of multiple peaks for each amino acid, identified as di-, tri- and tetra-TMS derivatives; a number of TMS-carbon (TMS-C) atoms added lower than the stoichiometric one, possibly due to incomplete combustion; different TMS-C δ(13)C for di-, tri- and tetra-TMS derivatives. For soil samples, only four amino acids (leucine, valine, threonine and serine) provide reliable δ(13)C values with a total average uncertainty of 1.3 ‰. We conclude that trimethylsilyl derivatives are only suitable for determining the (13)C incorporation in amino acids within experiments using (13)C-labelled tracers but cannot be applied for amino acids with natural carbon isotope abundance until the drawbacks described here are overcome and the measured total uncertainty significantly decreased.
Field dependence of T1 for hyperpolarized [1-13C]pyruvate
DEFF Research Database (Denmark)
Chattergoon, N.; Martnez-Santiesteban, F.; Handler, W. B.
2013-01-01
conformation and properties of the dissolution media such as buffer composition, solution pH, temperature and magnetic field. We have measured the magnetic field dependence of the spin–lattice relaxation time of hyperpolarized [1-13C]pyruvate using field-cycled relaxometry. [1-13C]pyruvate was hyperpolarized...
Energy Technology Data Exchange (ETDEWEB)
Krivdin, L.B.; Shcherbakov, V.V.; Kalabin, G.A.
1986-07-10
It was shown that the direct /sup 13/C-/sup 13/C spin-spin coupling constants can be used for the unambiguous identification of the configurational isomers of oximes and their derivatives. The stereospecificity of the constants is explained by the additional contribution from the unshared electron pair of the nitrogen atom to the spin-spin coupling constant between the adjacent carbon nuclei in the cis position.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Millimetre-wave spectrum of anti-13C1 and 13C2 isotopologues of ethanol
International Nuclear Information System (INIS)
Bouchez, Aurelia; Walters, Adam; Müller, Holger S.P.; Ordu, Matthias; Lewen, Frank; Koerber, Monika; Bottinelli, Sandrine; Endres, Christian P.; Schlemmer, Stephan
2012-01-01
The rotational spectra of the two monosubstituted 13 C isotopologues of the anti conformer of ethanol have been measured between 80-800 GHz using three different spectrometers at the Cologne Laboratory Astrophysics group. The dataset was constrained for fitting with a standard Watson-S reduction Hamiltonian by rejecting transitions from high-lying states showing significant perturbation with the gauche states and by averaging some small methyl torsional splits. This treatment is compatible with the needs for a first astrophysical research for which an appropriate set of predictions is given.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
Directory of Open Access Journals (Sweden)
Pablo S.B. de Oliveira
Full Text Available ABSTRACT: Canine parvovirus type 2c (CPV-2c emerged in Europe in the early 2000’s and rapidly spread out worldwide. Clinical and molecular data have demonstrated its circulation in Brazilian dogs, yet detailed descriptions of cases are still lacking. This article describes the epidemiological, clinical and pathological features of 24 cases of CPV-2c-associated disease in dogs submitted to veterinary clinics and laboratory diagnosis in southern Brazil (2014-2016. Most affected dogs presented signs/lesions suggestive of parvovirus enteritis: diarrhea, vomiting, hyperemia and hemorrhage of the serous membrane of the small intestine, diffuse segmental granulation, atrophy of the villi, necrosis and fusion of crypts, squamous metaplasia and epithelial syncytia. A number of cases presented features divergent from the classical presentations, including a wide variation in the color of feces (reddish and/or yellowish, light-brownish, orange-brown and brownish, involvement of adults (4/24 and vaccinated dogs (12/24, extensive involvement of the small intestine (8/20 and the presence of pulmonary edema (7/24 and convulsions (3/24. Feces and intestinal fragments submitted to PCR for the CPV-2 VP2 gene and to virus isolation in cell culture yielded positive results in 100% and 58.3% (14/24 of the cases, respectively. Nucleotide sequencing revealed a high nucleotide identity in VP2 (99.4 to 100% and a consistent mutation at amino acid 426 (asparagine to glutamic acid, considered a signature of CPV-2c. These results confirm the involvement of CPV-2c in the described cases and demonstrate the importance of CPV-2c infection among Brazilian dogs, calling attention of veterinarians to correctly diagnose the disease, mainly considering the frequent atypical presentations.
Eileen K. Jenkins; Mallory T. DeChant; Erin B. Perry
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic c...
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
13C Kinetic isotopic effect of polymerization on monomers with multiple bond
International Nuclear Information System (INIS)
Berman, E.L.; Polyakov, V.B.; Makovetskij, K.L.; Golenko, T.G.; Galimov, Eh.M.; AN SSSR, Moscow. Inst. Organicheskoj Khimii; AN SSSR, Moscow. Inst. Geokhimii i Analiticheskoj Khimii)
1988-01-01
13 C kinetic isotopic effect (KIE) of anionic and radical polymerization and metathesis reaction of monomers with multiple bonds are studied and correlation between the found KIE values of polymerization and the structure of transition state is established. 13 C KIE of polymerization reactions are investigated using monomers with natural content of the isotope. Polymerization was carried out using high-vacuum equipment: radical polymerization of methyl acrylate (MA) and vinyl acetate in benzene solution under the effect of benzoyl peroxide (60 deg C); anionic polymerization of MA, initiated by potassium butyl cellosolvolate, was realized in mass at 25 deg C; cyclopentene metathesis reaction was conducted in benzene under the effect of initiating system WCl 6 - (C 3 H 5 ) 2 Si(CH 3 ) 2 at -30 deg C; phenylacetylene polymers were prepared by polymerization in benzene solution at 20 deg C under the effect of WCl 6 . It is ascertained that 13 C KIE of radical and anionic polymerization of olefins and cycloolefin metathesis constitutes 2.0 -2.4%. Polymerization of compound with ternary bond is accompanied by a lower value of 13 C KIE (<1%), which is explained by double bond of reacting bond in transition state
Calvopina, Joseph Hargan; Cook, Helene; Vincent, John J; Nee, Kevin; Clark, Amander T
2015-07-01
Removal of cytosine methylation from the genome is critical for reprogramming and transdifferentiation and plays a central role in our understanding of the fundamental principles of embryo lineage development. One of the major models for studying cytosine demethylation is the mammalian germ line during the primordial germ cell (PGC) stage of embryo development. It is now understood that oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) is required to remove cytosine methylation in a locus-specific manner in PGCs; however, the mechanisms downstream of 5hmC are controversial and hypothesized to involve either active demethylation or replication-coupled loss. In the current study, we used the aorta-gonad-mesonephros (AGM) organ culture model to show that this model recapitulates germ line reprogramming, including 5hmC reorganization and loss of cytosine methylation from Snrpn and H19 imprinting control centers (ICCs). To directly address the hypothesis that cell proliferation is required for cytosine demethylation, we blocked PI3-kinase-dependent PGC proliferation and show that this leads to a G1 and G2/M cell cycle arrest in PGCs, together with retained levels of cytosine methylation at the Snrpn ICC, but not at the H19 ICC. Taken together, the AGM organ culture model is an important tool to evaluate mechanisms of locus-specific demethylation and the role of PI3-kinase-dependent PGC proliferation in the locus-specific removal of cytosine methylation from the genome.
Are Hypomineralized Primary Molars and Canines Associated with Molar-Incisor Hypomineralization?
da Silva Figueiredo Sé, Maria Jose; Ribeiro, Ana Paula Dias; Dos Santos-Pinto, Lourdes Aparecida Martins; de Cassia Loiola Cordeiro, Rita; Cabral, Renata Nunes; Leal, Soraya Coelho
2017-11-01
The purpose of this study was to evaluate the prevalence of and relationship between hypomineralized second primary molars (HSPM) and hypomineralized primary canines (HPC) with molar-incisor hypomineralization (MIH) in 1,963 schoolchildren. The European Academy of Paediatric Dentistry (EAPD) criterion was used for scoring HSPM/HPC and MIH. Only children with four permanent first molars and eight incisors were considered in calculating MIH prevalence (n equals 858); for HSPM/HPC prevalence, only children with four primary second molars (n equals 1,590) and four primary canines (n equals 1,442) were considered. To evaluate the relationship between MIH/HSPM, only children meeting both criteria cited were considered (n equals 534), as was true of MIH/HPC (n equals 408) and HSPM/HPC (n equals 360; chi-square test and logistic regression). The prevalence of MIH was 14.69 percent (126 of 858 children). For HSPM and HPC, the prevalence was 6.48 percent (103 of 1,592) and 2.22 percent (32 of 1,442), respectively. A significant relationship was observed between MIH and both HSPM/HPC (PMIH based on HSPM was 6.31 (95 percent confidence interval [CI] equals 2.59 to 15.13) and for HPC was 6.02 (95 percent CI equals 1.08 to 33.05). The results led to the conclusion that both hypomineralized second primary molars and hypomineralized primary canines are associated with molar-incisor hypomineralization, because children with HSPM/HPC are six times more likely to develop MIH.
Calculation of the 13C NMR shieldings of the C0 2 complexes of aluminosilicates
Tossell, J. A.
1995-04-01
13C NMR shieldings have been calculated using the random-phase-approximation, localized-orbital local-origins version of ab initio coupled Hartree-Fuck perturbation theory for CO 2 and and for several complexes formed by the reaction of CO 2 with molecular models for aluminosilicate glasses, H 3TOT'H3 3-n, T,T' = Si,Al. Two isomeric forms of the CO 2-aluminosilicate complexes have been considered: (1) "CO 2-like" complexes, in which the CO 2 group is bound through carbon to a bridging oxygen and (2) "CO 3-like" complexes, in which two oxygens of a central CO 3 group form bridging bonds to the two TH 3 groups. The CO 2-like isomer of CO 2-H 3SiOSiH 3 is quite weakly bonded and its 13C isotropic NMR shielding is almost identical to that in free CO 2. As Si is progressively replaced by Al in the - H terminated aluminosilicate model, the CO 2-like isomers show increasing distortion from the free CO 2 geometry and their 13C NMR shieldings decrease uniformly. The calculated 13C shielding value for H 3AlO(CO 2)AlH 3-2 is only about 6 ppm larger than that calculated for point charge stabilized CO 3-2. However, for a geometry of H 3SiO(CO 2) AlH 3-1, in which the bridging oxygen to C bond length has been artificially increased to that found in the - OH terminated cluster (OH) 3SiO(CO 2)Al(OH) 3-1, the calculated 13C shielding is almost identical to that for free CO 2. The CO 3-like isomers of the CO 2-aluminosili-cate complexes show carbonate like geometries and 13C NMR shieldings about 4-9 ppm larger than those of carbonate for all T,T' pairs. For the Si,Si tetrahedral atom pair the CO 2-like isomer is more stable energetically, while for the Si,Al and Al,Al cases the CO 3-like isomer is more stable. Addition of Na + ions to the CO 3-2 or H 3AlO(CO 2)AlH 3-2 complexes reduces the 13C NMR shieldings by about 10 ppm. Complexation with either Na + or CO 2 also reduces the 29Si NMR shieldings of the aluminosilicate models, while the changes in 27Al shielding with Na + or CO 2
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old