WorldWideScience

Sample records for camp response element

  1. Regulation of antidepressant activity by cAMP response element binding proteins.

    Science.gov (United States)

    Conti, Alana C; Blendy, Julie A

    2004-10-01

    Depression is a clinically and biologically heterogeneous disease that is one of the most prevalent and costly psychiatric disorders. It is the leading cause of disability regarding job performance and burden on family members in the United States and worldwide. Although the therapeutic efficacy of antidepressant drugs has been recognized for years, the exact molecular mechanisms of action remain elusive, making the systematic approach to the development of new drugs difficult. The acute increases in levels of monoamines brought about by various classes of antidepressants cannot account for the requirement of repeated, chronic administration for up to 2-6 wk before treatment benefits become evident. Furthermore, despite their efficacy, current antidepressant drugs improve symptoms in only 60% of patients treated. The development of new and better therapies depends on a thorough understanding of the neurobiology of depression and the molecular mechanisms underlying antidepressant drug action. Early studies focusing on alterations in the levels of receptors and second messengers helped define the important signaling pathways initiated by these drugs, whereas recent molecular studies suggested that long-term adaptations in cellular signaling mechanisms may be required for the onset and/or maintenance of antidepressant effects. Attention has now focused on downstream targets of Ca++ and cyclic adenosine monophosphate (cAMP) in the cell, such as the activation of transcription factors. This article discusses the transcription factor cAMP response element binding protein and a related protein, cyclic AMP response element modulator, and their roles as molecular mediators of antidepressant action.

  2. The cAMP pathway in combination with BMP2 regulates Phox2a transcription via cAMP response element binding sites.

    Science.gov (United States)

    Benjanirut, Chutamas; Paris, Maryline; Wang, Wen-Horng; Hong, Seok Jong; Kim, Kwang Soo; Hullinger, Ronald L; Andrisani, Ourania M

    2006-02-03

    Combined BMP2 and cAMP signaling induces the catechola-minergic lineage in neural crest (NC) cultures by increasing expression of the proneural transcription factor Phox2a, in a cAMP response element (CRE)-binding protein (CREB)-mediated mechanism. To determine whether CREB acts directly on Phox2a transcription induced by BMP2+cAMP-elevating agent IBMX, transient transfections of hPhox2a-reporter constructs were performed in avian NC cultures and murine, catecholaminergic CAD cells. Although BMP2+IBMX increased endogenous Phox2a expression, the 7.5-kb hPhox2a reporters expressing either luciferase or DsRed1-E5 fluorescent protein were unresponsive to BMP2+IBMX, but active in both cell types. Cell sorting of fluorescence-positive NC cells expressing the 7.5-kb hPhox2a fluorescent timer reporter differentiated to equal numbers of catecholaminergic cells as fluorescence-negative cells, suggesting inappropriate transcription from the transfected hPhox2a promoter. NC or CAD cells treated with histone deacetylase inhibitor trichostatin A and BMP2+IBMX display increased endogenous Phox2a transcription and prolonged CREB phosphorylation, indicating Phox2a chromatin remodeling is linked to CREB activation. Chromatin immunoprecipitations employing CREB, CREB-binding protein, and acetylated H4 antibodies identified two CRE half-sites at -5.5 kb in the murine Phox2a promoter, which is also conserved in the human promoter. Proximal to the CRE half-sites, within a 170-bp region, are E-box and CCAAT binding sites, also conserved in mouse and human genes. This 170-bp promoter region confers cAMP, BMP2, and enhanced BMP2+cAMP regulation to Phox2a-luciferase reporters. We conclude these CREs are functional, with CREB directly activating Phox2a transcription. Because the E-box binds bHLH proteins like ASH1 induced in NC cells by BMP2, we propose this novel 170-bp cis-acting element is a composite site, mediating the synergistic regulation by BMP2+cAMP on Phox2a transcription.

  3. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  4. The Regulator of Calcineurin 1 (RCAN1/DSCR1) Activates the cAMP Response Element-binding Protein (CREB) Pathway*

    Science.gov (United States)

    Kim, Seon Sook; Seo, Su Ryeon

    2011-01-01

    cAMP response element-binding protein (CREB) is one of the best known transcription factors in the development and function of the nervous system. In this report, we found that the regulator of calcineurin 1 (RCAN1), which is overexpressed in the brain of patients with Down syndrome, increased the phosphorylation of CREB and cAMP response element-mediated gene transcription in response to the activation of the intracellular cAMP pathway. Furthermore, we found that the increased activation of CREB signaling by RCAN1 depended on the ability of RCAN1 to inhibit calcineurin activity. Our data provide the first evidence that RCAN1 acts as an important regulatory component in the control of CREB signaling. PMID:21890628

  5. The regulator of calcineurin 1 (RCAN1/DSCR1) activates the cAMP response element-binding protein (CREB) pathway.

    Science.gov (United States)

    Kim, Seon Sook; Seo, Su Ryeon

    2011-10-28

    cAMP response element-binding protein (CREB) is one of the best known transcription factors in the development and function of the nervous system. In this report, we found that the regulator of calcineurin 1 (RCAN1), which is overexpressed in the brain of patients with Down syndrome, increased the phosphorylation of CREB and cAMP response element-mediated gene transcription in response to the activation of the intracellular cAMP pathway. Furthermore, we found that the increased activation of CREB signaling by RCAN1 depended on the ability of RCAN1 to inhibit calcineurin activity. Our data provide the first evidence that RCAN1 acts as an important regulatory component in the control of CREB signaling.

  6. cAMP response element binding protein is required for differentiation of respiratory epithelium during murine development.

    Directory of Open Access Journals (Sweden)

    A Daniel Bird

    Full Text Available The cAMP response element binding protein 1 (Creb1 transcription factor regulates cellular gene expression in response to elevated levels of intracellular cAMP. Creb1(-/- fetal mice are phenotypically smaller than wildtype littermates, predominantly die in utero and do not survive after birth due to respiratory failure. We have further investigated the respiratory defect of Creb1(-/- fetal mice during development. Lungs of Creb1(-/- fetal mice were pale in colour and smaller than wildtype controls in proportion to their reduced body size. Creb1(-/- lungs also did not mature morphologically beyond E16.5 with little or no expansion of airway luminal spaces, a phenotype also observed with the Creb1(-/- lung on a Crem(-/- genetic background. Creb1 was highly expressed throughout the lung at all stages examined, however activation of Creb1 was detected primarily in distal lung epithelium. Cell differentiation of E17.5 Creb1(-/- lung distal epithelium was analysed by electron microscopy and showed markedly reduced numbers of type-I and type-II alveolar epithelial cells. Furthermore, immunomarkers for specific lineages of proximal epithelium including ciliated, non-ciliated (Clara, and neuroendocrine cells showed delayed onset of expression in the Creb1(-/- lung. Finally, gene expression analyses of the E17.5 Creb1(-/- lung using whole genome microarray and qPCR collectively identified respiratory marker gene profiles and provide potential novel Creb1-regulated genes. Together, these results demonstrate a crucial role for Creb1 activity for the development and differentiation of the conducting and distal lung epithelium.

  7. Creb and Sp/Krüppel response elements cooperate to control rat TRH gene transcription in response to cAMP.

    Science.gov (United States)

    Cote-Vélez, Antonieta; Pérez-Maldonado, Adrián; Osuna, Joel; Barrera, Benito; Charli, Jean-Louis; Joseph-Bravo, Patricia

    2011-03-01

    Expression of hypophysiotropic TRH, that controls thyroid axis activity, is increased by cold exposure; this effect is mimicked in rat hypothalamic cells incubated with norepinephrine or cAMP analogs. TRH proximal promoter contains three putative CRE: Site-4 or CRE-1 that overlaps an element recognized by thyroid hormone receptors, CRE-2 with adjacent sequences GC box or CACCC recognized by Sp/Krüppel factors (extended CRE-2), and AP-1 sites flanking a GRE(1/2). To evaluate the role of each element in the cAMP response, these sites were mutated or deleted in rat TRH promoter linked to luciferase gene (TRH-luc) and co-transfected with β-gal expression vector in various cell lines; C6 cells gave the highest response to forskolin. Basal activity was most affected by mutations or deletion of CRE-2 site, or CACCC (50-75% of wild type-WT). Forskolin-induced 3× stimulation in WT which decreased 25% with CRE-1 or AP-1 deletions, but 50% when CRE-2 or its 5' adjacent GC box was altered. SH-SY5Y cells co-transfected with CREB-expression vector increased dB-cAMP response in the wild type but not in the CRE-2 mutated plasmid; cotransfecting CREB-A (a dominant negative expression vector) strongly diminished basal or cAMP response. Primary cultures of hypothalamic cells transfected with plasmids containing deletions of CRE-1, CRE-2, or extended CRE-2 failed to respond to forskolin when CRE-2 was modified. These results corroborate the CRE-2 site as the main cAMP-response element of rat TRH promoter, not exclusive of transcription factors of hypothalamic cells, and stress the relevance of adjacent Sp-1 sites, important mediators of some metabolic hormones. Published by Elsevier B.V.

  8. Impaired bidirectional synaptic plasticity and procedural memory formation in striatum-specific cAMP response element-binding protein-deficient mice

    OpenAIRE

    Pittenger, Christopher; Fasano, Stefania; Mazzocchi-Jones, David Martin; Dunnett, Stephen Bruce; Kandel, Eric R.; Brambilla, Riccardo

    2006-01-01

    The striatum has a well documented role in procedural learning and memory. However, the synaptic and molecular mechanisms of acquisition and storage of this form of memory remain poorly understood. We examined procedural memory and plasticity in transgenic mice reversibly expressing a dominant-negative cAMP response element-binding protein (CREB) mutant in the dorsal striatum. In these transgenic mice, corticostriatal long-term potentiation and depression are abolished, indicating that CREB f...

  9. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Directory of Open Access Journals (Sweden)

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  10. Alterations in phosphorylated cAMP response element-binding protein (pCREB) signaling: an endophenotype of lithium-responsive bipolar disorder?

    Science.gov (United States)

    Alda, Martin; Shao, Li; Wang, Jun-Feng; Lopez de Lara, Catalina; Jaitovich-Groisman, Iris; Lebel, Veronique; Sun, Xiujun; Duffy, Anne; Grof, Paul; Rouleau, Guy A; Turecki, Gustavo; Young, L Trevor

    2013-12-01

    Abnormalities of signal transduction are considered among the susceptibility factors for bipolar disorder (BD). These include changes in G-protein-mediated signaling and subsequent modification of gene expression via transcription factors such as cAMP response element-binding protein (CREB). We investigated levels of CREB in lymphoblasts from patients with BD, all responders to lithium prophylaxis (n = 13), and healthy control subjects (n = 15). Phosphorylated CREB (pCREB) was measured by immunoblotting in subjects with BD (n = 15) as well as in their affected (n = 17) and unaffected (n = 18) relatives, and healthy controls (n = 16). Basal CREB levels were comparable in patients and control subjects and were not changed by lithium treatment. pCREB levels were increased in both patients and their relatives compared to controls (p = 0.003). Forskolin stimulation led to a 24% increase in pCREB levels in cells from healthy subjects (p = 0.002) but not in the other three groups. When using basal and stimulated pCREB levels as a biochemical phenotype in a preliminary linkage study, we found the strongest support for linkage in regions largely overlapping with those showing linkage with the clinical phenotype (3p, 6p, 16p, 17q, 19q, and 21q). Abnormal pCREB signaling could be considered a biochemical phenotype for lithium-responsive BD. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. cAMP response element-binding protein and Yes-associated protein form a feedback loop that promotes neurite outgrowth.

    Science.gov (United States)

    Chen, Lei; Feng, Peimin; Peng, Anjiao; Qiu, Xiangmiao; Zhu, Xi; He, Shixu; Zhou, Dong

    2017-08-31

    The cAMP response element-binding (CREB) protein is a member of the CREB/activating transcription factor family that is activated by various extracellular stimuli. It has been shown that CREB-dependent transcription stimulation plays a key role in neuronal differentiation and plasticity, but the underlying mechanisms remain largely elusive. Here, we show that Yes-associated protein (YAP) is a direct target induced by CREB upon retinoic acid (RA)-induced neurite outgrowth stimuli in N2a cells. Interestingly, YAP knockout using the CRISPR/Cas9 system inhibits neuronal differentiation and reduced neurite length. We further show that YAP could directly bind to CREB via its N-terminal region, and loss of YAP results in instability of phosphorylated CREB upon neurite outgrowth stimuli. Transient expression of YAP could largely restore CREB expression and neurite outgrowth in YAP knockout cells. Together, our results suggest that CREB and YAP form a positive feedback loop that is critical to maintain the stability of phosphorylated CREB and promote neurite outgrowth. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  12. Erythropoietin activates the phosporylated cAMP [adenosine 3'5' cyclic monophosphate] response element-binding protein pathway and attenuates delayed paraplegia after ischemia-reperfusion injury.

    Science.gov (United States)

    Mares, Joshua M; Foley, Lisa S; Bell, Marshall T; Bennett, Daine T; Freeman, Kirsten A; Meng, Xianzhong; Weyant, Michael J; Cleveland, Joseph C; Fullerton, David A; Puskas, Ferenc; Reece, Thomas Brett

    2015-03-01

    Paraplegia remains a devastating complication of complex aortic surgery. Erythropoietin (EPO) has been shown to prevent paraplegia after ischemia reperfusion, but the protective mechanism remains poorly described in the spinal cord. We hypothesized that EPO induces the CREB (cAMP [adenosine 3'5' cyclic monophosphate] response element-binding protein) pathway and neurotrophin production in the murine spinal cord, attenuating functional and cellular injury. Adult male mice were subjected to 4 minutes of spinal cord ischemia via an aortic and left subclavian cross-clamp. Experimental groups included EPO treatment 4 hours before incision (n = 7), ischemic control (n = 7), and shams (n = 4). Hind-limb function was assessed using the Basso motor score for 48 hours after reperfusion. Spinal cords were harvested and analyzed for neuronal viability using histology and staining with a fluorescein derivative. Expression of phosphorylated (p)AKT (a serine/threonine-specific kinase), pCREB, B-cell lymphoma 2, and brain-derived neurotrophic factor were determined using immunoblotting. By 36 hours of reperfusion, EPO significantly preserved hind-limb function after ischemia-reperfusion injury (P < .01). Histology demonstrated preserved cytoarchitecture in the EPO treatment group. Cords treated with EPO expressed significant increases in pAKT (P = .021) and pCREB (P = .038). Treatment with EPO induced expression of both of the neurotrophins, B-cell lymphoma 2, and brain-derived neurotrophic factor, beginning at 12 hours. Erythropoietin-mediated induction of the CREB pathway and production of neurotrophins is associated with improved neurologic function and increased neuronal viability following spinal cord ischemia reperfusion. Further elucidation of EPO-derived neuroprotection will allow for expansion of adjunct mechanisms for spinal cord protection in high-risk thoracoabdominal aortic intervention. Copyright © 2015 The American Association for Thoracic Surgery. Published by

  13. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    Science.gov (United States)

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in…

  14. Extracellular receptor kinase and cAMP response element binding protein activation in the neonatal rat heart after perinatal cocaine exposure.

    Science.gov (United States)

    Sun, Lena S; Quamina, Aaron

    2004-12-01

    Prenatal exposure to cocaine has been shown to induce an increase in the myocardial expression and activation of the cAMP response binding protein (CREB), a transcriptional factor that has been shown to regulate gene expression. Several different kinases, including protein kinase A, calcium calmodulin kinase II, and mitogen-activated protein kinase can induce phosphorylation of CREB at serine 133, a necessary step for CREB activation. We examined whether the mitogen-activated protein kinase-extracellular receptor kinase (ERK) pathway may be involved in mediating the serine 133 CREB phosphorylation in cardiac nuclei after perinatal cocaine exposure. Pregnant rats were treated daily with saline or cocaine at 60 mg/kg (C60) by intragastric administration during the entire gestational period, and treatment was continued in the nursing dams after delivery until the time of the study. Nuclear extracts were isolated from hearts of 1-d- and 7-d-old neonatal rats. We performed immunoblotting experiments using an antibody that recognized CREB with phosphorylation specifically at the serine 133 site and an antibody that recognized both the phosphorylated and the unphosphorylated forms of CREB, as well as antibodies for total ERK, phospho-ERK, total ribosomal S6 kinase 1 (RSK1), RSK2, and phospho-RSK. We assessed the interaction of RSK with CREB or CREB-binding protein by performing co-immunoprecipitation experiments. We found that perinatal cocaine exposure increased both phospho-ERK and phospho-RSK expression, indicative of an increased activity of these two enzymes. Furthermore, we demonstrated that phospho-RSK was immunoprecipitated with CREB in all neonatal cardiac nuclei and that the greatest interaction was found in day 7 hearts after perinatal cocaine exposure. Our results thus illustrate that the ERK-RSK pathway was active in the postnatal rat heart at 1 and 7 d of age and that this pathway may mediate the increase in myocardial CREB activation after perinatal cocaine

  15. Transcriptional control of adrenal steroidogenesis: novel connection between Janus kinase (JAK) 2 protein and protein kinase A (PKA) through stabilization of cAMP response element-binding protein (CREB) transcription factor.

    Science.gov (United States)

    Lefrancois-Martinez, Anne-Marie; Blondet-Trichard, Antonine; Binart, Nadine; Val, Pierre; Chambon, Céline; Sahut-Barnola, Isabelle; Pointud, Jean-Christophe; Martinez, Antoine

    2011-09-23

    In the adrenal gland, adrenocorticotropin (ACTH) acting through the cAMP protein kinase (PKA) transduction pathway is the main regulator of genes involved in glucocorticoid synthesis. The prolactin (PRL) receptor is expressed in the adrenal cortex of most mammals, but experimental proof that PRL ensures direct control on glucocorticoid synthesis in rodents remains elusive. To unravel the physiological importance of PRL in adrenocortical functions, we measured steroidogenic capacity of Prlr-deficient mice (Prlr(-/-)) and explored the influence of JAK/STAT signaling, the major PRL transduction pathway, on the steroidogenic activity of adrenocortical cell cultures. We demonstrate that lack of Prlr does not affect basal (nor stress-induced) corticosterone levels in mice. PRL triggers JAK2/STAT5-dependent transcription in adrenal cells, but this does not influence corticosterone release. In contrast, pharmacological or siRNA-mediated inhibition of JAK2 reveals its essential role in both basal and ACTH/cAMP-induced steroidogenesis. We demonstrate that nuclear JAK2 regulates the amount of active transcription factor CREB (cAMP response element-binding protein) through tyrosine phosphorylation and prevention of proteasomal degradation, which in turn leads to transcriptional activation of the rate-limiting steroidogenic Star gene. Hence, we describe a novel link between PKA and JAK2 by which nuclear JAK2 signaling controls adrenal steroidogenesis by increasing the stability of CREB.

  16. The Steroid Hormone 20-Hydroxyecdysone Enhances Gene Transcription through the cAMP Response Element-binding Protein (CREB) Signaling Pathway*

    OpenAIRE

    Jing, Yu-Pu; Wang, Di; Han, Xiao-Lin; Dong, Du-Juan; Wang, Jin-Xing; Zhao, Xiao-Fan

    2016-01-01

    Animal steroid hormones regulate gene transcription through genomic pathways by binding to nuclear receptors. These steroid hormones also rapidly increase intracellular calcium and cyclic adenosine monophosphate (cAMP) levels and activate the protein kinase C (PKC) and protein kinase A (PKA) nongenomic pathways. However, the function and mechanism of the nongenomic pathways of the steroid hormones are unclear, and the relationship between the PKC and PKA pathways is also unclear. We propose t...

  17. Glial-specific cAMP response of the glial fibrillary acidic protein gene cell lines.

    OpenAIRE

    Kaneko, R; Hagiwara, N; Leader, K; Sueoka, N

    1994-01-01

    Expression of the rat glial fibrillary acidic protein (GFAP) gene is responsive to the intracellular level of cAMP. We have examined the sequence 5'-upstream of the transcription start site of the rat GFAP-encoding gene to determine the elements responsible for regulating the cAMP response. The RT4 cell lines consist of a neural stem-cell type RT4-AC and its three derivative cell types, one glial-cell type, RT4-D, and two neuronal-cell types, RT4-B and RT4-E. GFAP is expressed in the stem-cel...

  18. Insulin-like growth factor-1 (IGF-1 induces the activation/phosphorylation of Akt kinase and cAMP response element-binding protein (CREB by activating different signaling pathways in PC12 cells

    Directory of Open Access Journals (Sweden)

    Zheng Wen-Hua

    2006-06-01

    Full Text Available Abstract Background Insulin-like growth factor-1 (IGF-1 is a polypeptide growth factor with a variety of functions in both neuronal and non-neuronal cells. IGF-1 plays anti-apoptotic and other functions by activating multiple signaling pathways including Akt kinase, a serine/threonine kinase essential for cell survival. The nuclear transcription factor cAMP response element-binding protein (CREB may also be involved although relationships between these two proteins in IGF-1 receptor signaling and protection is not clear, especially in neuronal cells. Results IGF-1, in a concentration- and time-dependent manner, induces the activation/phosphorylation of Akt and CREB in PC12 cells by activating different signaling pathways. IGF-1 induced a sustained phosphorylation of Akt while only a transient one was seen for CREB. The phosphorylation of Akt is mediated by the PI3 kinase pathway while that of CREB is dependent on the activation of both MAPK kinase and p38 MAPK. Moreover, the stimulation of PKC attenuated the phosphorylation of Akt induced by IGF-1 while enhancing that of CREB. Survival assays with various kinase inhibitors suggested that the activation/phosphorylation of both Akt and CREB contributes to IGF-1 mediated cell survival in PC12 cells. Conclusion These data suggest that IGF-1 induced the activation of Akt and CREB using distinct pathways in PC12 cells.

  19. Snakes Have Feelings, Too: Elements of a Camp Snake Program.

    Science.gov (United States)

    Allen, Robert Ross

    2001-01-01

    A camp snake program can help campers overcome their fear of snakes, and people cannot truly enjoy nature when they carry a phobia about any one part of it. It can also help overcome prejudice by teaching truth and respect, instilling compassion, and helping campers develop empathy. Advice on catching, handling, identifying, keeping, and feeding…

  20. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    Science.gov (United States)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  1. Endogenous 5-HT2C Receptors Phosphorylate the cAMP Response Element Binding Protein via Protein Kinase C-Promoted Activation of Extracellular-Regulated Kinases-1/2 in Hypothalamic mHypoA-2/10 Cells.

    Science.gov (United States)

    Lauffer, Lisa; Glas, Evi; Gudermann, Thomas; Breit, Andreas

    2016-07-01

    Serotonin 5-HT2C receptors (5-HT2CR) activate Gq proteins and are expressed in the central nervous system (CNS). 5-HT2CR regulate emotion, feeding, reward, or cognition and may serve as promising drug targets to treat psychiatric disorders or obesity. Owing to technical difficulties in isolating cells from the CNS and the lack of suitable cell lines endogenously expressing 5-HT2CR, our knowledge about this receptor subtype in native environments is rather limited. The hypothalamic mHypoA-2/10 cell line was recently established and resembles appetite-regulating hypothalamic neurons of the paraventricular nucleus (PVN), where 5-HT2CR have been detected in vivo. Therefore, we tested mHypoA-2/10 cells for endogenous 5-HT2CR expression. Serotonin or the 5-HT2CR preferential agonist WAY-161,503 initiated cAMP response element (CRE)-dependent gene transcription with EC50 values of 15.5 ± 9.8 and 1.1 ± 0.9 nM, respectively. Both responses were blocked by two unrelated 5-HT2CR-selective antagonists (SB-242,084, RS-102,221) but not by a 5-HT2AR (EMD-281,014) or 5-HT2BR (RS-127,455) antagonists. By single-cell calcium imaging, we found that serotonin and WAY-161,503 induced robust calcium transients, which were also blunted by both 5-HT2CR antagonists. Additionally we revealed, first, that 5-HT2CR induced CRE activation via protein kinase C (PKC)-mediated engagement of extracellular-regulated kinases-1/2 and, second, that intrinsic activity of WAY-161,503 was in the range of 0.3-0.5 compared with serotonin, defining the frequently used 5-HT2CR agonist as a partial agonist of endogenous 5-HT2CR. In conclusion, we have shown that hypothalamic mHypoA-2/10 cells endogenously express 5-HT2CR and thus are the first cell line in which to analyze 5-HT2CR pharmacology, signaling, and regulation in its natural environment. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  2. Senescence responsive transcriptional element

    Science.gov (United States)

    Campisi, Judith; Testori, Alessandro

    1999-01-01

    Recombinant polynucleotides have expression control sequences that have a senescence responsive element and a minimal promoter, and which are operatively linked to a heterologous nucleotide sequence. The molecules are useful for achieving high levels of expression of genes in senescent cells. Methods of inhibiting expression of genes in senescent cells also are provided.

  3. Short Communication: Vegetation response to wagon wheel camp ...

    African Journals Online (AJOL)

    Wagon wheel camp layouts have been favoured, in some quarters, for rotational grazing due to the economy and convenience of having the camps radially arranged around central facilities. A possible disadvantage of such layouts is the tendency for over-grazing near the hub and under-grazing at the extremities.

  4. Proteomic signatures implicate cAMP in light and temperature responses in Arabidopsis thaliana

    KAUST Repository

    Thomas, Ludivine

    2013-05-01

    The second messenger 3\\'-5\\'-cyclic adenosine monophosphate (cAMP) and adenylyl cyclases (ACs), enzymes that catalyse the formation of cAMP from ATP, are increasingly recognized as important signaling molecules in a number of physiological responses in higher plants. Here we used proteomics to identify cAMP-dependent protein signatures in Arabidopsis thaliana and identify a number of differentially expressed proteins with a role in light- and temperature-dependent responses, notably photosystem II subunit P-1, plasma membrane associated cation-binding protein and chaperonin 60 β. Based on these proteomics results we conclude that, much like in cyanobacteria, algae and fungi, cAMP may have a role in light signaling and the regulation of photosynthesis as well as responses to temperature and we speculate that ACs could act as light and/or temperature sensors in higher plants. Biological significance: This current study is significant since it presents the first proteomic response to cAMP, a novel and key second messenger in plants. It will be relevant to researchers in plant physiology and in particular those with an interest in second messengers and their role in biotic and abiotic stress responses. © 2013 Elsevier B.V.

  5. Relationship between Adaptation of the Folic Acid and the cAMP Mediated cGMP Response in Dictyostelium

    NARCIS (Netherlands)

    Haastert, Peter J.M. van

    1983-01-01

    Chemotactic stimulation of post-vegetative Dictyostelium cells with folic acid or aggregative cells with cAMP results in a fast transient cGMP response which peaks at 10 s; basal levels are recovered in about 30-40 s. Stimulation with folic acid or cAMP rapidly desensitizes the cells for equal or

  6. Components of Camp Experiences for Positive Youth Development

    Directory of Open Access Journals (Sweden)

    Karla A. Henderson

    2007-03-01

    Full Text Available Youth development specialists advocate that well designed, implemented, and staffed youth centered programs result in positive outcomes for young people. Youth organizations have provided opportunities for young people to participate in camping experiences for over a century. The purpose of this paper is to describe what program components were related to camp environments and positive youth development. We describe these program components related to positive youth development based on a large scale national study of ACA (American Camp Association accredited camps that included independent, religiously affiliated, government, and not-for-profit organizations. Based on the responses given by camp directors, contact and leadership from trained staff and the supportive relationships they provided were essential elements of camp. Other aspects leading to positive youth development in camps were program mission and structure along with elements of accountability, assessment of outcomes, and opportunities for skill building.

  7. Examining Youth Camping Outcomes Across Multiple States: the National 4-H Camping Research Consortium (NCRC

    Directory of Open Access Journals (Sweden)

    Barry Garst

    2011-03-01

    Full Text Available The impact of residential camp participation is needed for camps focused on a variety of outcomes including education, summer fun, prevention, and youth development. One system, the Cooperative Extension Service, conducts 4-H residential camps in most states nationwide every year. These camps, though offering educational enhancement and fun activities, are focused on youth development, incorporating a framework called the essential elements of positive youth development. The National 4-H Camping Research Consortium (NCRC, a group of Extension specialists and county-level educators, designed and piloted assessment tools for 4-H camps that can be used at any camp that focuses on youth development. The camp context questionnaire measures three essential elements of youth development: relationship with a caring adult, self-determination and mastery, and safe and inclusive environments. The life skill questionnaire measures three life skills: accepting self and others, accomplishing goals, and taking responsibility. Logic models and evaluation guidelines help camp directors plan camps that work for youth.

  8. Physiological and performance responses to a training camp in the heat in professional Australian football players.

    Science.gov (United States)

    Racinais, Sebastien; Buchheit, Martin; Bilsborough, Johann; Bourdon, Pitre C; Cordy, Justin; Coutts, Aaron J

    2014-07-01

    To examine the physiological and performance responses to a heat-acclimatization camp in highly trained professional team-sport athletes. Eighteen male Australian Rules Football players trained for 2 wk in hot ambient conditions (31-33°C, humidity 34-50%). Players performed a laboratory-based heat-response test (24-min walk + 24 min seated; 44°C), a YoYo Intermittent Recovery Level 2 Test (YoYoIR2; indoor, temperate environment, 23°C) and standardized training drills (STD; outdoor, hot environment, 32°C) at the beginning and end of the camp. The heat-response test showed partial heat acclimatization (eg, a decrease in skin temperature, heart rate, and sweat sodium concentration, P test (r = -.52, 90%CI [-.77; -.12]). There was no clear correlation between the performance improvements in temperate and hot ambient conditions (r < .26). Running performance in both hot and temperate environments was improved after a football training camp in hot ambient conditions that stimulated heat acclimatization. However, physiological and performance responses were highly individual, and the absence of correlations between physical-performance improvements in hot and temperate environments suggests that their physiological basis might differ.

  9. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per; Andresen, Inger; Perino, Marco

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...... with technologies that promote the integration of responsive building elements and building services in integrated building concepts. In order to address some of these issues an international research effort, IEA-ECBCS Annex 44 has been initiated. The paper especially presents the annex activities regarding...

  10. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    There is a global need for a more sustainable building development. About 50% of energy is used in buildings indicating that buildings provide a considerable potential for operational energy savings. Studies were conducted with the following objectives: to perform a state-of-the-art review...... of responsive building elements, of integrated building concepts and of environmental performance assessment methods to improve and optimize responsive building elements to develop and optimize new building concepts with integration of responsive building elements, HVAC-systems as well as natural and renewable...... energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  11. Can packaging elements elicit consumers’ emotional responses?

    DEFF Research Database (Denmark)

    Liao, Lewis; Corsi, Armando; Lockshin, Larry

    Emotion has been an important concept in many areas of consumer research such as judgment, decision-making and advertising. Little research has been done on emotion in packaging adopting the physiological measures used in other areas. This paper draws on past studies in advertising that measure...... emotional responses toward image, colour and font, and apply them to packaging research. The study tests the extent at which packaging can elicit consumers’ spontaneous emotional response for each of those three elements, by using skin conductance, facial electromyography (EMG) and selfassessment scales....... The results show that packaging can elicit an emotional response via different elements. The paper also raises concerns about the accuracy of using selfreport measures of emotional responses to packaging research....

  12. Increases in cAMP, MAPK Activity and CREB Phosphorylation during REM Sleep: Implications for REM Sleep and Memory Consolidation

    OpenAIRE

    Luo, Jie; Phan, Trongha X.; Yang, Yimei; Garelick, Michael G.; Storm, Daniel R.

    2013-01-01

    The cyclic adenosine monophosphate (cAMP), mitogen-activated protein kinase (MAPK) and cAMP response element-binding protein (CREB) transcriptional pathway is required for consolidation of hippocampus-dependent memory. In mice, this pathway undergoes a circadian oscillation required for memory persistence that reaches a peak during the daytime. Since mice exhibit polyphasic sleep patterns during the day, this suggested the interesting possibility that cAMP, MAPK activity and CREB phosphorylat...

  13. Munitions Response Projects Shallow Water Marine UXO Detection Survey - Underwater Survey of Camp Lejeune

    Science.gov (United States)

    2011-03-01

    task helped to minimize production losses during the technology demonstration by anticipating potential equipment failure and/or system integration...Investigator David Lynch Range Development MCIEAST Operations & Training, MCB Camp Lejeune, North Carolina (910) 451-5772 MC Project Lead Herb Nelson...SERDP & ESTCP Washington DC 703-696-8726 ( Voice ) 202-215-4844 (Cell) Munitions Management Program Manager Raye Lahti AMEC Earth

  14. A cyclic AMP response element mediates repression of tyrosine aminotransferase gene transcription by the tissue-specific extinguisher locus Tse-1.

    Science.gov (United States)

    Boshart, M; Weih, F; Schmidt, A; Fournier, R E; Schütz, G

    1990-06-01

    Tyrosine aminotransferase (TAT) gene expression is liver specific and inducible by glucocorticoids and via the cAMP signaling pathway. In fibroblasts and other nonliver cells the gene is subject to negative control by the trans-dominant tissue-specific extinguisher locus Tse-1. We identified a hepatocyte-specific enhancer that is repressed by Tse-1. Two distinct sequence motifs are absolutely essential for function of this enhancer: a cAMP response element (CRE), which is the target for repression by Tse-1, and a hepatocyte-specific element. The specificity of the enhancer is generated by the combination of these two essential elements, which are fully interdependent. In vivo footprinting indicates that Tse-1 acts by affecting protein binding at the CRE. A direct antagonism between Tse-1 and the cAMP signaling pathway suggests that Tse-1 plays a role in control of developmental activation of the TAT gene.

  15. Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus

    Science.gov (United States)

    Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

    2008-01-01

    We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…

  16. CAMP/PKA-mediated regulation of erythropoiesis

    NARCIS (Netherlands)

    Boer, AK; Drayer, AL; Vellenga, E

    The role of cyclic AMP (cAMP) as second messenger in erythropoiesis has been suggested in the early 1980s. However, careful analysis showed that cAMP is not generated in direct response to the main erythropoiesis-controlling cytokines such as erythropoietin (Epo). As a result, cAMP disappeared from

  17. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    to antibody induced receptor ligation, bacterial superantigen (SEA and SEB) treatment of HLA-DR+ T-cells stimulated ZAP-70 tyrosine phosphorylation, consistent with class II transmembrane signaling by ligation of HLA-DR and V beta in cis. Modulation of the TCR/CD3 led to abrogation of class II induced ZAP-70......Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...

  18. MC1R, the cAMP pathway, and the response to solar UV: extending the horizon beyond pigmentation.

    Science.gov (United States)

    García-Borrón, Jose C; Abdel-Malek, Zalfa; Jiménez-Cervantes, Celia

    2014-09-01

    The melanocortin 1 receptor (MC1R) is a G protein-coupled receptor crucial for the regulation of melanocyte proliferation and function. Upon binding melanocortins, MC1R activates several signaling cascades, notably the cAMP pathway leading to synthesis of photoprotective eumelanin. Polymorphisms in the MC1R gene are a major source of normal variation of human hair color and skin pigmentation, response to ultraviolet radiation (UVR), and skin cancer susceptibility. The identification of a surprisingly high number of MC1R natural variants strongly associated with pigmentary phenotypes and increased skin cancer risk has prompted research on the functional properties of the wild-type receptor and frequent mutant alleles. We summarize current knowledge on MC1R structural and functional properties, as well as on its intracellular trafficking and signaling. We also review the current knowledge about the function of MC1R as a skin cancer, particularly melanoma, susceptibility gene and how it modulates the response of melanocytes to UVR. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Changes in the Arabidopsis thaliana Proteome Implicate cAMP in Biotic and Abiotic Stress Responses and Changes in Energy Metabolism

    KAUST Repository

    Alquraishi, May Majed

    2016-06-01

    The second messenger 3′,5′-cyclic adenosine monophosphate (cAMP) is increasingly recognized as having many different roles in plant responses to environmental stimuli. To gain further insights into these roles, Arabidopsis thaliana cell suspension culture was treated with 100 nM of cell permeant 8-bromo-cAMP for 5 or 10 min. Here, applying mass spectrometry and comparative proteomics, 20 proteins were identified as differentially expressed and we noted a specific bias in proteins with a role in abiotic stress, particularly cold and salinity, biotic stress as well as proteins with a role in glycolysis. These findings suggest that cAMP is sufficient to elicit specific stress responses that may in turn induce complex changes to cellular energy homeostasis.

  20. Ablative Thermal Response Analysis Using the Finite Element Method

    Science.gov (United States)

    Dec John A.; Braun, Robert D.

    2009-01-01

    A review of the classic techniques used to solve ablative thermal response problems is presented. The advantages and disadvantages of both the finite element and finite difference methods are described. As a first step in developing a three dimensional finite element based ablative thermal response capability, a one dimensional computer tool has been developed. The finite element method is used to discretize the governing differential equations and Galerkin's method of weighted residuals is used to derive the element equations. A code to code comparison between the current 1-D tool and the 1-D Fully Implicit Ablation and Thermal Response Program (FIAT) has been performed.

  1. cAMP and EPAC are key players in the regulation of the signal transduction pathway involved in the α-hemolysin autophagic response.

    Directory of Open Access Journals (Sweden)

    María Belén Mestre

    Full Text Available Staphylococcus aureus is a microorganism that causes serious diseases in the human being. This microorganism is able to escape the phagolysosomal pathway, increasing intracellular bacterial survival and killing the eukaryotic host cell to spread the infection. One of the key features of S. aureus infection is the production of a series of virulence factors, including secreted enzymes and toxins. We have shown that the pore-forming toxin α-hemolysin (Hla is the S. aureus-secreted factor responsible for the activation of the autophagic pathway and that this response occurs through a PI3K/Beclin1-independent form. In the present report we demonstrate that cAMP has a key role in the regulation of this autophagic response. Our results indicate that cAMP is able to inhibit the autophagy induced by Hla and that PKA, the classical cAMP effector, does not participate in this regulation. We present evidence that EPAC and Rap2b, through calpain activation, are the proteins involved in the regulation of Hla-induced autophagy. Similar results were obtained in cells infected with different S. aureus strains. Interestingly, in this report we show, for the first time to our knowledge, that both EPAC and Rap2b are recruited to the S. aureus-containing phagosome. We believe that our findings have important implications in understanding innate immune processes involved in intracellular pathogen invasion of the host cell.

  2. cAMP and EPAC Are Key Players in the Regulation of the Signal Transduction Pathway Involved in the α-Hemolysin Autophagic Response

    Science.gov (United States)

    Mestre, María Belén; Colombo, María Isabel

    2012-01-01

    Staphylococcus aureus is a microorganism that causes serious diseases in the human being. This microorganism is able to escape the phagolysosomal pathway, increasing intracellular bacterial survival and killing the eukaryotic host cell to spread the infection. One of the key features of S. aureus infection is the production of a series of virulence factors, including secreted enzymes and toxins. We have shown that the pore-forming toxin α-hemolysin (Hla) is the S. aureus–secreted factor responsible for the activation of the autophagic pathway and that this response occurs through a PI3K/Beclin1-independent form. In the present report we demonstrate that cAMP has a key role in the regulation of this autophagic response. Our results indicate that cAMP is able to inhibit the autophagy induced by Hla and that PKA, the classical cAMP effector, does not participate in this regulation. We present evidence that EPAC and Rap2b, through calpain activation, are the proteins involved in the regulation of Hla-induced autophagy. Similar results were obtained in cells infected with different S. aureus strains. Interestingly, in this report we show, for the first time to our knowledge, that both EPAC and Rap2b are recruited to the S. aureus–containing phagosome. We believe that our findings have important implications in understanding innate immune processes involved in intracellular pathogen invasion of the host cell. PMID:22654658

  3. Consulting to summer camps.

    Science.gov (United States)

    Ditter, Bob

    2007-10-01

    There has been an increased need for consultation to summer camps from the allied health/mental health fields because camps are available to children with medical and psychological illnesses. Factors in camp programs that are necessary for effective consultation and the various roles a consultant may serve within the camp community are discussed in this article.

  4. Victory Junction Gang Camp

    Science.gov (United States)

    Shell, Ryan

    2007-01-01

    This article describes the Victory Junction Gang Camp, a not-for-profit, NASCAR-themed camp for children with chronic medical conditions that serves 24 different disease groups. The mission of the camp is to give children life-changing camping experiences that are exciting, fun, and empowering in a safe and medically sound environment. While doing…

  5. Regulation of cyclic adenosine monophosphate response element binding protein on renin expression in kidney via complex cyclic adenosine monophosphate response element-binding-protein-binding protein/P300 recruitment.

    Science.gov (United States)

    Li, Pei; Zhang, Jing; Zhu, Yuanfang; Liu, Ming; Xuan, Jin

    2015-11-01

    Renin synthesis and release is the rate-limiting step in the renin-angiotensin system, because cyclic adenosine monophosphate (cAMP) has been identified as dominant pathway for renin gene expression, and cAMP response element-binding protein (CREB) is found in the human and mouse renin promoter. This study aimed to evaluate the role of CREB in expression of the renin gene. We created conditional deletion of CREB in mice with low-sodium diet, specifically in renin cells of the kidney. To assess the effect of CREB on renin expression, immunostaining of renin was used in samples from wild-type mice and mice with gene knock-down of CREB. Cyclic AMP response element-binding-protein-binding protein (CBP) and p300 were measured in cultured renin cells of the mice, and RNA detection was done with real-time polymerase chain reaction. With low-sodium diet, renin was expressed along the whole wall of the afferent glomerular arterioles in wild-type mice, while there was no increase or even decrease in renin expression in CREB-specific deletion mice; RNA level of renin in cultured cells decreased by 50% with single knock-down of CREB, CBP, or p300, and decreased 70% with triple knock-down of CREB, CBP, and p300. This study found that CREB was important for renin synthesis and the role of CREB can be achieved through the recruitment of co-activators CBP and p300.

  6. Transposable elements in response to environmental stressors&

    Science.gov (United States)

    Miousse, Isabelle R.; Chalbot, Marie-Cecile G.; Lumen, Annie; Ferguson, Alesia; Kavouras, Ilias G.; Koturbash, Igor

    2015-01-01

    Transposable elements (TEs) comprise a group of repetitive sequences that bring positive, negative, as well as neutral effects to the host organism. Earlier considered as “junk DNA,” TEs are now well-accepted driving forces of evolution and critical regulators the of expression of genetic information. Their activity is regulated by epigenetic mechanisms, including methylation of DNA and histone modifications. The loss of epigenetic control over TEs, exhibited as loss of DNA methylation and decondensation of the chromatin structure, may result in TEs reactivation, initiation of their insertional mutagenesis (retrotransposition) and has been reported in numerous human diseases, including cancer. Accumulating evidence suggests that these alterations are not the simple consequences of the disease, but often may drive the pathogenesis, as they can be detected early during disease development. Knowledge derived from the in vitro, in vivo, and epidemiological studies, clearly demonstrates that exposure to ubiquitous environmental stressors, many of which are carcinogens or suspected carcinogens, are capable of causing alterations in methylation and expression of TEs and initiate retrotransposition events. Evidence summarized in this review suggests that TEs are the sensitive endpoints for detection of effects caused by such environmental stressors, as ionizing radiation (terrestrial, space, and UV-radiation), air pollution (including particulate matter [PM]-derived and gaseous), persistent organic pollutants, and metals. Furthermore, the significance of these effects is characterized by their early appearance, persistence and presence in both, target organs and peripheral blood. Altogether, these findings suggest that TEs may potentially be introduced into safety and risk assessment and serve as biomarkers of exposure to environmental stressors. Furthermore, TEs also show significant potential to become invaluable surrogate biomarkers in clinic and possible targets

  7. Response of transposable elements to environmental stressors.

    Science.gov (United States)

    Miousse, Isabelle R; Chalbot, Marie-Cecile G; Lumen, Annie; Ferguson, Alesia; Kavouras, Ilias G; Koturbash, Igor

    2015-01-01

    Transposable elements (TEs) comprise a group of repetitive sequences that bring positive, negative, as well as neutral effects to the host organism. Earlier considered as "junk DNA," TEs are now well-accepted driving forces of evolution and critical regulators of the expression of genetic information. Their activity is regulated by epigenetic mechanisms, including methylation of DNA and histone modifications. The loss of epigenetic control over TEs, exhibited as loss of DNA methylation and decondensation of the chromatin structure, may result in TEs reactivation, initiation of their insertional mutagenesis (retrotransposition) and has been reported in numerous human diseases, including cancer. Accumulating evidence suggests that these alterations are not the simple consequences of the disease, but often may drive the pathogenesis, as they can be detected early during disease development. Knowledge derived from the in vitro, in vivo, and epidemiological studies, clearly demonstrates that exposure to ubiquitous environmental stressors, many of which are carcinogens or suspected carcinogens, are capable of causing alterations in methylation and expression of TEs and initiate retrotransposition events. Evidence summarized in this review suggests that TEs are the sensitive endpoints for detection of effects caused by such environmental stressors, as ionizing radiation (terrestrial, space, and UV-radiation), air pollution (including particulate matter [PM]-derived and gaseous), persistent organic pollutants, and metals. Furthermore, the significance of these effects is characterized by their early appearance, persistence and presence in both, target organs and peripheral blood. Altogether, these findings suggest that TEs may potentially be introduced into safety and risk assessment and serve as biomarkers of exposure to environmental stressors. Furthermore, TEs also show significant potential to become invaluable surrogate biomarkers in clinic and possible targets for

  8. A culture amplified multi-parametric intracellular cytokine assay (CAMP-ICC) for enhanced detection of antigen specific T-cell responses.

    Science.gov (United States)

    Munier, C Mee Ling; Zaunders, John J; Ip, Susanna; Cooper, David A; Kelleher, Anthony D

    2009-06-30

    Ex-vivo T-cell responses to vaccines and some viral antigens are not always detectable by conventional functional T-cell assays such as lympho-proliferation assays, IFN-gamma ELIspot and intracellular cytokine staining (ICC). In this study we describe the development, optimisation and utilisation of a culture amplified multiparametric intracellular cytokine assay (CAMP-ICC) to detect antigen specific T-cells that may be present at low frequencies and small primed responses typical of those induced by DNA vaccines in humans. CFSE labelled PBMCs are cultured for 10 days with antigens of interest. Low concentrations of exogenous proliferative and anti-apoptotic cytokines are added to assist in amplification of the antigen specific, but not background responses. On day 10 the cultured cells are re-challenged with or without antigen as for the standard ICC and then stained with fluorescent monoclonal antibodies of interest. Various conditions, including concentration, day of administration and length of incubation were tested employing the cytokines, IL-2, IL-7, IL-15 and IL-21 alone or in combination. CMV lysate, CEF peptides and measles viral lysate were used in the optimisation of the CAMP-ICC. We found that addition of 0.5 ng/ml of IL-15 in combination with 0.1 ng/ml of IL-21 at day 5 of culture enhanced proliferation of antigen specific responses whilst maintaining low background. The CAMP-ICC provides much more information than conventional functional T-cell assays allowing simultaneous determination of proliferative capacity and cytokine production by both CD4 and CD8+ T cells.

  9. The Colletotrichum gloeosporioides RhoB regulates cAMP and stress response pathways and is required for pathogenesis.

    Science.gov (United States)

    Xu, Xin; Wang, Yonglin; Tian, Chengming; Liang, Yingmei

    2016-11-01

    Rho GTPases regulate morphology and multiple cellular functions such as asexual development, polarity establishment, and differentiation in fungi. To determine the roles of CgRhoB, a Rho GTPase protein, here we characterized CgRhoB in the poplar anthracnose fungus Colletotrichum gloeosporioides. First of all, we determined that conidial germination was inhibited and intracellular cyclic AMP (cAMP) level was increased in the CgRhoB deletion mutants. Loss of CgRhoB resulted in shorter germ tubes and enhanced appressoria formation after germination on the hydrophobic surface. Exogenous addition of cAMP to the wild type generated the similar phenotypes of ΔCgRhoB inoculated in CM liquid. Furthermore, deletion of CgRhoB had discernible effect upon the sensitivity of C. gloeosporioides to cell wall perturbing agents and altered the distribution of chitin on the cell wall. H2O2 sensitivity assay showed the hypersensitive effect on the oxidative stress, and transcriptional analysis revealed that transcription of genes involved in peroxidase activities was altered in the mutants. Finally, virulence assay revealed that CgRhoB was required for pathogenicity. Taken together, our results showed that CgRhoB was associated with appressoria formation and pathogenicity, and affected cAMP level and stress pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Teenagers and Risk-Taking at Camp.

    Science.gov (United States)

    Woods, Ann

    2002-01-01

    Teen risk-taking is normal, healthy developmental behavior. Teens act out their fantasies--good and bad--at camp because it is a safe place away from parents. Signs of unhealthy risk-taking, camp staff responses, and how the September 11 tragedy might affect risk-taking are discussed. Sidebars describe tips for understanding adolescent behavior…

  11. Seafloor Science and Remotely Operated Vehicle (SSROV) Day Camp: A Week-Long, Hands-On STEM Summer Camp

    Science.gov (United States)

    Wheat, C. G.; Fournier, T.; Monahan, K.; Paul, C.

    2015-12-01

    RETINA (Robotic Exploration Technologies IN Astrobiology) has developed a program geared towards stimulating our youth with innovative and relevant hands-on learning modules under a STEM umbrella. Given the breadth of potential science and engineering topics that excite children, the RETINA Program focuses on interactive participation in the design and development of simple robotic and sensor systems, providing a range of challenges to engage students through project-based learning (PBL). Thus, young students experience scientific discovery through the use and understanding of technology. This groundwork serves as the foundation for SSROV Camp, a week-long, summer day camp for 6th-8th grade students. The camp is centered on the sensors and platforms that guide seafloor exploration and discovery and builds upon the notion that transformative discoveries in the deep sea result from either sampling new environments or making new measurements with sensors adapted to this extreme environment. These technical and scientific needs are folded into the curriculum. Each of the first four days of the camp includes four team-based, hands-on technical challenges, communication among peer groups, and competition. The fifth day includes additional activities, culminating in camper-led presentations to describe a planned mission based on a given geologic setting. Presentations include hypotheses, operational requirements and expected data products. SSROV Camp was initiated last summer for three sessions, two in Monterey, CA and one in Oxford, MS. Campers from both regions grasped key elements of the program, based on written responses to questions before and after the camp. On average, 32% of the pre-test questions were answered correctly compared with 80% of the post-test questions. Additional confirmation of gains in campers' knowledge, skills, and critical thinking on environmental issues and engineering problems were apparent during the "jeopardy" competition, nightly homework

  12. Camp and Human Behavior.

    Science.gov (United States)

    Henderson, Karla A.

    1995-01-01

    Addresses the potential of camp to promote self-esteem and nurture a sense of community. Summarizes articles in this journal issue that focus on individual and group behavior including homesickness, how camps can promote positive attitudes toward disabled campers, and a camp program that provides respite care for families of children with AIDS.…

  13. cAMP/Ca2+ response element-binding protein plays a central role in the biogenesis of respiratory chain proteins in mammalian cells.

    Science.gov (United States)

    De Rasmo, Domenico; Signorile, Anna; Papa, Francesco; Roca, Emilio; Papa, Sergio

    2010-06-01

    In mammalian cells, promotion of mitochondrial biogenesis by various agents involves cAMP and Ca(2+)-mediated signal transduction pathways. Recruitment of these pathways results in phosphorylation by cAMP and Ca(2+)-dependent protein kinases of cAMP/Ca(2+) response element-binding protein (CREB). Phosphorylation of CREB, bound to transcriptional complexes of target genes, activates a down-stream cascade of transcriptional complexes, which involve in sequence, the nuclear factors TORCs, PGC-1, NRF1 and NRF2, and the mitochondrial factor mitochondrial transcriptional factor A. CREB also binds directly to the D-loop of mitochondrial DNA and activates its expression. Activation of this network of transcriptional complexes results in concerted promotion of the expression of nuclear and mitochondrial genes encoding subunits of oxidative phosphorylation complexes.

  14. cAMP signaling in subcellular compartments.

    Science.gov (United States)

    Lefkimmiatis, Konstantinos; Zaccolo, Manuela

    2014-09-01

    In the complex microcosm of a cell, information security and its faithful transmission are critical for maintaining internal stability. To achieve a coordinated response of all its parts to any stimulus the cell must protect the information received from potentially confounding signals. Physical segregation of the information transmission chain ensures that only the entities able to perform the encoded task have access to the relevant information. The cAMP intracellular signaling pathway is an important system for signal transmission responsible for the ancestral 'flight or fight' response and involved in the control of critical functions including frequency and strength of heart contraction, energy metabolism and gene transcription. It is becoming increasingly apparent that the cAMP signaling pathway uses compartmentalization as a strategy for coordinating the large number of key cellular functions under its control. Spatial confinement allows the formation of cAMP signaling "hot spots" at discrete subcellular domains in response to specific stimuli, bringing the information in proximity to the relevant effectors and their recipients, thus achieving specificity of action. In this report we discuss how the different constituents of the cAMP pathway are targeted and participate in the formation of cAMP compartmentalized signaling events. We illustrate a few examples of localized cAMP signaling, with a particular focus on the nucleus, the sarcoplasmic reticulum and the mitochondria. Finally, we discuss the therapeutic potential of interventions designed to perturb specific cAMP cascades locally. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Cyclic AMP response element binding protein and brain-derived ...

    Indian Academy of Sciences (India)

    Madhu

    The transcription factor cyclic AMP response element binding protein (CREB) and the neurotrophin brain-derived neurotrophic factor (BDNF) are targets of diverse classes of antidepressants and are known to be regulated in animal models and in patients suffering from depression. Given their role in neuronal plasticity, ...

  16. Finite Element Vibration and Dynamic Response Analysis of Engineering Structures

    Directory of Open Access Journals (Sweden)

    Jaroslav Mackerle

    2000-01-01

    Full Text Available This bibliography lists references to papers, conference proceedings, and theses/dissertations dealing with finite element vibration and dynamic response analysis of engineering structures that were published from 1994 to 1998. It contains 539 citations. The following types of structures are included: basic structural systems; ground structures; ocean and coastal structures; mobile structures; and containment structures.

  17. Medical Record Keeping in the Summer Camp Setting.

    Science.gov (United States)

    Kaufman, Laura; Holland, Jaycelyn; Weinberg, Stuart; Rosenbloom, S Trent

    2016-12-14

    Approximately one fifth of school-aged children spend a significant portion of their year at residential summer camp, and a growing number have chronic medical conditions. Camp health records are essential for safe, efficient care and for transitions between camp and home providers, yet little research exists regarding these systems. To survey residential summer camps for children to determine how camps create, store, and use camper health records. To raise awareness in the informatics community of the issues experienced by health providers working in a special pediatric care setting. We designed a web-based electronic survey concerning medical recordkeeping and healthcare practices at summer camps. 953 camps accredited by the American Camp Association received the survey. Responses were consolidated and evaluated for trends and conclusions. Of 953 camps contacted, 298 (31%) responded to the survey. Among respondents, 49.3% stated that there was no computer available at the health center, and 14.8% of camps stated that there was not any computer available to health staff at all. 41.1% of camps stated that internet access was not available. The most common complaints concerning recordkeeping practices were time burden, adequate completion, and consistency. Summer camps in the United States make efforts to appropriately document healthcare given to campers, but inconsistency and inefficiency may be barriers to staff productivity, staff satisfaction, and quality of care. Survey responses suggest that the current methods used by camps to document healthcare cause limitations in consistency, efficiency, and communications between providers, camp staff, and parents. As of 2012, survey respondents articulated need for a standard software to document summer camp healthcare practices that accounts for camp-specific needs. Improvement may be achieved if documentation software offers the networking capability, simplicity, pediatrics-specific features, and avoidance of

  18. Medical Record Keeping in the Summer Camp Setting

    Science.gov (United States)

    Holland, Jaycelyn; Weinberg, Stuart; Rosenbloom, S. Trent

    2016-01-01

    Summary Background Approximately one fifth of school-aged children spend a significant portion of their year at residential summer camp, and a growing number have chronic medical conditions. Camp health records are essential for safe, efficient care and for transitions between camp and home providers, yet little research exists regarding these systems. Objective To survey residential summer camps for children to determine how camps create, store, and use camper health records. To raise awareness in the informatics community of the issues experienced by health providers working in a special pediatric care setting. Methods We designed a web-based electronic survey concerning medical recordkeeping and healthcare practices at summer camps. 953 camps accredited by the American Camp Association received the survey. Responses were consolidated and evaluated for trends and conclusions. Results Of 953 camps contacted, 298 (31%) responded to the survey. Among respondents, 49.3% stated that there was no computer available at the health center, and 14.8% of camps stated that there was not any computer available to health staff at all. 41.1% of camps stated that internet access was not available. The most common complaints concerning recordkeeping practices were time burden, adequate completion, and consistency. Conclusions Summer camps in the United States make efforts to appropriately document health-care given to campers, but inconsistency and inefficiency may be barriers to staff productivity, staff satisfaction, and quality of care. Survey responses suggest that the current methods used by camps to document healthcare cause limitations in consistency, efficiency, and communications between providers, camp staff, and parents. As of 2012, survey respondents articulated need for a standard software to document summer camp healthcare practices that accounts for camp-specific needs. Improvement may be achieved if documentation software offers the networking capability

  19. Dual functionality of cis-regulatory elements as developmental enhancers and Polycomb response elements.

    Science.gov (United States)

    Erceg, Jelena; Pakozdi, Tibor; Marco-Ferreres, Raquel; Ghavi-Helm, Yad; Girardot, Charles; Bracken, Adrian P; Furlong, Eileen E M

    2017-03-15

    Developmental gene expression is tightly regulated through enhancer elements, which initiate dynamic spatio-temporal expression, and Polycomb response elements (PREs), which maintain stable gene silencing. These two cis-regulatory functions are thought to operate through distinct dedicated elements. By examining the occupancy of the Drosophila pleiohomeotic repressive complex (PhoRC) during embryogenesis, we revealed extensive co-occupancy at developmental enhancers. Using an established in vivo assay for PRE activity, we demonstrated that a subset of characterized developmental enhancers can function as PREs, silencing transcription in a Polycomb-dependent manner. Conversely, some classic Drosophila PREs can function as developmental enhancers in vivo, activating spatio-temporal expression. This study therefore uncovers elements with dual function: activating transcription in some cells (enhancers) while stably maintaining transcriptional silencing in others (PREs). Given that enhancers initiate spatio-temporal gene expression, reuse of the same elements by the Polycomb group (PcG) system may help fine-tune gene expression and ensure the timely maintenance of cell identities. © 2017 Erceg et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Recreation Summer Camps

    Data.gov (United States)

    Montgomery County of Maryland — List of all Camps (Register here:https://apm.activecommunities.com/montgomerycounty/Home) to include Aquatics, Basketball, Soccer, Special Interest, General Sports,...

  1. Registration Summer Camp 2016

    CERN Multimedia

    2016-01-01

    Reminder: registration for the CERN Staff Association Summer Camp is now open for children from 4 to 6 years old.   More information on the website: http://nurseryschool.web.cern.ch/. The summer camp is open to all children. The proposed cost is 480.-CHF/week, lunch included. The camp will be open weeks 27, 28, 29 and 30, from 8:30 a.m. to 5:30 p.m. For further questions, you are welcome to contact us by email at Summer.Camp@cern.ch. CERN Staff Association

  2. Summer Camp July 2017 - Registration

    CERN Multimedia

    EVE et École

    2017-01-01

    The CERN Staff Association’s Summer Camp will be open for children from 4 to 6 years old during four weeks, from 3 to 28 July. Registration is offered on a weekly basis for 450 CHF, lunch included. This year, the various activities will revolve around the theme of the Four Elements. Registration opened on 20 March 2017 for children currently attending the EVE and School of the Association. It will be open from 3 April for children of CERN Members of Personnel, and starting from 24 April for all other children. The general conditions are available on the website of the EVE and School of CERN Staff Association: http://nurseryschool.web.cern.ch. For further questions, please contact us by email at Summer.Camp@cern.ch.

  3. Scrum Code Camps

    DEFF Research Database (Denmark)

    Pries-Heje, Jan; Pries-Heje, Lene; Dahlgaard, Bente

    2013-01-01

    is required. In this paper we present the design of such a new approach, the Scrum Code Camp, which can be used to assess agile team capability in a transparent and consistent way. A design science research approach is used to analyze properties of two instances of the Scrum Code Camp where seven agile teams...

  4. Friends' Discovery Camp

    Science.gov (United States)

    Seymour, Seth

    2008-01-01

    This article features Friends' Discovery Camp, a program that allows children with and without autism spectrum disorder to learn and play together. In Friends' Discovery Camp, campers take part in sensory-rich experiences, ranging from hands-on activities and performing arts to science experiments and stories teaching social skills. Now in its 7th…

  5. A Pediatric Cardiology Fellowship Boot Camp improves trainee confidence.

    Science.gov (United States)

    Allan, Catherine K; Tannous, Paul; DeWitt, Elizabeth; Farias, Michael; Mansfield, Laura; Ronai, Christina; Schidlow, David; Sanders, Stephen P; Lock, James E; Newburger, Jane W; Brown, David W

    2016-12-01

    Introduction New paediatric cardiology trainees are required to rapidly assimilate knowledge and gain clinical skills to which they have limited or no exposure during residency. The Pediatric Cardiology Fellowship Boot Camp (PCBC) at Boston Children's Hospital was designed to provide incoming fellows with an intensive exposure to congenital cardiac pathology and a broad overview of major areas of paediatric cardiology practice. The PCBC curriculum was designed by core faculty in cardiac pathology, echocardiography, electrophysiology, interventional cardiology, exercise physiology, and cardiac intensive care. Individual faculty contributed learning objectives, which were refined by fellowship directors and used to build a programme of didactics, hands-on/simulation-based activities, and self-guided learning opportunities. A total of 16 incoming fellows participated in the 4-week boot camp, with no concurrent clinical responsibilities, over 2 years. On the basis of pre- and post-PCBC surveys, 80% of trainees strongly agreed that they felt more prepared for clinical responsibilities, and a similar percentage felt that PCBC should be offered to future incoming fellows. Fellows showed significant increase in their confidence in all specific knowledge and skills related to the learning objectives. Fellows rated hands-on learning experiences and simulation-based exercises most highly. We describe a novel 4-week-long boot camp designed to expose incoming paediatric cardiology fellows to the broad spectrum of knowledge and skills required for the practice of paediatric cardiology. The experience increased trainee confidence and sense of preparedness to begin fellowship-related responsibilities. Given that highly interactive activities were rated most highly, boot camps in paediatric cardiology should strongly emphasise these elements.

  6. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  7. Pandemic influenza a in residential summer camps--Maine, 2009.

    Science.gov (United States)

    Robinson, Sara; Averhoff, Francisco; Kiel, John; Blaisdell, Laura; Haber, Michael; Sites, Anne; Copeland, Daphne

    2012-06-01

    The aim of this study was to evaluate the preparedness for and response of Maine summer camps to the 2009 pandemic influenza H1N1 (pH1N1). We conducted a retrospective web-based survey of the Maine Youth Camping Foundation members at the end of the 2009 camping season. The outcome measures were responses to the pandemic including educational efforts, isolation practices and antiviral usages as well as percentage of influenza-like illness (ILI) and laboratory-confirmed influenza outbreaks among Maine residential summer camps. Of 107 residential camps queried, 91 (85%) responded. Although 43 (47%) of 91 camps reported cases of ILI, and 19 (21%) had outbreaks (ie, 3 or more confirmed cases of pH1N1), no respondents reported closing camps or canceling sessions. Most camps reported that they communicated with campers' families about pH1N1 and implemented control measures, including educating campers and staff about symptoms, isolating ill campers and staff, encouraging increased hand washing and hygiene practices and increasing the availability of hand sanitizers. Of the 43 camps with cases of ILI or laboratory-confirmed pH1N1, 25 (58%) used antiviral medication for treatment, and 18 (42%) used antiviral medications for prophylaxis; antiviral practices varied among camps. Summer camps in Maine were in general well prepared for pH1N1. Most camps followed public health guidance and implemented preventive measures. Many camps experienced ILI and outbreaks during the season, but did not report major disruptions. Camps should review their preparedness and disease control plans annually and public health authorities should keep guidance and recommendations simple and consistent.

  8. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts......An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... with responsive building elements. The (Dutch) Toolkit Sustainable Residential Buildings is one of the examples of tools for an integrated design process....

  9. Summer camp nurtures student

    OpenAIRE

    Earl Anderson

    2017-01-01

    Summer camp is a coordinated program for youths or teenagers driven in the midst of the late spring months in a couple of countries. Adolescents and young people who go to summer camp are known as campers. It is each parent's stress: What is the perfect way for your adolescent to contribute his or her free vitality in the midst of summer and school breaks? Research Paper Help. To a couple, it is a period for youths to play and have an incredible time. By joining the late spring camp, yout...

  10. Hitler's Death Camps.

    Science.gov (United States)

    Wieser, Paul

    1995-01-01

    Presents a high school lesson on Hitler's death camps and the widespread policy of brutality and oppression against European Jews. Includes student objectives, instructional procedures, and a chart listing the value of used clothing taken from the Jews. (CFR)

  11. CDC Disease Detective Camp

    Centers for Disease Control (CDC) Podcasts

    2010-08-02

    The CDC Disease Detective Camp gives rising high school juniors and seniors exposure to key aspects of the CDC, including basic epidemiology, infectious and chronic disease tracking, public health law, and outbreak investigations. The camp also helps students explore careers in public health.  Created: 8/2/2010 by Centers for Disease Control and Prevention (CDC).   Date Released: 8/2/2010.

  12. Identification of a novel human glucagon receptor promoter: regulation by cAMP and PGC-1alpha

    DEFF Research Database (Denmark)

    Mortensen, Ole Hartvig; Dichmann, Darwin Sorento; Abrahamsen, Niels

    2007-01-01

    inhibitory effects of cAMP on glucagon receptor mRNA expression is mediated at the level of gene transcription. The cAMP-mediated downregulation of the proximal promoter was examined by deletion analysis in the human hepatoma cell line HepG2 and the cAMP responsiveness was found to be located in a region...... between 1051 and 1016 base pairs upstream of the transcription start site, which contains several putative cAMP responsive elements. Expression of peroxisome proliferator-activated receptor gamma coactivator 1alpha (PGC-1alpha), known to be upregulated in the liver by fasting, was found to abolish the c......AMP-dependent downregulation of glucagon receptor mRNA expression in vitro, whereas overexpression of PGC-1beta had no effect....

  13. Iron responsive-like elements in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Soto-Castro, Liliana; Plata-Guzmán, Laura Yuliana; Figueroa-Angulo, Elisa Elvira; Calla-Choque, Jaeson Santos; Reyes-López, Magda; de la Garza, Mireya; León-Sicairos, Nidia; Garzón-Tiznado, José Antonio; Arroyo, Rossana; León-Sicairos, Claudia

    2017-09-01

    In Entamoeba histolytica, iron modulates virulence and gene expression via unknown regulatory mechanisms. The existence of a posttranscriptional iron regulatory system parallel with the iron-responsive element (IRE)/iron regulatory protein (IRP) system in the protozoan Trichomonas vaginalis has recently been reported. Due to their evolutionary closeness and the importance of iron for growth and virulence in these protozoa, we hypothesized the existence of an IRE/IRP-like mechanism in E. histolytica. To determine the presence of IRE-like elements in some mRNAs from this parasite, we performed in silico analyses of the 5'- and 3'-UTRs of mRNAs encoding virulence factors and cytoskeleton, ribosomal and metabolism proteins. The Zuker mfold software predicted IRE-like secondary structures in 52 of the 135 mRNAs analysed. However, only nine structures shared sequence similarity with the apical loop sequence (CAGUGN) of the previously reported human IRE-ferritin, whereas the GUU/UUG protozoan-specific motif was detected in 23 stem-loop structures. A new motif, AUU/AUUU, was also observed in 23 structures, suggesting the possible existence of an amoeba-specific motif. Additionally, cross-linking and RNA electrophoretic mobility shift assays showed specific RNA-protein interactions, using as a model two amoebic IRE-like elements from iron-regulated mRNAs and HeLa, T. vaginalis and E. histolytica cytoplasmic proteins. Our data suggest the presence of a posttranscriptional iron regulatory IRE/IRP-like mechanism in E. histolytica.

  14. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  15. Sexual Harassment at Camp: Reducing Liability.

    Science.gov (United States)

    Oakleaf, Linda; Grube, Angela Johnson

    2003-01-01

    Employers are responsible for sexual harassment perpetrated by a supervisor. Camps may be responsible for sexual harassment between campers. Steps to reduce liability include providing multiple channels for reporting sexual harassment; having written policies prohibiting sexual harassment and procedures for reporting it; posting these policies and…

  16. Teaching Ugandan Traditional Dances and Drumming in Summer Camps

    Science.gov (United States)

    Mabingo, Alfdaniels

    2017-01-01

    Dances and drum rhythms from African traditions have been integrated into summer camp activities in the United States as a response to the ever-globalized environments in which these camps are located and the diversity of the campers and teachers that they attract. This reflective article draws on critical reflections, observations and experiences…

  17. An Analysis of the Relationship of Military Affiliation to Demographics, New Sailor Survey Responses, and Boot Camp Success

    Science.gov (United States)

    2008-06-01

    recruit to indicate his or her level of awareness regarding various Navy sponsorships (e.g. NFL, NASCAR , NBA etc.) The responses with respect to military...the scale below, please indicate your level of awareness of the Navy’s sponsorship of the following: NASCAR Chi-Squared Statistic 5.3858 p-value...awareness of the Navy’s sponsorship of the following: NASCAR 45.0% 49.1% 11.9% 14.7% 13.0% 9.6% 9.4% 18.8% 15.3%13.2% 0.0% 20.0% 40.0% 60.0% 80.0% 100.0

  18. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  19. The camp model for entrepreneurship teaching

    DEFF Research Database (Denmark)

    Bager, Torben

    2011-01-01

    Artiklen omhandler brugen af camps i entrepreneurship undervising - illustreret med danske camp eksempler Udgivelsesdato: online 31.03.2010......Artiklen omhandler brugen af camps i entrepreneurship undervising - illustreret med danske camp eksempler Udgivelsesdato: online 31.03.2010...

  20. Carbon monoxide poisoning during camping in Korea.

    Science.gov (United States)

    Kim, Youn-Jung; Sohn, Chang Hwan; Oh, Bum Jin; Lim, Kyoung Soo; Kim, Won Young

    2016-12-01

    The aim of this study was to evaluate the epidemiology and characteristics of unintentional carbon monoxide (CO) poisoning during camping in Korea. We performed a retrospective observational study on patients with unintentional camping-related CO poisoning who were admitted to the emergency department (ED) from 1 January 2010 to 31 December 2014. News reports about incidents of camping-related CO poisoning were collected using news search engines. A total of 72 patients (29 patients involved in 12 incidents, who were admitted to our ED, and 43 victims involved in 17 incidents reported in the media) were identified. Accidental camping-related CO poisoning occurred most frequently in May, late spring in Korea. Gas stove use and the burning of charcoal for tent heating were responsible for camping-related CO exposure. Seventeen victims (39.5%) were found dead when an ambulance arrived at the scene, in the cases reported in the media. In contrast, all the victims at our hospital were alive on hospital discharge. Twelve of the 17 incidents (70.6%) reported in the media were accidental fatalities. The majority of our patients (83.4%) were not aware of the potential danger of charcoal as a source of CO. Accidental camping-related CO poisoning occurred because of an ongoing lack of awareness about the potential danger of charcoal grills and stoves, and this caused prehospital mortality. Such accidents could be prevented by increasing the awareness of the potential danger of using charcoal grills and stoves during camping, as well as by establishing appropriate safety regulations.

  1. The role of cAMP in synaptic homeostasis in response to environmental temperature challenges and hyperexcitability mutations

    Directory of Open Access Journals (Sweden)

    Atsushi eUeda

    2015-02-01

    Full Text Available Homeostasis is the ability of physiological systems to regain functional balance following environment or experimental insults and synaptic homeostasis has been demonstrated in various species following genetic or pharmacological disruptions. Among environmental challenges, homeostatic responses to temperature extremes are critical to animal survival under natural conditions. We previously reported that axon terminal arborization in Drosophila larval neuromuscular junctions is enhanced at elevated temperatures; however, the amplitude of excitatory junctional potentials (EJPs remains unaltered despite the increase in synaptic bouton numbers. Here we determine the cellular basis of this homeostatic adjustment in larvae reared at high temperature (HT, 29 ˚C. We found that synaptic current focally recorded from individual synaptic boutons was unaffected by rearing temperature (30 ˚C. However, HT rearing decreased the quantal size (amplitude of spontaneous miniature EJPs, or mEJPs, which compensates for the increased number of synaptic releasing sites to retain a normal EJP size. The quantal size decrease is accounted for by a decrease in input resistance of the postsynaptic muscle fiber, indicating an increase in membrane area that matches the synaptic growth at HT. Interestingly, a mutation in rutabaga (rut encoding adenylyl cyclase (AC exhibited no obvious changes in quantal size or input resistance of postsynaptic muscle cells after HT rearing, suggesting an important role for rut AC in temperature-induced synaptic homeostasis in Drosophila. This extends our previous finding of rut-dependent synaptic homeostasis in hyperexcitable mutants, e.g. slowpoke (slo. In slo larvae, the lack of BK channel function is partially ameliorated by upregulation of presynaptic Sh IA current to limit excessive transmitter release in addition to postsynaptic glutamate receptor recomposition that reduces the quantal size.

  2. Geographies of the camp

    NARCIS (Netherlands)

    Minca, C.

    2015-01-01

    Facing the current growing global archipelago of encampments – including concentration, detention, transit, identification, refugee, military and training camps, this article is a geographical reflection on ‘the camp’, as a modern institution and as a spatial bio-political technology. In particular,

  3. Camp Sea Lab Visit

    OpenAIRE

    2009-01-01

    Approved for public release; distribution is unlimited On Wednesday July 8th, CAVR hosted 32 eight to thirteen year olds from California State Monterey Bay’s summer Camp SEA Lab. The students had the opportunity to interact with robotic dogs, an autonomous underwater vehicle (AUV), remotely operated vehicle (ROV), and unmanned aerial vehicles (UAV).

  4. Cardiac response to hypobaric hypoxia: persistent changes in cardiac mass, function, and energy metabolism after a trek to Mt. Everest Base Camp

    NARCIS (Netherlands)

    Holloway, Cameron J.; Montgomery, Hugh E.; Murray, Andrew J.; Cochlin, Lowri E.; Codreanu, Ion; Hopwood, Naomi; Johnson, Andrew W.; Rider, Oliver J.; Levett, Denny Z. H.; Tyler, Damian J.; Francis, Jane M.; Neubauer, Stefan; Grocott, Michael P. W.; Clarke, Kieran; Grocott, Mike; Montgomery, Hugh; Levett, Denny; Martin, Daniel; Wilson, Mark; Windsor, Jeremy; Luery, Helen; Murray, Andrew; Stroud, Mike; Khosravi, Maryam; Wandrag, Liesl; Holloway, Cameron; Edwards, Lindsay; Ince, Can; Mythen, Monty; Jonas, Max; Imray, Chris; Newman, Stan; Stygal, Jan; Doyle, Patrick; Rodway, George; Howard, David; McMorrow, Roger; Ahuja, Vijay; Aref-Adib, Golnar; Burnham, Richard Dick; Chisholm, Amber; Coates, David; Cook, Debbie; Dhillon, Sundeep; Dougall, Christina; Duncan, Polly; Edsell, Mark; Evans, Lynn; Gardiner, Paul Bugs; Gunning, Paul; Hart, Nigel; Harrington, Jane; Harvey, John Jules; Hurlbut, Dan; van der Kaaij, Jildou; Kolfschoten, Nicoline Nikki; Luks, Andrew; Meale, Paula; Mitchell, Kay; Morgan, Gwen; Mythen, Michael Monty; O'Dwyer, Michael Mick; Pate, James Jim; Plant, Tracie; Pun, Matiram; Richards, Paul; Richardson, Alan; Simpson, Joanna Jo; Stroud, Callan; Vercueil, Andre; Cox, Mark; Morgan, Jonathan Jon; van Tulleken, Chris; van Tulleken, Alex; Szawarski, Piotr

    2011-01-01

    We postulated that changes in cardiac high-energy phosphate metabolism may underlie the myocardial dysfunction caused by hypobaric hypoxia. Healthy volunteers (n=14) were studied immediately before, and within 4 d of return from, a 17-d trek to Mt. Everest Base Camp (5300 m). (31)P magnetic

  5. Increases in cAMP, MAPK activity, and CREB phosphorylation during REM sleep: implications for REM sleep and memory consolidation.

    Science.gov (United States)

    Luo, Jie; Phan, Trongha X; Yang, Yimei; Garelick, Michael G; Storm, Daniel R

    2013-04-10

    The cyclic adenosine monophosphate (cAMP), mitogen-activated protein kinase (MAPK), and cAMP response element-binding protein (CREB) transcriptional pathway is required for consolidation of hippocampus-dependent memory. In mice, this pathway undergoes a circadian oscillation required for memory persistence that reaches a peak during the daytime. Because mice exhibit polyphasic sleep patterns during the day, this suggested the interesting possibility that cAMP, MAPK activity, and CREB phosphorylation may be elevated during sleep. Here, we report that cAMP, phospho-p44/42 MAPK, and phospho-CREB are higher in rapid eye movement (REM) sleep compared with awake mice but are not elevated in non-REM sleep. This peak of activity during REM sleep does not occur in mice lacking calmodulin-stimulated adenylyl cyclases, a mouse strain that learns but cannot consolidate hippocampus-dependent memory. We conclude that a preferential increase in cAMP, MAPK activity, and CREB phosphorylation during REM sleep may contribute to hippocampus-dependent memory consolidation.

  6. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    Energy Technology Data Exchange (ETDEWEB)

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon; Kanter, Joan R.; Prabhakar, Shyam; Salomonis, Nathan; Vranizan, Karen; Dubchak Inna,; Conklin, Bruce R.; Insel, Paul A.

    2005-06-01

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrest of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.

  7. Summer Camp of the CERN Staff Association

    CERN Document Server

    Staff Association

    2017-01-01

    A Journey to Discover the Four Elements Over the past few years, the Children’s Day-Care Centre and School (EVEE) of the CERN Staff Association has transformed into a summer camp for the four weeks of July. Every year, this summer camp welcomes up to 40 children from 4 to 6 years old. The camp offers a rich and varied program. This year, the theme was the four elements of life, and the children set out on a journey to discover a different element every week: WATER was the theme of the first week. What is water? What purpose does it serve? Where can we find it? With these questions and many others in mind, the children set out on a cruise, sailing across Lake Geneva to visit the Lake Geneva Museum in Nyon. All through the week, the children were able to discover the different properties of water by carrying out various scientific experiments. For instance, getting soaked can certainly help observe a simple property of water: it’s wet! Giggles guaranteed. The children made fancy hats and e...

  8. Running Boot Camp

    CERN Document Server

    Toporek, Chuck

    2008-01-01

    When Steve Jobs jumped on stage at Macworld San Francisco 2006 and announced the new Intel-based Macs, the question wasn't if, but when someone would figure out a hack to get Windows XP running on these new "Mactels." Enter Boot Camp, a new system utility that helps you partition and install Windows XP on your Intel Mac. Boot Camp does all the heavy lifting for you. You won't need to open the Terminal and hack on system files or wave a chicken bone over your iMac to get XP running. This free program makes it easy for anyone to turn their Mac into a dual-boot Windows/OS X machine. Running Bo

  9. Mealtimes at residential summer camps: What are camp staff doing to promote campers' healthy eating behaviors?

    Science.gov (United States)

    Ventura, Alison K; Anzman-Frasca, Stephanie; Garst, Barry A

    2014-01-01

    To explore camp staff's reports of their interactions with campers during mealtimes at residential summer camps. Thirty-minute semistructured, face-to-face interviews with staff. Two residential summer camps in northeastern Pennsylvania. Fifty-two adult (>18 years of age) staff. Staff's perceived responsibilities, problems encountered, and feeding practices used during camp mealtimes. Qualitative interviews were analyzed using a hybrid analysis approach that combined deductive directed content analysis with inductive thematic analysis to identify themes and subthemes. The majority of staff indicated their responsibility during mealtimes was to ensure that campers eat. Common problems mentioned were campers' tendencies toward picky eating and overeating. Staff reported a number of strategies to deal with common mealtime problems including reasoning, modeling, limits or rules, punishment/contingencies, and responding to campers' needs/preferences. Most staff expressed concern about promoting campers' healthy eating behaviors. Although staff discussed several mealtime strategies that can be interpreted as adaptive in authoritative contexts, they need more guidance related to what they should and should not do during mealtimes. Avenues for future research to inform the promotion of healthier mealtime behaviors in camps are discussed. Copyright © 2014 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  10. Registration Day-Camp 2016

    CERN Multimedia

    Nursery School

    2016-01-01

    Reminder Registration for the CERN Staff Association Day-camp are open for children from 4 to 6 years old More information on the website: http://nurseryschool.web.cern.ch/. The day-camp is open to all children. An inscription per week is proposed, cost 480.-CHF/week, lunch included The camp will be open weeks 27, 28, 29 and 30, from 8:30 am to 5:30 pm. For further questions, thanks you for contacting us by email at Summer.Camp@cern.ch.

  11. Modeling Reader's Emotional State Response on Document's Typographic Elements

    Directory of Open Access Journals (Sweden)

    Dimitrios Tsonos

    2011-01-01

    Full Text Available We present the results of an experimental study towards modeling the reader's emotional state variations induced by the typographic elements in electronic documents. Based on the dimensional theory of emotions we investigate how typographic elements, like font style (bold, italics, bold-italics and font (type, size, color and background color, affect the reader's emotional states, namely, Pleasure, Arousal, and Dominance (PAD. An experimental procedure was implemented conforming to International Affective Picture System guidelines and incorporating the Self-Assessment Manikin test. Thirty students participated in the experiment. The stimulus was a short paragraph of text for which any content, emotion, and/or domain dependent information was excluded. The Analysis of Variance revealed the dependency of (a all the three emotional dimensions on font size and font/background color combinations and (b the Pleasure dimension on font type and font style. We introduce a set of mapping rules showing how PAD vary on the discrete values of font style and font type elements. Moreover, we introduce a set of equations describing the PAD dimensions' dependency on font size. This novel model can contribute to the automated reader's emotional state extraction in order, for example, to enhance the acoustic rendition of the documents, utilizing text-to-speech synthesis.

  12. No ordinary boot camp.

    Science.gov (United States)

    Tichy, N M

    2001-04-01

    Many companies now run boot camps--comprehensive orientation programs designed to help new hires hit the ground running. They're intense and intimidating, and new employees emerge from them with strong bonds to other recruits and to the organization. But at Trilogy, organizational consultant Noel Tichy discovered one program that's a breed apart. In this article, Tichy gives us a detailed tour of Trilogy's boot camp, Trilogy University, to demonstrate why it's so different--and so effective. Like the best boot camps, it serves as an immersion in both the technical skills new recruits will need for their jobs and Trilogy's corporate culture, which emphasizes risk-taking, teamwork, humility, and a strong customer focus. But this is a new-employee orientation session that's so fundamental to the company as a whole that it's presided over by the CEO and top corporate executives for fully six months of the year. Why? In two three-month sessions, these top executives hone their own strategic thinking about the company as they decide what to teach the new recruits each session. They also find the company's next generation of new products as they judge the innovative ideas the recruits are tasked with developing--making the program Trilogy's main R&D engine. And they pull the company's rising technical stars into mentoring roles for the new recruits, helping to build the next generation of top leadership. After spending months on-site studying Trilogy University, Tichy came away highly impressed by the power of the virtuous teaching cycle the program has set in motion. Leaders of the organization are learning from recruits at the same time that the recruits are learning from the leaders. It's a model, he argues, that other companies would do well to emulate.

  13. Development of finite element models to predict dynamic bridge response.

    Science.gov (United States)

    1997-10-01

    Dynamic response has long been recognized as one of the significant factors affecting the service life and safety of bridge structures. Even though considerable research, both analytical and experimental, has been devoted to dynamic bridge behavior, ...

  14. Summer Camp, July 2016

    CERN Multimedia

    Staff Association

    2016-01-01

    During the month of July, the Staff Association’s Children’s Day-Care Centre and School EVEE held a summer camp for 4- to 6-year-olds. 24 children altogether joined in on the adventures. On the summer camp, the children got to “travel” to a different continent of the world every week. Day after day, they would pass through make-believe Customs upon arrival and get their passports stamped by a “customs officer”. For the first week, we went on a trip to Africa. In the spirit of the theme, the children got to do plenty of crafts and coloring, make their own little bindles and play various games. They even had the chance to visit the Museum of Ethnography in Geneva (MEG), learn to play the balafon and make musical instruments with Sterrenlab. For the second week, we set off to discover the Americas, exploring both the South and the North. Alongside different workshops (singing, dancing, storytelling, crafts), the children could enjoy several special ac...

  15. Systems biology investigation of cAMP modulation to increase SMN levels for the treatment of spinal muscular atrophy.

    Directory of Open Access Journals (Sweden)

    Sean G Mack

    Full Text Available Spinal muscular atrophy (SMA, a leading genetic cause of infant death worldwide, is an autosomal recessive disorder caused by the loss of SMN1 (survival motor neuron 1, which encodes the protein SMN. The loss of SMN1 causes a deficiency in SMN protein levels leading to motor neuron cell death in the anterior horn of the spinal cord. SMN2, however, can also produce some functional SMN to partially compensate for loss of SMN1 in SMA suggesting increasing transcription of SMN2 as a potential therapy to treat patients with SMA. A cAMP response element was identified on the SMN2 promoter, implicating cAMP activation as a step in the transcription of SMN2. Therefore, we investigated the effects of modulating the cAMP signaling cascade on SMN production in vitro and in silico. SMA patient fibroblasts were treated with the cAMP signaling modulators rolipram, salbutamol, dbcAMP, epinephrine and forskolin. All of the modulators tested were able to increase gem formation, a marker for SMN protein in the nucleus, in a dose-dependent manner. We then derived two possible mathematical models simulating the regulation of SMN2 expression by cAMP signaling. Both models fit well with our experimental data. In silico treatment of SMA fibroblasts simultaneously with two different cAMP modulators resulted in an additive increase in gem formation. This study shows how a systems biology approach can be used to develop potential therapeutic targets for treating SMA.

  16. PDE4-Mediated cAMP Signalling

    Directory of Open Access Journals (Sweden)

    Bracy A. Fertig

    2018-01-01

    Full Text Available cAMP is the archetypal and ubiquitous second messenger utilised for the fine control of many cardiovascular cell signalling systems. The ability of cAMP to elicit cell surface receptor-specific responses relies on its compartmentalisation by cAMP hydrolysing enzymes known as phosphodiesterases. One family of these enzymes, PDE4, is particularly important in the cardiovascular system, where it has been extensively studied and shown to orchestrate complex, localised signalling that underpins many crucial functions of the heart. In the cardiac myocyte, cAMP activates PKA, which phosphorylates a small subset of mostly sarcoplasmic substrate proteins that drive β-adrenergic enhancement of cardiac function. The phosphorylation of these substrates, many of which are involved in cardiac excitation-contraction coupling, has been shown to be tightly regulated by highly localised pools of individual PDE4 isoforms. The spatial and temporal regulation of cardiac signalling is made possible by the formation of macromolecular “signalosomes”, which often include a cAMP effector, such as PKA, its substrate, PDE4 and an anchoring protein such as an AKAP. Studies described in the present review highlight the importance of this relationship for individual cardiac PKA substrates and we provide an overview of how this signalling paradigm is coordinated to promote efficient adrenergic enhancement of cardiac function. The role of PDE4 also extends to the vascular endothelium, where it regulates vascular permeability and barrier function. In this distinct location, PDE4 interacts with adherens junctions to regulate their stability. These highly specific, non-redundant roles for PDE4 isoforms have far reaching therapeutic potential. PDE inhibitors in the clinic have been plagued with problems due to the active site-directed nature of the compounds which concomitantly attenuate PDE activity in all highly localised “signalosomes”.

  17. Moral Responsibility: The Missing Element in Educational Leadership

    Science.gov (United States)

    Vasillopulos, Christopher; Denney, Morgan

    2013-01-01

    We intend to deepen the understanding of leadership in general and educational leadership in particular by an analysis of Chester Barnard's (1938) concept of executive responsibility. By so doing we believe that we will reveal how an educational leader can foster the environment in which competent teachers can optimize their students' learning…

  18. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells.

    Science.gov (United States)

    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W; Hussain, Arif; Ross, Douglas D

    2015-03-01

    Phosphorylated cyclic-AMP (cAMP) response element binding protein (p-CREB) is a downstream effector of a variety of important signaling pathways. We investigated whether the human BCRP promoter contains a functional cAMP response element (CRE). 8Br-cAMP, a cAMP analogue, increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Epidermal growth factor receptor (EGFR) pathway activation also led to an increase in p-CREB and in BCRP promoter reporter activity via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound p-CREB by a point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in several human cancer cell lines following activation of multiple cancer-relevant signaling pathways. Published by Elsevier B.V.

  19. Exploring early twenty-first century developed forest camping experiences and meanings

    Science.gov (United States)

    Barry A. Garst; Daniel R. Williams; Joseph W. Roggenbuck

    2010-01-01

    This study examines experiences and associated meanings of 38 family groups participating in developed camping. The analysis is guided by discursive social psychology in which expressed meanings reflect interpretive frames campers use to explain experiences. Key elements of camping experience include nature, social interaction, and comfort/convenience. The most common...

  20. Assessing Disaster Preparedness Among Select Children's Summer Camps in the United States and Canada.

    Science.gov (United States)

    Chang, Megan; Sielaff, Alan; Bradin, Stuart; Walker, Kevin; Ambrose, Michael; Hashikawa, Andrew

    2017-08-01

    Children's summer camps are at risk for multiple pediatric casualties during a disaster. The degree to which summer camps have instituted disaster preparedness is unknown. We assessed disaster preparedness among selected camps nationally for a range of disasters. We partnered with a national, web-based electronic health records system to send camp leadership of 315 camp organizations a 14-question online survey of disaster preparedness. One response from each camp was selected in the following order of importance: owner, director, physician, nurse, medical technician, office staff, and other. The results were analyzed using descriptive statistics. A total of 181 camps responses were received, 169 of which were complete. Camp types were overnight (60%), day (21%), special/medical needs (14%), and other (5%). Survey respondents were directors (52%), nurses (14%), office staff (10%), physicians (5%), owners (5%), emergency medical technicians (2%), and other (12%). Almost 18% of camps were located >20 mi from a major medical center, and 36% were >5 mi from police/fire departments. Many camps were missing emergency supplies: car/booster seats for evacuation (68%), shelter (35%), vehicles for evacuation (26%), quarantine isolation areas (21%), or emergency supplies of extra water (20%) or food (17%). Plans were unavailable for the following: power outages (23%); lockdowns (15%); illness outbreaks (15%); tornadoes (11%); evacuation for fire, flood, or chemical spill (9%); and other severe weather (8%). Many camps did not have online emergency plans (53%), plans for children with special/medical needs (38%), methods to rapidly communicate information to parents (25%), or methods to identify children for evacuation/reunification with parents (40%). Respondents reported that staff participation in disaster drills varied for weather (58%), evacuations (46%), and lockdowns (36%). The majority (75%) of respondents had not collaborated with medical organizations for planning. A

  1. Benefits of attending a summer camp for children with inflammatory bowel disease.

    Science.gov (United States)

    Salazar, Guadalupe; Heyman, Melvin B

    2014-07-01

    The aim of the present study was to investigate knowledge of pediatric patients with inflammatory bowel disease (IBD) and perceptions of Camp Gut Busters, an IBD summer camp. The present ethnographic study uses traditional anthropological methods to investigate participants' knowledge and perceptions of Camp Gut Busters. Data were gathered using in-depth qualitative interviews, participant observation during 4 Camp Gut Busters summer sessions, and attendance records for the summer camp. Participants either attended Camp Gut Busters (campers) or did not attend (noncampers). Campers' knowledge and perceptions were based on their actual experience at Camp Gut Busters, whereas those of noncampers were based on their expectations of camp. Participant responses reference their illness experience with IBD, their struggles of learning to live with a chronic condition, and the benefits of attending a disease-specific camp. Campers addressed notions of identity, the isolation associated with having a potentially stigmatizing chronic condition, therapeutic routines, and awareness of IBD. Noncampers focused on discomfort with IBD and their identity as an individual and child with the disease. Pediatric patients with IBD who attended a disease-specific summer camp benefited from the experience. Exposure to peers with similar therapeutic routines and to the range of IBD helped campers build an empathetic social network and introduced a new perspective on their disease. Attending a disease-specific camp helps pediatric patients with IBD in psychosocial adjustment and acquisition of knowledge about their disease. Ultimately, it helps them learn to live with their chronic condition.

  2. Elements that define the social responsibility of a product

    Directory of Open Access Journals (Sweden)

    Francesc Xavier Espinach

    2014-01-01

    Full Text Available La investigación se fundamenta en las relaciones entre los procesos de diseño, los productos que son el resultado y los actores necesarios que son causantes o resultan afectados. Averigua qué concepto tienen los diseñadores y las empresas sobre Producto Socialmente Responsable (PSR y cómo el hecho de tenerlo en cuenta puede repercutir en el desarrollo de su trabajo. La investigación construye un marco teórico, analizando las tareas de los profesionales expertos y el modo en cómo desarrollan su trabajo. Se concreta en un análisis cualitativo realizado mediante la Grounded Theory y el estudio de casos. Se han efectuado entrevistas a diseñadores junior y empresas, triangulando posteriormente los resultados con las opiniones de expertos. Los principales resultados han sido la especificación de las categorías necesarias para que un producto pueda ser considerado Socialmente Responsable, junto a la propuesta de incluir dichas categorías en la especificación básica de los productos.

  3. Integrating iron and oxygen/antioxidant signals via a combinatorial array of DNA - (antioxidant response elements) and mRNA (iron responsive elements) sequences.

    Science.gov (United States)

    Theil, Elizabeth C

    2006-12-01

    Fe (cellular iron), O (dioxygen, antioxidant inducers, hydrogen peroxide), and P (protein phosphorylation) signals combine to regulate DNA activity (transcription/mRNA synthesis) for antioxidant/Phase II response proteins (e.g., ferritin H, ferritin L, thioredoxin reductase I, NAD(P)H quinone oxido-reductase, heme oxygenase1 and beta-globin) and mRNA activity for proteins of iron transport, storage or oxygen metabolism (e.g., ferritin H, ferritin L, transferrin receptor1, ferroportin, mt-aconitase-TCA cycle and aminolevulinate synthase - heme biosynthesis). Ferritin regulation links the two groups of genetic controls via DNA (ARE-antioxidant response element) and mRNA (IRE-iron responsive element) structures. More is known about the IRE-mRNA and protein repressors, IRPs (iron regulatory proteins/aconitase homologues), than the DNA-ARE and protein repressors, e.g., Bach1. Iron responsive elements are very similar (65-80% sequence identity), but each mRNA has sufficient IRE specificity (>90% phylogenetic sequence conservation), that IRP binding and signal responses vary quantitatively. The structural specificity of each IRE-RNA provides an opportunity for finding small molecule regulators in vitro, and possibly in vivo. The potential of manipulating mRNA function with small molecules targeted to specific RNA regulatory structures, e.g., ferritin mRNA in iron overload, or viral mRNA control structures for replication, is high.

  4. Novel mechanisms and signaling pathways of esophageal ulcer healing: the role of prostaglandin EP2 receptors, cAMP, and pCREB.

    Science.gov (United States)

    Ahluwalia, Amrita; Baatar, Dolgor; Jones, Michael K; Tarnawski, Andrzej S

    2014-09-15

    Clinical studies indicate that prostaglandins of E class (PGEs) may promote healing of tissue injury e.g., gastroduodenal and dermal ulcers. However, the precise roles of PGEs, their E-prostanoid (EP) receptors, signaling pathways including cAMP and cAMP response element-binding protein (CREB), and their relation to VEGF and angiogenesis in the tissue injury healing process remain unknown, forming the rationale for this study. Using an esophageal ulcer model in rats, we demonstrated that esophageal mucosa expresses predominantly EP2 receptors and that esophageal ulceration triggers an increase in expression of the EP2 receptor, activation of CREB (the downstream target of the cAMP signaling), and enhanced VEGF gene expression. Treatment of rats with misoprostol, a PGE1 analog capable of activating EP receptors, enhanced phosphorylation of CREB, stimulated VEGF expression and angiogenesis, and accelerated esophageal ulcer healing. In cultured human esophageal epithelial (HET-1A) cells, misoprostol increased intracellular cAMP levels (by 163-fold), induced phosphorylation of CREB, and stimulated VEGF expression. A cAMP analog (Sp-cAMP) mimicked, whereas an inhibitor of cAMP-dependent protein kinase A (Rp-cAMP) blocked, these effects of misoprostol. These results indicate that the EP2/cAMP/protein kinase A pathway mediates the stimulatory effect of PGEs on angiogenesis essential for tissue injury healing via the induction of CREB activity and VEGF expression.

  5. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    Directory of Open Access Journals (Sweden)

    Pei-Chi Yang

    2016-07-01

    Full Text Available Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and

  6. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  7. Slave Labor Camps of the Third Reich.

    Science.gov (United States)

    Stone, Adolf

    1983-01-01

    Describes the ground rules used by Nazi architects in choosing the sites for slave labor camps. While some, like Auschwitz, became extermination camps, others also produced armaments. One camp, Theresienstadt, became a "model" camp to show to reporters and Red Cross representatives. (CS)

  8. A cAMP and CREB-mediated feed-forward mechanism regulates GSK3β in polycystic kidney disease.

    Science.gov (United States)

    Kakade, Vijayakumar R; Tao, Shixin; Rajagopal, Madhumitha; Zhou, Xia; Li, Xiaogang; Yu, Alan S L; Calvet, James P; Pandey, Pankaj; Rao, Reena

    2016-12-01

    Glycogen synthase kinase 3β (GSK3β), a serine/threonine protein kinase, is commonly known to be regulated at the level of its activity. However, in some diseases including polycystic kidney disease (PKD), GSK3β expression is increased and plays a pathophysiological role. The current studies aimed to determine the mechanism for the increased GSK3β expression in PKD and its significance to disease progression. In mouse models of PKD, increases in renal GSK3β corresponded with increases in renal cAMP levels and disease progression. In vivo and in vitro studies revealed that GSK3β is a cAMP-responsive gene, and elevated cAMP levels, as seen in PKD, can increase GSK3β expression. In normal mice, vasopressin signaling induced by water deprivation increased GSK3β expression, which decreased following rehydration. Examination of the GSK3β promoter revealed five potential binding sites for the transcription factor, cAMP response element binding protein (CREB). CREB was found to bind to GSK3β promoter and essential for cAMP-mediated regulation of GSK3β. Importantly, this regulation was demonstrated to be part of a feed-forward loop in which cAMP through CREB regulates GSK3β expression, and GSK3β in turn positively regulates cAMP generation. GSK3β or CREB inhibition reduced transepithelial fluid secretion and cyst expansion in vitro Thus, disruption at any point of this destructive cycle may be therapeutically useful to reduce cyst expansion and preserve renal function in PKD. © The Author (2016). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

  9. Residential summer camp: a new venue for nutrition education and physical activity promotion.

    Science.gov (United States)

    Ventura, Alison K; Garst, Barry A

    2013-05-24

    Millions of children attend residential summer camps each year. However, few studies have examined the potential of camps for obesity prevention efforts. Research in the domain of positive youth development has shown that camp programs as short as one week have both short- and long-term positive effects on self-esteem, self-efficacy and other youth outcomes. The objective of the present study was to highlight the potential of resident camps as promising venues for the promotion of healthy eating and physical activity behaviors in the children who attend. Data for this study came from the American Camp Association 2007 Emerging Issues Survey. This survey assessed camp professionals' perspectives on a diverse array of issues, including the healthy eating and physical activity of children. Data analysis focused on responses from 247 camp professionals whose camps offered resident camp programs. Descriptive and Chi-square statistics were calculated. Ninety-two percent of camp professionals reported that the healthy eating and physical activity of campers was an "important" or "very important" issue for camps. The majority of camps reported offering vegetarian options, healthy snacks and salad bars, and allergen-free options. Additionally, 86% of camp professionals indicated that they had implemented one or more strategies to address concerns related to the unhealthy eating behaviors of children, with top strategies including increasing the availability of fruits and vegetables, increasing the availability of healthy drink options, and improving the nutritional quality of menus. Fewer camp professionals (50%) indicated they had implemented strategies to increase children's physical activity levels, but many professionals indicated that their camp programs were inherently active and additional strategies to promote physical activity were not necessary. Associations were found between camp affiliation and food options available to campers. The majority of camp

  10. YMCA ROCKET RAMPAGE! SUMMER CAMP

    National Research Council Canada - National Science Library

    Anonymous

    2014-01-01

    ... & Controls, sponsored the Rocket Rampagel summer camp at the YMCA in Eklton MD. On day 1, campers took Rockets 101, constructing balloon rockets and straw rockets, followed by racket manufacturing, where campers made rocket "propellant" on day 2...

  11. Registration Day-Camp 2016

    CERN Document Server

    Nursery School

    2016-01-01

    Registration for the CERN SA Day-camp are open for children from 4 to 6 years old From March 14 to 25 for children already enrolled in CERN SA EVE and School From April 4 to 15 for the children of CERN members of the personnel (MP) From April 18 for other children More information on the website: http://nurseryschool.web.cern.ch/. The day-camp is open to all children. An inscription per week is proposed, cost 480.-CHF/week, lunch included The camp will be open weeks 27, 28, 29 and 30, from 8:30 am to 5:30 pm. For further questions, thanks you for contacting us by email at Summer.Camp@cern.ch.

  12. Base Camp Architecture

    Directory of Open Access Journals (Sweden)

    Warebi Gabriel Brisibe

    2016-03-01

    Full Text Available Longitudinal or time line studies of change in the architecture of a particular culture are common, but an area still open to further research is change across space or place. In particular, there is need for studies on architectural change of cultures stemming from the same ethnic source split between their homeland and other Diasporas. This change may range from minor deviations to drastic shifts away from an architectural norm and the accumulation of these shifts within a time frame constitutes variations. This article focuses on identifying variations in the architecture of the Ijo fishing group that migrates along the coastline of West Africa. It examines the causes of cross-cultural variation between base camp dwellings of Ijo migrant fishermen in the Bakassi Peninsula in Cameroon and Bayelsa State in Nigeria. The study draws on the idea of the inevitability of cultural and social change over time as proposed in the theories of cultural dynamism and evolution. It tests aspects of cultural transmission theory using the principal coordinates analysis to ascertain the possible causes of variation. From the findings, this research argues that migration has enhanced the forces of cultural dynamism, which have resulted in significant variations in the architecture of this fishing group.

  13. Pliable DNA Conformation of Response Elements Bound to Transcription Factor p63*

    Science.gov (United States)

    Chen, Chen; Gorlatova, Natalia; Herzberg, Osnat

    2012-01-01

    We show that changes in the nucleotide sequence alter the DNA conformation in the crystal structures of p63 DNA-binding domain (p63DBD) bound to its response element. The conformation of a 22-bp canonical response element containing an AT spacer between the two half-sites is unaltered compared with that containing a TA spacer, exhibiting superhelical trajectory. In contrast, a GC spacers abolishes the DNA superhelical trajectory and exhibits less bent DNA, suggesting that increased GC content accompanies increased double helix rigidity. A 19-bp DNA, representing an AT-rich response element with overlapping half-sites, maintains superhelical trajectory and reveals two interacting p63DBD dimers crossing one another at 120°. p63DBD binding assays to response elements of increasing length complement the structural studies. We propose that DNA deformation may affect promoter activity, that the ability of p63DBD to bind to superhelical DNA suggests that it is capable of binding to nucleosomes, and that overlapping response elements may provide a mechanism to distinguish between p63 and p53 promoters. PMID:22247550

  14. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings.......This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries....... The publication is an internal Annex report. With a focus on innovative building elements that dynamically respond to changes in climate and user demands, the report describes materials, components and systems that have been tested in laboratories and buildings around the world. This report is aimed...

  15. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  16. 5D imaging approaches reveal the formation of distinct intracellular cAMP spatial gradients

    Science.gov (United States)

    Rich, Thomas C.; Annamdevula, Naga; Trinh, Kenny; Britain, Andrea L.; Mayes, Samuel A.; Griswold, John R.; Deal, Joshua; Hoffman, Chase; West, Savannah; Leavesley, Silas J.

    2017-02-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions. Several lines of evidence suggest that the distribution of cAMP within cells is not uniform. However, to date, no studies have measured the kinetics of 3D cAMP distributions within cells. This is largely due to the low signal-tonoise ratio of FRET-based probes. We previously reported that hyperspectral imaging improves the signal-to-noise ratio of FRET measurements. Here we utilized hyperspectral imaging approaches to measure FRET signals in five dimensions (5D) - three spatial (x, y, z), wavelength (λ), and time (t) - allowing us to visualize cAMP gradients in pulmonary endothelial cells. cAMP levels were measured using a FRET-based sensor (H188) comprised of a cAMP binding domain sandwiched between FRET donor and acceptor - Turquoise and Venus fluorescent proteins. We observed cAMP gradients in response to 0.1 or 1 μM isoproterenol, 0.1 or 1 μM PGE1, or 50 μM forskolin. Forskolin- and isoproterenol-induced cAMP gradients formed from the apical (high cAMP) to basolateral (low cAMP) face of cells. In contrast, PGE1-induced cAMP gradients originated from both the basolateral and apical faces of cells. Data suggest that 2D (x,y) studies of cAMP compartmentalization may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D (x,y,z) studies are required to assess mechanisms of signaling specificity. Results demonstrate that 5D imaging technologies are powerful tools for measuring biochemical processes in discrete subcellular domains.

  17. Responses of Trace Elements to Aerobic Maximal Exercise in Elite Sportsmen

    Science.gov (United States)

    OTAĞ, Aynur; HAZAR, Muhsin; OTAĞ, İlhan; Gürkan, Alper Cenk; Okan, İlyas

    2014-01-01

    Trace elements are chemical elements needed in minute quantities for the proper growth, development, and physiology of the organism. In biochemistry, a trace element is also referred to as a micronutrient. Trace elements, such as nickel, cadmium, aluminum, silver, chromium, molybdenum, germanium, tin, titanium, tungsten, scandium, are found naturally in the environment and human exposure derives from a variety of sources, including air, drinking water and food. The Purpose of this study was investigated the effect of aerobic maximal intensity endurance exercise on serum trace elements as well-trained individuals of 28 wrestlers (age (year) 19.64±1.13, weight (Kg) 70.07 ± 15.69, height (cm) 176.97 ± 6.69) during and after a 2000 meter Ergometer test protocol was used to perform aerobic (75 %) maximal endurance exercise. Trace element serum levels were analyzed from blood samples taken before, immediately after and one hour after the exercise. While an increase was detected in Chromium (Cr), Nickel (Ni), Molybdenum (Mo) and Titanium (Ti) serum levels immediately after the exercise, a decrease was detected in Aluminum (Al), Scandium (Sc) and Tungsten (W) serum levels. Except for aluminum, the trace elements we worked on showed statistically meaningful responses (Ptrace elements to the exercise showed us the selection and application of the convenient sport is important not only in terms of sportsman performance but also in terms of future healthy life plans and clinically. PMID:24762350

  18. Camp for Youth With Type 1 Diabetes.

    Science.gov (United States)

    Fegan-Bohm, Kelly; Weissberg-Benchell, Jill; DeSalvo, Daniel; Gunn, Sheila; Hilliard, Marisa

    2016-08-01

    Camps for youth with type 1 diabetes (T1D) have grown in size and scope since they first emerged in the 1920s. Anecdotal evidence suggests that attending camp with other youth with T1D is beneficial, largely attributed to sharing fun, active experiences and removing the isolation of living with diabetes. However, few studies have evaluated the psychosocial and medical impacts of T1D camp attendance during and after camp sessions. In addition, T1D camps have been a setting for numerous studies on a variety of T1D-related research questions not related to camp itself, such as testing novel diabetes management technologies in an active, non-laboratory setting. This paper reviews the evidence of psychosocial and medical outcomes associated with T1D camp attendance across the globe, provides an overview of other research conducted at camp, and offers recommendations for future research conducted at T1D camp.

  19. Residential summer camp intervention improves camp food environment.

    Science.gov (United States)

    Di Noia, Jennifer; Orr, Lynne; Byrd-Bredbenner, Carol

    2014-07-01

    To evaluate the effects on fruit and vegetable (FV) intake of a camp-based intervention to improve the food environment. The intervention was evaluated in a variant of the recurrent institutional cycle design in a sample of 311 youth aged 7 to 13 years. FV intake and targeted environmental variables were assessed among youth who received the intervention relative to those who attended the camp before the program was implemented. Improvements occurred in the frequency and variety of FVs served, counselor informational and instrumental support for FV consumption, and in older youth who received nutrition education lessons, perceived peer attitudes towards eating FVs and FV intake. Improving the camp food environment can improve FV intake among youth in this setting.

  20. Cellular responses of osteoblast-like cells to 17 elemental metals.

    Science.gov (United States)

    Zhang, Dongmei; Wong, Cynthia S; Wen, Cuie; Li, Yuncang

    2017-01-01

    Elemental metals have been widely used to alloy metallic orthopedic implants. However, there is still insufficient research data elucidating the cell responses of osteoblastic cells to alloying elemental metals, which impedes the development of new metallic implant materials. In this study, the cellular responses of osteoblast-like cells (SaOS2) to 17 pure alloying elemental metals, that is, titanium (Ti), zirconium (Zr), hafnium (Hf), vanadium (V), niobium (Nb), tantalum (Ta), chromium (Cr), molybdenum (Mo), manganese (Mn), iron (Fe), ruthenium (Ru), cobalt (Co), nickel (Ni), copper (Cu), zinc (Zn), silicon (Si), and tin (Sn) were comparatively investigated in vitro. Cellular responses including intracellular total protein synthesis and collagen content, cell adhesion, cell proliferation, and alkaline phosphatase (ALP) activity on these elemental metals were systematically assessed and compared. It was found that these elemental metals could be categorized into three groups based on the cellular functions on them. Group 1, including Ti, Zr, Hf, Nb, Ta, Cr, Ru, and Si, showed excellent cell proliferation and varied ALP activity for SaOS2 cells. Cells exposed to Group 2, including Mo and Sn, although initially attached and grew, did not proliferate over time. In contrast, Group 3, including V, Mn, Fe, Co, Ni, Cu, and Zn, showed severe cytotoxicity toward SaOS2 cells. It is vital to consider the cell responses to the elemental metals when designing a new metallic implant material and the findings of this study provide insights into the biological performance of the elemental metals. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 148-158, 2017. © 2016 Wiley Periodicals, Inc.

  1. Management of diabetes at summer camps.

    Science.gov (United States)

    Ciambra, Roberta; Locatelli, Chiara; Suprani, Tosca; Pocecco, Mauro

    2005-01-01

    We report our experience in the organization of diabetic children summer-camps since 1973. Guidelines for organization have been recently reported by the SIEDP (Società Italiana di Endocrinologia e Diabetologia Pediatrica). Our attention is focused on diabetes management at camp, organization and planning, medical staff composition and staff training, treatment of diabetes-related emergencies, written camp management plan, diabetes education and psychological issues at camp, prevention of possible risks, assessment of effectiveness of education in summer camps and research at camp.

  2. The Popeye Domain Containing Genes and cAMP Signaling

    Directory of Open Access Journals (Sweden)

    Thomas Brand

    2014-05-01

    Full Text Available 3'-5'-cyclic adenosine monophosphate (cAMP is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs. Initially, it was thought that protein kinase A (PKA exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC and hyperpolarizing cyclic nucleotide-gated (HCN channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins.

  3. Pounding Effects on the Earthquake Response of Adjacent Reinforced Concrete Structures Strengthened by Cable Elements

    Science.gov (United States)

    Liolios, Angelos; Liolios, Asterios; Hatzigeorgiou, George; Radev, Stefan

    2014-06-01

    A numerical approach for estimating the effects of pounding (seismic interaction) on the response of adjacent Civil Engineering structures is presented. Emphasis is given to reinforced concrete (RC) frames of existing buildings which are seismically strengthened by cable-elements. A double discretization, in space by the Finite Element Method and in time by a direct incremental approach is used. The unilateral behaviours of both, the cable-elements and the interfaces contact-constraints, are taken strictly into account and result to inequality constitutive conditions. So, in each time-step, a non-convex linear complementarity problem is solved. It is found that pounding and cable strengthening have significant effects on the earthquake response and, hence, on the seismic upgrading of existing adjacent RC structures.

  4. Strategies for Developing a University-Sponsored Youth Sports Summer Camp

    Science.gov (United States)

    Walsh, David

    2011-01-01

    During the summer, universities have the ability to offer on-campus camps that serve the health, physical activity, and educational needs of youths. However, the tasks, responsibilities, time, and knowledge needed to run a camp can be overwhelming. This article describes the administrative components of the lessons learned from the development of…

  5. Functional analysis of the complex trans-activating response element RNA structure in simian immunodeficiency virus

    NARCIS (Netherlands)

    Centlivre, Mireille; Klaver, Bep; Berkhout, Ben; Das, Atze T.

    2008-01-01

    Transcription of human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) is activated through binding of the viral Tat protein to the trans-activating response (TAR) element at the 5 ' end of the nascent transcript. Whereas HIV type 1 (HIV-1) TAR folds a simple hairpin structure,

  6. Investigating the functionality of an OCT4-short response element in human induced pluripotent stem cells

    Directory of Open Access Journals (Sweden)

    Agustin Vega-Crespo

    2016-01-01

    Full Text Available Pluripotent stem cells offer great therapeutic promise for personalized treatment platforms for numerous injuries, disorders, and diseases. Octamer-binding transcription factor 4 (OCT4 is a key regulatory gene maintaining pluripotency and self-renewal of mammalian cells. With site-specific integration for gene correction in cellular therapeutics, use of the OCT4 promoter may have advantages when expressing a suicide gene if pluripotency remains. However, the human OCT4 promoter region is 4 kb in size, limiting the capacity of therapeutic genes and other regulatory components for viral vectors, and decreasing the efficiency of homologous recombination. The purpose of this investigation was to characterize the functionality of a novel 967bp OCT4-short response element during pluripotency and to examine the OCT4 titer-dependent response during differentiation to human derivatives not expressing OCT4. Our findings demonstrate that the OCT4-short response element is active in pluripotency and this activity is in high correlation with transgene expression in vitro, and the OCT4-short response element is inactivated when pluripotent cells differentiate. These studies demonstrate that this shortened OCT4 regulatory element is functional and may be useful as part of an optimized safety component in a site-specific gene transferring system that could be used as an efficient and clinically applicable safety platform for gene transfer in cellular therapeutics.

  7. Suppression of programmed cell death by intracellular cAMP is not mediated by expression of genes encoding an inhibitor of apoptosis.

    Science.gov (United States)

    Taurin, S; Ryazhsky, G G; Maximova, N V; Chuchalin, A G; Hamet, P; Pshezhetsky, A V; Orlov, S N

    2002-02-01

    The elevation of intracellular cAMP content is accompanied by expression of genes whose promoter contains a Ca(2+)-cAMP responsive element. In vascular smooth muscle cells (VSMC), activation of cAMP signaling blocks apoptosis triggered by serum deprivation. In the present study we investigated the role of gene expression in the inhibition of apoptosis by cAMP. In VSMC transfected with E1A adenovirus, incubation in the absence of serum for 6 h led to 20-fold elevation of chromatin fragmentation and 10-fold activation of caspase-3 activity, these being employed as markers of apoptosis. Forskolin-induced activation of cAMP signaling was accompanied by 50% elevation of RNA synthesis and completely abolished the development of apoptosis during the initial 6 h incubation in growth factor-free medium. In 12 h apoptosis in forskolin-treated VSMC was slowly developed and after 24 h the content of chromatin fragments was 2-fold less than in control cells. Addition of actinomycin D and cycloheximide completely blocked RNA synthesis and decreased protein synthesis by 80%, respectively. Neither compound affected baseline apoptosis or its inhibition by forskolin. More than 70 newly phosphorylated proteins were observed by 2D-electrophoresis of VSMC after incubation with forskolin for 3 h; in 24 h the number of phosphoproteins triggered by forskolin was decreased by 2-3-fold. These results show that suppression of VSMC apoptosis under activation of cAMP signaling is mediated via posttranslational modification of pre-existing intermediates of the apoptotic machinery rather than by de novo synthesis of inhibitors of programmed cell death.

  8. From Refugee Camp to Resilient City: Zaatari Refugee Camp, Jordan

    Directory of Open Access Journals (Sweden)

    Nada Maani

    2017-02-01

    Full Text Available This project is about how architecture can transform a refugee camp into a child friendly city designed around existing social networks. The vision is to respond to the refugee crisis with long-term resilient solutions rather than reactionary ones. 

  9. Concussion in professional football: brain responses by finite element analysis: part 9.

    Science.gov (United States)

    Viano, David C; Casson, Ira R; Pellman, Elliot J; Zhang, Liying; King, Albert I; Yang, King H

    2005-11-01

    Brain responses from concussive impacts in National Football League football games were simulated by finite element analysis using a detailed anatomic model of the brain and head accelerations from laboratory reconstructions of game impacts. This study compares brain responses with physician determined signs and symptoms of concussion to investigate tissue-level injury mechanisms. The Wayne State University Head Injury Model (Version 2001) was used because it has fine anatomic detail of the cranium and brain with more than 300,000 elements. It has 15 different material properties for brain and surrounding tissues. The model includes viscoelastic gray and white brain matter, membranes, ventricles, cranium and facial bones, soft tissues, and slip interface conditions between the brain and dura. The cranium of the finite element model was loaded by translational and rotational accelerations measured in Hybrid III dummies from 28 laboratory reconstructions of NFL impacts involving 22 concussions. Brain responses were determined using a nonlinear, finite element code to simulate the large deformation response of white and gray matter. Strain responses occurring early (during impact) and mid-late (after impact) were compared with the signs and symptoms of concussion. Strain concentration "hot spots" migrate through the brain with time. In 9 of 22 concussions, the early strain "hot spots" occur in the temporal lobe adjacent to the impact and migrate to the far temporal lobe after head acceleration. In all cases, the largest strains occur later in the fornix, midbrain, and corpus callosum. They significantly correlated with removal from play, cognitive and memory problems, and loss of consciousness. Dizziness correlated with early strain in the orbital-frontal cortex and temporal lobe. The strain migration helps explain coup-contrecoup injuries. Finite element modeling showed the largest brain deformations occurred after the primary head acceleration. Midbrain strain

  10. Music in Concentration Camps 1933-1945

    National Research Council Canada - National Science Library

    Fackler, Guido

    2007-01-01

    The author addresses the topic of musical activities in the German concentration camps from 1933 to 1945, focusing on those camps that the Nazi regime started to erect just a few weeks after Hitler's assumption of power...

  11. Identification and Characterization of Cyclic AMP Response Element-Binding Protein H Response Element in the Human Apolipoprotein A5 Gene Promoter

    Directory of Open Access Journals (Sweden)

    Kwang Hoon Song

    2013-01-01

    Full Text Available The cyclic AMP response element-binding protein H (CREBH plays important roles in hepatic lipogenesis, fatty acid oxidation, and lipolysis under metabolic stress. Here, we report CREBH as a novel regulator of human APOA5. Knockdown of endogenous CREBH expression via small interfering RNA resulted in the downregulation of human APOA5 mRNA expression in human hepatoma cells, HepG2. Sequence analysis suggested that putative CREBH response element (CREBHRE is located in the human APOA5 promoter region and is highly conserved in both human and rodent. To clarify whether the human APOA5 promoter is regulated by CREBH, we analyzed the human APOA5 promoter region using a transient transfection assay and determined that transfection of CREBH induced human APOA5 promoter activity. Moreover, it was shown that CREBH directly regulated human APOA5 gene expression by binding to a unique CREBHRE located in the proximal human APOA5 promoter region, using 5′-deletion and mutagenesis of human APOA5 promoter analysis and chromatin immunoprecipitation assay. Taken together, our results demonstrated that human APOA5 is directly regulated by CREBH via CREBHRE and provided a new insight into the role of this liver-specific bZIP transcription factor in lipoprotein metabolism and triglyceride homeostasis.

  12. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Directory of Open Access Journals (Sweden)

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  13. Communication, Coping, and Connections: Campers’ and Parents’ Perspectives of Self-Efficacy and Benefits of Participation in Deployment Support Camps

    Directory of Open Access Journals (Sweden)

    Christy D. Clary

    2015-06-01

    Full Text Available Military youth have unique challenges, particularly when a parent is deployed. Camp participation has been linked to multiple positive outcomes, thus camps have become popular as a setting for addressing these youth’s unique needs. With limited existing research on outcomes related to participation, this study explored to what extent participation in OMK camps affected military youth’s self-efficacy for communication, coping, and social skills. Participants responded to an online instrument three months after camp. Both campers and parents reported the largest increase in self-efficacy for communication skills, followed by social skills, and then coping skills. Open-ended responses overwhelmingly supported that developing friendships was one of the greatest benefits of attending a camp. The results are consistent with the literature regarding the importance of connectedness. Recommendations for conducting camps are offered. These finding may also be useful to those working with other special populations in the camp setting.

  14. Dynamic Stationary Response of Reinforced Plates by the Boundary Element Method

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Facundo Sanches

    2007-01-01

    Full Text Available A direct version of the boundary element method (BEM is developed to model the stationary dynamic response of reinforced plate structures, such as reinforced panels in buildings, automobiles, and airplanes. The dynamic stationary fundamental solutions of thin plates and plane stress state are used to transform the governing partial differential equations into boundary integral equations (BIEs. Two sets of uncoupled BIEs are formulated, respectively, for the in-plane state (membrane and for the out-of-plane state (bending. These uncoupled systems are joined to form a macro-element, in which membrane and bending effects are present. The association of these macro-elements is able to simulate thin-walled structures, including reinforced plate structures. In the present formulation, the BIE is discretized by continuous and/or discontinuous linear elements. Four displacement integral equations are written for every boundary node. Modal data, that is, natural frequencies and the corresponding mode shapes of reinforced plates, are obtained from information contained in the frequency response functions (FRFs. A specific example is presented to illustrate the versatility of the proposed methodology. Different configurations of the reinforcements are used to simulate simply supported and clamped boundary conditions for the plate structures. The procedure is validated by comparison with results determined by the finite element method (FEM.

  15. Transcription factor CREB3L1 mediates cAMP and glucocorticoid regulation of arginine vasopressin gene transcription in the rat hypothalamus.

    Science.gov (United States)

    Greenwood, Mingkwan; Greenwood, Michael P; Mecawi, Andre S; Loh, Su Yi; Rodrigues, José Antunes; Paton, Julian F R; Murphy, David

    2015-10-26

    Arginine vasopressin (AVP), a neuropeptide hormone that functions in the regulation of water homeostasis by controlling water re-absorption at kidneys, is synthesised in supraoptic nucleus and paraventricular nucleus of the hypothalamus. An increase in plasma osmolality stimulates secretion of AVP to blood circulation and induces AVP synthesis in these nuclei. Although studies on mechanism of AVP transcriptional regulation in hypothalamus proposed that cAMP and glucocorticoids positively and negatively regulate Avp expression, respectively, the molecular mechanisms have remained elusive. Recently, we identified CREB3L1 (cAMP-responsive element binding protein 3 like 1) as a putative transcription factor of Avp transcription in the rat hypothalamus. However the mechanism of how CREB3L1 is regulated in response of hyperosmotic stress in the neurons of hypothalamus has never been reported. This study aims to investigate effect of previously reported regulators (cAMP and glucocorticoid) of Avp transcription on transcription factor CREB3L1 in order to establish a molecular explanation for cAMP and glucocorticoids effect on AVP expression. The effect of cAMP and glucocorticoid treatment on Creb3l1 was investigated in both AtT20 cells and hypothalamic organotypic cultures. The expression of Creb3l1 was increased in both mRNA and protein level by treatment with forskolin, which raises intracellular cAMP levels. Activation of cAMP by forskolin also increased Avp promoter activity in AtT20 cells and this effect was blunted by shRNA mediated silencing of Creb3l1. The forskolin induced increase in Creb3l1 expression was diminished by combined treatment with dexamethasone, and, in vivo, intraperitoneal dexamethasone injection blunted the increase in Creb3l1 and Avp expression induced by hyperosmotic stress. Here we shows that cAMP and glucocorticoid positively and negatively regulate Creb3l1 expression in the rat hypothalamus, respectively, and regulation of cAMP on AVP

  16. Insulin inhibition of glucocorticoid-stimulated gene transcription: requirement for an insulin response element?

    Science.gov (United States)

    Pierreux, C E; Rousseau, G G; Lemaigre, F P

    1999-01-25

    The glucocorticoid hormone receptor binds to regulatory elements of target genes and activates transcription through interactions with coactivators. For a subset of genes, glucocorticoid receptor activity is inhibited by insulin. The present paper analyzes recent data on the molecular mechanisms whereby insulin exerts this antiglucocorticoid effect. Two models are proposed. In the first model insulin controls the activity of an insulin-responsive factor bound to an insulin-responsive DNA element. In a second model, insulin targets a non-DNA bound coactivator of the glucocorticoid receptor. Here, the gene-specificity of the effect of insulin is conferred by the combined action of the glucocorticoid receptor, of DNA-bound transcription factors and of coactivators, which form a higher order structure that binds to a DNA sequence called glucocorticoid/insulin responsive unit.

  17. Extension Sustainability Camp: Design, Implementation, and Evaluation

    Science.gov (United States)

    Brain, Roslynn; Upton, Sally; Tingey, Brett

    2015-01-01

    Sustainability Camps provide an opportunity for Extension educators to be in the forefront of sustainability outreach and to meet the growing demand for sustainability education. This article shares development, implementation, and evaluation of an Extension Sustainability Camp for youth, grades 4-6. Camp impact was measured via daily pre-and…

  18. Growth potential of the family camping market

    Science.gov (United States)

    W.F. LaPage; W.F. LaPage

    1973-01-01

    A study of the camping market's short-term growth potential, based upon interviews with the heads of 2,003 representative American households. The study estimates the size of the potential camping market and divides it into three segments: those families with a high, medium and low propensity to become campers. The developed camping market is also divided into an...

  19. A Look at Humane Education Summer Camps.

    Science.gov (United States)

    Finch, Patty

    1984-01-01

    Reviews comments of humane education summer camp directors (N=6) who answered the following questions: What is a humane education? Who attends? What do the campers do? Who offers these camps? Why? What are the special challenges of running a camp? What do the campers get out of the experience? (BC)

  20. A finite element large deflection random response analysis of beams and plates subjected to acoustic loading

    Science.gov (United States)

    Mei, Chuh; Chiang, C. K.

    1987-01-01

    A finite element formulation is presented for the analysis of beams and rectangular plates undergoing large deflections subjected to Gaussian white noise excitations. Single-mode response is assumed in the present formulation. Root-mean-square (RMS) maximum deflections for simply supported and clamped beams and plates at various sound spectrum levels are obtained and compared with solutions using the Fokker-Planck-Kolmogorov equation and the equivalent linearization methods. RMS maximum stains and equivalent linear frequencies are compared with the equivalent linearization results for assessment of the accuracy of the finite element method.

  1. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    OpenAIRE

    Khan, Ateeb Ahmad; Naushad Alam, M.; Rahman, Najeeb ur; Wajid, Mustafa

    2016-01-01

    Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM) beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT) with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has ...

  2. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    Energy Technology Data Exchange (ETDEWEB)

    Zuloaga, R. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Fuentes, E.N.; Molina, A. [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile); Valdés, J.A., E-mail: jvaldes@unab.cl [Facultad de Ciencias Biológicas, Universidad Andres Bello, Santiago (Chile); Interdisciplinary Center for Aquaculture Research (INCAR), Víctor Lamas 1290, PO Box 160-C, Concepción (Chile)

    2013-10-18

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

  3. The NAO goes to camp

    NARCIS (Netherlands)

    Wigdor, N.; Fraaije, A.; Solms, L.; Greeff, J. de; Janssen, J.; Blanson Henkemans, O.A.

    2014-01-01

    ALIZ-E is a Europe-wide project focusing on long-term child-robot interaction, specifically as a means of educating diabetic children on their condition. This video showcases a recent field study at "SugarKidsClub", a camp devoted to helping 7-12 year-olds handle type-1 diabetes. A wide range of CRI

  4. Sleep At Camp: A Survey.

    Science.gov (United States)

    Pravda, Myra

    1997-01-01

    Among 40 camp directors surveyed, the majority believed that campers get enough sleep, but that staff members and directors do not get enough sleep. Addresses how sleep deprivation can affect job performance and offers strategies for helping staff understand the importance of sleep to keep them alert and functioning in their job. Includes…

  5. Lyme Disease Comes to Camp.

    Science.gov (United States)

    Peterson, Michael

    1989-01-01

    Describes one summer camp's plan for dealing with Lyme disease. Describes the disease and the deer tick. Recommends avoiding tick exposure through clothing, frequent examination, showers, and avoiding high grass and brushy areas, and using chemical insect repellents and chemicals to kill ticks in deer mouse nests. (DHP)

  6. Surgical camps: the Ugandan experience

    African Journals Online (AJOL)

    of Surgeons of Uganda (ASOU) organised a pilot project in which surgical teams travelled to three hospitals in the Lira and Apac districts of Norhern. Uganda. The objectives of this project or 'Surgical Camp' were the following: 1 to offer free specialised surgical services in three hospitals which had no specialists or regular.

  7. Camp as a Teaching Method in Health Education

    DEFF Research Database (Denmark)

    Ringby, Betina

    Background Camp as a learning activity was introduced in entrepreneurship teaching. Students were engaged to get experiences on how to cope with uncertainty, complexity and to take action in collaboration with external partners. Relevance Society calls for creative and innovative health professio......Background Camp as a learning activity was introduced in entrepreneurship teaching. Students were engaged to get experiences on how to cope with uncertainty, complexity and to take action in collaboration with external partners. Relevance Society calls for creative and innovative health...... and concentration. Responsibility of own and others' learning process in combination with a professional focus seemed to ensure and maintain students’ motivation. Furthermore, CAMP was experienced as a self-governing and dialogue-based way of learning. Conclusions The result comprises important issues of interest...

  8. Academic Boot Camp for the Writing of Psychology Research Reports

    Science.gov (United States)

    Skues, Jason L.; Wise, Lisa

    2014-01-01

    Herein, we describe the implementation of, and responses to, a structured writing workshop in the form of an academic boot camp. Participants were 42 undergraduate psychology students from a medium-sized Australian university who were completing their major assignment for the semester. A majority of the students expressed satisfaction with the…

  9. Creating Diversified Response Profiles from a Single Quenchometric Sensor Element by Using Phase-Resolved Luminescence

    Directory of Open Access Journals (Sweden)

    Elizabeth C. Tehan

    2015-01-01

    Full Text Available We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i can become highly non-linear; (ii yield negative going responses; (iii can be biphasic; and (iv can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions.

  10. Piperine, a component of black pepper, decreases eugenol-induced cAMP and calcium levels in non-chemosensory 3T3-L1 cells.

    Science.gov (United States)

    Yoon, Yeo Cho; Kim, Sung-Hee; Kim, Min Jung; Yang, Hye Jeong; Rhyu, Mee-Ra; Park, Jae-Ho

    2015-01-01

    This study investigated the effects of an ethanol extract of black pepper and its constituent, piperine, on odorant-induced signal transduction in non-chemosensory cells. An ethanol extract of black pepper decreased eugenol-induced cAMP and calcium levels in preadipocyte 3T3-L1 cells with no toxicity. Phosphorylation of CREB (cAMP response element-binding protein) was down-regulated by the black pepper extract. The concentration (133.8 mg/g) and retention time (5.5 min) of piperine in the ethanol extract were quantified using UPLC-MS/MS. Pretreatment with piperine decreased eugenol-induced cAMP and calcium levels in 3T3-L1 cells. Piperine also decreased the phosphorylation of CREB, which is up-regulated by eugenol. These results suggest that piperine inhibits the eugenol-induced signal transduction pathway through modulation of cAMP and calcium levels and phosphorylation of CREB in non-chemosensory cells.

  11. Transformative Leadership: The Camp Counselor Experience

    Directory of Open Access Journals (Sweden)

    Stephanie Femrite

    2017-01-01

    Full Text Available A study, utilizing focus groups, was conducted with teens serving as camp counselors at the North Central 4-H camp in Missouri.  High school students, 14-18 years old, served as camp counselors during a four-day residential camp the summer of 2014. Each counselor was a current 4-H member and had served as a 4-H camp counselor in Missouri for at least one year, some serving as many as five years. Comparing two training models, evidence was found that intentional training sessions are crucial for the empowerment that leads to transformation.

  12. Suicide in the Soviet Gulag camps.

    Science.gov (United States)

    Krysinska, Karolina; Lester, David

    2008-01-01

    About 18 million Soviet citizens passed through the Gulag system of labor and concentration camps between 1929 and 1953. Based upon literary evidence from camp survivors and published documents, the authors present reports of attempted suicide and completed suicide, along with a discussion of whether suicide in Gulag camps was a frequent or rare behavior. Similar to reports from the Nazi concentration camps during WWII the existence of Muselmänner or dokhodyagi, the dying prisoners emaciated by hunger, sometimes considered as suicides, has been identified among the Gulag inmates. Also, the incidence and methods of self-mutilation among the camp inmates are discussed.

  13. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  14. THE SPORTS CAMP – FUNCTIONING SPECIFIC AND MANAGERIAL SPECIFIC IN THE GLOBALIZATION CONTEXT

    OpenAIRE

    Nichifor Florin

    2014-01-01

    The purpose of the research is to analyze the elements of cultural specificity of the OglinziTârguNeamţ sports camp, with a focus on the following aspects: the activity of the manager and of the managerial team, employees’ attitude, the behaviour of clients (children, students, young people, teenagers, athletes), the mental, behavioural, and attitudinal conditions in the context of globalization. Usually considered by children and teenagers the most exciting and attractive space, the camp att...

  15. What type of controlling investors impact on which elements of corporate social responsibility?

    OpenAIRE

    Rees, William; Rodionova, Tatiana

    2012-01-01

    Using a large sample of 3541 companies drawn from 30 countries over a period from 2002 to 2010, we analysed the impact of strategic shareholdings on different elements of corporate social responsibility (CSR). We find that total strategic or closely held equity holdings adversely affect the environmental, social and governance scores provided by ASSET4. However, this effect is largely driven by entrenched and undiversified holdings such as family and corporate cross-holdings, whereas diversif...

  16. Dynamic thermal wave response and propagation through building structures using infinite elements in time and frequency domain

    Science.gov (United States)

    Kazakov, Konstantin S.; Stoynova, Iliana Y.

    2017-07-01

    This paper is devoted to a new approach the dynamic termal response and the factor of termal wave propagation through of complex building structure to be evaluated using infinite elements. The far field of such structures is discretized by decay or mapped infinite elements. These elements are appropriate for complex building structures, subjected to termal wave propagation and solved in time or frequency domain. Such infinite elements can be treated as new modified forms of the recently proposed by the first author infinite elements with united shape functions. In the research the time domain form of the equations is demonstrated and used in the numerical example. Only 2D horizontal type infinite elements is used, but by similar techniques 2D vertical and 2D corner infinite elements can also be formulated. The application of the proposed elements in the Finite element method is demonstrated in brief.

  17. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    Directory of Open Access Journals (Sweden)

    Nicole M Warrington

    2015-07-01

    Full Text Available A relationship between cyclic adenosine 3’, 5’-monophosphate (cAMP levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor risk in individuals with Neurofibromatosis type 1 (NF1. Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex.

  18. Two-Dimensional Finite Element Ablative Thermal Response Analysis of an Arcjet Stagnation Test

    Science.gov (United States)

    Dec, John A.; Laub, Bernard; Braun, Robert D.

    2011-01-01

    The finite element ablation and thermal response (FEAtR, hence forth called FEAR) design and analysis program simulates the one, two, or three-dimensional ablation, internal heat conduction, thermal decomposition, and pyrolysis gas flow of thermal protection system materials. As part of a code validation study, two-dimensional axisymmetric results from FEAR are compared to thermal response data obtained from an arc-jet stagnation test in this paper. The results from FEAR are also compared to the two-dimensional axisymmetric computations from the two-dimensional implicit thermal response and ablation program under the same arcjet conditions. The ablating material being used in this arcjet test is phenolic impregnated carbon ablator with an LI-2200 insulator as backup material. The test is performed at the NASA, Ames Research Center Interaction Heating Facility. Spatially distributed computational fluid dynamics solutions for the flow field around the test article are used for the surface boundary conditions.

  19. Three-Dimensional Finite Element Ablative Thermal Response and Thermostructural Design of Thermal Protection Systems

    Science.gov (United States)

    Dec, John A.; Braun, Robert D.

    2011-01-01

    A finite element ablation and thermal response program is presented for simulation of three-dimensional transient thermostructural analysis. The three-dimensional governing differential equations and finite element formulation are summarized. A novel probabilistic design methodology for thermal protection systems is presented. The design methodology is an eight step process beginning with a parameter sensitivity study and is followed by a deterministic analysis whereby an optimum design can determined. The design process concludes with a Monte Carlo simulation where the probabilities of exceeding design specifications are estimated. The design methodology is demonstrated by applying the methodology to the carbon phenolic compression pads of the Crew Exploration Vehicle. The maximum allowed values of bondline temperature and tensile stress are used as the design specifications in this study.

  20. The Camp Setting for Promoting Youth Physical Activity: Systematic Observations of Summer Day Camps

    Directory of Open Access Journals (Sweden)

    Nicole Zarrett

    2012-09-01

    Full Text Available The risk for youth obesity is higher during the summer than any other time of year. Summer day camps can be ideal settings for preventing obesity through reducing youth summer sedentary behaviors. However, little-to-no research has examined the role of camps for promoting youth physical activity (PA and other healthy behaviors. This study begins to address the gap in research by conducting systematic observations of 4 summer day camps (2 highly- resourced and 2 low-resourced to determine: 1 the degree to which camps engage youth in moderate-to-vigorous PA, and; 2 to what extent camps provide important physical and social-motivational features for promoting PA. Results indicate camps provide opportunities for youth to meet national recommendations of daily MVPA. However, there were differences in PA and motivational features by level of camp resources. This study helps inform practice and policy through identifying strengths and needs of camps for promoting PA.

  1. Evolutionary conservation of an atypical glucocorticoid-responsive element in the human tyrosine hydroxylase gene.

    Science.gov (United States)

    Sheela Rani, C S; Soto-Pina, Alexandra; Iacovitti, Lorraine; Strong, Randy

    2013-07-01

    The human tyrosine hydroxylase (hTH) gene has a 42 bp evolutionarily conserved region designated (CR) II at -7.24 kb, which bears 93% homology to the region we earlier identified as containing the glucocorticoid response element, a 7 bp activator protein-1 (AP-1)-like motif in the rat TH gene. We cloned this hTH-CRII region upstream of minimal basal hTH promoter in luciferase (Luc) reporter vector, and tested glucocorticoid responsiveness in human cell lines. Dexamethasone (Dex) stimulated Luc activity of hTH-CRII in HeLa cells, while mifepristone, a glucocorticoid receptor (GR) antagonist, prevented Dex stimulation. Deletion of the 7 bp 5'-TGACTAA at -7243 bp completely abolished the Dex-stimulated Luc activity of hTH-CRII construct. The AP-1 agonist, tetradeconoyl-12,13-phorbol acetate (TPA), also stimulated hTH promoter activity, and Dex and TPA together further accentuated this response. Chromatin immunoprecipitation assays revealed the presence of both GR and AP-1 proteins, especially Jun family members, at this hTH promoter site. Dex did not stimulate hTH promoter activity in a catecholaminergic cell line, which had low endogenous GR levels, but did activate the response when GR was expressed exogenously. Thus, our studies have clearly identified a glucocorticoid-responsive element in a 7 bp AP-1-like motif in the promoter region at -7.24 kb of the human TH gene. © 2013 International Society for Neurochemistry.

  2. Optical Response to Submicron Digital Elements Simulated by FDTD Wavelets with Refractive Impulse

    Directory of Open Access Journals (Sweden)

    Antony J. Bourdillon

    2014-01-01

    Full Text Available Accurate simulation from digital, submicron, optical elements is obtained by finite difference time domain (FDTD results that are phase analyzed as sources for Huygens wavelets on fine scales much shorter than the wavelength used. Results, from the MIT electromagnetic evaluation program, are renormalized by a method here called “refractive impulse.” This is valid for polarized responses from digital diffractive and focusing optics. The method is employed with plane wave incidence at any angle or with diverging or converging beams. It is more systematic, more versatile, and more accurate than commercial substitutes.

  3. A finite element large deflection random response of a pipe containing fluid flow

    Science.gov (United States)

    Chiang, C. K.

    1991-01-01

    A finite element approach is developed for beam type pipes undergoing large deflections subjected to random loadings. The influence of fluid velocity on the random response is investigated. The root-mean-square (rms) deflections and frequencies for different sound spectrum level values are determined for pipes with both ends either simply supported or clamped. The required number of modes to achieve accurate rms deflections is studied. The prediction of fatigue life is then based on the maximum rms stress. This analytical investigation will help to broaden the basic understanding of the role of fluid flow within structures subjected to random excitations.

  4. Core influence on the frequency response analysis (FRA of power transformers through the finite element method

    Directory of Open Access Journals (Sweden)

    D. L. Alvarez

    2015-11-01

    Full Text Available In this paper the influence of core parameters in Frequency Response Analysis is analyzed through the equivalent circuit impedance matrix of the transformer winding; the parameters of the circuit have been computed using the Finite Element Method. In order to appreciate the behavior of the iron core in comparison to the air core, the frequency dependence of resonances is calculated to show how the air core only influences the results at low frequencies. The core is modeled using a complex permeability, and the parameters of conductivity and permeability are varied to show their influence in the resonances, which turned out to be negligible. In order to explain this behavior, the eigenvalues of the inverse impedance matrix are calculated showing that they are similar for different values of conductivity and permeability. Finally, the magnetic flux inside and outside the core and its influence in the frequency response is studied.

  5. Research summer camp in photonics

    Science.gov (United States)

    Buyanovskaya, Elizaveta; Melnik, Maksim; Egorov, Vladimir; Gleim, Artur; Lukishova, Svetlana; Kozlov, Sergei; Zhang, Xi-Cheng

    2017-08-01

    ITMO University and the University of Rochester became close partners several years ago. One of the first outcomes of this mutually beneficial partnership was the creation of International Institute of Photonics and Optical Information Technologies led by Prof. Sergei Kozlov and Prof. Xi-Cheng Zhang. Universities have created a double Masters-degree program in optics in 2014, and several ITMO students have been awarded degrees from Rochester. At the same time ITMO University organizes Summer Research camp in Photonics for University of Rochester students. Students spent two weeks in the Northern Capital of Russia learning about the emerging practical applications of femtosecond optics, terahertz biomedicine and quantum information technologies.

  6. Bidirectional Regulation of the Cyclic-AMP Response Element Binding Protein Encodes Spatial Map Alignment in Prism-Adapting Barn Owls

    Science.gov (United States)

    Nichols, Grant S; DeBello, William M

    2012-01-01

    The barn owl midbrain contains mutually aligned maps of auditory and visual space. Throughout life, map alignment is maintained through the actions of an instructive signal that encodes the magnitude of auditory-visual mismatch. The intracellular signaling pathways activated by this signal are unknown. Here we tested the hypothesis that CREB (cAMP response element binding protein) provides a cell-specific readout of instructive information. Owls were fitted with prismatic or control spectacles and provided rich auditory-visual experience - hunting live mice. CREB activation was analyzed within 30 minutes of hunting using phosphorylation state-specific (pCREB) and CREB antibodies, confocal imaging and immunofluorescence measurements at individual cell nuclei. In control owls or prism-adapted owls, which experience small instructive signals, the frequency distributions of pCREB/CREB values obtained for cell nuclei within the external nucleus of the inferior colliculus (ICX) were unimodal. In contrast, in owls adapting to prisms or re-adapting to normal conditions, the distributions were bimodal: certain cells had received a signal that positively regulated CREB, and by extension, transcription of CREB-dependent genes, while others a signal that negatively regulated it. These changes were restricted to the sub-region of the inferior colliculus that received optically displaced input, the rostral ICX, and not evident in the caudal ICX or central nucleus. Finally, the topographic pattern of CREB regulation was patchy, not continuous, as expected from the actions of a topographically precise signal encoding discrete events. These results support a model in which the magnitude of CREB activation within individual cells provides a readout of the instructive signal that guides plasticity and learning. PMID:18829948

  7. A CYCLIC-AMP RESPONSE ELEMENT IS INVOLVED IN RETINOIC ACID-DEPENDENT RAR-BETA-2 PROMOTER ACTIVATION

    NARCIS (Netherlands)

    KRUYT, FAE; FOLKERS, G; VANDENBRINK, CE; VANDERSAAG, PT; Kruyt, Frank

    1992-01-01

    Activation of the retinoic acid receptor (RAR) beta2 promoter is known to be mediated by a RA response element located in the proximity of the TATA-box. By deletion studies in P19 embryonal carcinoma cells we have analyzed the RARbeta2 promoter for the presence of additional regulatory elements. We

  8. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription...

  9. Mineralocorticoid receptor interaction with SP1 generates a new response element for pathophysiologically relevant gene expression.

    Science.gov (United States)

    Meinel, Sandra; Ruhs, Stefanie; Schumann, Katja; Strätz, Nicole; Trenkmann, Kay; Schreier, Barbara; Grosse, Ivo; Keilwagen, Jens; Gekle, Michael; Grossmann, Claudia

    2013-09-01

    The mineralocorticoid receptor (MR) is a ligand-induced transcription factor belonging to the steroid receptor family and involved in water-electrolyte homeostasis, blood pressure regulation, inflammation and fibrosis in the renocardiovascular system. The MR shares a common hormone-response-element with the glucocorticoid receptor but nevertheless elicits MR-specific effects including enhanced epidermal growth factor receptor (EGFR) expression via unknown mechanisms. The EGFR is a receptor tyrosine kinase that leads to activation of MAP kinases, but that can also function as a signal transducer for other signaling pathways. In the present study, we mechanistically investigate the interaction between a newly discovered MR- but not glucocorticoid receptor- responsive-element (=MRE1) of the EGFR promoter, specificity protein 1 (SP1) and MR to gain general insights into MR-specificity. Biological relevance of the interaction for EGFR expression and consequently for different signaling pathways in general is demonstrated in human, rat and murine vascular smooth muscle cells and cells of EGFR knockout mice. A genome-wide promoter search for identical binding regions followed by quantitative PCR validation suggests that the identified MR-SP1-MRE1 interaction might be applicable to other genes. Overall, a novel principle of MR-specific gene expression is explored that applies to the pathophysiologically relevant expression of the EGFR and potentially also to other genes.

  10. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  11. Time domain finite element method for the calculation of impulse response of enclosed spaces. Room acoustics application

    Science.gov (United States)

    Papadakis, Nikos; Stavroulakis, Georgios E.

    2015-12-01

    This paper presents an assessment of the accuracy and applicability of the Time Domain Finite Element Method (TDFEM) for sound-field analysis of enclosed spaces. An outline of the method is displayed for the calculation of the impulse response of a reverberant room. Frequency response and cumulative spectral decay which are useful for the representation of spaces can be derived from the impulse response. Room impulse response of an actual room was first measured with the Maximum Length Sequence (MLS) technique and then calculated with the time domain finite element method in the low frequency range. Frequency response and cumulative spectral decay are extracted from the calculated impulse response and then compared with the measured ones. The computed parameters agree well with the measured ones. The time domain finite element method is a valuable technique for accurate prediction of the sound field of enclosed spaces.

  12. Writing and Teaching behind Barbed Wire: An Exiled Composition Class in a Japanese-American Internment Camp

    Science.gov (United States)

    Wu, Hui

    2007-01-01

    By reflecting on Japanese internment camps executed by the U.S. government in World War II, this article examines camp schools' curricula and writing assignments and an English teacher's response to student essays to show how racially profiled students and their Caucasian teacher negotiated the political meanings of civil rights and freedom.…

  13. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  14. Measuring Mindfulness in Summer Camp Staff

    Science.gov (United States)

    Gillard, Ann; Roark, Mark F.; Nyaga, Lewis Ramsey Kanyiba; Bialeschki, M. Deborah

    2011-01-01

    Examining mindfulness in a non-clinical and non-therapeutic setting such as a summer camp is an area of growing interest. Our study tested three mindfulness scales with staff in a summer camp setting, and we conducted preliminary reliability and validity analyses for any modifications needed in the scales. Results indicated two major findings: (a)…

  15. Sustainable Design Principles for Refugee Camps

    NARCIS (Netherlands)

    Rooij, de L.L.; Wascher, D.M.; Paulissen, M.P.C.P.

    2016-01-01

    This report’s main focus is on the phenomenon of refugee camps as one of the most visible and spatially explicit results of refuge and migration movements at the global scale. Given the steadily growing numbers of people on the move and staying in temporary homes and settlements, refugee camps must

  16. Summer Camp of Mathematical Modeling in China

    Science.gov (United States)

    Tian, Xiaoxi; Xie, Jinxing

    2013-01-01

    The Summer Camp of Mathematical Modeling in China is a recently created experience designed to further Chinese students' academic pursuits in mathematical modeling. Students are given more than three months to research on a mathematical modeling project. Researchers and teams with outstanding projects are invited to the Summer Camp to present…

  17. Dealing with World Issues in Camp.

    Science.gov (United States)

    Kujawa, Charles

    1986-01-01

    Discusses dealing with global issues in the camp setting in a way that broadens young people's world views. Topics include the educational advantages of the camp setting, desired outcomes for campers, guidelines for staff, and program ideas for dealing with issues such as environmental awareness, racism, and economic justice. (JHZ)

  18. Suicides in the Nazi Concentration Camps.

    Science.gov (United States)

    Ryn, Zdzislaw

    1986-01-01

    On the basis of psychiatric interviews with 69 former prisoners of the Auschwitz-Birkenau concentration camp, this paper describes the circumstances, motives, and ways of committing suicide in the camp. The interviews made it clear that thousands of prisoners perished by suicide. The number of committed suicides was larger than that of attempted…

  19. Opening of a summer camp at CERN

    CERN Multimedia

    Nursery School

    2015-01-01

    The Staff Association has the pleasure to announce the opening of a summer camp in l’EVE et Ecole de l’AP du CERN. With a capacity of 40 children, aged 4 to 6 years, it will be open from July 6 to 30. Registration Summer camp 2015 Registration for the CERN SA Summer camp for children aged 4 to 6 is open 16 to 30 April 2015 More information on the website: http://nurseryschool.web.cern.ch/ The Summer camp is open to all children of CERN Staff. An inscription per week is proposed, cost 480.-CHF/week, lunch included. The camp will be open weeks 28, 29, 30 and 31, from 8:30 am to 5:30 pm.

  20. Whole-genome cartography of p53 response elements ranked on transactivation potential.

    Science.gov (United States)

    Tebaldi, Toma; Zaccara, Sara; Alessandrini, Federica; Bisio, Alessandra; Ciribilli, Yari; Inga, Alberto

    2015-06-17

    Many recent studies using ChIP-seq approaches cross-referenced to trascriptome data and also to potentially unbiased in vitro DNA binding selection experiments are detailing with increasing precision the p53-directed gene regulatory network that, nevertheless, is still expanding. However, most experiments have been conducted in established cell lines subjected to specific p53-inducing stimuli, both factors potentially biasing the results. We developed p53retriever, a pattern search algorithm that maps p53 response elements (REs) and ranks them according to predicted transactivation potentials in five classes. Besides canonical, full site REs, we developed specific pattern searches for non-canonical half sites and 3/4 sites and show that they can mediate p53-dependent responsiveness of associated coding sequences. Using ENCODE data, we also mapped p53 REs in about 44,000 distant enhancers and identified a 16-fold enrichment for high activity REs within those sites in the comparison with genomic regions near transcriptional start sites (TSS). Predictions from our pattern search were cross-referenced to ChIP-seq, ChIP-exo, expression, and various literature data sources. Based on the mapping of predicted functional REs near TSS, we examined expression changes of thirteen genes as a function of different p53-inducing conditions, providing further evidence for PDE2A, GAS6, E2F7, APOBEC3H, KCTD1, TRIM32, DICER, HRAS, KITLG and TGFA p53-dependent regulation, while MAP2K3, DNAJA1 and potentially YAP1 were identified as new direct p53 target genes. We provide a comprehensive annotation of canonical and non-canonical p53 REs in the human genome, ranked on predicted transactivation potential. We also establish or corroborate direct p53 transcriptional control of thirteen genes. The entire list of identified and functionally classified p53 REs near all UCSC-annotated genes and within ENCODE mapped enhancer elements is provided. Our approach is distinct from, and complementary

  1. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  2. Identification of functional hypoxia inducible factor response elements in the human lysyl oxidase gene promoter.

    Science.gov (United States)

    Wang, Victoria; Davis, David A; Yarchoan, Robert

    2017-08-19

    Human lysyl oxidase (LOX) is a hypoxia-responsive gene whose product catalyzes collagen crosslinking and is thought to be important in cancer metastasis and osteoarthritis. We previously demonstrated that LOX was upregulated by hypoxia inducible factor 2 (HIF-2) more strongly than hypoxia inducible 1 (HIF-1). Here, we further investigated the response of the LOX gene and LOX promoter to HIFs. LOX mRNA, measured by real time reverse transcriptase-PCR, was strongly up-regulated (almost 40-fold), by transfection of HEK-293T cells with a plasmid encoding the HIF-2α subunit of HIF-2, but only three-fold by a plasmid encoding HIF-1α. LOX protein was detectable by Western blot of cells transfected with HIF-2α, but not with HIF-1α. Analysis of a 1487 bp promoter sequence upstream of the human LOX gene revealed 9 potential hypoxia response elements (HREs). Promoter truncation allowed the mapping of two previously unidentified functional HREs, called here HRE8 and HRE7; -455 to -451 and -382 to -386 bp, respectively, upstream of the start codon for LOX. Removal or mutation of these HREs led to a substantial reduction in both HIF-1α and HIF-2α responsiveness. Also, expression of LOX was significantly inhibited by a small molecule specific HIF-2 inhibitor. In conclusion, LOX is highly responsive to HIF-2α and this is largely mediated by two previously unidentified HREs. These observations enhance our understanding of the regulation of this important gene involved in cancer and osteoarthritis, and suggest that these conditions may be targeted by HIF-2 inhibitors. Published by Elsevier Inc.

  3. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  4. Differential physiological responses and tolerance to potentially toxic elements in biodiesel tree Jatropha curcas.

    Science.gov (United States)

    Yamada, Minami; Malambane, Goitseone; Yamada, Satoshi; Suharsono, Sony; Tsujimoto, Hisashi; Moseki, Baleseng; Akashi, Kinya

    2018-01-26

    Environmental pollution by potentially toxic elements (PTEs) has become a serious problem with increasing industrialization and the disturbance of natural biogeochemical cycles. Jatropha is an oilseed-bearing shrub with high potential for biodiesel production in arid regions. In this study, we examined the physiological responses of this plant to five representative PTEs (Cd, Cr, Cu, Ni, and Zn) in a hydroponic culture. Application of higher concentrations of Cd and Zn led to severe leaf chlorosis, and Cd, Cu, and Ni treatments resulted in significant growth retardation. Higher enrichment of the applied PTEs in the shoots was observed for Zn- and Cd-treated plants, with the latter reaching 24-fold enrichment in plants exposed to 10 μM Cd, suggesting that Jatropha can cope with relatively higher internal concentrations of toxic Cd. Although Cd stress led to the disturbance of essential mineral homeostasis and photosynthesis, this induced an increase in thiol compounds in the roots, suggesting defensive responses of Jatropha to PTEs. This study showed that Jatropha exhibits distinct sensitivities and physiological responses to different PTEs. This study also provides basic knowledge for diagnosing the physiological status of Jatropha trees for potential dual use in afforestation and as a sustainable energy supply.

  5. [Medicine in the concentration camps of the Third Reich].

    Science.gov (United States)

    Shasha, Shaul M

    2005-04-01

    Between 1942 and 1944 millions of prisoners were subjected to forced labor in concentration camps throughout the Third Reich, all the while being the victims of a systematic and "scientific" extermination policy. Though the policy was directed mainly against Jews, it was implemented against other "inferior races" as well. The prisoners, stripped of all rights, experienced constant humiliation, uncertain survival and terror. The harsh living condition, characterized by crowding, absent sanitation and poor personal hygiene led to considerable morbidity, mainly due to injuries, infectious diseases and famine, and to high mortality rates. Medical care in the camps was the responsibility of the S.S. Each camp had a chief S.S. physician accompanied by a number of assistants and orderlies. There was also a parallel system of "prisoner-physicians." There was a chief prisoner-physician in every camp, and each block was assigned a "block doctor" who was responsible for sanitation, the removal of corpses, setting up the sick- call and authorizing sick leave. Work teams were accompanied by "mobile doctors" (Streckenpfleger), who dispensed first aid for work injuries. Prisoner-physicians were also charged with disinfecting the blocks and maintaining hygienic conditions in the camp. Every camp had one or more blocks, called "Reviers", that were used for treatment and hospitalization. In the larger camps a number of blocks were designated to function as a sort of hospital (Krankenbau). At times one camp out of a group of camps would be set aside as quarantine, primarily for patients with infectious diseases. Officially, the "Revier" was the responsibility of an S.S. physicians', assisted by a chief prisoner-physician, his assistants and, at times, nurses. But in actuality the Reviers were managed by prisoners (Capos) who did not have medical training but were authorized to make decisions in medical matters such as operations and, on occasion, even performed them. The Reviers

  6. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  7. Responses of Noccaea caerulescens and Lupinus albus in trace elements-contaminated soils.

    Science.gov (United States)

    Martínez-Alcalá, Isabel; Hernández, Luis E; Esteban, Elvira; Walker, David J; Bernal, M Pilar

    2013-05-01

    Plants exposed to trace elements can suffer from oxidative stress, which is characterised by the accumulation of reactive oxygen species, alteration in the cellular antioxidant defence system and ultimately lipid peroxidation. We assessed the most-appropriate stress indexes to describe the response of two plant species, with different strategies for coping with trace elements (TEs), to particular contaminants. Noccaea caerulescens, a hyperaccumulator, and Lupinus albus, an excluder, were grown in three soils of differing pH: an acidic soil, a neutral soil (both contaminated mainly by Cu, Zn and As) and a control soil. Then, plant stress indicators were measured. As expected, N. caerulescens accumulated higher levels of Zn and Cd in shoots than L. albus, this effect being stronger in the acid soil, reflecting greater TE solubility in this soil. However, the shoot concentrations of Mn were higher in L. albus than in N. caerulescens, while the As concentration was similar in the two species. In L. albus, the phenolic content and lipid peroxidation were related with the Cu concentration, whereas the Zn and Cd concentrations in N. caerulescens were more closely related to glutathione content and lipid peroxidation. Interestingly, phytochelatins were only found in L. albus grown in polluted soils. Hence, the two species differed with respect to the TEs which provoked stress and the biochemical indicators of the stress, there being a close relationship between the accumulation of TEs and their associated stress indicators in the different plant organs. Crown Copyright © 2013. Published by Elsevier Masson SAS. All rights reserved.

  8. HIV Rev Assembly on the Rev Response Element (RRE: A Structural Perspective

    Directory of Open Access Journals (Sweden)

    Jason W. Rausch

    2015-06-01

    Full Text Available HIV-1 Rev is an ~13 kD accessory protein expressed during the early stage of virus replication. After translation, Rev enters the nucleus and binds the Rev response element (RRE, a ~350 nucleotide, highly structured element embedded in the env gene in unspliced and singly spliced viral RNA transcripts. Rev-RNA assemblies subsequently recruit Crm1 and other cellular proteins to form larger complexes that are exported from the nucleus. Once in the cytoplasm, the complexes dissociate and unspliced and singly-spliced viral RNAs are packaged into nascent virions or translated into viral structural proteins and enzymes, respectively. Rev binding to the RRE is a complex process, as multiple copies of the protein assemble on the RNA in a coordinated fashion via a series of Rev-Rev and Rev-RNA interactions. Our understanding of the nature of these interactions has been greatly advanced by recent studies using X-ray crystallography, small angle X-ray scattering (SAXS and single particle electron microscopy as well as biochemical and genetic methodologies. These advances are discussed in detail in this review, along with perspectives on development of antiviral therapies targeting the HIV-1 RRE.

  9. A novel human polycomb binding site acts as a functional polycomb response element in Drosophila.

    Directory of Open Access Journals (Sweden)

    Suresh Cuddapah

    Full Text Available Polycomb group (PcG proteins are key chromatin regulators implicated in multiple processes including embryonic development, tissue homeostasis, genomic imprinting, X-chromosome inactivation, and germ cell differentiation. The PcG proteins recognize target genomic loci through cis DNA sequences known as Polycomb Response Elements (PREs, which are well characterized in Drosophila. However, mammalian PREs have been elusive until two groups reported putative mammalian PREs recently. Consistent with the existence of mammalian PREs, here we report the identification and characterization of a potential PRE from human T cells. The putative human PRE has enriched binding of PcG proteins, and such binding is dependent on a key PcG component SUZ12. We demonstrate that the putative human PRE carries both genetic and molecular features of Drosophila PRE in transgenic flies, implying that not only the trans PcG proteins but also certain features of the cis PREs are conserved between mammals and Drosophila.

  10. [Association of cyclic adenosine monophosphate response element-binding protein gene and major depressive disorder].

    Science.gov (United States)

    Liu, Xiao-hua; Xu, Yi-feng; Cui, Dong-hong; Jiang, San-duo; Qian, Yi-ping; Yu, Shun-ying; Jiang, Kai-da

    2010-06-01

    To investigate the association between single nucleotide polymorphisms (SNPs) in cyclic adenosine monophosphate response element-binding protein(CREB1) gene and major depressive disorder (MDD). We recruited 105 parent-offspring trios of Chinese descent, extracted whole blood genomic DNA, and genotyped the SNPs in rs10932201 and rs6740584 loci. Single-marker transmission disequilibrium test (TDT), pairwise SNP linkage disequilibrium(LD) and haplotype-based TDT were performed. No significant association with MDD was observed for SNPs rs10932201 and rs6740584 (P=0.1004 and P=0.4986). However, there was strong positive association between the rs10932201-rs6740584 haplotype and MDD (P=0.00003241), and both haplotypes of A-C and A-T were significantly associated with MDD (P=0.020 and P=0.00022). The rs10932201-rs6740584 haplotype of the CREB1 gene may play an important role in the pathogenesis of MDD.

  11. A finite element random response analysis of a complex panel with fluid-conveying pipes

    Science.gov (United States)

    Chiang, C. K.

    1991-01-01

    A finite element approach is developed for a complex panel with fluid-conveying pipes undergoing large deflections subjected to random loadings. The influence of fluid velocity on the random response is investigated. The root-mean-square (rms) deflections and frequencies for different sound spectrum level value are studied. All four edges of the panel are considered to have the same conditions and restrictions. Either simply supported of clamped boundary condition with respect to the transverse deflection of the panel is considered. The prediction of fatigue life is then based on obtained rms stress. This analytical investigation will help to broaden the basic understanding of the role of fluid flow within structures subjected to acoustic loading.

  12. Identification of putative PPAR response elements in and around the murine UCP3 gene

    DEFF Research Database (Denmark)

    Siersbæk, Majken

    Introduction: The mitochondrial uncoupling proteins (UCPs) constitute a unique group of closely related proteins that are known to be involved in thermogenesis and may play important roles in suppression of reactive oxygen species (ROS) formation and fatty acid metabolism. Although a role for UCP1...... in thermogenesis in unerring, the physiological functions of UCP2 and UCP3 are at present not fully understood. Synthetic agonists for the peroxisome proliferator-activated receptors (PPARs) as well as fatty acids have been shown to increase murine UCP2 and UCP3 mRNA expression but response elements and mechanisms...... differentiation. Results from sequencing of chromatin immunoprecipitated (ChIP) material from 3T3-L1 adipocytes revealed three PPAR and retinoid X receptor (RXR) binding sites in and around the murine UCP3 gene. The recruitment of PPAR and RXR to the three potential PPREs was determined by ChIP combined...

  13. Macrophage Migration Inhibitory Factor as an Emerging Drug Target to Regulate Antioxidant Response Element System

    Directory of Open Access Journals (Sweden)

    Hiroshi Yukitake

    2017-01-01

    Full Text Available Oxidative stress is involved in pathophysiology and pathological conditions of numerous human diseases. Thus, understanding the mechanisms underlying the redox homeostasis in cells and organs is valuable for discovery of therapeutic drugs for oxidative stress-related diseases. Recently, by applying chemical biology approach with an ARE activator, BTZO-1, we found macrophage migration inhibitory factor (MIF as a new regulator of antioxidant response element- (ARE- mediated gene transcription. BTZO-1 and its active derivatives bound to MIF and protected cells and organs from oxidative insults via ARE activation in animal models with oxidative stress such as ischemia/reperfusion injury, inflammatory bowel diseases, and septic shock. In this review, we briefly highlight key findings in understanding the MIF-ARE system.

  14. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    Energy Technology Data Exchange (ETDEWEB)

    Scheepers, R.; Heyns, P. S. [Dept. of Mechanical and Aeronautical Engineering, University of Pretoria, Pretoria (South Africa)

    2016-09-15

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended.

  15. Control of cAMP in lung endothelial cell phenotypes. Implications for control of barrier function.

    Science.gov (United States)

    Stevens, T; Creighton, J; Thompson, W J

    1999-07-01

    Pulmonary microvascular endothelial cells (PMVECs) form a more restrictive barrier to macromolecular flux than pulmonary arterial endothelial cells (PAECs); however, the mechanisms responsible for this intrinsic feature of PMVECs are unknown. Because cAMP improves endothelial barrier function, we hypothesized that differences in enzyme regulation of cAMP synthesis and/or degradation uniquely establish an elevated content in PMVECs. PMVECs possessed 20% higher basal cAMP concentrations than did PAECs; however, increased content was accompanied by 93% lower ATP-to-cAMP conversion rates. In PMVECs, responsiveness to beta-adrenergic agonist (isoproterenol) or direct adenylyl cyclase (forskolin) activation was attenuated and responsiveness to phosphodiesterase inhibition (rolipram) was increased compared with those in PAECs. Although both types of endothelial cells express calcium-inhibited adenylyl cyclase, constitutive PMVEC cAMP accumulation was not inhibited by physiological rises in cytosolic calcium, whereas PAEC cAMP accumulation was inhibited 30% by calcium. Increasing either PMVEC calcium entry by maximal activation of store-operated calcium entry or ATP-to-cAMP conversion with rolipram unmasked calcium inhibition of adenylyl cyclase. These data indicate that suppressed calcium entry and low ATP-to-cAMP conversion intrinsically influence calcium sensitivity. Adenylyl cyclase-to-cAMP phosphodiesterase ratios regulate cAMP at elevated levels compared with PAECs, which likely contribute to enhanced microvascular barrier function.

  16. Thyroid hormone response element half-site organization and its effect on thyroid hormone mediated transcription.

    Science.gov (United States)

    Paquette, Martin A; Atlas, Ella; Wade, Mike G; Yauk, Carole L

    2014-01-01

    Thyroid hormone (TH) exerts its effects by binding to the thyroid hormone receptor (TR), which binds to TH response elements (TREs) to regulate target gene expression. We investigated the relative ability of liganded homodimers TR and retinoid X receptor (RXR), and the heterodimer TR/RXR, to regulate gene expression for the TRE half-site organizations: direct repeat 4 (DR4), inverted repeat 0 (IR0) and everted repeat 6 (ER6). Luciferase reporter assays using a DR4 TRE suggest that both the TR homodimer and TR/RXR heterodimer regulate luciferase expression in the presence of their respective ligands. However, in the presence of the IR0 TRE, transfection with TR/RXR and RXR alone increased luciferase activity and there was no effect of TR alone. The presence of 9-cis-retinoic acid was necessary for luciferase expression, whereas TH treatment alone was insufficient. For the ER6 TRE, transfection with TR/RXR, TR alone and RXR alone (in the presence of their respective ligands) all caused a significant increase in luciferase activity. When both ligands were present, transfection with both TR/RXR caused more activation. Finally, we investigated the efficacy of the TR-antagonist 1-850 in inhibiting transcription by TR or TR/RXR at DR4 and ER6 TREs. We found that 1-850 did not suppress luciferase activation in the presence of TR/RXR for the ER6 TRE, suggesting conformational changes of the ligand binding domain of the TR when bound to different TRE half-site organizations. Collectively, the findings indicate that there are fundamental differences between TRE configurations that affect nuclear receptor interactions with the response element and ability to bind ligands and antagonists.

  17. The Arabidopsis ETHYLENE RESPONSE FACTOR1 regulates abiotic stress-responsive gene expression by binding to different cis-acting elements in response to different stress signals.

    Science.gov (United States)

    Cheng, Mei-Chun; Liao, Po-Ming; Kuo, Wei-Wen; Lin, Tsan-Piao

    2013-07-01

    ETHYLENE RESPONSE FACTOR1 (ERF1) is an upstream component in both jasmonate (JA) and ethylene (ET) signaling and is involved in pathogen resistance. Accumulating evidence suggests that ERF1 might be related to the salt stress response through ethylene signaling. However, the specific role of ERF1 in abiotic stress and the molecular mechanism underlying the signaling cross talk still need to be elucidated. Here, we report that ERF1 was highly induced by high salinity and drought stress in Arabidopsis (Arabidopsis thaliana). The salt stress induction required both JA and ET signaling but was inhibited by abscisic acid. ERF1-overexpressing lines (35S:ERF1) were more tolerant to drought and salt stress. They also displayed constitutively smaller stomatal aperture and less transpirational water loss. Surprisingly, 35S:ERF1 also showed enhanced heat tolerance and up-regulation of heat tolerance genes compared with the wild type. Several suites of genes activated by JA, drought, salt, and heat were found in microarray analysis of 35S:ERF1. Chromatin immunoprecipitation assays found that ERF1 up-regulates specific suites of genes in response to different abiotic stresses by stress-specific binding to GCC or DRE/CRT. In response to biotic stress, ERF1 bound to GCC boxes but not DRE elements; conversely, under abiotic stress, we observed specific binding of ERF1 to DRE elements. Furthermore, ERF1 bound preferentially to only one among several GCC box or DRE/CRT elements in the promoter region of its target genes. ERF1 plays a positive role in salt, drought, and heat stress tolerance by stress-specific gene regulation, which integrates JA, ET, and abscisic acid signals.

  18. Registrations for the 2017 Summer Camp : there are still places available!

    CERN Document Server

    Staff Association

    2017-01-01

    The CERN Staff Association’s Summer Camp will be open for 4- to 6 year-old children for four weeks, from 3 to 28 July. Registration is offered on a weekly basis for 450 CHF, lunch included. A maximum of 24 children can attend the camp per week. This year, the various activities will revolve around the theme of the Four Elements. Every week, one of the elements will be the core of all activities and explored through cultural outings, arts and crafts, stories, music, sports activities and scientific workshops, with or without special guests. The general conditions are available on the website of EVE and School of the CERN Staff Association: http://nurseryschool.web.cern.ch. For further questions and registration, please contact us by email at Summer.Camp@cern.ch.

  19. Can finite element models of ballooning procedures yield mechanical response of the cardiovascular site to overexpansion?

    Science.gov (United States)

    Bosi, Giorgia M; Biffi, Benedetta; Biglino, Giovanni; Lintas, Valentina; Jones, Rod; Tzamtzis, Spyros; Burriesci, Gaetano; Migliavacca, Francesco; Khambadkone, Sachin; Taylor, Andrew M; Schievano, Silvia

    2016-09-06

    Patient-specific numerical models could aid the decision-making process for percutaneous valve selection; in order to be fully informative, they should include patient-specific data of both anatomy and mechanics of the implantation site. This information can be derived from routine clinical imaging during the cardiac cycle, but data on the implantation site mechanical response to device expansion are not routinely available. We aim to derive the implantation site response to overexpansion by monitoring pressure/dimensional changes during balloon sizing procedures and by applying a reverse engineering approach using a validated computational balloon model. This study presents the proof of concept for such computational framework tested in-vitro. A finite element (FE) model of a PTS-X405 sizing balloon (NuMed, Inc., USA) was created and validated against bench tests carried out on an ad hoc experimental apparatus: first on the balloon alone to replicate free expansion; second on the inflation of the balloon in a rapid prototyped cylinder with material deemed suitable for replicating pulmonary arteries in order to validate balloon/implantation site interaction algorithm. Finally, the balloon was inflated inside a compliant rapid prototyped patient-specific right ventricular outflow tract to test the validity of the approach. The corresponding FE simulation was set up to iteratively infer the mechanical response of the anatomical model. The test in this simplified condition confirmed the feasibility of the proposed approach and the potential for this methodology to provide patient-specific information on mechanical response of the implantation site when overexpanded, ultimately for more realistic computational simulations in patient-specific settings. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. A Camp-based Intervention Targeting Independence Among Individuals with Spina Bifida

    Science.gov (United States)

    O’Mahar, Kerry; Jandasek, Barbara; Zukerman, Jill

    2010-01-01

    Objective To design and evaluate a camp-based intervention, the goal of which was to increase independence among children, adolescents, and adults with spina bifida. Methods An intervention targeting independence was embedded within a typical week long camp experience. The intervention consisted of the following: collaborative (i.e., parent and camper) goal identification, group sessions consisting of psycho-education and cognitive tools, and goal monitoring by camp counselors. Camper and parent report of demographic variables, goal attainment, spina bifida knowledge, and independence were gathered. Interventionist report of adherence to the treatment manual was also collected. Results Campers made significant gains in individual goals, management of spina bifida responsibilities, and independence with general spina bifida tasks, with medium effect sizes observed in goal attainment. Conclusions Results indicated that significant progress was made on individually oriented goals from pre- to post-camp. Design issues are discussed. PMID:20026569

  1. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    Science.gov (United States)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  2. Elemental Ingredients in the Macrophage Cocktail: Role of ZIP8 in Host Response to Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Charlie J. Pyle

    2017-11-01

    Full Text Available Tuberculosis (TB is a global epidemic caused by the infection of human macrophages with the world’s most deadly single bacterial pathogen, Mycobacterium tuberculosis (M.tb. M.tb resides in a phagosomal niche within macrophages, where trace element concentrations impact the immune response, bacterial metal metabolism, and bacterial survival. The manipulation of micronutrients is a critical mechanism of host defense against infection. In particular, the human zinc transporter Zrt-/Irt-like protein 8 (ZIP8, one of 14 ZIP family members, is important in the flux of divalent cations, including zinc, into the cytoplasm of macrophages. It also has been observed to exist on the membrane of cellular organelles, where it can serve as an efflux pump that transports zinc into the cytosol. ZIP8 is highly inducible in response to M.tb infection of macrophages, and we have observed its localization to the M.tb phagosome. The expression, localization, and function of ZIP8 and other divalent cation transporters within macrophages have important implications for TB prevention and dissemination and warrant further study. In particular, given the importance of zinc as an essential nutrient required for humans and M.tb, it is not yet clear whether ZIP-guided zinc transport serves as a host protective factor or, rather, is targeted by M.tb to enable its phagosomal survival.

  3. Body and Gender in Nazi Concentration Camps

    Directory of Open Access Journals (Sweden)

    Bożena Karwowska

    2009-01-01

    Full Text Available The article Body and Gender in Nazi Concentration Camps is an attempt to discuss difficult issues of human sexuality and sexually marked behaviors in the context of the concentration camps, and their descriptions in the memoirs of the survivors. Using notions and concepts of the so called "black American feminism" the author (referring extensively to books by Stanisław Grzesiuk and Zofia Romanowiczowa shows how in the concentration camp the human body became the only space of a relative privacy of the prisoner. At the same time the body becomes a territory on which all - both biological and socially constructed - human fates cross.

  4. Integrating Enhanced STEM Themes in the UTEP CAREERS Weather Camp for Youth

    Science.gov (United States)

    Güereque, M.; Olgin, J. G.; Kier, M. W.; Winston, C. E.; Fitzgerald, R. M.; Morris, V. R.

    2014-12-01

    The NOAA Center for Atmospheric Science (NCAS) sponsors a network of high school and middle school summer camps entitled "Channeling Atmospheric Research into Educational Experiences Reaching Students program, CAREERS". These camps are conducted nationwide at NCAS academic partners; the University of Texas at El Paso (UTEP), Howard University (HU), University of Puerto Rico at Mayagüez (UPRM), and Jackson State University (JSU). The goals of these camps are to increase the interest of secondary school (HS) students in atmospheric and weather related sciences, target under-represented students, and to ultimately boost their college enrollment in STEM related fields. For 2014 at UTEP, the annual student-outreach weather camp program underwent a thematic overhaul that sought to incorporate more of the geological and environmental context of the region. Doctoral students were allowed to assume greater responsibility for the design, development and implementation of the camp activities. The prevailing assumption was that these Ph.D. students were better suited for peer mentoring, bridging the age and interest gap, and delivering the material through the modern technologies and modes of communication. The redesigned approach focused on the identification of climate drivers within the region and this concept formed a thread throughout the planning and design of the camp modules. The outcome resulted in the incorporation of project based learning (PBL) activities, field excursions, and deployment of weather instrumentation, for explaining regional climate processes and events. Standardized surveys were administered to camp participants to evaluate the efficacy, as well as student perceptions of the camp and its activities. Results will be presented that are based on qualitative and quantitative analysis of student responses.

  5. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...... in the first year, but, because of high retention of N in the vegetation or mineral soil, there were no significant effects of warming on seepage water NO3-N and NH4-N. Retention of P was high at all three sites. In several cases, drought increased concentrations of elements momentarily, but element fluxes...

  6. Design and Development Issues for Educational Robotics Training Camps

    Science.gov (United States)

    Ucgul, Memet; Cagiltay, Kursat

    2014-01-01

    The aim of this study is to explore critical design issues for educational robotics training camps and to describe how these factors should be implemented in the development of such camps. For this purpose, two robotics training camps were organized for elementary school students. The first camp had 30 children attendees, and the second had 22. As…

  7. Summer Camps: A Fun Way to Reinforce Math Skills

    Science.gov (United States)

    Tichenor, Mercedes; Plavchan, Joan

    2010-01-01

    Faculty members from a university teacher education department partnered with a local school district to develop a summer camp program for children at-risk. This four week summer camp for elementary students provides reading and math intervention to rising first graders. This article discusses the math aspects of the camp, including camp lessons,…

  8. Institutionalized Adolescents' Perceptions of a Summer Camp Program

    Science.gov (United States)

    Herr, David E.

    1977-01-01

    Describes the use of the facilities of Camp Easter Seal, Virginia, for institutionalized adolescents from different hospitals in Virginia. Also includes the attitudes of the patients toward their camping experience, their camp counselors, and what they learned from their camping experience. (Author/RK)

  9. Characterization of Vaccination Policies for Attendance and Employment at Day/Summer Camps in New York State.

    Science.gov (United States)

    Prescott, William A; Violanti, Kelsey C; Fusco, Nicholas M

    2018-01-01

    New York state requires day/summer camps to keep immunization records for all enrolled campers and strongly recommends requiring vaccination for all campers and staff. The objective of this study was to characterize immunization requirements/recommendations for children/adolescents enrolled in and staff employed at day/summer camps in New York state. An electronic hyperlink to a 9-question survey instrument was distributed via e-mail to 178 day/summer camps located in New York state cities with a population size greater than 100 000 people. A follow-up telephone survey was offered to nonresponders. The survey instrument included questions pertaining to vaccination documentation policies for campers/staff and the specific vaccines that the camp required/recommended. Fisher's exact and Chi-square tests were used to analyze categorical data. Sixty-five day/summer camps responded to the survey (36.5% response rate): 48 (73.8%) and 23 (41.8%) camps indicated having a policy/procedure for documenting vaccinations for campers and staff, respectively. Camps that had a policy/procedure for campers were more likely to have a policy/procedure for staff ( P = .0007). Age-appropriate vaccinations that were required/recommended for campers by at least 80% of camps included: measles, mumps, and rubella (MMR), diphtheria, tetanus, and pertussis (DTaP), hepatitis B, inactivated/oral poliovirus (IPV/OPV), Haemophilus influenzae type b (Hib), and varicella. Age-appropriate vaccinations that were required/recommended for staff by at least 80% of camps included: DTaP, hepatitis B, IPV/OPV, MMR, meningococcus, varicella, Hib, and tetanus, diphtheria, and pertussis (Tdap). Vaccination policies at day/summer camps in New York state appear to be suboptimal. Educational outreach may encourage camps to strengthen their immunization policies, which may reduce the transmission of vaccine-preventable diseases.

  10. Training Camp Counselors as Leaders: Course Helps Counselors Earn College Credit.

    Science.gov (United States)

    LaFave, Robert; Loughran, Sandra Buck

    2001-01-01

    To increase its counselor retention rate, a New York camp developed a course for counselors that focuses on leadership training and earns participants college credit. The class teaches situational leadership and focuses on the camper, not the activity. Course curriculum and objectives, course elements, and lessons learned about program improvement…

  11. Serving At-Risk Youth at Camp: Understanding This Population and Meeting Their Needs.

    Science.gov (United States)

    Grayson, Randall

    2001-01-01

    Defines "at-risk youth." Describes characteristics of resilient children and their families, friends and mentors, schools, and communities. Discusses camp program practices that have been shown to promote resiliency: focus on youth development, intentional processes that target the personal domain, organizational elements borrowed from…

  12. The Camp Setting for Promoting Youth Physical Activity: Systematic Observations of Summer Day Camps

    OpenAIRE

    Nicole Zarrett; Brittany Skiles; Carl Sorensen

    2012-01-01

    The risk for youth obesity is higher during the summer than any other time of year. Summer day camps can be ideal settings for preventing obesity through reducing youth summer sedentary behaviors. However, little-to-no research has examined the role of camps for promoting youth physical activity (PA) and other healthy behaviors. This study begins to address the gap in research by conducting systematic observations of 4 summer day camps (2 highly- resourced and 2 low-resourced) to determine: 1...

  13. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  14. Glutathione Reductase/Glutathione Is Responsible for Cytotoxic Elemental Sulfur Tolerance via Polysulfide Shuttle in Fungi*

    Science.gov (United States)

    Sato, Ikuo; Shimatani, Kanami; Fujita, Kensaku; Abe, Tsuyoshi; Shimizu, Motoyuki; Fujii, Tatsuya; Hoshino, Takayuki; Takaya, Naoki

    2011-01-01

    Fungi that can reduce elemental sulfur to sulfide are widely distributed, but the mechanism and physiological significance of the reaction have been poorly characterized. Here, we purified elemental sulfur-reductase (SR) and cloned its gene from the elemental sulfur-reducing fungus Fusarium oxysporum. We found that NADPH-glutathione reductase (GR) reduces elemental sulfur via glutathione as an intermediate. A loss-of-function mutant of the SR/GR gene generated less sulfide from elemental sulfur than the wild-type strain. Its growth was hypersensitive to elemental sulfur, and it accumulated higher levels of oxidized glutathione, indicating that the GR/glutathione system confers tolerance to cytotoxic elemental sulfur by reducing it to less harmful sulfide. The SR/GR reduced polysulfide as efficiently as elemental sulfur, which implies that soluble polysulfide shuttles reducing equivalents to exocellular insoluble elemental sulfur and generates sulfide. The ubiquitous distribution of the GR/glutathione system together with our findings that GR-deficient mutants derived from Saccharomyces cerevisiae and Aspergillus nidulans reduced less sulfur and that their growth was hypersensitive to elemental sulfur indicated a wide distribution of the system among fungi. These results indicate a novel biological function of the GR/glutathione system in elemental sulfur reduction, which is distinguishable from bacterial and archaeal mechanisms of glutathione- independent sulfur reduction. PMID:21474441

  15. Glutathione reductase/glutathione is responsible for cytotoxic elemental sulfur tolerance via polysulfide shuttle in fungi.

    Science.gov (United States)

    Sato, Ikuo; Shimatani, Kanami; Fujita, Kensaku; Abe, Tsuyoshi; Shimizu, Motoyuki; Fujii, Tatsuya; Hoshino, Takayuki; Takaya, Naoki

    2011-06-10

    Fungi that can reduce elemental sulfur to sulfide are widely distributed, but the mechanism and physiological significance of the reaction have been poorly characterized. Here, we purified elemental sulfur-reductase (SR) and cloned its gene from the elemental sulfur-reducing fungus Fusarium oxysporum. We found that NADPH-glutathione reductase (GR) reduces elemental sulfur via glutathione as an intermediate. A loss-of-function mutant of the SR/GR gene generated less sulfide from elemental sulfur than the wild-type strain. Its growth was hypersensitive to elemental sulfur, and it accumulated higher levels of oxidized glutathione, indicating that the GR/glutathione system confers tolerance to cytotoxic elemental sulfur by reducing it to less harmful sulfide. The SR/GR reduced polysulfide as efficiently as elemental sulfur, which implies that soluble polysulfide shuttles reducing equivalents to exocellular insoluble elemental sulfur and generates sulfide. The ubiquitous distribution of the GR/glutathione system together with our findings that GR-deficient mutants derived from Saccharomyces cerevisiae and Aspergillus nidulans reduced less sulfur and that their growth was hypersensitive to elemental sulfur indicated a wide distribution of the system among fungi. These results indicate a novel biological function of the GR/glutathione system in elemental sulfur reduction, which is distinguishable from bacterial and archaeal mechanisms of glutathione- independent sulfur reduction.

  16. 2012 USGS Lidar: Brooks Camp (AK)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The U.S. Geological Survey (USGS) had a requirement for high resolution Lidar needed for mapping the Brooks Camp region of Katmai National Park in Alaska....

  17. Food Safety While Hiking, Camping and Boating

    Science.gov (United States)

    ... Standard Forms FSIS United States Department of Agriculture Food Safety and Inspection Service About FSIS District Offices ... Web Content Viewer (JSR 286) Actions ${title} Loading... Food Safety While Hiking, Camping & Boating Outdoor activities are ...

  18. 33 CFR 334.910 - Pacific Ocean, Camp Pendleton Boat Basin, U.S. Marine Corps Base, Camp Pendleton, Calif...

    Science.gov (United States)

    2010-07-01

    ... Boat Basin, U.S. Marine Corps Base, Camp Pendleton, Calif.; restricted area. 334.910 Section 334.910... AND RESTRICTED AREA REGULATIONS § 334.910 Pacific Ocean, Camp Pendleton Boat Basin, U.S. Marine Corps Base, Camp Pendleton, Calif.; restricted area. (a) The area. All of the waters of Camp Pendleton Boat...

  19. Heterogeneous structure and surface tension effects on mechanical response in pulmonary acinus: A finite element analysis.

    Science.gov (United States)

    Koshiyama, Kenichiro; Nishimoto, Keisuke; Ii, Satoshi; Sera, Toshihiro; Wada, Shigeo

    2018-01-20

    The pulmonary acinus is a dead-end microstructure that consists of ducts and alveoli. High-resolution micro-CT imaging has recently provided detailed anatomical information of a complete in vivo acinus, but relating its mechanical response with its detailed acinar structure remains challenging. This study aimed to investigate the mechanical response of acinar tissue in a whole acinus for static inflation using computational approaches. We performed finite element analysis of a whole acinus for static inflation. The acinar structure model was generated based on micro-CT images of an intact acinus. A continuum mechanics model of the lung parenchyma was used for acinar tissue material model, and surface tension effects were explicitly included. An anisotropic mechanical field analysis based on a stretch tensor was combined with a curvature-based local structure analysis. The airspace of the acinus exhibited nonspherical deformation as a result of the anisotropic deformation of acinar tissue. A strain hotspot occurred at the ridge-shaped region caused by a rod-like deformation of acinar tissue on the ridge. The local structure becomes bowl-shaped for inflation and, without surface tension effects, the surface of the bowl-shaped region primarily experiences isotropic deformation. Surface tension effects suppressed the increase in airspace volume and inner surface area, while facilitating anisotropic deformation on the alveolar surface. In the lungs, the heterogeneous acinar structure and surface tension induce anisotropic deformation at the acinar and alveolar scales. Further research is needed on structural variation of acini, inter-acini connectivity, or dynamic behavior to understand multiscale lung mechanics. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Finite element study of the mechanical response in spinal cord during the thoracolumbar burst fracture.

    Directory of Open Access Journals (Sweden)

    Ya-Bo Yan

    Full Text Available BACKGROUND: The mechanical response of the spinal cord during burst fracture was seldom quantitatively addressed and only few studies look into the internal strain of the white and grey matters within the spinal cord during thoracolumbar burst fracture (TLBF. The aim of the study is to investigate the mechanical response of the spinal cord during TLBF and correlate the percent canal compromise (PCC with the strain in the spinal cord. METHODOLOGY/PRINCIPAL FINDINGS: A three-dimensional (3D finite element (FE model of human T12-L1 spinal cord with visco-elastic property was generated based on the transverse sections images of spinal cord, and the model was validated against published literatures under static uniaxial tension and compression. With the validated model, a TLBF simulation was performed to compute the mechanical strain in the spinal cord with the PCC. Linear regressions between PCC and strain in the spinal cord show that at the initial stage, with the PCC at 20%, and 45%, the corresponding mechanical strains in ventral grey, dorsal grey, ventral white, dorsal white matters were 0.06, 0.04, 0.12, 0.06, and increased to 0.14, 0.12, 0.23, and 0.13, respectively. At the recoiled stage, when the PCC was decreased from 45% to 20%, the corresponding strains were reduced to 0.03, 0.02, 0.04 and 0.03. The strain was correlated well with PCC. CONCLUSIONS/SIGNIFICANCE: The simulation shows that the strain in the spinal cord correlated well with the PCC, and the mechanical strains in the ventral regions are higher than those in the dorsal regions of spinal cord tissue during burst fracture, suggesting that the ventral regions of the spinal cord may susceptible to injury than the dorsal regions.

  1. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yanyan [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); The First Affiliated Hospital, China Medical University, Shenyang 110001 (China); Xue, Peng [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Hou, Yongyong [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); School of Public Health, China Medical University, Shenyang 110001 (China); Zhang, Hao [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Zheng, Hongzhi [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); The First Affiliated Hospital, China Medical University, Shenyang 110001 (China); Zhou, Tong [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Teng, Weiping [The First Affiliated Hospital, China Medical University, Shenyang 110001 (China); Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jingbopi@gmail.com [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); School of Public Health, China Medical University, Shenyang 110001 (China)

    2013-12-15

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis.

  2. DSPP contains an IRES element responsible for the translation of dentin phosphophoryn.

    Science.gov (United States)

    Zhang, Y; Song, Y; Ravindran, S; Gao, Q; Huang, C C; Ramachandran, A; Kulkarni, A; George, A

    2014-02-01

    The major phosphoprotein in dentin is the aspartic acid and serine-rich protein called dentin phosphophoryn (DPP). DPP appears to be synthesized as a part of a larger compound protein, dentin sialophosphoprotein (DSPP). DSPP has never been isolated or detected in dentin extracts. It is now evident that DSPP is a chimeric protein composed of 3 parts: dentin sialoprotein (DSP), DPP, and dentin glycoprotein (DGP). Previous reports have suggested that the BMP1 protease is responsible for processing DSPP. However, unequal amounts of these products are present in the dentin matrix. Here, we provide evidence for an internal ribosome entry site in the DSPP gene that directs the synthesis of DPP. This mechanism would account for unequal amounts of intracellular DSP and DPP. The internal ribosomal entry site (IRES) activity varied in different cell types, suggesting the presence of additional regulatory elements during the translational regulation of DPP. Further, we provide evidence that DPP is transported to the extracellular matrix (ECM) through exosomes. Using tissue recombination and lentivirus-mediated gain-of-function approaches, we also demonstrate that DPP is essential for the formation of well-defined tooth structures with mineralized dentin matrix.

  3. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  4. A finite element formulation for the large deflection random response of thermally buckled beams

    Science.gov (United States)

    Locke, James; Mei, Chuh

    1989-01-01

    The effects of temperature and acoustic loading are included in a theoretical finite element large deflection formulation for thin, isotropic beams. Thermal loads are applied as steady-state temperature distributions, and acoustic loads are taken to be ergodic and Gaussian with zero mean and uniform magnitude and phase along the length of the beam. Material properties are considered presently to be independent of temperature. Also, inplane and rotary inertia terms are assumed to be negligible, and all inplane edge conditions are taken to be immovable. For the random response analysis, both auto- and cross-correlation terms are included. The nature of the loads leads to the solution of two separate problems. First, the problem of thermal postbuckling is solved to determine the deflections and stresses due to the thermal load only. These deflections and stresses are then used as initial deflections and stresses for the random vibration analysis. Root-mean-square (RMS) maximum deflections and strains are obtained and compared with previous classical equivalent linearization results.

  5. Analysis of trace elements responsible for antioxidant protection by SRXFA method

    Science.gov (United States)

    Gonchar, A.; Kolmogorov, Yu; Dikalova, A.; Yelinova, V.; Kondratev, V.

    2001-09-01

    The possibilities of using the energy dispersion synchrotron radiation X-ray fluorescence analysis (SRXFA) for control of blood plasma and liver trace element (TE) content in rats with hyperproduction of oxygen radicals and hair TE content in women with mammary hyperplasia and cancer are demonstrated. Our data show that activity of antioxidant enzymes superoxide dismutase (SOD) and catalase in the blood and liver depends on the amount of TE incorporated into the structure of the active center of these enzymes, which are responsible for antioxidant protection. A decrease of activity of these enzymes is accompanied by an increase of production of free OH radicals in the tissues. Clinical data demonstrated that scalp hair of patients with oncological mammary pathology was characterized by a significant decrease of concentrations of selenium (Se) and zinc (Zn) and by an increase of chromium (Cr). The Se deficit was more pronounced in patients with cancer than in those with mammary hyperplasia ( p<0.05). The SRXFA method permits one to carry out a controllable correction of TE imbalance in many diseases whose development is caused by oxygen radical injury.

  6. Finite element prediction of seismic response modification of monumental structures utilizing base isolation

    Science.gov (United States)

    Spanos, Konstantinos; Anifantis, Nikolaos; Kakavas, Panayiotis

    2015-05-01

    The analysis of the mechanical behavior of ancient structures is an essential engineering task concerning the preservation of architectural heritage. As many monuments of classical antiquity are located in regions of earthquake activity, the safety assessment of these structures, as well as the selection of possible restoration interventions, requires numerical models capable of correctly representing their seismic response. The work presented herein was part of a research project in which a better understanding of the dynamics of classical column-architrave structures was sought by means of numerical techniques. In this paper, the seismic behavior of ancient monumental structures with multi-drum classical columns is investigated. In particular, the column-architrave classical structure under strong ground excitations was represented by a finite element method. This approach simulates the individual rock blocks as distinct rigid blocks interconnected with slidelines and incorporates seismic isolation dampers under the basement of the structure. Sliding and rocking motions of individual stone blocks and drums are modeled utilizing non-linear frictional contact conditions. The seismic isolation is modeled through the application of pad bearings under the basement of the structure. These pads are interpreted by appropriate rubber and steel layers. Time domain analyses were performed, considering the geometric and material non-linear behavior at the joints and the characteristics of pad bearings. The deformation and failure modes of drum columns subject to seismic excitations of various types and intensities were analyzed. The adverse influence of drum imperfections on structural safety was also examined.

  7. [Response of a finite element model of the pelvis to different side impact loads].

    Science.gov (United States)

    Ruan, Shijie; Zheng, Huijing; Li, Haiyan; Zhao, Wei

    2013-08-01

    The pelvis is one of the most likely affected areas of the human body in case of side impact, especially while people suffer from motor vehicle crashes. With the investigation of pelvis injury on side impact, the injury biomechanical behavior of pelvis can be found, and the data can help design the vehicle security devices to keep the safety of the occupants. In this study, a finite element (FE) model of an isolated human pelvis was used to study the pelvic dynamic response under different side impact conditions. Fracture threshold was established by applying lateral loads of 1000, 2000, 3000, 4000 and 5000 N, respectively, to the articular surface of the right acetabulum. It was observed that the smaller the lateral loads were, the smaller the von Mises stress and the displacement in the direction of impact were. It was also found that the failure threshold load was near 3000 N, based on the fact that the peak stress would not exceed the average compressive strength of the cortical bone. It could well be concluded that with better design of car-door and hip-pad so that the side impact force was brought down to 3000 N or lower, the pelvis would not be injured.

  8. LAS0811: From Combinatorial Chemistry to Activation of Antioxidant Response Element

    Directory of Open Access Journals (Sweden)

    Ming Zhu

    2009-01-01

    Full Text Available The antioxidant response element (ARE and its transcription factor, nuclear factor-erythroid 2 p45-related factor 2 (Nrf2, are potential targets for cancer chemoprevention. We sought to screen small molecules synthesized with combinatorial chemistry for activation of ARE. By high-throughput screening of 9400 small molecules from 10 combinatorial chemical libraries using HepG2 cells with an ARE-driven reporter, we have identified a novel small molecule, 1,2-dimethoxy-4,5-dinitrobenzene (LAS0811, as an activator of the ARE. LAS0811 upregulated the activity of NAD(PH:quinone oxidoreductase 1 (NQO1, a representative antioxidative enzyme regulated by ARE. It enhanced production of an endogenous reducing agent, glutathione (GSH. In addition, LAS0811 induced expression of heme oxygenase 1 (HO1, which is an ARE-regulated enzyme with anti-inflammatory activity. Furthermore, LAS0811 reduced cell death due to the cytotoxic stress of a strong oxidant, t-butyl hydroperoxide (t-BOOH. Mechanistically, LAS0811 upregulated the expression of Nrf2 and promoted its translocation into the nuclei leading to subsequent ARE activation. Taken together, LAS0811 is a novel activator of the ARE and its associated detoxifying genes and, thus, a potential agent for cancer chemoprevention.

  9. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  10. MHC I-associated peptides preferentially derive from transcripts bearing miRNA response elements.

    Science.gov (United States)

    Granados, Diana Paola; Yahyaoui, Wafaa; Laumont, Céline M; Daouda, Tariq; Muratore-Schroeder, Tara L; Côté, Caroline; Laverdure, Jean-Philippe; Lemieux, Sébastien; Thibault, Pierre; Perreault, Claude

    2012-06-28

    MHC I-associated peptides (MIPs) play an essential role in normal homeostasis and diverse pathologic conditions. MIPs derive mainly from defective ribosomal products (DRiPs), a subset of nascent proteins that fail to achieve a proper conformation and the physical nature of which remains elusive. In the present study, we used high-throughput proteomic and transcriptomic methods to unravel the structure and biogenesis of MIPs presented by HLA-A and HLA-B molecules on human EBV-infected B lymphocytes from 4 patients. We found that although HLA-different subjects present distinctive MIPs derived from different proteins, these MIPs originate from proteins that are functionally interconnected and implicated in similar biologic pathways. Secondly, the MIP repertoire of human B cells showed no bias toward conserved versus polymorphic genomic sequences, were derived preferentially from abundant transcripts, and conveyed to the cell surface a cell-type-specific signature. Finally, we discovered that MIPs derive preferentially from transcripts bearing miRNA response elements. Furthermore, whereas MIPs of HLA-disparate subjects are coded by different sets of transcripts, these transcripts are regulated by mostly similar miRNAs. Our data support an emerging model in which the generation of MIPs by a transcript depends on its abundance and DRiP rate, which is regulated to a large extent by miRNAs.

  11. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism.

    Science.gov (United States)

    Iizuka, Katsumi

    2017-02-22

    Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP) is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase), fructolysis (Glut5, ketohexokinase), and lipogenesis (acetyl CoA carboxylase, fatty acid synthase). ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp(-/-) mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  12. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    J. JUGA

    2008-12-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.;

  13. A Finite Element Study of the Dynamic Response of Brain Based on Two Parasagittal Slice Models

    Directory of Open Access Journals (Sweden)

    Xuewei Song

    2015-01-01

    Full Text Available The objective of this study is to investigate the influence of gyri and sulci on the response of human head under transient loading. To this end, two detailed parasagittal slice models with and without gyri and sulci have been developed. The models comprised not only cerebrum and skull but also cerebellum, brain stem, CSF, and corpus callosum. In addition, white and gray matters were separated. The material properties were adopted from the literature and assigned to different parts of the models. Nahum’s and Trosseille’s experiments reported in relevant literature were simulated and the simulation results were compared with the test data. The results show that there is no evident difference in terms of intracranial pressure between the models with and without gyri and sulci under simulated conditions. The equivalent stress below gyri and sulci in the model with gyri and sulci is slightly higher than that in the counterpart model without gyri and sulci. The maximum principle strain in brain tissue is lower in the model with gyri and sulci. The stress and strain distributions are changed due to the existence of gyri and sulci. These findings highlight the necessity to include gyri and sulci in the finite element head modeling.

  14. Pioneer camps in post-Yugoslav context

    Directory of Open Access Journals (Sweden)

    Jankov Sonja

    2017-01-01

    Full Text Available The paper is revalorisation and architectural analysis of pioneer cities/camps in Zagreb and Belgrade and of the children's camp Mitrovac at Tara. It is divided into an introductory analysis of the context within which pioneer camps were built and four study cases written from contemporary perspective. Artek, one of the best known pioneer camps in world, protected by UNESCO, is analysed in the paper as a paradigm for wider contextualisation of pioneer camps in former Yugoslavia. Chapter Pioneer City in Belgrade and Mitrovac at Tara emphasizes these complexes as important architectural heritage, were Mitrovac at Tara is one of the best preserved and active resorts for children. High Modernism of Vitić's Pioneer City Today summarises the process of protecting this heritage form 1951 in 2015. The paper proposes that these Yugoslav pioneer camps can be used in contemporary art production and graduate education, by opening to resident artists and students who come to Serbia via Erasmus + exchange programme.

  15. Eye diseases and blindness in Adjumani refugee settlement camps, Uganda.

    Science.gov (United States)

    Kawuma, M

    2000-11-01

    To determine the prevalence and causes of the blindness and ocular morbidity amongst Sudanese refugees; to prioritise and provide eye care services to the refugees and; to device administrative strategies and logistics of prevention and control of blinding diseases among the refugees. A mobile outreach clinic study for six weeks. Adjumani settlement camps for Sudanese refugees in Uganda. Seven hundred patients in eighteen settlement camps. Medical treatment and surgical correction offered. Cataract, trachoma and xerophthalmia are the major causes of blindness. One hundred and forty six patients (21%) were bilaterally blind, and 77 patients (11%) were unilaterally blind. The three leading causes of blindness are cataract (42%), xerophthalmia (28%) and trachoma (21%). Glaucoma and other non-specified causes were responsible for the remaining blindness (9%). The crude prevalence of blindness among the 700 patients was 20. This is an extremely high prevalence, nearly ten times higher than for Ugandans living in Uganda. In refugee settlement camps setting, residents may have a much higher prevalence of eye diseases and blindness than non-refugees.

  16. Base Camp Life Cycle Management: Focusing on the Critical Elements

    Science.gov (United States)

    2011-12-01

    Hatch, Ronald Heifetz , and John Kotter detail theories on the core concept of power, as well as the difference sources of power within an organization...2011). Heifetz , Ronald A. Leadership Without Easy Answers. Cambridge, Mass.: Harvard University Press, 1994. Henderson, Rick, and Adrian T. Moore

  17. Lipoic Acid Stimulates cAMP Production in Healthy Control and Secondary Progressive MS Subjects.

    Science.gov (United States)

    Fiedler, Sarah E; Yadav, Vijayshree; Kerns, Amelia R; Tsang, Catherine; Markwardt, Sheila; Kim, Edward; Spain, Rebecca; Bourdette, Dennis; Salinthone, Sonemany

    2017-11-15

    Lipoic acid (LA) exhibits antioxidant and anti-inflammatory properties; supplementation reduces disease severity and T lymphocyte migration into the central nervous system in a murine model of multiple sclerosis (MS), and administration in secondary progressive MS (SPMS) subjects reduces brain atrophy compared to placebo. The mechanism of action (MOA) of LA's efficacy in suppression of MS pathology is incompletely understood. LA stimulates production of the immunomodulator cyclic AMP (cAMP) in vitro. To determine whether cAMP could be involved in the MOA of LA in vivo, we performed a clinical trial to examine whether LA stimulates cAMP production in healthy control and MS subjects, and whether there are differences in the bioavailability of LA between groups. We administered 1200 mg of oral LA to healthy control, relapsing remitting MS (RRMS) and SPMS subjects, and measured plasma LA and cAMP levels in peripheral blood mononuclear cells (PBMCs). There were no significant differences between the groups in pharmacokinetic (PK) parameters. Healthy and SPMS subjects had increased cAMP at 2 and 4 h post-LA treatment compared to baseline, while RRMS subjects showed decreases in cAMP. Additionally, plasma concentrations of prostaglandin E2 (PGE2, a known cAMP stimulator) were significantly lower in female RRMS subjects compared to female HC and SPMS subjects 4 h after LA ingestion. These data indicate that cAMP could be part of the MOA of LA in SPMS, and that there is a divergent response to LA in RRMS subjects that may have implications in the efficacy of immunomodulatory drugs. This clinical trial, "Defining the Anti-inflammatory Role of Lipoic Acid in Multiple Sclerosis," NCT00997438, is registered at https://clinicaltrials.gov/ct2/show/record/NCT00997438 .

  18. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... of superlight elements invented at DTU seems very promising in reducing the weight of the elements and improving their structural integrity in case of fire or other accidental actions. In particular, the behaviour under fire of a superlight floor slab element (SL-deck) is investigated in this paper...

  19. Widespread Alu repeat-driven expansion of consensus DR2 retinoic acid response elements during primate evolution

    Directory of Open Access Journals (Sweden)

    Wang Tian-Tian

    2007-01-01

    Full Text Available Abstract Background Nuclear receptors are hormone-regulated transcription factors whose signaling controls numerous aspects of development and physiology. Many receptors recognize DNA hormone response elements formed by direct repeats of RGKTCA motifs separated by 1 to 5 bp (DR1-DR5. Although many known such response elements are conserved in the mouse and human genomes, it is unclear to which extent transcriptional regulation by nuclear receptors has evolved specifically in primates. Results We have mapped the positions of all consensus DR-type hormone response elements in the human genome, and found that DR2 motifs, recognized by retinoic acid receptors (RARs, are heavily overrepresented (108,582 elements. 90% of these are present in Alu repeats, which also contain lesser numbers of other consensus DRs, including 50% of consensus DR4 motifs. Few DR2s are in potentially mobile AluY elements and the vast majority are also present in chimp and macaque. 95.5% of Alu-DR2s are distributed throughout subclasses of AluS repeats, and arose largely through deamination of a methylated CpG dinucleotide in a non-consensus motif present in AluS sequences. We find that Alu-DR2 motifs are located adjacent to numerous known retinoic acid target genes, and show by chromatin immunoprecipitation assays in squamous carcinoma cells that several of these elements recruit RARs in vivo. These findings are supported by ChIP-on-chip data from retinoic acid-treated HL60 cells revealing RAR binding to several Alu-DR2 motifs. Conclusion These data provide strong support for the notion that Alu-mediated expansion of DR elements contributed to the evolution of gene regulation by RARs and other nuclear receptors in primates and humans.

  20. A finite element scheme to study the nonlinear optical response of a finite grating without and with defect

    NARCIS (Netherlands)

    Suryanto, A.; van Groesen, Embrecht W.C.; Hammer, Manfred; Hoekstra, Hugo

    We present a simple numerical scheme based on the finite element method (FEM) using transparent-influx boundary conditions to study the nonlinear optical response of a finite one-dimensional grating with Kerr medium. Restricting first to the linear case, we improve the standard FEM to get a fourth

  1. Activation of antioxidant response element in mouse primary cortical cultures with sesquiterpene lactones isolated from Tanacetum parthenium

    NARCIS (Netherlands)

    Fischedick, J.T.; Standiford, M.; Johnson, D.A.; Vos, de R.C.H.; Todorovic, S.; Banjanac, T.; Verpoorte, R.; Johnson, J.A.

    2012-01-01

    Tanacetum parthenium produces biologically active sesquiterpene lactones (SL). Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor known to activate a series of genes termed the antioxidant response element (ARE). Activation of Nrf2/ARE may be useful for the treatment of

  2. Measurement of Trace Elements During the Development and Immune Response of Heliothis virescens Larvae

    Science.gov (United States)

    While many studies have examined the effect of microbial infections on the status of trace elements in mammalian tissues, similar studies have not been performed in insects. We used inductively coupled plasma-mass spectrometry (ICP-MS) to quantify changes in trace elements of Mg, Mn, Fe, Cu, Zn and ...

  3. Dual NRF2 paralogs in Coho salmon and their antioxidant response element targets

    Directory of Open Access Journals (Sweden)

    Richard Ramsden

    2016-10-01

    Full Text Available The transcription factor NFE2L2 (Nuclear Factor, Erythroid 2-Like 2, or NRF2 plays a key role in maintaining the redox state within cells. Characterization of this pathway has extended to fish, most notably zebrafish (Danio rerio, in which two paralogs of the transcription factor exist: Nrf2a, an activator, and Nrf2b, a negative regulator during embryogenesis. Only one ARE target has been thoroughly delineated in zebrafish, and this deviated from the canonical sequence derived from studies in mammals. In general, the mechanistic pathway has not been characterized in non-model aquatic organisms that are commonly exposed to environmental pollutants. The current study compares the zebrafish paralogs to those found in a non-model teleost, the ecologically important salmonid, Oncorhnychus kisutch (coho salmon. Two salmon paralogs, Nrf2A and -2B, described here were found to possess only slightly greater identity between one another (84% of amino acids than to the singleton ortholog of the esocid Esox lucius (80–82%, the nearest non-salmonid outgroup. Unlike one of the zebrafish forms, each is a strong activating factor based on sequence homology and in vitro testing. To uncover functional target AREs in coho, promoter flanking sequences were isolated for five genes that protect cells against oxidative stress: heme oxygenase 1, peroxiredoxin 1, glutamate-cysteine ligase, and the glutathione S-transferases pi and rho (hmox1, prdx1, gclc, gstp, and gstr. All except gstr had functional elements and all fit the standard mammalian-derived canonical sequence, unlike the motif found in zebrafish gstp. Expression studies demonstrate the presence of both Nrf2 paralogs in multiple organs, although in differing ratios. Collectively, our findings extend the conservation of Nrf2 and the ARE to salmonids, and should help inform future work in teleosts on mechanisms of redox control, as well as responsiveness of this pathway and its downstream antioxidant gene

  4. Craniofacial displacement in response to varying headgear forces evaluated biomechanically with finite element analysis.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-04-01

    The aim of this study was to evaluate biomechanically the displacement patterns of the facial bones in response to different headgear loading by using a higher-resolution finite element method model than used in previous studies. An analytical model was developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry skull of a 7-year-old. Different headgear forces were simulated by applying 1 kg of posteriorly directed force in the first molar region to simulate cervical-pull, straight-pull, and high-pull headgear. Displacements (in mm) of various craniofacial structures were evaluated along the x, y, and z coordinates with different headgear loading. All 3 headgears demonstrated posterior displacement of the maxilla with clockwise rotation of the palatal plane. The distal displacement of the maxilla was the greatest with the straight-pull headgear followed by the cervical-pull headgear. The high-pull headgear had better control in the vertical dimensions. The midpalatal suture opening was evident and was more pronounced in the anterior region. The articular fossa and the articular eminence were displaced laterally and postero-superiorly with each headgear type. The high-pull headgear was most effective in restricting the antero-inferior maxillary growth vector. Midpalatal suture opening similar to rapid maxillary expansion was observed with all 3 headgear types. The center of rotation varied with the direction of headgear forces for both the maxilla and the zygomatic complex. A potential for chondrogenic and osteogenic modeling exists for the articular fossa and the articular eminence with headgear loading.

  5. Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells

    Science.gov (United States)

    Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas

    2016-01-01

    Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction. PMID:27144291

  6. Diverse p53/DNA binding modes expand the repertoire of p53 response elements.

    Science.gov (United States)

    Vyas, Pratik; Beno, Itai; Xi, Zhiqun; Stein, Yan; Golovenko, Dmitrij; Kessler, Naama; Rotter, Varda; Shakked, Zippora; Haran, Tali E

    2017-10-03

    The tumor suppressor protein p53 acts as a transcription factor, binding sequence-specifically to defined DNA sites, thereby activating the expression of genes leading to diverse cellular outcomes. Canonical p53 response elements (REs) are made of two decameric half-sites separated by a variable number of base pairs (spacers). Fifty percent of all validated p53 REs contain spacers between 1 and 18 bp; however, their functional significance is unclear at present. Here, we show that p53 forms two different tetrameric complexes with consensus or natural REs, both with long spacers: a fully specific complex where two p53 dimers bind to two specific half-sites, and a hemispecific complex where one dimer binds to a specific half-site and the second binds to an adjacent spacer sequence. The two types of complexes have comparable binding affinity and specificity, as judged from binding competition against bulk genomic DNA. Structural analysis of the p53 REs in solution shows that these sites are not bent in both their free and p53-bound states when the two half-sites are either abutting or separated by spacers. Cell-based assay supports the physiological relevance of our findings. We propose that p53 REs with long spacers comprise separate specific half-sites that can lead to several different tetrameric complexes. This finding expands the universe of p53 binding sites and demonstrates that even isolated p53 half-sites can form tetrameric complexes. Moreover, it explains the manner in which p53 binds to clusters of more than one canonical binding site, common in many natural REs.

  7. Exosomes Derived from HIV-1-infected Cells Contain Trans-activation Response Element RNA*

    Science.gov (United States)

    Narayanan, Aarthi; Iordanskiy, Sergey; Das, Ravi; Van Duyne, Rachel; Santos, Steven; Jaworski, Elizabeth; Guendel, Irene; Sampey, Gavin; Dalby, Elizabeth; Iglesias-Ussel, Maria; Popratiloff, Anastas; Hakami, Ramin; Kehn-Hall, Kylene; Young, Mary; Subra, Caroline; Gilbert, Caroline; Bailey, Charles; Romerio, Fabio; Kashanchi, Fatah

    2013-01-01

    Exosomes are nano-sized vesicles produced by healthy and virus-infected cells. Exosomes derived from infected cells have been shown to contain viral microRNAs (miRNAs). HIV-1 encodes its own miRNAs that regulate viral and host gene expression. The most abundant HIV-1-derived miRNA, first reported by us and later by others using deep sequencing, is the trans-activation response element (TAR) miRNA. In this study, we demonstrate the presence of TAR RNA in exosomes from cell culture supernatants of HIV-1-infected cells and patient sera. TAR miRNA was not in Ago2 complexes outside the exosomes but enclosed within the exosomes. We detected the host miRNA machinery proteins Dicer and Drosha in exosomes from infected cells. We report that transport of TAR RNA from the nucleus into exosomes is a CRM1 (chromosome region maintenance 1)-dependent active process. Prior exposure of naive cells to exosomes from infected cells increased susceptibility of the recipient cells to HIV-1 infection. Exosomal TAR RNA down-regulated apoptosis by lowering Bim and Cdk9 proteins in recipient cells. We found 104–106 copies/ml TAR RNA in exosomes derived from infected culture supernatants and 103 copies/ml TAR RNA in the serum exosomes of highly active antiretroviral therapy-treated patients or long term nonprogressors. Taken together, our experiments demonstrated that HIV-1-infected cells produced exosomes that are uniquely characterized by their proteomic and RNA profiles that may contribute to disease pathology in AIDS. PMID:23661700

  8. Extracts of Fruits and Vegetables Activate the Antioxidant Response Element in IMR-32 Cells.

    Science.gov (United States)

    Orena, Stephen; Owen, Jennifer; Jin, Fuxia; Fabian, Morgan; Gillitt, Nicholas D; Zeisel, Steven H

    2015-09-01

    The biological effects of antioxidant nutrients are mediated in part by activation of antioxidant response elements (AREs) on genes for enzymes involved in endogenous pathways that prevent free radical damage. Traditional approaches for identifying antioxidant molecules in foods, such as total phenolic compound (TP) content or oxygen radical absorption capacity (ORAC), do not measure capacity to activate AREs. The goal of this study was to develop an assay to assess the ARE activation capacity of fruit and vegetable extracts and determine whether such capacity was predicted by TP content and/or ORAC activity. Fruits and vegetables were homogenized, extracted with acidified ethanol, lyophilized, and resuspended in growth medium. Human IMR-32 neuroblastoma cells, transfected with an ARE-firefly luciferase reporter, were exposed to extracts for 5 h. Firefly luciferase was normalized to constitutively expressed Renilla luciferase with tertiary butylhydroquinone (tBHQ) as a positive control. TP content and ORAC activity were measured for each extract. Relations between TPs and ORAC and ARE activity were determined. A total of 107 of 134 extracts tested significantly activated the ARE-luciferase reporter from 1.2- to 58-fold above that of the solvent control (P cells. ARE activity, TP content, and ORAC ranked higher in peels than in associated flesh. Despite this relation, ARE activity did not correlate with TP content (Spearman ρ = 0.05, P = 0.57) and only modestly but negatively correlated with ORAC (Spearman ρ = -0.24, P vegetable extracts in human IMR-32 cells. There are components of fruits and vegetables that activate the ARE but are not phenolic compounds and are low in ORAC. The ARE-luciferase reporter assay is likely a better predictor of the antioxidant benefits of fruits and vegetables than TP or ORAC. © 2015 American Society for Nutrition.

  9. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  10. Finite element comparison of human and Hybrid III responses in a frontal impact.

    Science.gov (United States)

    Danelson, Kerry A; Golman, Adam J; Kemper, Andrew R; Gayzik, F Scott; Clay Gabler, H; Duma, Stefan M; Stitzel, Joel D

    2015-12-01

    The improvement of finite element (FE) Human Body Models (HBMs) has made them valuable tools for investigating restraint interactions compared to anthropomorphic test devices (ATDs). The objective of this study was to evaluate the effect of various combinations of safety restraint systems on the sensitivity of thoracic injury criteria using matched ATD and Human Body Model (HBM) simulations at two crash severities. A total of seven (7) variables were investigated: 3-point belt with two (2) load limits, frontal airbag, knee bolster airbag, a buckle pretensioner, and two (2) delta-v's - 40kph and 50kph. Twenty four (24) simulations were conducted for the Hybrid III ATD FE model and repeated with a validated HBM for 48 total simulations. Metrics tested in these conditions included sternum deflection, chest acceleration, chest excursion, Viscous Criteria (V*C) criteria, pelvis acceleration, pelvis excursion, and femur forces. Additionally, chest band deflection and rib strain distribution were measured in the HBM for additional restraint condition discrimination. The addition of a frontal airbag had the largest effect on the occupant chest metrics with an increase in chest compression and acceleration but a decrease in excursion. While the THUMS and Hybrid III occupants demonstrated the same trend in the chest compression measurements, there were conflicting results in the V*C, acceleration, and displacement metrics. Similarly, the knee bolster airbag had the largest effect on the pelvis with a decrease in acceleration and excursion. With a knee bolster airbag the simulated occupants gave conflicting results, the THUMS had a decrease in femur force and the ATD had an increase. Preferential use of dummies or HBM's is not debated; however, this study highlights the ability of HBM metrics to capture additional chest response metrics. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Summer camps for children and adolescents with kidney disease.

    Science.gov (United States)

    Klee, K; Greenleaf, K; Watkins, S

    1997-02-01

    Summer camps, sports camps, and residential camps are readily available to children and adolescents across the country. However, children and adolescents with end stage renal disease (ESRD) may not be able to participate in summer camp experiences because of specialized medical needs (e.g., dialysis or immunosuppressive medications) and concerns about abilities to keep up with camp activities. With enhancements in pediatric nephrology care in the past 10 years, patients can be expected to attend school full time and participate in peer activities. In addition, attendance at summer camps becomes a possibility for these children, particularly camps aimed at children with ESRD. Twenty pediatric nephrology centers in North America were surveyed about their participation in summer camp programs. This article reviews these and attempts to elucidate the values of summer camp programs for pediatric ESRD patients.

  12. Ladders to Leadership: What Camp Counselor Positions Do for Youth

    Directory of Open Access Journals (Sweden)

    Darcy Tessman

    2012-09-01

    Full Text Available The 4-H youth development organization understands and has recognized residential camping as one of the major modes of program delivery. Primary benefactors of the residential camping program are those youth who serve as camp counselors. Not only are they recipients of the educational program, but also supervise and teach younger campers (Garst & Johnson, 2005; McNeely, 2004. As a result of their experience, camp counselors learn about and develop leadership and life skills (Thomas, 1996; Purcell, 1996. The residential camping experience allows youth to serve as volunteers through their role as camp counselors. In addition to the benefits earned from their volunteer role, residential camping provides youth camp counselors the opportunity to gain leadership skills (Arnold, 2003 as well as add to the camp structure, planning, and implementation (Hines & Riley, 2005.

  13. Calmodulin-dependent Protein Kinase II/cAMP Response Element-binding Protein/Wnt/β-Catenin Signaling Cascade Regulates Angiotensin II-induced Podocyte Injury and Albuminuria*

    Science.gov (United States)

    Jiang, Lei; Xu, Lingling; Song, Yuxian; Li, Jianzhong; Mao, Junhua; Zhao, Allan Zijian; He, Weichun; Yang, Junwei; Dai, Chunsun

    2013-01-01

    Angiotensin II (Ang II) plays a pivotal role in promoting podocyte dysfunction and albuminuria, however, the underlying mechanisms have not been fully delineated. In this study, we found that Ang II induced Wnt1 expression and β-catenin nuclear translocation in cultured mouse podocytes. Blocking Wnt signaling with Dickkopf-1 (Dkk1) or β-catenin siRNA attenuated Ang II-induced podocyte injury. Ang II could also induce the phosphorylation of calmodulin-dependent protein kinase (CaMK) II and cAMP response element-binding protein (CREB) in cultured podocytes. Blockade of this pathway with CK59 or CREB siRNA could significantly inhibit Ang II-induced Wnt/β-catenin signaling and podocyte injury. In in vivo studies, administration of Ang II promoted Wnt/β-catenin signaling, aggregated podocyte damage, and albuminuria in mice. CK59 could remarkably ameliorate Ang II-induced podocyte injury and albuminuria. Furthermore, ectopic expression of exogenous Dkk1 also attenuated Ang II-induced podocytopathy in mice. Taken together, this study demonstrates that the CaMK II/CREB/Wnt/β-catenin signaling cascade plays an important role in regulating Ang II-induced podocytopathy. Targeting this signaling pathway may offer renal protection against the development of proteinuric kidney diseases. PMID:23803607

  14. The catalytic subunit of cAMP-dependent protein kinase induces expression of genes containing cAMP-responsive enhancer elements.

    Science.gov (United States)

    Riabowol, K T; Fink, J S; Gilman, M Z; Walsh, D A; Goodman, R H; Feramisco, J R

    1988-11-03

    Transcriptional regulation of eukaryotic genes by cyclic AMP requires a cAMP-dependent protein kinase (A kinase). Two hypotheses have been proposed to explain how the holoenzyme of the A kinase induces transcription. The regulatory subunits of the A kinase, which bind cAMP and DNA, and have amino-acid homology with the Escherichia coli catabolite activator protein could directly stimulate gene expression. Alternatively, phosphorylation by the catalytic subunits could induce transcription by activating proteins involved in gene transcription. To distinguish between these models, we microinjected purified preparations of the catalytic and regulatory subunits of A kinase into tissue culture cells and monitored expression of a stably integrated fusion gene containing a cAMP-responsive human promoter fused to a bacterial reporter gene, or of the endogenous c-fos gene. The catalytic subunit stimulated expression of these genes, whereas the regulatory subunit did not. These results indicate that the catalytic subunit of A kinase is sufficient to induce expression of two cAMP-responsive genes, without increasing levels of cAMP.

  15. The MYC 3′ Wnt-Responsive Element Drives Oncogenic MYC Expression in Human Colorectal Cancer Cells

    Directory of Open Access Journals (Sweden)

    Sherri A. Rennoll

    2016-05-01

    Full Text Available Mutations in components of the Wnt/β-catenin signaling pathway drive colorectal cancer (CRC by deregulating expression of downstream target genes including the c-MYC proto-oncogene (MYC. The critical regulatory DNA enhancer elements that control oncogenic MYC expression in CRC have yet to be fully elucidated. In previous reports, we correlated T-cell factor (TCF and β-catenin binding to the MYC 3′ Wnt responsive DNA element (MYC 3′ WRE with MYC expression in HCT116 cells. Here we used CRISPR/Cas9 to determine whether this element is a critical driver of MYC. We isolated a clonal population of cells that contained a deletion of a single TCF binding element (TBE within the MYC 3′ WRE. This deletion reduced TCF/β-catenin binding to this regulatory element and decreased MYC expression. Using RNA-Seq analysis, we found altered expression of genes that regulate metabolic processes, many of which are known MYC target genes. We found that 3′ WRE-Mut cells displayed a reduced proliferative capacity, diminished clonogenic growth, and a decreased potential to form tumors in vivo. These findings indicate that the MYC 3′ WRE is a critical driver of oncogenic MYC expression and suggest that this element may serve as a therapeutic target for CRC.

  16. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    Science.gov (United States)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom; Cavalli, Giacomo

    2011-01-01

    Regulation of gene expression involves long-distance communication between regulatory elements and target promoters, but how this is achieved remains unknown. Insulator elements have been proposed to modulate the communication between regulatory elements and promoters due to their ability to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3 histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology. PMID:21262819

  17. Identifying and separating magnetic and electric microwave responses of chiral elements

    Science.gov (United States)

    Kazantsev, Yu. N.; Kraftmakher, G. A.; Mal'tsev, V. P.

    2016-03-01

    We propose a technique for identifying the type of resonance excitation by ac magnetic or electric fields in conducting chiral elements by reflection of electromagnetic waves in the standing- and travelingwave modes. The technique was tested experimentally in the microwave range and confirmed numerically. We demonstrate the possibility of broadband matching of composite radar absorbing materials with the use of a lattice of resonance elements excited by magnetic field of the wave rather instead of the traditional quarter- wavelength effects.

  18. Finite element model validation of bridge based on structural health monitoring—Part I: Response surface-based finite element model updating

    Directory of Open Access Journals (Sweden)

    Zhouhong Zong

    2015-08-01

    Full Text Available In the engineering practice, merging statistical analysis into structural evaluation and assessment is a tendency in the future. As a combination of mathematical and statistical techniques, response surface (RS methodology has been successfully applied to design optimization, response prediction and model validation. With the aid of RS methodology, these two serial papers present a finite element (FE model updating and validation method for bridge structures based on structural health monitoring. The key issues to implement such a model updating are discussed in this paper, such as design of experiment, parameter screening, construction of high-order polynomial response surface model, optimization methods and precision inspection of RS model. The proposed procedure is illustrated by a prestressed concrete continuous rigid-frame bridge monitored under operational conditions. The results from the updated FE model have been compared with those obtained from online health monitoring system. The real application to a full-size bridge has demonstrated that the FE model updating process is efficient and convenient. The updated FE model can relatively reflect the actual condition of Xiabaishi Bridge in the design space of parameters and can be further applied to FE model validation and damage identification.

  19. Evolution of motif variants and positional bias of the cyclic-AMP response element

    Directory of Open Access Journals (Sweden)

    Famili A Fazel

    2007-02-01

    Full Text Available Abstract Background Transcription factors regulate gene expression by interacting with their specific DNA binding sites. Some transcription factors, particularly those involved in transcription initiation, always bind close to transcription start sites (TSS. Others have no such preference and are functional on sites even tens of thousands of base pairs (bp away from the TSS. The Cyclic-AMP response element (CRE binding protein (CREB binds preferentially to a palindromic sequence (TGACGTCA, known as the canonical CRE, and also to other CRE variants. CREB can activate transcription at CREs thousands of bp away from the TSS, but in mammals CREs are found far more frequently within 1 to 150 bp upstream of the TSS than in any other region. This property is termed positional bias. The strength of CREB binding to DNA is dependent on the sequence of the CRE motif. The central CpG dinucleotide in the canonical CRE (TGACGTCA is critical for strong binding of CREB dimers. Methylation of the cytosine in the CpG can inhibit binding of CREB. Deamination of the methylated cytosines causes a C to T transition, resulting in a functional, but lower affinity CRE variant, TGATGTCA. Results We performed genome-wide surveys of CREs in a number of species (from worm to human and showed that only vertebrates exhibited a CRE positional bias. We performed pair-wise comparisons of human CREs with orthologous sequences in mouse, rat and dog genomes and found that canonical and TGATGTCA variant CREs are highly conserved in mammals. However, when orthologous sequences differ, canonical CREs in human are most frequently TGATGTCA in the other species and vice-versa. We have identified 207 human CREs showing such differences. Conclusion Our data suggest that the positional bias of CREs likely evolved after the separation of urochordata and vertebrata. Although many canonical CREs are conserved among mammals, there are a number of orthologous genes that have canonical CREs in

  20. A specialized program for children with developmental disabilities within a "typical" overnight summer camp: Camp Ramah's Tikvah Program.

    Science.gov (United States)

    Blas, Howard I

    2007-10-01

    The Tikvah Program is an overnight camping program at Camp Ramah in New England that serves campers with a range of developmental disabilities. The program has evolved over its 37-year history and includes a camping program, vocational training program, and inclusion program. Select graduates are hired by the camp for summer employment. The Tikvah Program offers a model for serving campers with special needs within a larger "typical" summer camp. Although serving the needs of such campers offers unique challenges, the presence of such a program in a regular summer camp offers tremendous opportunities and benefits for campers with special needs and more typically developing campers.

  1. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  2. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    for which queries were part of the study. The responses were assessed qualitatively by six clinical pharmacologists (internal experts) and six general practitioners (GPs, external experts). In addition, linguistic aspects of the responses were evaluated by a plain language expert. RESULTS: The quality......PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded...... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...

  3. Temperature, stress, and corrosive sensing apparatus utilizing harmonic response of magnetically soft sensor element (s)

    Science.gov (United States)

    Grimes, Craig A. (Inventor); Ong, Keat Ghee (Inventor)

    2003-01-01

    A temperature sensing apparatus including a sensor element made of a magnetically soft material operatively arranged within a first and second time-varying interrogation magnetic field, the first time-varying magnetic field being generated at a frequency higher than that for the second magnetic field. A receiver, remote from the sensor element, is engaged to measure intensity of electromagnetic emissions from the sensor element to identify a relative maximum amplitude value for each of a plurality of higher-order harmonic frequency amplitudes so measured. A unit then determines a value for temperature (or other parameter of interst) using the relative maximum harmonic amplitude values identified. In other aspects of the invention, the focus is on an apparatus and technique for determining a value for of stress condition of a solid analyte and for determining a value for corrosion, using the relative maximum harmonic amplitude values identified. A magnetically hard element supporting a biasing field adjacent the magnetically soft sensor element can be included.

  4. Winter camp for pre-school children

    OpenAIRE

    Golc, Mateja

    2017-01-01

    This thesis details the importance of physical activity for a healthy development of pre-school children in all areas of their development. The focus is placed mainly on outdoor physical activity, in all seasons of the year and in all types of weather. Also highlighted is the importance of outdoor physical activity, stretching over several days, in the form of a winter camp for pre-school children. Pre-school teachers, who take over the organisation of a winter camp, face a challenging task, ...

  5. Flaubert et Du Camp : quelques remarques

    Directory of Open Access Journals (Sweden)

    Michel Brix

    2016-12-01

    Full Text Available The Flaubert scholars accuse Maxime Du Camp of several instances of dishonesty and don’t pay attention to what Du Camp has said or written. This regrettable situation deprives the readers of numerous pieces of information which are likely to shed light on the stakes but also on the contradictions of the flaubertian poetics. This article takes a look at a few revealing cases and especially looks into the similitaries between a passage of the Du Camp’s book Le Nil (1854 and the episode where Marie Arnoux makes her appearance, in L’Éducation sentimentale (1869.

  6. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  7. Teens Learn Leadership At Virginia Tech Summer Camps

    OpenAIRE

    Ho, Sookhan

    2003-01-01

    Summer camps are in full swing around the country. At Virginia Tech, rising 10th graders from all over the state are learning leadership skills at a series of unusual summer camps sponsored by the Virginia Police Chiefs Foundation.

  8. CPSC Warns of Carbon Monoxide Poisoning with Camping Equipment

    Science.gov (United States)

    ... Warns of Carbon Monoxide Poisoning Hazard with Camping Equipment The U.S. Consumer Product Safety Commission (CPSC) warns ... about the carbon monoxide (CO) hazard with camping equipment. CO can kill you! From 2002–2006, CPSC ...

  9. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin......Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription......-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β(+/+) and LXRα/β(-/-) mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression...

  10. Deficiency of carbohydrate response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis

    OpenAIRE

    Iizuka, Katsumi; Bruick, Richard K.; Liang, Guosheng; Horton, Jay D.; Uyeda, Kosaku

    2004-01-01

    The liver provides for long-term energy needs of the body by converting excess carbohydrate into fat for storage. Insulin is one factor that promotes hepatic lipogenesis, but there is increasing evidence that glucose also contributes to the coordinated regulation of carbohydrate and fat metabolism in liver by mechanisms that are independent of insulin. In this study, we show that the transcription factor, carbohydrate response element-binding protein (ChREBP), is required both for basal and c...

  11. Cyclic adenosine monophosphate-responsive element-binding protein activation predicts an unfavorable prognosis in patients with hepatocellular carcinoma

    OpenAIRE

    Yu L; Guo X; Zhang P; Qi R; Li Z; Zhang S

    2014-01-01

    Lingxiang Yu,* Xiaodong Guo,* Peirui Zhang, Ruizhao Qi, Zhiwei Li, Shaogeng Zhang Department of Hepatobiliary Surgery, 302 Military Hospital of China, Beijing, People’s Republic of China *These authors contributed equally to this work Aim: To investigate the clinical significance of cyclic adenosine monophosphate-responsive element-binding (CREB) and phosphorylated CREB (pCREB) expression in human hepatocellular carcinoma (HCC). Materials and methods: Immunohistochemistry and Weste...

  12. Growth on glucose decreases cAMP-CRP activity while paradoxically increasing intracellular cAMP in the light-organ symbiont Vibrio fischeri.

    Science.gov (United States)

    Colton, Deanna M; Stoudenmire, Julie L; Stabb, Eric V

    2015-09-01

    Proteobacteria often co-ordinate responses to carbon sources using CRP and the second messenger cyclic 3', 5'-AMP (cAMP), which combine to control transcription of genes during growth on non-glucose substrates as part of the catabolite-repression response. Here we show that cAMP-CRP is active and important in Vibrio fischeri during colonization of its host squid Euprymna scolopes. Moreover, consistent with a classical role in catabolite repression, a cAMP-CRP-dependent reporter showed lower activity in cells grown in media amended with glucose rather than glycerol. Surprisingly though, intracellular cAMP levels were higher in glucose-grown cells. Mutant analyses were consistent with predictions that CyaA was responsible for cAMP generation, that the EIIA(Glc) component of glucose transport could enhance cAMP production and that the phophodiesterases CpdA and CpdP consumed intracellular and extracellular cAMP respectively. However, the observation of lower cAMP levels in glycerol-grown cells seemed best explained by changes in cAMP export, via an unknown mechanism. Our data also indicated that cAMP-CRP activity decreased during growth on glucose independently of crp's native transcriptional regulation or cAMP levels. We speculate that some unknown mechanism, perhaps carbon-source-dependent post-translational modulation of CRP, may help control cAMP-CRP activity in V.fischeri. © 2015 John Wiley & Sons Ltd.

  13. Novel kinin B₁ receptor splice variant and 5'UTR regulatory elements are responsible for cell specific B₁ receptor expression.

    Directory of Open Access Journals (Sweden)

    Faang Y Cheah

    Full Text Available The kinin B₁ receptor (B₁R is rapidly upregulated after tissue trauma or inflammation and is involved in cancer and inflammatory diseases such as asthma. However, the role of the: promoter; a postulated alternative promoter; and spliced variants in airway epithelial and other lung cells are poorly understood. We identified, in various lung cell lines and leucocytes, a novel, naturally occurring splice variant (SV of human B₁R gene with a shorter 5'untranslated region. This novel SV is ≈35% less stable than the wild-type (WT transcript in lung adenocarcinoma cells (H2126, but does not influence translation efficiency. Cell-specific differences in splice variant expression were observed post des[Arg10]-kallidin stimulation with delayed upregulation of SV compared to WT suggesting potentially different regulatory responses to inflammation. Although an alternative promoter was not identified in our cell-lines, several cell-specific regulatory elements within the postulated alternative promoter region (negative response element (NRE -1020 to -766 bp in H2126; positive response element (PRE -766 to -410 bp in 16HBE; -410 to +1 region acts as a PRE in H2126 and NRE in 16HBE cells were found. These findings reveal complex regulation of B₁R receptor expression in pulmonary cells which may allow future therapeutic manipulation in chronic pulmonary inflammation and cancer.

  14. The information coded in the yeast response elements accounts for most of the topological properties of its transcriptional regulation network.

    Directory of Open Access Journals (Sweden)

    Duygu Balcan

    Full Text Available The regulation of gene expression in a cell relies to a major extent on transcription factors, proteins which recognize and bind the DNA at specific binding sites (response elements within promoter regions associated with each gene. We present an information theoretic approach to modeling transcriptional regulatory networks, in terms of a simple "sequence-matching" rule and the statistics of the occurrence of binding sequences of given specificity in random promoter regions. The crucial biological input is the distribution of the amount of information coded in these cognate response elements and the length distribution of the promoter regions. We provide an analysis of the transcriptional regulatory network of yeast Saccharomyces cerevisiae, which we extract from the available databases, with respect to the degree distributions, clustering coefficient, degree correlations, rich-club coefficient and the k-core structure. We find that these topological features are in remarkable agreement with those predicted by our model, on the basis of the amount of information coded in the interaction between the transcription factors and response elements.

  15. Mortality study of civilian employees exposed to contaminated drinking water at USMC Base Camp Lejeune: a retrospective cohort study.

    Science.gov (United States)

    Bove, Frank J; Ruckart, Perri Zeitz; Maslia, Morris; Larson, Theodore C

    2014-08-13

    Two drinking water systems at U.S. Marine Corps Base Camp Lejeune, North Carolina were contaminated with solvents during 1950s-1985. We conducted a retrospective cohort mortality study of 4,647 civilian, full-time workers employed at Camp Lejeune during 1973-1985 and potentially exposed to contaminated drinking water. We selected a comparison cohort of 4,690 Camp Pendleton workers employed during 1973-1985 and unexposed to contaminated drinking water. Mortality follow-up period was 1979-2008. Cause-specific standardized mortality ratios utilized U.S. age-, sex-, race-, and calendar period-specific mortality rates as reference. We used survival analysis to compare mortality rates between Camp Lejeune and Camp Pendleton workers and assess the effects of estimated cumulative contaminant exposures within the Camp Lejeune cohort. Ground water contaminant fate/transport and distribution system models provided monthly estimated contaminant levels in drinking water serving workplaces at Camp Lejeune. The confidence interval (CI) indicated precision of effect estimates. Compared to Camp Pendleton, Camp Lejeune workers had mortality hazard ratios (HRs) >1.50 for kidney cancer (HR = 1.92, 95% CI: 0.58, 6.34), leukemias (HR = 1.59, 95% CI: 0.66, 3.84), multiple myeloma (HR = 1.84, 95% CI: 0.45, 7.58), rectal cancer (HR = 1.65, 95% CI: 0.36, 7.44), oral cavity cancers (HR = 1.93, 95% CI: 0.34, 10.81), and Parkinson's disease (HR = 3.13, 95% CI: 0.76, 12.81). Within the Camp Lejeune cohort, monotonic exposure-response relationships were observed for leukemia and vinyl chloride and PCE, with mortality HRs at the high exposure category of 1.72 (95% CI: 0.33, 8.83) and 1.82 (95% CI: 0.36, 9.32), respectively. Cumulative exposures were above the median for most deaths from cancers of the kidney, esophagus, rectum, prostate, and Parkinson's disease, but small numbers precluded evaluation of exposure-response relationships. The study found elevated HRs in the Camp Lejeune cohort for

  16. Camp Health Aide Manual = Manual para trabajadores de salud.

    Science.gov (United States)

    Robinson, June Grube; And Others

    This bilingual manual serves as a textbook for migrant Camp Health Aides. Camp Health Aides are members of migrant labor camps enlisted to provide information about health and social services to migrant workers and their families. The manual is divided into 12 tabbed sections representing lessons. Teaching notes printed on contrasting paper…

  17. Summer Camp and Positive Youth Development: Program with Romanian Youth

    Science.gov (United States)

    Feenstra, Jennifer S.

    2015-01-01

    A variety of activities are used in camps to help promote positive youth development, improving social skills and self-esteem in campers. I expanded on previous camp research in this study to address the influence camps have on trust, belief in the honesty of others, empowerment, and care for others in youth in Eastern Europe. Since 1999, New…

  18. Summer camps for diabetic children: an experience in Antalya, Turkey.

    Science.gov (United States)

    Semiz, S; Bilgin, U O; Bundak, R; Bircan, I

    2000-01-01

    To evaluate the effectiveness of diabetic summer camps with objective parameters, we examined the data relative to summer camps organized by our department in Antalya in the last two years. The duration of the camps was 10 days. Twenty-eight diabetic children with an average age of 13.6 +/- 2.9 years (range 8-20) participated in the first camp, fourteen of whom participated in both camps. The medical personnel consisted of three pediatric endocrinologists, one psychologist, two diabetes nurses and two dietitians. Despite a mean 10% reduction in insulin dosage and 10% increment in daily calorie intake at the beginning of the camp, hypoglycemia was common (mean, 2.4 hypoglycemic episodes per subject). Ketoacidosis was not encountered in any of the subjects during and after camps. An increment in weight in children whose weights, with respect to heights, were under the ideal weight and a decrement in weight of overweight children were observed at the end of the first camp. A significant improvement in knowledge and self-management of the disease was noted at the end of the camps. Improvement in nutrition and diabetic knowledge level of the children who participated in these consecutive camps was more obvious in the second compared with that in the first camp. No significant change in HbA1c level was observed at follow-up. In conclusion, summer camps are an invaluable way for diabetic children to gain skills in managing their disease.

  19. 7 CFR 502.6 - Hunting, fishing, camping, horseback riding.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Hunting, fishing, camping, horseback riding. 502.6..., MARYLAND § 502.6 Hunting, fishing, camping, horseback riding. The use of BARC grounds for any form of hunting, fishing, camping, or horseback riding is prohibited. Further, the use of these grounds for...

  20. Nutritional Status of Children in Displacement Camps in Sierra Leone

    African Journals Online (AJOL)

    In this study, stunting, under nutrition, and wasting were measured among 454 children under the age of 10 years in four internally displaced persons (IDP) camps. Stunting was found to be the most common nutritional abnormality in all four IDP camps with the highest prevalence rate (29.3%) in the Trade Center Camp and ...

  1. Engaging in the Community: Zoo Camp Goes to School

    Science.gov (United States)

    Martell, Emma

    2017-01-01

    Museum camps are a popular option over school vacation, but they are not always accessible to families who lack transportation and live far from the institution. This article presents an alternative format for camp: running a museum camp from within a neighborhood public school. Collaboration with school staff and community members is a key to…

  2. Three-Dimensional Learning at Camp Mind's Eye.

    Science.gov (United States)

    Bryant, Rita

    1987-01-01

    Camp Mind's Eye is a one-week residential summer program for intellectually and creatively gifted children provided by Camp Tyler (Texas), one of the oldest outdoor education facilities. The camp program stresses right brain thinking, a flexible curriculum, and autonomous instructors. (DB)

  3. Chemotactic antagonists of cAMP inhibit Dictyostelium phospholipase C

    NARCIS (Netherlands)

    Bominaar, Anthony A.; Haastert, Peter J.M. van

    In Dictyostelium discoideum extracellular cAMP induces chemotaxis via a transmembrane signal transduction cascade consisting of surface cAMP receptors, G-proteins and effector enzymes including adenylyl cyclase, guanylyl cyclase and phospholipase C. Previously it was demonstrated that some cAMP

  4. Healthy Campers: The Physical Benefits of Camp.

    Science.gov (United States)

    McSwegin, Patricia; And Others

    1991-01-01

    Discusses the importance of planning, implementing, and evaluating camp physical activity programs. Appropriate physical activity programing should consider frequency, intensity, time, and type of activity. Also important are following the principles critical to physical training: specificity, overload, and progression. Two examples of physical…

  5. British scorched earth and concentration camp policies.

    African Journals Online (AJOL)

    Nick

    THE BRITISH SCORCHED EARTH AND. CONCENTRATION CAMP POLICIES IN THE. POTCHEFSTROOM REGION, 1899–1902. 1. Prof GN van den Bergh. Research Associate, North-West University. Abstract. The continued military resistance of the Republics after the occupation of. Bloemfontein and Pretoria and ...

  6. Camp Minden Fact Sheet April 2014

    Science.gov (United States)

    Two groups of PRPs which include GD/ATK and Hercules Inc. signed Administrative Orders on Consent with the EPA that will remove and dispose approximately 3.7 million pounds of explosive material at the Explo Systems, Inc Camp Minden, Louisiana site.

  7. E. Coli: Preventing Outbreaks at Camp.

    Science.gov (United States)

    McKinney, Mary D.

    1996-01-01

    One strain of E. coli is not usually found in foods, but has been related to consumption of undercooked ground beef. Symptoms are stomach cramps and diarrhea, and 2-7% of infections lead to hemolytic uremic syndrome, which is life threatening. Camps can prevent outbreaks by avoiding uncooked meat on overnight campouts and requiring appropriate…

  8. Targeted needs assessment for a transitional "boot camp" curriculum for pediatric surgery residents.

    Science.gov (United States)

    Blackmore, Christopher; Lopushinsky, Steve; Lockyer, Jocelyn; Paolucci, Elizabeth Oddone

    2015-05-01

    Transition periods in medical education are associated with increased risk for learners and patients. For pediatric surgery residents, the transition to training is especially difficult as learners must adjust to new patient populations. In this study we perform a targeted needs assessment to determine the ideal content and format of a pediatric surgery boot camp to facilitate the transition to residency. A needs assessment survey was developed and distributed to pediatric surgery residents and staff across North America. The survey asked participants to rank 30 pediatric surgical diagnoses, 20 skills, and 11 physiological topics on "frequency" and "importance". Items were then ranked using empirical methods. The survey also evaluated the preferred boot camp format. In total, 12 residents and 23 staff completed the survey. No significant differences were identified between staff and residents in survey responses. The top 5 topics identified for inclusion in a boot camp were: (1) fluid and electrolyte management, (2) appendicitis, (3) pediatric hernias, (4) nutrition and (5) pain management. The preferred format for a boot camp was 3-4days in duration applying a blend of educational methods. Based on the results of the needs assessment survey, a novel pediatric surgery boot camp curriculum can be developed. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  9. Refugees in and out North Africa: a study of the Choucha refugee camp in Tunisia.

    Science.gov (United States)

    Dourgnon, Paul; Kassar, Hassène

    2014-08-01

    In recent years, North African (NA) countries ceased to be emigration-only countries and are now on the verge of becoming immigration as well as transit countries for economic migrants and refugees. Contextual as well as structural long-term factors are driving these changes. The ongoing crises in Africa and the Middle East are prompting strong outflows of refugees, which are likely to induce NA countries to share some common public policy and public health concerns with European countries in a near future. This article highlights some aspects of these changes, from the study of the consequences of the 2011 Libyan crisis in Tunisia. It addresses individual trajectories and health concerns of refugees in and out North Africa from a study of the Choucha camp in Tunisia. The camp opened to immigrants from Libya during the 2011 crisis and accommodated the bulk of the refugees flow to Tunisia until July 2012. The study includes a monographic approach and a qualitative survey in the Choucha camp refugees. We describe the crisis history and the health response with a focus on the camp. We then address refugees' trajectories, and health needs and concerns from the interviews we collected in the camp in April 2012. © The Author 2014. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

  10. Evidence for cAMP as a mediator of gonadotropin secretion from male pituitaries

    Energy Technology Data Exchange (ETDEWEB)

    Bourne, G.A.; Baldwin, D.M.

    1987-09-01

    The purpose of this study was to use sodium flufenamate, a compound that inhibits gonadotropin-releasing hormone (GnRH)-stimulated adenosine 3',5'-cyclic monophosphate (cAMP) production in the pituitary, to evaluate the potential role of cAMP as a mediator of GnRH-stimulated gonadotropin secretion from male pituitaries. Quartered male pituitaries were perifused at 37/sup 0/C and sequential effluent fractions collected every 10 min. Infusions of GnRH resulted in a twofold increase in luteinizing hormone (LH) and follicle-stimulating hormone (FSH) secretion. Cycloheximide, 5 ..mu..M, completely inhibited the GnRH-stimulated LH and FSH secretion. Infusions of 0.1 mM flufenamate had similar effects on gonadotropin secretion as cycloheximide, whereas the administration of 5 mM dibutyryl cAMP in combination with GnRH and flufenamate restored the secretory responses of both hormones. The flufenamate-inhibited GnRH stimulated LH and FSH release, which was restored by DBcAMP and appeared to be protein synthesis dependent and specific for cAMP.These results suggest an indirect role for cAMP as a mediator of gonadotropin secretion from male pituitaries. However, in contrast to female pituitaries, the secretion of these hormones form male pituitaries is completely dependent on cAMP and de novo protein synthesis.

  11. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres.

    Science.gov (United States)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter; Damkier, Per; Christensen, Hanne Rolighed; Böttiger, Ylva; Schjøtt, Jan

    2017-05-01

    The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for which queries were part of the study. The responses were assessed qualitatively by six clinical pharmacologists (internal experts) and six general practitioners (GPs, external experts). In addition, linguistic aspects of the responses were evaluated by a plain language expert. The quality of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some experts preferred the use of primary sources to the use of secondary and tertiary sources. Both internal and external experts criticised the use of abbreviations, professional terminology and study findings that was left unexplained. The plain language expert emphasised the importance of defining and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. This evaluation of responses to DIC queries may give some indications on how to improve written responses on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal.

  12. Offering a Forensic Science Camp To Introduce and Engage High School Students in Interdisciplinary Science Topics

    DEFF Research Database (Denmark)

    Ahrenkiel, Linda; Worm-Leonhard, Martin

    2014-01-01

    In this article, we present details of a one-week interdisciplinary science camp for high school students in Denmark, “Criminal Camp”. We describe the use of forensic science and simulated crimes as a common foundation for teaching the theory and practice of concepts in chemistry, physics......, and medicine or biology. The main goal of the science camp program was to introduce the participants to the nature of science and what scientists do as the students experience easily understandable real-world scenarios. Results from a survey indicate that Criminal Camp had a positive effect on the participants......’ attitudes toward science in general and the applications within forensic science in particular. From the free-response answers given in the survey, it was furthermore inferred that the participants enjoyed working with science in an interdisciplinary context, and that they gained both concrete knowledge...

  13. The role of the concentration camps in the Nazi repression of prostitutes, 1933-9.

    Science.gov (United States)

    Harris, Victoria

    2010-01-01

    This article uses prostitutes as a case study in order to investigate the role of the early concentration camps as centres of detention for social deviants. In contrasting the intensification of repressive policies towards prostitutes against narratives which demonstrate the unexpectedly lax treatment of these women, it explores what the reasons behind these contradictions might have been, and what this demonstrates about the development of these institutions. It asks the following questions. How and why were prostitutes interned? Which bureaucrats were responsible for incarcerating these women and what did they view the role of the camp to be? Were such policies centrally directed or the product of local decision-making? Through asking these questions, the article explores to what extent these camps were unique as mechanisms for the repression and marginalization of prostitutes.

  14. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    for all the distinct elements. The dynamic modulus and phase angle from uniaxial complex modulus tests of the asphalt mixtures in the laboratory have been collected. A macro-scale Burger’s model was first established and the input parameters of Burger’s contact model were calibrated by fitting....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties...

  15. Finite element modelling of crash response of composite aerospace sub-floor structures

    Science.gov (United States)

    McCarthy, M. A.; Harte, C. G.; Wiggenraad, J. F. M.; Michielsen, A. L. P. J.; Kohlgrüber, D.; Kamoulakos, A.

    Composite energy-absorbing structures for use in aircraft are being studied within a European Commission research programme (CRASURV - Design for Crash Survivability). One of the aims of the project is to evaluate the current capabilities of crashworthiness simulation codes for composites modelling. This paper focuses on the computational analysis using explicit finite element analysis, of a number of quasi-static and dynamic tests carried out within the programme. It describes the design of the structures, the analysis techniques used, and the results of the analyses in comparison to the experimental test results. It has been found that current multi-ply shell models are capable of modelling the main energy-absorbing processes at work in such structures. However some deficiencies exist, particularly in modelling fabric composites. Developments within the finite element code are taking place as a result of this work which will enable better representation of composite fabrics.

  16. Body Art Comes to Camp: Tattooing and Piercing Are Becoming Mainstream; Does Your Camp Have a Policy?

    Science.gov (United States)

    Cameron, Sandy

    2000-01-01

    Tattooing and body piercing are becoming mainstream, especially among the college population that comprises camp staff. Campers often idolize their counselors and want to be like them. Piercings may present a safety hazard. Camps should develop a policy and communicate it to prospective counselors and campers as early as possible. Several camps'…

  17. Balancing Educational Practice with Psychological Theory: Lukinsky's Study of a Bold Camp Ramah Curriculum

    Science.gov (United States)

    Reimer, Joseph

    2016-01-01

    Missing from the growing literature on Jewish camps is Lukinsky's (1968) pioneering study of the curriculum to teach responsibility that he designed for the 1966 Ramah American Seminar. Reviewing this work I discovered that Lukinsky--under Schwab's (1971) influence--creates a rare balance between his own perspectives as an educational practitioner…

  18. Requirement of cAMP signaling for Schwann cell differentiation restricts the onset of myelination.

    Directory of Open Access Journals (Sweden)

    Ketty Bacallao

    Full Text Available Isolated Schwann cells (SCs respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1. To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC agonists and antagonists revealed that selective transmembrane AC (tmAC activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC, a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the

  19. The ever unfolding story of cAMP signalling in trypanosomatids: vive la difference!

    Directory of Open Access Journals (Sweden)

    Daniel Nii Aryee Tagoe

    2015-09-01

    Full Text Available Kinetoplastids are unicellular, eukaryotic, flagellated protozoans containing the eponymous kinetoplast. Within this order, the family of trypanosomatids are responsible for some of the most serious human diseases, including Chagas disease (Trypanosoma cruzi, sleeping sickness (T. brucei spp. and leishmaniasis (Leishmania spp. Although cAMP is produced during the life cycle stages of these parasites, its signalling pathways are very different from those of mammals. The absence of G-protein-coupled recep¬tors, the presence of structurally different adenylyl cyclases, the paucity of known cAMP effector proteins and the stringent need for regulation of cAMP in the small kinetoplastid cells all suggest a significantly different biochemical pathway and likely cell biology. However, each of the main kinetoplastid parasites express four class 1-type cyclic nucleotide-specific phosphodiesterases (PDEA-D, which have highly similar catalytic domains to that of human PDEs. To date, only TbrPDEB, expressed as two slightly different isoforms TbrPDEB1 and B2, has been found to be essential when ablated. Although the genomes contain reasonably well con¬served genes for catalytic and regulatory domains of pro¬tein kinase A, these have been shown to have varied structural and functional roles in the different species. Recent discovery of a role of cAMP/AMP metabolism in a quorum-sensing signalling pathway in T. brucei, and the identification of downstream cAMP Response Proteins (CARPs whose expression levels correlate with sensitivity to PDE inhibitors, suggests a complex signalling cascade. The interplay between the roles of these novel CARPs and the quorum-sensing signalling pathway on cell division and differentiation makes for intriguing cell biology and a new paradigm in cAMP signal transduction, as well as potential targets for trypanosomatid-specific cAMP pathway-based therapeutics.

  20. The involvement of cAMP in the growth inhibition of filamentous fungus Rhizopus nigricans by steroids.

    Science.gov (United States)

    Jeraj, Natasa; Lenasi, Helena; Breskvar, Katja

    2005-01-01

    Several steroids, in particular progesterone, are toxic for the filamentous fungus Rhizopus nigricans and, at high concentrations, inhibit its growth. Previous studies on this microorganism revealed progesterone specific receptors coupled to G proteins at the plasma membrane. In this study, the next step of steroid signalling in R. nigricans following G protein activation is investigated, together with the possible impact of this pathway on fungal growth inhibition. The intracellular level of cAMP decreased in the presence of steroids, demonstrating the probable involvement of cAMP signalling in the response of R. nigricans to steroids. Results of the growth analysis in the presence of cAMP increasing agents suggest that the role of cAMP in fungal growth inhibition by steroids cannot be ruled out, but it would appear to be minor and not make a major contribution to growth inhibition.

  1. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  2. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L-1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Rights and responsibilities in Darfur

    Directory of Open Access Journals (Sweden)

    Katherine Reyes

    2009-09-01

    Full Text Available A combined UN-military-police-humanitarian initiative hasbeen promoting civic rights and responsibilities among IDPsin order to increase security throughout Kalma camp and itssurroundings.

  4. Summer camps for children with burn injuries: a literature review.

    Science.gov (United States)

    Maslow, Gary R; Lobato, Debra

    2010-01-01

    The first summer camps for children with burn injuries started over 25 years ago, and as of 2008, there were 60 camps worldwide. This review examines the literature on summer pediatric burn camps. The authors describe common characteristics of burn camp structure, activities, and staffing and then examine the scientific evidence regarding the effect of burn camp programs on campers and camp staff volunteers. A search of Pubmed and Psychinfo databases from 1970 to 2008 for articles related to pediatric burn summer camps identified 17 articles, of which 13 fit the inclusion criteria. Existing literature consists primarily of qualitative studies, suggesting that burn camp can decrease camper isolation, improve self-esteem, and promote coping and social skills. Studies examining volunteer staff at burn camp have consistently found that there are both personal and professional benefits. Quantitative studies of self-esteem have yielded equivocal results. No studies have examined safety or the effect of burn camp on medical or rehabilitation outcomes. For the past 25 years, pediatric summer camps for children with burn injuries have played an important rehabilitation role and provided a strong community that benefits both campers and staff. Future research using more rigorous research methods and examining a broader range of outcomes (eg, safety and medical/rehabilitation outcomes) is recommended.

  5. Sweat mineral-element responses during 7 h of exercise-heat stress.

    Science.gov (United States)

    Montain, Scott J; Cheuvront, Samuel N; Lukaski, Henry C

    2007-12-01

    Uncertainty exists regarding the effect of sustained sweating on sweat mineral-element composition. To determine the effect of multiple hours of exercise-heat stress on sweat mineral concentrations. Seven heat-acclimated subjects (6 males, 1 female) completed 5 x 60 min of treadmill exercise (1.56 m/s, 2% grade) with 20 min rest between exercise periods in 2 weather conditions (27 degrees C, 40% relative humidity, 1 m/s and 35 degrees C, 30%, 1 m/s). Sweat was collected from a sweat-collection pouch attached to the upper back during exercise bouts 1, 3, and 5. Mineral elements were determined by using inductively coupled plasma-emission spectrography. At 27 degrees C, sweat sodium (863 [563] microg/mL; mean [SD]), potassium (222 [48] microg/mL), calcium (16 [7]) microg/mL), magnesium (1265 [566] ng/mL), and copper (80 [56] ng/mL) remained similar to baseline over 7 h of exercise-heat stress, whereas sweat zinc declined 42-45% after the initial hour of exercise-heat stress (Ex1 = 655 [362], Ex3 = 382 [168], Ex5 = 355 [288] microg/mL, P sweat zinc at 35 degrees C when sweat rates were higher. Sweat rate had no effect on sweat trace-element composition. Sweat sodium, potassium, and calcium losses during multiple hours of sustained sweating can be predicted from initial sweat composition. Estimates of sweat zinc losses, however, will be overestimated if sweat zinc conservation is not accounted for in sweat zinc-loss estimates.

  6. Boot Camps for Charter Boards

    Science.gov (United States)

    Kronholz, June

    2015-01-01

    This article addresses the question of who owns the responsibility when a charter school gets into trouble--when its students aren't learning, or it misses its enrollment targets, or money runs short, or it closes. Upon presenting this question to a director of a charter school, a board member, and a Massachusetts-based education consultant and…

  7. Communication Boot Camp: Discover the Speaker in You!

    Directory of Open Access Journals (Sweden)

    Zuraidah Binti Ali

    2013-07-01

    Full Text Available Learning can take place almost anywhere, and this is especially true for our undergraduates who wish to become public speakers. Besides university course and public speaking workshops on campus grounds, undergraduates are now looking for a different learning environment – communication boot camps!! This study presents a compilation of learners’ experience, fun-filled activities, insightful feedback and memorable boot camp moments as captured in camp photos and feedback surveys. It involves a total of thirty seven undergraduates who enrolled in a Communication Boot Camp at Janda Baik, Pahang. Results show that Communication Boot Camp is a successful strategy to groom public speakers with a positive correlation between camp success and camp objectives, particularly in reducing shyness, motivating participants to become public speakers and discovering their talent and skills. In short, the study adds to the promise of zest and delight in public speaking.

  8. Children's cancer camps: a way to understand grief differently.

    Science.gov (United States)

    Laing, Catherine M; Moules, Nancy J

    2015-01-01

    A philosophical hermeneutic study was conducted as part of the first author's doctoral research to understand the meaning of children's cancer camps for the child with cancer and the family. Twenty family members from six families were interviewed in order to bring understanding to this topic. This article will detail the finding related to the experience of grief that often accompanies a cancer diagnosis, and how camp seems to allow children and families to understand their grief differently. The interesting thing about this particular cancer camp is that families of children who have died continue to attend the camp yearly, and there are events to memorialize the many children known to all the campers who no longer attend camp. This is not a grief camp but a cancer camp where grief is allowed presence as it necessarily has to in the world of childhood cancer.

  9. Suicide in Nazi concentration camps, 1933-9.

    Science.gov (United States)

    Goeschel, Christian

    2010-01-01

    Too often histories of the concentration camps tend to be ignorant of the wider political context of nazi repression and control. This article tries to overcome this problem. Combining legal, social and political history, it contributes to a more thorough understanding of the changing relationship between the camps as places of extra-legal terror and the judiciary, between nazi terror and the law. It argues that the conflict between the judiciary and the SS was not a conflict between "good" and "evil," as existing accounts claim. Rather, it was a power struggle for jurisdiction over the camps. Concentration camp authorities covered up the murders of prisoners as suicides to prevent judicial investigations. This article also looks at actual suicides in the pre-war camps, to highlight individual inmates' reactions to life within the camps. The article concludes that the history of the concentration camps needs to be firmly integrated into the history of nazi terror and the Third Reich.

  10. Yield and Mineral Element Concentration of Beetroot in Response to Nutrient Source in Hydroponic Solution

    OpenAIRE

    Egilla, Jonathan N.

    2009-01-01

    The yield and mineral element concentration of beetroot (Beta vulgaris ‘Bulls Blood’) was determined in a closed nutrient-recirculating ‘Nutrient Film Technique’ (NFT) hydroponic experiment. Seedlings were grown and harvested 42 days after transfer into NFT system (DAT), either with a commercial hydroponic fertilizer or a non-hydroponic soluble fertilizer containing in mg liter-1: 108 nitrogen (N) and 12 calcium (Ca) (N1Ca1), or 200 N and 66.7 Ca (N2Ca2), respectively. Nutrient source had no ...

  11. Sand Fly Surveillance and Control on Camp Ramadi, Iraq, as Part of a Leishmaniasis Control Program

    Science.gov (United States)

    2013-12-01

    Vol. 38, no. 2 Journal of Vector Ecology 411 Scientific Note Sand fly surveillance and control on Camp Ramadi, Iraq, as part of a leishmaniasis ...following the 2003 invasion experienced serious risk of infection by several vector-borne pathogens, specifically cutaneous (CL) and visceral leishmaniasis ...as part of a leishmaniasis control program 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e

  12. Differential regulation of GPR54 transcription by specificity protein-1 and partial estrogen response element in mouse pituitary cells.

    Science.gov (United States)

    DeFino, Mia C; Wacker, Jennifer L; Lyssand, John S; Wang, Edith H; Hague, Chris

    2010-03-19

    Precise spatial and temporal expression of the recently identified G-protein coupled receptor GPR54 is critical for proper reproductive function and metastasis suppression. However, regulatory factors that control GPR54 expression remain unknown. Thus, the identification of these cis-acting DNA elements can provide insight into the role of GPR54 in reproduction and cancer. Using luciferase reporter, electrophoretic mobility shift, and chromatin immunoprecipitation assays, we demonstrate that three SP1 sites and a partial estrogen response element modulate mouse GPR54 (mGPR54) promoter activity. Supporting experiments show transcription factor SP1 binds directly to the mGPR54 promoter region and activates gene expression. In conclusion, these novel findings now identify factors that regulate activity of the mGPR54 promoter, and these factors are highly conserved across multiple mammalian species. Published by Elsevier Inc.

  13. Quantitative analysis of polycomb response elements (PREs) at identical genomic locations distinguishes contributions of PRE sequence and genomic environment.

    Science.gov (United States)

    Okulski, Helena; Druck, Birgit; Bhalerao, Sheetal; Ringrose, Leonie

    2011-03-16

    Polycomb/Trithorax response elements (PREs) are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw) reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7) with a PRE from the vestigial (vg) gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT) that is essential for silencing. This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  14. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  15. Evidence for cAMP as a mediator of gonadotropin secretion from female pituitaries

    Energy Technology Data Exchange (ETDEWEB)

    Bourne, G.A.; Baldwin, D.M.

    1987-09-01

    Sodium flufenamate, which inhibited gonadotropin-releasing hormone (GnRH)-stimulated increases in adenosine 3',5'-cyclic monophosphate (cAMP), was used to evaluate the potential role of cAMP as a mediator of GnRH-stimulated gonadotropin secretion. Quartered pituitaries from diestrous II female rats were perifused at 37/sup 0/C, and sequential effluent fractions were collected every 10 min. Administration of GnRH resulted in a characteristic biphasic response for both luteinizing hormone (LH) and follicle-stimulating hormone (FSH), whereas 5 ..mu..M cycloheximide inhibited the secondary augmented responses (phase II) of both hormones. Infusions of 0.1 mM flufenamate inhibited GnRH-stimulated gonadotropin secretion in a manner similar to that of cycloheximide, whereas the administration of 5 mM dibutyryl cAMP in combination with GnRH and flufenamate resulted in the restoration of LH and FSH secretion. The dibutyryl cAMP-restored response appeared to be protein synthesis dependent and specific for cAMP. These results suggest that although the cyclic nucleotide is not involved in the acute release of LH and FSH, it does appear to play a pivotal but indirect role in phase II release of the hormones, by effects involving the stimulation of de novo protein synthesis.

  16. Video podcasts as a long-distance outreach tool: Polar science from Byrd Camp, West Antarctica

    Science.gov (United States)

    Berg, M.; Science; Engineering Team Of Polenet Field Seasons 2009-10; 2010-11

    2011-12-01

    Video Podcasts offer a unique opportunity to actively engage the public in ongoing research projects by revealing faces and stories from field, lab and engineering efforts that often happen behind the scenes. Podcasts thus allow the science community to not only present their accomplishments, but also the where, how and why. Publishing these videos in real time while stationed at remote field camps brings particular challenges to the process. This was the case during the POLNET (Polar Earth Observing Network) field seasons at Byrd Camp, West Antarctica. With no internet connection and limited flights in and out of camp, the team worked to produce a series of Video Podcast field updates that were flown to McMurdo Station and uploaded to a web server off the continent. These videos provided glimpses of living and working on a remote ice sheet while installing GPS and seismic stations. At a time when climate science is under extreme scrutiny, this project offered a tangible and human view of efforts to model how ice masses are changing. In any science education effort, the risk of diluting the science until it is no longer meaningful poses certain challenges. At the same time, going into great depth about the methods and theories using technical vocabulary can immediately turn away an audience that is already inundated with information. These videos represent an attempt to creatively and accurately present scientific concepts in short, digestible segments that bring elements of fun from the unique field setting and personalities of Byrd Camp, West Antarctica.

  17. "I Say Aggressive, You Say Assertive": The Intercultural Experiences of Israeli Shlichim at American Jewish Summer Camp

    Science.gov (United States)

    Meiseles, Andrea

    2017-01-01

    In this dissertation, I investigate how Israeli staff members understand the intercultural encounter they experienced in an overnight camp setting; how they navigated the experience; and how the intercultural encounter has impacted them. The research was conducted through qualitative methods of data collection, including elements of ethnography,…

  18. Member Discrete Element Method for Static and Dynamic Responses Analysis of Steel Frames with Semi-Rigid Joints

    Directory of Open Access Journals (Sweden)

    Jihong Ye

    2017-07-01

    Full Text Available In this paper, a simple and effective numerical approach is presented on the basis of the Member Discrete Element Method (MDEM to investigate static and dynamic responses of steel frames with semi-rigid joints. In the MDEM, structures are discretized into a set of finite rigid particles. The motion equation of each particle is solved by the central difference method and two adjacent arbitrarily particles are connected by the contact constitutive model. The above characteristics means that the MDEM is able to naturally handle structural geometric nonlinearity and fracture. Meanwhile, the computational framework of static analysis is consistent with that of dynamic analysis, except the determination of damping. A virtual spring element with two particles but without actual mass and length is used to simulate the mechanical behaviors of semi-rigid joints. The spring element is not directly involved in the calculation, but is employed only to modify the stiffness coefficients of contact elements at the semi-rigid connections. Based on the above-mentioned concept, the modified formula of the contact element stiffness with consideration of semi-rigid connections is deduced. The Richard-Abbort four-parameter model and independent hardening model are further introduced accordingly to accurately capture the nonlinearity and hysteresis performance of semi-rigid connections. Finally, the numerical approach proposed is verified by complex behaviors of steel frames with semi-rigid connections such as geometric nonlinearity, snap-through buckling, dynamic responses and fracture. The comparison of static and dynamic responses obtained using the modified MDEM and those of the published studies illustrates that the modified MDEM can simulate the mechanical behaviors of semi-rigid connections simply and directly, and can accurately effectively capture the linear and nonlinear behaviors of semi-rigid connections under static and dynamic loading. Some conclusions

  19. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  20. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  1. Yoga camp in Ayurvedgrams of Chhattisgarh

    Directory of Open Access Journals (Sweden)

    Raghavendra Madhu

    2012-01-01

    Full Text Available The clinical and empirical health benefits of yoga and pranayam have been reiterated through research. Yoga is being adopted as a system to alleviate the burden of noncommunicable diseases (NCDs across the globe. The Directorate of AYUSH, Government of Chhattisgarh (DoA, GoCG conducts annual 5-day-yoga camp across 146 Ayurvedgrams in the State. The present article brings out the AYUSH initiatives the State is taking toward active ageing. A total of 71,096 people participated in the 5-day-yoga camp across the State. A mean participation of 5079 people over 5 days was reported across districts. Such statewide practices need to be promoted and appraised.

  2. Primary health care in Somalian refugee camps.

    Science.gov (United States)

    Johnston, B

    1982-01-01

    The convergence of thousands in Somalia's refugee camps has created an emergency in health care provision. To tackle this problem, the Ministry of Health, in conjunction with UNICEF, recruited a small group of Somali professionals to draw up a plan for the training of community health workers to serve in the camps. A 2nd objective was to make an assessment of the nutritional status of the refugees, and provision of maternal and child health care. At the end of a 2 week workshop a plan was drawn up which emphasized the teaching of preventive medicine, particularly in the control of communicable diseases. It was decided that students in the postbasic training program in administration and teaching in the health service would serve as teachers. Teaching was kept basic and simple, mostly concentrating on topics related to hygiene and food preparation, for example. During program implementation inspection visits were carried out at intervals by a health educator and tutor from the nursing school. At the same time further briefing was given to as many concerned people in the camps as possible. Preliminary feedback suggested that the program was proceeding successfully. After 3 months an evaluation was carried out by teachers in the program. The evaluation showed a great deal to have been accomplished in spite of the disinterest of some parts of the population. The success was attributed to the involvement of Somalis in the camp communities. As of September 1981, the pace of the programs has increased, with the inclusion of health services from expatriate sources within Ministry of Health guidelines.

  3. S'Cool LAB Summer CAMP 2017

    CERN Document Server

    Woithe, Julia

    2017-01-01

    The S’Cool LAB Summer CAMP is an opportunity for high-school students (aged 16-19) from all around the world to spend 2 weeks exploring the fascinating world of particle physics. The 24 selected participants spend their summer at S’Cool LAB, CERN’s hands-on particle physics learning laboratory, for an epic programme of lectures and tutorials, team research projects, visits of CERN’s research installations, and social activities.

  4. Injury patterns at US and Canadian overnight summer camps: first year of the Healthy Camp study.

    Science.gov (United States)

    Goldlust, E; Walton, E; Stanley, R; Yard, E; Garst, B; Comstock, R D; Erceg, L E; Cunningham, R

    2009-12-01

    To describe injury patterns at overnight summer camps in 2006, and identify risk factors for more significant injury. Surveillance data obtained from Healthy Camp Study from 2006 were analyzed from 71 overnight camps, representing 437,541 camper-days and 206,031 staff-days. Injuries were reported in 218 campers and 81 staff. 51.8% of injured campers were male versus 34.6% of staff. Among campers, 60.1% were evaluated off-site; 2.3% required hospital admission. 43.9% of injuries required >24 h activity restriction (deemed "significant injury"). Among campers, significant injury was associated with camp sessions > or =14 days (RR 1.48); among staff, with male sex (RR 1.85) and camper-to-staff ratio (RR 0.67). There were no associations with age, time of day, setting, or level of supervision. Significant injuries are uncommon at overnight summer camps. Rates appear similar to those in comparable activities. Targeted interventions may further reduce injury risk.

  5. Extract of Ziziphus jujuba Fruit (Jujube) Stimulates Expression of Enzymes Responsible for Heme Recycle via Anti-oxidant Response Element in Cultured Murine Macrophages.

    Science.gov (United States)

    Chen, Jianping; Lam, Candy T W; Li, Zhonggui; Yao, Ping; Lin, Huangquan; Dong, Tina T X; Tsim, Karl W K

    2016-02-01

    Jujube, the fruit of Ziziphus jujuba Mill., is a functional food and commonly used as a health supplement worldwide. To study the beneficial role of jujube in heme iron recycling during erythrophagocytosis, the expression of heme oxygenase-1 (HO-1), biliverdin reductase A and B, and ferroportin were determined in jujube-treated cultured RAW 264.7 macrophages. Application of a chemically standardized jujube water extract in cultured RAW 264.7 cells for 24 h stimulated the expressions of HO-1, biliverdin reductase A, biliverdin reductase B, and ferroportin in a concentration-dependent manner, having the maximal responses from twofolds to threefolds. A plasmid containing anti-oxidant response element, a regulator for HO-1 transcription, was transfected into RAW 264.7 cells. Application of jujube water extract onto the transfected macrophages stimulated the anti-oxidant response element-mediated transcriptional activity by twofolds. These results supported the potential capacity of jujube by regulating expressions of heme iron recycling genes in cultured macrophages. Copyright © 2015 John Wiley & Sons, Ltd.

  6. Identification of a Gene Sharing a Promoter and Peroxisome Proliferator-Response Elements With Acyl-CoA Oxidase Gene

    Directory of Open Access Journals (Sweden)

    Mst. Hasina Akter

    2006-01-01

    Full Text Available Many mammalian genes are clustered on the genomes, and hence the genes in the same cluster can be regulated through a common regulatory element. We indeed showed previously that the perilipin/PEX11α gene pair is transactivated tissue-selectively by PPARγ and PPARα, respectively, through a common binding site. In the present study, we identified a gene, named GSPA, neighboring a canonical PPAR target, acyl-CoA oxidase (AOX gene. GSPA expression was induced by a peroxisome proliferator, Wy14,643, in the liver of wild-type mice, but not PPARα-null mice. GSPA and AOX share the promoter and two peroxisome proliferator-response elements. GSPA mRNA was also found in the heart and skeletal muscle, as well as 3T3-L1 cells. GSPA encodes a protein of 161 amino acids that is enriched in 3T3-L1 cells. Even other gene pairs might be regulated through common sequence elements, and conversely it would be interesting how each gene is aptly regulated in clusters.

  7. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  8. Structural Responses and Finite Element Modeling of Hakka Tulou Rammed Earth Structures

    Science.gov (United States)

    Sranislawski, Daniel

    Hakka Tulous are rammed earth structures that have survived the effects of aging and natural elements upwards of even over a thousand years. These structures have housed the Hakka people of the Fujian Province, China in natural yet modern housing that has provided benefits over newer building materials. The key building material, rammed earth, which is used for the walls of the Hakka Tulou structures, has provided structural stability along with thermal comfort to the respective inhabitants of the Hakka Tulous. Through material testing and analysis this study has examined how the Tulou structures have maintained their structural stability while also providing thermal comfort. Reports of self healing cracks in the rammed earth walls were also analyzed for their validity in this study. The study has found that although the story of the self healing crack cannot be validated, there is reason to believe that with the existence of lime, some type of autogenous healing could occur on a small scale. The study has also found, through the use of nondestructive testing, that both the internal wooden systems (flooring, roof, and column support) and the rammed earth walls, are still structurally sound. Also, rammed earth's high thermal mass along with the use of sufficient shading has allowed for a delay release of heat energy from the walls of the Tulous, thus providing thermal comfort that can be felt during both night and day temperatures. The Hakka Tulou structures have been found to resist destruction from natural disasters such as strong earthquakes even when more modern construction has not. Through finite element modeling, this study has shown that the high volume of rammed earth used in the construction of the Hakka Tulous helps dissipate lateral force energy into much lower stresses for the rammed earth wall. This absorption of lateral force energy allows the rammed earth structures to survive even the strongest of earthquakes experienced in the region. The Hakka

  9. Investigation of mechanical responses to the tactile perception of surfaces with different textures using the finite element method

    Directory of Open Access Journals (Sweden)

    Wei Tang

    2016-07-01

    Full Text Available Tactile perception is essential for humans to perceive the world, and it usually results in mechanical responses from the finger. In this study, a nonlinear, viscoelastic, and multilayered finite element model of the finger was developed. The relationship between the mechanical responses within the finger and tactile perception while the finger scanned different surface textures was studied. The results showed that the sensitivity of tactile perception is affected by the peak value of von Mises stress, which is itself determined by the shape and density of a given texture. The von Mises stress varies periodically with time, and this variation depends on the periodicity of the texture. Displacement signals around Pacinian corpuscles have periodic variation. The period of displacement decreases as the density of the texture increases. The spectral centroid increases as the spacing of the texture decreases. The related mechanisms are discussed in this article.

  10. Impact of the Purdue University School of Veterinary Medicine's Boiler Vet Camp on participants' knowledge of veterinary medicine.

    Science.gov (United States)

    Weisman, James L; Amass, Sandra F; Warren, Joshua D

    2011-04-01

    To assess whether Boiler Vet Camp, a 7-day residential summer camp for students entering eighth or ninth grade in the fall, would increase participants' understanding of career options in the veterinary profession, increase understanding of the science of veterinary medicine, or increase the number of students stating that they intended to apply to the Purdue University School of Veterinary Medicine. Survey. 48 individuals attending the 2009 Boiler Vet Camp. Information on participant demographics was obtained from camp applications. A questionnaire was administered on the first and sixth days of camp, and results were analyzed to identify changes in responses over time. More campers correctly answered questions designed to evaluate knowledge of the veterinary profession and 10 of 12 questions designed to evaluate specific knowledge of the science of veterinary medicine on day 6, compared with day 1. Remarkable differences were not observed among gender or race-ethnicity groups for these questions. There was no significant difference between percentages of campers who stated that they would apply to Purdue before and after camp. Significantly more Caucasian campers stated they would apply to Purdue on both day 1 and day 6, compared with campers from under-represented minority groups. Results indicated that the Boiler Vet Camp accomplished 2 of its 3 planned objectives, suggesting that such camps can be successfully used to increase knowledge of the veterinary profession among middle school students. Reasons for the low percentage of participants from underrepresented minorities who indicated they would apply to the Purdue University School of Veterinary Medicine require further exploration.

  11. DSPP Contains an IRES Element Responsible for the Translation of Dentin Phosphophoryn

    OpenAIRE

    Zhang, Y.; Song, Y.; Ravindran, S.; Gao, Q; Huang, C. C.; Ramachandran, A.; Kulkarni, A; George, A.

    2014-01-01

    The major phosphoprotein in dentin is the aspartic acid and serine-rich protein called dentin phosphophoryn (DPP). DPP appears to be synthesized as a part of a larger compound protein, dentin sialophosphoprotein (DSPP). DSPP has never been isolated or detected in dentin extracts. It is now evident that DSPP is a chimeric protein composed of 3 parts: dentin sialoprotein (DSP), DPP, and dentin glycoprotein (DGP). Previous reports have suggested that the BMP1 protease is responsible for processi...

  12. Elements That Regulate the DNA Damage Response of Proteins Defective in Cockayne Syndrome.

    Science.gov (United States)

    Iyama, Teruaki; Wilson, David M

    2016-01-16

    Cockayne syndrome (CS) is a premature aging disorder characterized by developmental defects, multisystem progressive degeneration and sensitivity to ultraviolet light. CS is divided into two primary complementation groups, A and B, with the CSA and CSB proteins presumably functioning in DNA repair and transcription. Using laser microirradiation and confocal microscopy, we characterized the nature and regulation of the CS protein response to oxidative DNA damage, double-strand breaks (DSBs), angelicin monoadducts and trioxsalen interstrand crosslinks (ICLs). Our data indicate that CSB recruitment is influenced by the type of DNA damage and is most rapid and robust as follows: ICLs>DSBs>monoadducts>oxidative lesions. Transcription inhibition reduced accumulation of CSB at sites of monoadducts and ICLs, but it did not affect recruitment to (although slightly affected retention at) oxidative damage. Inhibition of histone deacetylation altered the dynamics of CSB assembly, suggesting a role for chromatin status in the response to DNA damage, whereas the proteasome inhibitor MG132 had no effect. The C-terminus of CSB and, in particular, its ubiquitin-binding domain were critical to recruitment, while the N-terminus and a functional ATPase domain played a minor role at best in facilitating protein accumulation. Although the absence of CSA had no effect on CSB recruitment, CSA itself localized at sites of ICLs, DSBs and monoadducts but not at oxidative lesions. Our results reveal molecular components of the CS protein response and point to a major involvement of complex lesions in the pathology of CS. Published by Elsevier Ltd.

  13. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  14. Element Cycling and Energy Flux Responses in Ecosystem Simulations Conducted at the Chinese Lunar Palace-1

    Science.gov (United States)

    Dong, Chen; Fu, Yuming; Xie, Beizhen; Wang, Minjuan; Liu, Hong

    2017-01-01

    Bioregenerative life-support systems (BLSS) address interactions between organisms and their environment as an integrated system through the study of factors that regulate the pools and fluxes of materials and energy through ecological systems. As a simple model, using BLSS is very important in the investigation of element cycling and energy flux for sustainable development on Earth. A 105-day experiment with a high degree of closure was carried out in this system from February to May, 2014, with three volunteers. The results indicate that 247 g·d-1 carbon was imported into the system from stored food. Most hydrogen is circulated as water, and more than 99% H2O can be lost through leaf transpiration into the atmosphere. A total of 1.8 g·d-1 "unknown oxygen" emerged between the input and output of the plant growth module. For the urine processing module, 20.5% nitrogen was reused and 5.35 g·d-1 was put into the nutrient solution.

  15. Light and thermal responses of liquid-crystal-network films: A finite element study.

    Science.gov (United States)

    Chung, Hayoung; Choi, Joonmyung; Yun, Jung-Hoon; Cho, Maenghyo

    2015-04-01

    As a polymeric system incorporating rigid molecules within its structure, the liquid-crystal network (LCN) has been envisaged as a novel heterogeneous material. Under the influence of external stimuli, the orientational order of the liquid-crystalline phase becomes dilute and overall anisotropy is hence decreased; the actinic light absorbed by photochromic molecules, for example, induces the geometric isomerization and subsequently yields internal stress within the local network. In this study we investigate light- and temperature-induced spontaneous deformations of the LCN structure via a three-dimensional finite element model that incorporates geometric nonlinearity with a photomechanical constitutive model. We first examine the bending behavior and its nonlinearity and then parametrically study the various behaviors that stem from different origins ranging from the microscale to the macroscale: (i) the geometry of the LCN film, (ii) the macroscopic global order, (iii) the distorted mesogenic orientation due to the Fredericks distortion, and (iv) defect-induced instability. These interrelated behaviors demonstrate both the simulation capability and the necessity of the presenting framework. By employing a nonlinear consideration along with a microscopic shape parameter r the present approach facilitates further understanding of photomechanical physics such as the deconvolution of various stimuli and the deformed shape obtained due to snap-through instability. Furthermore, this study may offer insight into the design of light-sensitive actuation systems by deepening our knowledge and providing an efficient measure.

  16. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  17. Cyclic adenosine monophosphate-response element-binding protein mediates the proangiogenic or proinflammatory activity of gremlin.

    Science.gov (United States)

    Corsini, Michela; Moroni, Emanuela; Ravelli, Cosetta; Andrés, Germán; Grillo, Elisabetta; Ali, Imran H; Brazil, Derek P; Presta, Marco; Mitola, Stefania

    2014-01-01

    Angiogenesis and inflammation are closely related processes. Gremlin is a novel noncanonical vascular endothelial growth factor receptor-2 (VEGFR2) ligand that induces a proangiogenic response in endothelial cells (ECs). Here, we investigated the role of the cyclic adenosine monophosphate-response element (CRE)-binding protein (CREB) in mediating the proinflammatory and proangiogenic responses of ECs to gremlin. Gremlin induces a proinflammatory response in ECs, leading to reactive oxygen species and cyclic adenosine monophosphate production and the upregulation of proinflammatory molecules involved in leukocyte extravasation, including chemokine (C-C motif) ligand-2 (Ccl2) and Ccl7, chemokine (C-X-C motif) ligand-1 (Cxcl1), vascular cell adhesion molecule-1 (VCAM-1), and intercellular adhesion molecule-1 (ICAM-1). Accordingly, gremlin induces the VEGFR2-dependent phosphorylation, nuclear translocation, and transactivating activity of CREB in ECs. CREB activation mediates the early phases of the angiogenic response to gremlin, including stimulation of EC motility and permeability, and leads to monocyte/macrophage adhesion to ECs and their extravasation. All these effects are inhibited by EC transfection with a dominant-negative CREB mutant or with a CREB-binding protein-CREB interaction inhibitor that competes for CREB/CRE binding. Also, both recombinant gremlin and gremlin-expressing tumor cells induce proinflammatory/proangiogenic responses in vivo that are suppressed by the anti-inflammatory drug hydrocortisone. Similar effects were induced by the canonical VEGFR2 ligand VEGF-A165. Together, the results underline the tight cross-talk between angiogenesis and inflammation and demonstrate a crucial role of CREB activation in the modulation of the VEGFR2-mediated proinflammatory/proangiogenic response of ECs to gremlin.

  18. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest deflection, HIC, and BrIC) increased due to a modified occupant position. The human model and ATD models trended similarly in nearly all cases with greater risk indicated in the human model. These results suggest the need for integrated safety systems that have restraints that optimize

  19. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  20. A Coupled Experiment-finite Element Modeling Methodology for Assessing High Strain Rate Mechanical Response of Soft Biomaterials.

    Science.gov (United States)

    Prabhu, Rajkumar; Whittington, Wilburn R; Patnaik, Sourav S; Mao, Yuxiong; Begonia, Mark T; Williams, Lakiesha N; Liao, Jun; Horstemeyer, M F

    2015-05-18

    This study offers a combined experimental and finite element (FE) simulation approach for examining the mechanical behavior of soft biomaterials (e.g. brain, liver, tendon, fat, etc.) when exposed to high strain rates. This study utilized a Split-Hopkinson Pressure Bar (SHPB) to generate strain rates of 100-1,500 sec(-1). The SHPB employed a striker bar consisting of a viscoelastic material (polycarbonate). A sample of the biomaterial was obtained shortly postmortem and prepared for SHPB testing. The specimen was interposed between the incident and transmitted bars, and the pneumatic components of the SHPB were activated to drive the striker bar toward the incident bar. The resulting impact generated a compressive stress wave (i.e. incident wave) that traveled through the incident bar. When the compressive stress wave reached the end of the incident bar, a portion continued forward through the sample and transmitted bar (i.e. transmitted wave) while another portion reversed through the incident bar as a tensile wave (i.e. reflected wave). These waves were measured using strain gages mounted on the incident and transmitted bars. The true stress-strain behavior of the sample was determined from equations based on wave propagation and dynamic force equilibrium. The experimental stress-strain response was three dimensional in nature because the specimen bulged. As such, the hydrostatic stress (first invariant) was used to generate the stress-strain response. In order to extract the uniaxial (one-dimensional) mechanical response of the tissue, an iterative coupled optimization was performed using experimental results and Finite Element Analysis (FEA), which contained an Internal State Variable (ISV) material model used for the tissue. The ISV material model used in the FE simulations of the experimental setup was iteratively calibrated (i.e. optimized) to the experimental data such that the experiment and FEA strain gage values and first invariant of stresses were in

  1. Camp Sports Injuries: Analysis of Causes, Modes and Frequencies

    OpenAIRE

    Panagiota Papageorgiou; George Mavrommatis; George Costa

    2008-01-01

    The purpose of this study was the description of sports injuries sustained by campers at summer camps, aged 7-15 years. A sample of 8 camps from the Greek camp population participated in this sport injury surveillance study. Doctors and camp directors completed reports detailing the number of sports injuries events sustained and provided specific information about each event. During the period of the study, 337 sport injury reports were completed. A total of 237 (70.3%) boys and 100 (29.7%) g...

  2. Adventure Code Camp: Library Mobile Design in the Backcountry

    Directory of Open Access Journals (Sweden)

    David Ward

    2014-09-01

    Full Text Available This article presents a case study exploring the use of a student Coding Camp as a bottom-up mobile design process to generate library mobile apps. A code camp sources student programmer talent and ideas for designing software services and features.  This case study reviews process, outcomes, and next steps in mobile web app coding camps. It concludes by offering implications for services design beyond the local camp presented in this study. By understanding how patrons expect to integrate library services and resources into their use of mobile devices, librarians can better design the user experience for this environment.

  3. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available BACKGROUND: The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. METHODOLOGY/PRINCIPAL FINDINGS: Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. CONCLUSION/SIGNIFICANCE: We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  4. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  5. Enhancements in Confidence, Acceptance, and Friendship at a Summer Camp for Children With Inflammatory Bowel Disease.

    Science.gov (United States)

    McCombie, Andrew; Gearry, Richard B; Lopez, Robert N; Lönnfors, Sanna; Day, Andrew S

    2017-09-01

    Inflammatory bowel disease (IBD) affects many children and adolescents in terms of their confidence, acceptance, and ability to build friendships. New Zealand held its first summer camp for children with IBD in January 2015. We obtained feedback from the campers (ages 10-18 years) in terms of their confidence, acceptance, and quality of life. We also asked what experience was most beneficial to them, whether they made new friends with IBD, and if they would attend the camp again. Thirty-six campers responded (81.8% response rate; median age 14 years [range 10-18]; 83.3% Crohn disease; 41.7% girls). Most reported that the camp improved their confidence (86.1%), acceptance (83.3%), and overall quality of life (75.0%) relating to IBD. Moreover, most reported that meeting their fellow campers was the most beneficial experience to come from the camp (72.2%). Overall, these results emphasize the importance and relevance of such an undertaking.

  6. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  7. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  8. Prediction of the structural response of the femoral shaft under dynamic loading using subject-specific finite element models.

    Science.gov (United States)

    Park, Gwansik; Kim, Taewung; Forman, Jason; Panzer, Matthew B; Crandall, Jeff R

    2017-08-01

    The goal of this study was to predict the structural response of the femoral shaft under dynamic loading conditions using subject-specific finite element (SS-FE) models and to evaluate the prediction accuracy of the models in relation to the model complexity. In total, SS-FE models of 31 femur specimens were developed. Using those models, dynamic three-point bending and combined loading tests (bending with four different levels of axial compression) of bare femurs were simulated, and the prediction capabilities of five different levels of model complexity were evaluated based on the impact force time histories: baseline, mass-based scaled, structure-based scaled, geometric SS-FE, and heterogenized SS-FE models. Among the five levels of model complexity, the geometric SS-FE and the heterogenized SS-FE models showed statistically significant improvement on response prediction capability compared to the other model formulations whereas the difference between two SS-FE models was negligible. This result indicated the geometric SS-FE models, containing detailed geometric information from CT images with homogeneous linear isotropic elastic material properties, would be an optimal model complexity for prediction of structural response of the femoral shafts under the dynamic loading conditions. The average and the standard deviation of the RMS errors of the geometric SS-FE models for all the 31 cases was 0.46 kN and 0.66 kN, respectively. This study highlights the contribution of geometric variability on the structural response variation of the femoral shafts subjected to dynamic loading condition and the potential of geometric SS-FE models to capture the structural response variation of the femoral shafts.

  9. Validation of Shoulder Response of Human Body Finite-Element Model (GHBMC) Under Whole Body Lateral Impact Condition.

    Science.gov (United States)

    Park, Gwansik; Kim, Taewung; Panzer, Matthew B; Crandall, Jeff R

    2016-08-01

    In previous shoulder impact studies, the 50th-percentile male GHBMC human body finite-element model was shown to have good biofidelity regarding impact force, but under-predicted shoulder deflection by 80% compared to those observed in the experiment. The goal of this study was to validate the response of the GHBMC M50 model by focusing on three-dimensional shoulder kinematics under a whole-body lateral impact condition. Five modifications, focused on material properties and modeling techniques, were introduced into the model and a supplementary sensitivity analysis was done to determine the influence of each modification to the biomechanical response of the body. The modified model predicted substantially improved shoulder response and peak shoulder deflection within 10% of the observed experimental data, and showed good correlation in the scapula kinematics on sagittal and transverse planes. The improvement in the biofidelity of the shoulder region was mainly due to the modifications of material properties of muscle, the acromioclavicular joint, and the attachment region between the pectoralis major and ribs. Predictions of rib fracture and chest deflection were also improved because of these modifications.

  10. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  11. A strand-specific switch in noncoding transcription switches the function of a Polycomb/Trithorax response element.

    Science.gov (United States)

    Herzog, Veronika A; Lempradl, Adelheid; Trupke, Johanna; Okulski, Helena; Altmutter, Christina; Ruge, Frank; Boidol, Bernd; Kubicek, Stefan; Schmauss, Gerald; Aumayr, Karin; Ruf, Marius; Pospisilik, Andrew; Dimond, Andrew; Senergin, Hasene Basak; Vargas, Marcus L; Simon, Jeffrey A; Ringrose, Leonie

    2014-09-01

    Polycomb/Trithorax response elements (PRE/TREs) can switch their function reversibly between silencing and activation by mechanisms that are poorly understood. Here we show that a switch in forward and reverse noncoding transcription from the Drosophila melanogaster vestigial (vg) PRE/TRE switches the status of the element between silencing (induced by the forward strand) and activation (induced by the reverse strand). In vitro, both noncoding RNAs inhibit PRC2 histone methyltransferase activity, but, in vivo, only the reverse strand binds PRC2. Overexpression of the reverse strand evicts PRC2 from chromatin and inhibits its enzymatic activity. We propose that the interaction of RNAs with PRC2 is differentially regulated in vivo, allowing regulated inhibition of local PRC2 activity. Genome-wide analysis shows that strand switching of noncoding RNAs occurs at several hundred Polycomb-binding sites in fly and vertebrate genomes. This work identifies a previously unreported and potentially widespread class of PRE/TREs that switch function by switching the direction of noncoding RNA transcription.

  12. A dioxin response element in the multiple cloning site of the pGL3 luciferase reporter influences transcriptional activity.

    Science.gov (United States)

    Ochs, Sharon D; Liu, Jing; Fernando, Tharu M; Fecher, Roger A; Sulentic, Courtney E W

    2012-09-01

    Luciferase reporter plasmids (pGL3 backbone, Promega) have been utilized to characterize the transcriptional effects of the environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and other aryl hydrocarbon receptor (AhR) ligands. Following ligand activation, the AhR and its dimerization partner AhR nuclear translocator (ARNT) regulate transcription by binding dioxin response elements (DREs) in regulatory regions of dioxin-sensitive genes. Upon sequencing of our luciferase reporters, we unexpectedly identified a DRE core motif within the multiple cloning site (mcsDRE) of the pGL3 luciferase plasmid backbone in a subset of our reporters. Therefore, the objective of this study was to determine if the mcsDRE inadvertently influences reporter activity. Utilizing deletional analysis we determined that the mcsDRE did significantly alter the transcriptional effect induced by TCDD. Since many chemicals have been shown to interact with the AhR and influence transcription through the DRE, the presence of the mcsDRE in the pGL3 luciferase plasmid may inappropriately influence promoter and enhancer analysis. As such, insertion of regulatory elements into pGL3 reporters should be designed to avoid retaining the mcsDRE core motif (GCGTG) and currently utilized pGL3 reporters should be evaluated for the presence of the mcsDRE. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. An Inaugural Girl Scout Destinations Astronomy Camp

    Science.gov (United States)

    Lebofsky, Larry A.; McCarthy, Donald W.; Wright, Joe; Wright, Rita; Mace, Mikayla; Floyd, Charmayne

    2017-10-01

    The University of Arizona (UA) conducted its first teenage Girl Scout Destinations Astronomy Camp. This program was preceded by 24 Leadership Workshops for Adult Girl Scout Leaders, initially supported by EPO funding from NIRCam for JWST. For five days in late June, 24 girls (ages 13-17 years) attended from 16 states. The Camp was led by UA astronomers and long-term educators. Representing Girl Scouts of the USA (GSUSA) were a husband/wife amateur astronomer team who are SOFIA Airborne Astronomy and NASA Solar System Ambassadors. Other leaders included a Stanford undergraduate engineering student who is a lifelong Girl Scout and Gold Award recipient and a recent UA Master’s degree science journalist. The Camp is a residential, hands-on “immersion” adventure in scientific exploration using telescopes in southern Arizona’s Catalina Mountains near Tucson. Under uniquely dark skies girls become real astronomers, operating telescopes (small and large) and associated technologies, interacting with scientists, obtaining images and quantitative data, investigating their own questions, and most importantly having fun actually doing science and building observing equipment. Girls achieve a basic understanding of celestial objects, how and why they move, and their historical significance, leading to an authentic understanding of science, research, and engineering. Girls can lead these activities back home in their own troops and councils, encouraging others to consider STEM field careers. These programs are supported by a 5-year NASA Collaborative Agreement, Reaching for the Stars: NASA Science for Girl Scouts (www.seti.org/GirlScoutStars), through the SETI Institute in collaboration with the UA, GSUSA, Girl Scouts of Northern California, the Astronomical Society of the Pacific, and Aries Scientific, Inc. The Girl Scout Destinations Astronomy Camp aligns with the GSUSA Journey: It’s Your Planet-Love It! and introduces the girls to some of the activities being

  14. Contingency Base Camp Solid Waste Generation

    Science.gov (United States)

    2013-09-01

    0.8% Grass clippings 39 0.107 18 0.049 0.7% Glass 40 0.110 18 0.049 0.7% Textiles 25 0.068 11 0.068 0.4% Medical waste 13 0.036...waste and 80 pounds of liquid waste per day.” 2. Paragraph 3-21 ( Composting ): “A base camp population of 2,500 can pro- duce approximately 5,500...cubic meters, or 1,500 tons, of compostable sol- id waste (SW) (including sewage sludge) per year. 3. Paragraph 3-63 (Develop Preliminary Waste

  15. Organisation for the relief of concentration camps.

    Science.gov (United States)

    Engel, H O

    2003-12-01

    To review the essential principles involved in rescue missions for natural and man-made disasters. A description of the relief of a concentration camp in 1945 as an example of the logistics required in any major disaster or rescue. The arrival of trained Army rescue teams on the first day and dealing systematically with priorities in salvage, treatment and nursing saved many lives, even of desperately ill patients. A centralised administration and organisation of supplies is the first priority. Suitable intravenous and very light nutrients, and the prevention and combating of infections are more urgent than the provision of shelter and clothing.

  16. The Contribution of Pre-impact Posture on Restrained Occupant Finite Element Model Response in Frontal Impact.

    Science.gov (United States)

    Poulard, David; Subit, Damien; Nie, Bingbing; Donlon, John-Paul; Kent, Richard W

    2015-01-01

    The objective of this study was to discuss the influence of the pre-impact posture to the response of a finite element human body model (HBM) in frontal impacts. This study uses previously published cadaveric tests (PMHS), which measured six realistic pre-impact postures. Seven postured models were created from the THUMS occupant model (v4.0): one matching the standard UMTRI driving posture as it was the target posture in the experiments, and six matching the measured pre-impact postures. The same measurements as those obtained during the cadaveric tests were calculated from the simulations, and biofidelity metrics based on signals correlation (CORA) were established to compare the response of the seven models to the experiments. The HBM responses showed good agreement with the PMHS responses for the reaction forces (CORA = 0.80 ± 0.05) and the kinematics of the lower part of the torso but only fair correlation was found with the head, the upper spine, rib strains (CORA= 0.50 ± 0.05) and chest deflections (CORA = 0.67 ± 0.08). All models sustained rib fractures, sternal fracture and clavicle fracture. The average number of rib fractures for all the models was 5.3 ± 1.0, lower than in the experiments (10.8 ± 9.0). Variation in pre-impact posture greatly altered the time histories of the reaction forces, deflections and the rib strains, mainly in terms of time delay, but no definite improvement in HBM response or injury prediction was observed. By modifying only the posture of the HBM, the variability in the impact response was found to be equivalent to that observed in the experiments. The postured HBM sustained from 4 to 8 rib fractures, confirming that the pre-impact posture influenced the injury outcome predicted by the simulation. This study tries to answer an important question: what is the effect of occupant posture on kinematics and kinetics. Significant differences in kinematics observed between HBM and PMHS suggesting more coupling between the pelvis

  17. Influence of nitrogen element on total-dose radiation response of high-k Hf-based dielectric films

    Energy Technology Data Exchange (ETDEWEB)

    Song Zhaorui [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China)]. E-mail: szr@mail.sim.ac.cn; Cheng Xinhong [Department of Physics, University of Wenzhou, Xueyuan Road, Wenzhou 325000 (China); Zhang Enxia [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Xing Yumei [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Shen Qinwo [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Yu Yuehui [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Zhang Zhengxuan [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Wang Xi [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Shen Dashen [Department of Electrical and Computer Engineering, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)

    2007-04-15

    The purpose of this paper is to report some total-dose radiation response experimental results of HfON dielectric films compared with HfO{sub 2} dielectric films, then discuss the influence of the added nitrogen element on total-dose radiation tolerance of HfON and HfO{sub 2} dielectric films. Results of electrical measurements showed that the equivalent oxide thickness (EOT) of the HfON and HfO{sub 2} gate dielectrics was 19.67 nm and 8.15 nm, respectively. The MIS structures with HfON and HfO{sub 2} dielectric films were irradiated with 10 keV X-rays. The flatband voltage shifts of HfON MIS structures are much smaller than HfO{sub 2} MIS structures under different total-dose from 0 to 3 x 10{sup 4} Gy(Si)

  18. Differential induction of electrophile-responsive element-regulated genes by n-3 and n-6 polyunsaturated fatty acids.

    Science.gov (United States)

    van Beelen, Vincent A; Aarts, Jac M M J G; Reus, Astrid; Mooibroek, Hans; Sijtsma, Lolke; Bosch, Dirk; Rietjens, Ivonne M C M; Alink, Gerrit M

    2006-08-21

    In this study the n-3 polyunsaturated fatty acids (PUFAs) eicosapentaenoic acid and docosahexaenoic acid appear to be effective inducers of electrophile-responsive element (EpRE) regulated genes, whereas the n-6 PUFA arachidonic acid is not. These n-3 PUFAs need to be oxidized to induce EpRE-regulated gene expression, as the antioxidant vitamin E can partially inhibit the PUFA induced dose-dependent effect. Results were obtained using a reporter gene assay, real-time RT-PCR and enzyme activity assays. The induction of EpRE-regulated phase II genes by n-3 PUFAs may be a major pathway by which n-3 PUFAs, in contrast to n-6 PUFAs, are chemopreventive and anticarcinogenic.

  19. Activation of antioxidant response element in mouse primary cortical cultures with sesquiterpene lactones isolated from Tanacetum parthenium.

    Science.gov (United States)

    Fischedick, Justin T; Standiford, Miranda; Johnson, Delinda A; De Vos, Ric C H; Todorović, Slađana; Banjanac, Tijana; Verpoorte, Rob; Johnson, Jeffrey A

    2012-11-01

    Tanacetum parthenium produces biologically active sesquiterpene lactones (SL). Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor known to activate a series of genes termed the antioxidant response element (ARE). Activation of Nrf2/ARE may be useful for the treatment of neurodegenerative disease. In this study we isolated 11 SL from T. parthenium with centrifugal partition chromatography and semipreparative HPLC. Compounds were screened in vitro for their ability to activate the ARE on primary mouse cortical cultures as well as for their toxicity towards the cultures. All SL containing the α-methylene-γ-lactone moiety were able to activate the ARE and cause cellular toxicity. The structure-activity relationship among the SL isolated indicates that the guaianolides were more active and when lacking the endoperoxide functionality less toxic then the germacranolides. Georg Thieme Verlag KG Stuttgart · New York.

  20. Fuzzy tandem repeats containing p53 response elements may define species-specific p53 target genes.

    Directory of Open Access Journals (Sweden)

    Iva Simeonova

    2012-06-01

    Full Text Available Evolutionary forces that shape regulatory networks remain poorly understood. In mammals, the Rb pathway is a classic example of species-specific gene regulation, as a germline mutation in one Rb allele promotes retinoblastoma in humans, but not in mice. Here we show that p53 transactivates the Retinoblastoma-like 2 (Rbl2 gene to produce p130 in murine, but not human, cells. We found intronic fuzzy tandem repeats containing perfect p53 response elements to be important for this regulation. We next identified two other murine genes regulated by p53 via fuzzy tandem repeats: Ncoa1 and Klhl26. The repeats are poorly conserved in evolution, and the p53-dependent regulation of the murine genes is lost in humans. Our results indicate a role for the rapid evolution of tandem repeats in shaping differences in p53 regulatory networks between mammalian species.

  1. Fuzzy tandem repeats containing p53 response elements may define species-specific p53 target genes.

    Science.gov (United States)

    Simeonova, Iva; Lejour, Vincent; Bardot, Boris; Bouarich-Bourimi, Rachida; Morin, Aurélie; Fang, Ming; Charbonnier, Laure; Toledo, Franck

    2012-06-01

    Evolutionary forces that shape regulatory networks remain poorly understood. In mammals, the Rb pathway is a classic example of species-specific gene regulation, as a germline mutation in one Rb allele promotes retinoblastoma in humans, but not in mice. Here we show that p53 transactivates the Retinoblastoma-like 2 (Rbl2) gene to produce p130 in murine, but not human, cells. We found intronic fuzzy tandem repeats containing perfect p53 response elements to be important for this regulation. We next identified two other murine genes regulated by p53 via fuzzy tandem repeats: Ncoa1 and Klhl26. The repeats are poorly conserved in evolution, and the p53-dependent regulation of the murine genes is lost in humans. Our results indicate a role for the rapid evolution of tandem repeats in shaping differences in p53 regulatory networks between mammalian species.

  2. Long-range regulation by shared retinoic acid response elements modulates dynamic expression of posterior Hoxb genes in CNS development.

    Science.gov (United States)

    Ahn, Youngwook; Mullan, Hillary E; Krumlauf, Robb

    2014-04-01

    Retinoic acid (RA) signaling plays an important role in determining the anterior boundary of Hox gene expression in the neural tube during embryogenesis. In particular, RA signaling is implicated in a rostral expansion of the neural expression domain of 5׳ Hoxb genes (Hoxb9-Hoxb5) in mice. However, underlying mechanisms for this gene regulation have remained elusive due to the lack of RA responsive element (RARE) in the 5׳ half of the HoxB cluster. To identify cis-regulatory elements required for the rostral expansion, we developed a recombineering technology to serially label multiple genes with different reporters in a single bacterial artificial chromosome (BAC) vector containing the mouse HoxB cluster. This allowed us to simultaneously monitor the expression of multiple genes. In contrast to plasmid-based reporters, transgenic BAC reporters faithfully recapitulated endogenous gene expression patterns of the Hoxb genes including the rostral expansion. Combined inactivation of two RAREs, DE-RARE and ENE-RARE, in the BAC completely abolished the rostral expansion of the 5׳ Hoxb genes. Knock-out of endogenous DE-RARE lead to significantly reduced expression of multiple Hoxb genes and attenuated Hox gene response to exogenous RA treatment in utero. Regulatory potential of DE-RARE was further demonstrated by its ability to anteriorize 5׳ Hoxa gene expression in the neural tube when inserted into a HoxA BAC reporter. Our data demonstrate that multiple RAREs cooperate to remotely regulate 5׳ Hoxb genes during CNS development, providing a new insight into the mechanisms for gene regulation within the Hox clusters. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Regulation of brain-derived neurotrophic factor exon IV transcription through calcium responsive elements in cortical neurons.

    Directory of Open Access Journals (Sweden)

    Fei Zheng

    Full Text Available Activity-dependent transcription of brain-derived neurotrophic factor (BDNF has been studied as an important model to elucidate the mechanisms underlying numerous aspects of neuroplasticity. It has been extensively emphasized that Ca(2+ influx through different routes may have significantly different effects on BDNF transcription. Here, we examined the regulatory property of the major calcium responsive elements (CaRE in BDNF promoter IV in cultured rat cortical neurons. BDNF promoter IV, as well as CaRE1 and CaRE3, was significantly activated by Ca(2+ influx through L-type voltage-gated calcium channel (L-VGCC or NMDA receptor (NMDAR. However, the L-VGCC- and NMDAR-mediated activation of CaRE was differentially regulated by different Ca(2+-stimulated protein kinases. Specifically, PKA, CaMKI, and CaMKIV activity were required for L-VGCC-, but not NMDAR-mediated CaRE1 activation. CaMKI activity was required for NMDAR- but not L-VGCC-mediated CaRE3 activation. Surprisingly, the activation of CaRF, a previously identified transcription factor for CaRE1, was stimulated via L-VGCC but not NMDAR, and required MEK, PI3K and CaMKII activity. These results suggest a new working model that activity-dependent BDNF IV up-regulation may be coordinately mediated by CaRE1 and CaRE3 activity, which show different responses to Ca(2+-stimulated kinases. Our data also explain how the individual cis-element in BDNF promoter is distinctively coupled to different Ca(2+ routes.

  4. Cyclic adenosine monophosphate-responsive element-binding protein activation predicts an unfavorable prognosis in patients with hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Yu L

    2014-05-01

    Full Text Available Lingxiang Yu,* Xiaodong Guo,* Peirui Zhang, Ruizhao Qi, Zhiwei Li, Shaogeng Zhang Department of Hepatobiliary Surgery, 302 Military Hospital of China, Beijing, People’s Republic of China *These authors contributed equally to this work Aim: To investigate the clinical significance of cyclic adenosine monophosphate-responsive element-binding (CREB and phosphorylated CREB (pCREB expression in human hepatocellular carcinoma (HCC. Materials and methods: Immunohistochemistry and Western blot analyses were performed to detect the expression and subcellular localizations of CREB and pCREB proteins in 130 pairs of HCC and adjacent nonneoplastic liver tissues. Results: Both immunohistochemistry and Western blot analyses showed that the expression levels of CREB and pCREB proteins in HCC tissues were significantly higher than those in the adjacent nonneoplastic liver tissues (both P<0.001. In addition, the combined upregulation of CREB and pCREB proteins (CREB-high/pCREB-high was significantly associated with serum α-fetoprotein (P=0.02, tumor stage (P<0.001, and tumor grade (P=0.01. Moreover, HCC patients with CREB-high/pCREB-high expression showed shortest 5-year disease-free survival and 5-year overall survival (both P<0.001. Furthermore, the multivariate survival analysis found that the combined upregulation of CREB and pCREB proteins may be an independent unfavorable prognostic factor for both 5-year disease-free survival and 5-year overall survival (both P=0.01 in HCC. Conclusion: Our data indicate for the first time that the activation of the CREB protein may be associated with tumor progression in HCC, and may serve as a valuable marker of prognosis for patients with this malignancy. Keywords: hepatocellular carcinoma, cyclic AMP-responsive element-binding protein, tumor progression, prognosis

  5. Low expression of cyclic AMP response element modulator-1 can increase the migration and invasion of esophageal squamous cell carcinoma.

    Science.gov (United States)

    Wang, Yuchan; Zhou, Shuhui; Yang, Xiaojing; Shi, Hui; Li, Mei; Xue, Qun; Huang, Xianting; Wang, Xinxiu; Wang, Huijie; Zhang, Jianguo

    2013-12-01

    Cyclic AMP response element-binding protein (CREB) family can regulate biological functions of various types of cells and has relation with esophageal cancer cell migration and invasion. Cyclic AMP response element modulator-1 (CREM-1) is one member of the family with limited acquaintance. This study was conducted to investigate the effect of CREM-1 on migration and invasion in human esophageal squamous cell carcinoma (ESCC). The expression of CREM-1 protein in ESCC tissues with or without lymph nodes metastasis was determined by western blot. Immunohistochemical analysis of CREM-1 expression were carried out in paraffin-embedded sections of ESCC and correlated with clinical features. The roles of CREM-1 in migration and invasion were studied in TE1 cells through knocking CREM-1 down with siRNA or overexpression of CREM-1 in ECA109 cells. The regulations of CREM-1 on invasion and migration were determined by transwell and wounding healing assay. The effect of CREM-1 on chemotherapy drug was analyzed by Cell counting kit-8 assay. We found that the expression of CREM-1 was significantly downregulated in ESCC tissues with lymph nodes metastasis compared with the tissues without lymph nodes metastasis and was correlated with the clinical features of pathological grade, tumor stage and lymph node metastasis. Moreover, knocking CREM-1 down with siRNA increased cell migration and invasion in human ESCC cell lines TE1 while upregulation of CREM-1 inhibited the motility. Our data suggested that CREM-1 might play an important role in the regulation of tumor metastasis and invasion and serve as a tumor suppressor in human ESCC. We proposed that CREM-1 might be used as a potential therapeutic agent for human ESCC.

  6. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity.

    Science.gov (United States)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å; Steffensen, Knut R; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I; Grønning-Wang, Line M

    2015-04-01

    Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β(+/+) and LXRα/β(-/-) mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. Copyright © 2015 by the American Society for Biochemistry and Molecular Biology, Inc.

  7. Gaining a 'proper sense' of what happens out there: An 'Academic Bush Camp' to promote rural placements for students.

    Science.gov (United States)

    Page, Amy T; Hamilton, Sandy J; Hall, Maeva; Fitzgerald, Kathryn; Warner, Wayne; Nattabi, Barbara; Thompson, Sandra C

    2016-02-01

    Undergraduates who undertake rural placements often choose a rural career. Reluctance from universities to send students to rural settings limits placement numbers. The Western Australian Centre for Rural Health (WACRH) invited allied health and nursing academics and clinical placement coordinators from Western Australian (WA) universities to an Academic Bush Camp. Based on situated learning theory, this camp modelled student programs through experiential learning and structured workshops. It aimed to build relationships and showcase innovative rural learning opportunities. To build relationships and showcase innovative rural learning opportunities. An evaluation of a residential camp based on situated learning theory. The camp stated and finished in Geraldton, WA and was centered in Mt Magnet, WA a remote town 600 kilometres northeast of Perth. WACRH invited allied health and nursing academics and clinical placement coordinators from Western Australian (WA) universities. This camp modelled student programs through experiential learning and structured workshops. Online pre- and post-camp questionnaires included open-ended questions and questions on a 5-point Likert scale. Responses were analysed in SPSS 22 using descriptive statistics and Wilcoxon signed-rank test. Follow-up phone interviews six months later assessed longer-term reflections and changes in student placement practice. The main outcome measure was whether the camp met participants' expectations, and their knowledge about and interest in WACRH's programs. Twelve academics from five WA universities and seven health disciplines attended. Nine had previously lived or worked rurally. The camp met participants' expectations and all would recommend the opportunity to a colleague. Many valued the interaction with community and clinical placement partners and would have preferred more of this. The camp increased awareness of WACRH's programs and benefits of longer rural placements and a service

  8. Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines.

    Science.gov (United States)

    Wilson, Stephen; Qi, Jianfei; Filipp, Fabian V

    2016-09-14

    Sequence motifs are short, recurring patterns in DNA that can mediate sequence-specific binding for proteins such as transcription factors or DNA modifying enzymes. The androgen response element (ARE) is a palindromic, dihexameric motif present in promoters or enhancers of genes targeted by the androgen receptor (AR). Using chromatin immunoprecipitation sequencing (ChIP-Seq) we refined AR-binding and AREs at a genome-scale in androgen-insensitive and androgen-responsive prostate cancer cell lines. Model-based searches identified more than 120,000 ChIP-Seq motifs allowing for expansion and refinement of the ARE. We classified AREs according to their degeneracy and their transcriptional involvement. Additionally, we quantified ARE utilization in response to somatic copy number amplifications, AR splice-variants, and steroid treatment. Although imperfect AREs make up 99.9% of the motifs, the degree of degeneracy correlates negatively with validated transcriptional outcome. Weaker AREs, particularly ARE half sites, benefit from neighboring motifs or cooperating transcription factors in regulating gene expression. Taken together, ARE full sites generate a reliable transcriptional outcome in AR positive cells, despite their low genome-wide abundance. In contrast, the transcriptional influence of ARE half sites can be modulated by cooperating factors.

  9. Estradiol up-regulates L-type Ca2+channels via membrane-bound estrogen receptor / Phosphoinositide-3kinase / Akt / cAMP response element-binding protein signaling pathway.

    Science.gov (United States)

    Yang, Xiaoyan; Mao, Xiaofang; Xu, Gao; Xing, Shasha; Chattopadhyay, Ansuman; Jin, Si; Salama, Guy

    2018-01-09

    In long QT type-2 (LQT2), women are more prone to lethal arrhythmias called Torsade de Pointes (TdP) than men. We previously reported that 17-β-estradiol (E2) upregulates L-type Ca 2+ -channels and current (I Ca,L ) (∼30%) in rabbit ventricular myocytes by a classical genomic-mechanism mediated by estrogen-receptor-α (ER)α. In LQT2 ( I Kr -blockade or bradycardia), the higher Ca 2+ influx via I Ca,L , causes Ca 2+ -overload, spontaneous sarcoplasmic reticulum Ca 2+ -release, and re-activation of I Ca,L that trigger early afterdepolarizations (EADs) and TdP. The molecular mechanisms whereby E2 upregulates I Ca,L are poorly understood and are now investigated. H9C2 and rat myocytes were incubated with E2, ±ER antagonist, or inhibitors of downstream transcription factors 24 hours, followed by Western blots of Cav1.2α1C and voltage-clamp measurements of I Ca,L . Incubation of H9C2 cells with E2 (10∼100 nM) increased I Ca,L density and Cav1.2α1C expression which were suppressed by the ER-antagonist ICI-182,780 (1μM). Enhanced I Ca,L and Cav1.2α1C expression by E2 was suppressed by inhibitors of Pi3K (LY294002=30μM; pL via plasma-membrane ER, and activating a Pi3K, Akt and CREB signaling. The promoter regions of CACNA1C gene (human-rabbit-rat) contain adjacent/overlapping binding-sites for p-CREB and ERα which suggest a synergistic regulation by these pathways. Copyright © 2018. Published by Elsevier Inc.

  10. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  11. Different cis-acting elements are involved in the regulation of TRP1 and TRP2 promoter activities by cyclic AMP: pivotal role of M boxes (GTCATGTGCT) and of microphthalmia.

    Science.gov (United States)

    Bertolotto, C; Buscà, R; Abbe, P; Bille, K; Aberdam, E; Ortonne, J P; Ballotti, R

    1998-02-01

    In melanocytes and in melanoma cells, cyclic AMP (cAMP)-elevating agents stimulate melanogenesis and increase the transcription of tyrosinase, the rate-limiting enzyme in melanin synthesis. However, two other enzymes, tyrosinase-related protein 1 (TRP1) and TRP2, are required for a normal melanization process leading to eumelanin synthesis. In B16 melanoma cells, we demonstrated that stimulation of melanogenesis by cAMP-elevating agents results in an increase in tyrosinase, TRP1, and TRP2 expression. cAMP, through a cAMP-dependent protein kinase pathway, stimulates TRP1 and TRP2 promoter activities in both B16 mouse melanoma cells and normal human melanocytes. Regulation of the TRP1 and TRP2 promoters by cAMP involves a M box and an E box. Further, a classical cAMP response element-like motif participates in the cAMP responsiveness of the TRP2 promoter, demonstrating that the TRP2 gene is subjected to different regulatory processes, which could account for its different expression patterns during embryonic development or under specific physiological and pathological conditions. We also found that microphthalmia, a basic helix-loop-helix transcription factor, strongly stimulates the transcriptional activities of the TRP1 and TRP2 promoters, mainly through binding to the M boxes. Additionally, we demonstrated that cAMP increases microphthalmia expression and thereby its binding to TRP1 and TRP2 M boxes. These convergent and compelling results disclose at least a part of the molecular mechanism involved in the regulation of melanogenic gene expression by cAMP and emphasize the pivotal role of microphthalmia in this process.

  12. Camping under Western Stars: Joan Crawford in "Johnny Guitar."

    Science.gov (United States)

    Robertson, Pamela

    1995-01-01

    Examines the dissonant and "camp" effect inherent in describing "Johnny Guitar" as a Joan Crawford western. Argues that the film's camp effect depends on its crossing of a female star vehicle with the western, a stereotypically masculine genre. Summarizes Crawford's childhood and rise to fame. Concludes by exploring the lesbian…

  13. EduCamp Colombia: Social Networked Learning for Teacher Training

    Science.gov (United States)

    Fonseca, Diego Ernesto Leal

    2011-01-01

    This paper describes a learning experience called EduCamp, which was launched by the Ministry of Education of Colombia in 2007, based on emerging concepts such as e-Learning 2.0, connectivism, and personal learning environments. An EduCamp proposes an unstructured collective learning experience, which intends to make palpable the possibilities of…

  14. Camp GLOW (Girls Leading Our World): Handbook for Volunteers.

    Science.gov (United States)

    Peace Corps, Washington, DC. Information Collection and Exchange Div.

    Camp GLOW (Girls Leading Our World) began in Romania in 1995 as a weeklong leadership camp with the purpose of encouraging young women to become active citizens by building their self-esteem and confidence, increasing their self-awareness, and developing their skills in goal-setting, assertiveness, and career and life planning. Since that first…

  15. Architecture of Stalin’s Prison Camps in Yakutia

    Directory of Open Access Journals (Sweden)

    Nikolai Kradin

    2014-09-01

    Full Text Available Based on archive and field studies, the article considers architecture of prison camp facilities built on the territory of Yakutia during Stalin’s terror. With the help of field studies, measurements and photofixation we have revealed compositional, planning and design features of bridges and prison camp facilities and analyzed their location.

  16. Inclusion Coordinators at Jewish Summer Camps: Roles and Challenges

    Science.gov (United States)

    Shefter, Laura; Uhrman, Abigail L.; Tobin, Lisa; Kress, Jeffrey S.

    2017-01-01

    As appreciation of the impact of Jewish camping has grown, so have efforts to increase the number of campers able to participate in these settings. Inclusion of campers with disabilities, though not a new phenomenon, has likewise expanded. As more services are provided to campers with disabilities, more camps are hiring an Inclusion Coordinator to…

  17. Specialized Summer Camps: Provide Benefits for Children and Families Alike

    Science.gov (United States)

    Neff, John M.

    2009-01-01

    The arrival of summer signals a season of endless days of swimming, fishing, summer camps, and other outdoor activities. For children with chronic or terminal illnesses, it can be difficult to participate in many of these activities as well as challenging for parents to find summer camps that not only engage their children, but also offer the…

  18. Socialization of Adolescents: Cultural Practices in Children's Summer Camp

    Science.gov (United States)

    Demakova, Irina D.; Valeeva, Roza A.; Shipova, Alina V.

    2016-01-01

    The article describes the relevant aspects of the adolescents' cultural practices in children's summer camp, taking into account their specific characteristics. The summer camp is considered as an educational formation and holistic socio-pedagogical body, designed to create conditions for the development of the person. The criteria for inclusion…

  19. Residential Grief Camps: An Initial Phenomenological Study of Staff Perspectives

    Science.gov (United States)

    Brown, Tiffany B.; Kimball, Thomas G.

    2012-01-01

    Research has focused primarily on the impact of death on family functioning and the stages and tasks of grief, though little attention has been given to grief camps or the experiences of those who work there. This study explored the experiences of staff at a four-day overnight children's grief camp. Eight participants reported their experience of…

  20. Students Become Scientists at Science Skills Boot Camp | Poster

    Science.gov (United States)

    At the 2016 Science Skills Boot Camp (SSBC), a one-day training program designed for NIH summer interns with little or no prior research experience, students gathered to learn about basic research and laboratory skills. The boot camp provided a unique opportunity for interns to expand their knowledge of simple bench techniques, scientific papers, and ways to communicate their research.

  1. Crisis Management: How to Handle a Salmonella Outbreak at Camp.

    Science.gov (United States)

    Becker, William A.; Popkin, Rodger

    1992-01-01

    Details events of six days during Salmonella outbreak at camp in North Carolina. Explains how camp handled 280 sick campers and staff, well campers, news media, and parents. Based on an epidemiologic survey of food eaten, it was suspected that the culprit of the outbreak was a meat item. Offers suggestions for crisis management in the camp…

  2. 36 CFR 1002.10 - Camping and food storage.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Camping and food storage... USE AND RECREATION § 1002.10 Camping and food storage. (a) The Board may require permits, designate... result in the suspension or revocation of the permit. (d) Food storage. The Board may designate all or a...

  3. 36 CFR 2.10 - Camping and food storage.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Camping and food storage. 2... RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.10 Camping and food storage. (a) The superintendent may... revocation of the permit. (d) Food storage. The superintendent may designate all or a portion of a park area...

  4. Tactics, Techniques, and Procedures (TTP) for Migrant Camp Operations

    Science.gov (United States)

    1995-04-15

    include soap, towel, shower shoes, sheet, blanket, a wash bucket, toothbrush and toothpaste, comb/brush, razor, feminine hygiene products, and a...the camp. This may mean leasing of a hotel , other building, or open land for use as a camp. Also, consultation with the Army Corps of Engineers may

  5. Volunteer Surgical Camp at Gombe Hospital in Uganda | Alimoglu ...

    African Journals Online (AJOL)

    Background: The Islamic University Habib Medical School in Uganda (IUIU), in collaboration with Doctors Worldwide (DWW) from Turkey, organized a surgical camp in April 2014. In this camp, different types of hernia repair, among other general surgical procedures were conducted. The target population was the ...

  6. Outdoor adventure camps for people with mental illness.

    Science.gov (United States)

    Cotton, Sue; Butselaar, Felicity

    2013-08-01

    The aim of the study was to evaluate a novel outdoor adventure camping program for individuals with mental illness. The program was developed by YMCA Victoria in partnership with Sport and Recreation Victoria, and mental health service agencies. Orygen Youth Health Research Centre conducted the program evaluation. One hundred and eight individuals from mental health services across Victoria participated in 12 camps. Five camps targeted young people between the ages of 18 and 25 years. Seven camps were run for adults 26 years and older. Participants were assessed at baseline, end of camp, and four weeks following the camp in terms of self-esteem, mastery, and social connectedness. Quality of life was assessed at baseline and four weeks post-camp. Participants demonstrated significant improvements in mastery, self-esteem and social connectedness from baseline to end of the camp; however, these improvements were not sustained by the four-week follow-up. We have demonstrated that utilizing the expertise of mental health services and a community recreation provider can benefit individuals experiencing mental illness. More research is required with respect to how to sustain these benefits over the longer term.

  7. Camp Verde Adult Reading Program. Final Performance Report.

    Science.gov (United States)

    Maynard, David A.

    This document begins with a four-page performance report describing how the Camp Verde Adult Reading Program site was relocated to the Community Center Complex, and the Town Council contracted directly with the Friends of the Camp Verde Library to provide for the requirements of the program. The U.S. Department of Education grant allowed the…

  8. Making STEM Fun: How to Organize a STEM Camp

    Science.gov (United States)

    Davis, Kimberly E. Bryant; Hardin, Stacey E.

    2013-01-01

    The work from the University of Central Florida's STEM summer camp (sponsored by Workforce Central Florida) is shared. The camps targeted low-SES schools with a high percentage of students on free and reduced lunch as well as high percentages of students with. Students were given preassessments and postassessments to gauge their knowledge of and…

  9. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  10. A hypermorphic antioxidant response element is associated with increased MS4A6A expression and Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Sarah E. Lacher

    2018-04-01

    Full Text Available Late onset Alzheimer's disease (AD is a multifactorial disorder, with AD risk influenced by both environmental and genetic factors. Recent genome-wide association studies (GWAS have identified genetic loci associated with increased risk of developing AD. The MS4A (membrane-spanning 4-domains subfamily A gene cluster is one of the most significant loci associated with AD risk, and MS4A6A expression is correlated with AD pathology. We identified a single nucleotide polymorphism, rs667897, at the MS4A locus that creates an antioxidant response element and links MS4A6A expression to the stress responsive Cap-n-Collar (CNC transcription factors NRF1 (encoded by NFE2L1 and NRF2 (encoded by NFE2L2. The risk allele of rs667897 generates a strong CNC binding sequence that is activated by proteostatic stress in an NRF1-dependent manner, and is associated with increased expression of the gene MS4A6A. Together, these findings suggest that the cytoprotective CNC regulatory network aberrantly activates MS4A6A expression and increases AD risk in a subset of the population.

  11. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  12. The U-box family genes in Medicago truncatula: Key elements in response to salt, cold, and drought stresses.

    Science.gov (United States)

    Song, Jianbo; Mo, Xiaowei; Yang, Haiqi; Yue, Luming; Song, Jun; Mo, Beixin

    2017-01-01

    The ubiquitination pathway regulates growth, development, and stress responses in plants, and the U-box protein family of ubiquitin ligases has important roles in this pathway. Here, 64 putative U-box proteins were identified in the Medicago truncatula genome. In addition to the conserved U-box motif, other functional domains, such as the ARM, kinase, KAP, and WD40 domains, were also detected. Phylogenetic analysis of the M. truncatula U-box proteins grouped them into six subfamilies, and chromosomal mapping and synteny analyses indicated that tandem and segmental duplications may have contributed to the expansion and evolution of the U-box gene family in this species. Using RNA-seq data from M. truncatula seedlings subjected to three different abiotic stresses, we identified 33 stress-inducible plant U-box genes (MtPUBs). Specifically, 25 salinity-, 15 drought-, and 16 cold-regulated MtPUBs were detected. Among them, MtPUB10, MtPUB17, MtPUB18, MtPUB35, MtPUB42, and MtPUB44 responded to all three stress conditions. Expression profiling by qRT-PCR was consistent with the RNA-seq data, and stress-related elements were identified in the promoter regions. The present findings strongly indicate that U-box proteins play critical roles in abiotic stress response in M. truncatula.

  13. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements

    Science.gov (United States)

    Nguyen, Nga T.; McInturf, Samuel A.; Mendoza-Cózatl, David G.

    2016-01-01

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements. PMID:27500800

  14. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  15. A DEAD-Box Helicase Mediates an RNA Structural Transition in the HIV-1 Rev Response Element.

    Science.gov (United States)

    Hammond, John A; Lamichhane, Rajan; Millar, David P; Williamson, James R

    2017-03-10

    Nuclear export of partially spliced or unspliced HIV-1 RNA transcripts requires binding of the viral protein regulator of expression of virion (Rev) to the Rev response element (RRE) and subsequent oligomerization in a cooperative manner. Cellular DEAD-box helicase DEAD-box protein 1 (DDX1) plays a role in HIV replication, interacting with and affecting Rev-containing HIV transcripts in vivo, interacting directly with the RRE and Rev in vitro, and promoting Rev oligomerization in vitro. Binding of DDX1 results in enhancement of Rev oligomerization on the RRE that is correlated with an RNA structural change within the RRE that persists even after dissociation of DDX1. Furthermore, this structural transition is likely located within the three-way junction of stem II of the RRE that is responsible for initial Rev binding. This discovery of the stem II structural transition leads to a model wherein DDX1 can act as an RNA chaperone, folding stem IIB into a proper Rev binding conformation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Discrete element modeling of Martian pit crater formation in response to extensional fracturing and dilational normal faulting

    Science.gov (United States)

    Smart, Kevin J.; Wyrick, Danielle Y.; Ferrill, David A.

    2011-04-01

    Pit craters, circular to elliptical depressions that lack a raised rim or ejecta deposits, are common on the surface of Mars. Similar structures are also found on Earth, Venus, the Moon, and smaller planetary bodies, including some asteroids. While it is generally accepted that these pits form in response to material drainage into a subsurface void space, the primary mechanism(s) responsible for creating the void is a subject of debate. Previously proposed mechanisms include collapse into lave tubes, dike injection, extensional fracturing, and dilational normal faulting. In this study, we employ two-dimensional discrete element models to assess both extensional fracturing and dilational normal faulting as mechanisms for forming pit craters. We also examine the effect of mechanical stratigraphy (alternating strong and weak layers) and variation in regolith thickness on pit morphology. Our simulations indicate that both extensional fracturing and dilational normal faulting are viable mechanisms. Both mechanisms lead to generally convex (steepening downward) slope profiles; extensional fracturing results in generally symmetric pits, whereas dilational normal faulting produces strongly asymmetric geometries. Pit width is established early, whereas pit depth increases later in the deformation history. Inclusion of mechanical stratigraphy results in wider and deeper pits, particularly for the dilational normal faulting, and the presence of strong near-surface layers leads to pits with distinct edges as observed on Mars. The modeling results suggest that a thicker regolith leads to wider but shallower pits that are less distinct and may be more difficult to detect in areas of thick regolith.

  17. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  18. Direct climate action as public pedagogy:The cultural politics of the Camp for Climate Action

    OpenAIRE

    Mcgregor, Callum

    2015-01-01

    Discourse theory is employed to analyse the public curriculum generated through the Camp for Climate Action. This movement emerged as a germinal response to tensions within the dominant discourse on ‘Climate Action’ by articulating it into a broader history of civil disobedience and staging spatial interventions that ostensibly identified the root causes of climate change. This generated learning opportunities over time for both activists and the wider public. However, this attempted redefini...

  19. Evaluation of the Pulmonary Toxicity of Ambient Particulate Matter from Camp Victory, Iraq

    Science.gov (United States)

    2015-01-01

    Lewis, R. S. Thomas, and G. D. Chapman. 2012. Biological responses in rats exposed to cigarette smoke and Middle East sand (dust). Inhal. Toxicol. 24...Toxicol. 21: 327–336. Esmaeil, N., M. Gharagozloo, A. Rezaei, and G. Grunig. 2014. Dust events, pulmonary dis- eases and immune system . Am. J. Clin...online DOI: 10.1080/15287394.2015.1072611 EVALUATION OF THE PULMONARY TOXICITY OF AMBIENT PARTICULATE MATTER FROM CAMP VICTORY, IRAQ K. L. Porter1, F. H. Y

  20. Response Element Composition Governs Correlations between Binding Site Affinity and Transcription in Glucocorticoid Receptor Feed-forward Loops*

    Science.gov (United States)

    Sasse, Sarah K.; Zuo, Zheng; Kadiyala, Vineela; Zhang, Liyang; Pufall, Miles A.; Jain, Mukesh K.; Phang, Tzu L.; Stormo, Gary D.; Gerber, Anthony N.

    2015-01-01

    Combinatorial gene regulation through feed-forward loops (FFLs) can bestow specificity and temporal control to client gene expression; however, characteristics of binding sites that mediate these effects are not established. We previously showed that the glucocorticoid receptor (GR) and KLF15 form coherent FFLs that cooperatively induce targets such as the amino acid-metabolizing enzymes AASS and PRODH and incoherent FFLs exemplified by repression of MT2A by KLF15. Here, we demonstrate that GR and KLF15 physically interact and identify low affinity GR binding sites within glucocorticoid response elements (GREs) for PRODH and AASS that contribute to combinatorial regulation with KLF15. We used deep sequencing and electrophoretic mobility shift assays to derive in vitro GR binding affinities across sequence space. We applied these data to show that AASS GRE activity correlated (r2 = 0.73) with predicted GR binding affinities across a 50-fold affinity range in transfection assays; however, the slope of the linear relationship more than doubled when KLF15 was expressed. Whereas activity of the MT2A GRE was even more strongly (r2 = 0.89) correlated with GR binding site affinity, the slope of the linear relationship was sharply reduced by KLF15, consistent with incoherent FFL logic. Thus, GRE architecture and co-regulator expression together determine the functional parameters that relate GR binding site affinity to hormone-induced transcriptional responses. Utilization of specific affinity response functions and GR binding sites by FFLs may contribute to the diversity of gene expression patterns within GR-regulated transcriptomes. PMID:26088140

  1. Response Element Composition Governs Correlations between Binding Site Affinity and Transcription in Glucocorticoid Receptor Feed-forward Loops.

    Science.gov (United States)

    Sasse, Sarah K; Zuo, Zheng; Kadiyala, Vineela; Zhang, Liyang; Pufall, Miles A; Jain, Mukesh K; Phang, Tzu L; Stormo, Gary D; Gerber, Anthony N

    2015-08-07

    Combinatorial gene regulation through feed-forward loops (FFLs) can bestow specificity and temporal control to client gene expression; however, characteristics of binding sites that mediate these effects are not established. We previously showed that the glucocorticoid receptor (GR) and KLF15 form coherent FFLs that cooperatively induce targets such as the amino acid-metabolizing enzymes AASS and PRODH and incoherent FFLs exemplified by repression of MT2A by KLF15. Here, we demonstrate that GR and KLF15 physically interact and identify low affinity GR binding sites within glucocorticoid response elements (GREs) for PRODH and AASS that contribute to combinatorial regulation with KLF15. We used deep sequencing and electrophoretic mobility shift assays to derive in vitro GR binding affinities across sequence space. We applied these data to show that AASS GRE activity correlated (r(2) = 0.73) with predicted GR binding affinities across a 50-fold affinity range in transfection assays; however, the slope of the linear relationship more than doubled when KLF15 was expressed. Whereas activity of the MT2A GRE was even more strongly (r(2) = 0.89) correlated with GR binding site affinity, the slope of the linear relationship was sharply reduced by KLF15, consistent with incoherent FFL logic. Thus, GRE architecture and co-regulator expression together determine the functional parameters that relate GR binding site affinity to hormone-induced transcriptional responses. Utilization of specific affinity response functions and GR binding sites by FFLs may contribute to the diversity of gene expression patterns within GR-regulated transcriptomes. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  3. Yesterday and Today: The Impact of Research Conducted at Camp Detrick on Botulinum Toxin.

    Science.gov (United States)

    Lebeda, Frank J; Adler, Michael; Dembek, Zygmunt F

    2018-02-06

    This review summarizes the research conducted on botulinum toxin (BoTx) from 1943 to 1956 by a small group of Camp Detrick investigators and their staff. A systematic, cross-disciplinary approach was used to develop effective vaccines against this biological warfare threat agent. In response to the potential need for medical countermeasures against BoTx during World War II, the refinement of isolation and purification techniques for BoTx successfully led to the large-scale production of botulinum toxoid vaccines. In addition, the work at Camp Detrick provided the foundation for the subsequent use of BoTx as a tool for studying the trophic regulation of skeletal muscle within motor neuron terminals and, more recently, for elucidation of the intricate details of neurotransmitter release at the molecular level. Indirectly, Camp Detrick investigators also played a significant role in studies that culminated in the use of BoTx as a pharmaceutical product that has been approved by the U.S. Food and Drug Administration for treating movement disorders, autonomic dysfunctions, and other conditions. Online literature searches were performed with Google, Google Scholar, PubMed, the bibliography from the Camp Detrick technical library, and at the Defense Technical Information Center. Reference lists in some of the primary research publications and reviews also provided source material. Search terms included botulinum, botulinus, and Camp Detrick. References related to the subsequent impacts of the Camp Detrick results were selected and cited from reviews and primary references in the more recent literature. Notes on toxin nomenclature and potential sources of error in this study are presented. The literature searches returned 27 citations of Camp Detrick authors, 24 of which were articles in peer-reviewed journals. The publications by these investigators included several disciplines such as biochemistry, immunology, pharmacology, physiology, and toxicology. A fundamental

  4. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    Regulation of gene expression involves long-distance communication between regulatory elements and target promoters, but how this is achieved remains unknown. Insulator elements have been proposed to modulate the communication between regulatory elements and promoters due to their ability to insu...

  5. Identification of fungus-responsive cis-acting element in the promoter of Brassica juncea chitinase gene, BjCHI1.

    Science.gov (United States)

    Gao, Ying; Zan, Xin-Li; Wu, Xue-Feng; Yao, Lei; Chen, Yu-Ling; Jia, Shuang-Wei; Zhao, Kai-Jun

    2014-02-01

    Chitinases are a group of pathogenesis-related proteins. The Brassica juncea chitinase gene BjCHI1 is highly inducible by pathogenic fungal infection, suggesting that the promoter of BjCHI1 might contain specific cis-acting element responsive to fungal attack. To identify the fungus-responsive element in BjCHI1 promoter (BjC-P), a series of binary plant transformation vectors were constructed by fusing the BjC-P or its deletion-derivatives to β-glucuronidase (GUS) reporter gene. Expression of the GUS reporter gene was systematically assayed by a transient gene expression system in Nicotiana benthamiana leaves treated with fungal elicitor Hexa-N-Acetyl-Chitohexaose, as well as in transgenic Arabidopsis plants inoculated with fungus Botrytis cinerea. The histochemical and quantitative GUS assays showed that the W-box-like element (GTAGTGACTCAT) in the region (-668 to -657) was necessary for the fungus-response, although there were another five W-box-like elements in BjC-P. In addition, gain-of-function analysis demonstrated that the fragment (-409 to -337) coupled to the W-box-like element was needed for full magnitude of the fungal induction. These results revealed the existence of a novel regulation mechanism of W-box-like element involved in plant pathogenic resistance, and will benefit the potential application of BjC-P in engineering crops. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Camp Counseling and the Development and Transfer of Workforce Skills: The Perspective of Ohio 4-H Camp Counselor Alumni

    Directory of Open Access Journals (Sweden)

    Janel K. Digby

    2007-09-01

    Full Text Available Recent research shows that camp counselors, including those in 4-H, benefit from the experience by developing important life skills. However, because research regarding the perception of workforce skill development in this context has yielded inconsistent findings, the present study used focus groups to examine 4-H camp counselor alumni perceptions about the skills gained and transfer of these skills to other settings. Overall, 4-H camp counselor alumni thought their experience was fun and enjoyable, yet challenging. They believed they developed important life and workforce skills. Not only did alumni learn these skills, but the skills transferred beyond the camp setting. Leadership was noted as the skill most frequently applied to other contexts. Alumni believed that their counseling experiences had both indirect and direct impacts on their career choice. This study suggests many practical applications for those who work with camp programs.

  7. Rocket experiments and payloads for Super CAMP. [Cold Arctic Mesopause Project (CAMP)

    Science.gov (United States)

    Kopp, E.; Goldberg, R. A.

    1987-01-01

    The super Cold Arctic Mesopause Project (CAMP) follow-up project in the summer of 1990 is outlined. In situ measurements of appropriate height resolution are needed in the summer mesosphere at high latitudes to investigate structures and formation processes of polar mesospheric clouds. The rocket measurements from the high latitude site Thule AB in Greenland (76.6 N) are decisive for the understanding of the cold Arctic mesopause. Similar rocket measurements from the European ranges Andenes and Esrange (68 to 69 N) are needed to investigate the latitudinal variability of the parameters relevant for the formation, transport, and loss of mesospheric ice particles. An important aspect of Super CAMP is the study of the heterogeneous chemistry, the loss of electrons on aggregates, and the build-up of horizontal and vertical electric fields in the presence of charged ice particles. Instruments, measurements, and purpose are listed.

  8. Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

    Science.gov (United States)

    Chen, Chen; Gorlatova, Natalia; Kelman, Zvi; Herzberg, Osnat

    2011-04-19

    Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

  9. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  10. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. FINITE ELEMENT SIMULATION FOR STRUCTURAL RESPONSE OF U7MO DISPERSION FUEL PLATES VIA FLUID-THERMAL-STRUCTURAL INTERACTION

    Energy Technology Data Exchange (ETDEWEB)

    Hakan Ozaltun; Herman Shen; Pavel Madvedev

    2010-11-01

    This article presents numerical simulation of dispersion fuel mini plates via fluid–thermal–structural interaction performed by commercial finite element solver COMSOL Multiphysics to identify initial mechanical response under actual operating conditions. Since fuel particles are dispersed in Aluminum matrix, and temperatures during the fabrication process reach to the melting temperature of the Aluminum matrix, stress/strain characteristics of the domain cannot be reproduced by using simplified models and assumptions. Therefore, fabrication induced stresses were considered and simulated via image based modeling techniques with the consideration of the high temperature material data. In order to identify the residuals over the U7Mo particles and the Aluminum matrix, a representative SEM image was employed to construct a microstructure based thermo-elasto-plastic FE model. Once residuals and plastic strains were identified in micro-scale, solution was used as initial condition for subsequent multiphysics simulations at the continuum level. Furthermore, since solid, thermal and fluid properties are temperature dependent and temperature field is a function of the velocity field of the coolant, coupled multiphysics simulations were considered. First, velocity and pressure fields of the coolant were computed via fluidstructural interaction. Computed solution for velocity fields were used to identify the temperature distribution on the coolant and on the fuel plate via fluid-thermal interaction. Finally, temperature fields and residual stresses were used to obtain the stress field of the plates via fluid-thermal-structural interaction.

  12. Cyclic adenosine monophosphate-responsive element-binding protein activation predicts an unfavorable prognosis in patients with hepatocellular carcinoma.

    Science.gov (United States)

    Yu, Lingxiang; Guo, Xiaodong; Zhang, Peirui; Qi, Ruizhao; Li, Zhiwei; Zhang, Shaogeng

    2014-01-01

    To investigate the clinical significance of cyclic adenosine monophosphate-responsive element-binding (CREB) and phosphorylated CREB (pCREB) expression in human hepatocellular carcinoma (HCC). Immunohistochemistry and Western blot analyses were performed to detect the expression and subcellular localizations of CREB and pCREB proteins in 130 pairs of HCC and adjacent nonneoplastic liver tissues. Both immunohistochemistry and Western blot analyses showed that the expression levels of CREB and pCREB proteins in HCC tissues were significantly higher than those in the adjacent nonneoplastic liver tissues (both P<0.001). In addition, the combined upregulation of CREB and pCREB proteins (CREB-high/pCREB-high) was significantly associated with serum α-fetoprotein (P=0.02), tumor stage (P<0.001), and tumor grade (P=0.01). Moreover, HCC patients with CREB-high/pCREB-high expression showed shortest 5-year disease-free survival and 5-year overall survival (both P<0.001). Furthermore, the multivariate survival analysis found that the combined upregulation of CREB and pCREB proteins may be an independent unfavorable prognostic factor for both 5-year disease-free survival and 5-year overall survival (both P=0.01) in HCC. Our data indicate for the first time that the activation of the CREB protein may be associated with tumor progression in HCC, and may serve as a valuable marker of prognosis for patients with this malignancy.

  13. The expression of cyclic adenosine monophosphate responsive element modulator in rat sertoli cells following seminal extract administration

    Science.gov (United States)

    Akmal, Muslim; Siregar, Tongku Nizwan; Wahyuni, Sri; Hamny; Nasution, Mustafa Kamal; Indriati, Wiwik; Panjaitan, Budianto; Aliza, Dwinna

    2016-01-01

    Aim: This study aims to determine the effect of seminal vesicle extract on cyclic adenosine monophosphate responsive element modulator (CREM) expression in rat Sertoli cells. Materials and Methods: This study examined the expression of CREM on 20 male rats (Rattus norvegicus) at 4 months of age, weighing 250-300 g. The rats were divided into four groups: K0, KP1, KP2, and KP3. K0 group was injected with 0.2 ml normal saline; KP1 was injected with 25 mg cloprostenol (Prostavet C, Virbac S. A); KP2 and KP3 were injected with 0.2 and 0.4 ml seminal vesicle extract, respectively. The treatments were conducted 5 times within 12-day interval. At the end of the study, the rats were euthanized by cervical dislocation; then, the testicles were necropsied and processed for histology observation using immunohistochemistry staining. Results: CREM expression in rat Sertoli cells was not altered by the administration of either 0.2 or 0.4 ml seminal vesicle extract. Conclusion: The administration of seminal vesicle extract is unable to increase CREM expression in rat Sertoli cells. PMID:27733803

  14. A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels.

    Science.gov (United States)

    Xie, J; Black, D L

    2001-04-19

    Calcium regulation of gene expression is critical for the long-lasting activity-dependent changes in cellular electrical properties that underlie important physiological functions such as learning and memory. Cellular electrical properties are diversified through the extensive alternative splicing of ion channel pre-messenger RNAs; however, the regulation of splicing by cell signalling pathways has not been well explored. Here we show that depolarization of GH3 pituitary cells represses splicing of the STREX exon in BK potassium channel transcripts through the action of Ca2+/calmodulin-dependent protein kinases (CaMKs). Overexpressing constitutively active CaMK IV, but not CaMK I or II, specifically decreases STREX inclusion in the mRNA. This decrease is prevented by mutations in particular RNA repressor sequences. Transferring 54 nucleotides from the 3' splice site upstream of STREX to a heterologous gene is sufficient to confer CaMK IV repression on an otherwise constitutive exon. These experiments define a CaMK IV-responsive RNA element (CaRRE), which mediates the alternative splicing of ion channel pre-mRNAs. The CaRRE presents a unique molecular target for inducing long-term adaptive changes in cellular electrical properties. It also provides a model system for dissecting the effect of signal transduction pathways on alternative splicing.

  15. Three-dimensional integral imaging displays using a quick-response encoded elemental image array: an overview

    Science.gov (United States)

    Markman, A.; Javidi, B.

    2016-06-01

    Quick-response (QR) codes are barcodes that can store information such as numeric data and hyperlinks. The QR code can be scanned using a QR code reader, such as those built into smartphone devices, revealing the information stored in the code. Moreover, the QR code is robust to noise, rotation, and illumination when scanning due to error correction built in the QR code design. Integral imaging is an imaging technique used to generate a three-dimensional (3D) scene by combining the information from two-dimensional (2D) elemental images (EIs) each with a different perspective of a scene. Transferring these 2D images in a secure manner can be difficult. In this work, we overview two methods to store and encrypt EIs in multiple QR codes. The first method uses run-length encoding with Huffman coding and the double-random-phase encryption (DRPE) to compress and encrypt an EI. This information is then stored in a QR code. An alternative compression scheme is to perform photon-counting on the EI prior to compression. Photon-counting is a non-linear transformation of data that creates redundant information thus improving image compression. The compressed data is encrypted using the DRPE. Once information is stored in the QR codes, it is scanned using a smartphone device. The information scanned is decompressed and decrypted and an EI is recovered. Once all EIs have been recovered, a 3D optical reconstruction is generated.

  16. A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

    Science.gov (United States)

    Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

    2014-01-01

    SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

  17. Impact of material and morphological parameters on the mechanical response of the lumbar spine - A finite element sensitivity study.

    Science.gov (United States)

    Zander, Thomas; Dreischarf, Marcel; Timm, Anne-Katrin; Baumann, Wolfgang W; Schmidt, Hendrik

    2017-02-28

    Finite element models are frequently used to study lumbar spinal biomechanics. Deterministic models are used to reflect a certain configuration, including the means of geometrical and material properties, while probabilistic models account for the inherent variability in the population. Because model parameters are generally uncertain, their predictive power is frequently questioned. In the present study, we determined the sensitivities of spinal forces and motions to material parameters of intervertebral discs, vertebrae, and ligaments and to lumbar morphology. We performed 1200 model simulations using a generic model of the human lumbar spine loaded under pure moments. Coefficients of determination and of variation were determined for all parameter and response combinations. Material properties of the vertebrae displayed the least impact on results, whereas those of the discs and morphology impacted most. The most affected results were the axial compression forces in the vertebral body and in several ligaments during flexion and the facet-joint forces during extension. Intervertebral rotations were considerably affected only when several parameters were varied simultaneously. Results can be used to decide which model parameters require careful consideration in deterministic models and which parameters might be omitted in probabilistic studies. Findings allow quantitative estimation of a model׳s precision. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Summer camps for diabetic children: an experience in Campania, Italy.

    Science.gov (United States)

    Misuraca, A; Di Gennaro, M; Lioniello, M; Duval, M; Aloi, G

    1996-04-01

    To evaluate the effectiveness of summer camps with objective parameters, the authors examined data relative to nine summer camps organized by the Young Diabetics Association in Campania, Italy. The mean duration of camps was 10 days (range, 8-15) and a total of 256 diabetic children with an average age of 10 (range 8-16) participated in them. The medical personnel consisted of three pediatric endocrinologists, one psychologist, two male nurses and two parents who were directors of the Association. A significant improvement in knowledge and self-management of the disease was noted at the end of the camps. A beneficial effect on mean HbA1c level was also observed in the diabetic children who attended the monthly meetings and follow-up checks with their parents after the camp. On the other hand, a worsening of these values was noted in diabetic children who did not participate in them. No increased incidence of hypoglycaemia or ketoacidosis was found during or after camps, in contrast with previous studies. From a psychological viewpoint, the results suggest that summer camps have an important bearing on achieving acceptance of the disease. Sharing personal experiences with actively involved parents who participated in self-management training together with their children, has favourably influenced the results of this experience in Campania.

  19. MC1R and cAMP signaling inhibit cdc25B activity and delay cell cycle progression in melanoma cells.

    Science.gov (United States)

    Lyons, Jesse; Bastian, Boris C; McCormick, Frank

    2013-08-20

    The melanocortin 1 receptor (MC1R) mediates the tanning response through induction of cAMP and downstream pigmentary enzymes. Diminished function alleles of MC1R are associated with decreased tanning and increased melanoma risk, which has been attributed to increased rates of mutation. We have found that MC1R or cAMP signaling also directly decreases proliferation in melanoma cell lines. MC1R overexpression, treatment with the MC1R ligand, or treatment with small-molecule activators of cAMP signaling causes delayed progression from G2 into mitosis. This delay is caused by phosphorylation and inhibition of cdc25B, a cyclin dependent kinase 1-activating phosphatase, and is rescued by expression of a cdc25B mutant that cannot be phosphorylated at the serine 323 residue. These results show that MC1R and cAMP signaling can directly inhibit melanoma growth through regulation of the G2/M checkpoint.

  20. Food Allergy Trends and Epinephrine Autoinjector Presence in Summer Camps.

    Science.gov (United States)

    Schellpfeffer, Natalie R; Leo, Harvey L; Ambrose, Michael; Hashikawa, Andrew N

    Pediatric campers with food allergies are at greater risk for exposure and anaphylaxis. A diagnosis of asthma increases risk for anaphylaxis. Epidemiological investigations of food-allergic children at high risk for allergic reactions requiring intervention in camp settings are lacking. The objectives of this study were to estimate the prevalence of food allergies among otherwise healthy campers in summer camps throughout the United States and Canada, and to assess asthma comorbidity and determine rates of epinephrine autoinjector prescriptions present in this population. We partnered with CampDoc.com, a web-based camp electronic health record system. Deidentified data were abstracted from 170 camps representing 122,424 campers. Only food allergies with a parental report of symptoms requiring intervention or with a camp prescription for an epinephrine autoinjector were included, whereas gluten, lactose intolerance, and food dyes were excluded. Asthma status and epinephrine presence on the camp medication list were assessed. Overall, 2.5% of campers (n = 3055) had documented food allergies. Of these campers, 22% had multiple food allergies. Median age was 11 years; 52% were female. Nuts (81%), seafood (17.4%), egg (8.5%), fruit (8.1%), and seeds (7.2%) were the top 5 food allergies reported. Of food-allergic campers, 44.3% had concurrent asthma and 34.7% of those campers were taking multiple asthma medications. Less than half (39.7%) of food-allergic children brought an epinephrine autoinjector to the camp. Life-saving epinephrine is not necessarily available for food-allergic children in camp settings. A substantial proportion of food-allergic campers are at higher risk for anaphylaxis based on concurrent asthma status. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  1. Kosher dietary laws and children's food preferences: guide to a camp menu plan.

    Science.gov (United States)

    Feitelson, M; Fiedler, K

    1982-10-01

    Assessment of the food preferences of Jewish children and experience with the kosher dietary laws facilitated the planning of a summer camp menu. A lengthy list of foods was developed that satisfied the tastes of the campers. Recipes were modified to achieve greater value in the kosher menu. Both the children and the camp administration appreciated seeing the survey results implemented as an eight-week cycle menu. Dietitians have a responsibility to understand the cultural needs and food preferences of those whom they serve. An appreciation of ethnic and religious dietary patterns is essential in menu planning. Knowledge of the laws of kashruth and familiarity with kosher products, traditional Jewish foods, and taste preferences of Jewish children and adults are necessary to the dietitian wishing to please Jewish clientele.

  2. Preliminary assessment report for Camp Swift Military Reservation, Installation 48070, Bastrop County, Texas. Installation Restoration Program

    Energy Technology Data Exchange (ETDEWEB)

    Dennis, C.B.

    1993-08-01

    This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Texas Army National Guard property in Bastrop County, Texas. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, quantities of hazardous substances present, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the Camp Swift property, the requirement of the Department of Defense Installation Restoration Program (IRP). The review of both historical and current practices at the property indicated that the activities at Camp Swift include no operations considered to have an adverse impact to the environment. The recommendation, therefore, is that no further IRP action is necessary at this property.

  3. Impact of an informal learning science camp on urban, low socioeconomic status middle school students and participating teacher-leaders

    Science.gov (United States)

    Votaw, Nikki L.

    Studies suggest that students have difficulty connecting science to their own lives (Lee & Fradd, 1998; Aikenhead, 1996). This difficulty results in a decline in students' attitudes toward science, leading to low science achievement. These factors result in fewer students interested in careers related to science, specifically for urban, minority students. The purpose of this study was to examine the impact that a ten day informal learning immersion science camp had on the participants, both urban, low-socioeconomic status middle school students and teacher-leaders. The students were incoming seventh grade students involved in a community-based scholar program designed to recruit and support socioeconomically disadvantaged, academically talented students. The teacher-leaders were professional educators working toward an advanced degree. This ten day camp included seven visits to different sites and complementary classroom-based activities. The purpose of the camp was to immerse the students in informal learning environments that affect their daily lives. Students and teacher-leaders visited facilities that provide public utility services (i.e. power plant, sewage treatment facility, and water company), zoo, large commercial cave system, planetarium, university based electrooptics and nanotechnology center, and forest and arboretum. These site visits were supported by activities that were provided by teacher-leaders. A model used as a framework for studying learning in the context of this ten day camp as Falk and Dierking's (2000) Contextual Model for Learning. This model described three basic intersecting elements that contributed to learning within the given context. The three contexts (personal, sociocultural, and physical) intersect affecting the learning that takes place. A mixed methodology design was employed to determine the impact of the camp on students' content knowledge and attitudes toward science. Qualitative data were collected to determine the impact

  4. Summer Camp for Children And Adolescents with Chronic Conditions.

    Science.gov (United States)

    McCarthy, Alicia

    2015-01-01

    Children with chronic conditions experience physical, social, emotional, and developmental challenges that include physical differences, negative body image, social isolation, decreased emotional functioning, and developmental concerns. Summer camps are a way to help these children overcome their difficulties. They provide an enjoyable experience, encourage goal achievement, give children a sense of community and friendship, improve children's self-concept, increase children's disease knowledge and management, and contribute to campers' positive development. Nurses can encourage families to use these camps as a therapeutic intervention and help families evaluate individual camps to find a good fit for their child.

  5. Imaging alterations of cardiomyocyte cAMP microdomains in disease

    Directory of Open Access Journals (Sweden)

    Alexander eFroese

    2015-08-01

    Full Text Available 3’,5’-cyclic adenosine monophosphate (cAMP is an important second messenger which regulates heart function by acting in distinct subcellular microdomains. Recent years have provided deeper mechanistic insights into compartmentalized cAMP signaling and its link to cardiac disease. In this mini review, we summarize newest developments in this field achieved by cutting-edge biochemical and biophysical techniques. We further compile the data from different studies into a bigger picture of so far uncovered alterations in cardiomyocyte cAMP microdomains which occur in compensated cardiac hypertrophy and chronic heart failure. Finally, future research directions and translational perspectives are briefly discussed.

  6. Retinoic acid and cAMP inhibit rat hepatocellular carcinoma cell proliferation and enhance cell differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Ionta, M. [Instituto de Ciências Biomédicas, Universidade Federal de Alfenas, Alfenas MG (Brazil); Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP (Brazil); Rosa, M.C.; Almeida, R.B.; Freitas, V.M.; Rezende-Teixeira, P.; Machado-Santelli, G.M. [Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP (Brazil)

    2012-05-25

    Hepatocellular carcinoma (HCC) is the third highest cause of cancer death worldwide. In general, the disease is diagnosed at an advanced stage when potentially curative therapies are no longer feasible. For this reason, it is very important to develop new therapeutic approaches. Retinoic acid (RA) is a natural derivative of vitamin A that regulates important biological processes including cell proliferation and differentiation. In vitro studies have shown that RA is effective in inhibiting growth of HCC cells; however, responsiveness to treatment varies among different HCC cell lines. The objective of the present study was to determine if the combined use of RA (0.1 µM) and cAMP (1 mM), an important second messenger, improves the responsiveness of HCC cells to RA treatment. We evaluated the proliferative behavior of an HCC cell line (HTC) and the expression profile of genes related to cancer signaling pathway (ERK and GSK-3β) and liver differentiation [E-cadherin, connexin 26 (Cx26), and connexin 32 (Cx32)]. RA and cAMP were effective in inhibiting the proliferation of HTC cells independently of combined use. However, when a mixture of RA and cAMP was used, the signals concerning the degree of cell differentiation were increased. As demonstrated by Western blot, the treatment increased E-cadherin, Cx26, Cx32 and Ser9-GSK-3β (inactive form) expression while the expression of Cx43, Tyr216-GSK-3β (active form) and phosphorylated ERK decreased. Furthermore, telomerase activity was inhibited along treatment. Taken together, the results showed that the combined use of RA and cAMP is more effective in inducing differentiation of HTC cells.

  7. Retinoic acid and cAMP inhibit rat hepatocellular carcinoma cell proliferation and enhance cell differentiation

    Directory of Open Access Journals (Sweden)

    M. Ionta

    2012-08-01

    Full Text Available Hepatocellular carcinoma (HCC is the third highest cause of cancer death worldwide. In general, the disease is diagnosed at an advanced stage when potentially curative therapies are no longer feasible. For this reason, it is very important to develop new therapeutic approaches. Retinoic acid (RA is a natural derivative of vitamin A that regulates important biological processes including cell proliferation and differentiation. In vitro studies have shown that RA is effective in inhibiting growth of HCC cells; however, responsiveness to treatment varies among different HCC cell lines. The objective of the present study was to determine if the combined use of RA (0.1 µM and cAMP (1 mM, an important second messenger, improves the responsiveness of HCC cells to RA treatment. We evaluated the proliferative behavior of an HCC cell line (HTC and the expression profile of genes related to cancer signaling pathway (ERK and GSK-3β and liver differentiation (E-cadherin, connexin 26 (Cx26, and Cx32. RA and cAMP were effective in inhibiting the proliferation of HTC cells independently of combined use. However, when a mixture of RA and cAMP was used, the signals concerning the degree of cell differentiation were increased. As demonstrated by Western blot, the treatment increased E-cadherin, Cx26, Cx32 and Ser9-GSK-3β (inactive form expression while the expression of Cx43, Tyr216-GSK-3β (active form and phosphorylated ERK decreased. Furthermore, telomerase activity was inhibited along treatment. Taken together, the results showed that the combined use of RA and cAMP is more effective in inducing differentiation of HTC cells.

  8. The Arabidopsis ETHYLENE RESPONSE FACTOR1 Regulates Abiotic Stress-Responsive Gene Expression by Binding to Different cis-Acting Elements in Response to Different Stress Signals1[W][OA

    Science.gov (United States)

    Cheng, Mei-Chun; Liao, Po-Ming; Kuo, Wei-Wen; Lin, Tsan-Piao

    2013-01-01

    ETHYLENE RESPONSE FACTOR1 (ERF1) is an upstream component in both jasmonate (JA) and ethylene (ET) signaling and is involved in pathogen resistance. Accumulating evidence suggests that ERF1 might be related to the salt stress response through ethylene signaling. However, the specific role of ERF1 in abiotic stress and the molecular mechanism underlying the signaling cross talk still need to be elucidated. Here, we report that ERF1 was highly induced by high salinity and drought stress in Arabidopsis (Arabidopsis thaliana). The salt stress induction required both JA and ET signaling but was inhibited by abscisic acid. ERF1-overexpressing lines (35S:ERF1) were more tolerant to drought and salt stress. They also displayed constitutively smaller stomatal aperture and less transpirational water loss. Surprisingly, 35S:ERF1 also showed enhanced heat tolerance and up-regulation of heat tolerance genes compared with the wild type. Several suites of genes activated by JA, drought, salt, and heat were found in microarray analysis of 35S:ERF1. Chromatin immunoprecipitation assays found that ERF1 up-regulates specific suites of genes in response to different abiotic stresses by stress-specific binding to GCC or DRE/CRT. In response to biotic stress, ERF1 bound to GCC boxes but not DRE elements; conversely, under abiotic stress, we observed specific binding of ERF1 to DRE elements. Furthermore, ERF1 bound preferentially to only one among several GCC box or DRE/CRT elements in the promoter region of its target genes. ERF1 plays a positive role in salt, drought, and heat stress tolerance by stress-specific gene regulation, which integrates JA, ET, and abscisic acid signals. PMID:23719892

  9. Response of Basic Structural Elements and B-52 Structural Components to Simulated Nuclear Overpressure. Volume I-Program Description and Results (Basic Structural Elements)

    Science.gov (United States)

    1979-09-30

    determining the response of high-frequency structural components, such as aircraft skin panels, stringers, frames and radomes. As a result of the moratorium ...5) 00 C\\1 co a u- Cj 0 V) w CD -) (D - ~LLJO( 4-3 COD ) Ci Il 02 0 S-i 61 LL. 41) 05C LLI- <w C3 Co 0C 0l I-0 M- u cX< I- Z CD - Li -::I C.D 0 X: LLI

  10. Clinical laboratory evaluation of a reverse CAMP test for presumptive identification of Clostridium perfringens.

    OpenAIRE

    Buchanan, A G

    1982-01-01

    Ninety-six percent of Clostridium perfringens isolates from clinical specimens were reverse CAMP test positive, whereas several other Clostridium species tested were reverse CAMP test negative. C. perfringens was detected by direct inoculation of clinical specimens to reverse CAMP plates, and the reverse CAMP procedure provided reliable presumptive identification of this organism.

  11. A second look at the heavy half of the camping market

    Science.gov (United States)

    Wilbur R. LaPage; Dale P. Ragain; Dale P. Ragain

    1971-01-01

    A 1968 survey of campers revealed that one-half of the campers did more than three-fourths of all the reported camping. Campers in this heavy half of the camping market were found to differ significantly from light-half campers in their camping motivations, past experience, and investments in camping equipment (LdPage 1969). However, the 1968 survey identified heavy-...

  12. A Pan-European evaluation of residential burns camps for children and young people.

    Science.gov (United States)

    Gaskell, S L; Cooke, S; Lunke, M; O'Shaughnessy, J; Kazbekov, M; Zajicek, R

    2010-06-01

    Residential camps for children who have experienced a severe burn have existed for over 20 years. The idea stemmed from recognition that children with burns face additional challenges, both physical and psychological, and therefore need long-term psychosocial support away from the acute care setting. Whilst individual programmes have published positive evaluation findings, there have been no cross-regional evaluations undertaken to date. Five European burn camp programmes agreed to take part in a cross-regional study to assess the benefits as reported by participants. Shared objectives included: giving children the opportunity to experience success through overcoming challenging activities, enhancing self-esteem and confidence and enabling children to share their experiences of having a burn with peers and staff in a supportive environment. Each site collected qualitative feedback from children, parents and staff using a common framework. Simple Likert scale data were also collected. Each site coded responses into themes which were then collated at one site. 104 children, 57 parent/carers and 50 staff took part in the cross-regional evaluation. Children were aged between 5 and 18 years. 98% of children reported that they had enjoyed camp, in particular the activities and the sense of achievement they brought, along with the ability to gain support and friendship from peers and staff. A large proportion felt that they had benefitted from having the opportunity to share their experiences of having a burn with peers, leaving them feeling less isolated. In addition some comments related to boosting confidence and self-esteem and mastering new skills. Parent/carers again cited the increase in their child's confidence in self and appearance as key benefits of the camps. Staff reports also included the benefits for burn care teams by increasing awareness of patient needs and improving multidisciplinary team working. The study highlighted the generic benefits of burn camps

  13. Revisiting the magnetostratigraphy of the Central Atlantic Magmatic Province (CAMP) in Morocco

    Science.gov (United States)

    Font, E.; Youbi, N.; Fernandes, S.; El Hachimi, H.; Kratinová, Z.; Hamim, Y.

    2011-09-01

    The origin of the Triassic-Jurassic (Tr-J) mass extinction is still a matter of debate: proponents of the idea that continental flood basalts of the Central Atlantic Magmatic Province (CAMP) are responsible for the crisis are opposed by those who favor an extraterrestrial origin linked to the impact of meteorite. Principal limitations reside in the difficulty to date and correlate CAMP lavas with the marine realm turnover. One argument widely used to suggest that CAMP lavas pre-dated the Tr-J boundary in Morocco is based on the presence of two brief magnetic reversals in the intermediate units of the Tiourjdal and Oued Lahr sections (Morocco) that were correlated to the E23r chron from the Newark basin and to the SA5n.2r/3r and SA5r chrons of the Saint Audrie Bay [Knight, K.B., Nomade, S., Renne, P.R., Marzoli, A., Betrand, H., Youbi, N., 2004. The Central Atlantic Magmatic Province at the Triassic-Jurassic boundary: paleomagnetic and 40Ar/ 30Ar evidence from Morocco for brief, episodic volcanism. Earth and Planetary Science Letters 228, 143-160]. However the primary origin for these negative (reverse) magnetic components is questionable since no field or reversal test was provided to constrain the primary character of the remanence as well as because the small number of samples. Here we have conducted a detailed paleomagnetic and magnetic mineralogy study of the interbedded limestones of the Tiourjdal section and of other CAMP lavas sections where the intermediate unit is complete, namely the Tizi El Hajaj, Jbel Imzar and Aït Ourir sections, to better constrain the origin and stratigraphic location of these negative magnetic components. We show that the interbedded limestones of the Tiourjdal section were entirely remagnetized by chemical processes via acid and oxidizing hydrothermal fluids generated by eruptions of CAMP lavas. In addition, magnetostratigraphic data of the Tizi El Hajaj, Jbel Imzar and Aït Ourir sections show that the entire intermediate unit

  14. A/T gap tolerance in the core sequence and flanking sequence requirements of non-canonical p53 response elements

    Science.gov (United States)

    Cai, Bi-He; Chao, Chung-Faye; Lin, Hwang-Chi; Huang, Hua-Ying; Kannagi, Reiji; Chen, Jang-Yi

    2016-01-01

    The canonical core sequence of the p53 response element, CATG, has a two-base A/T gap. Previously, we found that p53 can also activate a non-canonical four-base A/T gap CATATG core sequence. In this study, we investigated the possible number of A/T bases used by p53 and showed that a six-base A/T gap CATATATG core sequence was the maximum A/T gap in the p53 response element that could be upregulated by p53 and p63. Canonical and non-canonical p53 response elements also have three-base flanking sequences. A/T bases could be substituted by G/C bases, including CACACG and CGTGTG, but not CGCGCG. We found that the SV40 promoter with functional six- and two-base A/T gap core sequences could be activated by TAp63γ and that TAp63γ could upregulate SV40 small and large T antigens expression in COS7 cells. We also found that the distal region of PUMA promoter with functional two six-base A/T gap core sequences could be activated by TAp63γ in 293T cells. These new findings could provide novel rules for the non-canonical p53 family response element and could extend the entire p53 family regulation network. PMID:26823482

  15. Methodology to determine skull bone and brain responses from ballistic helmet-to-head contact loading using experiments and finite element analysis

    NARCIS (Netherlands)

    Pintar, F.A.; Philippens, M.M.G.M.; Zhang, J.; Yoganandan, N.

    2013-01-01

    The objective of the study was to obtain helmet-to-head contact forces from experiments, use a human head finite element model to determine regional responses, and compare outputs to skull fracture and brain injury thresholds. Tests were conducted using two types of helmets (A and B) fitted to a

  16. Potency of isothiocyanates to induce luciferase reporter gene expression via the electrophile-responsive element from murine glutathione S-transferase Ya

    NARCIS (Netherlands)

    Vermeulen, M.; Boerboom, A.M.M.J.F.; Blankvoort, B.M.G.; Aarts, J.M.M.J.G.; Rietjens, I.M.C.M.; Bladeren, P.J. van; Vaes, W.H.J.

    2009-01-01

    Isothiocyanates are electrophiles that are able to induce phase II biotransformation enzyme gene expression via an electrophile-responsive element (EpRE) in the gene regulatory region. To study the potency of different isothiocyanates to induce the expression of EpRE-regulated genes, a Hepa-1c1c7

  17. Activation of Estrogen Response Element-Independent ERα Signaling Protects Female Mice From Diet-Induced Obesity.

    Science.gov (United States)

    Yasrebi, Ali; Rivera, Janelle A; Krumm, Elizabeth A; Yang, Jennifer A; Roepke, Troy A

    2017-02-01

    17β-estradiol (E2) regulates central and peripheral mechanisms that control energy and glucose homeostasis predominantly through estrogen receptor α (ERα) acting via receptor binding to estrogen response elements (EREs). ERα signaling is also involved in mediating the effects of E2 on diet-induced obesity (DIO), although the roles of ERE-dependent and -independent ERα signaling in reducing the effects of DIO remain largely unknown. We hypothesize that ERE-dependent ERα signaling is necessary to ameliorate the effects of DIO. We addressed this question using ERα knockout (KO) and ERα knockin/knockout (KIKO) female mice, the latter expressing an ERα that lacks a functional ERE binding domain. Female mice were ovariectomized, fed a low-fat diet (LFD) or a high-fat diet (HFD), and orally dosed with vehicle or estradiol benzoate (EB) (300 μg/kg). After 9 weeks, body composition, glucose and insulin tolerance, peptide hormone and inflammatory cytokine levels, and hypothalamic arcuate nucleus and liver gene expression were assessed. EB reduced body weight and body fat in wild-type (WT) female mice, regardless of diet, and in HFD-fed KIKO female mice, in part by reducing energy intake and feeding efficiency. EB reduced fasting glucose levels in KIKO mice fed both diets but augmented glucose tolerance only in HFD-fed KIKO female mice. Plasma insulin and interleukin 6 were elevated in KIKO and KO female mice compared with LFD-fed WT female mice. Expression of arcuate neuropeptide and receptor genes and liver fatty acid biosynthesis genes was altered by HFD and by EB through ERE-dependent and -independent mechanisms. Therefore, ERE-independent signaling mechanisms in both the brain and peripheral organs mediate, in part, the effects of E2 during DIO. Copyright © 2017 by the Endocrine Society.

  18. Cyclic AMP-response element modulator inhibits the promoter activity of the sodium iodide symporter gene in thyroid cancer cells.

    Science.gov (United States)

    Passon, Nadia; Puppin, Cinzia; Lavarone, Elisa; Bregant, Elisa; Franzoni, Alessandra; Hershman, Jerome M; Fenton, Mike S; D'Agostino, Maria; Durante, Cosimo; Russo, Diego; Filetti, Sebastiano; Damante, Giuseppe

    2012-05-01

    Comprehension of the regulatory mechanism involved in the sodium iodide symporter (NIS) expression is of great relevance for thyroid cancer. In fact, restoration of NIS expression would be a strategy to treat undifferentiated thyroid cancer. Previous in vitro findings suggest that the cyclic AMP-response element (CRE) modulator (CREM) is involved in control of NIS expression. In this work, we examined the expression of CREM in a series of thyroid cancer tissues and its action on NIS promoter in human thyroid cancer cells. Expression of mRNA levels for CREM, PAX8 and NIS was measured by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) in 6 normal thyroid tissues, 22 papillary, 12 follicular and 4 anaplastic thyroid cancers. The effect of CREM on transcriptional activity of the NIS promoter was investigated by transient transfection of human thyroid cell lines. Compared to normal tissues, NIS and PAX8 mRNA levels were significantly reduced in all types of thyroid cancer. As expected, the maximal decrease was detected in anaplastic thyroid cancer. Conversely, CREM mRNA levels were increased in all types of thyroid cancer, reaching statistical significance for follicular and anaplastic thyroid carcinoma (p=0.0157 and 0.0045, respectively). Transfection experiments showed an inhibitory effect of CREM on NIS promoter activity in various thyroid cancer cell lines. These data demonstrate that CREM expression is increased in thyroid cancer tissue and may play a role in the downregulation of NIS expression in thyroid cancer acting at the transcriptional level.

  19. Androgen response element of the glycine N-methyltransferase gene is located in the coding region of its first exon.

    Science.gov (United States)

    Lee, Cheng-Ming; Yen, Chia-Hung; Tzeng, Tsai-Yu; Huang, Yu-Zen; Chou, Kuan-Hsien; Chang, Tai-Jay; Arthur Chen, Yi-Ming

    2013-09-17

    Androgen plays an important role in the pathogenesis of PCa (prostate cancer). Previously, we identified GNMT (glycine N-methyltransferase) as a tumour susceptibility gene and characterized its promoter region. Besides, its enzymatic product-sarcosine has been recognized as a marker for prognosis of PCa. The goals of this study were to determine whether GNMT is regulated by androgen and to map its AREs (androgen response elements). Real-time PCR analyses showed that R1881, a synthetic AR (androgen receptor) agonist induced GNMT expression in AR-positive LNCaP cells, but not in AR-negative DU145 cells. In silico prediction showed that there are four putative AREs in GNMT-ARE1, ARE2 and ARE3 are located in the intron 1 and ARE4 is in the intron 2. Consensus ARE motif deduced from published AREs was used to identify the fifth ARE-ARE5 in the coding region of exon 1. Luciferase reporter assay found that only ARE5 mediated the transcriptional activation of R1881. ARE3 overlaps with a YY1 [Yin and Yang 1 (motif (CaCCATGTT, +1118/+1126)] that was further confirmed by antibody supershift and ChIP (chromatin immunoprecipitation) assays. EMSA (electrophoretic mobility shift assay) and ChIP assay confirmed that AR interacts with ARE5 in vitro and in vivo. In summary, GNMT is an AR-targeted gene with its functional ARE located at +19/+33 of the first exon. These results are valuable for the study of the influence of androgen on the gene expression of GNMT especially in the pathogenesis of cancer.

  20. Cardiac cAMP: production, hydrolysis, modulation and detection

    Directory of Open Access Journals (Sweden)

    Cédric eBOULARAN

    2015-10-01

    Full Text Available Cyclic adenosine 3’,5’-monophosphate (cAMP modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors’ signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability.

  1. STRATEGI CAMP DALAM NOVEL HIDING MY CANDY KARYA LADY CHABLIS

    Directory of Open Access Journals (Sweden)

    Sri Saraswati

    2016-07-01

    Penerapan strategi Camp tersebut ditujukan sebagai upaya untuk meraih kebertahanan transgender. Selanjutnya, kebertahanan transgender dapat dicerminkan melalui visibilitas sosial, terbentuknya wacana normalitas alternatif dan pemberdayaan transgender

  2. Psychiatric Morbidity in a Leprosy Camp in Northern Nigeria ...

    African Journals Online (AJOL)

    . Most of the previous studies have focused on leprosy patients in clinical settings while studies on isolated people with leprosy remain scanty. Aims : To determine the prevalence of psychiatric morbidity in a leprosy camp and its associated ...

  3. The Physics of Quidditch Summer Camp: An Interdisciplinary Approach

    Science.gov (United States)

    Hammer, Donna; Uher, Tim

    The University of Maryland Physics Department has developed an innovative summer camp program that takes an interdisciplinary approach to engaging and teaching physics. The Physics of Quidditch Camp uniquely sits at the intersection of physics, sports, and literature, utilizing the real-life sport of quidditch adapted from the Harry Potter novels to stimulate critical thinking about real laws of physics and leaps of imagination, while actively engaging students in learning the sport and discussing the literature. Throughout the camp, middle school participants become immersed in fun physics experiments and exciting physical activities, which aim to build and enhance skills in problem-solving, analytical thinking, and teamwork. This camp has pioneered new ways of teaching physics to pre-college students, successfully engaged middle school students in learning physics, and grown a large demand for such activities.

  4. Supporting Transgender and Gender Nonconforming Youth at Summer Camp

    National Research Council Canada - National Science Library

    Ann Gillard; Erin E Buzuvis; M Deborah Bialeschki

    2014-01-01

    .... Given that transgender and gender nonconforming youth tend to experience profound difficulties during the school year, camp can be a potential setting for positive youth development for these youth...

  5. Nationalsozialistische Konzentrations- und Vernichtungslager National Socialist Concentration and Extermination Camps

    Directory of Open Access Journals (Sweden)

    Max Plassmann

    2000-11-01

    Full Text Available Das Buch stellt Organisationsformen, Zuständigkeiten und Politik hinter dem nationalsozialistischen Konzentrationslagersystem dar.This book presents organization, competences and policies underlying the system of National Socialist concentration camps.

  6. Thinking Big for 25 Years: Astronomy Camp Research Projects

    Science.gov (United States)

    Hooper, Eric Jon; McCarthy, D. W.; Benecchi, S. D.; Henry, T. J.; Kirkpatrick, J. D.; Kulesa, C.; Oey, M. S.; Regester, J.; Schlingman, W. M.; Camp Staff, Astronomy

    2013-01-01

    Astronomy Camp is a deep immersion educational adventure for teenagers and adults in southern Arizona that is entering its 25th year of existence. The Camp Director (McCarthy) is the winner of the 2012 AAS Education Prize. A general overview of the program is given in an accompanying contribution (McCarthy et al.). In this presentation we describe some of the research projects conducted by Astronomy Camp participants over the years. Many of the Camps contain a strong project-oriented emphasis, which reaches its pinnacle in the Advanced Camps for teenagers. High school students from around the world participate in a microcosm of the full arc of astronomy research. They plan their own projects before the start of Camp, and the staff provide a series of "key projects." Early in the Camp the students submit observing proposals to utilize time on telescopes. (The block of observing time is secured in advance by the staff.) The participants collect, reduce and analyze astronomical data with the help of staff, and they present the results to their peers on the last night of Camp, all in a span of eight days. The Camps provide research grade telescopes and instruments, in addition to amateur telescopes. Some of the Camps occur on Kitt Peak, where we use an ensemble of telescopes: the 2.3-meter (University of Arizona) with a spectrograph; the WIYN 0.9-meter; the McMath-Pierce Solar Telescope; and the 12-meter millimeter wave telescope. Additionally the Camp has one night on the 10-meter Submillimeter Telescope on Mt. Graham. Campers use these resources to study stars, galaxies, AGN, transiting planets, molecular clouds, etc. Some of the camper-initiated projects have led to very high level performances in prestigious international competitions, such as the Intel International Science and Engineering Fair. The key projects often contribute to published astronomical research (e.g., Benecchi et al. 2010, Icarus, 207, 978). Many former Campers have received Ph.D. degrees in

  7. EduCamp Colombia: Social Networked Learning for Teacher Training

    OpenAIRE

    Diego Ernesto Leal Fonseca

    2011-01-01

    This paper describes a learning experience called EduCamp, which was launched by the Ministry of Education of Colombia in 2007, based on emerging concepts such as e-Learning 2.0, connectivism, and personal learning environments. An EduCamp proposes an unstructured collective learning experience, which intends to make palpable the possibilities of social software tools in learning and interaction processes while demonstrating face-to-face organizational forms that reflect social networked lear...

  8. Science and technology camp for girls. Final report

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-31

    This document reports on the success of Pacific University`s camp held during the summers of 1992 and 1993; ultimate goal of this summer day camp was to increase the number of women in technical and scientific fields. Some experimentation was done with the age groups (7th and 8th grade girls). The curriculum was biology, chemistry, physics, and mathematics/computer science. Laboratory work and field trips were emphasized, along with socialization.

  9. Camp Upshur, Marine Corps Base Quantico, VA Architectural Survey

    Science.gov (United States)

    2009-08-01

    mon occurrence during and post World War II construction. The building type was a quick fix to the growing needs of the Marine Corps. In 1950, the...of Skinner Street East of Mitchell Street South of Bonnyman Street West of Bailey Street at Camp Upshur, which is located in the northwest corner...of Skinner Street, east of Mitchell Street, south of Bonnyman Street, and west of Bailey Ave- nue at Camp Upshur, Marine Corps Base Quantico, Virginia

  10. Camp Sherman, Ohio: History of a World War I Training Camp

    Science.gov (United States)

    2015-12-01

    t.t.’T !tC.AL.t: O r MILl:, " · t CO ... TRUCTION OIVI.ION WA R OEJOT. WASH INGTON. D. C CAMP jHE12.MAN , OHIO KEY ~1AP OF PROPERTY .10e No 6...the rear of the bunker. It was an all-day assignment and at noon a cook’s truck arrived with some unsavory victuals with cold coffee slopped over...land for training purposes, but the OHARNG took full control of the land in 1971. 114 The rifle range was likely used for troop training in

  11. Targeted antiviral prophylaxis with oseltamivir in a summer camp setting.

    Science.gov (United States)

    Kimberlin, David W; Escude, Janell; Gantner, Janel; Ott, Jeanne; Dronet, Melissa; Stewart, Timothy A; Jester, Penelope; Redden, David T; Chapman, Whitney; Hammond, Rob

    2010-04-01

    To describe the effectiveness of containment of novel influenza A(H1N1) infection at a summer camp. Targeted use of oseltamivir phosphate by individuals in close contact with influenza-confirmed cases. Boys' camp in Alabama in July 2009. A total of 171 campers, 48 camp counselors, and 27 camp staff. Campers with confirmed influenza received oseltamivir and were immediately isolated and sent home. All boys and counselors in the infected child's adjoining cabins received prophylactic oseltamivir for 10 days, including 8 campers at higher risk for influenza infection (eg, those with asthma, seizure disorder, or diabetes). Alcohol-based hand sanitizer was provided at each of the daily activities, in the boys' cabins, and in the dining hall, and counselors were educated by the medical staff on the spread of influenza and its prevention through good hand hygiene. All cabins, bathrooms, and community sports equipment were sprayed or wiped down with disinfectant each day. Main Outcome Measure Virologic confirmation of influenza. Three of the 171 campers tested positive for influenza A during the course of the 2-week fourth session, for an attack rate of 1.8%. The probability of observing 3 or fewer infected campers if the attack rate was 12% is less than 1 in 10,000,000 (P camp session. In conjunction with comprehensive hand sanitization and surface decontamination, a targeted approach to antiviral prophylaxis contained the spread of influenza in a summer camp setting.

  12. Core Concepts: Orthopedic Intern Curriculum Boot Camp.

    Science.gov (United States)

    Seeley, Mark A; Kazarian, Erick; King, Brandon; Biermann, Janet S; Carpenter, James E; Caird, Michelle S; Irwin, Todd A

    2016-01-01

    Orthopedic surgical interns must gain a broad array of clinical skills in a short time. However, recent changes in health care have limited resident-patient exposures. With the reported success of simulation training in the surgical literature, the American Board of Orthopaedic Surgery (ABOS) and Residency Review Committee for Orthopaedic Surgery have required that surgical simulation training be a component of the intern curricula in orthopedic surgical residencies. This study examined the short-term effectiveness of an orthopedic "intern boot camp" covering 7 of 17 simulation training concept modules published by the ABOS. Eight orthopedic post-graduate year 1 (PGY-1) residents (study group) completed a structured 3-month curriculum and were compared with 7 post-graduate year 2 (PGY-2) residents (comparison group) who had just completed their orthopedic surgical internship. Seven core skills were assessed using both task-specific and global rating scales. The PGY-1 residents demonstrated a statistically significant improvement in all 7 modules with respect to their task-specific pre-test scores: sterile technique (P=.001), wound closure (Porthopedic internship elevated a variety of clinical skills to levels exhibited by PGY-2 residents. Copyright 2016, SLACK Incorporated.

  13. cAMP-Induced Desensitization of Surface cAMP Receptors in Dictyostelium : Different Second Messengers Mediate Receptor Phosphorylation, Loss of Ligand Binding, Degradation of Receptor, and Reduction of Receptor mRNA Levels

    NARCIS (Netherlands)

    Haastert, Peter J.M. van; Wang, Mei; Bominaar, Anthony A.; Devreotes, Peter N.; Schaap, Pauline

    Surface cAMP receptors on Dictyostelium cells are linked to several second messenger systems and mediate multiple physiological responses, including chemotaxis and differentiation. Activation of the receptor also triggers events which desensitize signal transduction. These events include the

  14. Regulated expression of HCN channels and cAMP levels shape the properties of the h current in developing rat hippocampus

    Science.gov (United States)

    Surges, Rainer; Brewster, Amy L.; Bender, Roland A.; Beck, Heinz; Feuerstein, Thomas J.; Baram, Tallie Z.

    2010-01-01

    The hyperpolarization-activated current (Ih) contributes to intrinsic properties and network responses of neurons. Its biophysical properties depend on the expression profiles of the underlying hyperpolarization-activated, cyclic nucleotide-gated (HCN) channels and the presence of cyclic AMP (cAMP) that potently and differentially modulates Ih conducted by HCN1, HCN2 and/or HCN4. Here, we studied the properties of Ih in hippocampal CA1 pyramidal cells, the developmental evolution of the HCN-subunit isoforms that contribute to this current, and their interplay with age-dependent free cAMP concentrations, using electrophysiological, molecular and biochemical methods. Ih amplitude increased progressively during the first four postnatal weeks, consistent with the observed overall increased expression of HCN channels. Activation kinetics of the current accelerated during this period, consonant with the quantitative reduction of mRNA and protein expression of the slow-kinetics HCN4 isoform and increased levels of HCN1. The sensitivity of Ih to cAMP, and the contribution of the slow component to the overall Ih, decreased with age. These are likely a result of the developmentally regulated transition of the complement of HCN channel isoforms from cAMP sensitive to relatively cAMP insensitive. Thus, although hippocampal cAMP concentrations increased over twofold during the developmental period studied, the coordinated changes in expression of three HCN channel isoforms resulted in reduced effects of this signalling molecule on neuronal h currents. PMID:16882011

  15. Transiently increasing cAMP levels selectively in hippocampal excitatory neurons during sleep deprivation prevents memory deficits caused by sleep loss.

    Science.gov (United States)

    Havekes, Robbert; Bruinenberg, Vibeke M; Tudor, Jennifer C; Ferri, Sarah L; Baumann, Arnd; Meerlo, Peter; Abel, Ted

    2014-11-19

    The hippocampus is particularly sensitive to sleep loss. Although previous work has indicated that sleep deprivation impairs hippocampal cAMP signaling, it remains to be determined whether the cognitive deficits associated with sleep deprivation are caused by attenuated cAMP signaling in the hippocampus. Further, it is unclear which cell types are responsible for the memory impairments associated with sleep deprivation. Transgenic approaches lack the spatial resolution to manipulate specific signaling pathways selectively in the hippocampus, while pharmacological strategies are limited in terms of cell-type specificity. Therefore, we used a pharmacogenetic approach based on a virus-mediated expression of a Gαs-coupled Drosophila octopamine receptor selectively in mouse hippocampal excitatory neurons in vivo. With this approach, a systemic injection with the receptor ligand octopamine leads to increased cAMP levels in this specific set of hippocampal neurons. We assessed whether transiently increasing cAMP levels during sleep deprivation prevents memory consolidation deficits associated with sleep loss in an object-location task. Five hours of total sleep deprivation directly following training impaired the formation of object-location memories. Transiently increasing cAMP levels in hippocampal neurons during the course of sleep deprivation prevented these memory consolidation deficits. These findings demonstrate that attenuated cAMP signaling in hippocampal excitatory neurons is a critical component underlying the memory deficits in hippocampus-dependent learning tasks associated with sleep deprivation. Copyright © 2014 the authors 0270-6474/14/3415715-07$15.00/0.

  16. Finite-element nonlinear transient response computer programs PLATE 1 and CIVM-PLATE 1 for the analysis of panels subjected to impulse or impact loads

    Science.gov (United States)

    Spilker, R. L.; Witmer, E. A.; French, S. E.; Rodal, J. J. A.

    1980-01-01

    Two computer programs are described for predicting the transient large deflection elastic viscoplastic responses of thin single layer, initially flat unstiffened or integrally stiffened, Kirchhoff-Lov ductile metal panels. The PLATE 1 program pertains to structural responses produced by prescribed externally applied transient loading or prescribed initial velocity distributions. The collision imparted velocity method PLATE 1 program concerns structural responses produced by impact of an idealized nondeformable fragment. Finite elements are used to represent the structure in both programs. Strain hardening and strain rate effects of initially isotropic material are considered.

  17. Finite element simulations of the head-brain responses to the top impacts of a construction helmet: Effects of the neck and body mass.

    Science.gov (United States)

    Wu, John Z; Pan, Christopher S; Wimer, Bryan M; Rosen, Charles L

    2017-01-01

    Traumatic brain injuries are among the most common severely disabling injuries in the United States. Construction helmets are considered essential personal protective equipment for reducing traumatic brain injury risks at work sites. In this study, we proposed a practical finite element modeling approach that would be suitable for engineers to optimize construction helmet design. The finite element model includes all essential anatomical structures of a human head (i.e. skin, scalp, skull, cerebrospinal fluid, brain, medulla, spinal cord, cervical vertebrae, and discs) and all major engineering components of a construction helmet (i.e. shell and suspension system). The head finite element model has been calibrated using the experimental data in the literature. It is technically difficult to precisely account for the effects of the neck and body mass on the dynamic responses, because the finite element model does not include the entire human body. An approximation approach has been developed to account for the effects of the neck and body mass on the dynamic responses of the head-brain. Using the proposed model, we have calculated the responses of the head-brain during a top impact when wearing a construction helmet. The proposed modeling approach would provide a tool to improve the helmet design on a biomechanical basis.

  18. Can You Hack It? Validating Predictors for IT Boot Camps

    Science.gov (United States)

    Gear, Courtney C.

    Given the large number of information technology jobs open and lack of qualified individuals to fill them, coding boot camps have sprung up in response to this skill gap by offering a specialized training program in an accelerated format. This fast growth has created a need to measure these training programs and understand their effectiveness. In the present study, a series of analyses examined whether specific or combinations of predictors were valid for training performance in this coding academy. Self-rated, daily efficacy scores were used as outcome variables of training success and correlation results showed a positive relationship with efficacy scores and the logic test score as a predictor. Exploratory analyses indicated a Dunning-Kruger effect where students with lower education levels experience higher overall mood during the training program. Limitations of the study included small sample size, severe range restriction in predictor scores, lack of variance in predictor scores, and low variability in training program success. These limitations made identifying jumps between training stages difficult to identify. By identifying which predictors matter most for each stage of skill acquisition, further research should consider more objective variables such as instructor scores which can serve as a guideline to better asses what stage learners join at and how to design curriculum and assignments accordingly (Honken, 2013).

  19. Element Selective Probe of the Ultra-Fast Magnetic Response to an Element Selective Excitation in Fe-Ni Compounds Using a Two-Color FEL Source

    Directory of Open Access Journals (Sweden)

    Eugenio Ferrari

    2017-01-01

    Full Text Available The potential of the two-color mode implemented at the FERMI free-electron laser (FEL source for pumping and probing selectively different atomic species has been demonstrated by time-resolved scattering experiments with permalloy (FeNi alloy and NiFe2O4 samples. We monitored the ultra-fast demagnetization of Ni induced by the pump FEL pulse, by tuning the linearly-polarized FEL probe pulse to the Ni-3p resonance and measuring the scattered intensity in the transverse magneto-optical Kerr effect geometry. The measurements were performed by varying the intensity of the FEL pump pulse, tuning its wavelength to and off of the Fe-3p resonance, and by spanning the FEL probe pulse delays across the 300–900 fs range. The obtained results have evidenced that for the case of NiFe2O4, there is a sensible difference in the magnetic response at the Ni site when the pump pulse causes electronic excitations at the Fe site.

  20. A 30-base pair element is responsible for the myeloid-specific activity of the human neutrophil elastase promoter.

    Science.gov (United States)

    Srikanth, S; Rado, T A

    1994-12-23

    Human neutrophil elastase (HNE), a serine protease, is expressed only in the promyelocytic stages of granulocyte maturation. We examined several regions of the promoter for transcriptional activity and report that a 30-base pair (bp) element located between -76 and -106 in the 5'-flanking region of HNE is sufficient for myeloid-specific expression of HNE. Gel shift assays using nuclear extracts from myeloid and non-myeloid cells reveal several myeloid-specific complexes binding to the 30-bp element. Examination of DNA-protein interactions shows that at least two myeloid-specific proteins of 38 and 55 kDa bind to this element. DNase I protection analysis reveals two distinct footprints between -80 to -91 and -94 to -104 within this element. Transient expression studies using deletion constructs of the HNE 5'-flanking region show that the 30-bp element is active in myeloid cells K 562 and U 937 but not in HeLa cells. Internal deletion of this element results in a 60-85% loss of promoter activity in myeloid cells. Additional functional studies also show that a 19-bp region between -112 and -131 contributes to transcriptional activity of the elastase promoter as well.

  1. Effect of a wildlife conservation camp experience in China on student knowledge of animals, care, propensity for environmental stewardship, and compassionate behavior toward animals

    Science.gov (United States)

    Bexell, Sarah M.

    The goal of conservation education is positive behavior change toward animals and the environment. This study was conducted to determine whether participation in a wildlife conservation education camp was effective in positively changing 8-12 year old students': (a) knowledge of animals, (b) care about animals, (c) propensity for environmental and wildlife stewardship, and (d) compassionate behavior toward animals. During the summer of 2005, 2 five-day camps were conducted at 2 zoological institutions in Chengdu, China. The camp curriculum was influenced by theory and research on the following: conservation psychology, social learning theory, empathy and moral development theory, socio-biological theory, constructivist theory, and conservation science. Camp activities were sensitive to Chinese culture and included Chinese conservation issues. Activities were designed to help children form bonds with animals and care enough about them to positively change their behavior toward animals and the environment. This mixed methods study triangulated quantitative and qualitative data from six sources to answer the following: (1) Did camp increase student knowledge of animals? (2) Did camp increase student caring about animals? (3) Did camp increase student propensity for environmental and wildlife stewardship? (4) Did camp affect student compassionate behavior toward animals? A conservation stewards survey revealed significant increases on pre-post, self-report of knowledge, care, and propensity. Pre-post, rubric-scored responses to human-animal interaction vignettes indicated a significant increase in knowledge, and stable scores on care and propensity. Qualitative data from student journals, vignettes, and end-of-camp questionnaires demonstrated knowledge, caring, and propensity, and revealed the emergent theme empathy. To address question 4, instructors tallied campers' behavior toward animals using a student behavior ethogram. Occurrence of positive behaviors was

  2. The Psychological Impact of First Burn Camp in Nicaragua.

    Science.gov (United States)

    Tropez-Arceneaux, Lisa L; Castillo Alaniz, Arlen Tatiana; Lucia Icaza, Ivette; Alejandra Murillo, Evelyn

    Asociacion Pro-Ninos Quemados de Nicaragua (APROQUEN) is a comprehensive burn center that provides a holistic and integrated approach to treating burns. APROQUEN has set the standards internationally with acute treatment for burns, intensive care, reconstructive surgeries, nutritional care, rehabilitation, occupational therapy, and psychological treatment. APROQUEN is excelling within Central and South America with life-saving techniques and quality of care. It is imperative that burn centers in Central America recognize that the treatment of a child with a burn injury surpasses physical care to include psychological treatment for the complete well-being of the child. It is necessary to provide the tools necessary to reintegrate the child back into their environment. APROQUEN developed and implemented the first burn camp in Latin America, "Confio en Mi" (I trust myself). The camp theme focused on self-esteem. The camp program included theory (educational) and practice (applied) components where the campers through "classroom type" activities had the opportunity to reflect and share with other campers and camp staff on self-esteem, depression, and anxiety. Participants were children who survived major burns (N = 33; 58% women; ages 12-25; 61% <18) and were shown to have difficulty socializing. Comprehensive interviews were conducted to ensure fit for camp. Forty-two percent of the campers had not slept away from home since the burn injury. Mean TBSA = 20% and mean age at time of burn injury was 13. The majority of campers (46%) endured flame burn injuries, with 24% having scald injuries. Mean years postburn = 4.8 + 3.2. Most campers (40%) were enrolled in secondary school, 30% in elementary school, and 21% in college. Standardized measures (CDI-2 Parent Form and Child Form, Rosenberg Scale, APROQUEN Burn Camp Measure Parent and Child Form, Beck Anxiety Inventory, and Beck Depression Inventory) were given to all campers prior to attending camp. The same measures

  3. ESTCP Munitions Response: Live Site Demonstration Former Camp Ellis

    Science.gov (United States)

    2014-07-01

    former cantonment area remain unfarmed because the thick concrete slabs used as building foundations are difficult to remove. Tree groves exist in...heated cab improved working conditions and helped minimize the potential for cold-stress injuries.  The cab provided a waterproof location for the

  4. The MluI cell cycle box (MCB motifs, but not damage-responsive elements (DREs, are responsible for the transcriptional induction of the rhp51+ gene in response to DNA replication stress.

    Directory of Open Access Journals (Sweden)

    Wugangerile Sartagul

    Full Text Available DNA replication stress induces the transcriptional activation of rhp51+, a fission yeast recA homolog required for repair of DNA double strand breaks. However, the mechanism by which DNA replication stress activates rhp51+ transcription is not understood. The promoter region of rhp51+ contains two damage-responsive elements (DREs and two MluI cell cycle box (MCB motifs. Using luciferase reporter assays, we examined the role of these elements in rhp51+ transcription. The full-length rhp51+ promoter and a promoter fragment containing MCB motifs only, but not a fragment containing DREs, mediated transcriptional activation upon DNA replication stress. Removal of the MCB motifs from the rhp51+ promoter abolished the induction of rhp51+ transcription by DNA replication stress. Consistent with a role for MCB motifs in rhp51+ transcription activation, deletion of the MBF (MCB-binding factor co-repressors Nrm1 and Yox1 precluded rhp51+ transcriptional induction in response to DNA replication stress. Using cells deficient in checkpoint signaling molecules, we found that the Rad3-Cds1/Chk1 pathway partially mediated rhp51+ transcription in response to DNA replication stress, suggesting the involvement of unidentified checkpoint signaling pathways. Because MBF is critical for G1/S transcription, we examined how the cell cycle affected rhp51+ transcription. The transcription of rhp51+ and cdc18+, an MBF-dependent G1/S gene, peaked simultaneously in synchronized cdc25-22 cells. Furthermore, DNA replication stress maintained transcription of rhp51+ similarly to cdc18+. Collectively, these results suggest that MBF and its regulators mediate rhp51+ transcription in response to DNA replication stress, and underlie rhp51+ transcription at the G1/S transition.

  5. The MluI cell cycle box (MCB) motifs, but not damage-responsive elements (DREs), are responsible for the transcriptional induction of the rhp51+ gene in response to DNA replication stress.

    Science.gov (United States)

    Sartagul, Wugangerile; Zhou, Xin; Yamada, Yuki; Ma, Ning; Tanaka, Katsunori; Furuyashiki, Tomoyuki; Ma, Yan

    2014-01-01

    DNA replication stress induces the transcriptional activation of rhp51+, a fission yeast recA homolog required for repair of DNA double strand breaks. However, the mechanism by which DNA replication stress activates rhp51+ transcription is not understood. The promoter region of rhp51+ contains two damage-responsive elements (DREs) and two MluI cell cycle box (MCB) motifs. Using luciferase reporter assays, we examined the role of these elements in rhp51+ transcription. The full-length rhp51+ promoter and a promoter fragment containing MCB motifs only, but not a fragment containing DREs, mediated transcriptional activation upon DNA replication stress. Removal of the MCB motifs from the rhp51+ promoter abolished the induction of rhp51+ transcription by DNA replication stress. Consistent with a role for MCB motifs in rhp51+ transcription activation, deletion of the MBF (MCB-binding factor) co-repressors Nrm1 and Yox1 precluded rhp51+ transcriptional induction in response to DNA replication stress. Using cells deficient in checkpoint signaling molecules, we found that the Rad3-Cds1/Chk1 pathway partially mediated rhp51+ transcription in response to DNA replication stress, suggesting the involvement of unidentified checkpoint signaling pathways. Because MBF is critical for G1/S transcription, we examined how the cell cycle affected rhp51+ transcription. The transcription of rhp51+ and cdc18+, an MBF-dependent G1/S gene, peaked simultaneously in synchronized cdc25-22 cells. Furthermore, DNA replication stress maintained transcription of rhp51+ similarly to cdc18+. Collectively, these results suggest that MBF and its regulators mediate rhp51+ transcription in response to DNA replication stress, and underlie rhp51+ transcription at the G1/S transition.

  6. Vitamin D responsive elements within the HLA-DRB1 promoter region in Sardinian multiple sclerosis associated alleles.

    Directory of Open Access Journals (Sweden)

    Eleonora Cocco

    Full Text Available Vitamin D response elements (VDREs have been found in the promoter region of the MS-associated allele HLA-DRB1*15:01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15:01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04:05, *03:01, *13:01 and *15:01 and non-MS-associated *16:01, *01, *11, *07:01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects. Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15:01, *16:01, *11 and in 45/73 *03:01 and in heterozygous state in 28/73 *03:01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13:03, *04:05 and *07:01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04:05 and *03:01 alleles carrying the new mutated VDRE, while the *16:01 and *03:01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16:01 and in the *15:01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients.

  7. Camp Golden Treasures: a multidisciplinary weight-loss and a healthy lifestyle camp for adolescent girls.

    Science.gov (United States)

    Pratt, Keeley J; Lamson, Angela L; Collier, David N; Harris, Nancy; Ballard, Sharon; Saporito, Maria; Sarvey, Sharon; Gross, Kevin; Crawford, Yancey S

    2009-03-01

    Camp Golden Treasures, (CGT) the first non-profit weight loss camp for overweight adolescent girls in the nation, was held for six weeks from June 24 to August 3, 2007 at the East Carolina University campus in Greenville, NC. The primary goal was to support campers to lose weight, raise self esteem, and to learn the tools necessary to lead a healthy lifestyle while reducing risks for developing chronic disease or mitigating the effects of existing obesity-related conditions (sleep apnea, insulin resistance, hypertension, lower extremity dysfunction, etc.). While at CGT, campers learned about the importance of physical activity and proper nutrition through workshops, discussion groups and hands-on activities. Additionally campers were taught the necessary tools and strategies needed to make concrete, positive lifestyle changes so they can achieve a healthy weight. Due to the nature of a chronic disease such as obesity, multidisciplinary collaborators including physical therapy, nutrition, health education, management, family therapy, risk management, fundraising, public relations, medical, nursing, and physician coverage were involved in designing, planning, and implementing CGT.

  8. Lipoic acid attenuates inflammation via cAMP and protein kinase A signaling.

    Directory of Open Access Journals (Sweden)

    Sonemany Salinthone

    2010-09-01

    Full Text Available Abnormal regulation of the inflammatory response is an important component of diseases such as diabetes, Alzheimer's disease and multiple sclerosis (MS. Lipoic acid (LA has been shown to have antioxidant and anti-inflammatory properties and is being pursued as a therapy for these diseases. We first reported that LA stimulates cAMP production via activation of G-protein coupled receptors and adenylyl cyclases. LA also suppressed NK cell activation and cytotoxicity. In this study we present evidence supporting the hypothesis that the anti-inflammatory properties of LA are mediated by the cAMP/PKA signaling cascade. Additionally, we show that LA oral administration elevates cAMP levels in MS subjects.We determined the effects of LA on IL-6, IL-17 and IL-10 secretion using ELISAs. Treatment with 50 µg/ml and 100 µg/ml LA significantly reduced IL-6 levels by 19 and 34%, respectively, in T cell enriched PBMCs. IL-17 levels were also reduced by 35 and 50%, respectively. Though not significant, LA appeared to have a biphasic effect on IL-10 production. Thymidine incorporation studies showed LA inhibited T cell proliferation by 90%. T-cell activation was reduced by 50% as measured by IL-2 secretion. Western blot analysis showed that LA treatment increased phosphorylation of Lck, a downstream effector of protein kinase A. Pretreatment with a peptide inhibitor of PKA, PKI, blocked LA inhibition of IL-2 and IFN gamma production, indicating that PKA mediates these responses. Oral administration of 1200 mg LA to MS subjects resulted in increased cAMP levels in PBMCs four hours after ingestion. Average cAMP levels in 20 subjects were 43% higher than baseline.Oral administration of LA in vivo resulted in significant increases in cAMP concentration. The anti-inflammatory effects of LA are mediated in part by the cAMP/PKA signaling cascade. These novel findings enhance our understanding of the mechanisms of action of LA.

  9. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  10. Role of clinical tutors in volunteering work camps.

    Science.gov (United States)

    Alloni, Rossana; D'Elia, Annunziata; Navajas, Francisca; De Gara, Laura

    2014-04-01

    The Università Campus Bio-Medico (Italy) promotes a summer volunteering work camp (Workcamp Perù) as a social activity for medical and non-medical students. Some junior doctors participate as 'clinical tutors', together with tutors from other professions; all clinical tutors have some teaching experience in our teaching hospital. The campsite is located in the South of Peru in the Cañete Valley, an area characterised by extreme poverty and a severe lack of infrastructure. During the five Workcamp Perù trips that have been organised so far, health science students have carried out many activities for disease prevention and health education, and bio-medical engineering students have organised sessions on the safety of electrical installations, for accident prevention. We observed that in this setting tutorial activity is fundamental, because it not only offers students an opportunity to learn but also encourages them to react in a more personal and reflective manner to various stressful situations, which often occur in the work camp. The professional competence of the tutor plays an important role before the work camp, in defining the learning objectives for the students and involving them in training sessions held prior to the work camp. Also, during the camp, tutors work with students and also direct the daily briefing and debriefing sessions that are the most important learning activity. For medical tutors involved in the work camp the volunteering experience is a challenge for developing their specific professional and teaching skills, but it also provides an enriching experience in both professional and personal terms. We consider these work camps to be a useful experience in the training of our clinical tutors. © 2014 John Wiley & Sons Ltd.

  11. Children's Moderate to Vigorous Physical Activity Attending Summer Day Camps.

    Science.gov (United States)

    Brazendale, Keith; Beets, Michael W; Weaver, R Glenn; Chandler, Jessica L; Randel, Allison B; Turner-McGrievy, Gabrielle M; Moore, Justin B; Huberty, Jennifer L; Ward, Dianne S

    2017-07-01

    National physical activity standards call for all children to accumulate 60 minutes/day of moderate to vigorous physical activity (MVPA). The contribution of summer day camps toward meeting this benchmark is largely unknown. The purpose of this study was to provide estimates of children's MVPA during summer day camps. Children (n=1,061, 78% enrollment; mean age, 7.8 years; 46% female; 65% African American; 48% normal weight) from 20 summer day camps wore ActiGraph GT3x+ accelerometers on the wrist during camp hours for up to 4 non-consecutive days over the summer of 2015 (July). Accumulated MVPA at the 25th, 50th, and 75th percentile of the distribution was estimated using random-effects quantile regression. All models were estimated separately for boys and girls and controlled for wear time. Minutes of MVPA were dichotomized to ≥60 minutes/day of MVPA or summer day camps, boys (n=569) and girls (n=492) accumulated a median of 96 and 82 minutes/day of MVPA, respectively. The percentage of children meeting 60 minutes/day of MVPA was 80% (range, 41%-94%) for boys and 73% (range, 30%-97%) for girls. Summer day camps are a setting where a large portion of boys and girls meet daily physical activity guidelines. Public health practitioners should focus efforts on making summer day camps accessible for children in the U.S. Copyright © 2017 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  12. Emergency Medicine Residency Boot Camp Curriculum: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Ataya, Ramsey

    2015-03-01

    Full Text Available Introduction: Establishing a boot camp curriculum is pertinent for emergency medicine (EM residents in order to develop proficiency in a large scope of procedures and leadership skills.  In this article, we describe our program’s EM boot camp curriculum as well as measure the confidence levels of resident physicians through a pre- and post-boot camp survey. Methods: We designed a one-month boot camp curriculum with the intention of improving the confidence, procedural performance, leadership, communication and resource management of EM interns. Our curriculum consisted of 12 hours of initial training and culminated in a two-day boot camp. The initial day consisted of clinical skill training and the second day included code drill scenarios followed by interprofessional debriefing.   Results: Twelve EM interns entered residency with an overall confidence score of 3.2 (1-5 scale across all surveyed skills. Interns reported the highest pre-survey confidence scores in suturing (4.3 and genitourinary exams (3.9. The lowest pre-survey confidence score was in thoracostomy (2.4. Following the capstone experience, overall confidence scores increased to 4.0. Confidence increased the most in defibrillation and thoracostomy. Additionally, all interns reported post-survey confidence scores of at least 3.0 in all skills, representing an internal anchor of “moderately confident/need guidance at times to perform procedure.” Conclusion: At the completion of the boot camp curriculum, EM interns had improvement in self-reported confidence across all surveyed skills and procedures. The described EM boot camp curriculum was effective, feasible and provided a foundation to our trainees during their first month of residency. [West J Emerg Med. 2015;16(2:356–361.

  13. Students' Perceptions of the Long-Term Impact of Attending a "CSI Science Camp"

    Science.gov (United States)

    Yanowitz, Karen L.

    2016-12-01

    A science summer camp is a popular type of informal science experience for youth. While there is no one model of a science camp, these experiences typically allow for more focused and in-depth exploration of different science domains and are usually hands-on and participatory. The goal of this research was to examine the impact of a short science camp program approximately 1 year after students attended the camp. Overall, the results revealed that attending a 2-day forensic science camp had a positive and continuing influence on the participants. Students' science self-efficacy increased immediately after attending the camp and remained higher than pre-camp levels approximately 1 year later. Students were able to articulate why they believed the camp had a long-term impact on their lives. Furthermore, participants attributed a higher level of engaging in additional informal STEM-related activities during the academic year as a result of attending the camp.

  14. The NO/cGMP pathway inhibits transient cAMP signals through the activation of PDE2 in striatal neurons

    Directory of Open Access Journals (Sweden)

    Marina ePolito

    2013-11-01

    Full Text Available The NO-cGMP signaling plays an important role in the regulation of striatal function although the mechanisms of action of cGMP specifically in medium spiny neurons (MSNs remain unclear. Using genetically encoded fluorescent biosensors, including a novel Epac-based sensor (EPAC-SH150 with increased sensitivity for cAMP, we analyze the cGMP response to NO and whether it affected cAMP/PKA signaling in MSNs. The Cygnet2 sensor for cGMP reported large responses to NO donors in both striatonigral and striatopallidal MSNs, and this cGMP signal was controlled partially by PDE2. At the level of cAMP brief forskolin stimulations produced transient cAMP signals which differed between D1 and D2 medium spiny neurons. NO inhibited these cAMP transients through cGMP-dependent PDE2 activation, an effect that was translated and magnified downstream of cAMP, at the level of PKA. PDE2 thus appears as a critical effector of NO which modulates the post-synaptic response of MSNs to dopaminergic transmission.

  15. A multisite evaluation of summer camps for children with cancer and their siblings.

    Science.gov (United States)

    Wu, Yelena P; McPhail, Jessica; Mooney, Ryan; Martiniuk, Alexandra; Amylon, Michael D

    2016-01-01

    Summer camps for pediatric cancer patients and their families are ubiquitous. However, there is relatively little research, particularly studies including more than one camp, documenting outcomes associated with children's participation in summer camp. The current cross-sectional study used a standardized measure to examine the role of demographic, illness, and camp factors in predicting children's oncology camp-related outcomes. In total, 2,114 children at 19 camps participated. Campers were asked to complete the pediatric camp outcome measure, which assesses camp-specific self-esteem, emotional, physical, and social functioning. Campers reported high levels of emotional, physical, social, and self-esteem functioning. There were differences in functioning based on demographic and illness characteristics, including gender, whether campers/siblings were on or off active cancer treatment, age, and number of prior years attending camp. Results indicated that summer camps can be beneficial for pediatric oncology patients and their siblings, regardless of demographic factors (e.g., gender, treatment status) and camp factors (e.g., whether camp sessions included patients only, siblings only, or both). Future work could advance the oncology summer camp literature by examining other outcomes linked to summer camp attendance, using longitudinal designs, and including comparison groups.

  16. A multisite evaluation of summer camps for children with cancer and their siblings

    Science.gov (United States)

    Wu, Yelena P.; McPhail, Jessica; Mooney, Ryan; Martiniuk, Alexandra; Amylon, Michael D.

    2017-01-01

    Summer camps for pediatric cancer patients and their families are ubiquitous. However, there is relatively little research, particularly studies including more than one camp, documenting outcomes associated with children’s participation in summer camp. The current cross-sectional study used a standardized measure to examine the role of demographic, illness, and camp factors in predicting children’s oncology camp-related outcomes. In total, 2,114 children at 19 camps participated. Campers were asked to complete the pediatric camp outcome measure, which assesses camp-specific self-esteem, emotional, physical, and social functioning. Campers reported high levels of emotional, physical, social, and self-esteem functioning. There were differences in functioning based on demographic and illness characteristics, including gender, whether campers/siblings were on or off active cancer treatment, age, and number of prior years attending camp. Results indicated that summer camps can be beneficial for pediatric oncology patients and their siblings, regardless of demographic factors (e.g., gender, treatment status) and camp factors (e.g., whether camp sessions included patients only, siblings only, or both). Future work could advance the oncology summer camp literature by examining other outcomes linked to summer camp attendance, using longitudinal designs, and including comparison groups. PMID:27491385

  17. Methodology to determine skull bone and brain responses from ballistic helmet-to-head contact loading using experiments and finite element analysis.

    Science.gov (United States)

    Pintar, Frank A; Philippens, Mat M G M; Zhang, JiangYue; Yoganandan, Narayan

    2013-11-01

    The objective of the study was to obtain helmet-to-head contact forces from experiments, use a human head finite element model to determine regional responses, and compare outputs to skull fracture and brain injury thresholds. Tests were conducted using two types of helmets (A and B) fitted to a head-form. Seven load cells were used on the head-form back face to measure helmet-to-head contact forces. Projectiles were fired in frontal, left, right, and rear directions. Three tests were conducted with each helmet in each direction. Individual and summated force- and impulse-histories were obtained. Force-histories were inputted to the human head-helmet finite element model. Pulse durations were approximately 4 ms. One-third force and impulse were from the central load cell. 0.2% strain and 40 MPa stress limits were not exceeded for helmet-A. For helmet-B, strains exceeded in left, right, and rear; pressures exceeded in bilateral directions; volume of elements exceeding 0.2% strains correlated with the central load cell forces. For helmet-A, volumes exceeding brain pressure threshold were: 5-93%. All elements crossed the pressure limit for helmet-B. For both helmets, no brain elements exceeded peak principal strain limit. These findings advance our understanding of skull and brain biomechanics from helmet-head contact forces. Published by Elsevier Ltd.

  18. Determining the Central Atlantic Magmatic Province (CAMPS)'s Role in the Increased Flux of CO2 in the end-Triassic Mass Extinction

    Science.gov (United States)

    Srinivasan, P. S.; Bachan, A.; Stanford School of Earth Sciences Department of Paleobiology

    2011-12-01

    The Central Atlantic Magmatic Province (CAMP) is one of the largest flood basalt provinces known. Its empacement coincided with a period of major plant and animal extinctions-the end-Triassic mass extinction. It is postulated that the release of large amounts of carbon dioxide into the atmosphere from the volcanics was one of the causes of this mass extinction. However,the magnitude of impact on ocean chemistry, and timescales involved remain unclear. To determine CAMP's role in this increased flux of CO2, we studied the geochemistry of samples of rock from the Triassic-Jurassic boundary, in northern Italy. Specifically, by observing the ratios of carbon isotopes 12 and 13 in the organic carbon found in these limestone sedimentary rocks, we could determine the ratio of carbonate to organic burial fluxes globally. We drilled limestone rocks from two different sections in the Southern Alps-- Pozzo Glaciale and Val Adrara. Once they were drilled to a fine powder-like form, we acidified the CaCO3 with HCl to isolate the organic carbon. Then, the organic matter was cleaned to rid the acid, and eventually was placed into tin foil to be placed into the Elemental Analyzer, which determined the percent Carbon in each sample. We tested about 200 samples, and placed them into the Mass Spectrometer machine to determine the isotopic ratios of C12 and C13. According to the data, there was a positive excursion for both sample sets, which means that there was an increase in the amount of C13 in the organic matter. The duration of this excursion was at least a few hundred thousand years. This suggests a protracted increase in the burial flux of organic carbon globally, which is consistent with the hypothesized volcanically driven increase in CO2. This further bolsters the contention that CAMP was responsible, in part, for this mass extinction. By studying the earth's recovery from increased carbon fluxes in the past, we can predict the recovery path that our anthropogenically

  19. Diacylglycerol Kinases Are Widespread in Higher Plants and Display Inducible Gene Expression in Response to Beneficial Elements, Metal, and Metalloid Ions.

    Science.gov (United States)

    Escobar-Sepúlveda, Hugo F; Trejo-Téllez, Libia I; Pérez-Rodríguez, Paulino; Hidalgo-Contreras, Juan V; Gómez-Merino, Fernando C

    2017-01-01

    Diacylglycerol kinases (DGKs) are pivotal signaling enzymes that phosphorylate diacylglycerol (DAG) to yield phosphatidic acid (PA). The biosynthesis of PA from phospholipase D (PLD) and the coupled phospholipase C (PLC)/DGK route is a crucial signaling process in eukaryotic cells. Next to PLD, the PLC/DGK pathway is the second most important generator of PA in response to biotic and abiotic stresses. In eukaryotic cells, DGK, DAG, and PA are implicated in vital processes such as growth, development, and responses to environmental cues. A plethora of DGK isoforms have been identified so far, making this a rather large family of enzymes in plants. Herein we performed a comprehensive phylogenetic analysis of DGK isoforms in model and crop plants in order to gain insight into the evolution of higher plant DGKs. Furthermore, we explored the expression profiling data available in public data bases concerning the regulation of plant DGK genes in response to beneficial elements and other metal and metalloid ions, including silver (Ag), aluminum (Al), arsenic (As), cadmium (Cd), chromium (Cr), mercury (Hg), and sodium (Na). In all plant genomes explored, we were able to find DGK representatives, though in different numbers. The phylogenetic analysis revealed that these enzymes fall into three major clusters, whose distribution depends on the composition of structural domains. The catalytic domain conserves the consensus sequence GXGXXG/A where ATP binds. The expression profiling data demonstrated that DGK genes are rapidly but transiently regulated in response to certain concentrations and time exposures of beneficial elements and other ions in different plant tissues analyzed, suggesting that DGKs may mediate signals triggered by these elements. Though this evidence is conclusive, further signaling cascades that such elements may stimulate during hormesis, involving the phosphoinositide signaling pathway and DGK genes and enzymes, remain to be elucidated.

  20. Nonalcoholic fatty liver disease: Regulation of glucose and fat metabolism in the liver by Carbohydrate Response Element Binding Protein (ChREBP) and impact of dietary influence

    OpenAIRE

    Elkatry, Haiam Omar Mohamed

    2011-01-01

    Deregulationen in der Leberlipidsynthese sind häufig mit Adipositas und Diabetes Typ 2 verbunden und daher ist ein detailliertes Verständnis der beteiligten, regulierenden Stoffwechselwege sehr wichtig, um künftig potentielle therapeutische Targets zu identifizieren. Die Leber ist der wichtigste Ort für den Kohlenhydratstoffwechsel (Glykolyse und Glykogen-Synthese) sowie Triglycerid-Synthese (Lipogenese). Carbohydrate-responsive element-binding protein (ChREBP) wurden in die Regulation durch ...

  1. Pseudohyphal growth is induced in Saccharomyces cerevisiae by a combination of stress and cAMP signalling.

    Science.gov (United States)

    Zaragoza, O; Gancedo, J M

    2000-08-01

    In Saccharomyces cerevisiae pseudohyphae formation may be triggered by nitrogen deprivation and is stimulated by cAMP. It was observed that even in a medium with an adequate nitrogen supply, cAMP can induce pseudohyphal growth when S. cerevisiae uses ethanol as carbon source. This led us to investigate the effects of the carbon source and of a variety of stresses on yeast morphology. Pseudohyphae formation and invasive growth were observed in a rich medium (YP) with poor carbon sources such as lactate or ethanol. External cAMP was required for the morphogenetic transition in one genetic background, but was dispensable in strain sigma 1278b which has been shown to have an overactive Ras2/cAMP pathway. Pseudohyphal growth and invasiveness also took place in YPD plates when the yeast was subjected to different stresses: a mild heat-stress (37 degrees C), an osmotic stress (1 m NACl), or addition of compounds which affect the lipid bilayer organization of the cell membrane (aliphatic alcohols at 2%) or alter the glucan structure of the cell wall (Congo red). We conclude that pseudohyphal growth is a physiological response not only to starvation but also to a stressful environment; it appears to require the coordinate action of a MAP kinase cascade and a cAMP-dependent pathway.

  2. Evaluating the Effectiveness of the General Surgery Intern Boot Camp.

    Science.gov (United States)

    Schoolfield, Clint S; Samra, Navdeep; Kim, Roger H; Shi, Runhua; Zhang, Wayne W; Tan, Tze-Woei

    2016-03-01

    The aim of our study is to evaluate the effectiveness of newly implemented general surgery intern boot camp. A 2-day didactic and skills-based intern boot camp was implemented before the start of clinical duties. Participants who did not attend all boot camp activities and had prior postgraduate training were excluded. A survey utilizing a 5-point Likert scale scoring system was used to assess the participants' confidence to perform intern-level tasks before and after the boot camp. Subgroup analyses were performed comparing changes in confidence among graduates from home institution versus others and general surgery versus other subspecialties. In the analysis, 21 participants over two years were included. Among them, 7 were graduates from home institution (4 general surgery, 3 subspecialty) and 14 were from other institutions (6 general surgery and 8 subspecialty). There were significant increases in overall confidence levels (pre = 2.79 vs post = 3.43, P surgery (2.78 vs 3.46, P = 0.001) and other specialties (2.74 vs 3.34, P surgery intern boot camp before the start of official rotation is effective in improving confidence level in performing level-appropriate tasks of the incoming new interns.

  3. Accumulation of trace elements and growth responses in Corbicula fluminea downstream of a coal-fired power plant.

    Science.gov (United States)

    Peltier, Gretchen Loeffler; Wright, Meredith S; Hopkins, William A; Meyer, Judy L

    2009-07-01

    Lentic organisms exposed to coal-fired power plant (CFPP) discharges can have elevated trace element concentrations in their tissues, but this relationship and its potential consequences are unclear for lotic organisms. To explore these patterns in a lotic environment, we transplanted Corbicula fluminea from a reference stream to a stream receiving CFPP discharge. We assessed trace element accumulation and glutathione concentration in clam tissue, shell growth, and condition index at five sites along a contamination gradient. Clams at the most upstream and contaminated site had the highest growth rate, condition index, glutathione concentrations, and concentrations of arsenic (7.85+/-0.25 microg/g [dry mass]), selenium (17.75+/-0.80 microg/g), and cadmium (7.28+/-0.34 microg/g). Mercury concentrations declined from 4.33+/-0.83 to 0.81+/-0.11 microg/g [dry mass] in clams transplanted into the selenium-rich environment nearest the power plant, but this effect was not as evident at less impacted, downstream sites. Even though dilution of trace elements within modest distances from the power plant reduced bioaccumulation potential in clams, long-term loading of trace elements to downstream depositional regions (e.g., slow moving, silty areas) is likely significant.

  4. Accumulation of trace elements and growth responses in Corbicula fluminea downstream of a coal-fired power plant

    Energy Technology Data Exchange (ETDEWEB)

    Peltier, G.L.; Wright, M.S.; Hopkins, W.A.; Meyer, J.L. [University of Georgia, Athens, GA (United States)

    2009-07-15

    Lentic organisms exposed to coal-fired power plant (CFPP) discharges can have elevated trace element concentrations in their tissues, but this relationship and its potential consequences are unclear for lotic organisms. To explore these patterns in a lotic environment, we transplanted Corbicula fluminea from a reference stream to a stream receiving CFPP discharge. We assessed trace element accumulation and glutathione concentration in clam tissue, shell growth, and condition index at five sites along a contamination gradient. Clams at the most upstream and contaminated site had the highest growth rate, condition index, glutathione concentrations, and concentrations of arsenic (7.85 {+-} 0.25 {mu} g/g (dry mass)), selenium (17.75 {+-} 0.80 {mu} g/g), and cadmium (7.28 {+-} 0.34 {mu} g/g). Mercury concentrations declined from 4.33 {+-} 0.83 to 0.81 {+-} 0.11 {mu} g/g (dry mass) in clams transplanted into the selenium-rich environment nearest the power plant, but this effect was not as evident at less impacted, downstream sites. Even though dilution of trace elements within modest distances from the power plant reduced bioaccumulation potential in clams, long-term loading of trace elements to downstream depositional regions (e.g., slow moving, silty areas) is likely significant.

  5. A Novel Negative Fe-Deficiency-Responsive Element and a TGGCA-Type-Like FeRE Control the Expression of FTR1 in Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Xiaowen Fei

    2010-01-01

    Full Text Available We have reported three Fe-deficiency-responsive elements (FEREs, FOX1, ATX1, and FEA1, all of which are positive regulatory elements in response to iron deficiency in Chlamydomonas reinhardtii. Here we describe FTR1, another iron regulated gene and mutational analysis of its promoter. Our results reveal that the FeREs of FTR1 distinguish itself from other iron response elements by containing both negative and positive regulatory regions. In FTR1, the −291/−236 region from the transcriptional start site is necessary and sufficient for Fe-deficiency-inducible expression. This region contains two positive FeREs with a TGGCA-like core sequence: the FtrFeRE1 (ATGCAGGCT at −287/−279 and the FtrFeRE2 (AAGCGATTGCCAGAGCGC at −253/−236. Furthermore, we identified a novel FERE, FtrFeRE3 (AGTAACTGTTAAGCC localized at −319/−292, which negatively influences the expression of FTR1.

  6. Direct Light-up of cAMP Derivatives in Living Cells by Click Reactions

    Directory of Open Access Journals (Sweden)

    Yan Xu

    2013-10-01

    Full Text Available 8-Azidoadenosine 3′,5′-cyclic monophosphate (8-azido cAMP was directly detected in living cells, by applying Cu-free azide-alkyne cycloaddition to probe cAMP derivatives by fluorescence light-up. Fluorescence emission was generated by two non-fluorescent molecules, 8-azido cAMP as a model target and difluorinated cyclooctyne (DIFO reagent as a probe. The azide-alkyne cycloaddition reaction between 8-azido cAMP and DIFO induces fluorescence in 8-azido cAMP. The fluorescence emission serves as a way to probe 8-azido cAMP in cells.

  7. Preliminary Outcomes from a Week-Long Environmental Engineering Summer Camp for High School Female Students

    Science.gov (United States)

    Balasubramanian, S.; Koloutsou-Vakakis, S.

    2014-12-01

    There is a need for environment engineers and sustainability managers to address global environmental, energy and health challenges. Environmental literacy programs at K-12 level provide a unique opportunity in motivating young minds in joining STEM and also provide additional value in learning about "saving planet earth". The Women in Engineering at the University of Illinois organize an annual week long camp, for female high school students with tracks corresponding to different fields of Engineering. The Environmental Engineering and Sustainability (EES) track is organized by faculty and graduate students of the Civil and Environmental Engineering department and introduces students to concepts in sustainability and systems thinking in connection with air and water quality, climate change and renewable energy. This study is a preliminary assessment of the relevance of the EES outreach track conducted in July 2014 in student learning. Specific goals include assessing (a) demographics of participants and their motivation to join this camp, (b) educational and enjoyability quotients of the modules and (c) learning and motivational outcomes using the Likert scale. A pre-camp survey indicated keen interest in learning about environmental engineering (4.56/5.0) and expected this camp to be a venue to learn about related career choices (4.9/5.0). Five days of instruction were divided thematically and included a mix of lectures, activity based learning, demonstrations and field visits. Overall modules were rated as educational (4.4/5.0) and enjoyable (4.5/5.0). Modules with hands-on learning were best received (4.67/5.0) and rated unique (4.7/5.0). Post camp, participants acknowledged the important contribution of environmental engineers to society (4.8/5.0) and could relate the different modules to the role engineer's play (4.06/5.0) for sustainability. On an average, the participants evinced interest in engineering as a career choice (4.0/5.0) but there was a broader

  8. Correlation between bone mineral density and serum trace elements in response to supervised aerobic training in older adults

    Science.gov (United States)

    Alghadir, Ahmad H; Gabr, Sami A; Al-Eisa, Einas S; Alghadir, Muaz H

    2016-01-01

    Background Life style and physical activity play a pivotal role in prevention and treatment of osteoporosis. The mechanism for better bone metabolism and improvement of physical disorders is not clear yet. Trace minerals such as Ca, Mn, Cu, and Zn are essential precursors for most vital biological process, especially those of bone health. Objective The main target of this study was evaluating the effective role of supervised aerobic exercise for 1 hour/day, 3 days/week for 12 weeks in the functions of trace elements in bone health through measuring bone mineral density (BMD), osteoporosis (T-score), bone markers, and trace element concentrations in healthy subjects aged 30–60 years with age average of 41.2±4.9. Methods A total of 100 healthy subjects (47 males, 53 females; age range 30–60 years) were recruited for this study. Based on dual-energy x-ray absorptiometry (DEXA) scan analysis, the participants were classified into three groups: normal (n=30), osteopenic (n=40), and osteoporotic (n=30). Following, 12 weeks of moderate aerobic exercise, bone-specific alkaline phosphatase (BAP), BMD, T-score, and trace elements such as Ca, Mn, Cu, and Zn were assessed at baseline and post-intervention. Results Significant improvement in serum BAP level, T-score, and BMD were observed in all participants following 12 weeks of moderate exercise. Participants with osteopenia and osteoporosis showed significant increase in serum Ca and Mn, along with decrease in serum Cu and Zn levels following 12 weeks of aerobic training. In control group, the improvements in serum trace elements and body mass index were significantly linked with the enhancement in the levels of BAP, BMD hip, and BMD spine. These results supported the preventive effects of moderate exercise in healthy subjects against osteoporosis. In both sexes, the changes in serum trace elements significantly correlated (Ptrace elements which are involved in the biosynthesis of bone matrix structures and inhibition

  9. Cyclic 3',5'-adenosine monophosphate (cAMP) signaling in the anterior pituitary gland in health and disease.

    Science.gov (United States)

    Hernández-Ramírez, Laura C; Trivellin, Giampaolo; Stratakis, Constantine A

    2017-08-16

    The cyclic 3',5'-adenosine monophosphate (cAMP) was the first among the so-called "second messengers" to be described. It is conserved in most organisms and functions as a signal transducer by mediating the intracellular effects of multiple hormones and neurotransmitters. In this review, we first delineate how different members of the cAMP pathway ensure its correct compartmentalization and activity, mediate the terminal intracellular effects, and allow the crosstalk with other signaling pathways. We then focus on the pituitary gland, where cAMP exerts a crucial function by controlling the responsiveness of the cells to hypothalamic hormones, neurotransmitters and peripheral factors. We discuss the most relevant physiological functions mediated by cAMP in the different pituitary cell types, and summarize the defects affecting this pathway that have been reported in the literature. We finally discuss how a deregulated cAMP pathway is involved in the pathogenesis of pituitary disorders and how it affects the response to therapy. Copyright © 2017. Published by Elsevier B.V.

  10. GIS IN EDUCATION: ESRI SUMMER CAMP FOR SECONDARY SCHOOLS

    Directory of Open Access Journals (Sweden)

    Maxime Rwaka

    2014-01-01

    Full Text Available Since 2007, Esri is supporting GIS education in Secondary Schools. From 2009 until today, 2000 pupils have learned GIS but they do not have time and means to link what they learn at school to the reality on the ground. It is therefore difficult for them to plan for a career in the GIS field. It is in that perspective that Esri has organized Summer Camps each year since 2008 with the objective of connecting pupils with GIS professionals by doing a real GIS project and achieve results that are beneficial for both students and professionals from partner institutions. The Summer Camp last for one week, during which pupils collect geographic and attribute data with GPS and questionnaires, prepare, edit, analyse and visualize collected data using GIS. They finally learn how to present and publish the result. This presentation will give an overview of topics, results and benefit of Summer Camps carried out for the last 6 years.

  11. Investigation of Sylvatic Typhus at a Wilderness Camp

    Centers for Disease Control (CDC) Podcasts

    2009-06-30

    In this podcast, Dr. Greg Dasch discusses an outbreak of four cases of sylvatic typhus that occurred at a wilderness camp in Pennsylvania. Sylvatic typhus is very rare in the United States, with only 41 cases since it was discovered in the United States in 1975. Lab work at CDC and the discovery that all four camp counselors who became ill had slept in the same bunk at the camp between 2004 and 2006 ultimately led to confirmation that flying squirrels living in the wall of the cabin were to blame for the illnesses.  Created: 6/30/2009 by Emerging Infectious Diseases.   Date Released: 6/30/2009.

  12. Camp jump start: effects of a residential summer weight-loss camp for older children and adolescents.

    Science.gov (United States)

    Huelsing, Jean; Kanafani, Nadim; Mao, Jingnan; White, Neil H

    2010-04-01

    Residential weight-loss camps offer an opportunity for overweight and obese children to lose weight in a medically safe, supervised, supportive environment. The purpose of this report is to describe short-term outcomes in 76 children participating in a 4- or 8-week residential weight-loss camp for children and adolescents. The camp program enrolled obese 10- to 18-year-old adolescents. The program consisted of structured and nonstructured physical activities and group educational sessions covering nutrition, physical fitness, and self-esteem. A diet plan of 3 balanced meals and 2 snacks per day was prepared under the supervision of a registered dietitian. Participants had height, weight, and blood pressure measured and performed a 1-mile run at maximum effort on an outdoor track. For all campers, statistically significant (P camps are highly effective in improving measures of health and fitness among overweight and obese children and adolescents. Additional study is needed on the long-term effects of such camps in terms of weight maintenance, behavior change, and metabolic and health outcomes.

  13. Advances in Pediatric Cardiology Boot Camp: Boot Camp Training Promotes Fellowship Readiness and Enables Retention of Knowledge.

    Science.gov (United States)

    Ceresnak, Scott R; Axelrod, David M; Sacks, Loren D; Motonaga, Kara S; Johnson, Emily R; Krawczeski, Catherine D

    2017-03-01

    We previously demonstrated that a pediatric cardiology boot camp can improve knowledge acquisition and decrease anxiety for trainees. We sought to determine if boot camp participants entered fellowship with a knowledge advantage over fellows who did not attend and if there was moderate-term retention of that knowledge. A 2-day training program was provided for incoming pediatric cardiology fellows from eight fellowship programs in April 2016. Hands-on, immersive experiences and simulations were provided in all major areas of pediatric cardiology. Knowledge-based examinations were completed by each participant prior to boot camp (PRE), immediately post-training (POST), and prior to the start of fellowship in June 2016 (F/U). A control group of fellows who did not attend boot camp also completed an examination prior to fellowship (CTRL). Comparisons of scores were made for individual participants and between participants and controls. A total of 16 participants and 16 control subjects were included. Baseline exam scores were similar between participants and controls (PRE 47 ± 11% vs. CTRL 52 ± 10%; p = 0.22). Participants' knowledge improved with boot camp training (PRE 47 ± 11% vs. POST 70 ± 8%; p cardiology knowledge after the training program and had excellent moderate-term retention of that knowledge. Participants began fellowship with a larger fund of knowledge than those fellows who did not attend.

  14. The role of concentration camps in the policies of the independent state of Croatia (NDH) in 1941

    National Research Council Canada - National Science Library

    Koljanin Milan

    2015-01-01

    .... After the outbreak of a mass Serb uprising and the dissolution of the Gospić camp, a new and much larger system of camps centred at Jasenovac operated as an extermination and concentration camp from the end of August...

  15. Hydrogen sulfide inhibits A2A adenosine receptor agonist induced β-amyloid production in SH-SY5Y neuroblastoma cells via a cAMP dependent pathway.

    Directory of Open Access Journals (Sweden)

    Bhushan Vijay Nagpure

    Full Text Available Alzheimer's disease (AD is the leading cause of senile dementia in today's society. Its debilitating symptoms are manifested by disturbances in many important brain functions, which are influenced by adenosine. Hence, adenosinergic system is considered as a potential therapeutic target in AD treatment. In the present study, we found that sodium hydrosulfide (NaHS, an H2S donor, 100 µM attenuated HENECA (a selective A2A receptor agonist, 10-200 nM induced β-amyloid (1-42 (Aβ42 production in SH-SY5Y cells. NaHS also interfered with HENECA-stimulated production and post-translational modification of amyloid precursor protein (APP by inhibiting its maturation. Measurement of the C-terminal APP fragments generated from its enzymatic cleavage by β-site amyloid precursor protein cleaving enzyme 1 (BACE1 showed that NaHS did not have any significant effect on β-secretase activity. However, the direct measurements of HENECA-elevated γ-secretase activity and mRNA expressions of presenilins suggested that the suppression of Aβ42 production in NaHS pretreated cells was mediated by inhibiting γ-secretase. NaHS induced reductions were accompanied by similar decreases in intracellular cAMP levels and phosphorylation of cAMP responsive element binding protein (CREB. NaHS significantly reduced the elevated cAMP and Aβ42 production caused by forskolin (an adenylyl cyclase, AC agonist alone or forskolin in combination with IBMX (a phosphodiesterase inhibitor, but had no effect on those caused by IBMX alone. Moreover, pretreatment with NaHS significantly attenuated HENECA-elevated AC activity and mRNA expressions of various AC isoforms. These data suggest that NaHS may preferentially suppress AC activity when it was stimulated. In conclusion, H2S attenuated HENECA induced Aβ42 production in SH-SY5Y neuroblastoma cells through inhibiting γ-secretase via a cAMP dependent pathway.

  16. Transcriptional activation of the human ucp1 gene in a rodent cell line. Synergism of retinoids, isoproterenol, and thiazolidinedione is mediated by a multipartite response element.

    Science.gov (United States)

    del Mar Gonzalez-Barroso, M; Pecqueur, C; Gelly, C; Sanchis, D; Alves-Guerra, M C; Bouillaud, F; Ricquier, D; Cassard-Doulcier, A M

    2000-10-13

    Uncoupling protein 1 (UCP1) is uniquely expressed in brown adipocytes and generates heat production by uncoupling respiration from ATP synthesis. The activatory effects of norepinephrine and retinoic acid (RA) on rodent ucp1 gene transcription have been well characterized. These effects are mediated by a 211-base pair (bp) enhancer which is also sufficient to restrict expression to brown adipose tissue. The molecular mechanisms controlling the transcription of the human ucp1 gene are unknown. In order to study the transcriptional regulation of the human gene, we set up chloramphenicol acetyltransferase constructs containing the entire or deleted 5' regions upstream of the transcriptional start site of the gene. These constructs were transiently transfected in a mouse cell line. A 350-bp hormone response region showing a significant homology with the rat ucp1 enhancer and located between the BclI polymorphic site and an AatII site (bp -3820/-3470) was detected. This region was sufficient to mediate the stimulation by RA and by combined treatments (RA + isoproterenol (ISO), RA + thiazolidinedione (TZD), or RA + ISO + TZD). The highest stimulation, a 26-fold increase in basal activity, was obtained by RA + ISO + TZD treatment. In contrast to the rodent gene, under our conditions, the effect of ISO and/or TZD is dependent on RA stimulation. Analysis of 105 bp inside the 350-bp element by site-directed mutagenesis and gel retardation experiments demonstrated that a multipartite response element mediates the drug stimulation. This region binds RARs and RXRs nuclear factors, CREB/ATF factors, and also PPARgamma despite the absence of a consensus peroxisome-proliferator response element. The activation of the human ucp1 gene transcription by certain hormones or drugs, and the identification of the cis-elements involved, will help to identify new compounds activating fat oxidation and energy expenditure in humans.

  17. Physiological and Molecular Effects of the Cyclic Nucleotides cAMP and cGMP on Arabidopsis thaliana

    KAUST Repository

    Herrera, Natalia M.

    2012-12-01

    The cyclic nucleotide monophosphates (CNs), cAMP and cGMP, are second messengers that participate in the regulation of development, metabolism and adaptive responses. In plants, CNs are associated with the control of pathogen responses, pollen tube orientation, abiotic stress response, membrane transport regulation, stomatal movement and light perception. In this study, we hypothesize that cAMP and cGMP promote changes in the transcription level of genes related to photosynthesis, high light and membrane transport in Arabidopsis thaliana leaves and, that these changes at the molecular level can have functional biological consequences. For this reason we tested if CNs modulate the photosynthetic rate, responses to high light and root ion transport. Real time quantitative PCR was used to assess transcription levels of selected genes and infrared gas analyzers coupled to fluorescence sensors were used to measure the photosynthetic parameters. We present evidence that both cAMP and cGMP modulate foliar mRNA levels early after stimulation. The two CNs trigger different responses indicating that the signals have specificity. A comparison of proteomic and transcriptional changes suggest that both transcriptional and post-transcriptional mechanisms are modulated by CNs. cGMP up-regulates the mRNA levels of components of the photosynthesis and carbon metabolism. However, neither cAMP nor cGMP trigger differences in the rate of carbon assimilation, maximum efficiency of the photosystem II (PSII), or PSII operating efficiency. It was also demonstrated that CN regulate the expression of its own targets, the cyclic nucleotide gated channels - CNGC. Further studies are needed to identify the components of the signaling transduction pathway that mediate cellular changes and their respective regulatory and/or signaling roles.

  18. Differential regulation of GPR54 transcription by specificity protein-1 and partial estrogen response element in mouse pituitary cells

    OpenAIRE

    DeFino, Mia C.; Wacker, Jennifer L.; Lyssand, John S.; Wang, Edith H.; Hague, Chris

    2010-01-01

    Precise spatial and temporal expression of the recently identified G-protein coupled receptor GPR54 is critical for proper reproductive function and metastasis suppression. However, regulatory factors that control GPR54 expression remain unknown. Thus, the identification of these cis-acting DNA elements can provide insight into the role of GPR54 in reproduction and cancer. Using luciferase reporter, electrophoretic mobility shift, and chromatin immunoprecipitation assays, we demonstrate that ...

  19. Healthcare needs of displaced women: Osire refugee camp, Namibia.

    Science.gov (United States)

    Pinehas, Lusia N; van Wyk, Neltjie C; Leech, Ronell

    2016-03-01

    The aim of this study was to explore and describe the experiences of healthcare needs of displaced women in the Osire refugee camp in Namibia. Namibia is a country where displaced people from other African countries seek refuge as a result of their own country's political instability. All displaced people are hosted in the Osire camp, which is a highly protected area. There are more women than men in the camp and their health is often compromised. In this descriptive phenomenological study, the natural dimension of the experiences of the participants of their healthcare needs were explored through in-depth interviews and reflected upon through transcendental processes to formulate the phenomenological dimension thereof. The essence of displaced women's healthcare needs was "the need for the restoration of hope and human dignity". Their needs refer to measures to enhance their autonomy and freedom; skills training; certainty about their future; security with aid distribution; protection against stigmatization due to human immunodeficiency virus (HIV) infection; protection against abuse; and participation in reproductive health care. When displaced women are admitted in a camp they lose their freedom to make decisions about everyday functioning and future. They thus develop feelings of insecurity and vulnerability. The participants referred to several factors that were detrimental for their well-being. The essence of their needs was "the need for the restoration of hope and human dignity" that could only be achieved when their needs are addressed. As nurses are in close contact with displaced women in refugee camps they should negotiate opportunities for the women to discuss their concerns with the camp officials. Policies should make provision for the involvement of displaced people in all aspects that relate to their everyday and future living arrangements. © 2016 International Council of Nurses.

  20. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.