WorldWideScience

Sample records for camp response element

  1. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  2. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  3. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  4. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Directory of Open Access Journals (Sweden)

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  5. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  6. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Science.gov (United States)

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  7. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    DEFF Research Database (Denmark)

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  8. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Science.gov (United States)

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  9. Bicarbonate-responsive “soluble” adenylyl cyclase defines a nuclear cAMP microdomain

    Science.gov (United States)

    Zippin, Jonathan H.; Farrell, Jeanne; Huron, David; Kamenetsky, Margarita; Hess, Kenneth C.; Fischman, Donald A.; Levin, Lonny R.; Buck, Jochen

    2004-01-01

    Bicarbonate-responsive “soluble” adenylyl cyclase resides, in part, inside the mammalian cell nucleus where it stimulates the activity of nuclear protein kinase A to phosphorylate the cAMP response element binding protein (CREB). The existence of this complete and functional, nuclear-localized cAMP pathway establishes that cAMP signals in intracellular microdomains and identifies an alternate pathway leading to CREB activation. PMID:14769862

  10. Vegetation response to wagon wheel camp layouts.

    African Journals Online (AJOL)

    Wagon wheel camp layouts have been favoured, in some quarters, for rotational grazing due to the economy and convenience of having the camps radially arranged around central facilities. A possible disadvantage of such layouts is the tendency for over-grazing near the hub and under-grazing at the extremities.

  11. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Science.gov (United States)

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  12. Connexin31.1 deficiency in the mouse impairs object memory and modulates open-field exploration, acetylcholine esterase levels in the striatum, and cAMP response element-binding protein levels in the striatum and piriform cortex.

    Science.gov (United States)

    Dere, E; Zheng-Fischhöfer, Q; Viggiano, D; Gironi Carnevale, U A; Ruocco, L A; Zlomuzica, A; Schnichels, M; Willecke, K; Huston, J P; Sadile, A G

    2008-05-02

    Neuronal gap junctions in the brain, providing intercellular electrotonic signal transfer, have been implicated in physiological and behavioral correlates of learning and memory. In connexin31.1 (Cx31.1) knockout (KO) mice the coding region of the Cx31.1 gene was replaced by a LacZ reporter gene. We investigated the impact of Cx31.1 deficiency on open-field exploration, the behavioral response to an odor, non-selective attention, learning and memory performance, and the levels of memory-related proteins in the hippocampus, striatum and the piriform cortex. In terms of behavior, the deletion of the Cx31.1 coding DNA in the mouse led to increased exploratory behaviors in a novel environment, and impaired one-trial object recognition at all delays tested. Despite strong Cx31.1 expression in the peripheral and central olfactory system, Cx31.1 KO mice exhibited normal behavioral responses to an odor. We found increased levels of acetylcholine esterase (AChE) and cAMP response element-binding protein (CREB) in the striatum of Cx31.1 KO mice. In the piriform cortex the Cx31.1 KO mice had an increased heterogeneity of CREB expression among neurons. In conclusion, gap-junctions featuring the Cx31.1 protein might be involved in open-field exploration as well as object memory and modulate levels of AChE and CREB in the striatum and piriform cortex.

  13. Regulation of cyclooxygenase-2 expression by cAMP response element and mRNA stability in a human airway epithelial cell line exposed to zinc

    Science.gov (United States)

    Exposure to zinc-laden particulate matter in ambient and occupational settings has been associated with proinflammatory responses in the lung. Cyclooxygenase 2-derived eicosanoids are important modulators of airway inflammation. In this study, we characterized the transcriptional...

  14. cAMP response element binding protein1 is essential for activation of steroyl co-enzyme a desaturase 1 (Scd1 in mouse lung type II epithelial cells.

    Directory of Open Access Journals (Sweden)

    Nisha Antony

    Full Text Available Cyclic AMP Response Element-Binding Protein 1 (Creb1 is a transcription factor that mediates cyclic adenosine 3', 5'-monophosphate (cAMP signalling in many tissues. Creb1(-/- mice die at birth due to respiratory failure and previous genome-wide microarray analysis of E17.5 Creb1(-/- fetal mouse lung identified important Creb1-regulated gene targets during lung development. The lipogenic enzymes stearoyl-CoA desaturase 1 (Scd1 and fatty acid synthase (Fasn showed highly reduced gene expression in Creb1(-/- lungs. We therefore hypothesized that Creb1 plays a crucial role in the transcriptional regulation of genes involved in pulmonary lipid biosynthetic pathways during lung development. In this study we confirmed that Scd1 and Fasn mRNA levels were down regulated in the E17.5 Creb1(-/- mouse lung while the lipogenic-associated transcription factors SrebpF1, C/ebpα and Pparγ were increased. In vivo studies using germline (Creb1(-/- and lung epithelial-specific (Creb1(EpiΔ/Δ Creb1 knockout mice showed strongly reduced Scd1, but not Fasn gene expression and protein levels in lung epithelial cells. In vitro studies using mouse MLE-15 epithelial cells showed that forskolin-mediated activation of Creb1 increased both Scd1 gene expression and protein synthesis. Additionally, MLE15 cells transfected with a dominant-negative ACreb vector blocked forskolin-mediated stimulation of Scd1 gene expression. Lipid profiling in MLE15 cells showed that dominant-negative ACreb suppressed forskolin-induced desaturation of ether linked lipids to produce plasmalogens, as well as levels of phosphatidylethanolamine, ceramide and lysophosphatidylcholine. Taken together these results demonstrate that Creb1 is essential for the induction and maintenance of Scd1 in developing fetal mouse lung epithelial cells.

  15. Suppressing cAMP response element-binding protein transcription shortens the duration of status epilepticus and decreases the number of spontaneous seizures in the pilocarpine model of epilepsy.

    Science.gov (United States)

    Zhu, Xinjian; Dubey, Deepti; Bermudez, Camilo; Porter, Brenda E

    2015-12-01

    Current epilepsy therapies directed at altering the function of neurotransmitter receptors or ion channels, or release of synaptic vesicles fail to prevent seizures in approximately 30% of patients. A better understanding of the molecular mechanism underlying epilepsy is needed to provide new therapeutic targets. The activity of cyclic AMP (cAMP) response element-binding protein (CREB), a major transcription factor promoting CRE-mediated transcription, increases following a prolonged seizure called status epilepticus. It is also increased in the seizure focus of patients with medically intractable focal epilepsy. Herein we explored the effect of acute suppression of CREB activity on status epilepticus and spontaneous seizures in a chronic epilepsy model. Pilocarpine chemoconvulsant was used to induce status epilepticus. To suppress CREB activity, a transgenic mouse line expressing an inducible dominant negative mutant of CREB (CREB(IR) ) with a serine to alanine 133 substitution was used. Status epilepticus and spontaneous seizures of transgenic and wild-type mice were analyzed using video-electroencephalography (EEG) to assess the effect of CREB suppression on seizures. Our findings indicate that activation of CREB(IR) shortens the duration of status epilepticus. The frequency of spontaneous seizures decreased in mice with chronic epilepsy during CREB(IR) induction; however, the duration of the spontaneous seizures was unchanged. Of interest, we found significantly reduced levels of phospho-CREB Ser133 upon activation of CREB(IR) , supporting prior work suggesting that binding to the CRE site is important for CREB phosphorylation. Our results suggest that CRE transcription supports seizure activity both during status epilepticus and in spontaneous seizures. Thus, blocking of CRE transcription is a novel target for the treatment of epilepsy. Wiley Periodicals, Inc. © 2015 International League Against Epilepsy.

  16. Snakes Have Feelings, Too: Elements of a Camp Snake Program.

    Science.gov (United States)

    Allen, Robert Ross

    2001-01-01

    A camp snake program can help campers overcome their fear of snakes, and people cannot truly enjoy nature when they carry a phobia about any one part of it. It can also help overcome prejudice by teaching truth and respect, instilling compassion, and helping campers develop empathy. Advice on catching, handling, identifying, keeping, and feeding…

  17. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    Science.gov (United States)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  18. Glycogen Synthase Kinase 3α Is the Main Isoform That Regulates the Transcription Factors Nuclear Factor-Kappa B and cAMP Response Element Binding in Bovine Endothelial Cells Infected with Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Octavio Silva-García

    2018-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutive enzyme implicated in the regulation of cytokine expression and the inflammatory response during bacterial infections. Mammals have two GSK3 isoforms named GSK3α and GSK3β that plays different but often overlapping functions. Although the role of GSK3β in cytokine regulation during the inflammatory response caused by bacteria is well described, GSK3α has not been found to participate in this process. Therefore, we tested if GSK3α may act as a regulatory isoform in the cytokine expression by bovine endothelial cells infected with Staphylococcus aureus because this bacterium is one of the major pathogens that cause tissue damage associated with inflammatory dysfunction. Interestingly, although both isoforms were phosphorylated–inactivated, we consistently observed a higher phosphorylation of GSK3α at Ser21 than that of GSK3β at Ser9 after bacterial challenge. During a temporal course of infection, we characterized a molecular switch from pro-inflammatory cytokine expression (IL-8, promoted by nuclear factor-kappa B (NF-κB, at an early stage (2 h to an anti-inflammatory cytokine expression (IL-10, promoted by cAMP response element binding (CREB, at a later stage (6 h. We observed an indirect effect of GSK3α activity on NF-κB activation that resulted in a low phosphorylation of CREB at Ser133, a decreased interaction between CREB and the co-activator CREB-binding protein (CBP, and a lower expression level of IL-10. Gene silencing of GSK3α and GSK3β with siRNA indicated that GSK3α knockout promoted the interaction between CREB and CBP that, in turn, increased the expression of IL-10, reduced the interaction of NF-κB with CBP, and reduced the expression of IL-8. These results indicate that GSK3α functions as the primary isoform that regulates the expression of IL-10 in endothelial cells infected with S. aureus.

  19. Proteomic signatures implicate cAMP in light and temperature responses in Arabidopsis thaliana

    KAUST Repository

    Thomas, Ludivine; Marondedze, Claudius; Ederli, Luisa; Pasqualini, Stefania; Gehring, Christoph A

    2013-01-01

    The second messenger 3'-5'-cyclic adenosine monophosphate (cAMP) and adenylyl cyclases (ACs), enzymes that catalyse the formation of cAMP from ATP, are increasingly recognized as important signaling molecules in a number of physiological responses

  20. A Closer Look at the Camp Experience: Examining Relationships between Life Skills, Elements of Positive Youth Development, and Antecedents of Change among Camp Alumni

    Science.gov (United States)

    Garst, Barry A.; Gagnon, Ryan J.; Whittington, Anja

    2016-01-01

    Understanding program components that contribute to positive youth outcomes following camp experiences can help program providers bring a greater level of intentionality to their efforts. The purposes of this study were twofold: (a) to develop reliable and valid measures of life skill development, elements of positive youth development (PYD), and…

  1. Characterization of a new CAMP factor carried by an integrative and conjugative element in Streptococcus agalactiae and spreading in Streptococci.

    Directory of Open Access Journals (Sweden)

    Sarah Chuzeville

    Full Text Available Genetic exchanges between Streptococci occur frequently and contribute to their genome diversification. Most of sequenced streptococcal genomes carry multiple mobile genetic elements including Integrative and Conjugative Elements (ICEs that play a major role in these horizontal gene transfers. In addition to genes involved in their mobility and regulation, ICEs also carry genes that can confer selective advantages to bacteria. Numerous elements have been described in S. agalactiae especially those integrated at the 3' end of a tRNA(Lys encoding gene. In strain 515 of S. agalactiae, an invasive neonate human pathogen, the ICE (called 515_tRNA(Lys is functional and carries different putative virulence genes including one encoding a putative new CAMP factor in addition to the one previously described. This work demonstrated the functionality of this CAMP factor (CAMP factor II in Lactococcus lactis but also in pathogenic strains of veterinary origin. The search for co-hemolytic factors in a collection of field strains revealed their presence in S. uberis, S. dysgalactiae, but also for the first time in S. equisimilis and S. bovis. Sequencing of these genes revealed the prevalence of a species-specific factor in S. uberis strains (Uberis factor and the presence of a CAMP factor II encoding gene in S. bovis and S. equisimilis. Furthermore, most of the CAMP factor II positive strains also carried an element integrated in the tRNA(Lys gene. This work thus describes a CAMP factor that is carried by a mobile genetic element and has spread to different streptococcal species.

  2. Proteomic signatures implicate cAMP in light and temperature responses in Arabidopsis thaliana

    KAUST Repository

    Thomas, Ludivine

    2013-05-01

    The second messenger 3\\'-5\\'-cyclic adenosine monophosphate (cAMP) and adenylyl cyclases (ACs), enzymes that catalyse the formation of cAMP from ATP, are increasingly recognized as important signaling molecules in a number of physiological responses in higher plants. Here we used proteomics to identify cAMP-dependent protein signatures in Arabidopsis thaliana and identify a number of differentially expressed proteins with a role in light- and temperature-dependent responses, notably photosystem II subunit P-1, plasma membrane associated cation-binding protein and chaperonin 60 β. Based on these proteomics results we conclude that, much like in cyanobacteria, algae and fungi, cAMP may have a role in light signaling and the regulation of photosynthesis as well as responses to temperature and we speculate that ACs could act as light and/or temperature sensors in higher plants. Biological significance: This current study is significant since it presents the first proteomic response to cAMP, a novel and key second messenger in plants. It will be relevant to researchers in plant physiology and in particular those with an interest in second messengers and their role in biotic and abiotic stress responses. © 2013 Elsevier B.V.

  3. Components of Camp Experiences for Positive Youth Development

    Directory of Open Access Journals (Sweden)

    Karla A. Henderson

    2007-03-01

    Full Text Available Youth development specialists advocate that well designed, implemented, and staffed youth centered programs result in positive outcomes for young people. Youth organizations have provided opportunities for young people to participate in camping experiences for over a century. The purpose of this paper is to describe what program components were related to camp environments and positive youth development. We describe these program components related to positive youth development based on a large scale national study of ACA (American Camp Association accredited camps that included independent, religiously affiliated, government, and not-for-profit organizations. Based on the responses given by camp directors, contact and leadership from trained staff and the supportive relationships they provided were essential elements of camp. Other aspects leading to positive youth development in camps were program mission and structure along with elements of accountability, assessment of outcomes, and opportunities for skill building.

  4. Year-to-year variability in haemoglobin mass response to two altitude training camps.

    Science.gov (United States)

    McLean, Blake D; Buttifant, David; Gore, Christopher J; White, Kevin; Kemp, Justin

    2013-12-01

    To quantify the year-to-year variability of altitude-induced changes in haemoglobin mass (Hb(mass)) in elite team-sport athletes. 12 Australian-Footballers completed a 19-day (ALT1) and 18-day (ALT2) moderate altitude (∼2100 m), training camp separated by 12 months. An additional 20 participants completed only one of the two training camps (ALT1 additional n=9, ALT2 additional n=11). Total Hb(mass) was assessed using carbon monoxide rebreathing before (PRE), after (POST₁) and 4 weeks after each camp. The typical error of Hb(mass) for the pooled data of all 32 participants was 2.6%. A contemporary statistics analysis was used with the smallest worthwhile change set to 2% for Hb(mass). POST₁ Hb(mass) was very likely increased in ALT1 (3.6 ± 1.6%, n=19; mean ± ∼90 CL) as well as ALT2 (4.4 ± 1.3%, n=23) with an individual responsiveness of 1.3% and 2.2%, respectively. There was a small correlation between ALT1 and ALT2 (R=0.21, p=0.59) for a change in Hb(mass), but a moderately inverse relationship between the change in Hb(mass) and initial relative Hb(mass) (g/kg (R=-0.51, p=0.04)). Two preseason moderate altitude camps 1 year apart yielded a similar (4%) mean increase in Hb(mass) of elite footballers, with an individual responsiveness of approximately half the group mean effect, indicating that most players gained benefit. Nevertheless, the same individuals generally did not change their Hb(mass) consistently from year to year. Thus, a 'responder' or 'non-responder' to altitude for Hb(mass) does not appear to be a fixed trait.

  5. An Analysis of the Relationship of Military Affiliation to Demographics, New Sailor Survey Responses, and Boot Camp Success

    National Research Council Canada - National Science Library

    Pond, Eric L

    2008-01-01

    .... Recruits' military affiliation showed no significant relationship with AFQT scores, age, bonus amounts, college level, graduation rate from boot camp, number of dependents, boot camp pay grade, race...

  6. Poker-camp: a program for calculating detector responses and phantom organ doses in environmental gamma fields

    International Nuclear Information System (INIS)

    Koblinger, L.

    1981-09-01

    A general description, user's manual and a sample problem are given in this report on the POKER-CAMP adjoint Monte Carlo photon transport program. Gamma fields of different environmental sources which are uniformly or exponentially distributed sources or plane sources in the air, in the soil or in an intermediate layer placed between them are simulated in the code. Calculations can be made on flux, kerma and spectra of photons at any point; and on responses of point-like, cylindrical, or spherical detectors; and on doses absorbed in anthropomorphic phantoms. (author)

  7. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  8. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  9. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  10. Physiological and performance responses to a preseason altitude-training camp in elite team-sport athletes.

    Science.gov (United States)

    McLean, Blake D; Buttifant, David; Gore, Christopher J; White, Kevin; Liess, Carsten; Kemp, Justin

    2013-07-01

    Little research has been done on the physiological and performance effects of altitude training on team-sport athletes. Therefore, this study examined changes in 2000-m time-trial running performance (TT), hemoglobin mass (Hbmass), and intramuscular carnosine content of elite Australian Football (AF) players after a preseason altitude camp. Thirty elite AF players completed 19 days of living and training at either moderate altitude (~2130 m; ALT, n = 21) or sea level (CON, n = 9). TT performance and Hbmass were assessed preintervention (PRE) and postintervention (POST1) in both groups and at 4 wk after returning to sea level (POST2) in ALT only. Improvement in TT performance after altitude was likely 1.5% (± 4.8-90%CL) greater in ALT than in CON, with an individual responsiveness of 0.8%. Improvements in TT were maintained at POST2 in ALT. Hbmass after altitude was very likely increased in ALT compared with CON (2.8% ± 3.5%), with an individual responsiveness of 1.3%. Hbmass returned to baseline at POST2. Intramuscular carnosine did not change in either gastrocnemius or soleus from PRE to POST1. A preseason altitude camp improved TT performance and Hbmass in elite AF players to a magnitude similar to that demonstrated by elite endurance athletes undertaking altitude training. The individual responsiveness of both TT and Hbmass was approximately half the group mean effect, indicating that most players gained benefit. The maintenance of running performance for 4 wk, despite Hbmass returning to baseline, suggests that altitude training is a valuable preparation for AF players leading into the competitive season.

  11. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  12. Marketing Your Day Camp.

    Science.gov (United States)

    Coleman, George

    1997-01-01

    Marketing strategies for day camps include encouraging camp staff to get involved in organizations involving children, families, and communities; holding camp fairs; offering the use of camp facilities to outside groups; hosting sport leagues and local youth outings; planning community fairs; and otherwise involving the camp in the community. (LP)

  13. Changes in the Arabidopsis thaliana Proteome Implicate cAMP in Biotic and Abiotic Stress Responses and Changes in Energy Metabolism

    KAUST Repository

    Alquraishi, May Majed; Gehring, Christoph A; Marondedze, Claudius

    2016-01-01

    The second messenger 3′,5′-cyclic adenosine monophosphate (cAMP) is increasingly recognized as having many different roles in plant responses to environmental stimuli. To gain further insights into these roles, Arabidopsis thaliana cell suspension culture was treated with 100 nM of cell permeant 8-bromo-cAMP for 5 or 10 min. Here, applying mass spectrometry and comparative proteomics, 20 proteins were identified as differentially expressed and we noted a specific bias in proteins with a role in abiotic stress, particularly cold and salinity, biotic stress as well as proteins with a role in glycolysis. These findings suggest that cAMP is sufficient to elicit specific stress responses that may in turn induce complex changes to cellular energy homeostasis.

  14. Changes in the Arabidopsis thaliana Proteome Implicate cAMP in Biotic and Abiotic Stress Responses and Changes in Energy Metabolism

    KAUST Repository

    Alquraishi, May Majed

    2016-06-01

    The second messenger 3′,5′-cyclic adenosine monophosphate (cAMP) is increasingly recognized as having many different roles in plant responses to environmental stimuli. To gain further insights into these roles, Arabidopsis thaliana cell suspension culture was treated with 100 nM of cell permeant 8-bromo-cAMP for 5 or 10 min. Here, applying mass spectrometry and comparative proteomics, 20 proteins were identified as differentially expressed and we noted a specific bias in proteins with a role in abiotic stress, particularly cold and salinity, biotic stress as well as proteins with a role in glycolysis. These findings suggest that cAMP is sufficient to elicit specific stress responses that may in turn induce complex changes to cellular energy homeostasis.

  15. Decreased hepatic response to glucagon, adrenergic agonists, and cAMP in glycogenolysis, gluconeogenesis, and glycolysis in tumor-bearing rats.

    Science.gov (United States)

    Biazi, Giuliana R; Frasson, Isabele G; Miksza, Daniele R; de Morais, Hely; de Fatima Silva, Flaviane; Bertolini, Gisele L; de Souza, Helenir M

    2018-05-15

    The response to glucagon and adrenaline in cancer cachexia is poorly known. The aim of this study was to investigate the response to glucagon, adrenergic agonists (α and β) and cyclic adenosine monophosphate (cAMP) on glycogenolysis, gluconeogenesis, and glycolysis in liver perfusion of Walker-256 tumor-bearing rats with advanced cachexia. Liver ATP content was also investigated. Rats without tumor (healthy) were used as controls. Agonists α (phenylephrine) and β (isoproterenol) adrenergic, instead of adrenaline, and cAMP, the second messenger of glucagon and isoproterenol, were used in an attempt to identify mechanisms involved in the responses. Glucagon (1 nM) stimulated glycogenolysis and gluconeogenesis and inhibited glycolysis in the liver of healthy and tumor-bearing rats, but their effects were lower in tumor-bearing rats. Isoproterenol (20 µM) stimulated glycogenolysis, gluconeogenesis, and glycolysis in healthy rats and had virtually no effect in tumor-bearing rats. cAMP (9 µM) also stimulated glycogenolysis and gluconeogenesis and inhibited glycolysis in healthy rats but had practically no effect in tumor-bearing rats. Phenylephrine (2 µM) stimulated glycogenolysis and gluconeogenesis and inhibited glycolysis and these effects were also lower in tumor-bearing rats than in healthy. Liver ATP content was lower in tumor-bearing rats. In conclusion, tumor-bearing rats with advanced cachexia showed a decreased hepatic response to glucagon, adrenergic agonists (α and β), and cAMP in glycogenolysis, gluconeogenesis, and glycolysis, which may be due to a reduced rate of regulatory enzyme phosphorylation caused by the low ATP levels in the liver. © 2018 Wiley Periodicals, Inc.

  16. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  17. cAMP and EPAC are key players in the regulation of the signal transduction pathway involved in the α-hemolysin autophagic response.

    Directory of Open Access Journals (Sweden)

    María Belén Mestre

    Full Text Available Staphylococcus aureus is a microorganism that causes serious diseases in the human being. This microorganism is able to escape the phagolysosomal pathway, increasing intracellular bacterial survival and killing the eukaryotic host cell to spread the infection. One of the key features of S. aureus infection is the production of a series of virulence factors, including secreted enzymes and toxins. We have shown that the pore-forming toxin α-hemolysin (Hla is the S. aureus-secreted factor responsible for the activation of the autophagic pathway and that this response occurs through a PI3K/Beclin1-independent form. In the present report we demonstrate that cAMP has a key role in the regulation of this autophagic response. Our results indicate that cAMP is able to inhibit the autophagy induced by Hla and that PKA, the classical cAMP effector, does not participate in this regulation. We present evidence that EPAC and Rap2b, through calpain activation, are the proteins involved in the regulation of Hla-induced autophagy. Similar results were obtained in cells infected with different S. aureus strains. Interestingly, in this report we show, for the first time to our knowledge, that both EPAC and Rap2b are recruited to the S. aureus-containing phagosome. We believe that our findings have important implications in understanding innate immune processes involved in intracellular pathogen invasion of the host cell.

  18. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  19. Teen Moms and Babies Benefit from Camping.

    Science.gov (United States)

    Goode, Marsha; Broesamle, Barbara

    1987-01-01

    Describes nine-day residential camp for Michigan teenage mothers/babies to enhance personal growth and develop responsible social skills. Outlines goals, pre-camp planning, staff, activities, evaluation. Reports 31 teen moms (ages 13-21) and 35 babies attended in 1986. Indicates participants were in therapy, experienced abuse, had low self-esteem,…

  20. Seafloor Science and Remotely Operated Vehicle (SSROV) Day Camp: A Week-Long, Hands-On STEM Summer Camp

    Science.gov (United States)

    Wheat, C. G.; Fournier, T.; Monahan, K.; Paul, C.

    2015-12-01

    RETINA (Robotic Exploration Technologies IN Astrobiology) has developed a program geared towards stimulating our youth with innovative and relevant hands-on learning modules under a STEM umbrella. Given the breadth of potential science and engineering topics that excite children, the RETINA Program focuses on interactive participation in the design and development of simple robotic and sensor systems, providing a range of challenges to engage students through project-based learning (PBL). Thus, young students experience scientific discovery through the use and understanding of technology. This groundwork serves as the foundation for SSROV Camp, a week-long, summer day camp for 6th-8th grade students. The camp is centered on the sensors and platforms that guide seafloor exploration and discovery and builds upon the notion that transformative discoveries in the deep sea result from either sampling new environments or making new measurements with sensors adapted to this extreme environment. These technical and scientific needs are folded into the curriculum. Each of the first four days of the camp includes four team-based, hands-on technical challenges, communication among peer groups, and competition. The fifth day includes additional activities, culminating in camper-led presentations to describe a planned mission based on a given geologic setting. Presentations include hypotheses, operational requirements and expected data products. SSROV Camp was initiated last summer for three sessions, two in Monterey, CA and one in Oxford, MS. Campers from both regions grasped key elements of the program, based on written responses to questions before and after the camp. On average, 32% of the pre-test questions were answered correctly compared with 80% of the post-test questions. Additional confirmation of gains in campers' knowledge, skills, and critical thinking on environmental issues and engineering problems were apparent during the "jeopardy" competition, nightly homework

  1. Medical Record Keeping in the Summer Camp Setting.

    Science.gov (United States)

    Kaufman, Laura; Holland, Jaycelyn; Weinberg, Stuart; Rosenbloom, S Trent

    2016-12-14

    Approximately one fifth of school-aged children spend a significant portion of their year at residential summer camp, and a growing number have chronic medical conditions. Camp health records are essential for safe, efficient care and for transitions between camp and home providers, yet little research exists regarding these systems. To survey residential summer camps for children to determine how camps create, store, and use camper health records. To raise awareness in the informatics community of the issues experienced by health providers working in a special pediatric care setting. We designed a web-based electronic survey concerning medical recordkeeping and healthcare practices at summer camps. 953 camps accredited by the American Camp Association received the survey. Responses were consolidated and evaluated for trends and conclusions. Of 953 camps contacted, 298 (31%) responded to the survey. Among respondents, 49.3% stated that there was no computer available at the health center, and 14.8% of camps stated that there was not any computer available to health staff at all. 41.1% of camps stated that internet access was not available. The most common complaints concerning recordkeeping practices were time burden, adequate completion, and consistency. Summer camps in the United States make efforts to appropriately document healthcare given to campers, but inconsistency and inefficiency may be barriers to staff productivity, staff satisfaction, and quality of care. Survey responses suggest that the current methods used by camps to document healthcare cause limitations in consistency, efficiency, and communications between providers, camp staff, and parents. As of 2012, survey respondents articulated need for a standard software to document summer camp healthcare practices that accounts for camp-specific needs. Improvement may be achieved if documentation software offers the networking capability, simplicity, pediatrics-specific features, and avoidance of

  2. Inhibitory effects of ginseng total saponin on up-regulation of cAMP pathway induced by repeated administration of morphine.

    Science.gov (United States)

    Seo, Jeong-Ju; Lee, Jae-Woong; Lee, Wan-Kyu; Hong, Jin-Tae; Lee, Chong-Kil; Lee, Myung-Koo; Oh, Ki-Wan

    2008-02-01

    We have reported that ginseng total saponin (GTS) inhibited the development of physical and psychological dependence on morphine. However, the possible molecular mechanisms of GTS are unclear. Therefore, this study was undertaken to understand the possible molecular mechanism of GTS on the inhibitory effects of morphine-induced dependence. It has been reported that the up-regulated cAMP pathway in the LC of the mouse brain after repeated administration of morphine contributes to the feature of withdrawals. GTS inhibited up-regulation of cAMP pathway in the LC after repeated administration of morphine in this experiment. GTS inhibited cAMP levels and protein expression of protein kinase A (PKA). In addition, GTS inhibited the increase of cAMP response element binding protein (CREB) phosphorylation. Therefore, we conclude that the inhibitory effects of GTS on morphine-induced dependence might be mediated by the inhibition of cAMP pathway.

  3. Tying the Design of Your Camp Staff Training to the Delivery of Desired Youth Outcomes

    Science.gov (United States)

    Galloway, Robin; Bourdeau, Virginia; Arnold, Mary; Nott, Brooke D.

    2013-01-01

    As experience camp directors, we've seen the challenges faced by young camp counselors and inexperienced staff. Evaluations from staff at many camps motivated us to help our people be more effective with their campers. In response we created a comprehensive camp staff training. Lessons showed staff what we wanted them to do and say as they…

  4. Recreation Summer Camps

    Data.gov (United States)

    Montgomery County of Maryland — List of all Camps (Register here:https://apm.activecommunities.com/montgomerycounty/Home) to include Aquatics, Basketball, Soccer, Special Interest, General Sports,...

  5. Registration Summer Camp 2016

    CERN Multimedia

    2016-01-01

    Reminder: registration for the CERN Staff Association Summer Camp is now open for children from 4 to 6 years old.   More information on the website: http://nurseryschool.web.cern.ch/. The summer camp is open to all children. The proposed cost is 480.-CHF/week, lunch included. The camp will be open weeks 27, 28, 29 and 30, from 8:30 a.m. to 5:30 p.m. For further questions, you are welcome to contact us by email at Summer.Camp@cern.ch. CERN Staff Association

  6. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  7. Influence of cAMP on reporter bioassays for dioxin and dioxin-like compounds

    International Nuclear Information System (INIS)

    Kasai, Ayumi; Yao, Jian; Yamauchi, Kozue; Hiramatsu, Nobuhiko; Hayakawa, Kunihiro; Meng, Yiman; Maeda, Shuichiro; Kitamura, Masanori

    2006-01-01

    In reporter assays for detection of dioxins, the dioxin-responsive element (DRE) is generally used as a sensor sequence. In several systems, the CYP1A1 promoter containing DREs (DRE cyp ) is inserted into a part of the long terminal repeat of mouse mammary tumor virus (LTR MMTV ) to improve sensitivity of assays. We found that DRE cyp -LTR MMTV responds not only to dioxins and dioxin-like compounds but also to forskolin, a cAMP-elevating agent. This effect was dose-dependent and reproduced by other cAMP-elevating agents including 8-bromo-cAMP and 3-isobutyl-methylxanthine. The cAMP response element (CRE) and CRE-like sequences were absent in DRE cyp -LTR MMTV and not involved in this process. In contrast to the effect of dioxin, the activation of DRE cyp -LTR MMTV by cAMP was independent of the aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor for DRE. Furthermore, neither DRE cyp , LTR MMTV nor the consensus sequence of DRE alone was activated in response to cAMP. These data elucidated for the first time that the combination of DRE cyp with LTR MMTV causes a peculiar response to cAMP and suggested that use of AhR antagonists is essential to exclude false-positive responses of DRE cyp -LTR MMTV -based bioassays for detection and quantification of dioxins and dioxin-like compounds

  8. Summer Camp July 2017 - Registration

    CERN Multimedia

    EVE et École

    2017-01-01

    The CERN Staff Association’s Summer Camp will be open for children from 4 to 6 years old during four weeks, from 3 to 28 July. Registration is offered on a weekly basis for 450 CHF, lunch included. This year, the various activities will revolve around the theme of the Four Elements. Registration opened on 20 March 2017 for children currently attending the EVE and School of the Association. It will be open from 3 April for children of CERN Members of Personnel, and starting from 24 April for all other children. The general conditions are available on the website of the EVE and School of CERN Staff Association: http://nurseryschool.web.cern.ch. For further questions, please contact us by email at Summer.Camp@cern.ch.

  9. Marketing for Camp Trends.

    Science.gov (United States)

    Biddle, Alicia

    1998-01-01

    To effectively market a camp, current trends and issues must be considered: specialty programming, the Americans With Disabilities Act, competing recreational programs, changes in the school year, programming for seniors, and accountability. Camps should have a marketing strategy that includes public relations, a marketing plan, a pricing…

  10. Camp's "Disneyland" Effect.

    Science.gov (United States)

    Renville, Gary

    1999-01-01

    Describes the positive mental, physical, and social growth impacts that the camping experience had on the author, and urges camp program evaluation to plan and implement such changes. Sidebar lists steps of effective evaluation: program goals and objectives, goals of evaluation, implementation of evaluation, data analysis, and findings and…

  11. Scrum Code Camps

    DEFF Research Database (Denmark)

    Pries-Heje, Lene; Pries-Heje, Jan; Dalgaard, Bente

    2013-01-01

    is required. In this paper we present the design of such a new approach, the Scrum Code Camp, which can be used to assess agile team capability in a transparent and consistent way. A design science research approach is used to analyze properties of two instances of the Scrum Code Camp where seven agile teams...

  12. CDC Disease Detective Camp

    Centers for Disease Control (CDC) Podcasts

    The CDC Disease Detective Camp gives rising high school juniors and seniors exposure to key aspects of the CDC, including basic epidemiology, infectious and chronic disease tracking, public health law, and outbreak investigations. The camp also helps students explore careers in public health.

  13. A Pediatric Cardiology Fellowship Boot Camp improves trainee confidence.

    Science.gov (United States)

    Allan, Catherine K; Tannous, Paul; DeWitt, Elizabeth; Farias, Michael; Mansfield, Laura; Ronai, Christina; Schidlow, David; Sanders, Stephen P; Lock, James E; Newburger, Jane W; Brown, David W

    2016-12-01

    Introduction New paediatric cardiology trainees are required to rapidly assimilate knowledge and gain clinical skills to which they have limited or no exposure during residency. The Pediatric Cardiology Fellowship Boot Camp (PCBC) at Boston Children's Hospital was designed to provide incoming fellows with an intensive exposure to congenital cardiac pathology and a broad overview of major areas of paediatric cardiology practice. The PCBC curriculum was designed by core faculty in cardiac pathology, echocardiography, electrophysiology, interventional cardiology, exercise physiology, and cardiac intensive care. Individual faculty contributed learning objectives, which were refined by fellowship directors and used to build a programme of didactics, hands-on/simulation-based activities, and self-guided learning opportunities. A total of 16 incoming fellows participated in the 4-week boot camp, with no concurrent clinical responsibilities, over 2 years. On the basis of pre- and post-PCBC surveys, 80% of trainees strongly agreed that they felt more prepared for clinical responsibilities, and a similar percentage felt that PCBC should be offered to future incoming fellows. Fellows showed significant increase in their confidence in all specific knowledge and skills related to the learning objectives. Fellows rated hands-on learning experiences and simulation-based exercises most highly. We describe a novel 4-week-long boot camp designed to expose incoming paediatric cardiology fellows to the broad spectrum of knowledge and skills required for the practice of paediatric cardiology. The experience increased trainee confidence and sense of preparedness to begin fellowship-related responsibilities. Given that highly interactive activities were rated most highly, boot camps in paediatric cardiology should strongly emphasise these elements.

  14. Summer Camp Registrations 2018

    CERN Multimedia

    Staff Association

    2018-01-01

    Registration for the CERN SA Summer camp, for children from 4 to 6 years old, is now open. The general conditions are available on the EVE and School website: http://nurseryschool.web.cern.ch For further questions, please contact us by email at  Summer.Camp@cern.ch An inscription per week is proposed, for 450.-CHF/week, lunch included. The camp will be open on weeks 27, 28, 29 and 30, from 8:30 am to 5:30 pm. This year the theme will be Vivaldi’s Four Seasons.

  15. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  16. Hitler's Death Camps.

    Science.gov (United States)

    Wieser, Paul

    1995-01-01

    Presents a high school lesson on Hitler's death camps and the widespread policy of brutality and oppression against European Jews. Includes student objectives, instructional procedures, and a chart listing the value of used clothing taken from the Jews. (CFR)

  17. CDC Disease Detective Camp

    Centers for Disease Control (CDC) Podcasts

    2010-08-02

    The CDC Disease Detective Camp gives rising high school juniors and seniors exposure to key aspects of the CDC, including basic epidemiology, infectious and chronic disease tracking, public health law, and outbreak investigations. The camp also helps students explore careers in public health.  Created: 8/2/2010 by Centers for Disease Control and Prevention (CDC).   Date Released: 8/2/2010.

  18. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  19. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  20. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  1. Sexual Harassment at Camp: Reducing Liability.

    Science.gov (United States)

    Oakleaf, Linda; Grube, Angela Johnson

    2003-01-01

    Employers are responsible for sexual harassment perpetrated by a supervisor. Camps may be responsible for sexual harassment between campers. Steps to reduce liability include providing multiple channels for reporting sexual harassment; having written policies prohibiting sexual harassment and procedures for reporting it; posting these policies and…

  2. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  3. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  4. An Analysis of the Relationship of Military Affiliation to Demographics, New Sailor Survey Responses, and Boot Camp Success

    Science.gov (United States)

    2008-06-01

    recruit to indicate his or her level of awareness regarding various Navy sponsorships (e.g. NFL, NASCAR, NBA etc.) The responses with respect to military...awareness of the Navy’s sponsorship of the following: NCAA Basketball Chi-Squared Statistic 2.4811 p-value 0.6480 Question 20e: The Navy...following: NCAA Basketball 50.2% 51.4% 16.3% 14.3% 14.7% 7.4% 8.8% 11.7% 9.9%15.3% 0.0% 20.0% 40.0% 60.0% 80.0% 100.0% Military Affiliation No Military

  5. Camp Marmal Flood Study

    Science.gov (United States)

    2012-03-01

    was simulated by means of a broad - crested weir built into the topography of the mesh. There is 0.5 m of freeboard and the width of the weir is 30 m...ER D C/ CH L TR -1 2- 5 Camp Marmal Flood Study Co as ta l a nd H yd ra ul ic s La bo ra to ry Jeremy A. Sharp , Steve H. Scott...Camp Marmal Flood Study Jeremy A. Sharp , Steve H. Scott, Mark R. Jourdan, and Gaurav Savant Coastal and Hydraulics Laboratory U.S. Army Engineer

  6. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  7. The role of cAMP in synaptic homeostasis in response to environmental temperature challenges and hyperexcitability mutations

    Directory of Open Access Journals (Sweden)

    Atsushi eUeda

    2015-02-01

    Full Text Available Homeostasis is the ability of physiological systems to regain functional balance following environment or experimental insults and synaptic homeostasis has been demonstrated in various species following genetic or pharmacological disruptions. Among environmental challenges, homeostatic responses to temperature extremes are critical to animal survival under natural conditions. We previously reported that axon terminal arborization in Drosophila larval neuromuscular junctions is enhanced at elevated temperatures; however, the amplitude of excitatory junctional potentials (EJPs remains unaltered despite the increase in synaptic bouton numbers. Here we determine the cellular basis of this homeostatic adjustment in larvae reared at high temperature (HT, 29 ˚C. We found that synaptic current focally recorded from individual synaptic boutons was unaffected by rearing temperature (30 ˚C. However, HT rearing decreased the quantal size (amplitude of spontaneous miniature EJPs, or mEJPs, which compensates for the increased number of synaptic releasing sites to retain a normal EJP size. The quantal size decrease is accounted for by a decrease in input resistance of the postsynaptic muscle fiber, indicating an increase in membrane area that matches the synaptic growth at HT. Interestingly, a mutation in rutabaga (rut encoding adenylyl cyclase (AC exhibited no obvious changes in quantal size or input resistance of postsynaptic muscle cells after HT rearing, suggesting an important role for rut AC in temperature-induced synaptic homeostasis in Drosophila. This extends our previous finding of rut-dependent synaptic homeostasis in hyperexcitable mutants, e.g. slowpoke (slo. In slo larvae, the lack of BK channel function is partially ameliorated by upregulation of presynaptic Sh IA current to limit excessive transmitter release in addition to postsynaptic glutamate receptor recomposition that reduces the quantal size.

  8. Geographies of the camp

    NARCIS (Netherlands)

    Minca, C.

    2015-01-01

    Facing the current growing global archipelago of encampments – including concentration, detention, transit, identification, refugee, military and training camps, this article is a geographical reflection on ‘the camp’, as a modern institution and as a spatial bio-political technology. In particular,

  9. Riflery: A Specialty Opportunity for Camp.

    Science.gov (United States)

    Pulliam, Richard

    1997-01-01

    Campers at the Virginia 4-H Shooting Education Camp receive intensive training from certified range coaches in shotgun, rifle, air rifle, air pistol, and archery. Such programs teach campers responsibility; develop character and self-concept; and promote safety, sportsmanship, and ethical behavior. Includes resources for developing a shooting…

  10. Cardiac response to hypobaric hypoxia: persistent changes in cardiac mass, function, and energy metabolism after a trek to Mt. Everest Base Camp

    NARCIS (Netherlands)

    Holloway, Cameron J.; Montgomery, Hugh E.; Murray, Andrew J.; Cochlin, Lowri E.; Codreanu, Ion; Hopwood, Naomi; Johnson, Andrew W.; Rider, Oliver J.; Levett, Denny Z. H.; Tyler, Damian J.; Francis, Jane M.; Neubauer, Stefan; Grocott, Michael P. W.; Clarke, Kieran; Grocott, Mike; Montgomery, Hugh; Levett, Denny; Martin, Daniel; Wilson, Mark; Windsor, Jeremy; Luery, Helen; Murray, Andrew; Stroud, Mike; Khosravi, Maryam; Wandrag, Liesl; Holloway, Cameron; Edwards, Lindsay; Ince, Can; Mythen, Monty; Jonas, Max; Imray, Chris; Newman, Stan; Stygal, Jan; Doyle, Patrick; Rodway, George; Howard, David; McMorrow, Roger; Ahuja, Vijay; Aref-Adib, Golnar; Burnham, Richard Dick; Chisholm, Amber; Coates, David; Cook, Debbie; Dhillon, Sundeep; Dougall, Christina; Duncan, Polly; Edsell, Mark; Evans, Lynn; Gardiner, Paul Bugs; Gunning, Paul

    2011-01-01

    We postulated that changes in cardiac high-energy phosphate metabolism may underlie the myocardial dysfunction caused by hypobaric hypoxia. Healthy volunteers (n=14) were studied immediately before, and within 4 d of return from, a 17-d trek to Mt. Everest Base Camp (5300 m). (31)P magnetic

  11. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  12. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Running Boot Camp

    CERN Document Server

    Toporek, Chuck

    2008-01-01

    When Steve Jobs jumped on stage at Macworld San Francisco 2006 and announced the new Intel-based Macs, the question wasn't if, but when someone would figure out a hack to get Windows XP running on these new "Mactels." Enter Boot Camp, a new system utility that helps you partition and install Windows XP on your Intel Mac. Boot Camp does all the heavy lifting for you. You won't need to open the Terminal and hack on system files or wave a chicken bone over your iMac to get XP running. This free program makes it easy for anyone to turn their Mac into a dual-boot Windows/OS X machine. Running Bo

  14. Cis-Lunar Base Camp

    Science.gov (United States)

    Merrill, Raymond G.; Goodliff, Kandyce E.; Mazanek, Daniel D.; Reeves, John D., Jr.

    2012-01-01

    Historically, when mounting expeditions into uncharted territories, explorers have established strategically positioned base camps to pre-position required equipment and consumables. These base camps are secure, safe positions from which expeditions can depart when conditions are favorable, at which technology and operations can be tested and validated, and facilitate timely access to more robust facilities in the event of an emergency. For human exploration missions into deep space, cis-lunar space is well suited to serve as such a base camp. The outer regions of cis-lunar space, such as the Earth-Moon Lagrange points, lie near the edge of Earth s gravity well, allowing equipment and consumables to be aggregated with easy access to deep space and to the lunar surface, as well as more distant destinations, such as near-Earth Asteroids (NEAs) and Mars and its moons. Several approaches to utilizing a cis-lunar base camp for sustainable human exploration, as well as some possible future applications are identified. The primary objective of the analysis presented in this paper is to identify options, show the macro trends, and provide information that can be used as a basis for more detailed mission development. Compared within are the high-level performance and cost of 15 preliminary cis-lunar exploration campaigns that establish the capability to conduct crewed missions of up to one year in duration, and then aggregate mass in cis-lunar space to facilitate an expedition from Cis-Lunar Base Camp. Launch vehicles, chemical propulsion stages, and electric propulsion stages are discussed and parametric sizing values are used to create architectures of in-space transportation elements that extend the existing in-space supply chain to cis-lunar space. The transportation options to cis-lunar space assessed vary in efficiency by almost 50%; from 0.16 to 0.68 kg of cargo in cis-lunar space for every kilogram of mass in Low Earth Orbit (LEO). For the 15 cases, 5-year campaign

  15. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  16. Summer Camp of the CERN Staff Association

    CERN Document Server

    Staff Association

    2017-01-01

    A Journey to Discover the Four Elements Over the past few years, the Children’s Day-Care Centre and School (EVEE) of the CERN Staff Association has transformed into a summer camp for the four weeks of July. Every year, this summer camp welcomes up to 40 children from 4 to 6 years old. The camp offers a rich and varied program. This year, the theme was the four elements of life, and the children set out on a journey to discover a different element every week: WATER was the theme of the first week. What is water? What purpose does it serve? Where can we find it? With these questions and many others in mind, the children set out on a cruise, sailing across Lake Geneva to visit the Lake Geneva Museum in Nyon. All through the week, the children were able to discover the different properties of water by carrying out various scientific experiments. For instance, getting soaked can certainly help observe a simple property of water: it’s wet! Giggles guaranteed. The children made fancy hats and e...

  17. Circadian expression of steroidogenic cytochromes P450 in the mouse adrenal gland--involvement of cAMP-responsive element modulator in epigenetic regulation of Cyp17a1.

    Science.gov (United States)

    Košir, Rok; Zmrzljak, Ursula Prosenc; Bele, Tanja; Acimovic, Jure; Perse, Martina; Majdic, Gregor; Prehn, Cornelia; Adamski, Jerzy; Rozman, Damjana

    2012-05-01

    The cytochrome P450 (CYP) genes Cyp51, Cyp11a1, Cyp17a1, Cyb11b1, Cyp11b2 and Cyp21a1 are involved in the adrenal production of corticosteroids, whose circulating levels are circadian. cAMP signaling plays an important role in adrenal steroidogenesis. By using cAMP responsive element modulator (Crem) knockout mice, we show that CREM isoforms contribute to circadian expression of steroidogenic CYPs in the mouse adrenal gland. Most striking was the CREM-dependent hypomethylation of the Cyp17a1 promoter at zeitgeber time 12, which resulted in higher Cyp17a1 mRNA and protein expression in the knockout adrenal glands. The data indicate that products of the Crem gene control the epigenetic repression of Cyp17 in mouse adrenal glands. © 2011 The Authors Journal compilation © 2011 FEBS.

  18. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  19. cAMP signalling in the vasculature: the role of Epac (exchange protein directly activated by cAMP).

    Science.gov (United States)

    Roberts, Owain Llŷr; Dart, Caroline

    2014-02-01

    The second messenger cAMP plays a central role in mediating vascular smooth muscle relaxation in response to vasoactive transmitters and in strengthening endothelial cell-cell junctions that regulate the movement of solutes, cells and macromolecules between the blood and the surrounding tissue. The vasculature expresses three cAMP effector proteins: PKA (protein kinase A), CNG (cyclic-nucleotide-gated) ion channels, and the most recently discovered Epacs (exchange proteins directly activated by cAMP). Epacs are a family of GEFs (guanine-nucleotide-exchange factors) for the small Ras-related GTPases Rap1 and Rap2, and are being increasingly implicated as important mediators of cAMP signalling, both in their own right and in parallel with the prototypical cAMP target PKA. In the present paper, we review what is currently known about the role of Epac within blood vessels, particularly with regard to the regulation of vascular tone, endothelial barrier function and inflammation.

  20. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  1. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  2. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  3. Registration Day-Camp 2016

    CERN Multimedia

    Nursery School

    2016-01-01

    Reminder Registration for the CERN Staff Association Day-camp are open for children from 4 to 6 years old More information on the website: http://nurseryschool.web.cern.ch/. The day-camp is open to all children. An inscription per week is proposed, cost 480.-CHF/week, lunch included The camp will be open weeks 27, 28, 29 and 30, from 8:30 am to 5:30 pm. For further questions, thanks you for contacting us by email at Summer.Camp@cern.ch.

  4. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  5. Summer Camp, July 2016

    CERN Multimedia

    Staff Association

    2016-01-01

    During the month of July, the Staff Association’s Children’s Day-Care Centre and School EVEE held a summer camp for 4- to 6-year-olds. 24 children altogether joined in on the adventures. On the summer camp, the children got to “travel” to a different continent of the world every week. Day after day, they would pass through make-believe Customs upon arrival and get their passports stamped by a “customs officer”. For the first week, we went on a trip to Africa. In the spirit of the theme, the children got to do plenty of crafts and coloring, make their own little bindles and play various games. They even had the chance to visit the Museum of Ethnography in Geneva (MEG), learn to play the balafon and make musical instruments with Sterrenlab. For the second week, we set off to discover the Americas, exploring both the South and the North. Alongside different workshops (singing, dancing, storytelling, crafts), the children could enjoy several special ac...

  6. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  7. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  8. The UXO Classification Demonstration at the Former Camp Butner, NC

    Science.gov (United States)

    2011-07-01

    Symposium and Workshop, Technical Session 2D: Classification Methods for Military Munitions Response. 1 December 2010. [49] Pasion , L. Personal...Communication. 15 June 2011. [50] Pasion , L. “Practical Strategies for UXO Discrimination: Camp Butner Analysis.” ESTCP Munitions Management In-Progress...Review. 9 February 2011. [51] Pasion , L., et al. “UXO Discrimination Using Full Coverage and Cued Interrogation Data Sets at Camp Butner, NC.” Partners

  9. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  10. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Science.gov (United States)

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  11. Assessing Disaster Preparedness Among Select Children's Summer Camps in the United States and Canada.

    Science.gov (United States)

    Chang, Megan; Sielaff, Alan; Bradin, Stuart; Walker, Kevin; Ambrose, Michael; Hashikawa, Andrew

    2017-08-01

    Children's summer camps are at risk for multiple pediatric casualties during a disaster. The degree to which summer camps have instituted disaster preparedness is unknown. We assessed disaster preparedness among selected camps nationally for a range of disasters. We partnered with a national, web-based electronic health records system to send camp leadership of 315 camp organizations a 14-question online survey of disaster preparedness. One response from each camp was selected in the following order of importance: owner, director, physician, nurse, medical technician, office staff, and other. The results were analyzed using descriptive statistics. A total of 181 camps responses were received, 169 of which were complete. Camp types were overnight (60%), day (21%), special/medical needs (14%), and other (5%). Survey respondents were directors (52%), nurses (14%), office staff (10%), physicians (5%), owners (5%), emergency medical technicians (2%), and other (12%). Almost 18% of camps were located >20 mi from a major medical center, and 36% were >5 mi from police/fire departments. Many camps were missing emergency supplies: car/booster seats for evacuation (68%), shelter (35%), vehicles for evacuation (26%), quarantine isolation areas (21%), or emergency supplies of extra water (20%) or food (17%). Plans were unavailable for the following: power outages (23%); lockdowns (15%); illness outbreaks (15%); tornadoes (11%); evacuation for fire, flood, or chemical spill (9%); and other severe weather (8%). Many camps did not have online emergency plans (53%), plans for children with special/medical needs (38%), methods to rapidly communicate information to parents (25%), or methods to identify children for evacuation/reunification with parents (40%). Respondents reported that staff participation in disaster drills varied for weather (58%), evacuations (46%), and lockdowns (36%). The majority (75%) of respondents had not collaborated with medical organizations for planning. A

  12. Exploring early twenty-first century developed forest camping experiences and meanings

    Science.gov (United States)

    Barry A. Garst; Daniel R. Williams; Joseph W. Roggenbuck

    2010-01-01

    This study examines experiences and associated meanings of 38 family groups participating in developed camping. The analysis is guided by discursive social psychology in which expressed meanings reflect interpretive frames campers use to explain experiences. Key elements of camping experience include nature, social interaction, and comfort/convenience. The most common...

  13. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  14. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  15. Registration Day-Camp 2016

    CERN Multimedia

    Nursery School

    2016-01-01

    Registration for the CERN SA Day-camp are open for children from 4 to 6 years old From March 14 to 25 for children already enrolled in CERN SA EVE and School From April 4 to 15 for the children of CERN members of the personnel (MP) From April 18 for other children More information on the website: http://nurseryschool.web.cern.ch/. The day-camp is open to all children. An inscription per week is proposed, cost 480.-CHF/week, lunch included The camp will be open weeks 27, 28, 29 and 30, from 8:30 am to 5:30 pm. For further questions, thanks you for contacting us by email at Summer.Camp@cern.ch.

  16. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  17. Base Camp Architecture

    Directory of Open Access Journals (Sweden)

    Warebi Gabriel Brisibe

    2016-03-01

    Full Text Available Longitudinal or time line studies of change in the architecture of a particular culture are common, but an area still open to further research is change across space or place. In particular, there is need for studies on architectural change of cultures stemming from the same ethnic source split between their homeland and other Diasporas. This change may range from minor deviations to drastic shifts away from an architectural norm and the accumulation of these shifts within a time frame constitutes variations. This article focuses on identifying variations in the architecture of the Ijo fishing group that migrates along the coastline of West Africa. It examines the causes of cross-cultural variation between base camp dwellings of Ijo migrant fishermen in the Bakassi Peninsula in Cameroon and Bayelsa State in Nigeria. The study draws on the idea of the inevitability of cultural and social change over time as proposed in the theories of cultural dynamism and evolution. It tests aspects of cultural transmission theory using the principal coordinates analysis to ascertain the possible causes of variation. From the findings, this research argues that migration has enhanced the forces of cultural dynamism, which have resulted in significant variations in the architecture of this fishing group.

  18. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  19. Activation of PKA in cell requires higher concentration of cAMP than in vitro: implications for compartmentalization of cAMP signalling.

    Science.gov (United States)

    Koschinski, Andreas; Zaccolo, Manuela

    2017-10-26

    cAMP is a ubiquitous second messenger responsible for the cellular effects of multiple hormones and neurotransmitters via activation of its main effector, protein kinase A (PKA). Multiple studies have shown that the basal concentration of cAMP in several cell types is about 1 μM. This value is well above the reported concentration of cAMP required to half-maximally activate PKA, which measures in the 100-300 nM range. Several hypotheses have been suggested to explain this apparent discrepancy including inaccurate measurements of intracellular free cAMP, inaccurate measurement of the apparent activation constant of PKA or shielding of PKA from bulk cytosolic cAMP via localization of the enzyme to microdomains with lower basal cAMP concentration. However, direct experimental evidence in support of any of these models is limited and a firm conclusion is missing. In this study we use multiple FRET-based reporters for the detection of cAMP and PKA activity in intact cells and we establish that the sensitivity of PKA to cAMP is almost twenty times lower when measured in cell than when measured in vitro. Our findings have important implications for the understanding of compartmentalized cAMP signalling.

  20. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  1. Management of diabetes at summer camps.

    Science.gov (United States)

    Ciambra, Roberta; Locatelli, Chiara; Suprani, Tosca; Pocecco, Mauro

    2005-01-01

    We report our experience in the organization of diabetic children summer-camps since 1973. Guidelines for organization have been recently reported by the SIEDP (Società Italiana di Endocrinologia e Diabetologia Pediatrica). Our attention is focused on diabetes management at camp, organization and planning, medical staff composition and staff training, treatment of diabetes-related emergencies, written camp management plan, diabetes education and psychological issues at camp, prevention of possible risks, assessment of effectiveness of education in summer camps and research at camp.

  2. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  3. The Popeye Domain Containing Genes and cAMP Signaling

    Directory of Open Access Journals (Sweden)

    Thomas Brand

    2014-05-01

    Full Text Available 3'-5'-cyclic adenosine monophosphate (cAMP is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs. Initially, it was thought that protein kinase A (PKA exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC and hyperpolarizing cyclic nucleotide-gated (HCN channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins.

  4. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  5. Communication, Coping, and Connections: Campers’ and Parents’ Perspectives of Self-Efficacy and Benefits of Participation in Deployment Support Camps

    Directory of Open Access Journals (Sweden)

    Christy D. Clary

    2015-06-01

    Full Text Available Military youth have unique challenges, particularly when a parent is deployed. Camp participation has been linked to multiple positive outcomes, thus camps have become popular as a setting for addressing these youth’s unique needs. With limited existing research on outcomes related to participation, this study explored to what extent participation in OMK camps affected military youth’s self-efficacy for communication, coping, and social skills. Participants responded to an online instrument three months after camp. Both campers and parents reported the largest increase in self-efficacy for communication skills, followed by social skills, and then coping skills. Open-ended responses overwhelmingly supported that developing friendships was one of the greatest benefits of attending a camp. The results are consistent with the literature regarding the importance of connectedness. Recommendations for conducting camps are offered. These finding may also be useful to those working with other special populations in the camp setting.

  6. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  8. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  9. Extension Sustainability Camp: Design, Implementation, and Evaluation

    Science.gov (United States)

    Brain, Roslynn; Upton, Sally; Tingey, Brett

    2015-01-01

    Sustainability Camps provide an opportunity for Extension educators to be in the forefront of sustainability outreach and to meet the growing demand for sustainability education. This article shares development, implementation, and evaluation of an Extension Sustainability Camp for youth, grades 4-6. Camp impact was measured via daily pre-and…

  10. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  11. Putting Your Camp on Video.

    Science.gov (United States)

    Peterson, Michael

    1997-01-01

    Creating a video to use in marketing camp involves selecting a format, writing the script, determining the video's length, obtaining release forms from campers who appear in the video, determining strategies for filming, choosing a narrator, and renting a studio and a mixing engineer (videotape editor). Includes distribution tips. (LP)

  12. Lyme Disease Comes to Camp.

    Science.gov (United States)

    Peterson, Michael

    1989-01-01

    Describes one summer camp's plan for dealing with Lyme disease. Describes the disease and the deer tick. Recommends avoiding tick exposure through clothing, frequent examination, showers, and avoiding high grass and brushy areas, and using chemical insect repellents and chemicals to kill ticks in deer mouse nests. (DHP)

  13. Camp Wanna-Read: Program Guide for the Texas Reading Club 1991.

    Science.gov (United States)

    Switzer, Robin Works

    Camp Wanna-Read is the theme for the 1991 program for the Texas Reading Club, which centers around the experiences and types of things that happen at summer camp. Each chapter is a type of camp a child might attend such as cooking camp, art camp, music camp, science camp, Indian camp, nature camp, and regular summer camp. The chapters are divided…

  14. Refugee-led humanitarianism in Lebanon’s Shatila camp

    Directory of Open Access Journals (Sweden)

    Hind Sharif

    2018-02-01

    Full Text Available Refugee-led humanitarian initiatives by ‘established’ Palestinian refugees in response to the arrival of ‘new’ displaced Syrians to Shatila camp raise key questions about the limitations of the humanitarian system and representations of refugees as passive victims.

  15. Academic Boot Camp for the Writing of Psychology Research Reports

    Science.gov (United States)

    Skues, Jason L.; Wise, Lisa

    2014-01-01

    Herein, we describe the implementation of, and responses to, a structured writing workshop in the form of an academic boot camp. Participants were 42 undergraduate psychology students from a medium-sized Australian university who were completing their major assignment for the semester. A majority of the students expressed satisfaction with the…

  16. Transformative Leadership: The Camp Counselor Experience

    Directory of Open Access Journals (Sweden)

    Stephanie Femrite

    2017-01-01

    Full Text Available A study, utilizing focus groups, was conducted with teens serving as camp counselors at the North Central 4-H camp in Missouri.  High school students, 14-18 years old, served as camp counselors during a four-day residential camp the summer of 2014. Each counselor was a current 4-H member and had served as a 4-H camp counselor in Missouri for at least one year, some serving as many as five years. Comparing two training models, evidence was found that intentional training sessions are crucial for the empowerment that leads to transformation.

  17. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  18. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  19. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP

    NARCIS (Netherlands)

    Kortenoeven, M.L.A.; van den Brand, M.; Wetzels, J.F.M.; Deen, P.M.T.

    2011-01-01

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined

  20. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    International Nuclear Information System (INIS)

    Zuloaga, R.; Fuentes, E.N.; Molina, A.; Valdés, J.A.

    2013-01-01

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP 3 /calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation

  1. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    Energy Technology Data Exchange (ETDEWEB)

    Zuloaga, R. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Fuentes, E.N.; Molina, A. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile); Valdés, J.A., E-mail: jvaldes@unab.cl [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile)

    2013-10-18

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

  2. Different cAMP sources are critically involved in G protein-coupled receptor CRHR1 signaling.

    Science.gov (United States)

    Inda, Carolina; Dos Santos Claro, Paula A; Bonfiglio, Juan J; Senin, Sergio A; Maccarrone, Giuseppina; Turck, Christoph W; Silberstein, Susana

    2016-07-18

    Corticotropin-releasing hormone receptor 1 (CRHR1) activates G protein-dependent and internalization-dependent signaling mechanisms. Here, we report that the cyclic AMP (cAMP) response of CRHR1 in physiologically relevant scenarios engages separate cAMP sources, involving the atypical soluble adenylyl cyclase (sAC) in addition to transmembrane adenylyl cyclases (tmACs). cAMP produced by tmACs and sAC is required for the acute phase of extracellular signal regulated kinase 1/2 activation triggered by CRH-stimulated CRHR1, but only sAC activity is essential for the sustained internalization-dependent phase. Thus, different cAMP sources are involved in different signaling mechanisms. Examination of the cAMP response revealed that CRH-activated CRHR1 generates cAMP after endocytosis. Characterizing CRHR1 signaling uncovered a specific link between CRH-activated CRHR1, sAC, and endosome-based signaling. We provide evidence of sAC being involved in an endocytosis-dependent cAMP response, strengthening the emerging model of GPCR signaling in which the cAMP response does not occur exclusively at the plasma membrane and introducing the notion of sAC as an alternative source of cAMP. © 2016 Inda et al.

  3. DRD2/AKT1 interaction on D2 c-AMP independent signaling, attentional processing, and response to olanzapine treatment in schizophrenia.

    Science.gov (United States)

    Blasi, Giuseppe; Napolitano, Francesco; Ursini, Gianluca; Taurisano, Paolo; Romano, Raffaella; Caforio, Grazia; Fazio, Leonardo; Gelao, Barbara; Di Giorgio, Annabella; Iacovelli, Luisa; Sinibaldi, Lorenzo; Popolizio, Teresa; Usiello, Alessandro; Bertolino, Alessandro

    2011-01-18

    The D2/AKT1/GSK-3β signaling pathway has been involved in the downstream intracellular effects of dopamine, in the pathophysiology of cognitive deficits and related brain activity in schizophrenia, as well as in response to treatment with antipsychotics. Polymorphisms in the D2 (DRD2 rs1076560) and AKT1 (AKT1 rs1130233) genes have been associated with their respective protein expression and with higher-order cognition and brain function, including attention. Given the strong potential for their relationship, we investigated the interaction of these polymorphisms on multiple molecular and in vivo phenotypes associated with this signaling pathway. We measured AKT1 and GSK-3β proteins and phosphorylation in human peripheral blood mononuclear cells, functional MRI cingulate response during attentional control, behavioral accuracy during sustained attention, and response to 8 wk of treatment with olanzapine in a total of 190 healthy subjects and 66 patients with schizophrenia. In healthy subjects, we found that the interaction between the T allele of DRD2 rs1076560 and the A allele of AKT1 rs1130233 was associated with reduced AKT1 protein levels and reduced phosphorylation of GSK-3β, as well as with altered cingulate response and reduced behavioral accuracy during attentional processing. On the other hand, interaction of these two alleles was associated with greater improvement of Positive and Negative Syndrome Scale scores in patients with schizophrenia after treatment with olanzapine. The present results indicate that these functional polymorphisms are epistatically associated with multiple phenotypes of relevance to schizophrenia. Our results also lend support to further investigation of this downstream molecular pathway in the etiology and treatment of this disorder.

  4. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    Directory of Open Access Journals (Sweden)

    Nicole M Warrington

    2015-07-01

    Full Text Available A relationship between cyclic adenosine 3’, 5’-monophosphate (cAMP levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor risk in individuals with Neurofibromatosis type 1 (NF1. Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex.

  5. Identification of a specific assembly of the G protein Golf as a critical and regulated module of dopamine and adenosine-activated cAMP pathways in the striatum

    Directory of Open Access Journals (Sweden)

    Denis eHervé

    2011-08-01

    Full Text Available In the principal neurons of striatum (medium spiny neurons, MSNs, cAMP pathway is primarily activated through the stimulation of dopamine D1 and adenosine A2A receptors, these receptors being mainly expressed in striatonigral and striatopallidal MSNs, respectively. Since cAMP signaling pathway could be altered in various physiological and pathological situations, including drug addiction and Parkinson’s disease, it is of crucial importance to identify the molecular components involved in the activation of this pathway. In MSNs, cAMP pathway activation is not dependent on the classical Gs GTP-binding protein but requires a specific G protein subunit heterotrimer containing Galpha-olf/beta2/gamma7 in particular association with adenylate cyclase type 5. This assembly forms an authentic functional signaling unit since loss of one of its members leads to defects of cAMP pathway activation in response to D1 or A2A receptor stimulation, inducing dramatic impairments of behavioral responses dependent on these receptors. Interestingly, D1 receptor-dependent cAMP signaling is modulated by the neuronal levels of Galpha-olf, indicating that Galpha-olf represents the rate-limiting step in this signaling cascade and could constitute a critical element for regulation of D1 receptor responses. In both Parkinsonian patients and several animal models of Parkinson’s disease, the lesion of dopamine neurons produces a prolonged elevation of Galpha-olf levels. This observation gives an explanation for the cAMP pathway hypersensitivity to D1 stimulation, occurring despite an unaltered D1 receptor density. In conclusion, alterations in the highly specialized assembly of Galpha-olf/beta2/gamma7 subunits can happen in pathological conditions, such as Parkinson’s disease, and it could have important functional consequences in relation to changes in D1 receptor signaling in the striatum.

  6. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  7. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Directory of Open Access Journals (Sweden)

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  8. The transcription factor cyclic adenosine 3',5'-monophosphate response element-binding protein enhances the odonto/osteogenic differentiation of stem cells from the apical papilla.

    Science.gov (United States)

    Su, S; Zhu, Y; Li, S; Liang, Y; Zhang, J

    2017-09-01

    To investigate the role of cAMP response element-binding protein (CREB) in the regulation of odonto/osteogenic differentiation of stem cells from the apical papilla (SCAPs). Stem cells from the apical papilla were obtained from human impacted third molars (n = 15). Isolated SCAPs were transfected with CREB overexpressing/silenced lentivirus. Transfected cells were stained with alizarin red to investigate mineralized nodule formation. The expression of the mineralization-related genes, alkaline phosphatase (ALP), collagen type I (Col I), runt-related transcription factor 2 (RUNX2), osterix (OSX) and osteocalcin (OCN), was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Protein expression of the odontogenic-related marker dentine sialoprotein (DSP) and the osteogenic-related marker RUNX2 was measured by Western blotting analysis. One-way analysis of variance (anova) and Student's t-test were used for statistical analysis (a = 0.05). The overexpression of CREB enhanced mineralized nodule formation and up-regulated (P odonto/osteogenic-related markers, including ALP, Col I, RUNX2, OSX and OCN, and also increased (P odonto/osteogenic-related markers. Up-regulation of CREB expression promoted odonto/osteogenic differentiation of SCAPs and provided a potential method for the regeneration of the dentine-pulp complex. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  9. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  10. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  11. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  12. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  13. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  14. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  15. Research summer camp in photonics

    Science.gov (United States)

    Buyanovskaya, Elizaveta; Melnik, Maksim; Egorov, Vladimir; Gleim, Artur; Lukishova, Svetlana; Kozlov, Sergei; Zhang, Xi-Cheng

    2017-08-01

    ITMO University and the University of Rochester became close partners several years ago. One of the first outcomes of this mutually beneficial partnership was the creation of International Institute of Photonics and Optical Information Technologies led by Prof. Sergei Kozlov and Prof. Xi-Cheng Zhang. Universities have created a double Masters-degree program in optics in 2014, and several ITMO students have been awarded degrees from Rochester. At the same time ITMO University organizes Summer Research camp in Photonics for University of Rochester students. Students spent two weeks in the Northern Capital of Russia learning about the emerging practical applications of femtosecond optics, terahertz biomedicine and quantum information technologies.

  16. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  17. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  18. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  19. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  20. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  1. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  2. Distancing Students From Nature: Science Camp and the Representation of the Human-Nature Relationship

    Science.gov (United States)

    Terrill, Laura Anne

    This study investigated the curricular representations of the environment and the human-environment relationship at one residential school sponsored science camp. Data gathered included field notes from observational time at the camp, interviews with staff and classroom teachers, and documents from the site's website, guides, manuals, and curricular guides. These data were analyzed to understand how the camp represented the human-environment relationship and the "proper" human-environment relationship to its participants. Analysis indicated that the camp's official and enacted curriculum was shaped in response to two perceived problems, (1) students were perceived as having a disconnected relationship with the outdoors and lacking in outdoor experiences; and (2) staff members of the camp believed that time for science during the school day had diminished and that students were not receiving adequate science instruction at school. In response, the goal of the camp was to connect students to the outdoors through hands-on, sensory, experience based science and outdoor education experiences. However, key aspects of the camp experience and the formal and enacted curriculum unintentionally positioned students as separate from nature. The camp experience presented a vacation like understanding of the human-environment relationship as students became tourists of the outdoors. Despite the site's goal of connecting students to the outdoors, the science camp experience worked to distance students from the outdoors by unintentionally representing the outdoors as a place that existed away from home and students' everyday lives. Notably, nature became a place that existed in the past, separate from modernity. Students were tourists in an exotic location - nature. They received tours of the foreign outdoors, had fun, and returned home to their ordinary lives that were separate and distinct from the natural world.

  3. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  4. Summer Camp of Mathematical Modeling in China

    Science.gov (United States)

    Tian, Xiaoxi; Xie, Jinxing

    2013-01-01

    The Summer Camp of Mathematical Modeling in China is a recently created experience designed to further Chinese students' academic pursuits in mathematical modeling. Students are given more than three months to research on a mathematical modeling project. Researchers and teams with outstanding projects are invited to the Summer Camp to present…

  5. Sustainable Design Principles for Refugee Camps

    NARCIS (Netherlands)

    Rooij, de L.L.; Wascher, D.M.; Paulissen, M.P.C.P.

    2016-01-01

    This report’s main focus is on the phenomenon of refugee camps as one of the most visible and spatially explicit results of refuge and migration movements at the global scale. Given the steadily growing numbers of people on the move and staying in temporary homes and settlements, refugee camps must

  6. Creating a Sun-Safe Camp.

    Science.gov (United States)

    Landrey, Ann

    1996-01-01

    Strategies for minimizing sun exposure of campers and staff include educating campers about the sun's effect on their skin, scheduling activities when the sun is less intense, creating shade at the camp site, incorporating sun protection into camp dress code, and training staff regarding sun protection. Addresses OSHA and liability issues. (LP)

  7. Life Skills Developed on the Camp "Stage."

    Science.gov (United States)

    Powell, Gwynn M.

    2000-01-01

    Draws on research concerning the components of sense of place, the rootedness of college students to their hometowns, and categories of environmental competence. Offer insights to camp staff into fostering sense of place and the emotional attachments to camp that comprise place attachment, and to developing environmental competence among campers…

  8. 1940s: Camping in the War Years.

    Science.gov (United States)

    Camping Magazine, 1999

    1999-01-01

    Camps continued to operate during World War II, but young male counselors, food, and supplies were difficult to obtain. An illustrative article from 1943, "Meal Planning for Summer Camps in Wartime" (Agnes B. Peterson), presents a guide to planning nutritious meals for campers despite shortages caused by wartime rationing, increased food…

  9. Camping Safety--Bring 'Em Back Alive.

    Science.gov (United States)

    Schmidt, Ernest F.

    1980-01-01

    A "prioritized" list of dangers of the woods is discussed and suggestions for safety in organized camping are listed. Available from: Center for Environmental, Camping and Outdoor Education; University of North Carolina at Greensboro; Pine Lake Field Campus; 4016 Blumenthal Road; Greensboro, NC, 27406. (AN)

  10. Forest Fire: A Crisis Reality for Camp.

    Science.gov (United States)

    Brown, Don; Mickelson, Rhonda

    2002-01-01

    Two camp directors were interviewed about evacuations from their camps due to forest fires. Topics covered include descriptions of the events; actions taken; aspects of advance planning that proved helpful; unexpected portions of the experience and resultant changes made in plans; relations with outside agencies, the media, and parents; working…

  11. The Camp Hill Project: Objectives and Design

    Science.gov (United States)

    Mattingly, John B.

    1976-01-01

    Available from: EC 090 474. Outlined are the problems and objectives of Pennsylvania's Camp Hill Project--a program designed to complete psychological needs assessments for juveniles incarcerated at Camp Hill, to develop project policies and guidelines in preparation for meeting with juvenile court judges, and to hire staff. (SBH)

  12. Is ROEE Good for Your Camp?

    Science.gov (United States)

    Parry, Jim

    1998-01-01

    Resident outdoor environmental education (ROEE) is a camp-based extension of the classroom for two to five days, promoting student independence, interpersonal skills, and ecological awareness. Advantages and disadvantages of the "camp as innkeeper" and full program-provider models are given. Program development guidelines cover expenses,…

  13. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  14. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  15. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  16. Opening of a summer camp at CERN

    CERN Multimedia

    Nursery School

    2015-01-01

    The Staff Association has the pleasure to announce the opening of a summer camp in l’EVE et Ecole de l’AP du CERN. With a capacity of 40 children, aged 4 to 6 years, it will be open from July 6 to 30. Registration Summer camp 2015 Registration for the CERN SA Summer camp for children aged 4 to 6 is open 16 to 30 April 2015 More information on the website: http://nurseryschool.web.cern.ch/ The Summer camp is open to all children of CERN Staff. An inscription per week is proposed, cost 480.-CHF/week, lunch included. The camp will be open weeks 28, 29, 30 and 31, from 8:30 am to 5:30 pm.

  17. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  18. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  19. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  1. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  2. Mental health needs of children and adolescents at camp: are they being assessed and treated appropriately by the camp nurse?

    Science.gov (United States)

    Courey, Tamra J

    2006-11-01

    Increasingly, more children and adolescents are attending camps with mental health concerns. This can pose a challenge for camp nurses who may lack experience in assessment and treatment of mental health issues. To focus on the importance of addressing and treating mental health needs of children and adolescents at camp utilizing the Scope and Standards of Psychiatric Mental Health Nursing Practice. Personal observations, camp nursing experience, and scholarly published literature. It is paramount that mental health needs of children and adolescents at camp are addressed and managed appropriately by the camp nurse. Education of camp nurses and camp administrators is also a vital part of providing care.

  3. Gabriel Camps (1927-2002

    Directory of Open Access Journals (Sweden)

    Marceau Gast

    2012-03-01

    Full Text Available Le professeur Gabriel Camps nous a quittés le 6 septembre 2002, emporté par les suites d’une grave maladie. Né le 20 mai 1927 à Misserghin, en Oranie, il affirma très jeune de grandes capacités intellectuelles. Dès l’âge de huit ans il se passionnait déjà à identifier des collections de pièces romaines. Son père, ingénieur à la Société nationale des chemins de fer algériens, sut favoriser sa curiosité concernant l’histoire antique de l’Afrique du Nord. Après des études secondaires au lycée d’...

  4. Effects of sodium ions on rat thyrocyte (FRTL-5 cells) swelling- and thyrotropin-activated taurine efflux dependent on cAMP and Epac.

    Science.gov (United States)

    Fugelli, Kjell

    2016-03-01

    Cellular osmolyte release is important in preventing water accumulation and swelling. However, the signaling pathways that detect volume increase and activate solute efflux are still not fully understood. We investigated efflux activation of the osmolyte taurine which is actively accumulated in rat thyrocytes (FRTL-5). Efflux of accumulated [(3)H]taurine was stimulated by cellular swelling and thyrotropin (TSH). These effects were significantly diminished in cells having reduced TSH receptor concentrations. Phosphodiesterase inhibitors (IBMX, Rolipram) enhanced both responses. An analog of forskolin (FSK; 7-deacetyl-7-[O-(N-methylpiperazino)-γ-butyryl] dihydrochloride) and an analog of cAMP, specific for activating exchange protein activated directly by cAMP (Epac; 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate, acetoxymethyl ester), significantly stimulated [(3)H]taurine efflux. A cAMP analog specific for activating protein kinase A (PKA; N6-benzoyladenosine-3',5'-cyclic monophosphate, acetoxymethyl ester) had no significant stimulatory effect on [(3)H]taurine efflux rate. The amiloride analog, 5-(N-ethyl-N-isopropyl)-amiloride, which inhibits a TSH-stimulated Na(+)/H(+) exchanger, enhanced (100 %) and ouabain inhibited (50 %) the TSH-stimulated [(3)H]taurine efflux rate. The effect of FSK on efflux was strongly potentiated by Na(+)-free iso-osmotic conditions and by osmolality/cell volume that affected also the db-cAMP-stimulated efflux. The TSH receptors and downstream elements of the signaling pathway comprising adenylyl cyclase, cAMP and Epac appeared to mediate the hormone-induced signal for [(3)H]taurine efflux from FRTL-5 cells. With less evidence, the cell volume/osmolality-induced [(3)H]taurine efflux cascade appeared to share some of the hormone signaling elements and to modulate the hormone signaling pathway at two levels through cellular Na(+).

  5. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  6. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  7. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  8. Registrations for the 2017 Summer Camp : there are still places available!

    CERN Multimedia

    Staff Association

    2017-01-01

    The CERN Staff Association’s Summer Camp will be open for 4- to 6 year-old children for four weeks, from 3 to 28 July. Registration is offered on a weekly basis for 450 CHF, lunch included. A maximum of 24 children can attend the camp per week. This year, the various activities will revolve around the theme of the Four Elements. Every week, one of the elements will be the core of all activities and explored through cultural outings, arts and crafts, stories, music, sports activities and scientific workshops, with or without special guests. The general conditions are available on the website of EVE and School of the CERN Staff Association: http://nurseryschool.web.cern.ch. For further questions and registration, please contact us by email at Summer.Camp@cern.ch.

  9. Body and Gender in Nazi Concentration Camps

    Directory of Open Access Journals (Sweden)

    Bożena Karwowska

    2009-01-01

    Full Text Available The article Body and Gender in Nazi Concentration Camps is an attempt to discuss difficult issues of human sexuality and sexually marked behaviors in the context of the concentration camps, and their descriptions in the memoirs of the survivors. Using notions and concepts of the so called "black American feminism" the author (referring extensively to books by Stanisław Grzesiuk and Zofia Romanowiczowa shows how in the concentration camp the human body became the only space of a relative privacy of the prisoner. At the same time the body becomes a territory on which all - both biological and socially constructed - human fates cross.

  10. Increasing the flexibility of the LANCE cAMP detection kit.

    Science.gov (United States)

    Hunter, Morag Rose; Glass, Michelle

    2015-01-01

    The detection of cAMP signalling is a common endpoint in the study of G-protein coupled receptors. A number of commercially available kits enable easy detection of cAMP. These kits are based on competition for a cAMP binding site on an antibody or cAMP binding protein and as such have a limited dynamic range. Here, we describe the optimisation of the commercially-available LANCE cAMP detection kit (PerkinElmer) to enable detection in cell lysates. This kit has been designed for use with live cells, with detection reagents applied to cells without wash steps. The standard protocol therefore requires that all assay reagents are compatible with the antibody and the final fluorescent detection stage, limiting the range of assay media and test compounds that can be utilised. The entire experiment must be repeated if cAMP levels fall outside the limited dynamic range. Here we describe a modified protocol that enables the assay to be performed on cell lysates, thereby overcoming these limitations. In this modified protocol, cells are stimulated for a cAMP response in standard media/buffers, washed and then lysed. The cell lysate is then assayed using a modified protocol for the LANCE cAMP detection kit. Samples were tested for stability following a freeze-thaw cycle. The modified LANCE cAMP detection protocol gives a reproducible measurement of cAMP in cell lysate. Lysate samples remain stable when stored at -80°C. Separating the stimulation and detection phases of this cAMP assay allows a vast array of cell stimulation conditions to be tested. The lysate-modified protocol for the LANCE cAMP detection kit therefore increases the flexibility, versatility and convenience of the assay. As samples are insensitive to freeze-thaw, it enables retesting of samples under different dilution conditions to ensure that all samples remain within the dynamic range of the standard curve. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  12. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  13. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  14. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  15. Integrating Enhanced STEM Themes in the UTEP CAREERS Weather Camp for Youth

    Science.gov (United States)

    Güereque, M.; Olgin, J. G.; Kier, M. W.; Winston, C. E.; Fitzgerald, R. M.; Morris, V. R.

    2014-12-01

    The NOAA Center for Atmospheric Science (NCAS) sponsors a network of high school and middle school summer camps entitled "Channeling Atmospheric Research into Educational Experiences Reaching Students program, CAREERS". These camps are conducted nationwide at NCAS academic partners; the University of Texas at El Paso (UTEP), Howard University (HU), University of Puerto Rico at Mayagüez (UPRM), and Jackson State University (JSU). The goals of these camps are to increase the interest of secondary school (HS) students in atmospheric and weather related sciences, target under-represented students, and to ultimately boost their college enrollment in STEM related fields. For 2014 at UTEP, the annual student-outreach weather camp program underwent a thematic overhaul that sought to incorporate more of the geological and environmental context of the region. Doctoral students were allowed to assume greater responsibility for the design, development and implementation of the camp activities. The prevailing assumption was that these Ph.D. students were better suited for peer mentoring, bridging the age and interest gap, and delivering the material through the modern technologies and modes of communication. The redesigned approach focused on the identification of climate drivers within the region and this concept formed a thread throughout the planning and design of the camp modules. The outcome resulted in the incorporation of project based learning (PBL) activities, field excursions, and deployment of weather instrumentation, for explaining regional climate processes and events. Standardized surveys were administered to camp participants to evaluate the efficacy, as well as student perceptions of the camp and its activities. Results will be presented that are based on qualitative and quantitative analysis of student responses.

  16. cAMP Stimulates Transepithelial Short-Circuit Current and Fluid Transport Across Porcine Ciliary Epithelium.

    Science.gov (United States)

    Cheng, Angela King-Wah; Civan, Mortimer M; To, Chi-Ho; Do, Chi-Wai

    2016-12-01

    To investigate the effects of cAMP on transepithelial electrical parameters and fluid transport across porcine ciliary epithelium. Transepithelial electrical parameters were determined by mounting freshly isolated porcine ciliary epithelium in a modified Ussing chamber. Similarly, fluid movement across intact ciliary body was measured with a custom-made fluid flow chamber. Addition of 1, 10, and 100 μM 8-Br-cAMP (cAMP) to the aqueous side (nonpigmented ciliary epithelium, NPE) induced a sustained increase in short-circuit current (Isc). Addition of niflumic acid (NFA) to the aqueous surface effectively blocked the cAMP-induced Isc stimulation. The administration of cAMP to the stromal side (pigmented ciliary epithelium, PE) triggered a significant stimulation of Isc only at 100 μM. No additive effect was observed with bilateral application of cAMP. Likewise, forskolin caused a significant stimulation of Isc when applied to the aqueous side. Concomitantly, cAMP and forskolin increased fluid transport across porcine ciliary epithelium, and this stimulation was effectively inhibited by aqueous NFA. Depleting Cl- in the bathing solution abolished the baseline Isc and inhibited the subsequent stimulation by cAMP. Pretreatment with protein kinase A (PKA) blockers (H89/KT5720) significantly inhibited the cAMP- and forskolin-induced Isc responses. Our results suggest that cAMP triggers a sustained stimulation of Cl- and fluid transport across porcine ciliary epithelium; Cl- channels in the NPE cells are potentially a cellular site for this PKA-sensitive cAMP-mediated response.

  17. Design and Development Issues for Educational Robotics Training Camps

    Science.gov (United States)

    Ucgul, Memet; Cagiltay, Kursat

    2014-01-01

    The aim of this study is to explore critical design issues for educational robotics training camps and to describe how these factors should be implemented in the development of such camps. For this purpose, two robotics training camps were organized for elementary school students. The first camp had 30 children attendees, and the second had 22. As…

  18. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Characterization of Vaccination Policies for Attendance and Employment at Day/Summer Camps in New York State.

    Science.gov (United States)

    Prescott, William A; Violanti, Kelsey C; Fusco, Nicholas M

    2018-01-01

    New York state requires day/summer camps to keep immunization records for all enrolled campers and strongly recommends requiring vaccination for all campers and staff. The objective of this study was to characterize immunization requirements/recommendations for children/adolescents enrolled in and staff employed at day/summer camps in New York state. An electronic hyperlink to a 9-question survey instrument was distributed via e-mail to 178 day/summer camps located in New York state cities with a population size greater than 100 000 people. A follow-up telephone survey was offered to nonresponders. The survey instrument included questions pertaining to vaccination documentation policies for campers/staff and the specific vaccines that the camp required/recommended. Fisher's exact and Chi-square tests were used to analyze categorical data. Sixty-five day/summer camps responded to the survey (36.5% response rate): 48 (73.8%) and 23 (41.8%) camps indicated having a policy/procedure for documenting vaccinations for campers and staff, respectively. Camps that had a policy/procedure for campers were more likely to have a policy/procedure for staff ( P = .0007). Age-appropriate vaccinations that were required/recommended for campers by at least 80% of camps included: measles, mumps, and rubella (MMR), diphtheria, tetanus, and pertussis (DTaP), hepatitis B, inactivated/oral poliovirus (IPV/OPV), Haemophilus influenzae type b (Hib), and varicella. Age-appropriate vaccinations that were required/recommended for staff by at least 80% of camps included: DTaP, hepatitis B, IPV/OPV, MMR, meningococcus, varicella, Hib, and tetanus, diphtheria, and pertussis (Tdap). Vaccination policies at day/summer camps in New York state appear to be suboptimal. Educational outreach may encourage camps to strengthen their immunization policies, which may reduce the transmission of vaccine-preventable diseases.

  20. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  1. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  2. 2012 USGS Lidar: Brooks Camp (AK)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The U.S. Geological Survey (USGS) had a requirement for high resolution Lidar needed for mapping the Brooks Camp region of Katmai National Park in Alaska....

  3. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  4. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  5. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  6. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  7. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  8. Preserved cardiac function despite marked impairment of cAMP generation.

    Directory of Open Access Journals (Sweden)

    Mei Hua Gao

    Full Text Available So many clinical trials of positive inotropes have failed, that it is now axiomatic that agents that increase cAMP are deleterious to the failing heart. An alternative strategy is to alter myocardial Ca(2+ handling or myofilament response to Ca(2+ using agents that do not affect cAMP. Although left ventricular (LV function is tightly linked to adenylyl cyclase (AC activity, the beneficial effects of AC may be independent of cAMP and instead stem from effects on Ca(2+ handling. Here we ask whether an AC mutant molecule that reduces LV cAMP production would have favorable effects on LV function through its effects on Ca(2+ handling alone.We generated transgenic mice with cardiac-directed expression of an AC6 mutant (AC6mut. Cardiac myocytes showed impaired cAMP production in response to isoproterenol (74% reduction; p<0.001, but LV size and function were normal. Isolated hearts showed preserved LV function in response to isoproterenol stimulation. AC6mut expression was associated with increased sarcoplasmic reticulum Ca(2+ uptake and the EC50 for SERCA2a activation was reduced. Cardiac myocytes isolated from AC6mut mice showed increased amplitude of Ca(2+ transients in response to isoproterenol (p = 0.0001. AC6mut expression also was associated with increased expression of LV S100A1 (p = 0.03 and reduced expression of phospholamban protein (p = 0.01.LV AC mutant expression is associated with normal cardiac function despite impaired cAMP generation. The mechanism appears to be through effects on Ca(2+ handling - effects that occur despite diminished cAMP.

  9. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  10. Payment or Reimbursement for Certain Medical Expenses for Camp Lejeune Family Members. Final rule.

    Science.gov (United States)

    2017-05-05

    The Department of Veterans Affairs (VA) adopts as final an interim final rule addressing payment or reimbursement of certain medical expenses for family members of Camp Lejeune veterans. Under this rule, VA reimburses family members, or pays providers, for medical expenses incurred as a result of certain illnesses and conditions that may be associated with contaminants present in the base water supply at U.S. Marine Corps Base Camp Lejeune (Camp Lejeune), North Carolina, from August 1, 1953, to December 31, 1987. Payment or reimbursement is made within the limitations set forth in statute and Camp Lejeune family members receive hospital care and medical services that are consistent with the manner in which we provide hospital care and medical services to Camp Lejeune veterans. The statutory authority has since been amended to also include certain veterans' family members who resided at Camp Lejeune, North Carolina, for no less than 30 days (consecutive or nonconsecutive) between August 1, 1953, and December 31, 1987. This final rule will reflect that statutory change and will address public comments received in response to the interim final rule.

  11. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  12. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  13. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  14. Ladders to Leadership: What Camp Counselor Positions Do for Youth

    Directory of Open Access Journals (Sweden)

    Darcy Tessman

    2012-09-01

    Full Text Available The 4-H youth development organization understands and has recognized residential camping as one of the major modes of program delivery. Primary benefactors of the residential camping program are those youth who serve as camp counselors. Not only are they recipients of the educational program, but also supervise and teach younger campers (Garst & Johnson, 2005; McNeely, 2004. As a result of their experience, camp counselors learn about and develop leadership and life skills (Thomas, 1996; Purcell, 1996. The residential camping experience allows youth to serve as volunteers through their role as camp counselors. In addition to the benefits earned from their volunteer role, residential camping provides youth camp counselors the opportunity to gain leadership skills (Arnold, 2003 as well as add to the camp structure, planning, and implementation (Hines & Riley, 2005.

  15. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  16. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  17. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  18. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  19. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  1. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  2. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  3. Functional desensitization to isoproterenol without reducing cAMP production in canine failing cardiocytes.

    Science.gov (United States)

    Laurent, C E; Cardinal, R; Rousseau, G; Vermeulen, M; Bouchard, C; Wilkinson, M; Armour, J A; Bouvier, M

    2001-02-01

    To corroborate alterations in the functional responses to beta-adrenergic receptor (beta-AR) stimulation with changes in beta-AR signaling in failing cardiomyocytes, contractile and L-type Ca(2+) current responses to isoproterenol along with stimulated cAMP generation were compared among cardiomyocytes isolated from canines with tachycardia-induced heart failure or healthy hearts. The magnitude of shortening of failing cardiomyocytes was significantly depressed (by 22 +/- 4.4%) under basal conditions, and the maximal response to isoproterenol was significantly reduced (by 45 +/- 18%). Similar results were obtained when the responses in the rate of contraction and rate of relaxation to isoproterenol were considered. The L-type Ca(2+) current amplitude measured in failing cardiomyocytes under basal conditions was unchanged, but the responses to isoproterenol were significantly reduced compared with healthy cells. Isoproterenol-stimulated cAMP generation was similar in sarcolemmal membranes derived from the homogenates of failing (45 +/- 6.8) and healthy cardiomyocytes (52 +/- 8.5 pmol cAMP. mg protein(-1). min(-1)). However, stimulated cAMP generation was found to be significantly reduced when the membranes were derived from the homogenates of whole tissue (failing: 67 +/- 8.1 vs. healthy: 140 +/- 27.8 pmol cAMP. mg protein(-1). min(-1)). Total beta-AR density was not reduced in membranes derived from either whole tissue or isolated cardiomyocyte homogenates, but the beta(1)/beta(2) ratio was significantly reduced in the former (failing: 45/55 vs. healthy: 72/28) without being altered in the latter (failing: 72/28, healthy: 77/23). We thus conclude that, in tachycardia-induced heart failure, reduction in the functional responses of isolated cardiomyocytes to beta-AR stimulation may be attributed to alterations in the excitation-contraction machinery rather than to limitation of cAMP generation.

  4. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  5. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  6. Base Camp Life Cycle Management: Focusing on the Critical Elements

    Science.gov (United States)

    2011-12-01

    needs of the occupants, although “building” this infrastructure often meant cobbling together prefabricated buildings or tents as much as it meant...as System Boundaries.” Journal of Industrial Ecology 10, no. 1 (2006): 61-77. Rebitzer, G. and Hunkeler, D. Life Cycle Costing in LCM: Ambitions

  7. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  8. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  9. Summer camp course in nuclear operations

    International Nuclear Information System (INIS)

    Peterson, P.F.; James, J.Z.; Terrell, B.E.

    1993-01-01

    This paper describes a new kind of nuclear engineering curriculum that echoes an old method of professional training - the intensive summer camp. For many years a staple of the training of civil engineers and foresters, summer camp courses immerse the student in an intensive, focused experience, isolated from the familiar campus and resembling the actual work environment for which the student is being trained. With financial support from the U.S. Department of Energy, University of California-Berkeley (UCB) and Pacific Gas ampersand Electric (PG ampersand E) have launched such a course for UCB nuclear engineering undergraduates

  10. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  11. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  12. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  13. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  14. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  15. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  16. Adventure Code Camp: Library Mobile Design in the Backcountry

    OpenAIRE

    Ward, David; Hahn, James; Mestre, Lori

    2014-01-01

    This article presents a case study exploring the use of a student Coding Camp as a bottom-up mobile design process to generate library mobile apps. A code camp sources student programmer talent and ideas for designing software services and features.  This case study reviews process, outcomes, and next steps in mobile web app coding camps. It concludes by offering implications for services design beyond the local camp presented in this study. By understanding how patrons expect to integrate li...

  17. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  18. Transitioning Traditions: Rectifying an Ontario Camp's Indian Council Ring

    Science.gov (United States)

    Wilkes, Taylor

    2011-01-01

    Council Ring has always been a very special event, remembered fondly by generations of campers. Taylor Statten Camps (TSC) are not the only camps to cherish such an activity. Across Canada there are dozens of camps that have supported "Indian" assemblies in the past, but a select few still do. Most organizations abandoned them during the…

  19. Rethinking the lessons from Za’atari refugee camp

    Directory of Open Access Journals (Sweden)

    Melissa N Gatter

    2018-02-01

    Full Text Available Humanitarian efforts to build a model refugee camp when constructing Azraq camp in Jordan – drawing on what was supposed to have been learned in Za’atari camp – missed crucial aspects of Za’atari’s governance.

  20. 49 CFR 218.80 - Movement of occupied camp cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Movement of occupied camp cars. 218.80 Section 218... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD OPERATING PRACTICES Protection of Occupied Camp Cars § 218.80 Movement of occupied camp cars. Occupied cars may not be humped or flat switched unless coupled to...

  1. Camp Health Aide Manual = Manual para trabajadores de salud.

    Science.gov (United States)

    Robinson, June Grube; And Others

    This bilingual manual serves as a textbook for migrant Camp Health Aides. Camp Health Aides are members of migrant labor camps enlisted to provide information about health and social services to migrant workers and their families. The manual is divided into 12 tabbed sections representing lessons. Teaching notes printed on contrasting paper…

  2. E. Coli: Preventing Outbreaks at Camp.

    Science.gov (United States)

    McKinney, Mary D.

    1996-01-01

    One strain of E. coli is not usually found in foods, but has been related to consumption of undercooked ground beef. Symptoms are stomach cramps and diarrhea, and 2-7% of infections lead to hemolytic uremic syndrome, which is life threatening. Camps can prevent outbreaks by avoiding uncooked meat on overnight campouts and requiring appropriate…

  3. Conduct Disorders: Are Boot Camps Effective?

    Science.gov (United States)

    Jeter, LaVaughn V.

    2010-01-01

    Youth diagnosed with "conduct disorder" are often placed in programs using forced compliance and coercive control. One type of intervention used to treat conduct disorder is the boot camp. The basic idea is that disruptive behaviors can be corrected by strict behavioral regulation and an emphasis on skills training (Weis & Toolis 2009; Weis,…

  4. Homosexual inmates in the Buchenwald Concentration Camp.

    Science.gov (United States)

    Röll, W

    1996-01-01

    The treatment of homosexual inmates in Nazi concentration camps is a subject which was largely ignored by historians in both West and East Germany after the war. Not until the 1980s, when research began to focus on some of the lesser-known victims of Nazi terror, did attention shift to the fate of homosexuals. This process can be seen clearly at the Buchenwald Memorial in the former GDR, the site of the persecution and also the death of considerable numbers of prisoners identified by the pink triangle on their clothing. The persecution of homosexuals in Nazi Germany began in 1933, even before Buchenwald was built in 1937. The Nazis aimed to eradicate homosexuality, which they saw as a threat to the survival of the German people. Incarceration in concentration camps like Buchenwald marked a stage in the radicalization of Nazi policy against homosexuals. There they were subjected to the harshest conditions and treated as the lowest of the low in the camp hierarchy. They were continually exposed to the terror of the SS but also the latent prejudices of the rest of the camp population. The culminating points of their maltreatment in Buchenwald were the use of homosexuals in experiments to develop immunization against typhus fever and the attempt by an SS doctor to "cure" homosexuality through the implantation of sexual hormones.

  5. Mortality study of civilian employees exposed to contaminated drinking water at USMC Base Camp Lejeune: a retrospective cohort study

    Science.gov (United States)

    2014-01-01

    Background Two drinking water systems at U.S. Marine Corps Base Camp Lejeune, North Carolina were contaminated with solvents during 1950s-1985. Methods We conducted a retrospective cohort mortality study of 4,647 civilian, full-time workers employed at Camp Lejeune during 1973–1985 and potentially exposed to contaminated drinking water. We selected a comparison cohort of 4,690 Camp Pendleton workers employed during 1973–1985 and unexposed to contaminated drinking water. Mortality follow-up period was 1979-2008. Cause-specific standardized mortality ratios utilized U.S. age-, sex-, race-, and calendar period-specific mortality rates as reference. We used survival analysis to compare mortality rates between Camp Lejeune and Camp Pendleton workers and assess the effects of estimated cumulative contaminant exposures within the Camp Lejeune cohort. Ground water contaminant fate/transport and distribution system models provided monthly estimated contaminant levels in drinking water serving workplaces at Camp Lejeune. The confidence interval (CI) indicated precision of effect estimates. Results Compared to Camp Pendleton, Camp Lejeune workers had mortality hazard ratios (HRs) >1.50 for kidney cancer (HR = 1.92, 95% CI: 0.58, 6.34), leukemias (HR = 1.59, 95% CI: 0.66, 3.84), multiple myeloma (HR = 1.84, 95% CI: 0.45, 7.58), rectal cancer (HR = 1.65, 95% CI: 0.36, 7.44), oral cavity cancers (HR = 1.93, 95% CI: 0.34, 10.81), and Parkinson’s disease (HR = 3.13, 95% CI: 0.76, 12.81). Within the Camp Lejeune cohort, monotonic exposure-response relationships were observed for leukemia and vinyl chloride and PCE, with mortality HRs at the high exposure category of 1.72 (95% CI: 0.33, 8.83) and 1.82 (95% CI: 0.36, 9.32), respectively. Cumulative exposures were above the median for most deaths from cancers of the kidney, esophagus, rectum, prostate, and Parkinson’s disease, but small numbers precluded evaluation of exposure-response relationships. Conclusion The study found

  6. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  7. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  8. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  9. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  11. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  12. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  13. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  14. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  15. cAMP signaling in skeletal muscle adaptation: hypertrophy, metabolism, and regeneration

    Science.gov (United States)

    Stewart, Randi

    2012-01-01

    Among organ systems, skeletal muscle is perhaps the most structurally specialized. The remarkable subcellular architecture of this tissue allows it to empower movement with instructions from motor neurons. Despite this high degree of specialization, skeletal muscle also has intrinsic signaling mechanisms that allow adaptation to long-term changes in demand and regeneration after acute damage. The second messenger adenosine 3′,5′-monophosphate (cAMP) not only elicits acute changes within myofibers during exercise but also contributes to myofiber size and metabolic phenotype in the long term. Strikingly, sustained activation of cAMP signaling leads to pronounced hypertrophic responses in skeletal myofibers through largely elusive molecular mechanisms. These pathways can promote hypertrophy and combat atrophy in animal models of disorders including muscular dystrophy, age-related atrophy, denervation injury, disuse atrophy, cancer cachexia, and sepsis. cAMP also participates in muscle development and regeneration mediated by muscle precursor cells; thus, downstream signaling pathways may potentially be harnessed to promote muscle regeneration in patients with acute damage or muscular dystrophy. In this review, we summarize studies implicating cAMP signaling in skeletal muscle adaptation. We also highlight ligands that induce cAMP signaling and downstream effectors that are promising pharmacological targets. PMID:22354781

  16. Refugees in and out North Africa: a study of the Choucha refugee camp in Tunisia.

    Science.gov (United States)

    Dourgnon, Paul; Kassar, Hassène

    2014-08-01

    In recent years, North African (NA) countries ceased to be emigration-only countries and are now on the verge of becoming immigration as well as transit countries for economic migrants and refugees. Contextual as well as structural long-term factors are driving these changes. The ongoing crises in Africa and the Middle East are prompting strong outflows of refugees, which are likely to induce NA countries to share some common public policy and public health concerns with European countries in a near future. This article highlights some aspects of these changes, from the study of the consequences of the 2011 Libyan crisis in Tunisia. It addresses individual trajectories and health concerns of refugees in and out North Africa from a study of the Choucha camp in Tunisia. The camp opened to immigrants from Libya during the 2011 crisis and accommodated the bulk of the refugees flow to Tunisia until July 2012. The study includes a monographic approach and a qualitative survey in the Choucha camp refugees. We describe the crisis history and the health response with a focus on the camp. We then address refugees' trajectories, and health needs and concerns from the interviews we collected in the camp in April 2012. © The Author 2014. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

  17. The role of the concentration camps in the Nazi repression of prostitutes, 1933-9.

    Science.gov (United States)

    Harris, Victoria

    2010-01-01

    This article uses prostitutes as a case study in order to investigate the role of the early concentration camps as centres of detention for social deviants. In contrasting the intensification of repressive policies towards prostitutes against narratives which demonstrate the unexpectedly lax treatment of these women, it explores what the reasons behind these contradictions might have been, and what this demonstrates about the development of these institutions. It asks the following questions. How and why were prostitutes interned? Which bureaucrats were responsible for incarcerating these women and what did they view the role of the camp to be? Were such policies centrally directed or the product of local decision-making? Through asking these questions, the article explores to what extent these camps were unique as mechanisms for the repression and marginalization of prostitutes.

  18. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  19. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  20. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  1. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  2. Requirement of cAMP signaling for Schwann cell differentiation restricts the onset of myelination.

    Directory of Open Access Journals (Sweden)

    Ketty Bacallao

    Full Text Available Isolated Schwann cells (SCs respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1. To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC agonists and antagonists revealed that selective transmembrane AC (tmAC activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC, a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the

  3. Summer camps for children with burn injuries: a literature review.

    Science.gov (United States)

    Maslow, Gary R; Lobato, Debra

    2010-01-01

    The first summer camps for children with burn injuries started over 25 years ago, and as of 2008, there were 60 camps worldwide. This review examines the literature on summer pediatric burn camps. The authors describe common characteristics of burn camp structure, activities, and staffing and then examine the scientific evidence regarding the effect of burn camp programs on campers and camp staff volunteers. A search of Pubmed and Psychinfo databases from 1970 to 2008 for articles related to pediatric burn summer camps identified 17 articles, of which 13 fit the inclusion criteria. Existing literature consists primarily of qualitative studies, suggesting that burn camp can decrease camper isolation, improve self-esteem, and promote coping and social skills. Studies examining volunteer staff at burn camp have consistently found that there are both personal and professional benefits. Quantitative studies of self-esteem have yielded equivocal results. No studies have examined safety or the effect of burn camp on medical or rehabilitation outcomes. For the past 25 years, pediatric summer camps for children with burn injuries have played an important rehabilitation role and provided a strong community that benefits both campers and staff. Future research using more rigorous research methods and examining a broader range of outcomes (eg, safety and medical/rehabilitation outcomes) is recommended.

  4. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  5. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  6. Suicide in Nazi concentration camps, 1933-9.

    Science.gov (United States)

    Goeschel, Christian

    2010-01-01

    Too often histories of the concentration camps tend to be ignorant of the wider political context of nazi repression and control. This article tries to overcome this problem. Combining legal, social and political history, it contributes to a more thorough understanding of the changing relationship between the camps as places of extra-legal terror and the judiciary, between nazi terror and the law. It argues that the conflict between the judiciary and the SS was not a conflict between "good" and "evil," as existing accounts claim. Rather, it was a power struggle for jurisdiction over the camps. Concentration camp authorities covered up the murders of prisoners as suicides to prevent judicial investigations. This article also looks at actual suicides in the pre-war camps, to highlight individual inmates' reactions to life within the camps. The article concludes that the history of the concentration camps needs to be firmly integrated into the history of nazi terror and the Third Reich.

  7. Girl Scout Camps and Badges: Engaging Girls in NASA Science

    Science.gov (United States)

    Harman, P. K.; DeVore, E. K.

    2017-12-01

    Reaching for the Stars: NASA Science for Girl Scouts (Girl Scout Stars) disseminates NASA STEM education-related resources, fosters interaction between Girl Scouts and NASA Subject Matter Experts (SMEs), and engages Girl Scouts in NASA science and programs through space science badges and summer camps. A space science badge is in development for each of the six levels of Girl Scouts: Daisies, Grades K - 1; Brownies, Grades 2 -3; Juniors, Grades 4 -5; Cadettes, Grades 6 -8; Seniors, Grades 9 -10: and Ambassadors, Grades 11 -12. Daisy badge will be accomplished by following three steps with two choices each. Brownie to Ambassador badges will be awarded by completing five steps with three choices for each. The badges are interwoven with science activities, role models (SMEs), and steps that lead girls to explore NASA missions. External evaluators monitor three rounds of field-testing and deliver formative assessment reports. Badges will be released in Fall of 2018 and 2019. Girl Scout Stars supports two unique camp experiences. The University of Arizona holds an Astronomy Destination, a travel and immersion adventure for individual girls ages 13 and older, which offers dark skies and science exploration using telescopes, and interacting with SMEs. Girls lean about motion of celestial objects and become astronomers. Councils send teams of two girls, a council representative and an amateur astronomer to Astronomy Camp at Goddard Space Flight Center. The teams were immersed in science content and activities, and a star party; and began to plan their new Girl Scout Astronomy Clubs. The girls will lead the clubs, aided by the council and amateur astronomer. Camps are evaluated by the Girl Scouts Research Institute. In Girl Scouting, girls discover their skills, talents and what they care about; connect with other Girl Scouts and people in their community; and take action to change the world. This is called the Girl Scout Leadership Experience. With girl-led, hands on

  8. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  9. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  10. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  11. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  12. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  13. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  14. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  15. Rights and responsibilities in Darfur

    Directory of Open Access Journals (Sweden)

    Katherine Reyes

    2009-09-01

    Full Text Available A combined UN-military-police-humanitarian initiative hasbeen promoting civic rights and responsibilities among IDPsin order to increase security throughout Kalma camp and itssurroundings.

  16. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  17. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  18. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  19. S'Cool LAB Summer CAMP 2017

    CERN Multimedia

    Woithe, Julia

    2017-01-01

    The S’Cool LAB Summer CAMP is an opportunity for high-school students (aged 16-19) from all around the world to spend 2 weeks exploring the fascinating world of particle physics. The 24 selected participants spend their summer at S’Cool LAB, CERN’s hands-on particle physics learning laboratory, for an epic programme of lectures and tutorials, team research projects, visits of CERN’s research installations, and social activities.

  20. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  1. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  2. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  3. Release from Xenopus oocyte prophase I meiotic arrest is independent of a decrease in cAMP levels or PKA activity.

    Science.gov (United States)

    Nader, Nancy; Courjaret, Raphael; Dib, Maya; Kulkarni, Rashmi P; Machaca, Khaled

    2016-06-01

    Vertebrate oocytes arrest at prophase of meiosis I as a result of high levels of cyclic adenosine monophosphate (cAMP) and protein kinase A (PKA) activity. In Xenopus, progesterone is believed to release meiotic arrest by inhibiting adenylate cyclase, lowering cAMP levels and repressing PKA. However, the exact timing and extent of the cAMP decrease is unclear, with conflicting reports in the literature. Using various in vivo reporters for cAMP and PKA at the single-cell level in real time, we fail to detect any significant changes in cAMP or PKA in response to progesterone. More interestingly, there was no correlation between the levels of PKA inhibition and the release of meiotic arrest. Furthermore, we devised conditions whereby meiotic arrest could be released in the presence of sustained high levels of cAMP. Consistently, lowering endogenous cAMP levels by >65% for prolonged time periods failed to induce spontaneous maturation. These results argue that the release of oocyte meiotic arrest in Xenopus is independent of a reduction in either cAMP levels or PKA activity, but rather proceeds through a parallel cAMP/PKA-independent pathway. © 2016. Published by The Company of Biologists Ltd.

  4. Effect of cholera toxin on cAMP levels and Na+ influx in isolated intestinal epithelial cells

    International Nuclear Information System (INIS)

    Hyun, C.S.; Kimmich, G.A.

    1982-01-01

    Freshly isolated chicken intestinal cells contain approximately 20 pmol adenosine 3',5'-cyclic monophosphate (cAMP)/mg cellular protein. Incubation with 3 μg/ml cholera toxin (CT) at 37 0 C induces an elevation of cellular cAMP beginning 10-15 min after initial exposure. The response is linear with time for 40-50 min and causes a six- to eightfold increase over control levels at steady state. Dibutyryl cAMP and agents that increase cAMP production inhibit Na + influx into the isolated enterocytes. Chlorpromazine completely abolishes the toxin-induced elevation of cAMP in the isolated cells and also reverses the effect on Na + entry. The data provide evidence for a cAMP-mediated control of intestinal cell Na + uptake, which may represent the mechanistic basis for the antiabsorptive effect of CT on Na + during induction of intestinal secretory activity. Studies on the time-dependent effects of chlorpromazine on both intracellular cAMP concentration and Na + influx suggest that the reactivation of the Na + transport system after cAMP-induced inhibition is slow relative to the disappearance of cAMP

  5. Impact of the Purdue University School of Veterinary Medicine's Boiler Vet Camp on participants' knowledge of veterinary medicine.

    Science.gov (United States)

    Weisman, James L; Amass, Sandra F; Warren, Joshua D

    2011-04-01

    To assess whether Boiler Vet Camp, a 7-day residential summer camp for students entering eighth or ninth grade in the fall, would increase participants' understanding of career options in the veterinary profession, increase understanding of the science of veterinary medicine, or increase the number of students stating that they intended to apply to the Purdue University School of Veterinary Medicine. Survey. 48 individuals attending the 2009 Boiler Vet Camp. Information on participant demographics was obtained from camp applications. A questionnaire was administered on the first and sixth days of camp, and results were analyzed to identify changes in responses over time. More campers correctly answered questions designed to evaluate knowledge of the veterinary profession and 10 of 12 questions designed to evaluate specific knowledge of the science of veterinary medicine on day 6, compared with day 1. Remarkable differences were not observed among gender or race-ethnicity groups for these questions. There was no significant difference between percentages of campers who stated that they would apply to Purdue before and after camp. Significantly more Caucasian campers stated they would apply to Purdue on both day 1 and day 6, compared with campers from under-represented minority groups. Results indicated that the Boiler Vet Camp accomplished 2 of its 3 planned objectives, suggesting that such camps can be successfully used to increase knowledge of the veterinary profession among middle school students. Reasons for the low percentage of participants from underrepresented minorities who indicated they would apply to the Purdue University School of Veterinary Medicine require further exploration.

  6. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  7. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  8. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  9. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  10. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  11. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  12. Modulation of cAMP levels by high-fat diet and curcumin and regulatory effects on CD36/FAT scavenger receptor/fatty acids transporter gene expression.

    Science.gov (United States)

    Zingg, Jean-Marc; Hasan, Syeda T; Nakagawa, Kiyotaka; Canepa, Elisa; Ricciarelli, Roberta; Villacorta, Luis; Azzi, Angelo; Meydani, Mohsen

    2017-01-02

    Curcumin, a polyphenol from turmeric (Curcuma longa), reduces inflammation, atherosclerosis, and obesity in several animal studies. In Ldlr -/- mice fed a high-fat diet (HFD), curcumin reduces plasma lipid levels, therefore contributing to a lower accumulation of lipids and to reduced expression of fatty acid transport proteins (CD36/FAT, FABP4/aP2) in peritoneal macrophages. In this study, we analyzed the molecular mechanisms by which curcumin (500, 1000, 1500 mg/kg diet, for 4 months) may influence plasma and tissue lipid levels in Ldlr -/- mice fed an HFD. In liver, HFD significantly suppressed cAMP levels, and curcumin restored almost normal levels. Similar trends were observed in adipose tissues, but not in brain, skeletal muscle, spleen, and kidney. Treatment with curcumin increased phosphorylation of CREB in liver, what may play a role in regulatory effects of curcumin in lipid homeostasis. In cell lines, curcumin increased the level of cAMP, activated the transcription factor CREB and the human CD36 promoter via a sequence containing a consensus CREB response element. Regulatory effects of HFD and Cur on gene expression were observed in liver, less in skeletal muscle and not in brain. Since the cAMP/protein kinase A (PKA)/CREB pathway plays an important role in lipid homeostasis, energy expenditure, and thermogenesis by increasing lipolysis and fatty acid β-oxidation, an increase in cAMP levels induced by curcumin may contribute to its hypolipidemic and anti-atherosclerotic effects. © 2016 BioFactors, 43(1):42-53, 2017. © 2016 International Union of Biochemistry and Molecular Biology.

  13. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  14. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  15. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  16. Radioprotection of the rat parotid gland by cAMP

    International Nuclear Information System (INIS)

    Sodicoff, M.; Conger, A.D.

    1983-01-01

    Most earlier studies showing a radioprotective effect by cAMP show only slight degrees of protection. The present study demonstrates a substantial protective effect (DMF, 1.63) of exogenously administered cAMP on the rat parotid gland and supports the mechanism suggested previously for protection afforded the parotid glands by the β-adrenergic agonist isoproterenol, which is known to elevate endogenous intracellular cAMP

  17. IDENTIFYING DEMENTIA IN ELDERLY POPULATION : A CAMP APPROACH

    OpenAIRE

    Anand P; Chaukimath; Srikanth; Koli

    2015-01-01

    BACKGROUND: Dementia is an emerging medico social problem affecting elderly, and poses a challenge to clinician and caregivers. It is usually identified in late stage where management becomes difficult. AIM: The aim of camp was to identify dementia in elderly population participating in screening camp. MATERIAL AND METHODS : The geriatric clinic and department of psychiatry jointly organised screening camp to detect dementia in elderly for five days in Sept...

  18. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  19. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  20. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  1. Adventure Code Camp: Library Mobile Design in the Backcountry

    Directory of Open Access Journals (Sweden)

    David Ward

    2014-09-01

    Full Text Available This article presents a case study exploring the use of a student Coding Camp as a bottom-up mobile design process to generate library mobile apps. A code camp sources student programmer talent and ideas for designing software services and features.  This case study reviews process, outcomes, and next steps in mobile web app coding camps. It concludes by offering implications for services design beyond the local camp presented in this study. By understanding how patrons expect to integrate library services and resources into their use of mobile devices, librarians can better design the user experience for this environment.

  2. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Future Interoperability of Camp Protection Systems (FICAPS)

    Science.gov (United States)

    Caron, Sylvie; Gündisch, Rainer; Marchand, Alain; Stahl, Karl-Hermann

    2013-05-01

    The FICAPS Project has been established as a Project of the European Defence Agency based on an initiative of Germany and France. Goal of this Project was to derive Guidelines, which by a proper implementation in future developments improve Camp Protection Systems (CPS) by enabling and improving interoperability between Camp Protection Systems and its Equipments of different Nations involved in multinational missions. These Guidelines shall allow for: • Real-time information exchange between equipments and systems of different suppliers and nations (even via SatCom), • Quick and easy replacement of equipments (even of different Nations) at run-time in the field by means of plug and play capability, thus lowering the operational and logistic costs and making the system highly available, • Enhancement of system capabilities (open and modular systems) by adding new equipment with new capabilities (just plug-in, automatic adjustment of the HMI Human Machine Interface) without costly and time consuming validation and test on system level (validation and test can be done on Equipment level), Four scenarios have been identified to summarize the interoperability requirements from an operational viewpoint. To prove the definitions given in the Guideline Document, a French and a German Demonstration System, based on existing national assets, were realized. Demonstrations, showing the capabilities given by the defined interoperability requirements with respect to the operational scenarios, were performed. Demonstrations included remote control of a CPS by another CPS, remote sensor control (Electro-Optic/InfraRed EO/IR) and remote effector control. This capability can be applied to extend the protection area or to protect distant infrastructural assets Demonstrations have been performed. The required interoperability functionality was shown successfully. Even if the focus of the FICAPS project was on camp protection, the solution found is also appropriate for other

  4. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  5. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  6. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  7. An Inaugural Girl Scout Destinations Astronomy Camp

    Science.gov (United States)

    Lebofsky, Larry A.; McCarthy, Donald W.; Wright, Joe; Wright, Rita; Mace, Mikayla; Floyd, Charmayne

    2017-10-01

    The University of Arizona (UA) conducted its first teenage Girl Scout Destinations Astronomy Camp. This program was preceded by 24 Leadership Workshops for Adult Girl Scout Leaders, initially supported by EPO funding from NIRCam for JWST. For five days in late June, 24 girls (ages 13-17 years) attended from 16 states. The Camp was led by UA astronomers and long-term educators. Representing Girl Scouts of the USA (GSUSA) were a husband/wife amateur astronomer team who are SOFIA Airborne Astronomy and NASA Solar System Ambassadors. Other leaders included a Stanford undergraduate engineering student who is a lifelong Girl Scout and Gold Award recipient and a recent UA Master’s degree science journalist. The Camp is a residential, hands-on “immersion” adventure in scientific exploration using telescopes in southern Arizona’s Catalina Mountains near Tucson. Under uniquely dark skies girls become real astronomers, operating telescopes (small and large) and associated technologies, interacting with scientists, obtaining images and quantitative data, investigating their own questions, and most importantly having fun actually doing science and building observing equipment. Girls achieve a basic understanding of celestial objects, how and why they move, and their historical significance, leading to an authentic understanding of science, research, and engineering. Girls can lead these activities back home in their own troops and councils, encouraging others to consider STEM field careers. These programs are supported by a 5-year NASA Collaborative Agreement, Reaching for the Stars: NASA Science for Girl Scouts (www.seti.org/GirlScoutStars), through the SETI Institute in collaboration with the UA, GSUSA, Girl Scouts of Northern California, the Astronomical Society of the Pacific, and Aries Scientific, Inc. The Girl Scout Destinations Astronomy Camp aligns with the GSUSA Journey: It’s Your Planet-Love It! and introduces the girls to some of the activities being

  8. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  9. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  10. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  11. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  12. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  13. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  14. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  16. Refugee camps, fire disasters and burn injuries

    Science.gov (United States)

    Atiyeh, B.S.; Gunn, S.W.A.

    2017-01-01

    Summary In the past five years, no fewer than 15 conflicts have brought unspeakable tragedy and misery to millions across the world. At present, nearly 20 people are forcibly displaced every minute as a result of conflict or persecution, representing a crisis of historic proportions. Many displaced persons end up in camps generally developing in an impromptu fashion, and are totally dependent on humanitarian aid. The precarious condition of temporary installations puts the nearly 700 refugee camps worldwide at high risk of disease, child soldier and terrorist recruitment, and physical and sexual violence. Poorly planned, densely packed refugee settlements are also one of the most pathogenic environments possible, representing high risk for fires with potential for uncontrolled fire spread and development over sometimes quite large areas. Moreover, providing healthcare to refugees comes with its own unique challenges. Internationally recognized guidelines for minimum standards in shelters and settlements have been set, however they remain largely inapplicable. As for fire risk reduction, and despite the high number of fire incidents, it is not evident that fire safety can justify a higher priority. In that regard, a number of often conflicting influences will need to be considered. The greatest challenge remains in balancing the various risks, such as the need/cost of shelter against the fire risk/cost of fire protection. PMID:29849526

  17. Compartmentalized cAMP Signaling Associated With Lipid Raft and Non-raft Membrane Domains in Adult Ventricular Myocytes.

    Science.gov (United States)

    Agarwal, Shailesh R; Gratwohl, Jackson; Cozad, Mia; Yang, Pei-Chi; Clancy, Colleen E; Harvey, Robert D

    2018-01-01

    Aim: Confining cAMP production to discrete subcellular locations makes it possible for this ubiquitous second messenger to elicit unique functional responses. Yet, factors that determine how and where the production of this diffusible signaling molecule occurs are incompletely understood. The fluid mosaic model originally proposed that signal transduction occurs through random interactions between proteins diffusing freely throughout the plasma membrane. However, it is now known that the movement of membrane proteins is restricted, suggesting that the plasma membrane is segregated into distinct microdomains where different signaling proteins can be concentrated. In this study, we examined what role lipid raft and non-raft membrane domains play in compartmentation of cAMP signaling in adult ventricular myocytes. Methods and Results: The freely diffusible fluorescence resonance energy transfer-based biosensor Epac2-camps was used to measure global cytosolic cAMP responses, while versions of the probe targeted to lipid raft (Epac2-MyrPalm) and non-raft (Epac2-CAAX) domains were used to monitor local cAMP production near the plasma membrane. We found that β-adrenergic receptors, which are expressed in lipid raft and non-raft domains, produce cAMP responses near the plasma membrane that are distinctly different from those produced by E-type prostaglandin receptors, which are expressed exclusively in non-raft domains. We also found that there are differences in basal cAMP levels associated with lipid raft and non-raft domains, and that this can be explained by differences in basal adenylyl cyclase activity associated with each of these membrane environments. In addition, we found evidence that phosphodiesterases 2, 3, and 4 work together in regulating cAMP activity associated with both lipid raft and non-raft domains, while phosphodiesterase 3 plays a more prominent role in the bulk cytoplasmic compartment. Conclusion: These results suggest that different membrane

  18. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Teen camp: a unique approach to recruit future nurses.

    Science.gov (United States)

    Redding, Donna A; Riech, Sandy; Prater, Marsha A

    2004-01-01

    A collaborative and unique approach to interest high school students in nursing. To inform educators and nursing departments about an innovative approach to recruit future nurses. Professional literature and authors' experience. All students related positive experiences. The initial camp evaluation produced innovative input from the students, and each camp met its goal of creating career interest in the nursing profession.

  20. Camp Verde Adult Reading Program. Final Performance Report.

    Science.gov (United States)

    Maynard, David A.

    This document begins with a four-page performance report describing how the Camp Verde Adult Reading Program site was relocated to the Community Center Complex, and the Town Council contracted directly with the Friends of the Camp Verde Library to provide for the requirements of the program. The U.S. Department of Education grant allowed the…

  1. Camp GLOW (Girls Leading Our World): Handbook for Volunteers.

    Science.gov (United States)

    Peace Corps, Washington, DC. Information Collection and Exchange Div.

    Camp GLOW (Girls Leading Our World) began in Romania in 1995 as a weeklong leadership camp with the purpose of encouraging young women to become active citizens by building their self-esteem and confidence, increasing their self-awareness, and developing their skills in goal-setting, assertiveness, and career and life planning. Since that first…

  2. Boot Camps: A Critique and a Proposed Alternative.

    Science.gov (United States)

    Salerno, Anthony W.

    1994-01-01

    Explores origins of boot camp concept and application of its principles to juvenile delinquents. Offers eight-point critique of concept itself. Concludes with alternative: combination of intermittent incarceration (lasting at least six months and comprised of "no frills" camp for one week, followed by weekends gradually spaced further…

  3. Specialized Summer Camps: Provide Benefits for Children and Families Alike

    Science.gov (United States)

    Neff, John M.

    2009-01-01

    The arrival of summer signals a season of endless days of swimming, fishing, summer camps, and other outdoor activities. For children with chronic or terminal illnesses, it can be difficult to participate in many of these activities as well as challenging for parents to find summer camps that not only engage their children, but also offer the…

  4. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  5. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  6. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  7. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  8. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  9. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  10. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  11. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  12. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  13. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  14. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  15. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  16. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  17. Yesterday and Today: The Impact of Research Conducted at Camp Detrick on Botulinum Toxin.

    Science.gov (United States)

    Lebeda, Frank J; Adler, Michael; Dembek, Zygmunt F

    2018-05-01

    This review summarizes the research conducted on botulinum toxin (BoTx) from 1943 to 1956 by a small group of Camp Detrick investigators and their staff. A systematic, cross-disciplinary approach was used to develop effective vaccines against this biological warfare threat agent. In response to the potential need for medical countermeasures against BoTx during World War II, the refinement of isolation and purification techniques for BoTx successfully led to the large-scale production of botulinum toxoid vaccines. In addition, the work at Camp Detrick provided the foundation for the subsequent use of BoTx as a tool for studying the trophic regulation of skeletal muscle within motor neuron terminals and, more recently, for elucidation of the intricate details of neurotransmitter release at the molecular level. Indirectly, Camp Detrick investigators also played a significant role in studies that culminated in the use of BoTx as a pharmaceutical product that has been approved by the U.S. Food and Drug Administration for treating movement disorders, autonomic dysfunctions, and other conditions. Online literature searches were performed with Google, Google Scholar, PubMed, the bibliography from the Camp Detrick technical library, and at the Defense Technical Information Center. Reference lists in some of the primary research publications and reviews also provided source material. Search terms included botulinum, botulinus, and Camp Detrick. References related to the subsequent impacts of the Camp Detrick results were selected and cited from reviews and primary references in the more recent literature. Notes on toxin nomenclature and potential sources of error in this study are presented. The literature searches returned 27 citations of Camp Detrick authors, 24 of which were articles in peer-reviewed journals. The publications by these investigators included several disciplines such as biochemistry, immunology, pharmacology, physiology, and toxicology. A fundamental

  18. Impact of an informal learning science camp on urban, low socioeconomic status middle school students and participating teacher-leaders

    Science.gov (United States)

    Votaw, Nikki L.

    Studies suggest that students have difficulty connecting science to their own lives (Lee & Fradd, 1998; Aikenhead, 1996). This difficulty results in a decline in students' attitudes toward science, leading to low science achievement. These factors result in fewer students interested in careers related to science, specifically for urban, minority students. The purpose of this study was to examine the impact that a ten day informal learning immersion science camp had on the participants, both urban, low-socioeconomic status middle school students and teacher-leaders. The students were incoming seventh grade students involved in a community-based scholar program designed to recruit and support socioeconomically disadvantaged, academically talented students. The teacher-leaders were professional educators working toward an advanced degree. This ten day camp included seven visits to different sites and complementary classroom-based activities. The purpose of the camp was to immerse the students in informal learning environments that affect their daily lives. Students and teacher-leaders visited facilities that provide public utility services (i.e. power plant, sewage treatment facility, and water company), zoo, large commercial cave system, planetarium, university based electrooptics and nanotechnology center, and forest and arboretum. These site visits were supported by activities that were provided by teacher-leaders. A model used as a framework for studying learning in the context of this ten day camp as Falk and Dierking's (2000) Contextual Model for Learning. This model described three basic intersecting elements that contributed to learning within the given context. The three contexts (personal, sociocultural, and physical) intersect affecting the learning that takes place. A mixed methodology design was employed to determine the impact of the camp on students' content knowledge and attitudes toward science. Qualitative data were collected to determine the impact

  19. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  20. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  1. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  2. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  3. Camp neobarroco: homenaje, artificio y violencia

    Directory of Open Access Journals (Sweden)

    Alicia Montes

    2010-05-01

    Full Text Available The aim of this paper is to examine some distinctive characteristics of post-vanguard, as shown in the works of Copi and Perlongher, as it is my intention to demonstrate that in the texts of these authors, the constructive principle that organizes the writing is related to a neo-baroque aesthetic and a camp view, as this carnival-like perspective allows them to work with the literary tradition, the different genres and the culture of masses from a parodic distance, that is violence and homage at the same time. This is why the world is represented as chaos, illusion, pure change, a carnival party where costume and transvestism proliferate.

  4. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  5. Inducible cAMP early repressor acts as a negative regulator for kindling epileptogenesis and long-term fear memory.

    Science.gov (United States)

    Kojima, Nobuhiko; Borlikova, Gilyana; Sakamoto, Toshiro; Yamada, Kazuyuki; Ikeda, Toshio; Itohara, Shigeyoshi; Niki, Hiroaki; Endo, Shogo

    2008-06-18

    Long-lasting neuronal plasticity as well as long-term memory (LTM) requires de novo synthesis of proteins through dynamic regulation of gene expression. cAMP-responsive element (CRE)-mediated gene transcription occurs in an activity-dependent manner and plays a pivotal role in neuronal plasticity and LTM in a variety of species. To study the physiological role of inducible cAMP early repressor (ICER), a CRE-mediated gene transcription repressor, in neuronal plasticity and LTM, we generated two types of ICER mutant mice: ICER-overexpressing (OE) mice and ICER-specific knock-out (KO) mice. Both ICER-OE and ICER-KO mice show no apparent abnormalities in their development and reproduction. A comprehensive battery of behavioral tests revealed no robust changes in locomotor activity, sensory and motor functions, and emotional responses in the mutant mice. However, long-term conditioned fear memory was attenuated in ICER-OE mice and enhanced in ICER-KO mice without concurrent changes in short-term fear memory. Furthermore, ICER-OE mice exhibited retardation of kindling development, whereas ICER-KO mice exhibited acceleration of kindling. These results strongly suggest that ICER negatively regulates the neuronal processes required for long-term fear memory and neuronal plasticity underlying kindling epileptogenesis, possibly through suppression of CRE-mediated gene transcription.

  6. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  7. Reward or its denial during the neonatal period affects adult spatial memory and hippocampal phosphorylated cAMP response element-binding protein levels of both the neonatal and adult rat.

    Science.gov (United States)

    Diamantopoulou, A; Stamatakis, A; Panagiotaropoulos, T; Stylianopoulou, F

    2011-05-05

    Early life experiences, particularly mother-infant interactions, have been shown to influence adult coping and learning abilities via gene-environment interactions. We have developed a paradigm, in which mother contact is used as either a positive or a negative reinforcer in a T-maze, during postnatal days 10-13. In both neonates receiving (RER) or denied (DER) the expected reward, exposure to the memory test in the absence of the mother resulted in a remarkable increase in the number of pCREB immunopositive cells, when compared to their corresponding levels 2 h after the completion of the training process, but also to the levels of naïve animals. In the CA3 area, the pattern of pCREB immunoreactivity, when evaluated 2 h after the completion of the training on postnatal day 13 seemed to distinguish between the two different neonatal experiences in the T-maze, with the DER pups showing higher levels of pCREB immunopositive cells than the RER. Exposure to the Morris Water Maze (MWM) during adulthood revealed a memory advantage of the DER animals compared to the RER and the animals not exposed to the neonatal experience. Relevantly, in the DER animals an increased number of pCREB immunopositive cells was observed in the CA3 area even 24 h after the end of MWM training. When also measured after exposure to the probe trial, the number of pCREB immunopositive cells was again higher in the DER compared to the RER animals. In conclusion, we show that a learning experience involving discrepancy during the particularly plastic neonatal period is able to induce long-term effects, which result in enhanced adult hippocampal dependent spatial memory. Furthermore, our data document a role of plasticity molecules like pCREB in mediating hippocampal dependent learning and detection of novelty not only in adulthood, but also more importantly in the neonatal period of the rat. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  8. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  9. IDENTIFYING DEMENTIA IN ELDERLY POPULATION : A CAMP APPROACH

    Directory of Open Access Journals (Sweden)

    Anand P

    2015-06-01

    Full Text Available BACKGROUND: Dementia is an emerging medico social problem affecting elderly, and poses a challenge to clinician and caregivers. It is usually identified in late stage where management becomes difficult. AIM: The aim of camp was to identify dementia in elderly population participating in screening camp. MATERIAL AND METHODS : The geriatric clinic and department of psychiatry jointly organised screening camp to detect dementia in elderly for five days in September 2014 to commemorate world Alzheimer’s day. The invitation regarding camp was sent to all senio r citizen forums and also published in leading Kannada daily newspaper. Mini Mental Status Examination and Diagnostic and Statistical Manual of Mental Disorders, 4 th edition criteria (DSM IV was used to identify dementia. RESULTS: Elderly male participate d in camp in more number than females and dementia was identified in 36% elderly with education less than 9 th standard. Dementia was found in 18% in our study population. CONCLUSION: The camp help identify elderly suffering from dementia and also created a wareness about it. Hypertension and diabetes mellitus were common co morbidity in study population. Our study suggested organising screening camp will help identify elderly living with dementia.

  10. Opposing effects of cAMP and T259 phosphorylation on plasma membrane diffusion of the water channel aquaporin-5 in Madin-Darby canine kidney cells

    DEFF Research Database (Denmark)

    Koffman, Jennifer Skaarup; Christensen, Eva Arnspang; Marlar, Saw

    2015-01-01

    Aquaporin-5 (AQP5) facilitates passive water transport in glandular epithelia in response to secretory stimuli via intracellular pathways involving calcium release, cAMP and protein kinase A (PKA). In epithelial plasma membranes, AQP5 may be acutely regulated to facilitate water transport...... in the plasma membrane diffusion coefficient of AQP5. We aimed to test the short-term regulatory effects of the above pathways, by measuring lateral diffusion of AQP5 and an AQP5 phospho-mutant, T259A, using k-space Image Correlation Spectroscopy of quantum dot- and EGFP-labeled AQP5. Elevated cAMP and PKA...... inhibition significantly decreased lateral diffusion of AQP5, whereas T259A mutation showed opposing effects; slowing diffusion without stimulation and increasing diffusion to basal levels after cAMP elevation. Thus, lateral diffusion of AQP5 is significantly regulated by cAMP, PKA, and T259 phosphorylation...

  11. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  12. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  13. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  14. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  15. Investigation of Sylvatic Typhus at a Wilderness Camp

    Centers for Disease Control (CDC) Podcasts

    In this podcast, Dr. Greg Dasch discusses an outbreak of four cases of sylvatic typhus that occurred at a wilderness camp in Pennsylvania. Sylvatic typhus is very rare in the United States, with only 41 cases since it was discovered in the United States in 1975. Lab work at CDC and the discovery that all four camp counselors who became ill had slept in the same bunk at the camp between 2004 and 2006 ultimately led to confirmation that flying squirrels living in the wall of the cabin were to blame for the illnesses.

  16. Imaging alterations of cardiomyocyte cAMP microdomains in disease

    Directory of Open Access Journals (Sweden)

    Alexander eFroese

    2015-08-01

    Full Text Available 3’,5’-cyclic adenosine monophosphate (cAMP is an important second messenger which regulates heart function by acting in distinct subcellular microdomains. Recent years have provided deeper mechanistic insights into compartmentalized cAMP signaling and its link to cardiac disease. In this mini review, we summarize newest developments in this field achieved by cutting-edge biochemical and biophysical techniques. We further compile the data from different studies into a bigger picture of so far uncovered alterations in cardiomyocyte cAMP microdomains which occur in compensated cardiac hypertrophy and chronic heart failure. Finally, future research directions and translational perspectives are briefly discussed.

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  18. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  19. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  20. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  1. Retinoic acid and cAMP inhibit rat hepatocellular carcinoma cell proliferation and enhance cell differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Ionta, M. [Instituto de Ciências Biomédicas, Universidade Federal de Alfenas, Alfenas MG (Brazil); Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP (Brazil); Rosa, M.C.; Almeida, R.B.; Freitas, V.M.; Rezende-Teixeira, P.; Machado-Santelli, G.M. [Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP (Brazil)

    2012-05-25

    Hepatocellular carcinoma (HCC) is the third highest cause of cancer death worldwide. In general, the disease is diagnosed at an advanced stage when potentially curative therapies are no longer feasible. For this reason, it is very important to develop new therapeutic approaches. Retinoic acid (RA) is a natural derivative of vitamin A that regulates important biological processes including cell proliferation and differentiation. In vitro studies have shown that RA is effective in inhibiting growth of HCC cells; however, responsiveness to treatment varies among different HCC cell lines. The objective of the present study was to determine if the combined use of RA (0.1 µM) and cAMP (1 mM), an important second messenger, improves the responsiveness of HCC cells to RA treatment. We evaluated the proliferative behavior of an HCC cell line (HTC) and the expression profile of genes related to cancer signaling pathway (ERK and GSK-3β) and liver differentiation [E-cadherin, connexin 26 (Cx26), and connexin 32 (Cx32)]. RA and cAMP were effective in inhibiting the proliferation of HTC cells independently of combined use. However, when a mixture of RA and cAMP was used, the signals concerning the degree of cell differentiation were increased. As demonstrated by Western blot, the treatment increased E-cadherin, Cx26, Cx32 and Ser9-GSK-3β (inactive form) expression while the expression of Cx43, Tyr216-GSK-3β (active form) and phosphorylated ERK decreased. Furthermore, telomerase activity was inhibited along treatment. Taken together, the results showed that the combined use of RA and cAMP is more effective in inducing differentiation of HTC cells.

  2. A second look at the heavy half of the camping market

    Science.gov (United States)

    Wilbur R. LaPage; Dale P. Ragain; Dale P. Ragain

    1971-01-01

    A 1968 survey of campers revealed that one-half of the campers did more than three-fourths of all the reported camping. Campers in this heavy half of the camping market were found to differ significantly from light-half campers in their camping motivations, past experience, and investments in camping equipment (LdPage 1969). However, the 1968 survey identified heavy-...

  3. 49 CFR 218.75 - Methods of protection for camp cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Methods of protection for camp cars. 218.75... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD OPERATING PRACTICES Protection of Occupied Camp Cars § 218.75 Methods of protection for camp cars. When camp cars requiring protection are on either main track...

  4. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  5. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  6. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  7. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  8. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  9. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  10. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  11. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  12. Sustainable transportation : technology, engineering, and science - summer camp instructor's guide.

    Science.gov (United States)

    2014-03-01

    This document reproduces the instructors guide for a ten day transportation engineering summer camp that was held at the University of Idaho in July 2013. The instructors guide is split into three units: Unit 1: Vehicle Technology, Unit 2: Traf...

  13. Cardiac cAMP: production, hydrolysis, modulation and detection

    Directory of Open Access Journals (Sweden)

    Cédric eBOULARAN

    2015-10-01

    Full Text Available Cyclic adenosine 3’,5’-monophosphate (cAMP modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors’ signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability.

  14. Camp as a Teaching Method in Health Education

    DEFF Research Database (Denmark)

    Ringby, Betina

    Background Camp as a learning activity was introduced in entrepreneurship teaching. Students were engaged to get experiences on how to cope with uncertainty, complexity and to take action in collaboration with external partners. Relevance Society calls for creative and innovative health professio......Background Camp as a learning activity was introduced in entrepreneurship teaching. Students were engaged to get experiences on how to cope with uncertainty, complexity and to take action in collaboration with external partners. Relevance Society calls for creative and innovative health...... to the future didactic development in health education. Camp as a learning process based on participation, creativity and an innovative approach combined with a professional focus seems relevant when trying to engage students to take action. Keywords Innovation, method, camp...

  15. The Physics of Quidditch Summer Camp: An Interdisciplinary Approach

    Science.gov (United States)

    Hammer, Donna; Uher, Tim

    The University of Maryland Physics Department has developed an innovative summer camp program that takes an interdisciplinary approach to engaging and teaching physics. The Physics of Quidditch Camp uniquely sits at the intersection of physics, sports, and literature, utilizing the real-life sport of quidditch adapted from the Harry Potter novels to stimulate critical thinking about real laws of physics and leaps of imagination, while actively engaging students in learning the sport and discussing the literature. Throughout the camp, middle school participants become immersed in fun physics experiments and exciting physical activities, which aim to build and enhance skills in problem-solving, analytical thinking, and teamwork. This camp has pioneered new ways of teaching physics to pre-college students, successfully engaged middle school students in learning physics, and grown a large demand for such activities.

  16. STRATEGI CAMP DALAM NOVEL HIDING MY CANDY KARYA LADY CHABLIS

    Directory of Open Access Journals (Sweden)

    Sri Saraswati

    2016-07-01

    Penerapan strategi Camp tersebut ditujukan sebagai upaya untuk meraih kebertahanan transgender. Selanjutnya, kebertahanan transgender dapat dicerminkan melalui visibilitas sosial, terbentuknya wacana normalitas alternatif dan pemberdayaan transgender

  17. Woods and Camping Safety for the Whole Family

    Science.gov (United States)

    ... for Educators Search English Español Woods and Camping Safety for the Whole Family KidsHealth / For Parents / Woods ... products before hiking that will act as a barrier against the oils of the plants. Any area ...

  18. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  19. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  20. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  1. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  2. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  3. ["Anxiety glistens on our brows". Dream reports in literary works on the horrors of ghettos and concentration camps].

    Science.gov (United States)

    Klein, J

    1991-06-01

    Dream reports occupy a special place in literature about confinement in concentration camps and ghettos (Robert Antelme, Charlotte Delbo, Anna Langfus, André Schwarz-Bart). They are central elements in the narrative that relate the anxiety of those threatened with destruction more faithfully than any realistic account could. They disrupt the chronological linearity and rationality and represent in images horror beyond memory or description.

  4. Thinking Big for 25 Years: Astronomy Camp Research Projects

    Science.gov (United States)

    Hooper, Eric Jon; McCarthy, D. W.; Benecchi, S. D.; Henry, T. J.; Kirkpatrick, J. D.; Kulesa, C.; Oey, M. S.; Regester, J.; Schlingman, W. M.; Camp Staff, Astronomy

    2013-01-01

    Astronomy Camp is a deep immersion educational adventure for teenagers and adults in southern Arizona that is entering its 25th year of existence. The Camp Director (McCarthy) is the winner of the 2012 AAS Education Prize. A general overview of the program is given in an accompanying contribution (McCarthy et al.). In this presentation we describe some of the research projects conducted by Astronomy Camp participants over the years. Many of the Camps contain a strong project-oriented emphasis, which reaches its pinnacle in the Advanced Camps for teenagers. High school students from around the world participate in a microcosm of the full arc of astronomy research. They plan their own projects before the start of Camp, and the staff provide a series of "key projects." Early in the Camp the students submit observing proposals to utilize time on telescopes. (The block of observing time is secured in advance by the staff.) The participants collect, reduce and analyze astronomical data with the help of staff, and they present the results to their peers on the last night of Camp, all in a span of eight days. The Camps provide research grade telescopes and instruments, in addition to amateur telescopes. Some of the Camps occur on Kitt Peak, where we use an ensemble of telescopes: the 2.3-meter (University of Arizona) with a spectrograph; the WIYN 0.9-meter; the McMath-Pierce Solar Telescope; and the 12-meter millimeter wave telescope. Additionally the Camp has one night on the 10-meter Submillimeter Telescope on Mt. Graham. Campers use these resources to study stars, galaxies, AGN, transiting planets, molecular clouds, etc. Some of the camper-initiated projects have led to very high level performances in prestigious international competitions, such as the Intel International Science and Engineering Fair. The key projects often contribute to published astronomical research (e.g., Benecchi et al. 2010, Icarus, 207, 978). Many former Campers have received Ph.D. degrees in

  5. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  6. Science and technology camp for girls. Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-31

    This document reports on the success of Pacific University`s camp held during the summers of 1992 and 1993; ultimate goal of this summer day camp was to increase the number of women in technical and scientific fields. Some experimentation was done with the age groups (7th and 8th grade girls). The curriculum was biology, chemistry, physics, and mathematics/computer science. Laboratory work and field trips were emphasized, along with socialization.

  7. [Widows of victims of Nazi concentration camps: their pathology].

    Science.gov (United States)

    Ryn, Z J

    1992-09-01

    The psychosocial situation of widows and orphans of victims of the Nazi concentration camps in Poland are presented. In 1984, 74 widows of victims from the Auschwitz-Birkenau camp were interviewed. This article describes widows' emotional-behavioral reactions when facing the imprisonment and death of their husbands, their difficulties in adapting themselves to widowhood, different adaptative forms of memories of their married life, and consequences relevant to widows' mental health and family, and social consequences of widowhood.

  8. Klambi Lurik Compang-Camping: Sebuah Komposisi Karawitan

    Directory of Open Access Journals (Sweden)

    SUHARDJONO -

    2013-11-01

    Full Text Available Klambi Lurik Compang-Camping Karawitan Composition. This article discusses the creation process ofKlambi Lurik Compang Camping karawitan composition. This composition is inspired by Jineman Klambi Lurik,penned by Wasiran –a traditional artist and teaching staff in Karawitan study programme in ISI Yogyakarta. Thisjineman is favoured by both laypeople and karawitan traditional artists. This composition consists of eight parts,united as one full composition. The creation methods are exploration, improvisation, and shaping.

  9. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  10. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  11. Exploring Marine Science through the University of Delaware's TIDE camp

    Science.gov (United States)

    Veron, D. E.; Newton, F. A.; Veron, F.; Trembanis, A. C.; Miller, D. C.

    2012-12-01

    For the past five years, the University of Delaware has offered a two-week, residential, summer camp to rising sophomores, juniors, and seniors who are interested in marine science. The camp, named TIDE (Taking an Interest in Delaware's Estuary) camp, is designed to introduce students to the breadth of marine science while providing them with a college experience. Campers participate in a variety of academic activities which include classroom, laboratory, and field experiences, as well as numerous social activities. Two unique features of this small, focused camp is the large number of university faculty that are involved, and the ability of students to participate in ongoing research projects. At various times students have participated in fish and dolphin counts, AUV deployment, wind-wave tank experiments, coastal water and beach studies, and ROV activities. In addition, each year campers have participated in a local service project. Through communication with former TIDE participants, it is clear that this two-week, formative experience plays a large role in students choice of major when entering college.2012 Tide Camp - Salt marsh in southern Delaware 2012 Tide Camp - Field trip on a small boat

  12. Adrenal hormones and liver cAMP in exercising rats--different modes of anesthesia.

    Science.gov (United States)

    Winder, W W; Fuller, E O; Conlee, R K

    1983-11-01

    We have compared five different modes of anesthesia (iv and ip pentobarbital sodium, ether, CO2, and cervical dislocation) with respect to their effects on liver glycogen, liver adenosine 3',5'-cyclic monophosphate (cAMP), blood glucose and lactate, plasma corticosterone, norepinephrine, and epinephrine in resting rats and in rats run on a treadmill at 26 m/min for 30 min. Ether, CO2, and cervical dislocation were found to be unsuitable due to the marked elevation in plasma catecholamines seen in both resting and exercising rats. Injection of pentobarbital sodium ip required an average of 8 min before onset of surgical anesthesia as opposed to less than 5 s for iv pentobarbital. Exercising rats anesthetized with ip pentobarbital showed markedly lower plasma catecholamines compared with rats given iv pentobarbital. Hepatic cAMP increased in response to exercise in all groups except the ip pentobarbital group. This is most likely due to the long delay between the end of the exercise and freezing of the liver in the ip pentobarbital-anesthetized animals. We conclude that iv injection of pentobarbital is the most suitable method of anesthesia for obtaining accurate measurements of plasma stress hormones, substrates, and metabolites and of hepatic cAMP and glycogen in resting and exercising rats.

  13. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  14. Can You Hack It? Validating Predictors for IT Boot Camps

    Science.gov (United States)

    Gear, Courtney C.

    Given the large number of information technology jobs open and lack of qualified individuals to fill them, coding boot camps have sprung up in response to this skill gap by offering a specialized training program in an accelerated format. This fast growth has created a need to measure these training programs and understand their effectiveness. In the present study, a series of analyses examined whether specific or combinations of predictors were valid for training performance in this coding academy. Self-rated, daily efficacy scores were used as outcome variables of training success and correlation results showed a positive relationship with efficacy scores and the logic test score as a predictor. Exploratory analyses indicated a Dunning-Kruger effect where students with lower education levels experience higher overall mood during the training program. Limitations of the study included small sample size, severe range restriction in predictor scores, lack of variance in predictor scores, and low variability in training program success. These limitations made identifying jumps between training stages difficult to identify. By identifying which predictors matter most for each stage of skill acquisition, further research should consider more objective variables such as instructor scores which can serve as a guideline to better asses what stage learners join at and how to design curriculum and assignments accordingly (Honken, 2013).

  15. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  16. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  17. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  18. Effect of a wildlife conservation camp experience in China on student knowledge of animals, care, propensity for environmental stewardship, and compassionate behavior toward animals

    Science.gov (United States)

    Bexell, Sarah M.

    The goal of conservation education is positive behavior change toward animals and the environment. This study was conducted to determine whether participation in a wildlife conservation education camp was effective in positively changing 8-12 year old students': (a) knowledge of animals, (b) care about animals, (c) propensity for environmental and wildlife stewardship, and (d) compassionate behavior toward animals. During the summer of 2005, 2 five-day camps were conducted at 2 zoological institutions in Chengdu, China. The camp curriculum was influenced by theory and research on the following: conservation psychology, social learning theory, empathy and moral development theory, socio-biological theory, constructivist theory, and conservation science. Camp activities were sensitive to Chinese culture and included Chinese conservation issues. Activities were designed to help children form bonds with animals and care enough about them to positively change their behavior toward animals and the environment. This mixed methods study triangulated quantitative and qualitative data from six sources to answer the following: (1) Did camp increase student knowledge of animals? (2) Did camp increase student caring about animals? (3) Did camp increase student propensity for environmental and wildlife stewardship? (4) Did camp affect student compassionate behavior toward animals? A conservation stewards survey revealed significant increases on pre-post, self-report of knowledge, care, and propensity. Pre-post, rubric-scored responses to human-animal interaction vignettes indicated a significant increase in knowledge, and stable scores on care and propensity. Qualitative data from student journals, vignettes, and end-of-camp questionnaires demonstrated knowledge, caring, and propensity, and revealed the emergent theme empathy. To address question 4, instructors tallied campers' behavior toward animals using a student behavior ethogram. Occurrence of positive behaviors was

  19. Good Camping for Children and Youth of Low Income Families; Some Suggestions for Camps Concerned About Providing Equal Opportunities for Children and Youth.

    Science.gov (United States)

    Richards, Catharine V.

    Guidelines are offered for positive camping experiences for poverty children and youth. There are sections on community organizations which can offer services for camp placement, recruitment of campers from among disadvantaged groups, and the orientation of new campers to camp (including such practical suggestions as the types of food and snacks…

  20. The Arabidopsis thaliana Cyclic-Nucleotide-Dependent Response – a Quantitative Proteomic and Phosphoproteomic Analysis

    KAUST Repository

    Alqurashi, May M.

    2013-01-01

    monophosphate (cAMP), has been shown to be a second messenger in abiotic and biotic stress responses. However, little is known about the precise role of cAMP in plants and in the down-stream activation of kinases, and hence cAMP

  1. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  2. Lipoic acid attenuates inflammation via cAMP and protein kinase A signaling.

    Directory of Open Access Journals (Sweden)

    Sonemany Salinthone

    2010-09-01

    Full Text Available Abnormal regulation of the inflammatory response is an important component of diseases such as diabetes, Alzheimer's disease and multiple sclerosis (MS. Lipoic acid (LA has been shown to have antioxidant and anti-inflammatory properties and is being pursued as a therapy for these diseases. We first reported that LA stimulates cAMP production via activation of G-protein coupled receptors and adenylyl cyclases. LA also suppressed NK cell activation and cytotoxicity. In this study we present evidence supporting the hypothesis that the anti-inflammatory properties of LA are mediated by the cAMP/PKA signaling cascade. Additionally, we show that LA oral administration elevates cAMP levels in MS subjects.We determined the effects of LA on IL-6, IL-17 and IL-10 secretion using ELISAs. Treatment with 50 µg/ml and 100 µg/ml LA significantly reduced IL-6 levels by 19 and 34%, respectively, in T cell enriched PBMCs. IL-17 levels were also reduced by 35 and 50%, respectively. Though not significant, LA appeared to have a biphasic effect on IL-10 production. Thymidine incorporation studies showed LA inhibited T cell proliferation by 90%. T-cell activation was reduced by 50% as measured by IL-2 secretion. Western blot analysis showed that LA treatment increased phosphorylation of Lck, a downstream effector of protein kinase A. Pretreatment with a peptide inhibitor of PKA, PKI, blocked LA inhibition of IL-2 and IFN gamma production, indicating that PKA mediates these responses. Oral administration of 1200 mg LA to MS subjects resulted in increased cAMP levels in PBMCs four hours after ingestion. Average cAMP levels in 20 subjects were 43% higher than baseline.Oral administration of LA in vivo resulted in significant increases in cAMP concentration. The anti-inflammatory effects of LA are mediated in part by the cAMP/PKA signaling cascade. These novel findings enhance our understanding of the mechanisms of action of LA.

  3. He Sapa Bloketu Waecun: 2008 Summer Science and Cultural Camps

    Science.gov (United States)

    Kliche, D. V.; Sanovia, J.; Decker, R.; Bolman, J.

    2008-12-01

    The South Dakota School of Mines, Humboldt State University and Sinte Gleska University with support from the National Science Foundation, sponsored four camps for South Dakota Lakota youth to nurture a geosciences learning community linked to culturally significant sites in the Black Hills. These camps utilized outdoor, experiential learning to integrate indigenous knowledge with contemporary western science. The project resulted in increased awareness among Native and non-Native Americans, young and adult, about the importance of geosciences in their connection and interpretation of nature. The project also motivated participants in learning and becoming active in land and resources protection and the importance of becoming knowledgeable and active in regulatory policies (both Tribal and State). The four camps were scheduled during the month of June, 2008, which is the month of the summer solstice, a sacred time for the Lakota people which signal the Lakota Sundance Ceremony. The timing of the camps was chosen to give the Native American participants the framework to express their connection to Native lands through the understanding of their oral history. For the first time in such camps, middle and high school students were encouraged to have a parent or relative attending with them. The camps proved to be a great success among students and their families. The curriculum and activities helped participants immerse themselves mentally, physically and spiritually into an experience of a life time. We plan to show our results from these camps and emphasize the usefulness of this new approach in teaching science and encouraging the new generation to pursue careers in geosciences.

  4. Emergency Medicine Residency Boot Camp Curriculum: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Ataya, Ramsey

    2015-03-01

    Full Text Available Introduction: Establishing a boot camp curriculum is pertinent for emergency medicine (EM residents in order to develop proficiency in a large scope of procedures and leadership skills.  In this article, we describe our program’s EM boot camp curriculum as well as measure the confidence levels of resident physicians through a pre- and post-boot camp survey. Methods: We designed a one-month boot camp curriculum with the intention of improving the confidence, procedural performance, leadership, communication and resource management of EM interns. Our curriculum consisted of 12 hours of initial training and culminated in a two-day boot camp. The initial day consisted of clinical skill training and the second day included code drill scenarios followed by interprofessional debriefing.   Results: Twelve EM interns entered residency with an overall confidence score of 3.2 (1-5 scale across all surveyed skills. Interns reported the highest pre-survey confidence scores in suturing (4.3 and genitourinary exams (3.9. The lowest pre-survey confidence score was in thoracostomy (2.4. Following the capstone experience, overall confidence scores increased to 4.0. Confidence increased the most in defibrillation and thoracostomy. Additionally, all interns reported post-survey confidence scores of at least 3.0 in all skills, representing an internal anchor of “moderately confident/need guidance at times to perform procedure.” Conclusion: At the completion of the boot camp curriculum, EM interns had improvement in self-reported confidence across all surveyed skills and procedures. The described EM boot camp curriculum was effective, feasible and provided a foundation to our trainees during their first month of residency. [West J Emerg Med. 2015;16(2:356–361.

  5. [Central Work Camp in Jaworzno (1945-1949) -- epidemiological aspects -- attempt of evaluation].

    Science.gov (United States)

    Smolik, Przemysław

    2013-01-01

    Publication presents the short history of camp hospital which was organised in 1943 Nazi concentration camp Neu-Dachs in Jaworzno. The camp was a branch of Oświecim concentration camp. Atfer the war damage of the camp, the restoration was begun in 1945. Already in Febraury 1945, in place of German concentration camp, rises Central Work Camp. Several thousands of prisoners of war were placed there. The prisoners of war: Germans, Volksdeutches, Silesians were forced emlpoyed in nearby coal mines. Since 1947 the camp was a place of staying for several thousands Ukrainians who were displaced from eastern part of Poland in "Vistula Operation". Based on available written materials, publication is an attempt to analyse and evaluate: sanitary conditions, prison illnesses, mortality reasons among prisoners, hospital equipment, personel work conditions. The publication gives opportunity to compare conditions of prison hospital under nazi occupation and conditions in the camp which was organised in the same place under Stalin system of terror.

  6. The NO/cGMP pathway inhibits transient cAMP signals through the activation of PDE2 in striatal neurons

    Directory of Open Access Journals (Sweden)

    Marina ePolito

    2013-11-01

    Full Text Available The NO-cGMP signaling plays an important role in the regulation of striatal function although the mechanisms of action of cGMP specifically in medium spiny neurons (MSNs remain unclear. Using genetically encoded fluorescent biosensors, including a novel Epac-based sensor (EPAC-SH150 with increased sensitivity for cAMP, we analyze the cGMP response to NO and whether it affected cAMP/PKA signaling in MSNs. The Cygnet2 sensor for cGMP reported large responses to NO donors in both striatonigral and striatopallidal MSNs, and this cGMP signal was controlled partially by PDE2. At the level of cAMP brief forskolin stimulations produced transient cAMP signals which differed between D1 and D2 medium spiny neurons. NO inhibited these cAMP transients through cGMP-dependent PDE2 activation, an effect that was translated and magnified downstream of cAMP, at the level of PKA. PDE2 thus appears as a critical effector of NO which modulates the post-synaptic response of MSNs to dopaminergic transmission.

  7. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  8. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  9. Targeted antiviral prophylaxis with oseltamivir in a summer camp setting.

    Science.gov (United States)

    Kimberlin, David W; Escude, Janell; Gantner, Janel; Ott, Jeanne; Dronet, Melissa; Stewart, Timothy A; Jester, Penelope; Redden, David T; Chapman, Whitney; Hammond, Rob

    2010-04-01

    To describe the effectiveness of containment of novel influenza A(H1N1) infection at a summer camp. Targeted use of oseltamivir phosphate by individuals in close contact with influenza-confirmed cases. Boys' camp in Alabama in July 2009. A total of 171 campers, 48 camp counselors, and 27 camp staff. Campers with confirmed influenza received oseltamivir and were immediately isolated and sent home. All boys and counselors in the infected child's adjoining cabins received prophylactic oseltamivir for 10 days, including 8 campers at higher risk for influenza infection (eg, those with asthma, seizure disorder, or diabetes). Alcohol-based hand sanitizer was provided at each of the daily activities, in the boys' cabins, and in the dining hall, and counselors were educated by the medical staff on the spread of influenza and its prevention through good hand hygiene. All cabins, bathrooms, and community sports equipment were sprayed or wiped down with disinfectant each day. Main Outcome Measure Virologic confirmation of influenza. Three of the 171 campers tested positive for influenza A during the course of the 2-week fourth session, for an attack rate of 1.8%. The probability of observing 3 or fewer infected campers if the attack rate was 12% is less than 1 in 10,000,000 (P hand sanitization and surface decontamination, a targeted approach to antiviral prophylaxis contained the spread of influenza in a summer camp setting.

  10. The role of the physician: Eugene Sanger and a standard of care at the Elmira prison camp.

    Science.gov (United States)

    Waggoner, Jesse

    2008-01-01

    The conduct of American military physicians in prisoner of war (POW) camps has been called into question by the abuse scandals at Abu Ghraib and Guantánamo Bay. This essay explores the experiences of the first U.S. military physicians to confront POW patients in large numbers-events that occurred during the American Civil War. While POWs received sub-standard care in camps north and south, the war also saw the issuance of the first document to outline the rights of POWs. This ambivalence toward the proper care and treatment of the POW is evident in the career of Dr. Eugene Sanger, the first Union surgeon at the prison camp in Elmira, New York. Sanger demonstrated both concern about the sanitary condition of the camp and pride in the deaths of POWs as furthering the overall war aims. His cruelty attracted some censure, but Sanger never faced disciplinary action. He was honorably discharged and went on to become the Surgeon General of his home state. This article places his actions at Elmira in the context of medical ethics, Army orders, and Northern opinion in 1864, and it will argue that the lack of Federal response to Eugene Sanger's poor record while serving at the prison set a precedent for inferior medical care of POWs by American military physicians.

  11. cAMP and forskolin decrease γ-aminobutyric acid-gated chloride flux in rat brain synaptoneurosomes

    International Nuclear Information System (INIS)

    Heuschneider, G.; Schwartz, R.D.

    1989-01-01

    The effects of the cyclic nucleotide cAMP on γ-aminobutyric acid-gated chloride channel function were investigated. The membrane-permeant cAMP analog N 6 , O 2' -dibutyryladenosine 3',5'-cyclic monophosphate inhibited muscimol-induced 36 Cl - uptake into rat cerebral cortical synaptoneurosomes in a concentration-dependent manner. The inhibition was due to a decrease in the maximal effect of muscimol, with no change in potency. Similar effects were observed with 8-(4-chlorophenylthio)adenosine 3',5'-cyclic monophosphate, 8-bromoadenosine 3',5'-cyclic monophosphate, and the phosphodiesterase inhibitor isobutylmethylxanthine. The effect of endogenous cAMP accumulation on the γ-aminobutyric acid-gated Cl - channel was studied with forskolin, an activator of adenylate cyclase. Under identical conditions, in the intact synaptoneurosomes, forskolin inhibited muscimol-induced 36 Cl - uptake and generated cAMP with similar potencies. Surprisingly, 1,9-dideoxyforskolin, which does not activate adenylate cyclase, also inhibited the muscimol response, suggesting that forskolin and its lipophilic derivatives may interact with the Cl - channel directly. The data suggest that γ-aminobutyric acid (GABA A ) receptor function in brain can be regulated by cAMP-dependent phosphorylation

  12. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  13. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  14. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  15. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  16. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  17. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  18. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  19. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  1. Anxiety and depression with neurogenesis defects in exchange protein directly activated by cAMP 2-deficient mice are ameliorated by a selective serotonin reuptake inhibitor, Prozac

    Science.gov (United States)

    Zhou, L; Ma, S L; Yeung, P K K; Wong, Y H; Tsim, K W K; So, K F; Lam, L C W; Chung, S K

    2016-01-01

    Intracellular cAMP and serotonin are important modulators of anxiety and depression. Fluoxetine, a selective serotonin reuptake inhibitor (SSRI) also known as Prozac, is widely used against depression, potentially by activating cAMP response element-binding protein (CREB) and increasing brain-derived neurotrophic factor (BDNF) through protein kinase A (PKA). However, the role of Epac1 and Epac2 (Rap guanine nucleotide exchange factors, RAPGEF3 and RAPGEF4, respectively) as potential downstream targets of SSRI/cAMP in mood regulations is not yet clear. Here, we investigated the phenotypes of Epac1 (Epac1−/−) or Epac2 (Epac2−/−) knockout mice by comparing them with their wild-type counterparts. Surprisingly, Epac2−/− mice exhibited a wide range of mood disorders, including anxiety and depression with learning and memory deficits in contextual and cued fear-conditioning tests without affecting Epac1 expression or PKA activity. Interestingly, rs17746510, one of the three single-nucleotide polymorphisms (SNPs) in RAPGEF4 associated with cognitive decline in Chinese Alzheimer's disease (AD) patients, was significantly correlated with apathy and mood disturbance, whereas no significant association was observed between RAPGEF3 SNPs and the risk of AD or neuropsychiatric inventory scores. To further determine the detailed role of Epac2 in SSRI/serotonin/cAMP-involved mood disorders, we treated Epac2−/− mice with a SSRI, Prozac. The alteration in open field behavior and impaired hippocampal cell proliferation in Epac2−/− mice were alleviated by Prozac. Taken together, Epac2 gene polymorphism is a putative risk factor for mood disorders in AD patients in part by affecting the hippocampal neurogenesis. PMID:27598965

  2. Direct Light-up of cAMP Derivatives in Living Cells by Click Reactions

    Directory of Open Access Journals (Sweden)

    Yan Xu

    2013-10-01

    Full Text Available 8-Azidoadenosine 3′,5′-cyclic monophosphate (8-azido cAMP was directly detected in living cells, by applying Cu-free azide-alkyne cycloaddition to probe cAMP derivatives by fluorescence light-up. Fluorescence emission was generated by two non-fluorescent molecules, 8-azido cAMP as a model target and difluorinated cyclooctyne (DIFO reagent as a probe. The azide-alkyne cycloaddition reaction between 8-azido cAMP and DIFO induces fluorescence in 8-azido cAMP. The fluorescence emission serves as a way to probe 8-azido cAMP in cells.

  3. Determining the Central Atlantic Magmatic Province (CAMPS)'s Role in the Increased Flux of CO2 in the end-Triassic Mass Extinction

    Science.gov (United States)

    Srinivasan, P. S.; Bachan, A.; Stanford School of Earth Sciences Department of Paleobiology

    2011-12-01

    The Central Atlantic Magmatic Province (CAMP) is one of the largest flood basalt provinces known. Its empacement coincided with a period of major plant and animal extinctions-the end-Triassic mass extinction. It is postulated that the release of large amounts of carbon dioxide into the atmosphere from the volcanics was one of the causes of this mass extinction. However,the magnitude of impact on ocean chemistry, and timescales involved remain unclear. To determine CAMP's role in this increased flux of CO2, we studied the geochemistry of samples of rock from the Triassic-Jurassic boundary, in northern Italy. Specifically, by observing the ratios of carbon isotopes 12 and 13 in the organic carbon found in these limestone sedimentary rocks, we could determine the ratio of carbonate to organic burial fluxes globally. We drilled limestone rocks from two different sections in the Southern Alps-- Pozzo Glaciale and Val Adrara. Once they were drilled to a fine powder-like form, we acidified the CaCO3 with HCl to isolate the organic carbon. Then, the organic matter was cleaned to rid the acid, and eventually was placed into tin foil to be placed into the Elemental Analyzer, which determined the percent Carbon in each sample. We tested about 200 samples, and placed them into the Mass Spectrometer machine to determine the isotopic ratios of C12 and C13. According to the data, there was a positive excursion for both sample sets, which means that there was an increase in the amount of C13 in the organic matter. The duration of this excursion was at least a few hundred thousand years. This suggests a protracted increase in the burial flux of organic carbon globally, which is consistent with the hypothesized volcanically driven increase in CO2. This further bolsters the contention that CAMP was responsible, in part, for this mass extinction. By studying the earth's recovery from increased carbon fluxes in the past, we can predict the recovery path that our anthropogenically

  4. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  5. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  6. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  7. Investigation of Sylvatic Typhus at a Wilderness Camp

    Centers for Disease Control (CDC) Podcasts

    2009-06-30

    In this podcast, Dr. Greg Dasch discusses an outbreak of four cases of sylvatic typhus that occurred at a wilderness camp in Pennsylvania. Sylvatic typhus is very rare in the United States, with only 41 cases since it was discovered in the United States in 1975. Lab work at CDC and the discovery that all four camp counselors who became ill had slept in the same bunk at the camp between 2004 and 2006 ultimately led to confirmation that flying squirrels living in the wall of the cabin were to blame for the illnesses.  Created: 6/30/2009 by Emerging Infectious Diseases.   Date Released: 6/30/2009.

  8. Advances in Pediatric Cardiology Boot Camp: Boot Camp Training Promotes Fellowship Readiness and Enables Retention of Knowledge.

    Science.gov (United States)

    Ceresnak, Scott R; Axelrod, David M; Sacks, Loren D; Motonaga, Kara S; Johnson, Emily R; Krawczeski, Catherine D

    2017-03-01

    We previously demonstrated that a pediatric cardiology boot camp can improve knowledge acquisition and decrease anxiety for trainees. We sought to determine if boot camp participants entered fellowship with a knowledge advantage over fellows who did not attend and if there was moderate-term retention of that knowledge. A 2-day training program was provided for incoming pediatric cardiology fellows from eight fellowship programs in April 2016. Hands-on, immersive experiences and simulations were provided in all major areas of pediatric cardiology. Knowledge-based examinations were completed by each participant prior to boot camp (PRE), immediately post-training (POST), and prior to the start of fellowship in June 2016 (F/U). A control group of fellows who did not attend boot camp also completed an examination prior to fellowship (CTRL). Comparisons of scores were made for individual participants and between participants and controls. A total of 16 participants and 16 control subjects were included. Baseline exam scores were similar between participants and controls (PRE 47 ± 11% vs. CTRL 52 ± 10%; p = 0.22). Participants' knowledge improved with boot camp training (PRE 47 ± 11% vs. POST 70 ± 8%; p cardiology knowledge after the training program and had excellent moderate-term retention of that knowledge. Participants began fellowship with a larger fund of knowledge than those fellows who did not attend.

  9. Cyclic 3',5'-adenosine monophosphate (cAMP) signaling in the anterior pituitary gland in health and disease.

    Science.gov (United States)

    Hernández-Ramírez, Laura C; Trivellin, Giampaolo; Stratakis, Constantine A

    2018-03-05

    The cyclic 3',5'-adenosine monophosphate (cAMP) was the first among the so-called "second messengers" to be described. It is conserved in most organisms and functions as a signal transducer by mediating the intracellular effects of multiple hormones and neurotransmitters. In this review, we first delineate how different members of the cAMP pathway ensure its correct compartmentalization and activity, mediate the terminal intracellular effects, and allow the crosstalk with other signaling pathways. We then focus on the pituitary gland, where cAMP exerts a crucial function by controlling the responsiveness of the cells to hypothalamic hormones, neurotransmitters and peripheral factors. We discuss the most relevant physiological functions mediated by cAMP in the different pituitary cell types, and summarize the defects affecting this pathway that have been reported in the literature. We finally discuss how a deregulated cAMP pathway is involved in the pathogenesis of pituitary disorders and how it affects the response to therapy. Copyright © 2017. Published by Elsevier B.V.

  10. Science Camp - lystigt eller lærerigt

    DEFF Research Database (Denmark)

    Ahrenkiel, Linda; Albrechtsen, Thomas S. R.

    2013-01-01

    I oplægget vil vi undersøge fænomenet Science Camps nærmere ved at fortælle om dets historiske udvikling og ikke mindst lægge op til en diskussion af en definition. Derudover vil vi præsentere en case, hvor der med udgangspunkt i et aktuelt ph.d.-projekt er blevet undersøgt, hvad deltagerne får ud...... af at deltage i en science camp: Kan man både vække begejstring og medvirke til læring?...

  11. Science Skills Boot Camp Gets Interns Ready for Research | Poster

    Science.gov (United States)

    By Ashley DeVine, Staff Writer Summer interns learned how to read a scientific paper, present a poster, maintain a laboratory notebook, and much more, at the Science Skills Boot Camp in June. “It was a great experience, and it was a great opportunity to meet some of the other interns also working on the campus,” said Alyssa Klein, a Werner H. Kirsten student intern in the Cellular Immunology Group, Laboratory of Molecular Immunoregulation. “The boot camp covered many topics essential to being a good scientist and science researcher.”

  12. Winter Camp: A Blog from the Greenland Summit, Part II

    Science.gov (United States)

    Koenig, Lora

    2009-01-01

    An earlier issue presents the first half of the author's experience living and working at the National Science Foundation's (NSF) Greenland Summit Camp. The author is a remote-sensing glaciologist at NASA s Goddard Space Flight Center. She took measurements that will be used to validate data collected by NASA s Aqua, Terra, and Ice, Clouds, and land Elevation Satellite (ICESat) satellites with ground-truth measurements of the Greenland Ice Sheet she made at Summit Camp from November 2008-February 2009. This article presents excerpts from the second half of her stay and work at the Greenland Summit.

  13. Physiological and Molecular Effects of the Cyclic Nucleotides cAMP and cGMP on Arabidopsis thaliana

    KAUST Repository

    Herrera, Natalia M.

    2012-12-01

    The cyclic nucleotide monophosphates (CNs), cAMP and cGMP, are second messengers that participate in the regulation of development, metabolism and adaptive responses. In plants, CNs are associated with the control of pathogen responses, pollen tube orientation, abiotic stress response, membrane transport regulation, stomatal movement and light perception. In this study, we hypothesize that cAMP and cGMP promote changes in the transcription level of genes related to photosynthesis, high light and membrane transport in Arabidopsis thaliana leaves and, that these changes at the molecular level can have functional biological consequences. For this reason we tested if CNs modulate the photosynthetic rate, responses to high light and root ion transport. Real time quantitative PCR was used to assess transcription levels of selected genes and infrared gas analyzers coupled to fluorescence sensors were used to measure the photosynthetic parameters. We present evidence that both cAMP and cGMP modulate foliar mRNA levels early after stimulation. The two CNs trigger different responses indicating that the signals have specificity. A comparison of proteomic and transcriptional changes suggest that both transcriptional and post-transcriptional mechanisms are modulated by CNs. cGMP up-regulates the mRNA levels of components of the photosynthesis and carbon metabolism. However, neither cAMP nor cGMP trigger differences in the rate of carbon assimilation, maximum efficiency of the photosystem II (PSII), or PSII operating efficiency. It was also demonstrated that CN regulate the expression of its own targets, the cyclic nucleotide gated channels - CNGC. Further studies are needed to identify the components of the signaling transduction pathway that mediate cellular changes and their respective regulatory and/or signaling roles.

  14. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  15. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  16. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  17. Control of βAR- and N-methyl-D-aspartate (NMDA Receptor-Dependent cAMP Dynamics in Hippocampal Neurons.

    Directory of Open Access Journals (Sweden)

    Andrew Chay

    2016-02-01

    Full Text Available Norepinephrine, a neuromodulator that activates β-adrenergic receptors (βARs, facilitates learning and memory as well as the induction of synaptic plasticity in the hippocampus. Several forms of long-term potentiation (LTP at the Schaffer collateral CA1 synapse require stimulation of both βARs and N-methyl-D-aspartate receptors (NMDARs. To understand the mechanisms mediating the interactions between βAR and NMDAR signaling pathways, we combined FRET imaging of cAMP in hippocampal neuron cultures with spatial mechanistic modeling of signaling pathways in the CA1 pyramidal neuron. Previous work implied that cAMP is synergistically produced in the presence of the βAR agonist isoproterenol and intracellular calcium. In contrast, we show that when application of isoproterenol precedes application of NMDA by several minutes, as is typical of βAR-facilitated LTP experiments, the average amplitude of the cAMP response to NMDA is attenuated compared with the response to NMDA alone. Models simulations suggest that, although the negative feedback loop formed by cAMP, cAMP-dependent protein kinase (PKA, and type 4 phosphodiesterase may be involved in attenuating the cAMP response to NMDA, it is insufficient to explain the range of experimental observations. Instead, attenuation of the cAMP response requires mechanisms upstream of adenylyl cyclase. Our model demonstrates that Gs-to-Gi switching due to PKA phosphorylation of βARs as well as Gi inhibition of type 1 adenylyl cyclase may underlie the experimental observations. This suggests that signaling by β-adrenergic receptors depends on temporal pattern of stimulation, and that switching may represent a novel mechanism for recruiting kinases involved in synaptic plasticity and memory.

  18. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    International Nuclear Information System (INIS)

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  19. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  1. Aging has the opposite effect on cAMP and cGMP circadian variations in rat Leydig cells.

    Science.gov (United States)

    Baburski, Aleksandar Z; Sokanovic, Srdjan J; Andric, Silvana A; Kostic, Tatjana S

    2017-05-01

    The Leydig cell physiology displays a circadian rhythm driven by a complex interaction of the reproductive axis hormones and circadian system. The final output of this regulatory process is circadian pattern of steroidogenic genes expression and testosterone production. Aging gradually decreases robustness of rhythmic testosterone secretion without change in pattern of LH secretion. Here, we analyzed effect of aging on circadian variation of cAMP and cGMP signaling in Leydig cells. Results showed opposite effect of aging on cAMP and cGMP daily variation. Reduced amplitude of cAMP circadian oscillation was probably associated with changed expression of genes involved in cAMP production (increased circadian pattern of Adcy7, Adcy9, Adcy10 and decreased Adcy3); cAMP degradation (increased Pde4a, decreased Pde8b, canceled rhythm of Pde4d, completely reversed circadian pattern of Pde7b and Pde8a); and circadian expression of protein kinase A subunits (Prkac/PRKAC and Prkar2a). Aging stimulates expression of genes responsible for cGMP production (Nos2, Gucy1a3 and Gucy1b3/GUCYB3) and degradation (Pde5a, Pde6a and Pde6h) but the overall net effect is elevation of cGMP circadian oscillations in Leydig cells. In addition, the expression of cGMP-dependent kinase, Prkg1/PRKG1 is up-regulated. It seems that aging potentiate cGMP- and reduce cAMP-signaling in Leydig cells. Since both signaling pathways affect testosterone production and clockwork in the cells, further insights into these signaling pathways will help to unravel disorders linked to the circadian timing system, aging and reproduction.

  2. Measuring the Influences of Youth Participation in Ohio 4-H Camps

    Directory of Open Access Journals (Sweden)

    Greg Homan

    2008-06-01

    Full Text Available Findings from a multi-component 4-H camp marketing and enrollment study of Ohio 4-H camps are highlighted. Significant influencers on the camp enrollment decision (parents, other adults, peers, siblings, and the respective camper are evaluated as well as the effectiveness of various marketing techniques. The data found in this study indicates that the decision to enroll in camp is most influenced by the respective 4-H camper; however parents are also a strong factor in the choice to participate in 4-H camps. Alumni parents report significantly higher influence in the camp enrollment decision than those parents who are not alumni of 4-H. Personal methods of promoting camps were rated the most effective in reaching potential camp audiences.

  3. Hydrogen sulfide inhibits A2A adenosine receptor agonist induced β-amyloid production in SH-SY5Y neuroblastoma cells via a cAMP dependent pathway.

    Directory of Open Access Journals (Sweden)

    Bhushan Vijay Nagpure

    Full Text Available Alzheimer's disease (AD is the leading cause of senile dementia in today's society. Its debilitating symptoms are manifested by disturbances in many important brain functions, which are influenced by adenosine. Hence, adenosinergic system is considered as a potential therapeutic target in AD treatment. In the present study, we found that sodium hydrosulfide (NaHS, an H2S donor, 100 µM attenuated HENECA (a selective A2A receptor agonist, 10-200 nM induced β-amyloid (1-42 (Aβ42 production in SH-SY5Y cells. NaHS also interfered with HENECA-stimulated production and post-translational modification of amyloid precursor protein (APP by inhibiting its maturation. Measurement of the C-terminal APP fragments generated from its enzymatic cleavage by β-site amyloid precursor protein cleaving enzyme 1 (BACE1 showed that NaHS did not have any significant effect on β-secretase activity. However, the direct measurements of HENECA-elevated γ-secretase activity and mRNA expressions of presenilins suggested that the suppression of Aβ42 production in NaHS pretreated cells was mediated by inhibiting γ-secretase. NaHS induced reductions were accompanied by similar decreases in intracellular cAMP levels and phosphorylation of cAMP responsive element binding protein (CREB. NaHS significantly reduced the elevated cAMP and Aβ42 production caused by forskolin (an adenylyl cyclase, AC agonist alone or forskolin in combination with IBMX (a phosphodiesterase inhibitor, but had no effect on those caused by IBMX alone. Moreover, pretreatment with NaHS significantly attenuated HENECA-elevated AC activity and mRNA expressions of various AC isoforms. These data suggest that NaHS may preferentially suppress AC activity when it was stimulated. In conclusion, H2S attenuated HENECA induced Aβ42 production in SH-SY5Y neuroblastoma cells through inhibiting γ-secretase via a cAMP dependent pathway.

  4. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  5. Impact of Attending Jump Start Literacy Camp on Reading Achievement among Third and Fourth Grade Students

    Science.gov (United States)

    Padgett, Carrie B.

    2010-01-01

    The Jump Start Literacy Camp was developed as a means to combat summer learning loss. The camp utilized high-energy activities to target phonemic awareness, phonics, vocabulary, fluency, and comprehension. This study examined the effects of the Jump Start Literacy Camp on reading achievement for rising third and fourth grade students in an urban…

  6. Culture Camp, Ethnic Identity, and Adoption Socialization for Korean Adoptees: A Pretest and Posttest Study

    Science.gov (United States)

    Baden, Amanda L.

    2015-01-01

    This study explores the impact of racial-ethnic socialization on adopted South Korean children and adolescents who attended a sleepaway Korean culture camp for one week. This camp provided racial-ethnic socialization experiences via exposure to camp counselors, staff, and teachers who were Korean Americans, Korean nationals, and Korean adult…

  7. The Impact of Learning Styles on Learning Outcomes at FFA Camp: What Campers Retain over Time

    Science.gov (United States)

    Brown, Nicholas R.; Terry, Robert, Jr.; Kelsey, Kathleen D.

    2013-01-01

    Twenty-four states host FFA summer camps to support adolescent maturation along with indoctrination into the culture and values of the FFA. Camps typically include a variety of activities designed to engage members in social activities and non-formal academic content. More than 1500 campers attend the Oklahoma FFA Alumni Leadership Camp annually…

  8. 77 FR 5398 - Safety Zone; Atlantic Intracoastal Waterway, Vicinity of Marine Corps Base, Camp Lejeune, NC

    Science.gov (United States)

    2012-02-03

    ...-AA00 Safety Zone; Atlantic Intracoastal Waterway, Vicinity of Marine Corps Base, Camp Lejeune, NC... zone on the Atlantic Intracoastal Waterway (AICW) adjacent to Marine Corps Base (MCB) Camp Lejeune..., Vicinity of Marine Corps Base, Camp Lejeune, NC in the Federal Register (77 FR 1431). We received no...

  9. Reflections on Refugee Students' Major Perceptions of Education in Kakuma Refugee Camp, Kenya

    Science.gov (United States)

    Mareng, Chuei D.

    2010-01-01

    This reflective study explores refugee students' perceptions of the educational approach used in Kakuma Refugee Camp in Kenya. The study focuses on my personal reflections as a teacher and a student in this camp, and as a refugee. My goal of writing this narrative is to reflect fully on the refugee students' life in a camp and then contribute to…

  10. The accidental city : violence, economy and humanitarianism in Kakuma refugee camp Kenya

    NARCIS (Netherlands)

    Jansen, B.J.

    2011-01-01

    In this research I examine social ordering processes in Kakuma refugee camp in

    Kenya. I view the camp as an accidental city, by which I challenge the image of

    the camp as a temporary and artificial waiting space or a protracted refugee crisis

    per se. The reference to the

  11. A Multidisciplinary Science Summer Camp for Students with Emphasis on Environmental and Analytical Chemistry

    Science.gov (United States)

    Schwarz, Gunnar; Frenzel, Wolfgang; Richter, Wolfgang M.; Ta¨uscher, Lothar; Kubsch, Georg

    2016-01-01

    This paper presents the course of events of a five-day summer camp on environmental chemistry with high emphasis on chemical analysis. The annual camp was optional and open for students of all disciplines and levels. The duration of the summer camp was five and a half days in the Feldberg Lake District in northeast Germany (federal state of…

  12. Hack City Summer: Computer Camps Can Bring a Vacation of Keyboard Delights.

    Science.gov (United States)

    Shell, Ellen Ruppel

    1983-01-01

    Activities at a summer computer camp (Camp Atari held at East Stroudsburg State College PA) are described. The curriculum, using logic, systematic analysis, and other fundamental programing skills, teaches students to interact effectively and creatively with computers. Sources for finding a computer camp are included. (JN)

  13. First urology simulation boot camp in the United Kingdom

    Directory of Open Access Journals (Sweden)

    C.S. Biyani

    2017-09-01

    Conclusion: This first UK Urology Simulation Boot Camp has demonstrated feasibility and effectiveness in enhancing trainee’s experience. Given these positive feedbacks there is a good reason to expect that future courses will improve the overall skills of a new urology trainee.

  14. Addressing Nature Deficit Disorder through Primitive Camping Experiences

    Science.gov (United States)

    Allen, Kevin; Varner, Keegan; Sallee, Jeff

    2011-01-01

    Today's youth suffer from Nature Deficit Disorder, a condition that has been connected to ADHD, shortage of creativity, and general lack of knowledge about the outdoors. A team of educators and specialists are addressing this issue with primitive camping. County educators were trained using experiential learning and train-the-trainer techniques.…

  15. 29 CFR 1910.142 - Temporary labor camps.

    Science.gov (United States)

    2010-07-01

    ... employed or permitted to work in the preparation, cooking, serving, or other handling of food, foodstuffs... facilities shall be provided for storing and preparing food. (11) All heating, cooking, and water heating... principal camp area in which food is prepared and served and where sleeping quarters are located shall be at...

  16. Middle School Girls Sample "Hard Hat" Life at Construction Camp

    Science.gov (United States)

    Brown, Aneeta

    2013-01-01

    On a Monday morning in July, a fan as tall as a refrigerator churned noisily in the cavernous classroom. As the outdoor temperature crept higher, teenage girls wearing hardhats and safety glasses wiped perspiration and sawdust from their faces. This was not a field trip. This was the second hour of camp at Ranken Technical College in St. Louis,…

  17. Coaching Emotional Skills at Camp: You Bet You Can!

    Science.gov (United States)

    Coleman, Marla

    1997-01-01

    Stresses the importance of camps fostering the self-esteem and emotional intelligence of campers by creating an envelope of physical safety, building emotional security, creating a sense of identity, developing a sense of belonging, nurturing competence, and achieving a sense of mission. Discusses achieving this goal through cooperation with…

  18. Expert Review of Pedagogical Activities at Therapeutic Recreation Camps

    Science.gov (United States)

    Kiselev, N. N.; Kiseleva, E. V.

    2015-01-01

    An analysis of pedagogical expert reviews at children's therapeutic recreation camps in Novosibirsk Region shows that it is necessary to implement an expert review system that plays a supporting and developmental role. Such a system should allow teams of teachers to submit their work to expert review and to move forward by reflecting on their…

  19. Participant Perspectives on the ESO Astronomy Camp Programme

    Science.gov (United States)

    Olivotto, C.; Cenadelli, D.; Gamal, M.; Grossmann, D.; Teller, L. A. I.; Marta, A. S.; Matoni, C. L.; Taillard, A.

    2015-09-01

    This article describes the experience of attending the European Southern Observatory (ESO) Astronomy Camp from the perspective of its participants - students aged between 16 and 18 years old from around the world. The students shared a week together during the winter of 2014 in the Alpine village of Saint-Barthelemy, Italy. The camp was organised by ESO in collaboration with Sterrenlab and the Astronomical Observatory of the Autonomous Region of the Aosta Valley and offered a rich programme of astronomy and leisure activities. This article focuses on the concept of astronomy camps, and their role as a unique tool to complement formal classroom education, rather than on the astronomy activities and the scientific programme. Thus, it is not an academic review of the implemented methodologies, but rather a reflection on the overall experience. The article was brought together from collaborative accounts by some of the participants who were asked to reflect on the experience. The participants who contributed to this article represent the diversity of the ESO Astronomy Camp's alumni community.

  20. Installation Restoration Program Preliminary Assessment Naknek Recreational Camps, Alaska

    Science.gov (United States)

    1989-04-01

    Conservation Service, the soils at Camps I and II consist of the Typic Cryandepts-Histic Pergelic Cryaquepts complex (Reiger and others, 1979). The permeability...2 0 0 IC IP 3 - -r TVI 111-3-rIiovil 8 I Histic Pergelic Cryaquepts, sandy, nearly level to rolling, are poorly drained soils with permafrost in broad

  1. Criticality for Global Citizenship in Korean English Immersion Camps

    Science.gov (United States)

    Ahn, So-Yeon

    2015-01-01

    Given a heavy social, ideological pressure for parents to pursue better English education for their children in the globalized world, short-term English immersion camp programs have emerged as an educational option in South Korea, promoted as environments for intercultural communication between native English-speaking teachers and local Korean…

  2. Punishing Kids: The Rise of the "Boot Camp"

    Science.gov (United States)

    Mills, Martin; Pini, Barbara

    2015-01-01

    This paper is concerned with the rise of 'the boot camp' as a means of addressing "the problem of troubled youth" in contemporary industrialised nations such as Australia and the UK. Drawing on a corpus of publicly available material including press releases and policy documents, media reports, and programme websites, the paper explores…

  3. Evaluation of a Summer Camp Environmental Education Program in Spain

    Science.gov (United States)

    Samperiz, Ana; Herrero, Juan

    2018-01-01

    The objective of this study was to develop a nonformal environmental education program in a summer camp and to measure its effectiveness increasing environmental knowledge and attitudes of the participants. Seventy six teenagers between 14 and 17 years participated. Activities dealt with both natural and urban environment. Preactivity and…

  4. Resveratrol stimulates c-Fos gene transcription via activation of ERK1/2 involving multiple genetic elements.

    Science.gov (United States)

    Thiel, Gerald; Rössler, Oliver G

    2018-06-05

    The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  6. Cross-talk between signaling pathways can generate robust oscillations in calcium and cAMP.

    Directory of Open Access Journals (Sweden)

    Fernando Siso-Nadal

    Full Text Available BACKGROUND: To control and manipulate cellular signaling, we need to understand cellular strategies for information transfer, integration, and decision-making. A key feature of signal transduction is the generation of only a few intracellular messengers by many extracellular stimuli. METHODOLOGY/PRINCIPAL FINDINGS: Here we model molecular cross-talk between two classic second messengers, cyclic AMP (cAMP and calcium, and show that the dynamical complexity of the response of both messengers increases substantially through their interaction. In our model of a non-excitable cell, both cAMP and calcium concentrations can oscillate. If mutually inhibitory, cross-talk between the two second messengers can increase the range of agonist concentrations for which oscillations occur. If mutually activating, cross-talk decreases the oscillation range, but can generate 'bursting' oscillations of calcium and may enable better filtering of noise. CONCLUSION: We postulate that this increased dynamical complexity allows the cell to encode more information, particularly if both second messengers encode signals. In their native environments, it is unlikely that cells are exposed to one stimulus at a time, and cross-talk may help generate sufficiently complex responses to allow the cell to discriminate between different combinations and concentrations of extracellular agonists.

  7. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  8. Creating a social work link to the burn community: a research team goes to burn camp.

    Science.gov (United States)

    Williams, Nancy R; Reeves, Patricia M; Cox, Ellen R; Call, Serena B

    2004-01-01

    Social work faculty and graduate students conducted focus groups with 52 burn-injured adolescents from three burn camps to explore perceptions of their camp experience. Three themes emerged from data analysis that suggest burn camps play an important role in participants' lives. Camp is a place where burn-injured adolescents: (1) feel "normal" and accepted; (2) acquire insight in regard to self and meaning in life; and (3) gain confidence, increase self-esteem, and develop empathy. This project highlights how the use of qualitative research methods with grassroots organizations such as burn camps can serve as a link to greater social work involvement with this community.

  9. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  10. Transcutaneous electrical nerve stimulation (TENS) improves the diabetic cytopathy (DCP) via up-regulation of CGRP and cAMP.

    Science.gov (United States)

    Ding, Liucheng; Song, Tao; Yi, Chaoran; Huang, Yi; Yu, Wen; Ling, Lin; Dai, Yutian; Wei, Zhongqing

    2013-01-01

    The objective of this study was to investigate the effects and mechanism of Transcutaneous Electrical Nerve Stimulation (TENS) on the diabetic cytopathy (DCP) in the diabetic bladder. A total of 45 rats were randomly divided into diabetes mellitus (DM)/TENS group (n=15), DM group (n=15) and control group (n=15). The rats in the DM/TENS and TENS groups were electronically stimulated (stimulating parameters: intensity-31 V, frequency-31 Hz, and duration of stimulation of 15 min) for three weeks. Bladder histology, urodynamics and contractile responses to field stimulation and carbachol were determined. The expression of calcitonin gene-related peptide (CGRP) was analyzed by RT-PCR and Western blotting. The results showed that contractile responses of the DM rats were ameliorated after 3 weeks of TENS. Furthermore, TENS significantly increased bladder wet weight, volume threshold for micturition and reduced PVR, V% and cAMP content of the bladder. The mRNA and protein levels of CGRP in dorsal root ganglion (DRG) in the DM/TENS group were higher than those in the DM group. TENS also significantly up-regulated the cAMP content in the bladder body and base compared with diabetic rats. We conclude that TENS can significantly improve the urine contractility and ameliorate the feeling of bladder fullness in DM rats possibly via up-regulation of cAMP and CGRP in DRG.

  11. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  12. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  13. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  14. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  15. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  16. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  17. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  18. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  19. From camp to kitsch: A queer eye on console fandom

    Directory of Open Access Journals (Sweden)

    Rob Gallagher

    2014-03-01

    Full Text Available Offering a queer perspective on video game fandom, this article considers the factors that fostered a subculture of Western devotees of Japanese video games in the 1990s. Focused on readers of the English publication Sega Saturn Magazine, it shows how, for these players, Japanese games became the basis of a collective identity founded on precisely the kinds of perverse over-attachment, projective identification and hermeneutic ingenuity that Eve Kosofsky Sedgwick identifies with camp. Citing this subculture as an example of how fans transform the texts they put to use, the article also addresses its implications for our understanding of fandom today, at a time when the proliferation of quantitative analysis techniques is transforming the production and consumption of games. Such techniques, I argue, threaten to compromise the contingency and ambiguity on which camp thrives, instead fostering the kinds of cynical calculation Sedgwick associates with kitsch.

  20. Building Energy Audit Report for Camp Smith, HI

    Energy Technology Data Exchange (ETDEWEB)

    Chvala, William D.; De La Rosa, Marcus I.; Brown, Daryl R.; Dixon, Douglas R.

    2010-09-30

    A detailed energy assessment was performed by a team of engineers from Pacific Northwest National Laboratory (PNNL) under contract to the Department of Energy/Federal Energy Management program (FEMP). The effort used the Facility Energy Decision System (FEDS) model to determine how energy is consumed at Camp Smith, identify the most cost-effective energy retrofit measures, and calculate the potential energy and cost savings. This report documents the results of that assessment.

  1. Assessment of DoD Wounded Warrior Matters -- Camp Lejeune

    Science.gov (United States)

    2012-03-30

    wheelchairs, oxygen equipment, crutches , hospital beds, patient lifts, power scooters and nebulizers. The Naval Hospital Camp Lejeune’s lead MCM...on paper , it looked much different than the picture he had in his mind. Our interviews with Platoon Leaders reveal that they did not have an...noted that in the past year the MTF had used over 1.5 million sheets of paper processing paper work for medical boards. The current PEB backlog was

  2. Planning and Executing the Neurosurgery Boot Camp: The Bolivia Experience.

    Science.gov (United States)

    Ament, Jared D; Kim, Timothy; Gold-Markel, Judah; Germano, Isabelle M; Dempsey, Robert; Weaver, John P; DiPatri, Arthur J; Andrews, Russell J; Sanchez, Mary; Hinojosa, Juan; Moser, Richard P; Glick, Roberta

    2017-08-01

    The neurosurgical boot camp has been fully incorporated into U.S. postgraduate education. This is the first implementation of the neurosurgical boot in a developing country. To advance neurosurgical education, we developed a similar boot camp program, in collaboration with Bolivian neurosurgeons, to determine its feasibility and effectiveness in an international setting. In a collective effort, the Bolivian Society for Neurosurgery, Foundation for International Education in Neurological Surgery, Solidarity Bridge, and University of Massachusetts organized and executed the first South American neurosurgical boot camp in Bolivia in 2015. Both U.S. and Bolivian faculty led didactic lectures followed by a practicum day using mannequins and simulators. South American residents and faculty were surveyed after the course to determine levels of enthusiasm and their perceived improvement in fund of knowledge and course effectiveness. Twenty-four neurosurgery residents from 5 South American countries participated. Average survey scores ranged between 4.2 and 4.9 out of 5. Five Bolivian neurosurgeons completed the survey with average scores of 4.5-5. This event allowed for Bolivian leaders in the field to unify around education, resulting in the formation of an institute to continue similar initiatives. Total cost was estimated at $40 000 USD; however, significant faculty, industry, and donor support helped offset this amount. The first South American neurosurgical boot camp had significant value and was well received in Bolivia. This humanitarian model provides a sustainable solution to education needs and should be expanded to other regions as a means for standardizing the core competencies in neurosurgery. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Smart and Green Energy (SAGE) for Base Camps Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Engels, Matthias; Boyd, Paul A.; Koehler, Theresa M.; Goel, Supriya; Sisk, Daniel R.; Hatley, Darrel D.; Mendon, Vrushali V.; Hail, John C.

    2014-02-11

    The U.S. Army Logistics Innovation Agency’s (LIA’s) Smart and Green Energy (SAGE) for Base Camps project was to investigate how base camps’ fuel consumption can be reduced by 30% to 60% using commercial off-the-shelf (COTS) technologies for power generation, renewables, and energy efficient building systems. Field tests and calibrated energy models successfully demonstrated that the fuel reductions are achievable.

  4. The Promotion of HAMK Winter and Summer Camps: Case China

    OpenAIRE

    Lin, Yulu

    2017-01-01

    The main purpose of this thesis is to promote HAMK winter and summer camps in China and maintain its competitive advantages by figuring out more effective marketing activities to attract students. The theories used to support and give references to this thesis were based on the research and studies from Philip Kotler, Kevin Keller and Armstrong. Some marketing related books such as Principles of Marketing or Marketing Management proved to be professional sources and explanations for conce...

  5. CORRECTIVE SURGERY IN CONGENITAL TALIPES EQUINOVARUS DEFORMITY: A CAMP APPROACH

    Directory of Open Access Journals (Sweden)

    Antony R.

    2015-09-01

    Full Text Available The study was intended to assess the results of soft tissue release and bony corrective surgery in patients of moderate to severe deformed rigid club foot (CTEV and neglected clubfoot (CTEV at free disabled surgical camps at Chhattisgarh state . MATERIAL AND METHODS : In our study 50 patients were included with 70% male and 30% female with 4 - 16 years of age grou p and 70% unilateral and 30% bilateral foot involvement. Patients were admitted and operated in different free disabled surgical camps at Chhattisgarh state over the period of 36 months (1 may 2004 to 30 th April 2007. Improvement in functional ability and locomotion of all operated patients were assessed by physical and clinical examination. RESULTS : All patients who were operated in our study showed significant improvement in functional ability and locomotion after surgery. All patients were maintaining f unctional ability at follow up duration of 12 months (1 year. 75% patients were walking normally, 10% cases were walking with internal rotation of leg and 5% cases were walking with midtarsal varus foot with AFO with medial bar support. CONCLUSION : Our st udy showed and established that excellent results can be obtained in congenital talipes equinovarus (CTEV patients by soft tissue release with bony corrective surgery. The team work of devoted surgeons, paramedical and rehabilitation staff in whole durati on of camps to achieve the goal. With an aim to help more number of CTEV cases by surgery, our team has started doing surgeries in small institutions, and organize charity camps to help poor patients and mankind even in small clinics

  6. MIDSUMMER IN TOP CAMPING YYTERI - A CUSTOMER SATISFACTION SURVEY

    OpenAIRE

    Iisakkala, Riikka

    2014-01-01

    Nowadays camping is a popular way to spend holidays, because the accommodation possibilities are cheap. There are different types campsites, like sports campsites, religious campsites and nature campsites. What makes them so popular is that idea of the campsites are the same in all over the world, so people knows what to get when they come to Finland and use the campsites. Customer satisfaction and quality of a campsite are key words to every campsite. If the customer leaves a campsi...

  7. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  8. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  9. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  10. Outbreak of chickenpox in a refugee camp of northern Thailand

    Directory of Open Access Journals (Sweden)

    Camélique Olivier

    2010-02-01

    Full Text Available Abstract Although chickenpox is a generally mild, self-limited illness of children, it can cause fatal disease in adults. Accumulating reports from tropical countries showed a high prevalence of seronegativity among the adults, implying that varicella diseases could become a heavy burden in tropical countries. However, in the situation of humanitarian emergencies in tropical areas, chickenpox has largely been ignored as a serious communicable disease, due to lack of data regarding varicella mortality and hospital admissions in such a context. This is the first report describing an outbreak of chickenpox in a refugee camp of tropical region. In 2008, we experienced a varicella outbreak in ethnic Lao Hmong refugee camp in Phetchabun Province, northern Thailand. The attack rate was 4.0% (309/7,815 and this caused 3 hospitalizations including one who developed severe varicella pneumonia with respiratory failure. All hospitalizations were exclusively seen in adults, and the proportion of patients ≥15 years old was 13.6% (42/309. Because less exposure to varicella-zoster virus due to low population density has previously been suggested to be one of the reasons behind higher prevalence of susceptible adults in tropics, the influx of displaced people from rural areas to a densely populated asylum might result in many severe adult cases once a varicella outbreak occurs. Control interventions such as vaccination should be considered even in refugee camp, if the confluence of the risk factors present in this situation.

  11. Effectiveness of mammography boot camp for radiology residents

    International Nuclear Information System (INIS)

    Kim, Keum Won; Kim, Young Joong; Seo, Jae Young

    2017-01-01

    To evaluate an educational effect of the mammography boot camp (MBC) for radiology residents and analyze affecting factors. Between December 2014 and February 2015, radiology residents in 16 institutions performed the MBC program. We compared the educational effect (score difference between pre- and post-camp test) using 25 case series and analyzed the affecting factors including institution, grades of residents, training periods, presence of sub-specialized breast staff, breast density, and types of cases. The mean scores of 92 residents were 52.80 ± 18.10 and 72.50 ± 12.91 in the pre- and post-camp test, respectively (p = 0.001). There was no significant difference of educational effect according to institution (19.70 ± 16.31), grade, or training period. Although the educational effect of non-trainees was superior to that of trainees (28.10 ± 17.55 vs. 15.90 ± 14.22; p = 0.001), the scores of trainees were higher than those of non-trainees. The diagnostic accuracy showed more improvement in a fatty breast and cases with microcalcifications than compared with others. The MBC showed an effective educational result for radiology residents when interpretating a mammography. It was helpful even for non-trainees. The institution, grades training period, and presence of sub-specialized breast staff did not affect the educational effect

  12. Effectiveness of mammography boot camp for radiology residents

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Keum Won; Kim, Young Joong; Seo, Jae Young [Dept. of Radiology, Konyang University Hospital, Daejeon (Korea, Republic of); and others

    2017-01-15

    To evaluate an educational effect of the mammography boot camp (MBC) for radiology residents and analyze affecting factors. Between December 2014 and February 2015, radiology residents in 16 institutions performed the MBC program. We compared the educational effect (score difference between pre- and post-camp test) using 25 case series and analyzed the affecting factors including institution, grades of residents, training periods, presence of sub-specialized breast staff, breast density, and types of cases. The mean scores of 92 residents were 52.80 ± 18.10 and 72.50 ± 12.91 in the pre- and post-camp test, respectively (p = 0.001). There was no significant difference of educational effect according to institution (19.70 ± 16.31), grade, or training period. Although the educational effect of non-trainees was superior to that of trainees (28.10 ± 17.55 vs. 15.90 ± 14.22; p = 0.001), the scores of trainees were higher than those of non-trainees. The diagnostic accuracy showed more improvement in a fatty breast and cases with microcalcifications than compared with others. The MBC showed an effective educational result for radiology residents when interpretating a mammography. It was helpful even for non-trainees. The institution, grades training period, and presence of sub-specialized breast staff did not affect the educational effect.

  13. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  14. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  15. Developing Social Skills of Summer Campers with Autism Spectrum Disorder: A Case Study of Camps on TRACKS Implementation in an Inclusive Day-Camp Setting

    Science.gov (United States)

    Maich, Kimberly; Hall, Carmen L.; van Rhijn, Tricia Marie; Quinlan, Laurie

    2015-01-01

    This research provides preliminary results of an exploratory case study conducted of the Camps on TRACKS program in an inclusive, municipal day-camp program in southwestern Ontario, Canada. Positive changes are demonstrated in the social skills of nine day campers with an autism spectrum disorder (ASD) who participated in the program. In this…

  16. The Effect of a Disability Camp Program on Attitudes towards the Inclusion of Children with Disabilities in a Summer Sport and Leisure Activity Camp

    Science.gov (United States)

    Papaioannou, Christina; Evaggelinou, Christina

    2014-01-01

    The aim of the present study was to examine the impact of a specific Disability Camp Program (DCP) in the attitudes of children without disabilities toward the inclusion of children with disabilities in a summer sport and leisure activity camp. Three hundred eighty-seven campers without disabilities participated in the study and were divided into…

  17. Exchange Protein Directly Activated by cAMP (epac) : A Multidomain cAMP Mediator in the Regulation of Diverse Biological Functions

    NARCIS (Netherlands)

    Schmidt, Martina; Dekker, Frank J.; Maarsingh, Harm

    Since the discovery nearly 60 years ago, cAMP is envisioned as one of the most universal and versatile second messengers. The tremendous feature of cAMP to tightly control highly diverse physiologic processes, including calcium homeostasis, metabolism, secretion, muscle contraction, cell fate, and

  18. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    International Nuclear Information System (INIS)

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  19. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  20. Impact of pediatric burn camps on participants' self esteem and body image: an empirical study.

    Science.gov (United States)

    Bakker, Anne; Van der Heijden, Peter G M; Van Son, Maarten J M; Van de Schoot, Rens; Van Loey, Nancy E E

    2011-12-01

    This study focuses on possible effects of specialized summer camps on young burn survivors' self esteem and body image. Quantitative as well as qualitative measures was used. To study possible effects, a pretest-posttest comparison group design with a follow-up was employed. Self-report questionnaires were used to measure self esteem and body image in a burn camp group (n=83, 8-18 years) and in a comparison group of children with burns who did not attend a burn camp during the course of the study (n=90, 8-18 years). Additionally, burn camp participants and parents completed an evaluation form about benefits derived from burn camp. A small positive short-term effect of burn camp participation was found on the 'satisfaction with appearance' component of body image. Overall, participants and parents showed high appreciation of the burn camps and reported several benefits, particularly concerning meeting other young burn survivors. Albeit statistically modest, this is the first quantitative study to document on a significant short-term impact of burn camp on young burn survivors' body image. Implications of this result for future research and burn camp organization were discussed, including the strengths of residential camps for young burn survivors. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  1. Chlorella intake attenuates reduced salivary SIgA secretion in kendo training camp participants

    Directory of Open Access Journals (Sweden)

    Otsuki Takeshi

    2012-12-01

    Full Text Available Abstract Background The green alga Chlorella contains high levels of proteins, vitamins, and minerals. We previously reported that a chlorella-derived multicomponent supplement increased the secretion rate of salivary secretory immunoglobulin A (SIgA in humans. Here, we investigated whether intake of this chlorella-derived supplement attenuated the reduced salivary SIgA secretion rate during a kendo training camp. Methods Ten female kendo athletes participated in inter-university 6-day spring and 4-day summer camps. They were randomized into two groups; one took placebo tablets during the spring camp and chlorella tablets during the summer camp, while the other took chlorella tablets during the spring camp and placebo tablets during the summer camp. Subjects took these tablets starting 4 weeks before the camp until post-camp saliva sampling. Salivary SIgA concentrations were measured by ELISA. Results All subjects participated in nearly all training programs, and body-mass changes and subjective physical well-being scores during the camps were comparable between the groups. However, salivary SIgA secretion rate changes were different between these groups. Salivary SIgA secretion rates decreased during the camp in the placebo group (before vs. second, middle, and final day of camp, and after the camp: 146 ± 89 vs. 87 ± 56, 70 ± 45, 94 ± 58, and 116 ± 71 μg/min, whereas no such decreases were observed in the chlorella group (121 ± 53 vs. 113 ± 68, 98 ± 69,115 ± 80, and 128 ± 59 μg/min. Conclusion Our results suggest that a use of a chlorella-derived dietary supplement attenuates reduced salivary SIgA secretion during a training camp for a competitive sport.

  2. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  3. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  4. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  5. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  6. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  7. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  8. Health-related quality of life of Palestinian refugees inside and outside camps in Jordan.

    Science.gov (United States)

    Alduraidi, Hamza; Waters, Catherine M

    Jordan hosts more Palestinian refugees than any country in the world. Conditions under which people in a community live influence their health-related quality of life (HRQOL). The purpose of this descriptive comparative cross-sectional study was to compare HRQOL of Palestinian refugees in Jordan who live inside camps with those who live outside camps. Participants, recruited from inside the Baqa'a camp (n = 86) and the surrounding Abu Nsair community (n = 91), completed the World Health Organization Quality of Life Brief questionnaire. There were disparities in education and social relations and environment HRQOL related to income and residency, but not gender, among refugees. Refugees living inside camps, particularly if poorer, fared worse than refugees living outside camps. Enhanced programs and policies may be needed to improve HRQOL, education, and socioeconomics for camp refugees. Nursing's perspective on refugee health could make an important contribution to humanitarian efforts and health diplomacy. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. cAMP biosensors applied in molecular pharmacological studies of G protein-coupled receptors

    DEFF Research Database (Denmark)

    Mathiesen, Jesper Mosolff; Vedel, Line; Bräuner-Osborne, Hans

    2013-01-01

    end-point assays for quantifying GPCR-mediated changes in intracellular cAMP levels exist. More recently, fluorescence resonance energy transfer (FRET)-based cAMP biosensors that can quantify intracellular cAMP levels in real time have been developed. These FRET-based cAMP biosensors have been used...... primarily in single cell FRET microscopy to monitor and visualize changes in cAMP upon GPCR activation. Here, a similar cAMP biosensor with a more efficient mCerulean/mCitrine FRET pair is described for use in the 384-well plate format. After cloning and expression in HEK293 cells, the biosensor...... is characterized in the 384-well plate format and used for measuring the signaling of the G(s)-coupled ß(2)-adrenergic receptor. The procedures described may be applied for other FRET-based biosensors in terms of characterization and conversion to the 384-well plate format....

  10. How Women Work: The Symbolic and Material Reproduction of Migrant Labor Camps in United States Agribusiness

    Directory of Open Access Journals (Sweden)

    Robert CARLEY

    2011-05-01

    Full Text Available This article analyzes gender exploitation in Mexican and Central American migrant farm worker camps in the U.S through small group interactions. We describe how gender exploitation and oppression is transmitted through the social fabric of the camp. We argue that the camp produces an endogenous system of social interaction, which maintains uneven gender relationships. Our data is based on observations of twenty-five women and girls in three labor camps in North Carolina. Research was conducted over a period of six weeks. We found that women who served as the primary bearers of patrimonial authority best maintained the camp community. We conclude that women who successfully reproduce the authority structure gain social status in the camps and are more likely to stay.

  11. Differences in HIV-related behaviors at Lugufu refugee camp and surrounding host villages, Tanzania

    Directory of Open Access Journals (Sweden)

    Mbaruku Godfrey

    2008-10-01

    a protective factor. Most respondents knew where to go for HIV testing (84% of refugee respondents and 78% of respondents in surrounding villages, while more refugees than respondents from villages had ever been tested (42% vs. 22%, χ2 63.69, p = .000. Conclusion This research has important programmatic implications. Regardless of differences between camp and village populations, study results point to the need for targeted activities within each population. Services should include youth education and life skills programs emphasizing the benefits of delayed sexual initiation and the risks involved in transactional sex, especially in the camp where greater proportions of youth are affected by these issues relative to the surrounding host villages. As well, programs should stress the importance of correct and consistent condom use to increase usage in both populations. Further investigation into forced sex within regular partnerships, and programs that encourage male involvement in addressing this issue are needed. Program managers should verify that current commodity distribution systems ensure vulnerable women's access to resources, and consider additional program responses.

  12. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  13. The accidental city : violence, economy and humanitarianism in Kakuma refugee camp Kenya

    OpenAIRE

    Jansen, B.J.

    2011-01-01

    In this research I examine social ordering processes in Kakuma refugee camp in Kenya. I view the camp as an accidental city, by which I challenge the image of the camp as a temporary and artificial waiting space or a protracted refugee crisis per se. The reference to the city is both metaphorically and physically relevant. First, the metaphorical dimension of the city places refugees and their negotiation of space into the realm of the normal and the possible, contrary to prevailing not...

  14. Preparing for the primary care clinic: an ambulatory boot camp for internal medicine interns

    Science.gov (United States)

    Esch, Lindsay M.; Bird, Amber-Nicole; Oyler, Julie L.; Lee, Wei Wei; Shah, Sachin D.; Pincavage, Amber T.

    2015-01-01

    Introduction Internal medicine (IM) interns start continuity clinic with variable ambulatory training. Multiple other specialties have utilized a boot camp style curriculum to improve surgical and procedural skills, but boot camps have not been used to improve interns’ ambulatory knowledge and confidence. The authors implemented and assessed the impact of an intern ambulatory boot camp pilot on primary care knowledge, confidence, and curricular satisfaction. Methods During July 2014, IM interns attended ambulatory boot camp. It included clinically focused case-based didactic sessions on common ambulatory topics as well as orientation to the clinic and electronic medical records. Interns anonymously completed a 15-question pre-test on topics covered in the boot camp as well as an identical post-test after the boot camp. The interns were surveyed regarding their confidence and satisfaction. Results Thirty-eight interns participated in the boot camp. Prior to the boot camp, few interns reported confidence managing common outpatient conditions. The average pre-test knowledge score was 46.3%. The average post-test knowledge score significantly improved to 76.1% (pinterns reported that the boot camp was good preparation for clinics and 97% felt that the boot camp boosted their confidence. Conclusions The ambulatory boot camp pilot improved primary care knowledge, and interns thought it was good preparation for clinic. The ambulatory boot camp was well received and may be an effective way to improve the preparation of interns for primary care clinic. Further assessment of clinical performance and expansion to other programs and specialties should be considered. PMID:26609962

  15. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  16. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  17. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    International Nuclear Information System (INIS)

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  18. Opening communication channels with people living with HIV using mobile phone text messaging: insights from the CAMPS trial.

    Science.gov (United States)

    Mbuagbaw, Lawrence; Thabane, Lehana; Ongolo-Zogo, Pierre

    2013-04-04

    Using two-way mobile phone text messages to improve adherence to antiretroviral medication enhances communication between patients and health workers. We describe the implications of participants' responses to text messages in the Cameroon Mobile Phone SMS (CAMPS) trial. This is a cross-sectional analysis of data from the intervention arm of the CAMPS trial. CAMPS was a randomized controlled trial of motivational text messaging versus usual care to improve adherence to antiretroviral medication among people living with HIV in Yaounde, Cameroon (n = 200) over a 6 month period. Participants in the intervention arm (n = 101) were given a contact phone number, but were not required to respond to their reminder messages. If they did, their responses were noted and reported as counts and percentages. We received 99 phone calls and 55 text messages (154 responses) from 48 participants during the study period. The median number of responses was 1 (first quartile [Q1]: 1; third quartile [Q3]: 3). Half (n = 79, 51.1%) of them were expressions of gratitude. The rest included requests for logistical (n = 21, 13.6%), medical (n = 20, 12.9%) and financial (n = 11, 7.1%) support. Initiating two-way mobile communication opens more channels for people living with HIV to express unmet needs. Researchers, policy makers and clinicians should be ready to respond to the needs expressed by patients who respond to text messages. Pan-African Clinical Trials Registry: PACTR201011000261458;

  19. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Directory of Open Access Journals (Sweden)

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  20. "cAMP sponge": a buffer for cyclic adenosine 3', 5'-monophosphate.

    Directory of Open Access Journals (Sweden)

    Konstantinos Lefkimmiatis

    Full Text Available BACKGROUND: While intracellular buffers are widely used to study calcium signaling, no such tool exists for the other major second messenger, cyclic AMP (cAMP. METHODS/PRINCIPAL FINDINGS: Here we describe a genetically encoded buffer for cAMP based on the high-affinity cAMP-binding carboxy-terminus of the regulatory subunit RIbeta of protein kinase A (PKA. Addition of targeting sequences permitted localization of this fragment to the extra-nuclear compartment, while tagging with mCherry allowed quantification of its expression at the single cell level. This construct (named "cAMP sponge" was shown to selectively bind cAMP in vitro. Its expression significantly suppressed agonist-induced cAMP signals and the downstream activation of PKA within the cytosol as measured by FRET-based sensors in single living cells. Point mutations in the cAMP-binding domains of the construct rendered the chimera unable to bind cAMP in vitro or in situ. Cyclic AMP sponge was fruitfully applied to examine feedback regulation of gap junction-mediated transfer of cAMP in epithelial cell couplets. CONCLUSIONS: This newest member of the cAMP toolbox has the potential to reveal unique biological functions of cAMP, including insight into the functional significance of compartmentalized signaling events.