WorldWideScience

Sample records for californium 246 target

  1. Metabolism and toxicity of californium

    International Nuclear Information System (INIS)

    Metabolism of californium can be compared with that of other transplutonium elements. The most important points are as follows: a fast blood clearance and fast bone uptake more important than liver uptake, a relatively high urinary excretion and kidney retention. Blood clearance of californium can be compared with that of americium. Distribution of californium 252 nitrate after intramuscular injection in rats was studied. There are very few experimental data on acute or long term toxicity of californium. (28 references)

  2. Magnetism in californium

    International Nuclear Information System (INIS)

    A SQUID-based magnetic susceptometer has been constructed for studying small radioactive samples at temperatures below 350 K and in magnetic fields up to 50 kilogauss. The device has been used to study californium (element 98) in a number of solid-state forms: the dhcp metal, several oxides (Cf2O3 in both the bcc and monoclinic structures, Cf7O12, CfO2 and BaCfO3), several monopnictides (CfN, CfAs and CfSb) and the trichloride (in both the hexagonal and orthorhombic structures). All of these materials were studied in polycrystalline form, and hexagonal CfCl3 was studied in single-crystal form as well. The susceptometer has the sensitivity to measure samples containing less than 10 micrograms of californium. The magnetic susceptibilities of all of the californium materials at temperatures above about 100 K are described well by the Curie-Weiss relationship. This behavior is consistent with the assumption that the magnetic 5f electrons are localized and that the paramagnetic behavior can be interpreted in terms of the properties of the free ion. The measured values of the effective paramagnetic moment, μ/sub eff/, for all the californium materials that were studied are reasonably consistent with theoretical values based on intermediate coupling models. All of the californium materials showed some indications of cooperative magnetic effects. The dhcp metal was observed to order ferromagnetically at 52 K, and all of the californium compounds studied showed signs of antiferromagnetic ordering, mostly at temperatures below 25 K. 91 refs., 50 figs., 19 tabs

  3. Californium Multiplier (CFX)

    International Nuclear Information System (INIS)

    The availability of 252Cf as an economical high-intensity neutron source has made it possible to construct compact neutron irradiation devices with widespread applications. The simplest such device consists of a single 252Cf source within a moderating and shielding medium. Higher neutron flux levels can be attained either through the use of more 252Cf or through source multiplication by means of a subcritical uranium assembly. Although the use of larger 252Cf sources to achieve higher neutron flux is technically straightforward, an economic penalty is paid as the source strength is increased. Larger californium sources imply larger initial investments to cover the cost of source material and larger operating costs resulting from the decay of the 252Cf source. A Californium Multiplier, the CFX, which produces a flux enhancement of 30 when compared to a conventional moderated 252Cf system has been designed, licensed, built, and tested by IRT Corporation. Such systems are now available on a commercial basis for both neutron radiography and neutron activation analysis. The first commercial CFX system was installed at the Research Laboratories of Eastman Kodak Company in Rochester, NY, in March 1975. This device, using 1 mg of 252Cf, is very stable and the neutron flux generated by the CFX is very reproducible. The performance characteristics of this system are summarized

  4. Californium--palladium metal neutron source material

    Science.gov (United States)

    Dahlen, B.L.; Mosly, W.C. Jr.; Smith, P.K.; Albenesius, E.L.

    1974-01-22

    Californium, as metal or oxide, is uniformly dispersed throughout a noble metal matrix, provided in compact, rod or wire form. A solution of californium values is added to palladium metal powder, dried, blended and pressed into a compact having a uni-form distribution of californium. The californium values are decomposed to californium oxide or metal by heating in an inert or reducing atmosphere. Sintering the compact to a high density closes the matrix around the dispersed californium. The sintered compact is then mechanically shaped into an elongated rod or wire form. (4 claims, no drawings) (Official Gazette)

  5. Californium Electrodepositions at Oak Ridge National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Boll, Rose Ann [ORNL

    2015-01-01

    Electrodepositions of californium isotopes were successfully performed at Oak Ridge National Laboratory (ORNL) during the past year involving two different types of deposition solutions, ammonium acetate (NH4C2H3O2) and isobutanol ((CH3)2CHCH2OH). A californium product that was decay enriched in 251Cf was recovered for use in super-heavy element (SHE) research. This neutron-rich isotope, 251Cf, provides target material for SHE research for the potential discovery of heavier isotopes of Z=118. The californium material was recovered from aged 252Cf neutron sources in storage at ORNL. These sources have decayed for over 30 years, thus providing material with a very high 251Cf-to-252Cf ratio. After the source capsules were opened, the californium was purified and then electrodeposited using the isobutanol method onto thin titanium foils for use in an accelerator at the Joint Institute for Nuclear Research in Dubna, Russia. Another deposition method, ammonium acetate, was used to produce a deposition containing 1.7 0.1 Ci of 252Cf onto a stainless steel substrate. This was the largest single electrodeposition of 252Cf ever prepared. The 252Cf material was initially purified using traditional ion exchange media, such as AG50-AHIB and AG50-HCl, and further purified using a TEVA-NH4SCN system to remove any lanthanides, resulting in the recovery of 3.6 0.1 mg of purified 252Cf. The ammonium acetate deposition was run with a current of 1.0 amp, resulting in a 91.5% deposition yield. Purification and handling of the highly radioactive californium material created additional challenges in the production of these sources.

  6. Californium-252 Neutron Sources for Medical Applications

    International Nuclear Information System (INIS)

    Californium-252 neutron sources are being prepared to investigate the value of this radionuclide in diagnosing and treating diseases. A source resembling a cell-loaded radium needle was developed for neutron therapy. Since therapy needles are normally implanted in the body, very conservative design criteria were established to prevent leakage of radioactive. Methods are being developed to prepare very intense californium sources that could be used eventually for neutron radiography and for diagnosis by neutron activation analysis. This paper discusses these methods

  7. Historical review of californium-252 discovery and development

    International Nuclear Information System (INIS)

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

  8. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.

    1995-10-10

    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  9. Californium-252: a remarkable versatile radioisotope

    International Nuclear Information System (INIS)

    A product of the nuclear age, Californium-252 (252Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252Cf from ORNL is summarized herein

  10. Californium-252 Neutron Therapy in China

    International Nuclear Information System (INIS)

    Californium-252 brachytherapy, believed to be the most successful source for neutron therapy, gives most of the cures as well as long-term and complication-free survivals. Chinese radiation oncologists were interested in californium neutron therapy (Cf-NT) in the early 1980s, but 252Cf sources for medical use were not available in China until 1992 when a californium joint venture was established by the China Institute of Atomic Energy (Beijing) and the Research Institute for Nuclear Reactors (Dimitrovgrad) of Russia. In 1995, 25 seeds of 252Cf with a strength of 3 μg each were sent to China for preclinical investigation. Three years later, a high dose rate (HDR) 252Cf source was imported and transferred into a home-made remote after-loader for intracavitary treatment in Chongqing, and a clinical trail was started in February 1999. This is the first time that Cf-NT was performed for cancer patients in China. Since then, Cf-NT in China has developed rapidly. It is estimated that one-tenth of those radiation oncology centers with brachytherapy practice will be equipped with californium units in 5 yr. That means more than 30 units will be in use in hospitals. That is significant compared with other countries, but it is just one, on average, for each province or one per 40 million people in China. Progress also has been achieved in the 252Cf treatment delivery equipment. Preliminary clinical trails showed complete response observed in all cases treated, with a rapid clearance of tumors and mild reactions in normal tissues. The short-term results are quite encouraging. To deal with problems due to the demand for Cf-NT in China, attention should be paid to the following particulars: (1) A high-strength miniature source is needed for HDR/MDR interstitial therapy to extend the Cf-NT coverage. (2) Basic work on radiophysics and radiobiology needs to be done, including source calibration, clinical dosimetry, clinical RBE determination, and Cf-NT quality assurance

  11. Californium-252 sales and loans at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    The production and distribution in the United States of 252Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252Cf Industrial Sales/Loan Program and the 252Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point

  12. Californium-252 encapsulation at the Savannah River Laboratory

    International Nuclear Information System (INIS)

    More than 1 g of the neutron-emitting isotope californium-252 has been encapsulated at SRL for worldwide medical, industrial, and research uses. Bulk sales packages have been prepared for the USDOE sales program since 1971. Doubly-encapsulated sources have been prepared for USDOE's market evaluation program since 1968. Californium-252 sources for loan and sales packages satisfy the criteria for Special Form Radioactive Material. Encapsulation is performed in special neutron-shielded containment facilities at SRL. Development of improved source and shipping package designs and processes is continuing. 17 figures

  13. Production, distribution and applications of californium-252 neutron sources

    International Nuclear Information System (INIS)

    The radioisotope 252Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-yr half-life. A source the size of a person's little finger can emit up to 1011 neutrons s-1. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement and minerals, as well as for detection and identification of explosives, land mines and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 yr of experience and by US Bureau of Mines tests of source survivability during explosions. The production and distribution center for the US Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252Cf to commercial reencapsulators domestically and internationally. Sealed 252Cf sources are also available for loan to agencies and subcontractors of the US government and to universities for educational, research and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments and irradiation of rice to induce genetic mutations

  14. Production, distribution and applications of californium-252 neutron sources.

    Science.gov (United States)

    Martin, R C; Knauer, J B; Balo, P A

    2000-01-01

    The radioisotope 252Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-yr half-life. A source the size of a person's little finger can emit up to 10(11) neutrons s(-1). Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement and minerals, as well as for detection and identification of explosives, land mines and unexploded military ordinance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 yr of experience and by US Bureau of Mines tests of source survivability during explosions. The production and distribution center for the US Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252Cf to commercial reencapsulators domestically and internationally. Sealed 252Cf sources are also available for loan to agencies and subcontractors of the US government and to universities for educational, research and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments and irradiation of rice to induce genetic mutations. PMID:11003521

  15. Production, Distribution, and Applications of Californium-252 Neutron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.

    1999-10-03

    The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10{sup 11} neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6- year half-life. A source the size of a person's little finger can emit up to 10 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory(ORNL). DOE sells {sup 252}Cf to commercial

  16. Anti-leukaemic effects induced by APR-246 are dependent on induction of oxidative stress and the NFE2L2/HMOX1 axis that can be targeted by PI3K and mTOR inhibitors in acute myeloid leukaemia cells.

    Science.gov (United States)

    Ali, Dina; Mohammad, Dara K; Mujahed, Huthayfa; Jonson-Videsäter, Kerstin; Nore, Beston; Paul, Christer; Lehmann, Sören

    2016-07-01

    The small molecule APR-246 (PRIMA-1(MET) ) is a novel drug that restores the activity of mutated and unfolded TP53 protein. However, the mechanisms of action and potential off-target effects are not fully understood. Gene expression profiling in TP53 mutant KMB3 acute myeloid leukaemia (AML) cells showed that genes which protected cells from oxidative stress to be the most up-regulated. APR-246 exposure also induced reactive oxygen species (ROS) formation and depleted glutathione in AML cells. The genes most up-regulated by APR-246, confirmed by quantitative real time polymerase chain reaction, were heme oxygenase-1 (HMOX1, also termed HO-1), SLC7A11 and RIT1. Up-regulation of HMOX1, a key regulator of cellular response to ROS, was independent of TP53 mutational status. NFE2L2 (also termed Nrf2), a master regulator of HMOX1 expression, showed transcriptional up-regulation and nuclear translocation by APR-246. Down-regulation of NFE2L2 by siRNA in AML cells significantly increased the antitumoural effects of APR-246. The PI3K inhibitor wortmannin and the mTOR inhibitor rapamycin inhibited APR-246-induced nuclear translocation of NFE2L2 and counteracted the protective cellular responses to APR-246, resulting in synergistic cell killing together with APR-246. In conclusion, ROS induction is important for antileukaemic activities of APR-246 and inhibiting the protective response of the Nrf-2/HMOX1 axis using PI3K inhibitors, enhances the antileukaemic effects. PMID:26991755

  17. Design, construction, and characterization of a facility for neutron capture gamma ray analysis of sulfur in coal using californium-252

    International Nuclear Information System (INIS)

    A study of neutron capture gamma ray analysis of sulfur in coal using californium-252 as a neutron source is reported. Both internal and external target geometries are investigated. The facility designed for and used in this study is described. The external target geometry is found to be inappropriate because of the low thermal neutron flux at the sample location, which must be outside the biological shielding. The internal target geometry is found to have a sufficient thermal neutron flux, but an excessive gamma ray background. A water filled plastic facility, rather than the paraffin filled steel one used in this study, is suggested as a means of increasing flexibility and decreasing the beackground in the internal target geometry

  18. Production of extra pure curium and californium preparations

    International Nuclear Information System (INIS)

    Preparations of curium-244,245,248 and californium-249,252 are used for the production of ionizing radiation sources for different applications and fundamental nuclear-physical investigations, placing high requirements on the radiochemical and chemical purity of the preparations. Extraction chromatography using di-(2-ethylhexyl)phosphoric acid (D2EHPA) as extractant was chosen to prepare extra pure curium and californium preparations. In order to identify the optimal conditions of Cm-Cf separation and to remove impurities from them (reagent and other impurities), investigations were performed into the effect of impurities (Na+, Ca2+, Al3+, Fe2+, Fe3+ taken as example), extractant and eluent concentration and solution flow rate on the efficiency of mutual purification of Cm and Cf. Both theoretical and experimental estimations were made of the maximum concentration at which the impurities do not affect the process. The conditions chosen allow mutual purification of milligram amounts of Cm and Cf from impurity elements at E(pur) =102 - 103 during a single chromatographic cycle (E(pur) =>103) using a column with 5 - 10 cm3 volume. In this case the production yield exceeds 98%. The purification of milligram amounts of curium and californium from fission products (lanthanides in general, cerium in particular) was performed in D2EHPA-decane-PbO2-HNO3 and D2EHPA-decane-DTPA-H3-Cit extraction chromatography systems. In order to establish the optimal conditions, the effect of [D2EHPA] and eluent on the mutual purification of Cm and Cf and on their purification from cerium and impurity elements was studied in the D2EHPA-decane-PbO2-HNO3 system. During a single chromatographic cycle the mutual purification factors of TPE and of their purification from impurity cations achieve 102-103, from cerium - E(pur) > 10. In the D2EHPA-decane-DTPA-H3Cit system, the effect of concentration of extractant and eluent pH on the efficiency of Cm and Cf purification from lanthanides was

  19. Prompt neutron spectrum of the spontaneous fission of californium-252

    International Nuclear Information System (INIS)

    The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references

  20. Separation of californium from actinides and lanthanides in aqueous solution by electrochemical formation of amalgams

    International Nuclear Information System (INIS)

    The electrochemical reduction of transneptunium elements (Pu to Cf) and rare earths (Eu, Tm) from aqueous complexing solutions to amalgams was studied over a wide range of cathodic potentials in order to achieve optimal separation of californium. The reduction in acetate media (pH 4.5-4.6) at potentials around -1.7 to -1.9 V1 leads to a quantitative extraction of californium into the mercury phase, while more negative potentials are required for the reduction of the lighter transuranium elements and of the lanthanides. Hence, the optimal conditions for the separation of californium from the investigated actinides and lanthanides were determined. Separation factors α between 25 and 90 were found except in the case of Cf/Eu, where poor values (α varying from 7 to 12) were observed. More negative cathodic potentials decrease the selectivity of the reduction process. A similar study with lithium citrate solutions (pH ∝6) shows that satisfactory separation of californium from lighter and heavier actinides is achievable. A separation factor of 88 is obtained for Cf/Am at -1.98 V. The anodic stripping of mixed amalgams (Pu, Am, Cm, Bk, Tm and Cf) Hg in nitric and acetic acid soultions at potentials ranging from +0.1 to -0.7 V proceeds slowly and proved to be ineffective for the separation of californium from light actinides under conditions described. (orig.)

  1. On-line slurry analyses by californium-252

    International Nuclear Information System (INIS)

    In chemical processing technology on-line activation methods gain an increasing importance for process monitoring and control. A method is described according to which the different fluorspar contents at various strategic points of a flotation plant are determined through neutron activation by 100 μg californium-252. A continuous analytical system for onstream process control of slurries was designed and constructed. A compact facility, called SUSAC, allows continuous application of the method on an industrial scale. The main components of the SUSAC facility are the irradiation and measurement cells. The cells are equipped with multistage countercurrent stirrers ensuring a proper radial and vertical distribution of the sample. The hollow shaft of the stirrer of the irradiation cell houses the Cf-source. The NaI-detector has been installed in a recess in the bottom of the measuring cell. The volumes are 9 dm3 for the irradiation cell, 7.5 dm3 for the measuring cell, 1/2 dm3 for the vonnection line and 4 dm3 for feed and drainage lines including the pump. Investigations on the following topics are discussed: selection of stirrers, residence time, flow rate, pulp density, calibration measurements. (T.G.)

  2. Biomedical neutron research at the Californium User Facility for neutron science

    International Nuclear Information System (INIS)

    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252Cf sources. Three projects at the CUF that demonstrate the versatility of 252Cf for biological and biomedical neutron-based research are described: future establishment of a 252Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy

  3. Biomedical neutron research at the Californium User Facility for neutron science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R.C. [Oak Ridge National Lab., TN (United States); Byrne, T.E. [Roane State Community College, Harriman, TN (United States); Miller, L.F. [Univ. of Tennessee, Knoxville, TN (United States)

    1997-04-01

    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact {sup 252}Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with {sup 252}Cf sources. Three projects at the CUF that demonstrate the versatility of {sup 252}Cf for biological and biomedical neutron-based research are described: future establishment of a {sup 252}Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded {sup 252}Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy.

  4. Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252Cf neutron source for university and research loans. Within the CF, the 252Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests

  5. Emergence of californium as the second transitional element in the actinide series.

    Science.gov (United States)

    Cary, Samantha K; Vasiliu, Monica; Baumbach, Ryan E; Stritzinger, Jared T; Green, Thomas D; Diefenbach, Kariem; Cross, Justin N; Knappenberger, Kenneth L; Liu, Guokui; Silver, Mark A; DePrince, A Eugene; Polinski, Matthew J; Van Cleve, Shelley M; House, Jane H; Kikugawa, Naoki; Gallagher, Andrew; Arico, Alexandra A; Dixon, David A; Albrecht-Schmitt, Thomas E

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resultant complex with respect to that predicted for the free ion. We expand on this by characterizing the americium and curium analogues for comparison, and show that these pronounced effects result from a second transition in periodicity in the actinide series that occurs, in part, because of the stabilization of the divalent oxidation state. The metastability of californium(II) is responsible for many of the unusual properties of californium including the green photoluminescence. PMID:25880116

  6. Fissile analysis of Hanford waste using Californium Multiplier/Delayed Neutron Counter system

    International Nuclear Information System (INIS)

    Measurement of low-level (10 ng/g or lower) fissile material (mainly plutonium) in Hanford waste and process samples is becoming increasingly important. A system has been designed consisting of a Californium Multiplier (CFX) and a Delayed Neutron Counter (DNC) to characterize these samples. This report describes hardware and analytical capability of the CFX/DNC system

  7. Study of the shielding for spontaneous fission sources of Californium-252

    International Nuclear Information System (INIS)

    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  8. 48 CFR 2453.246 - Quality Assurance.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Quality Assurance. 2453.246 Section 2453.246 Federal Acquisition Regulations System DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT CLAUSES AND FORMS FORMS Prescription of Forms 2453.246 Quality Assurance....

  9. 32 CFR 246.5 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 246.5 Section 246.5 National... STARS AND STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS § 246.5 Responsibilities. (a) The Assistant to the Secretary of Defense (Public Affairs), under 32 CFR part 375, as the principal staff assistant...

  10. 42 CFR 431.246 - Corrective action.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Corrective action. 431.246 Section 431.246 Public... Recipients Procedures § 431.246 Corrective action. The agency must promptly make corrective payments, retroactive to the date an incorrect action was taken, and, if appropriate, provide for admission...

  11. 7 CFR 246.11 - Nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nutrition education. 246.11 Section 246.11 Agriculture... Participant Benefits § 246.11 Nutrition education. (a) General. (1) Nutrition education shall be considered a benefit of the Program, and shall be made available at no cost to the participant. Nutrition...

  12. Californium (252Cf) and its use as neutron source in science medicine and technology

    International Nuclear Information System (INIS)

    The application of radionuclides in science and nuclear techniques basically is related to unstable isotopes, which are produced from stable elements in nuclear reactor. Their specifications are various from view point of application . Using of physical and chemical properties of radionuclides in chemistry, for with marking the organic compounds we can exactly explain the mechanism of chemical reactions in medical, biology and bio-chemistry. In these cases the behaviour of radionuclides is very important and the selection of the suitable radionuclides is determined between the elements for investigation aims. The special specification of radio-nuclides analysis such as, half-life, kind of ray and energy should be considered with an special accuracy as well as the laws security regulations from view point of ray-protection should be completely observed mean time working these radio-nuclides. It should be considered that application of radio-isotopes is very important from their special specifications point of view. Applying the radionuclides from technology point of view in sciences and nuclear techniques aren't only limited to three analyses of α, β, and γ, but we can use the share of neutron which are produced from spli ting of heavy nucleus such as Californium252 as a neutron source in the depths of the sea and also determining the concentration of low quantity elements on moon and other spheres. The radioisotope of Californium252 is a neutron useful radiator for investigation in nuclear medical and technology because of automatically rapid split to 3.2% Californium252 radiates 1.34 * 109N/m in each mil/GH which suitable replacement for neutron sources based on (a, n) reaction, for example, Radium-Brellium or Amersium-Brellium. The energy distribution of radiated neutrons from analyzing of Californium252 like the spectrum of neutron which is produced from splitting of U235, Pu239 nucleus has the maximum energy in quantity, En=1 MeV in the range of 1.5 MeV. The

  13. Contribution to clinical dosimetry of californium 252 sources used at Gustave Roussy institute

    International Nuclear Information System (INIS)

    The main characteristics of californium 252 sources are presented in the first part of the report. Dose measurements around Californium sources were performed with a pair of ionization multiplication chambers: the first one has an Aluminium wall and is filled with Argon, the second one a plastic tissue-equivalent gas. A set of experiments was performed in order to investigate the relative influence of beta rays on the response of both chambers. Besides the experimental work a computer program was written to calculate the dose distribution around the actual sources made of a series of small active sources placed in catheters. Theoretical data around small sources can be found in the litterature. The comparison between experimental results and theoretical ones has shown a good agreement. The computer program will be included as a sub-routine in the more general computer program used for patients treated with interstitial therapy

  14. Safety Analysis Report for Packaging (SARP) of the Oak Ridge National Laboratory TRU Californium Shipping Container

    International Nuclear Information System (INIS)

    An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations

  15. Emergence of californium as the second transitional element in the actinide series

    OpenAIRE

    Cary, Samantha K.; Vasiliu, Monica; Baumbach, Ryan E.; Stritzinger, Jared T.; GREEN, THOMAS D.; Diefenbach, Kariem; Cross, Justin N.; Knappenberger, Kenneth L.; Liu, Guokui; Silver, Mark A.; DePrince, A. Eugene; Polinski, Matthew J.; Van Cleve, Shelley M.; House, Jane H.; Kikugawa, Naoki

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resu...

  16. Dicty_cDB: CHR246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR246 (Link to dictyBase) - - - Contig-U16475-1 CHR246P (Link to Original site) CHR...246F 145 CHR246Z 524 CHR246P 649 - - Show CHR246 Library CH (Link to library) Clone ID CHR... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR2-B/CHR246Q.Seq.d/ Representative seq. ID CHR...246P (Link to Original site) Representative DNA sequence >CHR246 (CHR246Q) /CSM/CH/CHR2-B/CHR2...equences producing significant alignments: (bits) Value N AC116957 |AC116957.2 Dictyostelium discoideum chro

  17. 50 CFR 665.246 - Gear identification.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gear identification. 665.246 Section 665.246 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC... Gear identification. In Permit Area 1, the vessel's official number must be marked legibly on all...

  18. 7 CFR 246.21 - Investigations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Investigations. 246.21 Section 246.21 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE..., where appropriate, a review of pertinent practices and policies of any State or local agency,...

  19. 7 CFR 246.8 - Nondiscrimination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nondiscrimination. 246.8 Section 246.8 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN Participant Eligibility §...

  20. Development of ST-246® for Treatment of Poxvirus Infections

    Directory of Open Access Journals (Sweden)

    Dennis E. Hruby

    2010-11-01

    Full Text Available ST-246 (Tecovirimat is a small synthetic antiviral compound being developed to treat pathogenic orthopoxvirus infections of humans. The compound was discovered as part of a high throughput screen designed to identify inhibitors of vaccinia virus-induced cytopathic effects. The antiviral activity is specific for orthopoxviruses and the compound does not inhibit the replication of other RNA- and DNA-containing viruses or inhibit cell proliferation at concentrations of compound that are antiviral. ST-246 targets vaccinia virus p37, a viral protein required for envelopment and secretion of extracellular forms of virus. The compound is orally bioavailable and protects multiple animal species from lethal orthopoxvirus challenge. Preclinical safety pharmacology studies in mice and non-human primates indicate that ST-246 is readily absorbed by the oral route and well tolerated with the no observable adverse effect level (NOAEL in mice measured at 2000 mg/kg and the no observable effect level (NOEL in non-human primates measured at 300 mg/kg. Drug substance and drug product processes have been developed and commercial scale batches have been produced using Good Manufacturing Processes (GMP. Human phase I clinical trials have shown that ST-246 is safe and well tolerated in healthy human volunteers. Based on the results of the clinical evaluation, once a day dosing should provide plasma drug exposure in the range predicted to be antiviral based on data from efficacy studies in animal models of orthopoxvirus disease. These data support the use of ST-246 as a therapeutic to treat pathogenic orthopoxvirus infections of humans.

  1. Measurements of integral cross sections in the californium-252 fission neutron spectrum

    International Nuclear Information System (INIS)

    In a low-scattering arrangement cross sections averaged over the californium-252 spontaneous fission neutron spectrum were measured. The reactions 27Al(n,α)46Ti, 47Ti, 48Ti(n,p), 54Fe,56Fe(n,p), 58Ni(n,p), 64Zn(n,p), 115In(n,n') were studied in order to obtain a consistent set of threshold detectors used in fast neutron flux density measurements. Overall uncertainties between 2 and 2.5% could be achieved; corrections due to neutron scattering in source and samples are discussed

  2. Measurement of californium-252 gamma photons depth dose distribution in tissue equivalent material. Vol. 4

    International Nuclear Information System (INIS)

    Phantom of tissue equivalent material with and without bone was used measuring depth dose distribution of gamma-rays from californium-252 source. The source was positioned at center of perspex walled phantom. Depth dose measurements were recorded for X, Y and Z planes at different distances from source. TLD 700 was used for measuring the dose distribution. Results indicate that implantation of bone in tissue equivalent medium cause changes in the gamma depth dose distribution which varies according to variation in bone geometry. 9 figs

  3. 48 CFR 246.470 - Government contract quality assurance actions.

    Science.gov (United States)

    2010-10-01

    ... quality assurance actions. 246.470 Section 246.470 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT QUALITY ASSURANCE Government Contract Quality Assurance 246.470 Government contract quality assurance actions....

  4. Dicty_cDB: AFM246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM246 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...246Z 559 - - - - Show AFM246 Library AF (Link to library) Clone ID AFM246 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM2-B/AFM...246Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...246 (AFM246Q) /CSM/AF/AFM2-B/AFM246Q.Seq.d/ XXXXXXXXXXAGATTAAACAATTCATTCTTGATGAATGTGATACC

  5. Spontaneous Partitioning of Californium from Curium: Curious Cases from the Crystallization of Curium Coordination Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Cary, Samantha K.; Silver, Mark A.; Liu, Guokui; Wang, Jamie C.; Bogart, Justin A.; Stritzinger, Jared T.; Arico, Alexandra A.; Hanson, Kenneth; Schelter, Eric J.; Albrecht-Schmitt, Thomas E.

    2015-12-07

    The reaction of 248CmCl3 with excess 2,6-pyridinedicarboxylic acid (DPA) under mild solvothermal conditions results in crystallization of the tris-chelate complex Cm(HDPA)3·H2O. Approximately half of the curium remains in solution at the end of this process, and evaporation of the mother liquor results in crystallization of the bis-chelate complex [Cm(HDPA)- (H2DPA)(H2O)2Cl]Cl·2H2O. 248Cm is the daughter of the α decay of 252Cf and is extracted in high purity from this parent. However, trace amounts of 249,250,251Cf are still present in all samples of 248Cm. During the crystallization of Cm(HDPA)3·H2O and [Cm(HDPA)(H2DPA)(H2O)2Cl]Cl·2H2O, californium(III) spontaneously separates itself from the curium complexes and is found doped within crystals of DPA in the form of Cf(HDPA)3. These results add to the growing body of evidence that the chemistry of californium is fundamentally different from that of earlier actinides.

  6. Mechanistic studies of APR-246 in leukemia

    OpenAIRE

    Ali, Dina Mahmoud

    2013-01-01

    PRIMA-1and its analog APR-246 are novel drugs that restore the active conformation of mutated and unfolded p53 protein and induce apoptosis and cell death in various tumors in pre-clinical models. We first aimed to explore the effects of APR-246 alone and in combination with other drugs in acute myeloid leukemia (AML) in vitro. APR-246 induced dose-dependent apoptosis and increased active caspase-3 and p53 protein levels as well as the Bax/Bcl-2 ratio independently of TP53...

  7. 40 CFR 246.202-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ...-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE SEPARATION FOR MATERIALS RECOVERY GUIDELINES Requirements and Recommended Procedures § 246.202-1 Requirement. Any commercial establishment generating 10 or more tons of waste corrugated containers per month...

  8. 48 CFR 252.246-7002 - Warranty of construction (Germany).

    Science.gov (United States)

    2010-10-01

    ... (Germany). 252.246-7002 Section 252.246-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.246-7002 Warranty of construction (Germany). As prescribed in 246.710(4), use the following clause: Warranty of Construction (Germany) (JUN 1997) (a) In addition to any...

  9. 48 CFR 246.408-71 - Aircraft.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Aircraft. 246.408-71... Aircraft. (a) The Federal Aviation Administration (FAA) has certain responsibilities and prerogatives in connection with some commercial aircraft and of aircraft equipment and accessories (Pub. L. 85-726 (72...

  10. Dicty_cDB: AFG246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFG246 (Link to dictyBase) - - - Contig-U15510-1 AFG246P (Link to Original ... yhkllnmlkrlfqmd lhmnqmdqfiliq*hfqkhmimvn*--- ---lh*imc *tkdkskikfn*cnrrvyhlhflcfrfnrifnrlfndwfrfrw*r*yrrgd ...

  11. 40 CFR 246.200 - High-grade paper recovery.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false High-grade paper recovery. 246.200 Section 246.200 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE... paper recovery....

  12. 48 CFR 52.246-14 - Inspection of Transportation.

    Science.gov (United States)

    2010-10-01

    ... Transportation. 52.246-14 Section 52.246-14 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION....246-14 Inspection of Transportation. As prescribed in 46.314, insert the following clause in solicitations and contracts for freight transportation services (including local drayage) by rail,...

  13. 40 CFR 246.202-5 - Recommended procedures: Transportation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation. 246.202-5 Section 246.202-5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.202-5 Recommended procedures: Transportation. Transportation to market may be supplied by...

  14. 40 CFR 246.200-7 - Recommended procedures: Transportation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation. 246.200-7 Section 246.200-7 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.200-7 Recommended procedures: Transportation. Transportation to market may be supplied by...

  15. 40 CFR 246.201-4 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.201-4 Section 246.201-4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.201-4 Recommended procedures: Market study. An investigation of markets should be made for...

  16. 40 CFR 246.202-3 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.202-3 Section 246.202-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.202-3 Recommended procedures: Market study. An investigation of markets should be made by...

  17. 40 CFR 246.200-3 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.200-3 Section 246.200-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.200-3 Recommended procedures: Market study. An investigation of markets should be made by...

  18. 48 CFR 552.246-71 - Source Inspection by Government.

    Science.gov (United States)

    2010-10-01

    ... Government. 552.246-71 Section 552.246-71 Federal Acquisition Regulations System GENERAL SERVICES....246-71 Source Inspection by Government. As prescribed in 546.302-71, insert the following clause: Source Inspection by Government (JUNE 1, 2009) (a) Inspection by Government personnel. (1) Supplies to...

  19. Fast and efficient charge breeding of the Californium rare isotope breeder upgrade electron beam ion source

    Energy Technology Data Exchange (ETDEWEB)

    Ostroumov, P. N., E-mail: ostroumov@anl.gov; Barcikowski, A.; Dickerson, C. A.; Perry, A.; Sharamentov, S. I.; Vondrasek, R. C.; Zinkann, G. P. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Pikin, A. I. [Brookhaven National Laboratory, Upton, New York 11973 (United States)

    2015-08-15

    The Electron Beam Ion Source (EBIS), developed to breed Californium Rare Isotope Breeder Upgrade (CARIBU) radioactive beams at Argonne Tandem Linac Accelerator System (ATLAS), is being tested off-line. A unique property of the EBIS is a combination of short breeding times, high repetition rates, and a large acceptance. Overall, we have implemented many innovative features during the design and construction of the CARIBU EBIS as compared to the existing EBIS breeders. The off-line charge breeding tests are being performed using a surface ionization source that produces singly charged cesium ions. The main goal of the off-line commissioning is to demonstrate stable operation of the EBIS at a 10 Hz repetition rate and a breeding efficiency into single charge state higher than 15%. These goals have been successfully achieved and exceeded. We have measured (20% ± 0.7%) breeding efficiency into the single charge state of 28+ cesium ions with the breeding time of 28 ms. In general, the current CARIBU EBIS operational parameters can provide charge breeding of any ions in the full mass range of periodic table with high efficiency, short breeding times, and sufficiently low charge-to-mass ratio, 1/6.3 for the heaviest masses, for further acceleration in ATLAS. In this paper, we discuss the parameters of the EBIS and the charge breeding results in a pulsed injection mode with repetition rates up to 10 Hz.

  20. Fast and efficient charge breeding of the Californium rare isotope breeder upgrade electron beam ion source

    International Nuclear Information System (INIS)

    The Electron Beam Ion Source (EBIS), developed to breed Californium Rare Isotope Breeder Upgrade (CARIBU) radioactive beams at Argonne Tandem Linac Accelerator System (ATLAS), is being tested off-line. A unique property of the EBIS is a combination of short breeding times, high repetition rates, and a large acceptance. Overall, we have implemented many innovative features during the design and construction of the CARIBU EBIS as compared to the existing EBIS breeders. The off-line charge breeding tests are being performed using a surface ionization source that produces singly charged cesium ions. The main goal of the off-line commissioning is to demonstrate stable operation of the EBIS at a 10 Hz repetition rate and a breeding efficiency into single charge state higher than 15%. These goals have been successfully achieved and exceeded. We have measured (20% ± 0.7%) breeding efficiency into the single charge state of 28+ cesium ions with the breeding time of 28 ms. In general, the current CARIBU EBIS operational parameters can provide charge breeding of any ions in the full mass range of periodic table with high efficiency, short breeding times, and sufficiently low charge-to-mass ratio, 1/6.3 for the heaviest masses, for further acceleration in ATLAS. In this paper, we discuss the parameters of the EBIS and the charge breeding results in a pulsed injection mode with repetition rates up to 10 Hz

  1. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252

    International Nuclear Information System (INIS)

    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U233 when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO2(NO3)4 and 18% of thorium Th(NO3)4 as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 107 s-1. In the design the value of the effective multiplication factor, whose value turned out keff <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  2. Fast and efficient charge breeding of the Californium rare isotope breeder upgrade electron beam ion source.

    Science.gov (United States)

    Ostroumov, P N; Barcikowski, A; Dickerson, C A; Perry, A; Pikin, A I; Sharamentov, S I; Vondrasek, R C; Zinkann, G P

    2015-08-01

    The Electron Beam Ion Source (EBIS), developed to breed Californium Rare Isotope Breeder Upgrade (CARIBU) radioactive beams at Argonne Tandem Linac Accelerator System (ATLAS), is being tested off-line. A unique property of the EBIS is a combination of short breeding times, high repetition rates, and a large acceptance. Overall, we have implemented many innovative features during the design and construction of the CARIBU EBIS as compared to the existing EBIS breeders. The off-line charge breeding tests are being performed using a surface ionization source that produces singly charged cesium ions. The main goal of the off-line commissioning is to demonstrate stable operation of the EBIS at a 10 Hz repetition rate and a breeding efficiency into single charge state higher than 15%. These goals have been successfully achieved and exceeded. We have measured (20% ± 0.7%) breeding efficiency into the single charge state of 28+ cesium ions with the breeding time of 28 ms. In general, the current CARIBU EBIS operational parameters can provide charge breeding of any ions in the full mass range of periodic table with high efficiency, short breeding times, and sufficiently low charge-to-mass ratio, 1/6.3 for the heaviest masses, for further acceleration in ATLAS. In this paper, we discuss the parameters of the EBIS and the charge breeding results in a pulsed injection mode with repetition rates up to 10 Hz. PMID:26329185

  3. Neutron activation analysis at the Californium User Facility for Neutron Science

    International Nuclear Information System (INIS)

    The Californium User Facility (CUF) for Neutron Science has been established to provide 252Cf-based neutron irradiation services and research capabilities including neutron activation analysis (NAA). A major advantage of the CUF is its accessibility and controlled experimental conditions compared with those of a reactor environment The CUF maintains the world's largest inventory of compact 252Cf neutron sources. Neutron source intensities of ≤ 1011 neutrons/s are available for irradiations within a contamination-free hot cell, capable of providing thermal and fast neutron fluxes exceeding 108 cm-2 s-1 at the sample. Total flux of ≥109 cm-2 s-1 is feasible for large-volume irradiation rabbits within the 252Cf storage pool. Neutron and gamma transport calculations have been performed using the Monte Carlo transport code MCNP to estimate irradiation fluxes available for sample activation within the hot cell and storage pool and to design and optimize a prompt gamma NAA (PGNAA) configuration for large sample volumes. Confirmatory NAA irradiations have been performed within the pool. Gamma spectroscopy capabilities including PGNAA are being established within the CUF for sample analysis

  4. Long-term effects of an intracavitary treatment with californium-252 on normal tissue

    International Nuclear Information System (INIS)

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252Cf and 7000 rad from 226Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252Cf and 5000 rad from 226Ra

  5. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source

    International Nuclear Information System (INIS)

    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction 55Mn (n.gamma)56 Mn, high concentration of manganese in the matrix and short half - life of 56Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions 56Fe(n,p)56Mn and 59 Co (n, α)56 were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  6. Five-year cure of cervical cancer treated using californium-252 neutron brachytherapy

    International Nuclear Information System (INIS)

    Female pelvic carcinoma is one of the common malignancies seen at the University of Kentucky Medical Center and often presents in an advanced stage. In 1976, the authors began to test californium-252 neutron brachytherapy (NT) for its efficacy for control of primary and recurrent advanced uterine, cervix, and vaginal cancers. The first protocol used was 5000-5500 rad of whole pelvis irradiation followed by 1-2 Cf-252 insertions using a single tandem placed in the utero-cervico-vaginal region. Of 27 patients with primary carcinomas treated, 10 are alive and well 5 year later (37%). Two of two recurrent tumors were locally controlled but failed later. These patients had advanced cervical, vaginal, or endometrial carcinomas. In 1977, a transitional year, treatment of only unfavorable stages and presentations with NT was initiated. Similar results were obtained with NT as compared to conventional photon therapy (PT). Further improvement in treatment results can be anticipated as NT brachytherapy is used for advanced cancer therapy by more effective treatment schedules and radiation doses. Cf-252 can be used as a radium substitute and achieved similar rates of tumor control and 5-year survivals. 21 references, 2 tables

  7. Uptake and distribution of californium-252 chloride administered intraperitoneally, intravenously or intratracheally and the effect of in vivo DTPA chelation on intratracheal instillation in the rat

    International Nuclear Information System (INIS)

    The first phase of this investigation, comprising of three groups of animals, was designed to study the fate of californium-252 chloride administered intraperitoneally, intravenously or intratracheally. The second phase, which consisted of two groups of animals, was designed to examine the effectiveness of DTPA chelation therapy in accelerating the excretion and preventing the deposition of californium-252 chloride instilled into the lungs of rats. Immediately following the dose administration of 2 uCi of californium-252 chloride which was dissolved in 0.2 ml of 0.9% NaCl at pH 3.5, each rat was placed in a metabolism cage. Each rat in the first group of phase II was given intraperitoneal injection of CaNa3 DTPA (50 mg/kg) and each rat in the second group was given intraperitoneal injections of 0.9% NaCl. Injections of the DTPA or the NaCl sham were initiated immediately after the intratracheal administration of californium-252 chloride and were continued every three days until sacrifice. Following intraperitoneal, intravenous or intratracheal administration, the whole body retention of californium as a function of time was described by a three component exponential equation. For each mode of administration the short term component exhibited a biological half-life of between 5 and 10 hours; the intermediate component between 4 and 6 days; and the long term component between 200 and 300 days. The organ data obtained following intraperitoneal and intravenous administration were indistinguishable. On day one, the liver retained about 9% of the administered dose and the kidneys retained 2.4%. Retention for these organs decreased to about 1% by day 32. The femurs maintained an almost constant level of 4.5% of the injected dose over the 32 days. The lungs, spleen, heart, and testes showed significant retention of californium

  8. ENEA results in the international comparison organized by BIPM for the measurament of neutron fluxes of a Californium source

    International Nuclear Information System (INIS)

    During the period between May 1978 and August 1984 under the auspices of Section III of CCEMRI of CIPM it has been carried out the international intercomparison of Californium neutron source emission rate. The previous intercomparison was based on Ra-Be (α -n) source measuraments, which took place between 1959 and 1965, and the results showed a total spread of +- 3%. Owing to the better accuracy achived over the following decade the Ra-Be intercomparison was no longer representative of the state of the art, therefore it was decided to arrange the intercomparison based on Californium which in the meantime reached a wide use in the world. Contributions to the intercomparison were received from fourteen laboratories representative of twelve Nations plus the BIPM. The results put into evidence a considerable advance on accuracy in the neutron source emission rate measuraments. The standard deviation of the residuals obtained from least square fit of normalized data resulted +- 0,57%. In the present report it is widely described the Manganese bath method used at ENEA, CRE Casaccia in Roma, and the experimental procedure followed for its absolute calibration. All measuraments are reported and analysed, including those effectuated for corrective factors determination. The final results obtained at ENEA for the circulated Californium source is (3,457 +- 0,013) 10*H7 neutron/s. The analysis of data from all partecipantes has been effectuated and concluded by J. Axton in March 1986 and the conclusions which have been showed in the present report put in evidence the satisfactory results achived by the ENEA

  9. Feasibility and market potential of protein determination of wheat using californium-252

    International Nuclear Information System (INIS)

    To evaluate the feasibility of protein determination by capture gamma-ray analysis using californium-252 neutrons, an in-situ protein analysis system for use by grain handlers has been examined. Three 227 kilogram (approximately) lots of wheat were used to determine the amount of nitrogen present. Protein analyses by the Kjeldahl method were obtained from samples taken before and after the capture gamma-ray analyses. The 5.267-MeV gamma-ray was selected for use in this study as a compromise between efficiency and interference from other elements. The associated counting equipment was a multichannel analyzer with pulse shaping electronic and analysis computing equipment. A linear regression program was used to compare the regions of interest to the Kjeldahl protein averages. The counts composing each peak were summed and normalized using the total count of the hydrogen peak. The normalized nitrogen percentages indicate a significant correlation between the spectral regions and the Kjeldahl analyses. To a first approximation, the value of wheat is the wheat protein. At the present time, protein testing of wheat is destructive, cumbersome, and time-consuming as compared to the potential for capture gamma-ray analysis testing. Assuming that such a protein analysis unit can analyze 42 tonne of wheat per hour, over 120 units would be needed to monitor one-half the U.S. annual wheat production. A 0.5% improvement in processor realizations and grain throughput value of $167.00 per tonne will result in a projected savings of $150,000 per year per unit

  10. Oxygen enhancement ratio (OER) and therapeutic gain factor (GF) for californium-252 at low dose rate

    International Nuclear Information System (INIS)

    The potential benefit of the introduction of californium-252 in interstitial and intracavitary therapy is related to the greater efficiency of its neutron emission against anoxic cancer cells. In that respect, the oxygen enhancement ratio (OER) of the 252Cf emission has been determined for a continuous low dose rate irradiation. The biological system is growth inhibition in Vicia faba bean roots. A new Vicia faba ''BelB'' strain has been used, which better tolerates long periods (up to about 10 hours) of anoxia. In a first series of experiments, for a 252Cf (Dsub(n+γ)) dose rate of 0.11 Gy.h-1, an OER of 1.4+-0.1 was observed (the γ contribution Dγ to the total absorbed dose Dsub(n+γ) was 0.35 at the position of the root tips). In a second series of experiments, in somewhat different geometrical conditions with a 252Cf (Dsub(n+γ)) dose rate of 0.13 Gy.h-1, an OER of 1.5+-0.1 was observed (Dγ/Dsub(n+γ)=0.42). The OER values observed for similar irradiation times, with iridium-192 γ-rays, were 2.3+-0.2 and 2.6+-0.1 respectively, which leads to therapeutic gain factors (GF) of 1.6 and 1.7 respectively. These GF values are slightly lower than those previously obtained (GF=1.8) on the same system, with d(50)-Be p(75)-Be and 15 MeV neutron beams

  11. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    International Nuclear Information System (INIS)

    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  12. Divalent and trivalent gas-phase coordination complexes of californium: evaluating the stability of Cf(ii).

    Science.gov (United States)

    Dau, Phuong D; Shuh, David K; Sturzbecher-Hoehne, Manuel; Abergel, Rebecca J; Gibson, John K

    2016-08-01

    The divalent oxidation state is increasingly stable relative to the trivalent state for the later actinide elements, with californium the first actinide to exhibit divalent chemistry under moderate conditions. Although there is evidence for divalent Cf in solution and solid compounds, there are no reports of discrete complexes in which Cf(II) is coordinated by anionic ligands. Described here is the divalent Cf methanesulfinate coordination complex, Cf(II)(CH3SO2)3(-), prepared in the gas phase by reductive elimination of CH3SO2 from Cf(III)(CH3SO2)4(-). Comparison with synthesis of the corresponding Sm and Cm complexes reveals reduction of Cf(III) and Sm(III), and no evidence for reduction of Cm(III). This reflects the comparative 3+/2+ reduction potentials: Cf(3+) (-1.60 V) ≈ Sm(3+) (-1.55 V) ≫ Cm(3+) (-3.7 V). Association of O2 to the divalent complexes is attributed to formation of superoxides, with recovery of the trivalent oxidation state. The new gas-phase chemistry of californium, now the heaviest element to have been studied in this manner, provides evidence for Cf(II) coordination complexes and similar chemistry of Cf and Sm. PMID:27424652

  13. Hypoxic versus normoxic external-beam irradiation of cervical carcinoma combined with californium-252 neutron brachytherapy. Comparative treatment results of a 5-year randomized study

    Czech Academy of Sciences Publication Activity Database

    Tačev, T.; Vacek, Antonín; Ptáčková, B.; Strnad, V.

    2005-01-01

    Roč. 181, č. 5 (2005), s. 273-284. ISSN 0179-7158 Institutional research plan: CEZ:AV0Z50040507 Keywords : cervical carcinoma * hypoxyradiotherapy * californium-252 Subject RIV: BO - Biophysics Impact factor: 3.490, year: 2005

  14. Solving the Hydration Structure of the Heaviest Actinide Aqua Ion Known: The Californium(III) Case

    Energy Technology Data Exchange (ETDEWEB)

    Den Auwer, Ch.; Guillaumont, D. [CEA Marcoule, Nucl Energy Div, Radiochem Proc Dept, SCPS LILA, 30 (France); Galbis, E.; Pappalardo, Rafael R.; Marcos Sanchez, E. [Univ Seville, Dept Quim Fis, E-41012 Seville (Spain); Hernandez-Cobos, J. [Inst Ciencias Fis, Cuernavaca 62251, Morelos (Mexico); Le Naour, C.; Simoni, E. [Univ Paris Sud, Inst Phys Nucl Orsay, Paris (France)

    2010-07-01

    In summary, the first MC simulation of the trivalent cation of californium, based on an exchangeable hydrated ion-water intermolecular potential, has been shown to extend and improve the hydrated ion model. Likewise, the CfL{sub III}-edge EXAFS spectrum of an acidic 1 mm Cf(ClO{sub 4}){sub 3} aqueous solution recorded under optimized experimental conditions has greatly improved the signal/noise ratio of the only previously recorded spectrum. The comparison of the experimental EXAFS spectrum with the two computed ones, obtained from two different intermolecular potentials that predict eight (BP86) or nine (MP2) water molecules in the first coordination shell, leads to the conclusion that the lowest hydration number is preferred. Then, as Cf{sup III} is the heaviest actinide aqua ion for which there is experimental information, the actinide contraction is supported by the present study. (For U{sup III}, R{sub U-O}=2.56 Angstroms, and CN=9{+-}1; for Pu{sup III}, R{sub Pu-O}=2.51 Angstroms and CN=9{+-}1; for Cm{sup III}, R{sub Cm-O}=2.47 Angstroms and CN=9{+-}1). The role of the second hydration shell is important in defining the structure and dynamics of the Cf{sup III} aqua ion, but the contribution of second-shell water molecules to the EXAFS signal as back-scatters is marginal. Finally, this work gives an illustrative example of the benefits which can be achieved from the combination of experimental X-ray absorption spectroscopy and computer simulations. The usefulness of the simultaneous analysis of the results as well as the importance of the structural statistical average has been clearly demonstrated herein. Each technique independently was not adequate. We believe that this study traces out a still poorly explored combined methodology which may be extremely useful for many other complexes and chemical problems. A systematic theoretical and experimental examination of the other known actinide cations on the same basis should be undertaken to confirm the

  15. Mesityl(2,4,6-trimethoxyphenylborinic acid

    Directory of Open Access Journals (Sweden)

    Sergiusz Luliński

    2010-07-01

    Full Text Available In the title molecule, C18H23BO4, the dihedral angle between the least-squares planes of the aromatic rings is 84.88 (3°. The B atom deviates by 0.202 (1 Å from the least-squares plane of the mesityl ring. All of the methoxy groups are approximately coplanar with the 2,4,6-trimethoxyphenyl ring, whereas the BOH group is twisted with respect to it by 19.5°. The borinic OH group is engaged in an intramolecular O—H...O hydrogen bond with one of ortho-methoxy groups. The molecular structure is stabilized by weak C—H...O contacts. In the crystal, molecules are linked by weak C—H...O and C—H...π interactions, generating a three-dimensional network.

  16. Transuranium element production. II. Chemical processing of targets

    International Nuclear Information System (INIS)

    The chemical processing described concerns small experimental targets irradiated in OSIRIS or EL-III and industrial targets irradiated in the CELESTIN reactors. In view of the difficulties encountered when processing highly irradiated targets (760MWd.kg-1) by liquid-liquid extraction (interface sludges leading to stable emulsion) the new processes developed are based on inverse phase chromatography. This technique applied to targets of americium 241, plutonium 239 and a plutonium mixture rich in isotope 242 has given tens of milligrams of curium 242, grams of americium 243 and curium 244 and micrograms of californium 252

  17. Dicty_cDB: SHA246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHA246 (Link to dictyBase) - - - Contig-U10899-1 | Contig-U12190-1 SHA246P ... 4-21.b_022.ab1 Whole-genome shotgun library of the elephant ... shark (aka elephant ... fish) Callorhinchus milii geno ...

  18. Dicty_cDB: AFJ246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFJ246 (Link to dictyBase) - - - Contig-U16240-1 AFJ246P (Link to Original ... il**mvq***slfklffklsirsrslg*f*ynrwwwtictn*wcwiw *p*sip *vck*siqsvslf*a--- ---TSVCFDGQCSVCXVDSSSVXISXTGIVTT ...

  19. 40 CFR 246.200-6 - Recommended procedures: Storage.

    Science.gov (United States)

    2010-07-01

    ....200-6 Section 246.200-6 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE SEPARATION FOR MATERIALS RECOVERY GUIDELINES Requirements and Recommended Procedures § 246..., the use of stationary compactors, or storage in corrugated boxes or normal waste containers....

  20. 21 CFR 520.246 - Butorphanol tartrate tablets.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Butorphanol tartrate tablets. 520.246 Section 520.246 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... tartrate tablets. (a) Specifications. Each tablet contains 1, 5, or 10 milligrams of butorphanol...

  1. 7 CFR 246.5 - Selection of local agencies.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Selection of local agencies. 246.5 Section 246.5 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF... cost efficiency and cost effectiveness of the local agency in terms of both food and nutrition...

  2. 7 CFR 246.13 - Financial management system.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Financial management system. 246.13 Section 246.13 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN State Agency Provisions §...

  3. 7 CFR 246.9 - Fair hearing procedures for participants.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Fair hearing procedures for participants. 246.9 Section 246.9 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN Participant...

  4. 7 CFR 246.15 - Program income other than grants.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Program income other than grants. 246.15 Section 246.15 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN State Agency Provisions §...

  5. 48 CFR 246.704 - Authority for use of warranties.

    Science.gov (United States)

    2010-10-01

    ... acquisitions for— (i) Commercial items (see FAR 46.709); (ii) Technical data, unless the warranty provides for extended liability (see 246.708); (iii) Supplies and services in fixed-price type contracts...

  6. Dicty_cDB: VHP246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP246 (Link to dictyBase) - - - Contig-U16439-1 VHP246P (Link to Original ... (bits) Value (Q55C16) RecName: Full=Ubiquitin-like modi fier-activating enzyme... 375 e-102 EF468345_1( EF4 ... BC047256 |pid:none) Xenopus laevis ubiquitin-like modi ... 200 9e-50 AB040073_1( AB040073 |pid:none) Xenop ...

  7. Operational experience with the Argonne National Laboratory Californium Rare Ion Breeder Upgrade facility and electron cyclotron resonance charge breeder

    Science.gov (United States)

    Vondrasek, R.; Clark, J.; Levand, A.; Palchan, T.; Pardo, R.; Savard, G.; Scott, R.

    2014-02-01

    The Californium Rare Ion Breeder Upgrade (CARIBU) of the Argonne National Laboratory Argonne Tandem Linac Accelerator System (ATLAS) facility provides low-energy and accelerated neutron-rich radioactive beams to address key nuclear physics and astrophysics questions. A 350 mCi 252Cf source produces fission fragments which are thermalized and collected by a helium gas catcher into a low-energy particle beam with a charge of 1+ or 2+. An electron cyclotron resonance (ECR) ion source functions as a charge breeder in order to raise the ion charge sufficiently for acceleration in the ATLAS linac. The ECR charge breeder has achieved stable beam charge breeding efficiencies of 10.1% for 23Na7+, 17.9% for 39K10+, 15.6% for 84Kr17+, and 12.4% for 133Cs27+. For the radioactive beams, a charge breeding efficiency of 11.7% has been achieved for 143Cs27+ and 14.7% for 143Ba27+. The typical breeding times are 10 ms/charge state, but the source can be tuned such that this value increases to 100 ms/charge state with the best breeding efficiency corresponding to the longest breeding times—the variation of efficiencies with breeding time will be discussed. Efforts have been made to characterize and reduce the background contaminants present in the ion beam through judicious choice of q/m combinations. Methods of background reduction are being investigated based upon plasma chamber cleaning and vacuum practices.

  8. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

    1976-01-01

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  9. Dicty_cDB: VHD246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHD246 (Link to dictyBase) - - - Contig-U11170-1 VHD246P (Link to Original ... ce. 38 0.28 5 CX072513 |CX072513.1 UCRCS08_28E10_g Parent ... Washington Navel Orange Callus cDNA Library UCRCS0 ... nce. 46 1.4 1 CX072512 |CX072512.1 UCRCS08_28E10_b Parent ... Washington Navel Orange Callus cDNA Library UCRCS0 ...

  10. Results with the electron cyclotron resonance charge breeder for the 252Cf fission source project (Californium Rare Ion Breeder Upgrade) at Argonne Tandem Linac Accelerator System

    International Nuclear Information System (INIS)

    The construction of the Californium Rare Ion Breeder Upgrade, a new radioactive beam facility for the Argonne Tandem Linac Accelerator System (ATLAS), is nearing completion. The facility will use fission fragments from a 1 Ci 252Cf source; thermalized and collected into a low-energy particle beam by a helium gas catcher. In order to reaccelerate these beams, an existing ATLAS electron cyclotron resonance (ECR) ion source was redesigned to function as an ECR charge breeder. Thus far, the charge breeder has been tested with stable beams of rubidium and cesium achieving charge breeding efficiencies of 9.7% into 85Rb17+ and 2.9% into 133Cs20+.

  11. Preparation of actinide targets by electrodeposition

    Science.gov (United States)

    Trautmann, N.; Folger, H.

    1989-10-01

    Actinide targets with varying thicknesses on different substrates have been prepared by electrodeposition either from aqueous solutions or from solutions of their nitrates in isopropyl alcohol. With these techniques the actinides can be deposited almost quantitatively on various backing materials within 15 to 30 min. Targets of thorium, uranium, neptunium, plutonium, americium, curium and californium with areal densities from almost carrier-free up to 1.4 mg/cm 2 on thin beryllium, carbon, titanium, tantalum and platinum foils have been prepared. In most cases, prior to the deposition, the actinides had to be purified chemically and for some of them, due to the limited amount of material available, recycling procedures were required. Applications of actinide targets in heavy-ion reactions are briefly discussed.

  12. 48 CFR 246.470-2 - Quality evaluation data.

    Science.gov (United States)

    2010-10-01

    ... SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT QUALITY ASSURANCE Government Contract Quality Assurance 246.470-2 Quality evaluation data. The contract administration office shall establish a system for the... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Quality evaluation...

  13. 7 CFR 246.6 - Agreements with local agencies.

    Science.gov (United States)

    2010-01-01

    ... nutrition education services to participants, in compliance with § 246.11 and FNS guidelines and... Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND...

  14. 40 CFR Appendix to Part 246 - Recommended Bibliography

    Science.gov (United States)

    2010-07-01

    ... Part 246 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE... Belknap, M. Paper recycling: a business perspective. Subcommittee on Solid Waste, New York Chamber of... Publication SW-155. Washington, U.S. Government Printing Office, 1975. 26 p. Hansen, P. Solid waste...

  15. 48 CFR 1852.246-73 - Human space flight item.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Human space flight item... 1852.246-73 Human space flight item. As prescribed in 1845.370(b), insert the following clause: Human Space Flight Item (MAR 1997) The Contractor shall include the following statement in all...

  16. 40 CFR 86.246-94 - Intermediate temperature testing.

    Science.gov (United States)

    2010-07-01

    ...) contained in 40 CFR part 86, subpart C. (c) For testing at temperatures of 50 °F (10 °C) or higher, the FTP... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Intermediate temperature testing. 86... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.246-94...

  17. Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

    Science.gov (United States)

    Amari, S.; Bouhafs, B.

    2016-09-01

    Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young's modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

  18. 48 CFR 52.246-17 - Warranty of Supplies of a Noncomplex Nature.

    Science.gov (United States)

    2010-10-01

    ... Noncomplex Nature. 52.246-17 Section 52.246-17 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.246-17 Warranty of Supplies of a Noncomplex Nature. As prescribed in 46.710(a)(1), insert a clause substantially as follows: Warranty of Supplies of a Noncomplex Nature (JUN 2003) (a)...

  19. 48 CFR 52.246-18 - Warranty of Supplies of a Complex Nature.

    Science.gov (United States)

    2010-10-01

    ... Complex Nature. 52.246-18 Section 52.246-18 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.246-18 Warranty of Supplies of a Complex Nature. As prescribed in 46.710(b)(1), insert a clause substantially as follows: Warranty of Supplies of a Complex Nature (MAY 2001) (a) Definitions. As used in...

  20. 48 CFR 552.246-77 - Additional Contract Warranty Provisions for Supplies of a Noncomplex Nature.

    Science.gov (United States)

    2010-10-01

    ... Warranty Provisions for Supplies of a Noncomplex Nature. 552.246-77 Section 552.246-77 Federal Acquisition... a Noncomplex Nature. As prescribed in 546.710(a), insert the following clause in solicitations and contracts that include FAR 52.246-17, Warranty of Supplies of a Noncomplex Nature. Additional...

  1. 10 CFR 431.246 - Energy conservation standards and their effective dates.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy conservation standards and their effective dates. 431.246 Section 431.246 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY EFFICIENCY PROGRAM FOR CERTAIN COMMERCIAL AND INDUSTRIAL EQUIPMENT Unit Heaters Energy Conservation Standards § 431.246...

  2. 48 CFR 246.402 - Government contract quality assurance at source.

    Science.gov (United States)

    2010-10-01

    ... quality assurance at source. 246.402 Section 246.402 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT QUALITY ASSURANCE Government Contract Quality Assurance 246.402 Government contract quality assurance at source. Do not...

  3. 40 CFR 246.201-6 - Recommended procedures: Transportation to market.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation to market. 246.201-6 Section 246.201-6 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Procedures § 246.201-6 Recommended procedures: Transportation to market. Transportation to market may...

  4. Microwave assisted facile synthesis of {1/1,3-bis/1,3,5-tris-[(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene]} using bismuth nitrate pentahydrate as an eco-friendly nitrating agent

    International Nuclear Information System (INIS)

    1-(2-Nitroxyethylnitramino)-2,4,6-trinitrobenzene (3a), 1,3-bis(2-nitroxyethyl nitramino)-2,4,6-trinitrobenzene (3b) and 1,3,5-tris(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene (3c) were prepared by the nitration of 1-(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2a) 1,3-bis(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2b) and 1,3,5-tris(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2c) using bismuth nitrate pentahydrate (eco-friendly nitrating agent) in tetrahydrofuran adsorbed on silica gel under microwave irradiation, respectively. Key intermediate compounds viz., 2a, 2b and 2c were synthesized by condensing picryl chloride, styphnyl chloride and 1,3,5-trichloro-2,4,6-trinitrobenzene with ethanol amine, respectively, based on the lines of the reported method. The synthesized compounds were characterized based on their physical constant, infrared (IR) spectroscopy and 1H nuclear magnetic resonance (NMR) spectroscopy. The spectroscopic data obtained indicated the formation of nitrate esters (3a-3c). The nitration methodology adopted in the present study is of relevance in the context of green chemistry. The target compounds (3a-3c) synthesized using eco-friendly approach are of interest from the point of high energy materials (HEMs)

  5. Microwave assisted facile synthesis of {1/1,3-bis/1,3,5-tris-[(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene]} using bismuth nitrate pentahydrate as an eco-friendly nitrating agent.

    Science.gov (United States)

    Badgujar, D M; Talawar, M B; Asthana, S N; Venugopalan, S; Rao, A Subhananda; Mahulikar, P P

    2008-04-01

    1-(2-Nitroxyethylnitramino)-2,4,6-trinitrobenzene (3a), 1,3-bis(2-nitroxyethyl nitramino)-2,4,6-trinitrobenzene (3b) and 1,3,5-tris(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene (3c) were prepared by the nitration of 1-(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2a) 1,3-bis(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2b) and 1,3,5-tris(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2c) using bismuth nitrate pentahydrate (eco-friendly nitrating agent) in tetrahydrofuran adsorbed on silica gel under microwave irradiation, respectively. Key intermediate compounds viz., 2a, 2b and 2c were synthesized by condensing picryl chloride, styphnyl chloride and 1,3,5-trichloro-2,4,6-trinitrobenzene with ethanol amine, respectively, based on the lines of the reported method. The synthesized compounds were characterized based on their physical constant, infrared (IR) spectroscopy and (1)H nuclear magnetic resonance (NMR) spectroscopy. The spectroscopic data obtained indicated the formation of nitrate esters (3a-3c). The nitration methodology adopted in the present study is of relevance in the context of green chemistry. The target compounds (3a-3c) synthesized using eco-friendly approach are of interest from the point of high energy materials (HEMs). PMID:17723262

  6. Microwave assisted facile synthesis of {l_brace}1/1,3-bis/1,3,5-tris-[(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene]{r_brace} using bismuth nitrate pentahydrate as an eco-friendly nitrating agent

    Energy Technology Data Exchange (ETDEWEB)

    Badgujar, D.M. [School of Chemical Sciences, North Maharashtra University, Jalgaon, 425001 Maharashtra (India)], E-mail: dmbadgujar@rediffmail.com; Talawar, M.B. [High Energy Material Research Laboratory (HEMRL), Ministry of Defense (MOD), Defense Research and Development Organization - DRDO, Pune, 411021 Maharastra (India)], E-mail: mbtalawar@yahoo.com; Asthana, S.N.; Venugopalan, S.; Rao, A. Subhananda [High Energy Material Research Laboratory (HEMRL), Ministry of Defense (MOD), Defense Research and Development Organization - DRDO, Pune, 411021 Maharastra (India); Mahulikar, P.P. [School of Chemical Sciences, North Maharashtra University, Jalgaon, 425001 Maharashtra (India)], E-mail: mahulikarpp@rediffmail.com

    2008-04-01

    1-(2-Nitroxyethylnitramino)-2,4,6-trinitrobenzene (3a), 1,3-bis(2-nitroxyethyl nitramino)-2,4,6-trinitrobenzene (3b) and 1,3,5-tris(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene (3c) were prepared by the nitration of 1-(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2a) 1,3-bis(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2b) and 1,3,5-tris(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2c) using bismuth nitrate pentahydrate (eco-friendly nitrating agent) in tetrahydrofuran adsorbed on silica gel under microwave irradiation, respectively. Key intermediate compounds viz., 2a, 2b and 2c were synthesized by condensing picryl chloride, styphnyl chloride and 1,3,5-trichloro-2,4,6-trinitrobenzene with ethanol amine, respectively, based on the lines of the reported method. The synthesized compounds were characterized based on their physical constant, infrared (IR) spectroscopy and {sup 1}H nuclear magnetic resonance (NMR) spectroscopy. The spectroscopic data obtained indicated the formation of nitrate esters (3a-3c). The nitration methodology adopted in the present study is of relevance in the context of green chemistry. The target compounds (3a-3c) synthesized using eco-friendly approach are of interest from the point of high energy materials (HEMs)

  7. Dicty_cDB: SHK246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CJ486536 |CJ486536.1 Macaca fascicularis mRNA, clone: QtsA-14165, 5' end, expressed in testis. 42 0.012 2 A...frontal lobe. 48 0.54 1 AM076235 |AM076235.1 Staphylococcus aureus partial sdrD gene for Ser-Asp rich fibrinogen-binding, bone si...l*tr*sttfksfh tfkynnlvtr*sngckcntq*scqrsiys*rtk*ryy*sdhlcnwr*gytrf*khni*g* wlrgwccyssiip...00686 |pid:none) Roseiflexus sp. RS-1, complete ... 75 5e-12 (Q7A780) RecName: Full=Serine-aspartate repeat-...SH (Link to library) SHK246 (Link to dictyBase) - - - Contig-U15700-1 SHK246P (Link to Original si

  8. Determination of 2,4,6-trichloroanisole by cyclic voltammetry

    OpenAIRE

    Freitas, Patrícia; Dias, L.G.; Peres, António M.; Luís M. de Castro; Veloso, Ana C. A.

    2012-01-01

    The electrochemical reduction of 2,4,6-trichloroanisole (TCA), which is a chlorinated arene with electron-donating substituents, was evaluated by cyclic voltammetry (CV). TCA is a major concern for the winery industry since it is related with “cork taint”, a wine defect. The results obtained in this work showed that CV could be used to detect and quantify TCA in preparative standard solutions. Linear relationships could be set between the current amplitude and TCA concentration (R...

  9. Solidification Effects in MAR-M246(Hf) Alloy

    Science.gov (United States)

    Johnston, M. H.; Parr, R. A.

    1987-01-01

    Fatigue properties degraded with crystallographic orientations greater than 10 degrees from {001} axis. Influence of solidification and heat-treatment parameters on structure and fatigue properties of nickel-based superalloy MAR-M246(Hf) described in 24-page report. Superalloys have high strength and corrosion resistance at temperatures up to 1,400 degrees C; their uses range from petrochemical equipment to marine, industrial, aircraft, and vehicular gas turbines.

  10. Sensitive determination of 2,4,6-trichloroanisole in water samples by ultrasound assisted emulsification microextraction prior to gas chromatography-tandem mass spectrometry analysis.

    Science.gov (United States)

    Fontana, Ariel R; Altamirano, Jorgelina C

    2010-06-15

    A novel application of an ultrasound assisted emulsification microextraction (USAEME) technique is proposed for the extraction and preconcentration of 2,4,6-trichloroanisole (2,4,6-TCA) from water samples prior to its determination by gas chromatography-tandem mass spectrometry (GC-MS/MS). USAEME employs a non-polar high-density solvent (extractant solvent), which forms an oil-in-water emulsion (O/W) in the aqueous sample bulk assisted by ultrasonic radiation. Several factors including, solvent type and volume, extraction time, extraction temperature, shaking mode and matrix modifiers were studied and optimized over the relative recovery of the target analyte. An aliquot of 5mL water sample was conditioned by adding 150microL 6.15molL(-1) sodium chloride and 300microL 0.05molL(-1) phosphate buffer (pH 6), and finally extracted with 40microL chloroform by using USAEME technique. Under the optimal experimental conditions 2,4,6-TCA was quantitatively extracted achieving an enrichment factor (EF) of 555. The detection limit (LOD), calculated as three times the signal-to-noise ratio (S/N), was 0.2ngL(-1) and the RSD was 6.3% (n=5) when 1ngL(-1) 2,4,6-TCA standard mixture was analyzed. The coefficients of estimation of the calibration curves obtained following the proposed methodology was >or=0.997 and the linear working range was 1-5000ngL(-1). Finally, the proposed technique was successfully applied for extraction and determination of the 2,4,6-TCA in water samples. Recovery studies lead values >or=94%, which showed a successfully robustness of the analytical methodology for determination of nanogram per liter of 2,4,6-TCA in water samples. PMID:20441935

  11. Anatomy of a controversy: Application of the Langevin technique to the analysis of the Californium-252 Source-Driven Noise Analysis method for subcriticality determination

    International Nuclear Information System (INIS)

    The expressions for the power spectral density of the noise equivalent sources have been calculated explicitly for the (a) stochastic transport equation, (b) the one-speed transport equaton, (c) the one-speed P1 equations, (d) the one-speed diffusion equation and (e) the point kinetic equation. The stochastic nature of Fick's law in (d) has been emphasized. The Langevin technique has been applied at various levels of approximation to the interpretation of the Californium-252 Source-Driven Noise Analysis (CSDNA) experiment for determining the reactivity in subcritical media. The origin of the controversy surrounding this method has been explained. The foundations of the CSDNA method as a viable experimental technique to infer subcriticality from a measured ratio of power spectral densities of the outputs of two neutron detectors and a third external source detector has been examined by solving the one-speed stochastic diffusion equation for a point external Californium-252 source and two detectors in an infinite medium. The expression relating reactivity to the measured ratio of PSDs was found to depend implicitly on k itself. Through a numerical analysis fo this expression, the authors have demonstrated that for a colinear detector-source-detector configuration for neutron detectors far from the source, the expression for the subcritical multiplication factor becomes essentially insensitive to k, hence, demonstrating some possibility for the viability of this technique. However, under more realistic experimental conditions, i.e., for finite systems in which diffusion theroy is not applicable, the measurement of the subcritical multiplication factor from a single measured ratio of PSDs, without extensive transport calculations, remains doubtful

  12. Application of SCGE assay, classical cytogenetics and FISH for studying in vitro californium-252 neutrons irradiations and BSH pretreatment on human lymphocytes

    International Nuclear Information System (INIS)

    Recently, there has been observed a tendency to apply various energy neutrons for tumor therapy and particularly low energy neutrons from various sources, including californium-252 source, for cancer radiotherapy based on the neutron capture. In this study peripheral blood lymphocytes were used as a model for human cells and three methods were applied to assess the effectiveness of californium-252 neutrons irradiations in vitro in normal cells or pre-treated with compound enriched in B-10 ion. Human blood samples or isolated lymphocytes were irradiated with neutrons from isotopic 252Cf source at the Faculty of Nuclear Physics and Technics at University of Mining and Metallurgy (both neutron source and samples were placed in polyethylene block). Chemical pretreatment with BSH (Na210B12H11SH) was done to introduce boron-10 ion into cells in order to check any enhancement effect due to the process of boron neutron capture. Comet assay was done to investigate the DNA damage. Classical cytogenetics was applied to assess the frequencies of unstable aberrations (dicentrics and rings). Fluorescence in situ hybridization (FISH) with probes for chromosomes 1, 4 (14.3% of whole genome) and pancentromeric probe was performed to evaluate the frequencies of stable aberrations. Linear (or close to linear) increase of DNA damage and aberration frequency was observed with dose of radiation both for lymphocytes untreated or pre-treated with BSH. Very little differences (statistically insignificant) due to radiation dose and BSH pretreatment were observed in the frequencies of SCEs detected in the second mitosis. There is no significant difference between boron pre-treated and not treated cells, and even slightly higher effects were observed in case of the highest dose without BSH pretreatment. The level of translocations observed is comparable with the frequencies of dicentrics and rings. (author)

  13. Photocatalytic degradation of 2,4,6-trinitrotoluene

    Institute of Scientific and Technical Information of China (English)

    LIU XiuHua; FU YiBei; WANG HeYi; ZHONG ZhiJing; XU YunShu

    2008-01-01

    A Pt/TiO2 photocatalyst was used in the photocatalytic degradation of 2,4,6-trinitrotoluene (TNT) under the irradiation of the simulated sunlight. The results show that the destruction of TNT is faster and more complete with the photocatalyst. The photocatalytic degradation of TNT follows first order kinetics. The transformation of nitryl groups of TNT molecules into nitrite and nitrate ions may be accelerated in the presence of the Pt/TiO2 photocatalyst. Compared with that without the catalyst, the concentration of nitrate ions was improved 32.3 times within 2.5 h.

  14. Dicty_cDB: SHJ246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHJ246 (Link to dictyBase) - - - Contig-U16427-1 - (Link to Original site) ... yfg*ytlyiyiiq*nviffrtdfrkdgfhr*ry*ihgns*sck*irkryf*ngs ... nl*k*ncykiisins*fsk*csrkcc*mfrfin*ks*rftsnrny*yiik ... f--- Homology vs CSM-cDNA Score E Sequences producing s ignificant alignments: (bits) Value VHP493 (VHP493 ... 003. 6. 8 Homology vs DNA Score E Sequences producing s ignificant alignments: (bits) Value N AC116956 |AC ... 5.10 Homology vs Protein Score E Sequences producing s ignificant alignments: (bits) Value (Q86KD1) RecNa ...

  15. Californium-252 neutron sources

    International Nuclear Information System (INIS)

    Major production programs for the Savannah River reactors and the High Flux Isotopes Reactor at Oak Ridge have made 252Cf one of the most available and, at the USAEC's sales price of $10/μg, one of the least-expensive isotopic neutron sources. Reactor production has totaled approximately 2 g, and, based on expected demand, an additional 10 g will be produced in the next decade. The approximately 800 mg chemically separated to date has been used to prepare over 600 neutron sources. Most, about 500, have been medical sources containing 1 to 5 μg of 252Cf plated in needles for experimental cancer therapy studies. The remainder have generally been point sources containing 10 μg to 12 mg of oxide for activation, well logging, or radiography uses. Bulk sources have also been supplied to the commercial encapsulators. The latest development has been the production of 252Cf cermet wire which can be cut into almost contamination-free lengths of the desired 252Cf content. Casks are available for transport of sources up to 50 mg. Subcritical assemblies have been developed to multiply the source neutrons by a factor of 10 to 40, and collimators and thermalizers have also been extensively developed to shape the neutron flux and energy distributions for special applications. (U.S.)

  16. APR-246 (PRIMA-1(MET)) strongly synergizes with AZD2281 (olaparib) induced PARP inhibition to induce apoptosis in non-small cell lung cancer cell lines.

    Science.gov (United States)

    Deben, Christophe; Lardon, Filip; Wouters, An; Op de Beeck, Ken; Van den Bossche, Jolien; Jacobs, Julie; Van Der Steen, Nele; Peeters, Marc; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick

    2016-06-01

    APR-246 (PRIMA-1(Met)) is able to bind mutant p53 and restore its normal conformation and function. The compound has also been shown to increase intracellular ROS levels. Importantly, the poly-[ADP-ribose] polymerase-1 (PARP-1) enzyme plays an important role in the repair of ROS-induced DNA damage. We hypothesize that by blocking this repair with the PARP-inhibitor AZD2281 (olaparib), DNA damage would accumulate in the cell leading to massive apoptosis. We observed that APR-246 synergistically enhanced the cytotoxic response of olaparib in TP53 mutant non-small cell lung cancer cell lines, resulting in a strong apoptotic response. In the presence of wild type p53 a G2/M cell cycle block was predominantly observed. NOXA expression levels were significantly increased in a TP53 mutant background, and remained unchanged in the wild type cell line. The combined treatment of APR-246 and olaparib induced cell death that was associated with increased ROS production, accumulation of DNA damage and translocation of p53 to the mitochondria. Out data suggest a promising targeted combination strategy in which the response to olaparib is synergistically enhanced by the addition of APR-246, especially in a TP53 mutant background. PMID:26975633

  17. Calculations of Nuclear Astrophysics and Californium Fission Neutron Spectrum Averaged Cross Section Uncertainties Using ENDF/B-VII.1, JEFF-3.1.2, JENDL-4.0 and Low-fidelity Covariances

    International Nuclear Information System (INIS)

    Nuclear astrophysics and californium fission neutron spectrum averaged cross sections and their uncertainties for ENDF materials have been calculated. Absolute values were deduced with Maxwellian and Mannhart spectra, while uncertainties are based on ENDF/B-VII.1, JEFF-3.1.2, JENDL-4.0 and Low-Fidelity covariances. These quantities are compared with available data, independent benchmarks, EXFOR library, and analyzed for a wide range of cases. Recommendations for neutron cross section covariances are given and implications are discussed

  18. Development of an analytical method to quantify PBDEs, OH-BDEs, HBCDs, 2,4,6-TBP, EH-TBB, and BEH-TEBP in human serum.

    Science.gov (United States)

    Butt, Craig M; Miranda, Marie Lynn; Stapleton, Heather M

    2016-04-01

    Polybrominated diphenyl ethers (PBDEs) flame retardants (FRs) were phased-out in the mid-2000s (penta- and octaBDE) and 2013 (decaBDE); however, their hydroxylated metabolites (OH-BDEs) are still commonly detected in human serum. Today, novel FRs such as Firemaster® 550, a mixture that contains two brominated compounds, EH-TBB and BEH-TEBP are used as replacements for PBDEs in some applications, and there is a need to develop a comprehensive analytical method to assess exposure to both legacy PBDEs and novel FRs. This study developed a solid-phase extraction (SPE)-based method to analyze PBDEs, OH-BDEs, 2,4,6-tribromophenol (TBP), hexabromocylcododecane isomers (HBCDs), EH-TBB, and BEH-TEBP in human serum. Briefly, serum proteins were first denatured with formic acid, and then the target analytes were isolated using a SPE column. Finally, the extract was cleaned and fractioned using a silica SPE column. Method performance was assessed by spiking fetal bovine serum with 1-2 ng of the target analytes, and method accuracy was quantified by comparison to a serum Standard Reference Material (SRM). The developed method showed good recovery and accuracy for all target analytes with the exception of the very low and very high molecular weight PBDE congeners. Using this method, 43 serum samples collected from the Healthy Pregnancy, Healthy Baby Study (HPHB) cohort in Durham, NC, USA were analyzed for FRs. A novel finding was the ubiquitous detection of 2,4,6-TBP, at levels greater than the individual PBDE congeners. Furthermore, 2,4,6-TBP was positively correlated with PBDEs, suggesting that they may have a similar source of exposure, or that 2,4,6-TBP may result from metabolism of PBDEs in vivo. PMID:26864867

  19. 25 CFR 1000.246 - Must an AFA that contains a construction project or activity incorporate provisions of Federal...

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Must an AFA that contains a construction project or activity incorporate provisions of Federal construction standards? 1000.246 Section 1000.246 Indians OFFICE... Construction § 1000.246 Must an AFA that contains a construction project or activity incorporate provisions...

  20. 33 CFR 148.246 - When is a document considered filed and where should I file it?

    Science.gov (United States)

    2010-07-01

    ... filed and where should I file it? 148.246 Section 148.246 Navigation and Navigable Waters COAST GUARD... Formal Hearings § 148.246 When is a document considered filed and where should I file it? (a) If a document to be filed is submitted by mail, it is considered filed on the date it is postmarked. If...

  1. Californium interrogation prompt neutron (CIPN) instrument for non-destructive assay of spent nuclear fuel-Design concept and experimental demonstration

    Science.gov (United States)

    Henzlova, D.; Menlove, H. O.; Rael, C. D.; Trellue, H. R.; Tobin, S. J.; Park, Se-Hwan; Oh, Jong-Myeong; Lee, Seung-Kyu; Ahn, Seong-Kyu; Kwon, In-Chan; Kim, Ho-Dong

    2016-01-01

    This paper presents results of the first experimental demonstration of the Californium Interrogation Prompt Neutron (CIPN) instrument developed within a multi-year effort launched by the Next Generation Safeguards Initiative Spent Fuel Project of the United States Department of Energy. The goals of this project focused on developing viable non-destructive assay techniques with capabilities to improve an independent verification of spent fuel assembly characteristics. For this purpose, the CIPN instrument combines active and passive neutron interrogation, along with passive gamma-ray measurements, to provide three independent observables. This paper describes the initial feasibility demonstration of the CIPN instrument, which involved measurements of four pressurized-water-reactor spent fuel assemblies with different levels of burnup and two initial enrichments. The measurements were performed at the Post-Irradiation Examination Facility at the Korea Atomic Energy Institute in the Republic of Korea. The key aim of the demonstration was to evaluate CIPN instrument performance under realistic deployment conditions, with the focus on a detailed assessment of systematic uncertainties that are best evaluated experimentally. The measurements revealed good positioning reproducibility, as well as a high degree of insensitivity of the CIPN instrument's response to irregularities in a radial burnup profile. Systematic uncertainty of individual CIPN instrument signals due to assembly rotation was found to be orientation in the instrument.

  2. Two new polytypes of 2,4,6-tribromobenzonitrile

    Directory of Open Access Journals (Sweden)

    Doyle Britton

    2016-02-01

    Full Text Available Three polymorphs of 2,4,6-tribromobenzonitrile (RCN, C7H2Br3N, two of which are novel and one of which is a redetermination of the original structure first determined by Carter & Britton [(1972. Acta Cryst. B28, 945–950] are found to be polytypic. Each has a layer structure which differs only in the stacking of the layers. Each layer is composed of molecules associated through C[triple-bond]N...Br contacts which form R22(10 rings. Two such rings are associated with each N atom; one with each ortho-Br atom. No new polytypes of 1,3,5-tribromo-2-isocyanobenzene (RNC were found but a re-determination of the original structure by Carter et al. [(1977. Cryst. Struct. Commun. 6, 543–548] is presented. RNC was found to be isostructural with one of the novel polytypes of RCN. Unit cells were determined for 23 RCN samples and 11 RNC samples. Polytypes could not be distinguished based on crystal habits. In all four structures, each molecule of the asymmetric unit lies across a mirror plane.

  3. 10 CFR 72.246 - Issuance of amendment to a certificate of compliance.

    Science.gov (United States)

    2010-01-01

    ... INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of Spent Fuel Storage Casks § 72.246 Issuance of amendment to a certificate...

  4. Bis(2,4,6-triaminopyrimidin-1-ium sulfate pentahydrate

    Directory of Open Access Journals (Sweden)

    Yupa Wattanakanjana

    2013-08-01

    Full Text Available The asymmetric unit of the title salt, 2C4H8N5+·SO42−·5H2O, contains four 2,4,6-triaminopyrimidinium (TAPH+ cations, two sulfate anions and ten lattice water molecules. Each two of the four TAPH+ cations form dimers via N—H...N hydrogen bonds between the amino groups and the unprotonated pyrimidine N atoms [graph-set motif R22(8]. The (TAPH+2 dimers, in turn, form slightly offset infinite π–π stacks parallel to [010], with centroid–centroid distances between pyrimidine rings of 3.5128 (15 and 3.6288 (16 Å. Other amino H atoms, as well as the pyrimidinium N—H groups, are hydrogen-bonded to sulfate and lattice water O atoms. The SO42− anions and water molecules are interconnected with each other via O—H...O hydrogen bonds. The combination of hydrogen-bonding interactions and π–π stacking leads to the formation of a three-dimensional network with alternating columns of TAPH+ cations and channels filled with sulfate anions and water molecules. One of the sulfate anions shows a minor disorder by a ca 37° rotation around one of the S—O bonds [occupancy ratio of the two sets of sites 0.927 (3:0.073 (3]. One water molecule is disordered over two mutually exclusive positions with an occupancy ratio of 0.64 (7:0.36 (7.

  5. Penta- and 2,4,6-tri-chlorophenol biodegradation during municipal solid waste anaerobic digestion.

    Science.gov (United States)

    Limam, Intissar; Limam, Rim Driss; Mezni, Mohamed; Guenne, Angéline; Madigou, Céline; Driss, Mohamed Ridha; Bouchez, Théodore; Mazeas, Laurent

    2016-08-01

    In this study isotopic tracing using (13)C labelled pentachlorophenol (PCP) and 2,4,6-trichlorophenol (2,4,6-TCP) is proposed as a tool to distinguish the loss of PCP and 2,4,6-TCP due to biodegradation from other physical processes. This isotopic approach was applied to accurately assess in situ PCP and 2,4,6-TCP degradation under methanogenic conditions in several microcosms made up of household waste. These microcosms were incubated in anaerobic conditions at 35°C (mesophilic) and 55°C (thermophilic) without agitation. The volume of biogas produced (CH4 and CO2), was followed for a period of 130 days. At this stage of stable methanogenesis, (13)C6-PCP and (13)C6-2,4,6-TCP were introduced anaerobically in microcosms and its monitoring at mesophilic and thermophilic conditions was performed in parallel by gas chromatography mass spectrometry (GC-MS) and gas chromatography isotope-ratio mass spectrometry (GC-IRMS). This study proved the almost total dechlorination of bioavailable PCP and 2,4,6-TCP into 4-CP at 35°C. Nevertheless, high rate adsorption in particular materials of the two compounds was observed. Furthermore, Carbon-13 Nuclear Magnetic Resonance ((13)C-NMR) Spectroscopy analysis of (13)C labelled 2,4,6-TCP mesophilic incubations showed the partial mineralization of 4-CP at 35°C to acetate and then to HCO(3-). Consequently, NMR results confirm the biogas isotopic results indicating the mineralization of (13)C labelled 2,4,6-TCP into (13)C (CH4 and CO2). Concerning (13)C labelled PCP mesophilic incubations, the isotopic composition of the biogas still natural until the day 262. In contrast, no dechlorination was observed at 55°C. Thus PCP and 2,4,6-TCP were persistent in thermophilic conditions. PMID:27151678

  6. Inhibitory activities against rice pathogens of 8-hydroxy-2,4,6-octatriynamide from Agrocybe sp.

    Science.gov (United States)

    Zheng, Yongbiao; Xu, Xiaoping; Wu, Yabin

    2016-03-01

    8-Hydroxy-2,4,6-octatriynamide, a natural polyacetylene with inhibitory activities against rice pathogens, was isolated from the liquid fermentation broth of strain Agrocybe sp. YB2005 during screening for new natural chemical agents to control rice pathogens. 8-hydroxy-2,4,6-octatriynamide was purified by consecutive chromatography over a Cl8 reversed phase silica gel, sephadex LH-20 and silica gel. The chemical structure of 8-hydroxy-2,4,6-octatriynamide was elucidated through spectroscopic analyses, including 1D- and 2D-NMR, ESI mass spectrometry and X-ray single crystal diffraction. Bioassays showed that 8-hydroxy-2,4,6-octatriynamide could significantly inhibit growth of Xanthomonas oryzae with an MIC of 53.1 μM in a 96-well plate and the growth of Rhizoctonia solani at 1.02 mM in a 24-well plate. When rice leaves were inoculated with Magnaporthe grisea and cultured in artificial nutrition liquid containing 0.34 mM 8-hydroxy-2,4,6-octatriynamide, no rice blast was observed. The present study implied that 8-hydroxy-2,4,6-octatriynamide could be a candidate agent against rice pathogens. PMID:26861586

  7. Pathway of the ozonation of 2,4,6-trichlorophenol in aqueous solution

    Institute of Scientific and Technical Information of China (English)

    PI Yunzheng; WANG Jianlong

    2007-01-01

    The reaction mechanism and pathway of the ozonation of 2,4,6-trichlorophenol(2,4,6-TCP)in aqueous solution were investigated.The removal efficiency and the variation of H2O2,Cl-,formic acid,and oxalic acid were studied during the semi-batch ozonation experiments(continuous for ozone gas supply,fixed volume of water sample).The results showed that when there was no scavenger,the removal efficiency of 0.1 mmol/L 2,4,6-TCP could reach 99% within 6 min by adding 24 mg/L ozone.The reaction of molecular ozone with 1 2,4,6-TCP resulted in the formation of H2O2.The maximal concentration of H2O2 detected during the ozonation could reach 22.5% of the original concentration of 2,4,6-TCP.The reaction of ozone with H2O2 resulted in the molecule firstly degraded 2,4,6-TCP to form chlorinated quinone,which was subsequently oxidized to formic acid and oxalic acid.Two reaction pathways of the degradation of 2,4,6-TCP by ozone and O2/OH·were proposed in this study.

  8. Biological Efficiency of Californium-252 Source Evaluated by Comet Assay, Classical Cytogenetics and FISH in Human Lymphocytes Irradiated without and with BSH Pretreatment

    International Nuclear Information System (INIS)

    Biological effectiveness of californium-252 source was evaluated after irradiations in vitro of normal or pre-treated with compound enriched in B-10 ion cells. Peripheral blood lymphocytes were used as a model for human cells. DNA and chromosomal damage were studied to compare biological effectiveness of irradiation. Human blood samples or isolated lymphocytes were irradiated with the isotopic source of 252Cf, at the Faculty of Physics and Nuclear Techniques at the University of Mining and Metallurgy (both neutron source and samples were placed in ''infinite'' polyethylene block). Chemical pretreatment with Na210B12H11SH (BSH) was performed to introduce boron-10 ion into cells in order to check any enhancement effect due to the process of boron neutron capture. Single cell gel electrophoresis also known as the Comet assay was done to investigate the DNA damage. Classical cytogenetic analysis was applied to assess the frequencies of unstable aberrations (dicentrics, rings and a centric fragments). To evaluate the frequencies of stable aberrations the fluorescence in situ hybridisation (FISH) with probes for chromosomes 1, 4 (14.3% of the whole genome) was performed. Linear (or close to linear) increase with radiation dose were observed for the DNA damage and aberration frequencies in lymphocytes both untreated or pre-treated with BSH. Levels of translocations evaluated for the whole genome were comparable with the frequencies of dicentrics and rings. No significant differences were detected due to radiation dose in the frequencies of sister chromatid exchanges (SCE) detected in the second mitosis. No statistically significant differences were observed in various biological end-points between normal or boron pre-treated cells. (author)

  9. Isolation of Pseudomonas pickettii strains that degrade 2,4,6-trichlorophenol and their dechlorination of chlorophenols.

    OpenAIRE

    Kiyohara, H.; Hatta, T; Ogawa, Y.; T Kakuda; H. Yokoyama; Takizawa, N

    1992-01-01

    Three strains of Pseudomonas pickettii that can grow with 2,4,6-trichlorophenol (2,4,6-TCP) as the sole source of carbon and energy were isolated from different mixed cultures of soil bacterial populations that had been acclimatized to 2,4,6-TCP. These strains released 3 mol of chloride ion from 1 mol of 2,4,6-TCP during the complete degradation of the TCP. Of these strains, P. pickettii DTP0602 in high-cell-density suspension cultures dechlorinated various chlorophenols (CPs). Cells that wer...

  10. Functions of Flavin Reductase and Quinone Reductase in 2,4,6-Trichlorophenol Degradation by Cupriavidus necator JMP134▿

    OpenAIRE

    Belchik, Sara Mae; Xun, Luying

    2007-01-01

    The tcpRXABCYD operon of Cupriavidus necator JMP134 is involved in the degradation of 2,4,6-trichlorophenol (2,4,6-TCP), a toxic pollutant. TcpA is a reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenase that converts 2,4,6-TCP to 6-chlorohydroxyquinone. It has been implied via genetic analysis that TcpX acts as an FAD reductase to supply TcpA with FADH2, whereas the function of TcpB in 2,4,6-TCP degradation is still unclear. In order to provide direct biochemical evidence for t...

  11. Condensation monomers and polymers based on 2,4,6-trinitrotoluene

    International Nuclear Information System (INIS)

    The feasibility of conversion of 2,4,6-trinitrotoluene into condensation monomers (nitro compounds, diamines, etc.) and their applications in the synthesis of aromatic polymers has been analysed within the framework of a general problem of 2,4,6-trinitroluene conversion. The use of aromatic dinitro compounds and diamines for the preparation of oligomeric polyethers and polyamides (or polyimides), respectively, is considered. The possibility of the synthesis of polyamides and polyimides containing side aliphatic and aromatic groups and possessing better (in comparison with the corresponding unsubstituted polymers) characteristics is demonstrated.

  12. Coordination chemistry of 2,4,6-tri(pyridyl)-1,3,5-triazine ligands

    OpenAIRE

    Therrien, Bruno

    2012-01-01

    This review covers the rich coordination chemistry of 2,4,6-tri(pyridyl)-1,3,5-triazine ligands. These polypyridyl derivatives have been coupled to transition metals and lanthanides, and the complexes obtained have been used in various fields such as luminescent materials, for the preparation of coordination polymers and networks as well as for the synthesis of discrete metalla-assemblies. The synthetic and structural aspects of the different isomers of 2,4,6-tri(pyridyl)-1,3,5-triazine are p...

  13. In Vitro Drug Combination Studies of Letermovir (AIC246, MK-8228) with Approved Anti-Human Cytomegalovirus (HCMV) and Anti-HIV Compounds in Inhibition of HCMV and HIV Replication

    OpenAIRE

    Wildum, Steffen; Zimmermann, Holger; Lischka, Peter

    2015-01-01

    Despite modern prevention and treatment strategies, human cytomegalovirus (HCMV) remains a common opportunistic pathogen associated with serious morbidity and mortality in immunocompromised individuals, such as transplant recipients and AIDS patients. All drugs currently licensed for the treatment of HCMV infection target the viral DNA polymerase and are associated with severe toxicity issues and the emergence of drug resistance. Letermovir (AIC246, MK-8228) is a new anti-HCMV agent in clinic...

  14. A systematic study on the absorption and fluorescence properties of 2,4,6-triaryl and tripyridylpyridines

    OpenAIRE

    FINDIK, Esra; ARIK, Mustafa; Ceylan, Mustafa

    2009-01-01

    Eight different 2,4,6-triaryl, and tripyridylpridines compounds were synthesized and their fluorescent properties were studied by using steady-state and time-resolved fluorescence and UV-Vis absorption spectroscopy techniques in 6 different solvents. Especially, 2,4,6-triarylpyridines showed strong fluorescence properties with high fluorescence quantum yields but small Stokes shifts.

  15. APR-246/PRIMA-1(MET) rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations.

    Science.gov (United States)

    Shen, Jinfeng; van den Bogaard, Ellen H; Kouwenhoven, Evelyn N; Bykov, Vladimir J N; Rinne, Tuula; Zhang, Qiang; Tjabringa, Geuranne S; Gilissen, Christian; van Heeringen, Simon J; Schalkwijk, Joost; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing

    2013-02-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome patients with p63 mutations as an in vitro human model to study the disease mechanism in the skin of EEC patients. We show that these patient keratinocytes cultured either in submerged 2D cultures or in 3D skin equivalents have impaired epidermal differentiation and stratification. Treatment of these patient keratinocytes with the mutant p53-targeting compound APR-246/PRIMA-1(MET) (p53 reactivation and induction of massive apoptosis) that has been successfully tested in a phase I/II clinical trial in cancer patients partially but consistently rescued morphological features and gene expression during epidermal stratification in both 2D and 3D models. This rescue coincides with restoration of p63 target-gene expression. Our data show that EEC patient keratinocytes with p63 mutations can be used for characterization of the abnormal molecular circuitry in patient skin and may open possibilities for the design of novel pharmacological treatment strategies for patients with mutant p63-associated developmental abnormalities. PMID:23355676

  16. 5 CFR 531.246 - Within-grade increases for GM employees.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Within-grade increases for GM employees... REGULATIONS PAY UNDER THE GENERAL SCHEDULE Determining Rate of Basic Pay Special Rules for Gm Employees § 531.246 Within-grade increases for GM employees. GM employees are entitled to within-grade increases...

  17. SAGE ANALYSIS OF TRANSCRIPTOME RESPONSES IN ARABIDOPSIS ROOTS EXPOSED TO 2,4,6-TRINITROTOLUENE

    Science.gov (United States)

    Serial Analysis of Gene Expression (SAGE) was used to profile transcript levels in Arabidopsis thaliana roots and assess their responses to 2,4,6-trinitrotoluene (TNT) exposure. SAGE libraries representing control and TNT-exposed seedling root transcripts were constructed, and ea...

  18. 8 CFR 246.4 - Immigration judge's authority; withdrawal and substitution.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Immigration judge's authority; withdrawal... IMMIGRATION REGULATIONS RESCISSION OF ADJUSTMENT OF STATUS § 246.4 Immigration judge's authority; withdrawal and substitution. In any proceeding conducted under this part, the immigration judge shall...

  19. Levan-type fructooligosaccharide production using Bacillus licheniformis RN-01 levansucrase Y246S immobilized on chitosan beads

    Directory of Open Access Journals (Sweden)

    Surawut Sangmanee

    2016-06-01

    Full Text Available Bacillus licheniformis RN-01 levansucrase Y246S (LsRN-Y246S was immobilized by covalently linking onto chitosan, Sepabead EC-EP, and Sepabead EC-HFA, beads. The stability of immobilized LsRN-Y246S was found to be the highest with chitosan beads, retaining more than 70% activity after 13 weeks storage at 4 oC, and 68% activity after 12 hours incubation at 40°C. LsRN-Y246S immobilized on chitosan beads withstands sucrose concentrations up to 70% (w/v, retaining over 85% of its activity, significantly better than LsRN-Y246S immobilized on others supporting matrices. LsRN-Y246S immobilized on chitosan showed a 2.4 fold increase in activity in the presence of Mn2+, and gave slight protection against deactivation by of Cu2+, Zn2+, Fe3+, SDS and EDTA. A maximum of 8.36 g and an average of 7.35 g LFOS yield at least up to DP 11 can be produced from 25 g of sucrose, during five production cycles. We have demonstrated that LFOS can be effectively produced by chitosan immobilized LsRN-Y246S and purified.

  20. Californium Recovery from Palladium Wire

    Energy Technology Data Exchange (ETDEWEB)

    Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-08-01

    The recovery of 252Cf from palladium-252Cf cermet wires was investigated to determine the feasibility of implementing it into the cermet wire production operation at Oak Ridge National Laboratory’s Radiochemical Engineering Development Center. The dissolution of Pd wire in 8 M HNO3 and trace amounts of HCl was studied at both ambient and elevated temperatures. These studies showed that it took days to dissolve the wire at ambient temperature and only 2 hours at 60°C. Adjusting the ratio of the volume of solvent to the mass of the wire segment showed little change in the kinetics of dissolution, which ranged from 0.176 mL/mg down to 0.019 mL/mg. A successful chromatographic separation of 153Gd, a surrogate for 252Cf, from Pd was demonstrated using AG 50x8 cation exchange resin with a bed volume of 0.5 mL and an internal diameter of 0.8 cm.

  1. White upconversion luminescence nanocrystals for the simultaneous and selective detection of 2,4,6-trinitrotoluene and 2,4,6-trinitrophenol.

    Science.gov (United States)

    Ma, Yingxin; Huang, Sheng; Deng, Mingliang; Wang, Leyu

    2014-05-28

    A highly water stable and strong upconversion (UC) luminescence NaYF4@PSI-NH nanosensor for the simultaneous and selective detection of 2,4,6-trinitrotoluene (TNT) and 2,4,6-trinitrophenol (TNP) was successfully developed. Via the 980 nm near-infrared (NIR) irradiation, these nanosensors emit strong white UC luminescence with five typical emission peaks centered at 363, 455, 475, 546, and 654 nm. The UC emission at both 363 and 546 nm was quenched by the addition of TNT; however, the ratio of luminescence intensity at 363 nm to 546 nm (I363/I546) had no change with the increase of TNT concentration. Meanwhile, only violet UC emission at 363 nm was dramatically quenched via the addition of TNP, and the I363/I546 ratio is negatively proportional to the TNP concentration in the range of 0.01-4.5 μg/mL of TNP. On the other hand, the green UC emission intensity at 546 nm is in negative proportion to the concentration of TNT. Moreover, cyclohexane, toluene, and other nitroaromatics (such as 2,4-dinitrotoluene (DNT) and nitrobenzene (NB)) have no influence on the detection. Therefore, we developed a facile method for the simultaneous and selective detection of TNT and TNP in the mixture solution of nitroaromatics independent of complicated instruments and sample pretreatment. PMID:24734988

  2. Vicarious nucleophilic substitution to prepare 1,3-diamino-2,4,6-trinitrobenzene or 1,3,5-triamino-2,4,6-trinitrobenzene

    Science.gov (United States)

    Mitchell, A.R.; Pagoria, P.F.; Schmidt, R.D.

    1996-10-29

    The present invention relates to a process to produce 1,3-diamino-2,4,6-trinitrobenzene (DATB) or 1,3,5-triamino-2,4,6,trinitrobenzene (TATB) by: (a) reacting at ambient pressure and a temperature of between about 0 and 50 C for between about 0.1 and 24 hr, a trinitroaromatic compound of the structure shown within where X, Y, and Z are each independently selected from --H, or --NH{sub 2}, with the proviso that at least 1 or 2 of X, Y, and Z are hydrogen, with an amount effective to produce DATB or TATB, or 1,1,1-trialkylhydrazinium halide wherein alkyl is selected from methyl, ethyl, propyl or butyl and halide is selected from chloride, bromide or iodide, in the presence of a strong base selected from sodium butoxide, potassium butoxide, potassium propoxide, sodium propoxide, sodium ethoxide, potassium ethoxide, sodium methoxide, potassium methoxide, and combinations thereof; in a solvent selected from the group consisting of methanol, ethanol, propanol, butanol, dimethylsulfoxide, N-methylpyrrolidone, hexamethylphosphoramide, dimethylformide, dimethylacetamide and mixtures thereof, provided that when alcohols are present primarily DATB and picramide is formed; and (b) isolating the DATB or TATB produced. DATB and TATB are useful specialty explosives. TATB is also used for the preparation of benzenehexamine, a starting material for the synthesis of novel materials (optical imaging devices, liquid crystals, ferromagnetic compounds).

  3. Theoretical design of energetic nitrogen-rich derivatives of 1,7-diamino-1,7-dinitrimino-2,4,6-trinitro-2,4,6-triazaheptane.

    Science.gov (United States)

    Wu, Qiong; Zhu, Weihua; Xiao, Heming

    2013-08-01

    The heats of formation (HOFs), energetic properties, and thermal stability of a series of 1,7-diamino-1,7-dinitrimino-2,4,6-trinitro-2,4,6-triazaheptane derivatives with different substituents, different numbers of substituents, and different original chains are found by using the DFT-B3LYP method. The results show that -NO2 or -NH2 is an effective substituent for increasing the gas-phase HOFs of the title compounds, especially -NO2 group. As the numbers of substitutents increase, their HOFs enhance obviously. Increasing the length of original chain is helpful for improving their HOFs. The substitution of -NO2 is useful for enhancing their detonation performances and the effects of the length of original chains on detonation properties are coupled with those of the substituents. An analysis of the BDE of the weakest bonds indicates that the substitution of the -NH2 groups and replacing the -NO2 groups of N-NO2 by the -NH2 groups are favorable for improving their thermal stability, while the substitution of -NO2 and increasing the length of original chain decrease their thermal stability. Considering the detonation performance and thermal stability, seven compounds may be considered as the potential candidates of high energy density compounds. PMID:23559097

  4. Synthesis and structure of diorganotin dibromides, R2SnBr2 (R = 2,4,6-trimethylphenyl or 2,4,6-trimethylbenzyl): Hydrolysis of (2,4,6-Me3C6H2)2SnBr2

    Indian Academy of Sciences (India)

    Vadapalli Chandrasekhar; Ramalingam Thirumoorthi

    2010-09-01

    The reaction of SnBr4 with in situ generated 2,4,6-trimethylphenylmagnesium bromide afforded a mixture of (2,4,6-Me3C6H2)2SnBr2 (1) and (2,4,6-Me3C6H2)3SnBr (2) which could be separated from each other by their solubility differences in diethyl ether. On the other hand, the reaction of tin metal with 2,4,6-Me3C6H2CH2Br afforded (2,4,6-Me3C6H2CH2)2SnBr2 (3). Hydrolysis of the latter using triethylamine as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(Br)(-OH)]2.2CH2Cl2 (4) while the use of NaOH as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(OH)(-OH)]2.2CH2Cl2 (5). Compounds 4 and 5 are dimeric tetraorganodistannoxanes consisting of a central distannoxane (Sn2O2) motif.

  5. 1,2-Bis(dimethylamino-1,2-bis(2,4,6-triisopropylphenyldiborane(4

    Directory of Open Access Journals (Sweden)

    Alexander Damme

    2010-12-01

    Full Text Available In the molecular structure of the title compound, C34H58B2N2, each B atom of the diborane(4 is connected to one dimethylamino group and one Tip ligand (Tip = 2,4,6-triisopropylphenyl. These findings indicate that the increased steric demand of the Tip groups exerts influence solely on the B—B separation but not on the overall geometry of the title compound.

  6. Development of the small-molecule antiviral ST-246® as a smallpox therapeutic

    OpenAIRE

    Grosenbach, Douglas W.; Jordan, Robert; Hruby, Dennis E

    2011-01-01

    Naturally occurring smallpox has been eradicated, yet it remains as one of the highest priority pathogens due to its potential as a biological weapon. The majority of the US population would be vulnerable in a smallpox outbreak. SIGA Technologies, Inc. has responded to the call of the US government to develop and supply to the Strategic National Stockpile a smallpox antiviral to be deployed in the event of a smallpox outbreak. ST-246® (tecovirimat) was initially identified via a high-throughp...

  7. 2,4,6-Trichloroanisole is a potent suppressor of olfactory signal transduction

    OpenAIRE

    Takeuchi, Hiroko; Kato, Hiroyuki; Kurahashi, Takashi

    2013-01-01

    Off-flavor substances generated naturally in foods/beverages deteriorate the quality of products considerably. Generally, it has been thought that off-flavor substances induce unpleasant smells exogenously. Here, however, we show that 2,4,6-trichroloanisole (TCA), known as one of the strongest off-flavors, inhibits ciliary transduction channels. Surprisingly, suppression was caused with 1-aM solution. The TCA effect showed slow kinetics, with an integration time of approximately 1 s, and posi...

  8. 2,4,6-Trinitrotoluene Reduction by Carbon Monoxide Dehydrogenase from Clostridium thermoaceticum

    OpenAIRE

    Huang, Shouqin; Lindahl, Paul A.; Wang, Chuanyue; Bennett, George N.; Rudolph, Frederick B.; Hughes, Joseph B.

    2000-01-01

    Purified CO dehydrogenase (CODH) from Clostridium thermoaceticum catalyzed the transformation of 2,4,6-trinitrotoluene (TNT). The intermediates and reduced products of TNT transformation were separated and appear to be identical to the compounds formed by C. acetobutylicum, namely, 2-hydroxylamino-4,6-dinitrotoluene (2HA46DNT), 4-hydroxylamino-2,6-dinitrotoluene (4HA26DNT), 2,4-dihydroxylamino-6-nitrotoluene (24DHANT), and the Bamberger rearrangement product of 2,4-dihydroxylamino-6-nitrotolu...

  9. Structural Studies of N-(2,4,6-trisubstitutedphenyl)-Chloroacetamides, 2,4,6-X3C6 H2 -NHCO-CH3_y Cly, (X = CH3 or Cl and y = 1 -3)

    Science.gov (United States)

    Gowda, B. Thimme; Svoboda, I.; Fuess, Hartmut

    2000-10-01

    The effect of side chain and ring substitutions on the crystal structures of N-(2,4,6-substitutedpheny)- chloroacetamides of the type, 2,4,6-X3C6H2-NHCO-CH3_yCly (X = CH3 or Cl and 1 ⩽ y ⩽ 3), has been studied by determining the crystal structures of N-(2,4,6-trimethylphenyl)- 2-chloroacetamide, 2,4,6-(CH3)3C6H2-NHCO-CH2Cl (TMPMCA); N-(2,4,6-trichlorophenyl)-2- chloroacetamide, 2,4,6-Cl3C6H2-NHCO-CH2Cl (TCPMCA); N-(2,4,6-trichlorophenyl)-2,2-dichloroacetamide, 2,4,6-Cl3C6H2-NHCO-CHCl2 (TCPDCA) and N-(2,4,6-trichlorophenyl)-2,2,2- trichloroacetamide, 2,4,6-Cl3C6H2-NHCO-CCl3 (TCPTCA). The crystal type, space group, formula units and lattice constants in A are: (TMiPMCA); monoclinic, P21,/n, Z = 8, a = 9.029(5), b = 15.688(2), c = 16.150(3), ß = 96.77(2)°; (TCPMCA): orthorhombic, Pna21, Z = 8, a = 30.708(4), b = 4.685(1), c = 14.506(2); (TCPDCA) orthorhombic, P212121 Z = 4, a = 16.459(3), b = 15.240(3), c = 4.640(1) and (TCPTCA): triclinic, P Ī , Z = 4, a = 9.828(2), b = 11.953(2), c = 12.278(2), a = 71,05( 1)°, ß = 75.26(2)°, g = 83.29( 1)°. The results have been analysed along with the structures of the ring unsubstituted N-phenylacetamide (PA), N-phenyl-2,2,2-trichloro-acetamide, side chain unsubstituted N-(2,4,6-trichlorophenyl)-acetamide, 2,4,6-Cl3C6H2-NHCO-CH3 (TCPA) and the corresponding di-substituted phenyl acetamides and chloroacetamides. The compounds TMPMCA, TCPMCA and TCPTCA have 2 molecules each in their asymmetric units. This is in agreement with the multiple lines observed in the 35CI NQR spectra of TCPTCA. Further, this compound shows disorder as indicated by the multiplicity of the C(side chain) - Cl bonds. The compound TCPMCA does not show 35C1 NQR spectra, while the compound TMPMCA shows a single frequency which fades out above 200 K, indicating that it may undergo a phase transition well below room temperature. Conversion of 2,4,6-trichloroaniline into 2,4,6-trichlorophenyl acetamide and gradual replacement of H-atoms in the side chain

  10. Monoklonale Antikörper zum Nachweis von 2,4,6-Trichloranisol in Kork

    OpenAIRE

    Lausterer, Ralph

    2005-01-01

    Die Verbindung 2,4,6-Trichloranisol (TCA) kann in Kork und Wein vorkommen. TCA entsteht durch mikrobielle Umsetzung von Chlorphenolen. In den betroffenen Industrien führt TCA zu jährlichen Verlusten von mehr als einer Milliarde €. Zur Bestimmung von TCA sollten enzymkoppelte Immunabsorptionstest (ELISAs) mit monoklonalen Antikörpern (mAk) entwickelt werden. Es wurden drei TCA-spezifische mAk-produzierende Zelllinien gewonnen. Mit diesen mAk wurden hochsensitive ELISAs hergstellt, die eine Nac...

  11. Synthesis of 2,4,6-triamino-1,3,5- trinitrobenzene

    Directory of Open Access Journals (Sweden)

    Gilson da Silva

    2011-01-01

    Full Text Available The 2,4,6-triamino-1,3,5-trinitrobenzene (TATB is perhaps the most thermostable and insensitive explosive known. Its low sensibility to shock makes it suitable for military and civil applications. TATB application is done either alone or in combination with another high energetic material. This study aimed at reporting the review about many processes to produce TATB and the problems associated with them, as well as suggest techniques like Fourier Transform Infrared Spectroscopy (FT-IR and Differential Scanning Calorimetry (DSC, which can be useful in the characterization of this energetic compound.

  12. Thermal Decomposition Kinetics of Lead 2,4,6-Trinitroresorcinate Monohydrate

    Institute of Scientific and Technical Information of China (English)

    HU Rong-zu; YAO Pu; LI Jing; CHEN San-ping; GAO Sheng-li; ZHAO Feng-qi; SONG Ji-rong; SHI Qi-zhen; CHEN Pei; LUO Yang; ZHAO Hong-an

    2004-01-01

    The non-isothermal decomposition of lead 2,4,6-trinitroresorcinate monohydrate, Pb (TNR) · H2O. was investigated by means of TG-DTA, DSC and IR. The thermal decomposition mechanism and the dissociated kinetics were also investigated. The kinetic parameters were obtained from the analysis of the DSC curves by integral and differential methods. The most probable kinetic model function of the dehydration reaction of Pb(TNR) · H2O was suggested by the comparison of the kinetic parameters.

  13. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: ce_delgado89@hotmail.com [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)

    2015-10-15

    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  14. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Antonio

    1976-07-01

    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  15. Synthesis of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide – a tailor-made photoinitiator for dental adhesives

    OpenAIRE

    Moszner, Norbert; Lamparth, Iris; Angermann, Jörg; Fischer, Urs Karl; Zeuner, Frank; Bock, Thorsten; Liska, Robert; Rheinberger, Volker

    2010-01-01

    Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide (WBAPO) was synthesized starting from 3-(chloromethyl)-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxy)ethanol. In the second step, 3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated...

  16. WE-A-18A-01: TG246 On Patient Dose From Diagnostic Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Supanich, M [Rush University Medical Center, Chicago, IL (United States); Dong, F [The Cleveland Clinic, Solon, OH (United States); Andersson, J [Umea University, Umea (Sweden); Pavlicek, W [Mayo Clinic Arizona, Scottsdale, AZ (United States); Bolch, W [University Florida, Gainesville, FL (United States); Fetterly, K [Mayo Clinic, Rochester, MN (United States)

    2014-06-15

    Radiation dose from diagnostic and interventional radiations continues to be a focus of the regulatory, accreditation and standards organizations in the US and Europe. A Joint AAPM/EFOMP effort has been underway in the past year — having the goal to assist the clinical medical physicist with communicating optional and varied approaches in estimating (and validating) patient dose. In particular, the tools provided by DICOM Radiation Dose Structured Reports, either by themselves or as part of a networked data repository of dose related information are a rich source of actionable information. The tools of the medical physicist have evolved to include using DICOM data in meaningful ways to look at patient dose with respect to imaging practices. In addition to how accurate or reproducible a dose value is (totally necessary and our traditional workspace) it is now being asked how reproducible (patient to patient, device to device) are the delivered doses (new tasking)? Clinical medical physicists are best equipped to assist our radiology and technologist colleagues with this effort. The purpose of this session is to review the efforts of TG246 - bringing forward a summary content of the TG246 Report including specific dose descriptors for CT and Fluoroscopy — particularly in a focus of leveraging the RDSR as a means for monitoring good practices ALARA. Additionally, rapidly evolving technologies for more refined dose estimates are now in use. These will be presented as they look to having highly patient specific dose estimates in automated use.

  17. Identification and responsibility of 2,4,6-tribromoanisole in musty, corked odors in wine.

    Science.gov (United States)

    Chatonnet, Pascal; Bonnet, Sandra; Boutou, Stéphane; Labadie, Marie-Dominique

    2004-03-10

    In this work, gas phase chromatography analysis coupled with selective selected ion monitoring (SIM) identified 2,4,6-tribromoanisole (TBA) in wines found on tasting to have significant "musty or corked" character, although they did not contain noteworthy quantities of chloroanisoles or chlorophenols, the contaminants generally reported to cause this type of defect. The perception thresholds were studied, together with contamination conditions during winemaking, storage, and bottle-aging. A "musty" off-odor was perceptible on smelling wine containing as little as 4 ng L(-)(1) TBA, and spoilage may be detected by retro-olfaction at even lower concentrations. TBA, produced by O-methylation of its direct precursor, 2,4,6-tribromophenol, generally comes from sources in the winery environment. This paper is the first to identify the sources of a large number of cases of wines polluted during storage in premises where the atmosphere was contaminated with TBA used recently to treat wood, or originating from much older structural elements of the winery, or from used wooden containers. In certain cases, although the initial source had been eliminated, residual pollution adsorbed on walls could be sufficient to make a building unsuitable for storing wooden barrels and plastics, as well as corks, which have been found to be particularly susceptible to contamination by the TBA in the winery atmosphere. PMID:14995130

  18. Ecotoxicological evaluation of wastewater from 2.4.6-TNT production.

    Science.gov (United States)

    Ribeiro, Elaine N; Da Silva, Flávio Teixeira; De Paiva, Teresa Cristina Brazil

    2012-01-01

    During the manufacture of explosives, large amounts of water are used to remove unwanted by-products generated. This water in turn, ends up in wastewater treatment plants or water bodies. The aim of this study was to evaluate the toxic potential of effluent generated by 2.4.6-Trinitrotoluene (TNT) production, yellow water, red water and mixture of yellow and red water, produced from a plant located in the Paraíba Valley, São Paolo state, Brazil. Daphnia similis, Danio rerio, Escherichia coli, Pseudomonas putida and Pseudokircheneriella subcaptata were used as test organisms. Physicochemical parameters such as color, pH, conductivity, total dissolved solids, dissolved oxygen, chemical oxygen demand (COD) and biochemical oxygen demand (BOD) were evaluated. Effluent from 2.4.6-TNT production was extremely toxic to all test organisms. The physicochemical parameters evaluated showed high levels of conductivity (from 41.533 to 42.344 μS /cm) and chemical oxygen demand (COD of 8471 to 27.364 mg/L) for the effluents analyzed. PMID:22242870

  19. WE-A-18A-01: TG246 On Patient Dose From Diagnostic Radiation

    International Nuclear Information System (INIS)

    Radiation dose from diagnostic and interventional radiations continues to be a focus of the regulatory, accreditation and standards organizations in the US and Europe. A Joint AAPM/EFOMP effort has been underway in the past year — having the goal to assist the clinical medical physicist with communicating optional and varied approaches in estimating (and validating) patient dose. In particular, the tools provided by DICOM Radiation Dose Structured Reports, either by themselves or as part of a networked data repository of dose related information are a rich source of actionable information. The tools of the medical physicist have evolved to include using DICOM data in meaningful ways to look at patient dose with respect to imaging practices. In addition to how accurate or reproducible a dose value is (totally necessary and our traditional workspace) it is now being asked how reproducible (patient to patient, device to device) are the delivered doses (new tasking)? Clinical medical physicists are best equipped to assist our radiology and technologist colleagues with this effort. The purpose of this session is to review the efforts of TG246 - bringing forward a summary content of the TG246 Report including specific dose descriptors for CT and Fluoroscopy — particularly in a focus of leveraging the RDSR as a means for monitoring good practices ALARA. Additionally, rapidly evolving technologies for more refined dose estimates are now in use. These will be presented as they look to having highly patient specific dose estimates in automated use

  20. Visual detection of 2,4,6-trinitrotolune by molecularly imprinted colloidal array photonic crystal.

    Science.gov (United States)

    Lu, Wei; Asher, Sanford A; Meng, Zihui; Yan, Zequn; Xue, Min; Qiu, Lili; Yi, Da

    2016-10-01

    We developed a photonic crystal (PhC) sensor for the quantification of 2,4,6-trinitrotoluene (TNT) in solution. Monodisperse (210nm in diameter) molecularly imprinted colloidal particles (MICs) for TNT were prepared by the emulsion polymerization of methyl methacrylate and acrylamide in the presence of TNT as a template. The MICs were then self-assembled into close-packed opal PhC films. The adsorption capacity of the MICs for TNT was 64mg TNT/g. The diffraction from the PhC depended on the TNT concentration in a methanol/water (3/2, v/v) potassium dihydrogen phosphate buffer solution (pH=7.0, 30mM). The limit of detection (LOD) of the sensor was 1.03μg. The color of the molecularly imprinted colloidal array (MICA) changed from green to red with an 84nm diffraction red shift when the TNT concentration increased to 20mM. The sensor response time was 3min. The PhC sensor was selective for TNT compared to similar compounds such as 2,4,6-trinitrophenol, 2,4-dinitrotoluene, 2,6-dinitrotoluene, 2-nitromesitylene, 4-nitrotoluene, 2-nitrotoluene, 1,3-dinitrobenzene, methylbenzene, 4-nitrophenol, 2-nitroaniline, 3-aminophenol and 3-nitroaniline. The sensor showed high stability with little response change after three years storage. This sensor technology might be useful for the visual determination of TNT. PMID:27214001

  1. 儿童支气管异物246例临床分析%Clinical analysis of bronchial foreign bodies in 246 children

    Institute of Scientific and Technical Information of China (English)

    马渝燕; 焦安夏; 江沁波; 饶小春; 潘跃娜; 刘玺诚

    2010-01-01

    目的 回顾性研究儿童支气管异物的临床特点以及电子支气管镜在诊断治疗儿童支气管异物中的作用.方法 2000年1月至2009年8月北京儿童医院经支气管镜诊断治疗的支气管异物患儿246例,应用Olympus电子支气管镜,在局部黏膜麻醉下经鼻插入支气管镜逐级观察支气管结构,使用篮状异物钳或齿状异物钳钳取异物.结果 246例患儿中,支气管异物以果仁或果壳类(230例,占93.5%)最为常见,异物嵌顿位置以右下叶支气管开口(98例,占39.8%)为最多.钳取异物手术次数平均为(1.9±1.3)次,一次取出率为58.5%(144例).阻塞于左右主支气管、右中叶和右下叶支气管的异物一次取出率较高,分别为91.1%、60.0%和55.1%.篮状异物钳钳取所需次数(1.4±0.9)明显低于齿状异物钳所需次数(2.1±1.4),差异有统计学意义(P=0.000).结论 儿童支气管异物种类以果仁或果壳类植物性异物为主,阻塞部位以右下支气管为多见.位于左右主支气管异物一次取出率明显高于其他部位.用篮状异物钳钳取异物所需手术次数明显少于使用齿状异物钳.%Objective To analyze the characters of bronchial foreign bodies in children and the utilization of bronchoscope in the treatment of bronchial foreign bodies. Methods A total of 246 children were diagnosed with bronchial foreign bodies at our hospital during January 2000 until August 2009. Under local mucosal anesthesia, a bronchoscope was inserted through nasal cavity into bronchi. After identifying the site of foreign body, grasping forceps was guided through bronchoscope to remove the foreign body from airway. Results Among 246 cases, hard nut and skin of melon seed were found ( n = 230, 93.5% ). The most common site of foreign body was in right lower lobe bronchi ( n =98, 38.9% ). The average operative frequency was 1.9 ± 1.3 and one-time extraction ratio 58.5% ( n = 144). The one-time extraction ratio of patients with foreign

  2. Timing analysis of the X-ray transient source XTE J1806--246 (2S1803--245)

    OpenAIRE

    Revnivtsev, M.; Borozdin, K.; A. Emelyanov

    1999-01-01

    An outburst of the X-ray transient source XTE J1806--246 (2S1803--245) has been observed by Rossi X-ray Timing Explorer in April-July 1998. Strong quasi-periodical oscillations (QPO) with a central peak frequency around 9 Hz was detected in one observation of the series performed by PCA/RXTE experiment. X-ray flux from the source during the observation with QPO was maximal. The energy spectrum of XTE J1806--246 at this time was softer than for other observations. A sufficient variability of t...

  3. Chemically catalyzed uptake of 2,4,6-trinitrotoluene by Vetiveria zizanioides.

    Science.gov (United States)

    Makris, Konstantinos C; Shakya, Kabindra M; Datta, Rupali; Sarkar, Dibyendu; Pachanoor, Devanand

    2007-07-01

    The efficiency of vetiver grass (Vetiveria zizanioides) in removing 2,4,6-trinitrotoluene (TNT) from aqueous media was explored in the presence of a common agrochemical, urea, used as a chaotropic agent. Chaotropic agents disrupt water structure, increasing solubilization of hydrophobic compounds (TNT), thus, enhancing plant TNT uptake. The primary objectives of this study were to: (i) characterize TNT absorption by vetiver in hydroponic media, and (ii) determine the effect of urea on chemically catalyzing TNT uptake by vetiver grass in hydroponic media. Results showed that vetiver exhibited a high TNT uptake capacity (1.026 mgg(-1)), but kinetics were slow. Uptake was considerably enhanced in the presence of urea, which significantly (pvetiver grass. PMID:17240499

  4. The high-pressure phase behavior and compressibility of 2,4,6-trinitrotoluene

    Energy Technology Data Exchange (ETDEWEB)

    Stevens, Lewis L.; Velisavljevic, Nenad; Hooks, Daniel E.; Dattelbaum, Dana M. (LANL)

    2008-10-24

    The phase stability and isothermal compression behavior of 2,4,6-trinitrotoluene (TNT) have been established to 26.5 GPa using angle-dispersive x-ray diffraction. P-V isotherms derived from the high-pressure x-ray spectra displayed a slight density hysteresis around 4.0 GPa and a sharp discontinuity at - 20.0 GPa. The latter transition is ascribed to a monoclinic-to-orthorhombic first-order phase transition in TNT. The conversion of the isothermal P-V data to the shock velocity-particle velocity plane revealed a deviation from linearity at low u{sub p}, a cusp associated with the phase transition at high u{sub p}, and general agreement with the wealth of unreacted Hugoniot data on TNT.

  5. Crystal structure of [2-(triethylammonioethyl][(2,4,6-triisopropylphenylsulfonyl]amide tetrahydrate

    Directory of Open Access Journals (Sweden)

    C. Golz

    2015-05-01

    Full Text Available The zwitterionic title compound, C23H42N2O2S·4H2O, crystallized as a tetrahydrate from a solution of N-[(2,4,6-triisopropylphenylsulfonyl]aziridine in triethylamine, diethyl ether and pentane in the presence of moist air. It is formed by a nucleophillic ring-opening that is assumed to be reversible. The molecular structure shows a major disorder of the triisopropylphenyl group over two equally occupied locations. An interesting feature is the uncommon hydrate structure, exhibiting a tape-like motif which can be classified as a transition of the one-dimensional T4(26(2 motif into the two-dimensional L4(65(76(8 motif.

  6. The high-pressure phase stability of 2,4,6-trinitrotoluene (TNT)

    Science.gov (United States)

    Bowden, P. R.; Chellappa, R. S.; Dattelbaum, D. M.; Manner, V. W.; Mack, N. H.; Liu, Z.

    2014-05-01

    2,4,6-trinitrotoluene (TNT) is a widely used explosive that is relatively insensitive to initiation by shock loading. While the detonation properties of TNT have been extensively reported, the high pressure-temperature (P-T) stability of TNT has not been investigated in detail. At ambient conditions, TNT crystallizes in a monoclinic lattice (space group P21/a), and our previous X-ray diffraction (XRD) measurements at room temperature suggested a phase transition to orthorhombic (space group Pca21) at ~20 GPa. In this work, we have performed in-situ synchrotron XRD and vibrational spectroscopy measurements along the room temperature isotherm to investigate phase stabilities up to 18 GPa. While our Raman spectroscopy measurements indicate spectral changes at ~2 GPa, careful XRD measurements reveal that the monoclinic phase persists up to 10 GPa.

  7. The high-pressure phase stability of 2,4,6-trinitrotoluene (TNT)

    International Nuclear Information System (INIS)

    2,4,6-trinitrotoluene (TNT) is a widely used explosive that is relatively insensitive to initiation by shock loading. While the detonation properties of TNT have been extensively reported, the high pressure-temperature (P-T) stability of TNT has not been investigated in detail. At ambient conditions, TNT crystallizes in a monoclinic lattice (space group P21/a), and our previous X-ray diffraction (XRD) measurements at room temperature suggested a phase transition to orthorhombic (space group Pca21) at ∼20 GPa. In this work, we have performed in-situ synchrotron XRD and vibrational spectroscopy measurements along the room temperature isotherm to investigate phase stabilities up to 18 GPa. While our Raman spectroscopy measurements indicate spectral changes at ∼2 GPa, careful XRD measurements reveal that the monoclinic phase persists up to 10 GPa.

  8. Poly[[triaqua(μ3-pyridine-2,4,6-tricarboxylatoterbium(III] monohydrate

    Directory of Open Access Journals (Sweden)

    Hong-lin Zhu

    2012-07-01

    Full Text Available The asymmetric unit of the title compound, {[Tb(C8H2NO6(H2O3]·H2O}n, contains one TbIII ion, one pyridine-2,4,6-tricarboxylate (ptc anion, three aqua ligands and one lattice water molecule. The TbIII ion is nine coordinated by one N and five O atoms from three ptc ligands and by three O atoms from the three aqua ligands in a distorted bicapped trigonal–prismatic geometry. The ptc ligands bridge the TbIII ions into a two-dimensional polymeric framework parallel to (100. An extensive O—H...O hydrogen-bonding network consolidates the crystal packing.

  9. High uptake of 2,4,6-trinitrotoluene by vetiver grass--potential for phytoremediation?

    Science.gov (United States)

    Makris, Konstantinos C; Shakya, Kabindra M; Datta, Rupali; Sarkar, Dibyendu; Pachanoor, Devanand

    2007-03-01

    2,4,6-Trinitrotoluene (TNT) is a potent mutagen, and a Group C human carcinogen that has been widely used to produce munitions and explosives. Vast areas that have been previously used as ranges, munition burning, and open detonation sites are heavily contaminated with TNT. Conventional remediation activities in such sites are expensive and damaging to the ecosystem. Phytoremediation offers a cost-effective, environment-friendly solution, utilizing plants to extract TNT from contaminated soil. We investigated the potential use of vetiver grass (Vetiveria zizanioides) to effectively remove TNT from contaminated solutions. Vetiver grass plants were grown in hydroponic systems containing 40 mg TNTL(-1) for 8d. Aqueous concentrations of TNT reached the method detection limit ( approximately 1 microg L(-1)) within the 8-d period, demonstrating high affinity of vetiver for TNT, without any visible toxic effects. Results from this preliminary hydroponic study are encouraging, but in need of verification using TNT-contaminated soils. PMID:16899329

  10. Reliability of optical fibres and components final report of COST 246

    CERN Document Server

    Griffioen, Willem; Gadonna, Michel; Limberger, Hans; Heens, Bernard; Knuuttila, Hanna; Kurkjian, Charles; Mirza, Shehzad; Opacic, Aleksandar; Regio, Paola; Semjonov, Sergei

    1999-01-01

    Reliability of Optical Fibres and Components reports the findings of COST 246 (1993-1998) - European research initiative in the field of optical telecommunications. Experts in the materials and reliability field of optical fibres and components have contributed to this unique study programme. The results, conclusions and achievements of their work have been obtained through joint experimentation and discussion with representatives from manufacturing and research groups. Topics covered include: Lifetime estimation; Failure mechanisms; Ageing test methods; Field data and service environments for components. For the first time the reader can explore the reliability of products and examine the results and conclusions in published form. This comprehensive volume is intended to provide a deeper understanding of the reliability of optical fibres and components. The book will be extremely useful to all scientists and practitioners involved in the industry.

  11. Oral exposure of adult zebrafish (Danio rerio) to 2,4,6-tribromophenol affects reproduction

    DEFF Research Database (Denmark)

    Halden, Anna Norman; Nyholm, Jenny Rattfelt; Andersson, Patrik L;

    2010-01-01

    not significantly affected, but yolk-sac oedema tended to increase in frequency in exposed groups with time. Our results show that dietary exposure to TBP, at concentrations found in marine organisms that are part of the natural diet of wild fish, can interfere with reproduction in zebrafish. We also......The bromophenol 2,4,6-tribromophenol (TBP) is widely used as an industrial chemical, formed by degradation of tetrabromobisphenol-A, and it occurs naturally in marine organisms. Concentrations of TBP in fish have been related to intake via feed, but little is known about effects on fish health...... after oral exposure. In this study, we exposed adult male and female zebrafish (Danio rerio) to TBP via feed in nominal concentrations of 33, 330, and 3300 mu g/g feed (or control feed) for 6 weeks to assess the effects of TBP on reproductive output, gonad morphology, circulatory vitellogenin levels...

  12. Towards the island of superheavy stability - Prompt spectroscopy of 246Fm and 256Rf nuclei

    International Nuclear Information System (INIS)

    The region of trans-fermium nuclei (Z = 100 to 104) is the last region of the nuclides chart to be accessible to spectroscopic measurements. It therefore provides the ultimate anchor points for nuclear models. This region also lies on the path of the alpha-decay chains of the super-heavy elements. This region represents the limit of today's spectroscopic capabilities. It therefore requires technological developments in order to overcome these limits. My thesis focuses on various aspects of the spectroscopy of trans-fermium nuclei. I took part in the development of the TNT2D digital acquisition cards for germanium detectors. I validated their use on the gamma-ray spectrometer JUROGAM during an in-beam experiment and demonstrated the gain compared to an analogue acquisition system. These tests were part of the developments needed to secure a study of the prompt spectroscopy of 256Rf. The preparation of this experiment also lead me to work on the development of a 50Ti beam. For that purpose, I studied and tested the use of titanium organo-metallic compounds compatible with the MIVOC technique. In parallel, I studied the use of metallic and oxide titanium pellets with an inductive oven newly developed at the University of Jyvaeskylae. In addition to these developments, I had the opportunity to study the in-beam prompt spectroscopy of 246Fm at the University of Jyvaeskylae. The measurements yielded a rotational band built on the ground state of 246Fm. This band has been observed up to the level 16+ and shows a behaviour quite similar to the neighbouring even-even isotopes, except for the top of the band for which a wider statistics is necessary in order to conclude. (author)

  13. Susceptibility of male and female Japanese medaka (Oryzias latipes) to 2,4,6-trichlorophenol-induced micronuclei in peripheral erythrocytes

    Institute of Scientific and Technical Information of China (English)

    Nannan LIU; Mei MA; Yiping XU; Jinmiao ZHA; Kaifeng RAO; Zijian WANG

    2013-01-01

    2,4,6-trichlorophenol (2,4,6-TCP) is a wide- spread probable human carcinogen and has been proven to have genotoxicity in in vitro assays. However, little genotoxicity information and no micronuclei induction data for 2,4,6-TCP is available from in vivo tests, especially for sex-specific differences. Following a preliminary test, a piscine peripheral erythrocyte micro- nucleus assay was conducted on medaka (Oryzias latipes) after a 28-day exposure to 2,4,6-TCE In the present study, the mean micronuclei (MNC) frequencies of all of the groups increased in a dose-dependent manner, which indicated the potential genotoxicity of 2,4,6-TCE More- over, males were found to be more susceptible compared with females after a 28-day exposure to 2,4,6-TCP in all of the dosed groups above 10 ~tg-L-1. This is the first report on the potential of micronuclei induction and a sex-susceptible effect in the peripheral erythrocytes of mature fish after 2,4,6-TCP in vivo exposure.

  14. Highly sensitive detection of 2,4,6-trichlorophenol based on HS-β-cyclodextrin/gold nanoparticles composites modified indium tin oxide electrode

    International Nuclear Information System (INIS)

    Graphical abstract: Display Omitted -- Highlights: •A novel electrochemical sensing platform by self-assembling of HS-β-cyclodextrin/gold nanoparticles onto indium tin oxide electrode (HS-β-CD/AuNPs/SAM/ITO electrode) surface was constructed. •The proposed electrochemical sensor exhibited high sensitivity for the determination 2,4,6-trichlorophenol which electrochemical activity is very weak. •The newly developed method was successfully applied to quantitatively determine 2,4,6-trichlorophenol in tap water samples. -- ABSTRACT: A new electrochemical sensor for determination of 2,4,6-trichlorophenol (2,4,6-TCP) was fabricated. The characterization of the sensor was studied by scanning electron microscopy, electrochemical impedance spectroscopy and cyclic voltammetry techniques. The electrochemical behavior of 2,4,6-TCP was investigated using cyclic voltammetry and differential pulse voltammetry at the HS-β-cyclodextrin (HS-β-CD)/gold nanoparticles (AuNPs) composite modified indium tin oxide (ITO) electrode. The results showed that the current responses of 2,4,6-TCP greatly enhanced due to the high catalytic activity and enrichment capability of composites. The peak current of 2,4,6-TCP increases linearly with the increase of the 2,4,6-TCP concentration from 3.0 × 10−9 to 2.8 × 10−8 M, with the limit of detection of 1.0 × 10−9. Further more, the modified electrode was successfully applied to detect the level of 2,4,6-TCP in tap water samples with excellent sensitivity

  15. PBCDD/F formation from radical/radical cross-condensation of 2-Chlorophenoxy with 2-Bromophenoxy, 2,4-Dichlorophenoxy with 2,4-Dibromophenoxy, and 2,4,6-Trichlorophenoxy with 2,4,6-Tribromophenoxy

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Xiangli [Environment Research Institute, Shandong University, Jinan 250100 (China); Yu, Wanni [Environment Research Institute, Shandong University, Jinan 250100 (China); College of Resources and Environment, Linyi University, Linyi 276000 (China); Xu, Fei [Environment Research Institute, Shandong University, Jinan 250100 (China); Zhang, Qingzhu, E-mail: zqz@sdu.edu.cn [Environment Research Institute, Shandong University, Jinan 250100 (China); Hu, Jingtian; Wang, Wenxing [Environment Research Institute, Shandong University, Jinan 250100 (China)

    2015-09-15

    Highlights: • We studied the formation of PBCDD/Fs from the reaction of three CPRs with BPRs. • The substitution pattern of halogenated phenols determines those of PBCDD/Fs. • The substitution of halogenated phenols influence the coupling of phenoxy radicals. • The rate constants of the crucial elementary steps were evaluated. - Abstract: Quantum chemical calculations were carried out to investigate the homogeneous gas-phase formation of mixed polybrominated/chlorinated dibenzo-p-dioxins/benzofurans (PBCDD/Fs) from the cross-condensation of 2-chlorophenoxy radical (2-CPR) with 2-bromophenoxy radical (2-BPR), 2,4-dichlorophenoxy radical (2,4-DCPR) with 2,4-dibromophenoxy radical (2,4-DBPR), and 2,4,6-trichlorophenoxy radical (2,4,6-TCPR) with 2,4,6-tribromophenoxy radical (2,4,6-TBPR). The geometrical parameters and vibrational frequencies were calculated at the MPWB1K/6-31+G(d,p) level, and single-point energy calculations were performed at the MPWB1K/6-311+G(3df,2p) level of theory. The rate constants of the crucial elementary reactions were evaluated by the canonical variational transition-state (CVT) theory with the small curvature tunneling (SCT) correction over a wide temperature range of 600–1200 K. Studies show that the substitution pattern of halogenated phenols not only determines the substitution pattern of the resulting PBCDD/Fs, but also has a significant influence on the formation mechanism of PBCDD/Fs, especially on the coupling of the halogenated phenoxy radicals.

  16. HIP 3678: a hierarchical triple stellar system in the centre of the planetary nebula NGC 246

    CERN Document Server

    Adam, C

    2014-01-01

    We report the detection of a new low-mass stellar companion to the white dwarf HIP 3678 A, the central star of the planetary nebula NGC 246. The newly found companion is located about 1 arcsec (at projected separation of about 500 au) north-east of HIP 3678 A, and shares a common proper motion with the white dwarf and its known comoving companion HIP 3678 B. The hypothesis that the newly detected companion is a non-moving background object can be rejected on a significance level of more than 8 $\\sigma$, by combining astrometric measurements from the literature with follow-up astrometry, obtained with Wild Field Planetary Camera 2/\\textit{Hubble Space Telescope} and NACO/Very Large Telescope. From our deep NACO imaging data, we can rule out additional stellar companions of the white dwarf with projected separations between 130 up to 5500 au. In the deepest high-contrast NACO observation, we achieve a detection limit in the \\textit{Ks} band of about 20 mag, which allows the detection of brown dwarf companions w...

  17. Degradation mechanism of 2,4,6-trinitrotoluene in supercritical water oxidation

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The 2,4,6-trinitrotoluene (TNT) is a potential carcinogens and TNT contaminated wastewater, which could not be effectively disposed with conventional treatments. The supercritical water oxidation (SCWO) to treat TNT contaminated wastewater was studied in this article. The TNT concentration in wastewater was measured by high-performance liquid chromatograph (HPLC) and the degraded intermediates were analyzed using GC-MS. The results showed that SCWO could degrade TNT efficiently with O2. The reaction temperature, pressure, residence time and oxygen excess were the main contributing factors in the process. The decomposition of TNT was accelerated as the temperature or residence time increases. At 550℃, 24 MPa, 120 s and oxygen excess 300%, TNT removal rate could exceed 99.9%. Partial oxidation occurs in SCWO without oxygen. It was concluded that supercritical water was a good solvent and had excellent oxidation capability in the existence of oxygen. The main intermediates of TNT during SCWO include toluene, 1,3,5-trinitrobenzene, nitrophenol, naphthalene, fluorenone, dibutyl phthalate, alkanes and several dimers based on the intermediate analysis. Some side reactions, such as coupled reaction, hydrolysis reaction and isomerization reaction may take place simultaneously as TNT is oxidized by SCWO.

  18. Molecularly Imprinted Nanofiber Film for Sensitive Sensing 2,4,6-Tribromophenol

    Directory of Open Access Journals (Sweden)

    Limei Huang

    2016-06-01

    Full Text Available The determination of brominated flame retardants is of great importance, but remains a challenge. Particularly, universal and facile approaches are limited. Here we report a new general approach, combining molecular imprinting and electrospinning, for the efficient and facile imprinting sensor of 2,4,6-tribromophenol (TBP, which was used as a “novel” brominated flame retardant. With TBP as the template molecular, β-cyclodextrin (β-CD as the functional monomer, and poly-vinylbutyral (PVB as the electro-spinning matrix, the nanofiber film was deposited on the glassy carbon electrode (GCE via electrospinning technique directly. The β-CD-PVB/GCE sensor system exhibited excellent TBP sensing performances, such as a low detection limit (6.29 × 10−10 mol·L−1 at room temperature, selective recognition to TBP/phenol/4-methyl-phenol, and good regeneration performance. The approach of fabricating a molecular imprinting nanofiber sensor may shed new light in the detection of other phenolic pollutants.

  19. Phototransformation of 2,4,6-trinitrotoluene: Sensitized by riboflavin under different irradiation spectral range

    Energy Technology Data Exchange (ETDEWEB)

    Yang Xin [Department of Biology, Jackson State University, Jackson, MS 39217 (United States); Beijing Institute of Pharmacology and Toxicology, Beijing 100850 (China); Zhao Xueheng [Department of Biology, Jackson State University, Jackson, MS 39217 (United States); Hwang, H.-M. [Department of Biology, Jackson State University, Jackson, MS 39217 (United States)]. E-mail: hwang@jsums.edu

    2007-05-08

    Riboflavin-sensitized phototransformation of 2,4,6-trinitrotoluene (TNT) under natural sunlight was investigated with reverse-phase high performance liquid chromatography/mass spectrometry (HPLC/MS) and gas chromatography/mass spectrometry (GC/MS). The effect of different spectral region of sunlight on TNT phototransformation in the absence or presence of riboflavin was also investigated by using optical filters with cut-off at 400 or 455 nm. The concentration of riboflavin in the phototransformation of TNT was optimized. Concentration of riboflavin and TNT was 1.0 and 50 {mu}M, respectively. The rates of phototransformation of TNT under natural sunlight in the presence or absence of riboflavin were conformed to initial pseudo-first-order rate equation. The photolysis half life of TNT in the presence of riboflavin was 21.87 min, compared to 39 min in the absence of riboflavin under natural sunlight. Two major phototransformation products of TNT, 3,5-dinitroaniline (3,5-DNA) and 1,3,5-trinitrobenzene (1,3,5-TNB), were detected in the samples in the presence of riboflavin receiving irradiation at full wavelength or wavelength >400 nm. The results indicate that riboflavin mediates TNT sensitized-phototransfomation under natural sunlight or near-UV-vis light.

  20. Chemically catalyzed uptake of 2,4,6-trinitrotoluene by Vetiveria zizanioides

    International Nuclear Information System (INIS)

    The efficiency of vetiver grass (Vetiveria zizanioides) in removing 2,4,6-trinitrotoluene (TNT) from aqueous media was explored in the presence of a common agrochemical, urea, used as a chaotropic agent. Chaotropic agents disrupt water structure, increasing solubilization of hydrophobic compounds (TNT), thus, enhancing plant TNT uptake. The primary objectives of this study were to: (i) characterize TNT absorption by vetiver in hydroponic media, and (ii) determine the effect of urea on chemically catalyzing TNT uptake by vetiver grass in hydroponic media. Results showed that vetiver exhibited a high TNT uptake capacity (1.026 mg g-1), but kinetics were slow. Uptake was considerably enhanced in the presence of urea, which significantly (p<0.001) increased the 2nd-order reaction rate constant over that of the untreated (no urea) control. Three major TNT metabolites were detected in the roots, but not in the shoot, namely 1,3,5-trinitrobenzene, 4-amino 2,6-dinitrotoluene, and 2-amino 4,6-dinitrotoluene, indicating TNT degradation by vetiver grass. - A common agrochemical, urea catalyzes TNT removal by vetiver grass in aqueous media

  1. Degradation of 2,4,6-trinitrotoluene by P. aeruginosa and characterization of some metabolites

    Directory of Open Access Journals (Sweden)

    Hatice Aysun Mercimek

    2015-03-01

    Full Text Available Degradation of 2,4,6-trinitrotoluene (TNT, a nitroaromatic explosive found in the soil and ground water, was investigated using Pseudomonas aeruginosa in in vitroexperiments. Biodegradable abilitiy of this bacteria was performed with 50 and 75 mg L−1 TNT concentrations in a defined liquid medium for 96 h time period. Treatment of TNT in supernatant samples taken at 0, 6, 12, 24, 48, 72 and 96 h from agitated vessels was followed by reverse-phase high-performance liquid chromatography (HPLC. In cultures supplemented with 50 and 75 mgL−1 TNT, after 96 h of incubation 46% and 59% reduction were detected respectively. Two metabolites as degradation intermediates with nitrite release into the medium, 2,4-dinitrotoluene (2,4-DNT and 4-aminodinitrotoluene (4-ADNT, were elucidated by thin layer chromatography (TLC and gas chromatography-mass spectrometry (GC-MS. These findings clearly indicate that Pseudomonas aeruginosa can be used in bioremediation of TNT contaminated sites.

  2. The high pressure-temperature phase behavior of 2,4,6-trinitrotoluene (TNT)

    Science.gov (United States)

    Bowden, Patrick; Chellappa, Raja; Dattelbaum, Dana; Manner, Virginia; Mack, Nathan; Liu, Zhenxian

    2013-06-01

    2,4,6-trinitrotoluene (TNT) is a widely used explosive that is relatively insensitive to initiation by shock loading. While the detonation properties of TNT have been extensively reported, the high pressure-temperature (P - T) stability of TNT has not been investigated in detail. In addition, there are no studies that have determined the effects of pressure on the stability of the liquid phase. At ambient conditions, TNT crystallizes in a monoclinic lattice (space group P21 / a) , and our previous x-ray diffraction (XRD) measurements at room temperature suggested a phase transition to orthorhombic (space group Pca21) at ~20 GPa. In this work, we have performed in situ synchrotron XRD and vibrational spectroscopy measurements at various P - T conditions along isothermal and isobaric pathways to confirm previously reported phase transitions, and investigate phase stabilities up to 30 GPa and 500°C. Using all the available data, we have established the first comprehensive high P - T phase diagram of TNT, including the melting line as a function of pressure. While our synchrotron IR and Raman spectroscopy measurements indicate spectral changes at ~2 GPa, careful XRD measurements (hydrostatic, He medium and non-hydrostatic) reveal that the monoclinic phase is likely stable up to 20 GPa. We will present a self-consistent P - V - T equation of state derived from the reported structural and vibrational data.

  3. High uptake of 2,4,6-trinitrotoluene by vetiver grass - Potential for phytoremediation?

    International Nuclear Information System (INIS)

    2,4,6-Trinitrotoluene (TNT) is a potent mutagen, and a Group C human carcinogen that has been widely used to produce munitions and explosives. Vast areas that have been previously used as ranges, munition burning, and open detonation sites are heavily contaminated with TNT. Conventional remediation activities in such sites are expensive and damaging to the ecosystem. Phytoremediation offers a cost-effective, environment-friendly solution, utilizing plants to extract TNT from contaminated soil. We investigated the potential use of vetiver grass (Vetiveria zizanioides) to effectively remove TNT from contaminated solutions. Vetiver grass plants were grown in hydroponic systems containing 40 mg TNT L-1 for 8 d. Aqueous concentrations of TNT reached the method detection limit (∼1 μg L-1) within the 8-d period, demonstrating high affinity of vetiver for TNT, without any visible toxic effects. Results from this preliminary hydroponic study are encouraging, but in need of verification using TNT-contaminated soils. - Vetiver grass demonstrates ability to absorb TNT in aqueous media

  4. The Value Of The Nonprofit Hospital Tax Exemption Was $24.6 Billion In 2011.

    Science.gov (United States)

    Rosenbaum, Sara; Kindig, David A; Bao, Jie; Byrnes, Maureen K; O'Laughlin, Colin

    2015-07-01

    The federal government encourages public support for charitable activities by allowing people to deduct donations to tax-exempt organizations on their income tax returns. Tax-exempt hospitals are major beneficiaries of this policy because it encourages donations to the hospitals while shielding them from federal and state tax liability. In exchange, these hospitals must engage in community benefit activities, such as providing care to indigent patients and participating in Medicaid. The congressional Joint Committee on Taxation estimated the value of the nonprofit hospital tax exemption at $12.6 billion in 2002--a number that included forgone taxes, public contributions, and the value of tax-exempt bond financing. In this article we estimate that the size of the exemption reached $24.6 billion in 2011. The Affordable Care Act (ACA) brings a new focus on community benefit activities by requiring tax-exempt hospitals to engage in communitywide planning efforts to improve community health. The magnitude of the tax exemption, coupled with ACA reforms, underscores the public's interest not only in community benefit spending generally but also in the extent to which nonprofit hospitals allocate funds for community benefit expenditures that improve the overall health of their communities. PMID:26085486

  5. High uptake of 2,4,6-trinitrotoluene by vetiver grass - Potential for phytoremediation?

    Energy Technology Data Exchange (ETDEWEB)

    Makris, Konstantinos C. [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Shakya, Kabindra M. [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Datta, Rupali [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Sarkar, Dibyendu [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States)]. E-mail: dibyendu.sarkar@utsa.edu; Pachanoor, Devanand [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States)

    2007-03-15

    2,4,6-Trinitrotoluene (TNT) is a potent mutagen, and a Group C human carcinogen that has been widely used to produce munitions and explosives. Vast areas that have been previously used as ranges, munition burning, and open detonation sites are heavily contaminated with TNT. Conventional remediation activities in such sites are expensive and damaging to the ecosystem. Phytoremediation offers a cost-effective, environment-friendly solution, utilizing plants to extract TNT from contaminated soil. We investigated the potential use of vetiver grass (Vetiveria zizanioides) to effectively remove TNT from contaminated solutions. Vetiver grass plants were grown in hydroponic systems containing 40 mg TNT L{sup -1} for 8 d. Aqueous concentrations of TNT reached the method detection limit ({approx}1 {mu}g L{sup -1}) within the 8-d period, demonstrating high affinity of vetiver for TNT, without any visible toxic effects. Results from this preliminary hydroponic study are encouraging, but in need of verification using TNT-contaminated soils. - Vetiver grass demonstrates ability to absorb TNT in aqueous media.

  6. Chemically catalyzed uptake of 2,4,6-trinitrotoluene by Vetiveria zizanioides

    Energy Technology Data Exchange (ETDEWEB)

    Makris, Konstantinos C. [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Shakya, Kabindra M. [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Datta, Rupali [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Sarkar, Dibyendu [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States)]. E-mail: dibyendu.sarkar@utsa.edu; Pachanoor, Devanand [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States)

    2007-07-15

    The efficiency of vetiver grass (Vetiveria zizanioides) in removing 2,4,6-trinitrotoluene (TNT) from aqueous media was explored in the presence of a common agrochemical, urea, used as a chaotropic agent. Chaotropic agents disrupt water structure, increasing solubilization of hydrophobic compounds (TNT), thus, enhancing plant TNT uptake. The primary objectives of this study were to: (i) characterize TNT absorption by vetiver in hydroponic media, and (ii) determine the effect of urea on chemically catalyzing TNT uptake by vetiver grass in hydroponic media. Results showed that vetiver exhibited a high TNT uptake capacity (1.026 mg g{sup -1}), but kinetics were slow. Uptake was considerably enhanced in the presence of urea, which significantly (p<0.001) increased the 2nd-order reaction rate constant over that of the untreated (no urea) control. Three major TNT metabolites were detected in the roots, but not in the shoot, namely 1,3,5-trinitrobenzene, 4-amino 2,6-dinitrotoluene, and 2-amino 4,6-dinitrotoluene, indicating TNT degradation by vetiver grass. - A common agrochemical, urea catalyzes TNT removal by vetiver grass in aqueous media.

  7. Using corona discharge-ion mobility spectrometry for detection of 2,4,6-Trichloroanisole.

    Science.gov (United States)

    Lichvanová, Zuzana; Ilbeigi, Vahideh; Sabo, Martin; Tabrizchi, Mahmoud; Matejčík, Stefan

    2014-09-01

    In this work possible application of the corona discharge-ion mobility spectrometer (CD-IMS) for detection of 2,4,6-Trichloroanisole (TCA) has been investigated. We applied CD-IMS interfaced with orthogonal acceleration time of flight mass spectrometer (CD-IMS-oaTOF) to study the ion processes within the CD-IMS technique. The CD-IMS instrument was operated in two modes, (i) standard and (ii) reverse flow modes resulting in different chemical ionisation schemes by NO3(-)(HNO3)n (n=0,1,2) and O2(-)(H2O)n (n=0,1,2), respectively. The O2(-)(H2O)n ionisation was associated with formation of Cl(-) and (TCA-CH3)(-) ions from TCA. The NO3(-)(HNO3)n ionisation, resulted in formation of NO3(-)(HNO3)(TCA-Cl) adduct ions. Limit of detection (LOD) for TCA was determined in gas (100 ppb) and solid phases (150 ng). PMID:24913882

  8. Study on the Synthesis of Phenyl- thio- phosphine Acyl bis ( 2,4,6 - tribromophenyl) amine%苯基硫代膦酰二(2,4,6-三溴苯基)胺的合成研究

    Institute of Scientific and Technical Information of China (English)

    王彦林; 张艳丽; 陈小慧; 季勇

    2011-01-01

    文章以苯胺,溴素,苯基硫代膦酰二氯等为原料,合成了P,N,S,Br四元素协同阻燃的新型高效阻燃剂苯基硫代膦酰二(2,4,6-三溴苯基)胺,最佳工艺条件为以二甲苯做溶剂,吡啶做缚酸剂,低水合硼酸锌作催化剂,苯基硫代膦酰二氯与2,4,6-三溴苯胺的摩尔比为1:2.1,回流反应12 h,产率可达81.21%.并通过IR和NMR对产品的结构进行了表征.%In this paper, a novel high effective flame retardant which collaborated by P, N,S, Br was prepared via the reaction of aniline, bromide and phenylthiophosphonic dichloride. The optimum reaction conditions were: Xylene as the solvent , pyridine as aci - binding agent, low hydrated zinc borate as catalyst, while the molar ratio for the phenylthiophosphonic dichloride and 2,4,6 - tribromoaniline wasl: 2. 1, and the reaction time is 12 h, the yield was 81.21%. The structure of product were characterized by 1R and NMR.

  9. Selective detection of 2,4,6-trinitrophenol based on a fluorescent nanoscale bis(8-hydroxyquinoline) metal complex.

    Science.gov (United States)

    Lv, Xiao-Jun; Qi, Liang; Gao, Xiang-Yu; Wang, Huan; Huo, Yuan; Zhang, Zhi-Qi

    2016-04-01

    The reliable and accurate detection of explosives such as 2,4,6-trinitrophenol (TNP) and 2,4,6-trinitrotoluene (TNT) is in high demand for homeland security and public safety. Although extremely high sensitivity towards TNT has been demonstrated, detection of TNP remains a challenge. In this work, a fluorescent nanoscale complex composed of bis(8-hydroxyquinoline) and Al(3+) ions has been prepared, characterized and applied in detection of TNP. This complex exhibits the ability to sense the nitro explosive TNP via a fluorescence quenching mechanism with high selectivity. A simple paper test system for the rapid monitoring of TNP was also investigated. The results show that Bhq-Al is a quite ideal sensing material for trace-level detection of TNP. PMID:26838414

  10. The statistical model calculation of prompt neutron spectra from spontaneous fission of {sup 244}Cm and {sup 246}Cm

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimenko, B.F. [V.G. Khlopin Radium Inst., Saint Peterburg (Russian Federation)

    1997-03-01

    The calculations of integral spectra of prompt neutrons of spontaneous fission of {sup 244}Cm and {sup 246}Cm were carried out. The calculations were done by the Statistical Computer Code Complex SCOFIN applying the Hauser-Feschbach method as applied to the description of the de-excitation of excited fission fragments by means of neutron emission. The emission of dipole gamma-quanta from these fragments was considered as a competing process. The average excitation energy of a fragment was calculated by two-spheroidal model of tangent fragments. The density of levels in an excited fragment was calculated by the Fermi-gas model. The quite satisfactory agreement was reached between theoretical and experimental results obtained in frames of Project measurements. The calculated values of average multiplicities of neutron number were 2,746 for {sup 244}Cm and 2,927 for {sup 246}Cm that was in a good accordance with published experimental figures. (author)

  11. CERN: Fixed target targets

    International Nuclear Information System (INIS)

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become

  12. (N,N,N′,N′-Tetramethylethylenediamine-κNbis(2,4,6-trimethylphenolato-κOgermanium(II

    Directory of Open Access Journals (Sweden)

    Eduard Rusanov

    2012-03-01

    Full Text Available In the title compound, [Ge(C9H11O2(C6H16N2], the GeII atom is coordinated in a distorted trigonal–pyramidal geometry by two O atoms belonging to two 2,4,6-trimethylphenolate ligands and one N atom of a tetramethylethylenediamine ligand. Comparing the structure with published data of similar compounds shows that the Ge—O bonds are covalent and the Ge—N bond is coordinated.

  13. Removal of 2,4,6-trichlorophenol from a solution by humic acids repeatedly extracted from a peat soil

    International Nuclear Information System (INIS)

    Humic acid (HA) is one of the major components of soil organic matter. It strongly affects the sorption behavior of organic and inorganic contaminants in soils. To obtain a better understanding of the interactions of contaminants with HA, a repeated extraction technique has been applied to a peat soil to obtain HA fractions with varying aliphaticity and aromaticity, which were subsequently correlated to the sorption properties of 2,4,6-trichlorophenol (TCP). HA fractions were extracted repeatedly using an alkaline solution and each HA fraction was separated into two portions with an air-drying or re-suspending (denoted as RSHAs) process. Solid-state 13C NMR and elemental analysis demonstrated that the aromaticity and polarity of HAs decreased with extractions. Kinetic results indicated that air-dried HAs exhibited two-step first order sorption behavior with a rapid stage followed by a slower stage. The slower sorption is attributed to the diffusion of 2,4,6-TCP in the condensed aromatic domains of HAs. Conversely, sorption of 2,4,6-TCP on RSHAs was extremely rapid and could not be fitted with any kinetic model. For air-dried HAs the sorption capacity (Koc) was weakly correlated with the chemical compositions of HAs. However, a positive trend between Koc and aromaticity was observed for RSHAs. Compared with the results of air-dried HAs with their counterparts of RSHAs, it is therefore concluded that air-drying may alter the structure of HAs through artificially creating a more condensed domain in HAs. The structural alternation may result in an incorrect interpretation of the relationship between sorption capacity and chemical composition of HAs and a misjudgment of the transport behavior of 2,4,6-TCP in soils and sediments

  14. Transformation of 2,4,6-trinitrotoluene (TNT) by actinomycetes isolated from TNT-contaminated and uncontaminated environments.

    OpenAIRE

    Pasti-Grigsby, M B; Lewis, T A; Crawford, D. L.; Crawford, R L

    1996-01-01

    Actinomycete strains isolated from 2,4,6-trinitrotoluene (TNT)-contaminated and uncontaminated environments were compared for TNT tolerance and abilities to transform TNT. Regardless of previous TNT exposure history, no significant differences in TNT tolerance were seen among strains. Selected strains did not significantly mineralize [14C]TNT. The actinomycetes did, however, transform TNT into reduced intermediates. The data indicate that, in actinomycete-rich aerobic environments like compos...

  15. Sputter target

    Science.gov (United States)

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  16. Dual role of endogenous serotonin in 2,4,6-trinitrobenzene sulfonic acid-induced colitis

    Directory of Open Access Journals (Sweden)

    Alberto eRapalli

    2016-03-01

    Full Text Available Background and Aims: Changes in gut serotonin content have been described in Inflammatory Bowel Disease and in different experimental models of colitis: the critical role of this monoamine in the pathogenesis of chronic gastrointestinal inflammation is gradually emerging. Aim of the present study was to evaluate the contribution of endogenous serotonin through the activation of its specific receptor subtypes to the local and systemic inflammatory responses in an experimental model of Inflammatory Bowel Disease. Methods: Colitis was induced by intrarectal 2,4,6-TriNitroBenzene Sulfonic acid in mice subacutely treated with selective antagonists of 5-HT1A (WAY100135, 5-HT2A (Ketanserin, 5-HT3 (Ondansetron, 5-HT4 (GR125487, 5-HT7 (SB269970 receptors and with 5-HT1A agonist 8-Hydroxy-2-(di-n-propylaminotetralin. Results: Blockade of 5-HT1A receptors worsened TNBS-induced local and systemic neutrophil recruitment while 5-HT1A agonist delayed and mitigated the severity of colitis, counteracting the increase in colonic 5-HT content. On the contrary, blockade of 5-HT2A receptors improved global health conditions, reduced colonic morphological alterations, down-regulated neutrophil recruitment, inflammatory cytokines levels and colonic apoptosis. Antagonism of 5-HT3, 5-HT4 and 5-HT7 receptor sites did not remarkably affect the progression and outcome of the pathology or only slightly improved it.Conclusions: The prevailing deleterious contribution given by endogenous serotonin to inflammation in TNBS-induced colitis is seemingly mediated by 5-HT2A and, to a lesser extent, by 5-HT4 receptors and coexists with the weak beneficial effect elicited by 5-HT1A stimulation. These findings suggest how only a selective interference with 5-HT pro-inflammatory actions may represent an additional potential therapeutic option for intestinal inflammatory disorders.

  17. Development of a cellular biosensor for the detection of 2,4,6-trichloroanisole (TCA).

    Science.gov (United States)

    Varelas, Vassileios; Sanvicens, Nuria; M-Pilar-Marco; Kintzios, Spiridon

    2011-05-15

    2,4,6-trichloroanisole (TCA) is a microbial metabolite formed from chlorophenols through the activity of several natural fungal strains present on the cork oak bark. TCA is the primary compound responsible for the mousty/mould off-odour known as "cork taint" present in cork stoppers, wine, water and alcoholic beverages. Chromatographic and electrochemical methods are currently used for the determination of TCA, however its detection at low concentrations remains a technical challenge. The aim of this study was the development of a rapid novel biosensor system based on the Bioelectric Recognition Assay (BERA). The sensor measured the electric response of cultured membrane-engineered fibroblast cells suspended in an alginate gel matrix due to the change of their membrane potential in the presence of the analyte. Membrane-engineered cells were prepared by osmotic insertion of 0.5 μg/l of specific TCA antibodies into the membrane of the cells. The BERA-based sensor was able to detect TCA in a few minutes (3-5 min) at extremely low concentrations (10(-1)ppt), thus demonstrating higher sensitivity than the human sensory threshold. In addition, the assay was quite selective against other haloanisoles and halophenols structurally related to or co-occurring with TCA. Finally the sensor was tested against real white wine samples from cork soaks. At this real test, the BERA sensor was able to detect TCA from cork soaks rapidly (3-5 min) at very low concentrations (1.02-12 ng/l), covering the whole range for the detection threshold for wines (1.4-10 ng/l). Therefore, this novel biosensor offers new perspectives for ultra-rapid, ultra-sensitive and low-cost monitoring of TCA presence in cork and wine and possibly also other food commodities. PMID:21482306

  18. Dual Role of Endogenous Serotonin in 2,4,6-Trinitrobenzene Sulfonic Acid-Induced Colitis

    Science.gov (United States)

    Rapalli, Alberto; Bertoni, Simona; Arcaro, Valentina; Saccani, Francesca; Grandi, Andrea; Vivo, Valentina; Cantoni, Anna M.; Barocelli, Elisabetta

    2016-01-01

    Background and Aims: Changes in gut serotonin (5-HT) content have been described in Inflammatory Bowel Disease (IBD) and in different experimental models of colitis: the critical role of this monoamine in the pathogenesis of chronic gastrointestinal inflammation is gradually emerging. Aim of the present study was to evaluate the contribution of endogenous 5-HT through the activation of its specific receptor subtypes to the local and systemic inflammatory responses in an experimental model of IBD. Materials and Methods: Colitis was induced by intrarectal 2,4,6-TriNitroBenzene Sulfonic acid in mice subacutely treated with selective antagonists of 5-HT1A (WAY100135), 5-HT2A (Ketanserin), 5-HT3 (Ondansetron), 5-HT4 (GR125487), 5-HT7 (SB269970) receptors and with 5-HT1A agonist 8-Hydroxy-2-(di-n-propylamino)tetralin. Results: Blockade of 5-HT1A receptors worsened TNBS-induced local and systemic neutrophil recruitment while 5-HT1A agonist delayed and mitigated the severity of colitis, counteracting the increase in colonic 5-HT content. On the contrary, blockade of 5-HT2A receptors improved global health conditions, reduced colonic morphological alterations, down-regulated neutrophil recruitment, inflammatory cytokines levels and colonic apoptosis. Antagonism of 5-HT3, 5-HT4, and 5-HT7 receptor sites did not remarkably affect the progression and outcome of the pathology or only slightly improved it. Conclusion: The prevailing deleterious contribution given by endogenous 5-HT to inflammation in TNBS-induced colitis is seemingly mediated by 5-HT2A and, to a lesser extent, by 5-HT4 receptors and coexists with the weak beneficial effect elicited by 5-HT1A stimulation. These findings suggest how only a selective interference with 5-HT pro-inflammatory actions may represent an additional potential therapeutic option for intestinal inflammatory disorders. PMID:27047383

  19. Bis(2,4,6-tri-amino-pyrimidin-1-ium) sulfate penta-hydrate.

    Science.gov (United States)

    Nimthong, Ruthairat; Chamchong, Siva; Pakawatchai, Chaveng; Mokhagul, Jedsada; Wattanakanjana, Yupa

    2013-01-01

    The asymmetric unit of the title salt, 2C4H8N5 (+)·SO4 (2-)·5H2O, contains four 2,4,6-tri-amino-pyrimidinium (TAPH(+)) cations, two sulfate anions and ten lattice water mol-ecules. Each two of the four TAPH(+) cations form dimers via N-H⋯N hydrogen bonds between the amino groups and the unprotonated pyrimidine N atoms [graph-set motif R 2 (2)(8)]. The (TAPH(+))2 dimers, in turn, form slightly offset infinite π-π stacks parallel to [010], with centroid-centroid distances between pyrimidine rings of 3.5128 (15) and 3.6288 (16) Å. Other amino H atoms, as well as the pyrimidinium N-H groups, are hydrogen-bonded to sulfate and lattice water O atoms. The SO4 (2-) anions and water mol-ecules are inter-connected with each other via O-H⋯O hydrogen bonds. The combination of hydrogen-bonding inter-actions and π-π stacking leads to the formation of a three-dimensional network with alternating columns of TAPH(+) cations and channels filled with sulfate anions and water mol-ecules. One of the sulfate anions shows a minor disorder by a ca 37° rotation around one of the S-O bonds [occupancy ratio of the two sets of sites 0.927 (3):0.073 (3)]. One water mol-ecule is disordered over two mutually exclusive positions with an occupancy ratio of 0.64 (7):0.36 (7). PMID:24109349

  20. Biodegradation of TNT (2,4,6-Trinitrotoluene) by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Extensive biodegradation of TNT (2,4,6-trinitrotoluene) by the white rot fungus Phanerochaete chrysosporium was observed. At an initial concentration of 1.3 mg/liter, 35.4 ± 3.6% of the [14C]TNT was degraded to 14CO2 in 18 days. The addition of glucose 12 days after the addition of TNT did not stimulate mineralization, and, after 18 days of incubation with TNT only, about 3.3% of the initial TNT could be recovered. Mineralization of [14C]TNT absorbed on soil was also examined. Ground corncobs served as the nutrient for slow but sustained degradation of [14C]TNT to 14CO2 such that 6.3 ± 0.6% of the [14C]TNT initially present was converted to 14CO2 during the 30-day incubation period. Mass balance analysis of liquid cultures and of soil-corncob cultures revealed that polar [14C]TNT metabolites are formed in both systems, and high-performance liquid chromatography analyses revealed that less then 5% of the radioactivity remained as undegraded [14C]TNT following incubation with the fungus in soil and liquid cultures. When the concentration of TNT in cultures (both liquid and soil) was adjusted to contamination levels that might be found in the environment, i.e., 10,000 mg/kg in soil and 100 mg/liter in water, mineralization studies showed that 18.4 ± 2.9% and 19.6 ± 3.5% of the initial TNT was converted to 14CO2 in 90 days in soil and liquid cultures, respectively. In both cases (90 days in water at 100 mg/liter and in soil at 10,000 mg/kg) approximately 85% of the TNT was degraded. These results suggest that this fungus may be useful for the decontamination of sites in the environment contaminated with TNT

  1. Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation

    International Nuclear Information System (INIS)

    For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high AD/AR ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values εG, and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies (∼95%), and by the stoichiometric release of chloride ions from the halogenated compound (∼80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions)

  2. 40 CFR 721.7280 - 1,3-Propanediamine, N,N′-1,2-ethanediylbis-, polymer with 2,4,6-trichloro-1,3,5-triazine...

    Science.gov (United States)

    2010-07-01

    ...-ethanediylbis-, polymer with 2,4,6-trichloro-1,3,5-triazine, reaction products with N-butyl-2,2,6,6-tetramethyl...-, polymer with 2,4,6-trichloro-1,3,5-triazine, reaction products with N-butyl-2,2,6,6-tetramethyl-4... identified as 1,3-propanediamine, N,N′-1,2-ethanediylbis-, polymer with...

  3. Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-De Jesus, A.; Romano-Baez, F.J.; Leyva-Amezcua, L.; Juarez-Ramirez, C.; Ruiz-Ordaz, N. [Departamento de Ingenieria Bioquimica, Escuela Nacional de Ciencias Biologicas, IPN. Prol. Carpio y Plan de Ayala, Colonia Santo Tomas, s/n. CP 11340, Mexico, D.F. (Mexico); Galindez-Mayer, J. [Departamento de Ingenieria Bioquimica, Escuela Nacional de Ciencias Biologicas, IPN. Prol. Carpio y Plan de Ayala, Colonia Santo Tomas, s/n. CP 11340, Mexico, D.F. (Mexico)], E-mail: cmayer@encb.ipn.mx

    2009-01-30

    For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high A{sub D}/A{sub R} ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values {epsilon}{sub G}, and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies ({approx}95%), and by the stoichiometric release of chloride ions from the halogenated compound ({approx}80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions)

  4. Target capture and target ghosts

    Science.gov (United States)

    Auerbach, Steven P.

    1996-05-01

    Optimal detection methods for small targets rely on whitened matched filters, which convolve the measured data with the signal model, and whiten the result with the noise covariance. In real-world implementations of such filters, the noise covariance must be estimated from the data, and the resulting covariance estimate may be corrupted by presence of the target. The resulting loss in SNR is called 'target capture'. Target capture is often thought to be a problem only for bright targets. This presentation shows that target capture also arises for dim targets, leading to an SNR loss which is independent of target strength and depends on the averaging method used to estimate the noise covariance. This loss is due to a 'coherent beat' between the true noise and that portion of the estimated noise covariance due to the target. This beat leads to 'ghost targets', which diminish the target SNR by producing a negative target ghost at the target's position. A quantitative estimate of this effect will be given, and shown to agree with numerical results. The effect of averaging on SNR is also discussed for data scenes with synthetic injected targets, in cases where the noise covariance is estimated using 'no target' data. For these cases, it is shown that the so-called 'optimal' filter, which uses the true noise covariance, is actually worse than a 'sub-optimal' filter which estimates the noise from scene. This apparent contradiction is resolved by showing that the optimal filter is best if the same filter is used for many scenes, but is outperformed by a filter adapted to a specific scene.

  5. Suppression of PCDD/Fs formation because of the presence of DEHP during the model slow combustion of 2,4,6-trichlorophenol.

    Science.gov (United States)

    Kishi, Tomohiro; Shinkura, Toshinori; Suzuki, Shota; Kawakami, Tsuyoshi; Takeda, Ken; Onodera, Sukeo

    2010-03-01

    The thermal reactions of 2,4,6-T(3)CP in the presence and absence of DEHP in a dry air stream was investigated using a silica flow reactor at a residence time of 10s and a temperature range from 450 degrees C to 850 degrees C. Two isomers of T(4)CDDs (1,3,6,8- and 1,3,7,9-T(4)CDDs) were the most abundant products during the combustion of 2,4,6-T(3)CP alone and were observed at temperatures ranging from 550 degrees C to 800 degrees C. In the presence of DEHP, we observed a remarkable decrease in the yields of T(4)CDDs during the combustion of 2,4,6-T(3)CP. The suppression ratio of the T(4)CDDs formation was more than 90% in the case of the co-combustion with 10% DEHP in molar ratio. Other PCDD/Fs except for 2,7-/2,8-DCDD and 2,8-DCDF also decreased upon the combustion of 2,4,6-T(3)CP in the presence of DEHP. During the co-combustion of 2,4,6-T(3)CP and DEHP, the residual ratio of 2,4,6-T(3)CP increased slightly and formations of lower chlorinated phenols were observed. The suppression of the T(4)CDDs was strongly dependent on the DEHP ratio in the starting material. The prospective pathways of the suppressions of the T(4)CDDs formations during the combustion of 2,4,6-T(3)CP in the presence of DEHP were proposed. PMID:20080281

  6. Anomalous temperature effect on the hydrogen bond strength and phase transition in 2,4,6-trimethylpyridinium pentachlorophenolate.

    Science.gov (United States)

    Majerz, Irena; Jakubas, Ryszard

    2004-06-01

    The phase transition in 2,4,6-trimethylpyridinium pentachlorophenolate has been studied by differential scanning calorimetry (DSC), thermogravimetric analysis (TGA) and dielectric method as well as theoretical calculations. The crystal undergoes a first order phase transition of order-disorder type at 376 K. The transition to the high temperature phase causes anomalous hydrogen-bond shortening. Experimental and theoretical results show that the change in the mutual orientation of the phenol and pyridine rings is connected with the change of the hydrogen bond. Such an effect, which appears in the present simple hydrogen-bond complex, may be common also for the other hydrogen-bond complexes.

  7. The effects of temperature gradient and growth rate on the morphology and fatigue properties of MAR-M246(Hf)

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, D.D.; Alter, W.S.; Hamilton, W.D.; Parr, R.A.

    1989-08-01

    MAR-M246(Hf) is a nickel based superalloy used in the turbopump blades of the Space Shuttle main engines. The effects are considered of temperature gradient (G) and growth rate (R) on the microstructure and fatigue properties of this superalloy. The primary dendrite arm spacings were found to be inversely proportional to both temperature gradient and growth rate. Carbide and gamma - gamma prime morphology trends were related to G/R ratios. Weibull analysis of fatigue results shows the characteristic life to be larger by a factor of 10 for the low gradient/fast rate pairing of G and R, while the reliability (beta) was lower.

  8. Poly[[triaqua­(μ3-pyridine-2,4,6-tricarboxyl­ato)terbium(III)] monohydrate

    OpenAIRE

    Hong-lin Zhu

    2012-01-01

    The asymmetric unit of the title compound, {[Tb(C8H2NO6)(H2O)3]·H2O}n, contains one TbIII ion, one pyridine-2,4,6-tricarboxylate (ptc) anion, three aqua ligands and one lattice water molecule. The TbIII ion is nine coordinated by one N and five O atoms from three ptc ligands and by three O atoms from the three aqua ligands in a distorted bicapped trigonal–prismatic geometry. The ptc ligands bridge the TbIII ions into a two-dimensional polymeric framework parallel to (100). ...

  9. Structural studies of the polysaccharides from the lipopolysaccharides of Azospirillum brasilense Sp246 and SpBr14.

    Science.gov (United States)

    Sigida, Elena N; Fedonenko, Yuliya P; Shashkov, Alexander S; Grinev, Vyacheslav S; Zdorovenko, Evelina L; Konnova, Svetlana A; Ignatov, Vladimir V; Knirel, Yuriy A

    2014-10-29

    Lipopolysaccharides from closely related Azospirillum brasilense strains, Sp246 and SpBr14, were obtained by phenol-water extraction. Mild acid hydrolysis of the lipopolysaccharides followed by GPC on Sephadex G-50 resulted in polysaccharide mixtures. On the basis of sugar and methylation analyses, Smith degradation and (1)H and (13)C NMR spectroscopy data, it was concluded that both bacteria possess the same two distinct polysaccharides having structures 1 and 2: [structure: see text]. Structure 1 has been reported earlier for a polysaccharide of A. brasilense 54 [Fedonenko et al., 2011] whereas to our knowledge structure 2 has not been hitherto found in bacterial polysaccharides. PMID:25240180

  10. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  11. Vicarious nucleophilic substitution using 4-amino-1,2,4-triazole, hydroxylamine or O-alkylhydroxylamine to prepare 1,3-diamino-2,4,6-trinitrobenzene or 1,3,5-triamino-2,4,6-trinitrobenzene

    Science.gov (United States)

    Mitchell, Alexander R.; Pagoria, Philip F.; Schmidt, Robert D.

    1997-01-01

    The present invention relates to a process to produce 1,3-diamino-2,4,6-trinitrobenzene (DATB) or 1,3,5-triamino-2,4,6,-trinitrobenzene (TATB) by: (a) reacting at ambient pressure and a temperature of between about 0.degree. and 50.degree. C. for between about 0.1 and 24 hr, a trinitroaromatic compound of structure V: ##STR1## wherein X, Y, and Z are each independently selected from the group consisting of --H and --NH.sub.2, with the proviso that at least 1 or 2 of X, Y, and Z are hydrogen; with an effective amount of 1-amino-1,2,4-triazole, hydroxylamine or O-alkylhydroxamine to produce DATB or TATB; in the presence of a strong base selected from sodium butoxide, potassium butoxide, potassium propoxide, sodium propoxide, sodium ethoxide, potassium ethoxide, sodium methoxide, potassium methoxide, and combinations thereof; in a solvent selected from the group consisting of methanol, ethanol, propanol, butanol, dimethylsulphoxide, N-methylpyrrolidone, hexamethylphosphoramide, dimethylformide, dimethylacetamide and mixtures thereof, provided that when alcohols are present or when hydroxylamine or its O-alkyl derivatives replace ATA primarily DATB is formed; and (b) isolating the DATB or TATB produced. DATB and TATB are important and useful specialty explosives and intermediates for other materials.

  12. Synthesis of bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine oxide – a tailor-made photoinitiator for dental adhesives

    Directory of Open Access Journals (Sweden)

    Norbert Moszner

    2010-03-01

    Full Text Available Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine oxide (WBAPO was synthesized starting from 3-(chloromethyl-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxyethanol. In the second step, 3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated. The formed acid chloride showed an unexpected low thermal stability. Its thermal rearrangement at 180 °C resulted in a fast formation of 3-(chloromethyl-2,4,6-trimethylbenzoic acid 2-(allyloxyethyl ester. In the third step, the acid chloride was reacted with phenylphosphine dilithium with the formation of bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine, which was oxidized to WBAPO. The structure of WBAPO was confirmed by 1H NMR, 13C NMR, 31P NMR, and IR spectroscopy, as well as elemental analysis. WBAPO, a yellow liquid, possesses improved solubility in polar solvents and shows UV–vis absorption, and a high photoreactivity comparable with the commercially available bisacylphosphine oxides. A sufficient storage stability was found in dental acidic aqueous primer formulations.

  13. Synthesis of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide - a tailor-made photoinitiator for dental adhesives.

    Science.gov (United States)

    Moszner, Norbert; Lamparth, Iris; Angermann, Jörg; Fischer, Urs Karl; Zeuner, Frank; Bock, Thorsten; Liska, Robert; Rheinberger, Volker

    2010-01-01

    Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide (WBAPO) was synthesized starting from 3-(chloromethyl)-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxy)ethanol. In the second step, 3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated. The formed acid chloride showed an unexpected low thermal stability. Its thermal rearrangement at 180 ° C resulted in a fast formation of 3-(chloromethyl)-2,4,6-trimethylbenzoic acid 2-(allyloxy)ethyl ester. In the third step, the acid chloride was reacted with phenylphosphine dilithium with the formation of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine, which was oxidized to WBAPO. The structure of WBAPO was confirmed by ¹H NMR, ¹³C NMR, ³¹P NMR, and IR spectroscopy, as well as elemental analysis. WBAPO, a yellow liquid, possesses improved solubility in polar solvents and shows UV-vis absorption, and a high photoreactivity comparable with the commercially available bisacylphosphine oxides. A sufficient storage stability was found in dental acidic aqueous primer formulations. PMID:20502649

  14. Preparation of oil palm empty fruit bunch-based activated carbon for removal of 2,4,6-trichlorophenol: Optimization using response surface methodology

    International Nuclear Information System (INIS)

    The effects of three preparation variables: CO2 activation temperature, CO2 activation time and KOH:char impregnation ratio (IR) on the 2,4,6-trichlorophenol (2,4,6-TCP) uptake and carbon yield of the activated carbon prepared from oil palm empty fruit bunch (EFB) were investigated. Based on the central composite design, two quadratic models were developed to correlate the three preparation variables to the two responses. The activated carbon preparation conditions were optimized using response surface methodology by maximizing both the 2,4,6-TCP uptake and activated carbon yield within the ranges studied. The optimum conditions for preparing activated carbon from EFB for adsorption of 2,4,6-TCP were found as follows: CO2 activation temperature of 814 deg. C, CO2 activation time of 1.9 h and IR of 2.8, which resulted in 168.89 mg/g of 2,4,6-TCP uptake and 17.96% of activated carbon yield. The experimental results obtained agreed satisfactorily with the model predictions. The activated carbon prepared under optimum conditions was mesoporous with BET surface area of 1141 m2/g, total pore volume of 0.6 cm3/g and average pore diameter of 2.5 nm. The surface morphology and functional groups of the activated carbon were respectively determined from the scanning electron microscopy and Fourier transform infrared analysis.

  15. Influence of a magnetic field during directional solidification of MAR-M 246 + Hf superalloy. Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, J.B.; Alter, W.; Schmidt, D.

    1991-01-01

    An area that has been almost totally overlooked in the optimization of properties in directionally solidified superalloys is the control of microstructural features through the application of a magnetic field during solidification. The influence of a magnetic field on the microstructural features of a nickel-base superalloys is investigated. Studies were performed on the dendritic MAR-M 246+Hf alloy, which was solidified under both a 5 K gauss magnetic field and under no-applied-field conditions. The possible influences of the magnetic field on the solidification process were observed by studying variations in microstructural features including volume fraction, surface area, number, and shape of the carbide particles. Stereological factors analyzed also included primary and secondary dendrite arm spacing and the volume fraction of the interdendritic eutectic constituent. Microprobe analysis was performed to determine the chemistry of the carbides, dendrites, and interdendritic constituents, and how it varied between field and no-field solidification samples. Experiments involving periodic application and removal of the magnetic field were also performed in order to permit a comparison with structural variations observed in a MAR-M 246+Hf alloy solidified during KC{sup {minus}135} high-g, low-g maneuvers.

  16. Simultaneous determination of 2,4,6-trichlorophenol and pentachlorophenol based on poly(Rhodamine B)/graphene oxide/multiwalled carbon nanotubes composite film modified electrode

    Science.gov (United States)

    Zhu, Xiaolin; Zhang, Kexin; Lu, Nan; Yuan, Xing

    2016-01-01

    In the present study, a poly(Rhodamine B)/graphene oxide/multiwalled carbon nanotubes nanocomposite modified glass carbon electrode (PRhB/GO/MWCNTs/GCE) was developed for the simultaneous determination of 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP). The PRhB/GO/MWCNTs film was extensively characterized by emission scanning electron microscopy (SEM), X-ray diffraction (XRD), Raman spectroscopy and electrochemical impedance spectroscopy (EIS). The electrochemical behaviors of 2,4,6-TCP and PCP were investigated by cyclic voltammetry, linear sweep voltammetry and differential pulse voltammetry. Due to the synergistic effect, the PRhB/GO/MWCNTs/GCE significantly facilitated the simultaneous electro-oxidation of 2,4,6-TCP and PCP with peak potential difference of 160 mV and enhanced oxidation currents. Under optimum conditions, the oxidation current of 2,4,6-TCP was linear to its concentration in the ranges of 4.0 × 10-9 to 1.0 × 10-7 M and 1.0 × 10-7 to 1.0 × 10-4 M with the detection limit (S/N = 3) of 8.0 × 10-10 M. And the linear concentration ranges for PCP were 2.0 × 10-9 to 1.0 × 10-7 M and 1.0 × 10-7 to 9.0 × 10-5 M with the detection limit of 5.0 × 10-10 M. Moreover, the proposed PRhB/GO/MWCNTs/GCE was successfully applied to the simultaneous determination of 2,4,6-TCP and PCP in practical water samples.

  17. Targeted Learning

    CERN Document Server

    van der Laan, Mark J

    2011-01-01

    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  18. Strong synergy with APR-246 and DNA-damaging drugs in primary cancer cells from patients with TP53 mutant High-Grade Serous ovarian cancer

    OpenAIRE

    Fransson, Åsa; Glaessgen, Daria; Alfredsson, Jessica; Wiman, Klas G.; Bajalica-Lagercrantz, Svetlana; Mohell, Nina

    2016-01-01

    Background Mutation in the tumor suppressor gene TP53 is an early event in the development of high-grade serous (HGS) ovarian cancer and is identified in more than 96 % of HGS cancer patients. APR-246 (PRIMA-1MET) is the first clinical-stage compound that reactivates mutant p53 protein by refolding it to wild type conformation, thus inducing apoptosis. APR-246 has been tested as monotherapy in a Phase I/IIa clinical study in hematological malignancies and prostate cancer with promising result...

  19. N-(2-{[5-Bromo-2-(piperidin-1-ylpyrimidin-4-yl]sulfanyl}-4-methoxyphenyl-2,4,6-trimethylbenzenesulfonamide

    Directory of Open Access Journals (Sweden)

    Mohan Kumar

    2012-09-01

    Full Text Available In the title compound, C25H29BrN4O3S2, the benzene rings bridged by the sulfonamide group are tilted relative to each other by 63.9 (1° and the dihedral angle between the sulfur-bridged pyrimidine and benzene rings is 64.9 (1°. The molecular conformation is stabilized by a weak intramolecular π–π stacking interaction between the pyrimidine and the 2,4,6-trimethylbenzene rings [centroid–centroid distance = 3.766 (2 Å]. The piperidine ring adopts a chair conformation. In the crystal, molecules are linked into inversion dimers by pairs of N—H...O hydrogen bonds and these dimers are further linked by C—H...O hydrogen bonds into chains propagating along [010].

  20. Aquatrinitrato[2,4,6-tris(pyridin-2-yl-1,3,5-triazine]neodymium(III dihydrate

    Directory of Open Access Journals (Sweden)

    Jin Zhou

    2011-06-01

    Full Text Available In the title compound, [Nd(NO33(C18H12N6(H2O]·2H2O, the Nd3+ ion is in a distorted bicapped square-antiprismatic geometry formed by three N atoms from the 2,4,6-tris(pyridin-2-yl-1,3,5-triazine (TPTZ ligand, six O atoms from the three nitrate anions and one O atom from the aqua ligand. The molecules are linked by O—H...O and O—H...N hydrogen bonds. Two types of π–π stacking interactions occur between the TPTZ ligands of adjacent complexes [centroid-to-centroid distances = 3.760 (4 and 3.870 (3 Å].

  1. Grignard Reaktiflerinin Aseton O-(2,4,6-trimetilfenilsülfoniloksim ile Elektrofilik Aminasyonuyla Arilaminlerin Sentezi

    Directory of Open Access Journals (Sweden)

    Tahir DAŞKAPAN

    2009-04-01

    Full Text Available Arilaminler, birçok pratik ve yararlı uygulamalara imkan veren önemli bir organik bilesik sınıfıdır. Arilamino grubu dogada temel bir yapısal motiftir. Amin sentezi için gelistirilen modern yöntemler arasında kolay bulunabilen bir organometalik reaktifin elektrofilik aminasyonu yöntemi, organik sentezde önemli bir yöntem olarak ortaya çıkmıstır.Bu çalısmada, sentetik organik, ilaç ve tarım kimyasında kullanılan arilaminlerin, organomagnezyum reaktiflerinin aseton O-(2,4,6-trimetilfenilsülfoniloksim ile elektrofilik aminasyonuyla ılımlı reaksiyon sartları altında ve iyi verimle hazırlanması için kolay uygulanabilir bir yöntem gelistirilmistir.

  2. Ecotoxicological evaluation of in situ bioremediation of soils contaminated by the explosive 2,4,6-trinitrotoluene (TNT)

    International Nuclear Information System (INIS)

    The luminescent bacteria assay, using soil leachates, was the most sensitive toxicity indicator. - To evaluate the environmental relevance of in situ bioremediation of contaminated soils, effective and reliable monitoring approaches are of special importance. The presented study was conducted as part of a research project investigating in situ bioremediation of topsoils contaminated by the explosive 2,4,6-trinitrotoluene (TNT). Changes in soil toxicity within different experimental fields at a former ordnance factory were evaluated using a battery of five bioassays (plant growth, Collembola reproduction, soil respiration, luminescent bacteria acute toxicity and mutagenicity test) in combination to chemical contaminant analysis. Resulting data reveal clear differences in sensitivities between methods with the luminescent bacteria assay performed with soil leachates as most sensitive toxicity indicator. Complete test battery results are presented in so-called soil toxicity profiles to visualise and facilitate the interpretation of data. Both biological and chemical monitoring results indicate a reduction of soil toxicity within 17 months of remediation

  3. Green and solvent-free procedure for microwave-assisted synthesis of 2,4,6-triarylpyridines catalysed using MgAl2O4 nanocrystals

    Indian Academy of Sciences (India)

    Javad Safari; Soheila Gandomi-Ravandi; Mahmoud Borjian Borujeni

    2013-09-01

    Design and development of a heterogeneous nanocatalyst for condensation reaction of acetophenone derivatives, aromatic aldehydes, and ammonium acetate to yield 2,4,6-triarylpyridines followed by microwave irradiation is described. Nanocrystalline MgAl2O4 as a novel heterogeneous recyclable catalyst shows high activity for the above reaction. In addition, the easily recoverable nanosized catalysts showed good reusability.

  4. Critical and subcritical masses of curium-245, -246 and -247 calculated with a combination of MCNP4A code and JENDL-3.2 library

    International Nuclear Information System (INIS)

    Critical masses of three curium isotopes, 245Cm, 246Cm and 247Cm, were calculated with a combination of the current version of the Japanese Evaluated Nuclear Data Library, JENDL-3.2, and a continuous energy Monte Carlo neutron transport code, MCNP4A. The subcritical masses corresponding to the neutron multiplication factor keff=0.9 and 0.8 were also computed in the same way. The subcritical masses that correspond to keff=0.9 for 246Cm metal and 246CmO2 with a 30-cm-thick stainless steel reflector were computed as 25.2 kg and 41.8 kg, respectively. The minimum critical mass for 245Cm was obtained as 65.6 g in a sphere of a homogeneous mixture of granulated 245Cm metal and water surrounded by a fully thick water reflector. The corresponding quantity for 247Cm was found to be 2.19 kg. The critical masses of 245Cm, 246Cm and 247Cm metals were computed also for reference by replacing the JENDL-3.2 with the ENDF/B-VI; they were reduced by 23%, 45% and 2%, respectively, from each corresponding value, which revealed a large dependence of the results on the evaluated nuclear data libraries. The present report was prepared for revision of the ANSI/ANS-8.15, the American National Standard for Nuclear Criticality Control of Special Actinide Elements. (author)

  5. Degradation of 2,4,6-Trichlorophenol Using Hydrogen Peroxide Catalyzed by Nanoscale Zero-Valent Iron Supported on Ion Exchange Resin.

    Science.gov (United States)

    Tai, Chao; She, Jiaping; Yin, Yongguang; Zhao, Tongqian; Wu, Li

    2016-06-01

    Nanoscale zero-valent iron (NZVI) supported on ion exchange resin was prepared and characterized by scanning electron microscope and energy dispersive spectroscopy, with a simple model developed for describing the catalyst. The degradation of 2,4,6-trichlorophenol (2,4,6-TCP) by hydrogen peroxide using NZVI supported on ion exchange resin as the catalyst, was studied. The results showed that 2,4,6-TCP with a concentration of 1 mmol L(-1) could be well degraded into low molecule weight organic acids in two hours. The optimized condition was as follows: pH, 3.0; temperature, 35 degrees C; catalyst dosage, 1.5 g; and hydrogen peroxide, 0.16 mmol L(-1). The catalyst has good reusability, with no catalytic efficiency decreasing even after ten times recycles. A possible mechanism of 2,4,6-TCP degradation was proposed, based on the products indentified by GC-MS after derived using trimethylsulfonium hydroxide. PMID:27427643

  6. 2,4,6-Trichloro-1,3,5-triazine/dimethylformamide as an efficient reagent for one-pot conversion of alcohols into N-alkylphthalimides

    Institute of Scientific and Technical Information of China (English)

    Babak; Mokhtari; Roya; Azadi; Aseieh; Azhdari

    2010-01-01

    An efficient and mild method for the direct conversion of alcohols into N-alkylphthalimides using 2,4,6-trichloro-1,3,5-triazine and dimethylformamide was described.The reaction was preceded via(alcoxymethylene) dimethylammonium chloride intermediate and produced corresponding N-alkylphthalimides in good-to-excellent yields.

  7. 1,1´,1´´-(2,4,6-Trihydroxybenzene-1,3,5-triyl)triethanone tautomerism revisited

    DEFF Research Database (Denmark)

    Hansen, Poul Erik; Kamounah, Fadhil S.; Zhiryakova, Diana;

    2014-01-01

    It has recently been suggested that 1,1′,1′′-(2,4,6-trihydroxybenzene-1,3,5-triyl)triethanone may be tautomeric. Using 13C NMR chemical shifts and deuterium isotope effects on 13C chemical shifts, it is demonstrated that this is not the case. This compound occurs as a strongly hydrogen bonded ben...

  8. Accelerator target

    Energy Technology Data Exchange (ETDEWEB)

    Schlyer, David J. (Bellport, NY); Ferrieri, Richard A. (Patchogue, NY); Koehler, Conrad (Miller Place, NY)

    1999-01-01

    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression.

  9. Aniline and 2,4,6-trinitrotoluene associate preferentially to low molecular weight fractions of dissolved soil organic matter

    International Nuclear Information System (INIS)

    Aniline and 2,4,6-trinitrotoluene (TNT) were equilibrated with particulate (POM) and dissolved organic matter (DOM) from an organic soil at different compositions of adsorbed major cations (Na, Al) and pH (aniline: 3.7-5.1, TNT: 4.8-5.0). After separation of POM, concentrations of 14C-labelled aniline and TNT* (including TNT degradation products) were determined in DOM size fractions using size-exclusion chromatography (SEC) and UV-detection. Concentrations in the 40 kDa fraction. Thus, both aniline and TNT* were preferentially associated to the smallest DOM size fraction. The significant binding to DOM (similar extent as to POM) and the fact that the <3.5 kDa DOM fraction was less susceptible to flocculation by major metals suggests that the mobility of aniline and TNT is highly affected by the solubility of soil organic matter. - Concentrations of aniline and TNT associated with dissolved organic matter (DOM) was shown to increase with decreasing apparent molecular mass of DOM.

  10. In vitro study to determine decontamination of 3,5-dichloro-2,4,6-trifluoropyridine (DCTFP) from human skin.

    Science.gov (United States)

    Hui, Xiaoying; Domoradzki, Jeanne Y; Maibach, Howard C

    2012-07-01

    This in vitro study determined the decontamination potential of soap and water, D-TAM skin cleanser, corn oil and the O'Dell reactive skin decontamination system to remove 3,5-dichloro-2,4,6-trifluoropyridine (DCTFP) from human skin after short exposure periods (10 and 30 min). The main result turned out to be the rapid volatility of DCTFP where half of the dose evaporated within 10 min and most of the dose was evaporated after 30 min. This rapid volatility was confirmed in an additional study where DCTFP rapidly evaporated from inert plastic disks (70% loss in 10 min). Despite rapid evaporation and short exposure periods, some DCTFP entered into the human skin epidermis, dermis and receptor fluid. Less DCTFP reached the receptor fluid with the 10 min decontamination (0.13%) than the 30 min decontamination (0.27%). Statistically, all tested decontamination systems performed the same (P>0.05). For human risk the volatility of DCTFP seems paramount. For skin decontamination any of the tested systems will work. An important point is that they should be used within minutes of skin exposure. This study exhibits the dynamics of evaporation, substantivity (skin binding), percutaneous absorption and decontamination of a volatile chemical. PMID:22504088

  11. Molecular and Crystal Structure of 1,3,5 Tris(benzimidazol-1-ylmethyl)-2,4,6-Trimethylbenzene

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The compound 1,3,5-tris(benzimidazol-l-ylmethyl)-2,4,6-trimethylbenzene, crystallizes in the monoclinic system, space group P2rC, with a = 17.571(4), b = 10.860(2), c = 14.126(3) A; β = 92.89(3)°, V= 2692(1)A3, De = 1.260 g/cm3, Z = 4, C33H30N6, Mr. = 510.63, μ(MoKα) = 0.077mm-1, F(000) = 1080. The structure was refined to R = 0.0592, wR = 0.1379 for 1492 (I>2σ(I)) reflections. The title molecule has cis, trans, trans-conformation about the central phenyl ring. The screw-related molecules are connected by hydrogen bonds C-H...N (x,-0.5-y, 0.5+z) and form the infinite helical chains. The polar molecular chains are antiparallelly stacked through edge-to-face C-H… π interactions.

  12. Highly selective detection of 2,4,6-trinitrophenol by using newly developed terbium-doped blue carbon dots.

    Science.gov (United States)

    Chen, Bin Bin; Liu, Ze Xi; Zou, Hong Yan; Huang, Cheng Zhi

    2016-04-25

    The detection of nitroaromatic explosives is of great importance owing to their strong explosive power and harmfulness in terms of the environment, homeland security and public safety. Herein, rare earth-doped carbon dots with multifunctional features were firstly prepared by simply keeping the mixture of terbium(iii) nitrate pentahydrate and citric acid at 190 °C for 30 min. The as-prepared terbium doped carbon dots (Tb-CDs), through a rapid and simple direct carbonization route, have a size of about 3 nm, and exhibit excitation wavelength dependent emission of blue fluorescence, are stable, and can be applied for the selective and colorimetric detection of 2,4,6-trinitrophenol (TNP) in the range of 500 nM-100 μM with a limit of detection of 200 nM based on the inner filtering effect (IFE) of the excitation and emission bands of Tb-CDs by TNP and the electron transfer (ET) from Tb-CDs to TNP, giving a precise and highly reproducible result for detecting complex water samples. PMID:27109163

  13. 2,4,6-Trinitrotoluene mineralization and bacterial production rates of natural microbial assemblages from coastal sediments

    International Nuclear Information System (INIS)

    The nitrogenous energetic constituent, 2,4,6-Trinitrotoluene (TNT), is widely reported to be resistant to bacterial mineralization (conversion to CO2); however, these studies primarily involve bacterial isolates from freshwater where bacterial production is typically limited by phosphorus. This study involved six surveys of coastal waters adjacent to three biome types: temperate broadleaf, northern coniferous, and tropical. Capacity to catabolize and mineralize TNT ring carbon to CO2 was a common feature of natural sediment assemblages from these coastal environments (ranging to 270+/-38 μg C kg-1 d-1). More importantly, these mineralization rates comprised a significant proportion of total heterotrophic production. The finding that most natural assemblages surveyed from these ecosystems can mineralize TNT ring carbon to CO2 is consistent with recent reports that assemblage components can incorporate TNT ring carbon into bacterial biomass. These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - Highlights: → TNT mineralization is a common feature of natural bacterial assemblages in coastal sediments. → TNT mineralization rates comprised a significant proportion of total heterotrophic production. → These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - The capacity to mineralize TNT ring carbon to CO2 is a common feature of natural bacterial assemblages in coastal sediment.

  14. Highly Photoluminescent Molybdenum Oxide Quantum Dots: One-Pot Synthesis and Application in 2,4,6-Trinitrotoluene Determination.

    Science.gov (United States)

    Xiao, Sai Jin; Zhao, Xiao Jing; Hu, Ping Ping; Chu, Zhao Jun; Huang, Cheng Zhi; Zhang, Li

    2016-03-30

    As a well-studied transition-metal semiconductor material, MoOx has a wider band gap than molybdenum disulfide (MoS2), and its property varies dramatically for the existence of several different allotropes and suboxide phases of molybdenum oxides (MoOx, x synthesis of highly photoluminescent MoOx quantum dots (MoOx QDs), in which commercial molybdenum disulfide (MoS2) powder and hydrogen peroxide (H2O2) are employed as the precursor and oxidant, respectively. The obtained MoOx QDs can be further utilized as an efficient photoluminescent probe, and a new turn-off sensor is developed for 2,4,6-trinitrotoluene (TNT) determination based on the fact that the photoluminescence of MoOx QDs can be quenched by the Meisenheimer complexes formed in the strong alkali solution through the inner filter effect (IFE). Under the optimal conditions, the decreased photoluminescence of MoOx QDs shows a good linear relationship to the concentration of TNT ranging from 0.5 to 240.0 μM, and the limit of detection was 0.12 μM (3σ/k). With the present turn-off sensor, TNT in river water samples can be rapidly and selectively detected without tedious sample pretreatment processes. PMID:26954663

  15. Effectiveness of urea in enhancing the extractability of 2,4,6-trinitrotoluene from chemically variant soils.

    Science.gov (United States)

    Das, Padmini; Sarkar, Dibyendu; Makris, Konstantinos C; Punamiya, Pravin; Datta, Rupali

    2013-11-01

    One of the major challenges in developing an effective phytoremediation technology for 2,4,6-trinitrotoluene (TNT) contaminated soils is limited plant uptake resulting from low solubility of TNT. The effectiveness of urea as a solubilizing agent in increasing plant uptake of TNT in hydroponic systems has been documented. Our preliminary greenhouse experiments using urea were also very promising, but further characterization of the performance of urea in highly-complex soil-solution was necessary. The present study investigated the natural retention capacity of four chemically variant soils and optimized the factors influencing the effectiveness of urea in enhancing TNT solubility in the soil solutions. Results show that the extent of TNT sorption and desorption varies with the soil properties, and is mainly dependent on soil organic matter (SOM) content. Hysteretic desorption of TNT in all tested soils suggests irreversible sorption of TNT and indicates the need of using an extractant to increase the release of TNT in soil solutions. Urea significantly (porganic matter content and urea application rates showed significant effects, whereas pH did not exert any significant effect on urea catalysis of TNT extraction from soil. The optimum urea application rates (125 or 350 mg kg(-1)) for maximizing TNT extraction were within the limits set by the agronomic fertilizer-N rates used for major agricultural crops. The data obtained from this batch study will facilitate the optimization of a chemically-catalyzed phytoremediation model for cleaning up TNT-contaminated soils. PMID:23835412

  16. Ozonation catalyzed by the raw bauxite for the degradation of 2,4,6-trichloroanisole in drinking water

    International Nuclear Information System (INIS)

    A kind of inexpensive and environmental friendly mineral, the raw bauxite has been used successfully as a catalyst combined with ozonation in the degradation of 2,4,6-trichloroanisole (TCA). The catalyst was characterized by using various analytical techniques. X-ray powder diffraction (XRD) characterization showed that the raw bauxite containing boehmite (γ-AlOOH), kaolinite (Al2Si2O5(OH)4) and quartz (SiO2), and γ-AlOOH was the major composition. The catalytic ozonation removal effectiveness of TCA was investigated under various physicochemical conditions. Both the adsorption and the single ozonation were not effective for the degradation of TCA, and the presence of the raw bauxite in ozonation enhanced the TCA removal effectiveness. Both the hydroxyl radicals (·OH) scavenging experiment and Rct characterization confirmed that the generation of ·OH was accounted for the enhancement of the degradation of TCA. The generation of ·OH was inhibited faintly by the presence of both natural organic matters (NOMs) and alkalinity in the natural water during catalyzed ozonation with the raw bauxite. The increasing of both the bauxite dosage and the ozone dosage enhanced the removal effectiveness of TCA. The raw bauxite was an efficient green catalyst for TCA degradation in drinking water.

  17. Biotransformation of 2,4,6-trinitrotoluene (TNT) by enchytraeids (Enchytraeus albidus) in vivo and in vitro

    International Nuclear Information System (INIS)

    2,4,6-Trinitrotoluene (TNT) is toxic to soil invertebrates, but little is known about its toxicokinetic behavior in soil. Tissue residue analysis was used to evaluate whether the presence of TNT and its reduced metabolites in soil invertebrates was due to uptake of these compounds from the soil into the organism, or due to microbial transformation of TNT associated with the organism followed by uptake. Adult white potworms (Enchytraeus albidus) were exposed to non-lethal concentrations of TNT in amended artificial soil for 21 d, or to TNT in solution for 20 h. Soil exposure studies confirmed earlier reports that TNT was transformed in enchytraeids in vivo to 2- and 4-aminodinitrotoluenes. However, enchytraeid exposure to TNT in solution led to the additional presence of 2,4-diaminonitrotoluene as well as 2- and 4- hydroxyamino-dinitrotoluenes and azoxy-compounds, suggesting that TNT can be metabolized in vivo in the absence of soil. Incubation of unexposed enchytraeid homogenates with TNT led to a protein-dependent appearance of these metabolites in vitro after ≥16 h incubation. Cellular fractionation studies indicated that most of this activity resided in the 8000xg pellet, and was completely inhibited by broad-spectrum antibiotics. These studies demonstrate that enchytraeids can transform TNT in vivo and in vitro, at least in part, by bacteria associated with the host organism

  18. Effects of additives on 2,4,6-trinitrotoluene (TNT) removal and its mineralization in aqueous solution by gamma irradiation

    International Nuclear Information System (INIS)

    The effects of additives (i.e., methanol, EDTA, mannitol, thiourea, nitrous oxide, oxygen and ozone) on gamma irradiation of 2,4,6-trinitrotoluene (TNT) were investigated to elucidate the initial reaction mechanism of TNT degradation and suggest an practical method for complete by-product removal. All additives, except thiourea, significantly increased the TNT removal efficiency by gamma irradiation. The overall results of the additive experiments implied that the TNT decomposition would be initiated by ·OH, eaq-, and HO2·/O2·-, and also implied that ·H did not have any direct effect on the TNT decomposition. Additions of methanol and nitrous oxide were more effective in TNT removal than the other additives, achieving complete removal of TNT at doses below 20 kGy. Total organic carbon (TOC) of the irradiated solution was analyzed to evaluate the degree of TNT mineralization under the additive conditions. TOC under the nitrous oxide addition was removed rapidly, and complete TNT mineralization was thus achieved at 50 kGy. Methanol addition was very effective in the TNT removal, but it was not effective in reduction in TOC. Trinitrobenzene (TNB), oxalic acid and glyoxalic acid were detected as radiolytic organic by-products, while ammonia and nitrate were detected as radiolytic inorganic by-products. The most efficient TNT removal and its mineralization by gamma irradiation would be achieved by supersaturating the solution with nitrous oxide before irradiation.

  19. Synthesis and Docking Studies of 2,4,6-Trihydroxy-3-Geranylacetophenone Analogs as Potential Lipoxygenase Inhibitor

    Directory of Open Access Journals (Sweden)

    Chean Hui Ng

    2014-08-01

    Full Text Available The natural product molecule 2,4,6-trihydroxy-3-geranyl-acetophenone (tHGA isolated from the medicinal plant Melicope ptelefolia was shown to exhibit potent lipoxygenase (LOX inhibitory activity. It is known that LOX plays an important role in inflammatory response as it catalyzes the oxidation of unsaturated fatty acids, such as linoleic acid to form hydroperoxides. The search for selective LOX inhibitors may provide new therapeutic approach for inflammatory diseases. Herein, we report the synthesis of tHGA analogs using simple Friedel-Craft acylation and alkylation reactions with the aim of obtaining a better insight into the structure-activity relationships of the compounds. All the synthesized analogs showed potent soybean 15-LOX inhibitory activity in a dose-dependent manner (IC50 = 10.31–27.61 μM where compound 3e was two-fold more active than tHGA. Molecular docking was then applied to reveal the important binding interactions of compound 3e in soybean 15-LOX binding site. The findings suggest that the presence of longer acyl bearing aliphatic chain (5Cs and aromatic groups could significantly affect the enzymatic activity.

  20. Application of Novel Amino-Functionalized NZVI@SiO2 Nanoparticles to Enhance Anaerobic Granular Sludge Removal of 2,4,6-Trichlorophenol

    Directory of Open Access Journals (Sweden)

    Zeyu Guan

    2015-01-01

    Full Text Available A novel amino-functionalized silica-coated nanoscale zerovalent iron (NZVI@SiO2-NH2 was successfully synthesized by using one-step liquid-phase method with the surface functionalization of nanoscale zerovalent iron (NZVI to enhance degradation of chlorinated organic contaminants from anaerobic microbial system. NZVI@SiO2-NH2 nanoparticles were synthesized under optimal conditions with the uniform core-shell structure (80–100 nm, high loading of amino functionality (~0.9 wt%, and relatively large specific surface area (126.3 m2/g. The result demonstrated that well-dispersed NZVI@SiO2-NH2 nanoparticle with nFe0-core and amino-functional silicon shell can effectively remove 2,4,6-trichlorophenol (2,4,6-TCP in the neutral condition, much higher than that of NZVI. Besides, the surface-modified nanoparticles (NZVI@SiO2-NH2 in anaerobic granule sludge system also showed a positive effect to promote anaerobic biodechlorination system. More than 94.6% of 2,4,6-TCP was removed from the combined NZVI@SiO2-NH2-anaerobic granular sludge system during the anaerobic dechlorination processes. Moreover, adding the appropriate concentration of NZVI@SiO2-NH2 in anaerobic granular sludge treatment system can decrease the toxicity of 2,4,6-TCP to anaerobic microorganisms and improved the cumulative amount of methane production and electron transport system activity. The results from this study clearly demonstrated that the NZVI@SiO2-NH2/anaerobic granular sludge system could become an effective and promising technology for the removal of chlorophenols in industrial wastewater.

  1. 40 CFR 721.5356 - Ethanol, 2,2′2″-nitrilotris-, compound with alpha-2,4,6-tris (1-phenylethyl)phenyl]-omega...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Ethanol, 2,2â²2â³-nitrilotris... Substances § 721.5356 Ethanol, 2,2′2″-nitrilotris-, compound with alpha-2,4,6-tris (1-phenylethyl)phenyl... subject to reporting. (1) The chemical substance identified as ethanol, 2,2′2″-nitrilotris-, compound...

  2. Dichlorido{(E-2,4,6-trimethyl-N-[phenyl(2-pyridylmethylidene]aniline-κ2N,N′}palladium(II

    Directory of Open Access Journals (Sweden)

    Cheng-Hsien Yang

    2010-06-01

    Full Text Available The title complex, [PdCl2(C21H20N2], contains a PdII atom in a slightly distorted square-planar coordination environment defined by two N atoms from one 2,4,6-trimethyl-N-[phenyl(2-pyridylmethylidene]aniline ligand and two Cl atoms, forming a five-membered ring (N—Pd—N—C—C.

  3. Draft Genome Sequence of Bacillus sp. GZT, a 2,4,6-Tribromophenol-Degrading Strain Isolated from the River Sludge of an Electronic Waste-Dismantling Region

    Science.gov (United States)

    Liang, Zhishu; Li, Guiying; Das, Ranjit

    2016-01-01

    Here, we report the draft genome sequence of Bacillus sp. strain GZT, a 2,4,6-tribromophenol (TBP)-degrading bacterium previously isolated from an electronic waste-dismantling region. The draft genome sequence is 5.18 Mb and has a G+C content of 35.1%. This is the first genome report of a brominated flame retardant-degrading strain. PMID:27257197

  4. Characterization of bacterial populations of 2,4,6-trinitrotoluene (TNT) contaminated soils and isolation of a Pseudomonas aeruginosa strain with TNT denitration activities

    OpenAIRE

    Eyers, Laurent

    2007-01-01

    2,4,6-trinitrotoluene (TNT) is a toxic and recalcitrant pollutant contaminating soils and groundwater. Therefore, characterization of microbial populations of TNT-contaminated soils and isolation of bacteria degrading this pollutant are of primordial importance. Comparison of hybridizations of 16S rRNA derived from uncontaminated and TNT-contaminated soil samples required the development of a functional ANOVA model. Specifically, a statistical tool was necessary to compare dissociation curves...

  5. 含不同水溶性基团的三聚氰氯衍生物的合成%Synthesis of 2,4,6-Trichloro-1,3,5-triazine Derivatives with Different Water-Soluble Groups

    Institute of Scientific and Technical Information of China (English)

    刘琳; 田秀枝; 蒋学

    2015-01-01

    The key of producing fuel ethanol with lignocellulose is how to hydrolyze cellulose into fermentable sugars efficiently, but the low yield of fermentable sugar in cellulose hydrolysis is the bottle-neck problem in biomass utilization. A creative idea was proposed that based on the cellulose fabric dyed reactive dyes owns the character of“reactive tendering”, the yield of hydrolysis can be improved by the crystal structural change of cellulose based on chemical modification. 2,4,6-trichloro-1,3,5-triazine derivatives with different water-soluble groups were synthesized successfully through nucleophilic substitution reaction between cyanuric chloride and aminopropionic acid or aminoethanesulfonic acid. These 2,4,6-trichloro-1,3,5-triazine derivatives were used as modifiers and reacted with lignocellulose under chemical modification. The structure of the target products were determined by IR, HPLC/MS and 13C NMR spectrometer.%木质纤维素制备乙醇最关键的步骤是使纤维素水解成可发酵糖,但目前纤维素水解效率很低,是生物质能源化利用的瓶颈。依据活性染料染色纤维素类织物具有“活性脆损”的性质提出一种新思路——以化学改性的方法改变纤维素的结晶结构从而提高其水解效率。采用三聚氰氯与氨基丙酸、氨基乙磺酸中的-NH2发生亲核取代反应,制备含有不同水溶性基团的三聚氰氯衍生物作为木质纤维素化学改性的改性剂。通过红外光谱、高效液相色谱质谱联用、13C NMR谱对其进行结构验证。

  6. Organic-inorganic compounds with strong nonlinear optical properties based on 2,4,6-trimethylpyridinium and tetrahedral BF4- networks

    Science.gov (United States)

    Wojtaś, Maciej; Bil, Andrzej; Jakubas, Ryszard; Gągor, Anna; Pietraszko, Adam; Czupiński, Olaf; Tylczyński, Zbigniew; Isakov, Dmitry

    2011-04-01

    A different organic-inorganic crystal—[2,4,6-trimethylpyridinium][BF4]—of nonlinear optical properties at room temperature was synthesized and characterized. The compound is built up of the organic [2,4,6-trimethylpyridinium] cations incorporated into inorganic, tetrahedral BF4 anions. It crystallizes at room temperature in the polar space group Pmn21, and undergoes three first-order phase transitions at [cooling (heating)] 241 (245) K, 297 (328) K, and 389 (406) K. The lowest temperature ferroic phase transition (ferroelastic; mm2→m type) is related to the significant pyroelectric effect. The compound was studied by single-crystal x-ray diffraction at several temperatures, using thermal (differential scanning calorimetry and thermogravimetric analysis) methods and dielectric spectroscopy. The piezoelectric, pyroelectric, and second-harmonic generation (SHG) properties were determined. Density-functional theory calculations in two stable phases are given. The [2,4,6-trimethylpyridinium][BF4] crystal exhibits a SHG efficiency of 1.7 times that of KDP. The mechanism of structural phase transitions in the title compound is discussed.

  7. Chemical and physical data collected aboard the THOMAS G. THOMPSON during cruise TN246 in the South Atlantic Ocean and South Pacific Ocean from 2010-01-15 to 2010-03-05 (NODC Accession 0117396)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0117396 includes chemical and physical data collected aboard the THOMAS G. THOMPSON during cruise TN246 in the South Atlantic Ocean and South Pacific...

  8. 2,4,6-Trimethylpyridinium perchlorate: Polar properties and correlations with molecular structure of organic-inorganic hybrid crystal

    International Nuclear Information System (INIS)

    [(CH3)3C5H2NH][ClO4] has been synthesized and characterized by X-ray (at 344, 245, 180 and 115 K), calorimetric, dilatometric, dielectric and pyroelectric measurements. At room temperature the crystal structure is polar, space group Pmn21. It consists of discrete disordered [ClO4]- anions and ordered trimethylpyridinium cations giving the 3D network of hydrogen bonds. The compound reveals a rich polymorphism in the solid state. It undergoes four solid-solid phase transitions: from phases I to II at 356/327 K (heating/cooling), II→III at 346/326, III→IV at 226 K and IV→V at 182/170 K. [(CH3)3C5H2NH][ClO4] reveals a strong pyroelectric response over a wide temperature region (phases III, IV and V) with the spontaneous polarization changes (ΔPs) of the order of 1.5-8x10-3C/m2. The spontaneous polarization is irreversible over all the polar phases, however, the magnitude of the ΔPs in the vicinity of the phase transitions is characteristic of compounds with the ferroelectric order. The molecular mechanism of the successive phases transitions in the studied crystal is proposed. - A novel organic-inorganic hybrid material, simple ionic salt: 2,4,6-trimethylpyridinium perchlorate, [(CH3)3C5H2NH][ClO4] has been synthesized. In this paper we report singlecrystal X-ray, powder X-ray, calorimetric, dilatometric, dielectric and pyroelectric studies of this compound over a wide temperature range. A possible mechanism of the structural phase transitions in [(CH3)3C5H2NH][ClO4] is discussed with particular attention focused on unusually strong pyroelectric properties.

  9. Degradation of 2,4,6-trinitrotoluene in water and soil slurry utilizing a calcium peroxide compound.

    Science.gov (United States)

    Arienzo, M

    2000-02-01

    The degradation of 2,4,6-trinitrotoluene was examined in pure water and contaminated soil slurry using calcium peroxide as a source of solid hydrogen peroxide and oxygen. The extent of TNT oxidation was compared with that obtained by using hydrated lime, which is normally generated by slurrying CaO2 in water and contained in CaO2 technical formulation (approximately 50%, w/w). Complete TNT degradation occurred between 280 min, 0.1% CaO2/Ca(OH)2 and 20 min, 1% CaO2/Ca(OH)2. A large part of the generated oxidation products, 80-90%, were absorbed on the solid calcium hydroxide, whereas the remaining 10-20% was detected in solution until 48 h. Removal of nitro groups was extremely effective in CaO2 slurry, where all the nitrogen (3 mol per mol of TNT) was removed from TNT within 240 min. Respect to calcium hydroxide, the peroxy compound liberated H2O2 in solution, 370 mg l-1 at 0.2% CaO2, w/v, which then decomposed within 480 min. Most of the 14C-TNT was retained more strongly on the calcium hydroxide generated by slurrying CaO2. This pool remained adsorbed on the solid until pH dropped below 5.8. The treatment of a contaminated soil slurry, 700 mg TNT kg-1, reduced CH3CN extractable TNT below 20 mg kg-1 at very low concentration of CaO2/Ca(OH)2, approximately 0.2%, w/w. Both oxidants do not lead to soil sterilization as the phosphorus added to neutralize the pH serves as a source of nutrient for the soil biomass. PMID:10665396

  10. Alkaline Hydrolysis/Polymerization of 2,4,6-Trinitrotoluene: Characterization of Products by 13C and 15N NMR

    Science.gov (United States)

    Thorn, K.A.; Thorne, P.G.; Cox, L.G.

    2004-01-01

    Alkaline hydrolysis has been investigated as a nonbiological procedure for the destruction of 2,4,6-trinitrotoluene (TNT) in explosives contaminated soils and munitions scrap. Nucleophilic substitutions of the nitro and methyl groups of TNT by hydroxide ion are the initial steps in the alkaline degradation of TNT. Potential applications of the technique include both in situ surface liming and ex situ alkaline treatment of contaminated soils. A number of laboratory studies have reported the formation of an uncharacterized polymeric material upon prolonged treatment of TNT in base. As part of an overall assessment of alkaline hydrolysis as a remediation technique, and to gain a better understanding of the chemical reactions underlying the hydrolysis/polymerization process, the soluble and precipitate fractions of polymeric material produced from the calcium hydroxide hydrolysis of unlabeled and 15N-labeled TNT were analyzed by elemental analysis and 13C and 15N nuclear magnetic resonance spectroscopy. Spectra indicated that reactions leading to polymerization included nucleophilic displacement of nitro groups by hydroxide ion, formation of ketone, carboxyl, alcohol, ether, and other aliphatic carbons, conversion of methyl groups to diphenyl methylene carbons, and recondensation of aromatic amines and reduced forms of nitrite, including ammonia and possibly hydroxylamine, into the polymer. Compared to the distribution of carbons in TNT as 14% sp 3- and 86% sp2-hybridized, the precipitate fraction from hydrolysis of unlabeled TNT contained 33% sp3- and 67% sp 2-hybridized carbons. The concentration of nitrogen in the precipitate was 64% of that in TNT. The 15N NMR spectra showed that, in addition to residual nitro groups, forms of nitrogen present in the filtrate and precipitate fractions include aminohydroquinone, primary amide, indole, imine, and azoxy, among others. Unreacted nitrite was recovered in the filtrate fraction. The toxicities and susceptibilities to

  11. Vibrational spectroscopic study of new promising materials for non-linear optics. Phosphates of 2,4,6-triaminopyrimidine

    International Nuclear Information System (INIS)

    Complete text of publication follows. The searching for new materials exhibiting nonlinear optical properties (e.g. second harmonic generation - SHG) in combination with other desirable properties (optical transparency, thermal, optical and mechanical stability) continues to be an important research goal in nonlinear optics (NLO). Essential applications of these materials lie in the areas of optical communications and optical signal processing, as well as storage and other information processing tasks. Interesting class of NLO compounds is based on salts combining a cation derived from a polarizable organic molecule with an inorganic anion capable of forming hydrogen-bonded crystal structures. The bonding energy present in the hydrogen bonds can counteract the tendencies of the organic dipoles to form centrosymmetric pairs. It is assumed that the acid part of such molecular complex is responsible for favourable chemical, mechanical and thermal properties, due to strong hydrogen bond interactions which stabilize the crystal lattice and also contributes to the second-order NLO coefficient of the crystal. The organic part is mainly responsible for the nonlinear optical properties of the crystal. Full assignment of vibrational spectra (employing quantum-chemical computational methods) of crystalline materials with promising SHG activity is very useful not only for their identification but also with respect to their nonlinear optical properties. In this contribution we are presenting results concerning three novel phosphates of 2,4,6-triaminopyrimidine. Assignment of vibrational spectra is based on results of X-ray structural analysis and quantum-chemical computations. Efficiency of SHG for polycrystalline samples is also presented and discussed. This work was supported by the Grant Agency of Czech Republic (grant No. 203/09/0878 and is part of the long term Research Plan of the Ministry of Education of the Czech Republic No. MSM0021620857.

  12. Spartathlon, a 246 kilometer foot race: effects of acute inflammation induced by prolonged exercise on circulating progenitor reparative cells.

    Science.gov (United States)

    Goussetis, Evgenios; Spiropoulos, Antonia; Tsironi, Maria; Skenderi, Katerina; Margeli, Alexandra; Graphakos, Stelios; Baltopoulos, Panayiotis; Papassotiriou, Ioannis

    2009-01-01

    Endothelial progenitor cells (EPCs) and the recently described circulating fibrocytes (CFs) are strongly associated with tissue repair. We investigated the kinetics of both "repair" progenitor cells in healthy athletes who participated in the "Spartahlon" ultradistance foot race (246 km continuous running exercise), which provides a unique model of inducing dramatic systemic inflammatory changes. Peripheral blood mononuclear cells (PBMCs) were isolated from 10 volunteer athletes, who completed successfully the race, before, at the end, and at 48 h post-race. EPCs and CFs were detected as endothelial colony-forming units (CFU-ECs) and as the number of adherent with a spindle-shaped morphology Collagen I(+) cells detected after 6-day culture of PBMCs, respectively. The marked increase of plasma levels of CRP, IL-6, SAA, MCP-1, IL-8, sVCAM-1, sICAM-1, thrombomodulin (sTM) and NT-pro-BNP at the end of race established acute inflammation and tissue injury. EPCs increased by nearly eleven-fold in peripheral blood at the end of the race from 44.5+/-2.5/ml to 494.6+/-27.9/ml and remained increased 428.5+/-31.5/ml at 48 h post-race (p<0.0001). The number of the fibrocytes cultured from PBMCs obtained before, at the end, and 48 h post-race did not reveal any significant difference. These findings indicate that bone marrow responses to acute inflammatory damage, induced by exhausting exercise, with a rapid release of EPCs but not CFs into circulation. Given the ability of EPCs to promote angiogenesis and vascular regeneration, we may suggest that this kind of cell mobilization may serve as a physiologic repair mechanism in acute inflammatory tissue injury. PMID:19233694

  13. Transformation of 2,4,6-trinitrotoluene in soil in the presence of the earthworm Eisenia andrei

    Energy Technology Data Exchange (ETDEWEB)

    Renoux, A.Y.; Sarrazin, M.; Hawari, J.; Sunahara, G.I.

    2000-06-01

    The ability of the earthworm Eisenia andrei to metabolize 2,4,6-trinitrotoluene (TNT) was studied in experiments with TNT-spiked soils, dermal contact tests, and with an in vitro assay. Lethality of TNT in a forest sandy soil was first determined. Then TNT at lethal and sublethal concentrations was applied to the same soil and was monitored along with its metabolites in extracts of soil and earthworm tissue for up to 14 d post application. High performance liquid chromatography-ultra violet analyses indicated that TNT was transformed in the presence of E. andrei by a reductive pathway to 2-amino-3,6-dinitrotoluene (2-ADNT), 4-amino-2,6-dinitrotoluene (4-ADNT), 2,4-diamino-6-nitrotoluene (2.4-DANT), and traces of 2,6-diamino-4-nitrotoluene (2,6-DANT) in earthworm tissues. This transformation could be explained by either a metabolic mechanism within the earthworm or by the enhancement of an earthworm-associated microbial activity or both. The TNT concentrations decreased from the spiked soils. However, the monoamino-dinitrotoluene (2-ADNT and 4-ADNT) concentrations increased with exposure duration and were dependent on the initial TNT soil concentrations. This was also observed to a lesser extent in the TNT-spiked soils with no earthworms present. The biotransformation of TNT into 2-ADNT, 4-ADNT, and 2,4-DANT and the presence of these metabolites in E. andrei after dermal contact on TNT-spiked filter paper showed that dermal uptake can be a significant exposure route for TNT. In vitro experiments showed that earthworm homogenate could metabolize TNT and form 2-ADNT and 4-ADNT at room temperature and at 37 C. This effect was inhibited by heat inactivation prior to incubation or by incubation at 4 C, suggesting that the biotransformation of TNT in the presence of E. andrei may be enzymatic in nature.

  14. Transplacental transport and fetal localization of bispehnol A, tetrabromobisphenol A and 2,4,6-tribromophenol in mice

    Energy Technology Data Exchange (ETDEWEB)

    Sundberg, A.; Brunstroem, B.; Brandt, I. [Uppsala Univ. (Sweden). Dept. of Environmental Toxicology; Cantillana, T.; Bergman, Aa. [Stockholm Univ. (Sweden). Dept. of Environmental Chemistry

    2004-09-15

    Bisphenol A (BPA) is an intermediate in the production of epoxy resins, while its brominated derivative tetrabromobishenol A (TBBPA) and its photolysis degradation product 2,4,6-tribromophenol (TBP) are widely used flame retardants. These brominated compounds have been identified in human blood. TBBPA, TBP and a number of 4-hydroxy-PCBs (e.g. 4-OH-CB107) are high affinity ligands for the thyroxin (T4) transporter transthyretin (TTR) in rodents and other species. Displacement of T4 from the TTR binding site has been proposed as an important mechanism of endocrine disruption by certain halogenated phenolic environmental pollutants. BPA is a fairly potent environmental estrogen receptor agonist that can induce an array of estrogenic effects in several species including mammals, birds and fish. Although the estrogenic activity of TBBPA is less obvious, this brominated BPA analog has been reported to interact with the estrogen receptor and induce estrogenic effects in some in vitro test systems. While the reproductive and developmental toxicity of BPA is well documented, there is evidence that also halogenated phenolic compounds can pass the placental barrier and induce such toxicity. Within the objectives of the COMPARE EU project we study the fetal and maternal kinetics and transplacental transport of phenolic environmental pollutants in pregnant mice. To explore the role of TTR in the placental and blood-brain barrier transport, we employ TTR-deficient mice. For comparative reasons, we also explore the transfer to bird embryos following injection into the yolk or administration to the egg-laying bird. In the present communication, we report on the disposition of BPA, TBBPA and TBP in the fetoplacental unit in pregnant wild-type mice.

  15. SEMI SINTESIS SENYAWA 2,4,6-TRINITROFENILHIDRAZON KALANON DAN UJI AKTIVITAS TERHADAP SEL LEUKIMIA L1210

    Directory of Open Access Journals (Sweden)

    Mochammad Chasani

    2011-11-01

    Full Text Available Kalanon adalah senyawa antikanker yang diisolasi dari Calophyllum biflorum Hends dan Ws. Aktivitas kalanon terhadap sel leukemia L1210 masih rendah yakni dengan niali IC50 = 59,4 ug/mL. Suatu senyawa dikatakan aktif sebagai antikanker jjika memiliki nilai IC50 di bawah 10 ug/mL. Penelitian ini ditujukan untuk mensintesis senyawa turunan kalanon dan diharapkan diperoleh senyawa baru yang mempunyai aktivitas lebih tinggi dibandingkan senyawa asal kalanon. Senyawa turunan kalanon diperoleh melalui reaksi antara kalanon dengan 2,4,6-trinitrofenilhidrazin. Reaksi dilakukan pada suhu 78 oC selama delapan jam. Analisis pendahuluan senyawa hasil sintesis dilakukan dengan metode kromatografi lapis tipis (KLT menggunakan eluen n-heksana dan etil asetat (2:1, v/v. Pemurnian senyawa hasil sintesis menggunakan teknik rekristalisasi dengan pelarut n-heksana dan diklorometan (3:1, v/v. Senyawa hasil sintesis diperoleh dengan Rf = 0,6609 dan rendemen 5,125 % ( b/b serta berupa kristal berwarna coklat. Identifikasi senyawa hasil sintesis dilakukan dengan spektrometer massa dan spektrofotometer IR. Hasil identifikasi menunjukkan bahwa senyawa hasil sintesis yang diharapkan telah terbentuk. Data spektrometer massa diperoleh ion molekul M+ = 647 dengan lepasnya molekul H2. Fragmen-fragmen yang terbentuk adalah pada m/e = 504, m/e = 479, m/e = 451, m/e = 429, m/e = 405, m/e = 377, m/e = 341, m/e = 316, m/e = 281, m/e = 253, m/e = 233, m/e = 207, m/e = 177, m/e = 156, m/e = 135, m/e = 96, m/e = 73, dan m/e = 41. Hasil spektrofotometer IR menunjukkan pita serapan pada 1654.8 cm-1 yang merupakan daerah regang ikatan rangkap C=N, pita serapan pada 3000 cm-1 – 3400 cm-1 adalah pita getaran OH fenol dan pita pada 1380 cm-1 menunjukkan rentangan simetri gugus nitro (NO2. Hasil uji sitotoksik terhadap sel leukemia L1210 menghasilkan nilai IC50 sebesr 47.69 μg/ml.

  16. Uptake of 2,4,6-Trinitrotoluene (TNT) by Vetiver grass (Vetiviera ziznoides L.) -- Preliminary results from a hydroponic study

    Science.gov (United States)

    Shakya, K. M.; Sarkar, D.; Datta, R.; Makris, K.; Pachanoor, D.

    2006-05-01

    2,4,6-Trinitrotoluene(TNT) is a potent mutagen and a Group C human carcinogen that has been widely used to produce munitions and explosives. As a result, vast areas that have been previously used as military ranges, munition burning and open detonation sites have been heavily contaminated with TNT. Conventional remedial activities in such contaminated sites commonly rely on methods such as incineration, land filling and soil composting. Phytoremediation offers a cost-effective solution, utilizing plants to phytoextract TNT from the contaminated soil. We propose the use of vetiver grass (Vetiveria zizanoides) to remove TNT from such contaminated soils. Vetiver is a fast-growing and adaptive grass, enabling its use in TNT-contaminated sites in a wide variety of soil types and climate. We also hypothesized that TNT removal by vetiver grass will be enhanced by utilizing a chaotropic agent (urea) to alter rhizosphere/root hair chemical environment. The objectives of this preliminary hydroponic study were: i) to investigate the effectiveness of vetiver grass in removing TNT from solution, and ii) to evaluate the use of a common agrochemical (urea) in enhancing TNT removal by vetiver grass. Vetiver plants were grown in a hydroponic system with five different TNT concentrations (0, 5, 10, 25, and 50 mg TNT L-1) and three urea concentrations (0, 0.01 and 0.1%). A plant density of 10 g L-1 and three replicate vessels per treatment were used. Aliquots were collected at several time intervals up to 192 hour, and were analyzed for TNT with HPLC. Results showed that vetiver was able to remove TNT from hydroponic solutions. The overall magnitude and kinetics of TNT removal by vetiver grass was enhanced in the presence of urea. TNT removal kinetics depended on TNT and urea initial concentrations, suggestive of second-order kinetic reactions. Preliminary results are encouraging, but in need for verification using more detailed studies involving TNT-contaminated soils. Ongoing

  17. Preliminary kinetics and metabolism of 2,4,6-trinitrotoluene and its reduced metabolites in an aquatic oligochaete

    Energy Technology Data Exchange (ETDEWEB)

    Conder, Jason M.; Point, Thomas W. La; Bowen, Alethea T

    2004-08-25

    We examined the toxicokinetics and metabolism of 2,4,6-trinitirotoluene (TNT) and four of its major reduced metabolites (2-amino-4,6-dinitrotoluene (2ADNT), 4-amino-2,6-dinitrotoluene (4ADNT), and 2,4-diamino-6-nitrotoluene (2,4DANT)) in the freshwater, aquatic oligochaete Tubifex tubifex exposed to spiked, reconstituted water. In uptake experiments with each compound, steady state concentrations were reached within 1 h, and all absorbed compounds were completely eliminated in 0-3 h. The appearance of 2ADNT and 4ADNT (from metabolism of absorbed TNT) was five times slower, reaching 95% of steady state in 14.2-16.1 h. Approximately, 82% of absorbed TNT was metabolized to ADNTs; metabolism to 4ADNT was favored over 2ADNT by a factor of 3. No further metabolism of ADNTs to DANTs was detected. After a loss of 29-50% of metabolically-generated ADNTs during the first hour of the TNT depuration experiment, Tubifex ADNT concentrations remained constant throughout the 53 h depuration period. This suggests differences between the toxicokinetics of absorbed ADNTs and the toxicokinetics of metabolically-generated ADNTs. Experiments using radiolabeled ({sup 14}C) TNT revealed that only 15-47% of {sup 14}C-TNT equivalents were identified as TNT, 2ADNT, or 4ADNT, indicating significant metabolism and/or binding to biomolecules. Of unidentified {sup 14}C-TNT equivalents, 28-38% remained unextractable. Both unextractable and extractable unidentified substances increased throughout the 54 h {sup 14}C-TNT uptake experiment. The unidentified portions of the radiolabel were not eliminated during a 53-h depuration experiment. Bioconcentration factors (BCFs) for HPLC-detectable compounds were found to be linearly related to log K{sub OW} (r{sup 2} = 0.9963). BCFs for 2ADNT, 4ADNT, and 2,4DANT were 10.22, 12.41, and 2.75, respectively. The BCF for TNT was 12.25, based on a molar sum of total TNT and its metabolites ({sigma}TNT + 2ADNT + 4ADNT), and 2.53 based on TNT only. Compound

  18. Preliminary kinetics and metabolism of 2,4,6-trinitrotoluene and its reduced metabolites in an aquatic oligochaete

    International Nuclear Information System (INIS)

    We examined the toxicokinetics and metabolism of 2,4,6-trinitirotoluene (TNT) and four of its major reduced metabolites (2-amino-4,6-dinitrotoluene (2ADNT), 4-amino-2,6-dinitrotoluene (4ADNT), and 2,4-diamino-6-nitrotoluene (2,4DANT)) in the freshwater, aquatic oligochaete Tubifex tubifex exposed to spiked, reconstituted water. In uptake experiments with each compound, steady state concentrations were reached within 1 h, and all absorbed compounds were completely eliminated in 0-3 h. The appearance of 2ADNT and 4ADNT (from metabolism of absorbed TNT) was five times slower, reaching 95% of steady state in 14.2-16.1 h. Approximately, 82% of absorbed TNT was metabolized to ADNTs; metabolism to 4ADNT was favored over 2ADNT by a factor of 3. No further metabolism of ADNTs to DANTs was detected. After a loss of 29-50% of metabolically-generated ADNTs during the first hour of the TNT depuration experiment, Tubifex ADNT concentrations remained constant throughout the 53 h depuration period. This suggests differences between the toxicokinetics of absorbed ADNTs and the toxicokinetics of metabolically-generated ADNTs. Experiments using radiolabeled (14C) TNT revealed that only 15-47% of 14C-TNT equivalents were identified as TNT, 2ADNT, or 4ADNT, indicating significant metabolism and/or binding to biomolecules. Of unidentified 14C-TNT equivalents, 28-38% remained unextractable. Both unextractable and extractable unidentified substances increased throughout the 54 h 14C-TNT uptake experiment. The unidentified portions of the radiolabel were not eliminated during a 53-h depuration experiment. Bioconcentration factors (BCFs) for HPLC-detectable compounds were found to be linearly related to log KOW (r2 = 0.9963). BCFs for 2ADNT, 4ADNT, and 2,4DANT were 10.22, 12.41, and 2.75, respectively. The BCF for TNT was 12.25, based on a molar sum of total TNT and its metabolites (ΣTNT + 2ADNT + 4ADNT), and 2.53 based on TNT only. Compound hydrophobicity predicted the toxicokinetics and

  19. Wet oxidative method for removal of 2,4,6-trichlorophenol in water using Fe(III), Co(II), Ni(II) supported MCM41 catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Chaliha, Suranjana [Department of Chemistry, Gauhati University, Guwahati 781014, Assam (India); Bhattacharyya, Krishna Gopal [Department of Chemistry, Gauhati University, Guwahati 781014, Assam (India)], E-mail: krishna2604@sify.com

    2008-02-11

    Chlorophenols in water are resistant to biological oxidation and they have to be destroyed by chemical oxidation. In the present work, Fe(III), Co(II) and Ni(II) incorporated MCM41 mesoporous solids were used as catalysts for oxidation of 2,4,6-trichlorophenol in water with or without the oxidant, H{sub 2}O{sub 2}. The catalysts were prepared by impregnation and were characterized by XRD and FTIR measurements. The parent MCM41, Fe(III), Co(II) and Ni(II) impregnated MCM41 had cation exchange capacity of 20.5, 25.5, 24.2, 26.0 mequiv./100 g, respectively. The catalysts were used after calcination at 773-873 K for 5 h. The reactions were carried out in a high pressure stirred reactor at 0.2 MPa (autogenous) and 353 K under various reaction conditions. The conversion achieved with Fe(III), Co(II) and Ni(II) incorporated MCM41 in 5 h is respectively 59.4, 50.0 and 65.6% with 2,4,6-TCP:H{sub 2}O{sub 2} molar ratio of 1:1, and 60.2, 60.9 and 68.8% in absence of H{sub 2}O{sub 2}. The oxidation has a first order rate coefficient of (1.2-4.8) x 10{sup -3} min{sup -1}. The results show that introduction of Fe(III), Co(II) and Ni(II) into MCM-41 through impregnation produces very effective catalysts for wet oxidation of 2,4,6-trichlorophenol.

  20. Target Awareness: Lupus

    Science.gov (United States)

    ... Target Awareness: Lupus Jan. 15, 2009 Target Awareness: Lupus Target Awareness: Lupus provides a brief overview of ... Email Print Tags for this Story treatments symptoms Lupus FAQ What is lupus? What are the common ...

  1. Target Awareness: Lupus

    Medline Plus

    Full Text Available ... Target Awareness: Lupus Jan. 15, 2009 Target Awareness: Lupus Target Awareness: Lupus provides a brief overview of ... Email Print Tags for this Story treatments symptoms Lupus FAQ What is lupus? What are the common ...

  2. Target factory in perspective

    International Nuclear Information System (INIS)

    A target factory diagram has been constructed for an analysis of the shell coating process system in relation to target production. The number of deposition units needed to achieve the coating requirements will be a major target production operating cost

  3. Detecció de compostos volàtils, clorofenols, cloroanisoles i 2,4,6-tribromoanisole, relacionats amb el "gust del suro"

    OpenAIRE

    Insa Aguilar, Sara

    2006-01-01

    D'entre els defectes organolèptics associats al vi, en destaca l'anomenat "gust de suro" habitualment vinculat a la presència de cloroanisoles, els quals són productes de l'activitat microbiana formats a partir dels corresponents clorofenols. La present tesi doctoral recull, en primer lloc, metodologies analítiques adreçades principalment a la determinació dels compostos clorofenòlics (2,4,6-triclorofenol, 2,3,4,6-tetraclorofenol i pentaclorofenol) en el control de qualitat dels taps suro, em...

  4. PRIMA-1Met/APR-246 induces apoptosis and tumor growth delay in small cell lung cancer expressing mutant p53

    DEFF Research Database (Denmark)

    Zandi, Roza; Selivanova, Galina; Christensen, Camilla Laulund;

    2011-01-01

    Small cell lung cancer (SCLC) is a highly malignant disease with poor prognosis, necessitating the need to develop new and efficient treatment modalities. PRIMA-1(Met) (p53-dependent reactivation of massive apoptosis), also known as APR-246, is a small molecule, which restores tumor suppressor...... function to mutant p53 and induces cancer cell death in various cancer types. Since p53 is mutated in more than 90% of SCLC, we investigated the ability of PRIMA-1(Met) to induce apoptosis and inhibit tumor growth in SCLC with different p53 mutations....

  5. Synthesis and characterization of 2,3-dibromopropyl-2,4,6-tribromophenyl ether (DPTE) and structurally related compounds evidenced in seal blubber and brain.

    Science.gov (United States)

    von der Recke, Roland; Vetter, Walter

    2007-03-01

    The unknown compound UBC-1 previously described as the major organobromine contamination in the blubber extract of a hooded seal (Cystophora cristata) from the Barents Sea was identified as 2,3-dibromopropyl-2,4,6-tribromophenyl ether (DPTE). DPTE, which is the main component of the brominated flame retardant (BFR) Bromkal 73-5 PE, was synthesized by electrophilic addition of bromine to allyl-2,4,6-tribromophenyl ether (ATE). The chirality of DPTE was proven by gas chromatographic enantioseparation of the synthesized racemate. On the basis of GC/ECNI-MS ion chromatograms (m/z79 and 81), DPTE was the dominating organobromine compound in blubber and brain samples of hooded seals and harp seals (Phoca groenlandica) from the Barents and Greenland Seas. The concentrations of DPTE in blubber and brain were up to 470 and 340 microg/kg wet weight. Next to DPTE, the natural dibromo-trichloromonoterpene (MHC-1), the anthropogenic BDE 47 and BDE 99, as well as ATE, 3,5-dibromo-2-(2',4'-dibromo)-phenoxyanisole (6-MeO-BDE 47), 2-bromoallyl-2,4,6-tribromophenyl ether (BATE), and 4,6-dibromo-2-(2',4'-dibromo)-phenoxyanisole (2'-MeO-BDE 68) were present with decreasing relevance. BATE, which was detected for the first time in environmental samples, was synthesized from DPTE by E2 elimination. In brain samples of the harp seals, DPTE, ATE, and BATE were the most abundant organobromine compounds, whereas polybrominated diphenyl ethers (PBDEs) and MHC-1 were virtually absent. This indicated that DPTE, ATE, and BATE were able to penetrate the blood-brain barrier. The general co-occurrence of ATE and BATE in samples contaminated with DPTE support the hypothesis that these compounds are biotransformation products of DPTE. Anaerobic transformation studies of DPTE with super-reduced corrinoids resulted in the formation of ATE. Furthermore, 2,4,6-tribromophenol (TBP) and two other unknown minor transformation products were detected. PMID:17396646

  6. catena-Poly[[diaquabis(formato-κOnickel(II]-μ-2,4,6-tris(4-pyridyl-1,3,5-triazine-κ2N2:N4

    Directory of Open Access Journals (Sweden)

    Miao Feng

    2011-05-01

    Full Text Available In the title compound, [Ni(CHO22(C18H12N6(H2O2]n, the NiII ion, lying on a crystallographic inversion center, has a distorted octahedral coordination comprising two water ligands, two O-atom donors from formate ligands and two N-atom donors from the 2,4,6-tris(4-pyridyl-1,3,5-triazine ligands. These ligands bridge the NiII complex units, forming zigzag chains along the c axis. Adjacent chains are linked by O—H...O hydrogen bonds, forming a three-dimensional supramolecular network.

  7. Fe(III) mineral reduction followed by partial dissolution and reactive oxygen species generation during 2,4,6-trinitrotoluene transformation by the aerobic yeast Yarrowia lipolytica

    OpenAIRE

    Ziganshin, Ayrat M; Ziganshina, Elvira E; Byrne, James; Gerlach, Robin; Struve, Ellen; Biktagirov, Timur; Rodionov, Alexander; Kappler, Andreas

    2015-01-01

    Understanding the factors that influence pollutant transformation in the presence of ferric (oxyhydr)oxides is crucial to the efficient application of different remediation strategies. In this study we determined the effect of goethite, hematite, magnetite and ferrihydrite on the transformation of 2,4,6-trinitrotoluene (TNT) by Yarrowia lipolytica AN-L15. The presence of ferric (oxyhydr)oxides led to a small decrease in the rate of TNT removal. In all cases, a significant release of NO2 − fro...

  8. Theoretical Study on the Structures and Electronic Spectra of the Derivatives of C60-P-2,4,6-Triphenyl Borazinc

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The structures and electronic spectra of the derivatives of C6o-P-2,4,6-triphenyl borazinc have been studied by using AM1 method. The calculated results indicate that this kind of compounds has a lower energy difference between HOMO and LUMO. It is found that the electron cloud on unoccupied frontier orbital mainly comes from the contribution of C6o, while that on occupied frontier orbital mainly concentrates on the side chain. A long-lived charge-separated state may occur in the objective compounds.

  9. Template synthesis, characterization and antimicrobial activity of the complex combinations of some transitional metals with isonicotinoylhydrazone -2,4,6- trimethylbenzaldehyde

    International Nuclear Information System (INIS)

    The complexes of Cu(II), Ni(II), Co(II), Mn(II), and Zn(II) with isonicotinoyl-hydrazone -2,4,6-trimethylbenzaldehyde (INHTB) are reported. The complexes have been characterized by analytical data, IR, UV-Vis, NMR spectra, magnetic susceptibility, thermal analysis and for the Cu(II) complex the ESR spectrum has been recorded. The anti-bacterial activity of these complexes were investigated against Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Salmonella enteritidis, Shigella flexneri bacteria. The INHTB ligand is coordinated at the metallic ions by oxygen amide (O=C) and the azomethine nitrogen. (author)

  10. Highly efficient and easy synthesis of 2,4,6-triarylpyridines catalyzed by pentafluorophenylammonium triflate (PFPAT) as a new recyclable solid acid catalyst in solvent-free conditions

    Institute of Scientific and Technical Information of China (English)

    Naser Montazeri; Saber Mahjoob

    2012-01-01

    Pentafluorophenylammonium triflate (PFPAT) was found to be a highly efficient catalyst for the preparation of 2,4,6-triarylpyridines from the reaction of acetophenone derivatives,aromatic aldehydes and ammonium acetate.Present methodology offers several advantages,such as short reaction time,high yields,simple procedure with an easy work-up and the absence of any volatile and hazardous organic solvent.In addition,this catalytic system can act as an active,inexpensive,metal-free,recoverable and recyclable catalyst.

  11. Hexaaquabis[3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanido-κ2N3,O4]barium tetrahydrate

    Directory of Open Access Journals (Sweden)

    Nguyen Dinh Do

    2013-11-01

    Full Text Available In the title compound, [Ba(C7H5N2O52(H2O6]·4H2O, the Ba2+ cation lies on a twofold rotation axis and is ten-coordinated by two 3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanide oxo O atoms [Ba—O = 2.8715 (17 Å], two hydroxyimino N atoms [Ba—N = 3.036 (2 Å], and six water molecules [Ba—O = 2.847 (2, 2.848 (2, and 2.880 (2 Å]. The 3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanide monoanions act in a bidentate chelating manner, coordinating through an N atom of the non-deprotonated hydroxyimino group and an O atom of the neighboring oxo group. Two lattice water molecules are located in the cavities of the framework and are involved in hydrogen bonding to O atoms of one of the coordinating water molecules and the O atom of a keto group of the ligand. As a result, a three-dimensional network is formed.

  12. Thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine – Synthesis, structure and luminescence properties

    International Nuclear Information System (INIS)

    Two new thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized and characterized. The resulted complexes [Cd(SCN)(NO3)(tptz)(H2O)] (1) and [Cd(SCN)2(tptz)(MeOH)] (2) were studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. The luminescent properties of 1 and 2 were studied in solution and solid state and compared with the free ligand. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(SCN)(NO3)(tptz)(H2O)] and [Cd(SCN)2(tptz)(MeOH)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. - Highlights: • Two novel thiocyanate cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TD-DFT level employing B3LYP/LANL2DZ

  13. Thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine – Synthesis, structure and luminescence properties

    Energy Technology Data Exchange (ETDEWEB)

    Nawrot, I. [Department of Crystallography, Institute of Chemistry, University of Silesia, ul. Szkolna 9, 40-006 Katowice (Poland); Machura, B., E-mail: basia@ich.us.edu.pl [Department of Crystallography, Institute of Chemistry, University of Silesia, ul. Szkolna 9, 40-006 Katowice (Poland); Kruszynski, R., E-mail: rafal.kruszynski@p.lodz.pl [Department of X-ray Crystallography and Crystal Chemistry, Institute of General and Ecological Chemistry, Lodz University of Technology, ul. Żeromskiego 116, 90-924 Łódź (Poland)

    2014-12-15

    Two new thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized and characterized. The resulted complexes [Cd(SCN)(NO{sub 3})(tptz)(H{sub 2}O)] (1) and [Cd(SCN){sub 2}(tptz)(MeOH)] (2) were studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. The luminescent properties of 1 and 2 were studied in solution and solid state and compared with the free ligand. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(SCN)(NO{sub 3})(tptz)(H{sub 2}O)] and [Cd(SCN){sub 2}(tptz)(MeOH)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. - Highlights: • Two novel thiocyanate cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TD-DFT level employing B3LYP/LANL2DZ.

  14. Structural and Catalytic Differences between Two FADH2-Dependent Monooxygenases: 2,4,5-TCP 4-Monooxygenase (TftD) from Burkholderia cepacia AC1100 and 2,4,6-TCP 4-Monooxygenase (TcpA) from Cupriavidus necator JMP134

    OpenAIRE

    ChulHee Kang; Luying Xun; Andrew Popchock; Arun Kumar Subramanian; Webb, Brian N.; Robert P. Hayes; Mark Nissen

    2012-01-01

    2,4,5-TCP 4-monooxygenase (TftD) and 2,4,6-TCP 4-monooxygenase (TcpA) have been discovered in the biodegradation of 2,4,5-trichlorophenol (2,4,5-TCP) and 2,4,6-trichlorophenol (2,4,6-TCP). TcpA and TftD belong to the reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenases and both use 2,4,6-TCP as a substrate; however, the two enzymes produce different end products. TftD catalyzes a typical monooxygenase reaction, while TcpA catalyzes a typical monooxygenas...

  15. Effective neutron targets

    International Nuclear Information System (INIS)

    Because of the lack of a free neutron target, deuterium targets have been used extensively in studying the neutron structure. The unique spin structure of the 3He ground state wave function and the recent developments in laser technologies made polarized 3He targets widely used in many experiments from neutron electromagnetic form factor studies to nucleon spin structure function measurements at all major electron accelerator facilities. In this talk, the current status of the polarized 3He targets will be reviewed. The author will focus on neutron electromagnetic form factor studies using polarized 3He targets. The polarized nucleon spin structure function measurements using polarized 3He targets will also be discussed

  16. Molecular Targets for Targeted Radionuclide Therapy

    International Nuclear Information System (INIS)

    Molecular targeted radionuclide cancer therapy is becoming of increasing importance, especially for disseminated diseases. Systemic chemotherapies often lack selectivity while targeted radionuclide therapy has important advantages as the radioactive cytotoxic unit of the targeting vector is specifically directed to the cancer, sparing normal tissues. The principle strategy to improve cancer selectivity is to couple therapeutic agents to tumour-targeting vectors. In targeted radionuclide therapy (TRT), the cytotoxic portion of the conjugates normally contains a therapeutic radiometal immobilised by a bifunctional chelator. The aim is therefore to use as ligand-targeted therapeutics vectors coupled to Auger-, alpha- and/or beta-emitting radionuclides. An advantage of using radiation instead of chemotherapeutics as the cytotoxic agent is the so called 'crossfire effect'. This allows sterilisation of tumour cells that are not directly targeted due to heterogeneity in target molecule expression or inhomogeneous vector delivery. However, before the targeting ligands can be selected, the target molecule on the tumour has to be selected. It should be uniquely expressed, or at least highly overexpressed, on or in the target cells relative to normal tissues. The target should be easily accessible for ligand delivery and should not be shed or down- regulated after ligand binding. An important property of a receptor (or antigen) is its potential to be internalized upon binding of the ligand. This provides an active uptake mechanism and allows the therapeutic agent to be trapped within the tumour cells. Molecular targets of current interest include: Receptors: G-protein coupled receptors are overexpressed on many major human tumours. The prototype of these receptors are somatostatin receptors which show very high density in neuroendocrine tumours, but there are many other most interesting receptors to be applied for TRT. The targeting ligands for these receptors are

  17. Price level targeting

    OpenAIRE

    Shukayev, Malik; Ueberfeldt, Alexander

    2010-01-01

    Various papers have suggested that Price-Level targeting is a welfare improving policy relative to Inflation targeting. From a practical standpoint, this raises an important yet unanswered question: What is the optimal price index to target? This paper derives the optimal price level targeting index defined over the eight main components of the Consumer Price Index. It finds that such an index places a heavier weight, relative to the expenditure weight, on sectors with slow price adjustments....

  18. Multilayer polymer microspot targets

    International Nuclear Information System (INIS)

    Last year the authors reported on the development of a seeded microspot x-ray diagnostic target. This target consisted of a 300-μm-diam, 2-μm-thick disk of silicon or sulfur-seeded hydrocarbon polymer nested tightly in a hole in a 2-μm-thick film of pure hydrocarbon polymer. This year they extended our work on the microspot target, fully encapsulating the microspot in what they call the multilayer polymer microspot target

  19. Target Price Accuracy

    OpenAIRE

    Alexander G. Kerl

    2011-01-01

    This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown) 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio). However, target price accuracy is positive...

  20. The Targeting of Advertising

    OpenAIRE

    Ganesh Iyer; David Soberman; J. Miguel Villas-Boas

    2005-01-01

    An important question that firms face in advertising is developing effective media strategy. Major improvements in the quality of consumer information and the growth of targeted media vehicles allow firms to precisely target advertising to consumer segments within a market. This paper examines advertising strategy when competing firms can target advertising to different groups of consumers within a market. With targeted advertising, we find that firms advertise more to consumers who have a st...

  1. TARGET COSTING FUNCTIONS

    OpenAIRE

    Dimi OFILEANU

    2015-01-01

    This article aims to highlight the concept of Target Costing. Based on the characteristics of Target Costing, identified in specialized literature, the article presents its main advantages and disadvantages. Also, a comparison is being made between Target Cost and Traditional Cost (in its traditional form, the cost represents an independent variable on the basis of which the sell price is established; and in the Target Cost form the cost represents a dependent variable which is determined on ...

  2. An actionable climate target

    Science.gov (United States)

    Geden, Oliver

    2016-05-01

    The Paris Agreement introduced three mitigation targets. In the future, the main focus should not be on temperature targets such as 2 or 1.5 °C, but on the target with the greatest potential to effectively guide policy: net zero emissions.

  3. Bis(2,4,6-triamino-1,3,5-triazin-1-ium) tris(pyridine-2,6-dicarboxylato)zirconate(IV) tetrahydrate

    OpenAIRE

    Faranak Manteghi; Hossein Aghabozorg; Shirin Daneshvar

    2008-01-01

    The title compound, (C3H7N6)2[Zr(C7H3NO4)3]·4H2O or (tataH)2[Zr(pydc)3]·4H2O (tata is 2,4,6-triamino-1,3,5-triazine and pydcH2 is pyridine-2,6-dicarboxylic acid), was obtained by reaction between pydcH2, tata and zirconyl chloride octahydrate in aqueous solution. In the structure, the ZrIV atom is nine-coordinated by three (pydc)2− groups, resulting in an anionic complex which is balanced by two (tataH)+ cations. One of the NH2 groups shows positional disorder, with site occup...

  4. Adhesive properties of some fluoropolymer binders with the insensitive explosive 1,3,5-triamino-2,4,6-trinitrobenzene (TATB).

    Science.gov (United States)

    Yeager, J D; Dattelbaum, A M; Orler, E B; Bahr, D F; Dattelbaum, D M

    2010-12-15

    Adhesion between binders and explosive crystals is of critical importance for the mechanical performance of plastic-bonded explosives (PBXs). The surface properties of several prospective binders have been determined from static advancing contact angle measurements. The surface energies have been used to calculate theoretical work of adhesion to 1,3,5-triamino-2,4,6-trinitrobenzene (TATB), a common insensitive high explosive. The fluorinated terpolymer Oxy-461™, and Kel-F™ chlorotrifluoroethylene-vinylidene fluoride copolymers show the greatest potential for wetting TATB surfaces, and should promote the best adhesion to TATB in PBX formulations. In general, none of the fluoropolymer binders investigated here exhibit markedly superior adhesion to TATB. Thus, bulk physical properties are likely to be more important when choosing a binder. PMID:20875644

  5. Synthesis of novel tripodal-benzimidazole from 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine: Structural, electrochemical and antimicrobial studies

    Energy Technology Data Exchange (ETDEWEB)

    Koc, Ziya Erdem, E-mail: zerdemkoc@gmail.com [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey); Bingol, Haluk; Saf, Ahmet O. [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey); Torlak, Emrah [Provincial Control Laboratory, Konya (Turkey); Coskun, Ahmet [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey)

    2010-11-15

    Four new tripodal-benzimidazole derivatives were synthesized by Schiff base reaction between 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine (TRIPOD) and different diamine derivatives. The structures of the obtained compounds were identified by FT-IR, {sup 1}H NMR, {sup 13}C NMR and UV-vis spectral data, thermal analysis and elemental analysis. Electrochemical behaviors of the compounds were studied by cyclic voltammetry in DMF including 0.1 M [NBu{sub 4}] [PF{sub 6}]. The voltammograms showed peaks having similar characteristics except tripodal-benzimidazole including -NO{sub 2} derivative. In addition, their antimicrobial activities were evaluated by using the standard disk diffusion method in dimethylformamide media. The activities were determined against 4 bacteria cultures by comparing to those of gentamycin.

  6. Fluorescence-based Sensing of 2,4,6-Trinitrotoluene (TNT Using a Multi-channeled Poly(methyl methacrylate (PMMA Microimmunosensor

    Directory of Open Access Journals (Sweden)

    Anne W. Kusterbeck

    2010-01-01

    Full Text Available Fluorescence immunoassays employing monoclonal antibodies directed against the explosive 2,4,6-trinitrotoluene (TNT were conducted in a multi-channel microimmunosensor. The multi-channel microimmunosensor was prepared in poly (methyl methacrylate (PMMA via hot embossing from a brass molding tool. The multi-channeled microfluidic device was sol-gel coated to generate a siloxane surface that provided a scaffold for antibody immobilization. AlexaFluor-cadaverine-trinitrobenzene (AlexaFluor-Cad-TNB was used as the reporter molecule in a displacement immunoassay. The limit of detection was 1-10 ng/mL (ppb with a linear dynamic range that covered three orders of magnitude. In addition, antibody crossreactivity was investigated using hexahydro-1,3,5-triazine (RDX, HMX, 2,4-dinitrotoluene (DNT, 4-nitrotoluene (4-NT and 2-amino-4,6-DNT.

  7. Synthesis, characterization and evaluation of 1,2-bis(2,4,6-trinitrophenyl) hydrazine: a key precursor for the synthesis of high performance energetic materials.

    Science.gov (United States)

    Badgujar, D M; Talawar, M B; Harlapur, Sujata F; Asthana, S N; Mahulikar, P P

    2009-12-15

    1,2-Bis(2,4,6-trinitrophenyl) hydrazine (3) is one of the precursors in the synthesis of an important energetic material viz., hexanitrazobenzene. The simple and convenient lab scale synthesis of title compound (3) was carried out by the condensation of picryl chloride (2) with hydrazine hydrate at 30-50 degrees C in methanol based on the lines of scanty literature reports. Picryl chloride was synthesized by the reaction of picric acid (1) with phosphorous oxychloride based on the lines of reported method. The synthesized compound (3) was characterized by IR and 1H NMR spectral data. Some of the energetic properties of the synthesized compound have also been studied. The theoretically computed energetic properties of the title compound (3) indicated the superior performance in comparison to tetranitrodibenzo tetraazapentalene (TACOT) and hexanitrostilbene (HNS) in terms of velocity of detonation. PMID:19665292

  8. Fabrication of surface plasmon resonance sensor surface with control of the nonspecific adsorption and affinity for the detection of 2,4,6-trinitrotoluene using an antifouling copolymer

    Directory of Open Access Journals (Sweden)

    RuiYatabe

    2014-04-01

    Full Text Available We fabricated a surface plasmon resonance (SPR sensor using a hydrophilic polymer for the highly sensitive detection of 2,4,6-trinitrotoluene (TNT. The hydrophilic polymer was made from mono-2-(methacryloyloxyethylsuccinate (MES and 2-hydroxyethylmethacrylate (HEMA by surface-initiated atom transfer radical polymerization (SI-ATRP. The detection of TNT was carried out by displacement assay with the SPR measurement. In displacement assay, the affinity between anti-TNT antibody and the sensor surface, affects to the sensitivity. In the SPR measurement, nonspecific adsorption should be controlled because SPR sensor cannot discriminate between specific and nonspecific adsorption. Therefore, the affinity and nonspecific adsorption were controlled by changing the ratio of HEMA to MES. A detection limit of 0.4 ng/ml (ppb for TNT was achieved using a sensor surface with the lowest affinity without nonspecific adsorption.

  9. Magnetism of 1,3,5-trithia-2,4,6-triazapentalenyl (TTTA) and bis(hexafluoroacetylacetonato)copper(II) (Cu(hfac)2)

    International Nuclear Information System (INIS)

    An accurate full-potential density-functional method is used to study the mechanism of the origin of magnetism and the magnetic interactions in 1,3,5-Trithia-2,4,6-triazapentalenyl (TTTA) and Bis(hexafluoroacetylacetonato)copper(II) (Cu(hfac)2). The results revealed that the spontaneous magnetic moments for the TTTA.Cu(hfac)2 mainly come from Cu and N1 atoms, and the O1, O2, O3, O4 and N2, N3, S1, S2 atoms also contribute to the magnetism. In TTTA.Cu(hfac)2, there would be ferromagnetic interaction between the Cu(II) ion and the N1atom of TTTAA, and there exists antiferromagnetic interaction between the intramolecular organic ligands

  10. Synthesis of novel tripodal-benzimidazole from 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine: Structural, electrochemical and antimicrobial studies

    International Nuclear Information System (INIS)

    Four new tripodal-benzimidazole derivatives were synthesized by Schiff base reaction between 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine (TRIPOD) and different diamine derivatives. The structures of the obtained compounds were identified by FT-IR, 1H NMR, 13C NMR and UV-vis spectral data, thermal analysis and elemental analysis. Electrochemical behaviors of the compounds were studied by cyclic voltammetry in DMF including 0.1 M [NBu4] [PF6]. The voltammograms showed peaks having similar characteristics except tripodal-benzimidazole including -NO2 derivative. In addition, their antimicrobial activities were evaluated by using the standard disk diffusion method in dimethylformamide media. The activities were determined against 4 bacteria cultures by comparing to those of gentamycin.

  11. Crystal structure of 4,4′,4′′-(1,3,5-triazine-2,4,6-triyltripyridinium trichloride 2.5-hydrate

    Directory of Open Access Journals (Sweden)

    Bo-Kai Ling

    2015-11-01

    Full Text Available The asymmetric unit of the title compound, C18H15N63+·3Cl−·2.5H2O, contains two independent (1,3,5-triazine-2,4,6-triyltripyridinium cations. Both cations are approximately planar, the r.m.s. deviations of fitted non-H atoms being 0.045 and 0.051 Å. In the crystal, extensive O—H...Cl, O—H...O, N—H...Cl and N—H...O hydrogen bonds and weak C—H...Cl and C—H...O interactions link the organic cations, Cl− anions and water molecules into a three-dimensional supramolecular architecture. π–π stacking between the pyridine rings of adjacent cations is also observed, the centroid-to-centroid distance being 3.7578 (8 Å.

  12. Elimination Reactions of (E)-2,4,6-Trinitrobenzaldehyde O-benzoyloximes Promoted by R2NH in MeCN. Change of Reaction Mechanism

    International Nuclear Information System (INIS)

    We have studied the nitrile-forming elimination reactions from 1 promoted by R2NH in MeCN. The reaction proceeded by (E1cb)irr mechanism. Change of the β-aryl group from 2,4-dinitrophenyl to a more strongly electron-withdrawing 2,4,6-trinitrophenyl increased the reaction rate by 470-fold, shifted the transition state toward more reactant-like, and changed the reaction mechanism from E2 to (E1cb)irr. To the best of our knowledge, this is the first example of nitrile-forming elimination reaction that proceeds by the (E1cb)irr mechanism in MeCN. Noteworthy is the carbanion stabilizing ability of the 2,4,6-trinitrophenyl group in aprotic solvent. Nitrile-forming elimination reactions of (E)-benzaldoxime derivatives have been extensively investigated under various conditions. The reactions proceeded by the E2 mechanism in MeCN despite the fact that the reactants have syn stereochemistry, poor leaving, and sp2 hybridized β-carbon atom, all of which favor E1cb- or E1cb-like transition state. Moreover, the transition state structures were relatively insensitive to the variation of the reactant structures. The results have been attributed to the poor anion solvating ability of MeCN, which favors E2 transition state with maximum charge dispersal. For eliminations from strongly activated (E)-2,4-(NO2)2C6H3CH=NOC(O)C6H4X, a change in the reaction mechanism from E2 to (E1cb)irr was observed as the base-solvent was changed from R2NH in MeCN to R2NH/R2NH2+ in 70 mol % MeCN(aq). A combination of a strong electron-withdrawing β-aryl group and anion-solvating protic solvent was required for the mechanistic change

  13. Preparation, Crystal Structure and Thermal Analyses of 1,5-Diamino-4-hydro-1,2,3,4-tetrazolium 3,5-Dihydroxy-2,4,6-trinitrophenolate

    Institute of Scientific and Technical Information of China (English)

    CUI Yan; ZHANG Tong-Lai; ZHANG Jian-Guo; HU Xiao-Chun; ZHANG Jin; HUANG Hui-Sheng

    2008-01-01

    A novel energetic salt 1,5-diamino-4-hydro-1,2,3,4-tetrazolium 3,5-dihydroxy-2,4,6-trinitrophenolate was synthesized by the reaction of 1,5-diamino-1,2,3,4-tetrazole (DAT) with 2,4,6-trinitro-1,3,5-trihydroxybenzene (trinitrophloroglucinol, TNPG). It was characterized by X-ray single crystal diffraction, elemental analysis, FT-IR spectroscopy and 1H NMR. The title compound crystallizes in monoclinic system, P2(1)/c space group with crystal parameters of a=1.3399(3) nm, b=0.47088(9) nm, c=2.0127(4) nm, β=92.83(3)°, V= 1.2684(4) nm3, Z=4. Hydrogen bonds, electrostatic interactions, and weak van der Waals' forces make the molecules form a stable threedimensional net structure. Mulliken charge distribution and overlap population of DAT and DATH+TNPG- in bulk state have been obtained from the density functional theory (DFT) with the B3LYP method employing the 6-31G**basis sets to interpret the reason why the protonation site of DAT is N(4) atom of the tetrazole ring. Thermal decomposition of the title compound was studied by using differential scanning calorimetry (DSC) and thermogravimetric analysis (TG) techniques. The high enthalpy change and leaving no solid residue after thermal decomposition indicate that the title compound can be used as a promising energetic material or gas-generating composition.The kinetic parameters of the exothermic process of DATH+TNPG- were studied by using Kissinger's and Ozawa-Doyle's methods and the Arrhenius equation of this process was obtained.

  14. Synthesis, structure and luminescence properties of cadmium(II) complexes with 2,4,6-tri(2-pyridyl)-1,3,5-triazine

    International Nuclear Information System (INIS)

    The paper presents a combined experimental and computational study for two cadmium(II) complexes [Cd(dca)(NO3)(tptz)(H2O)]·2H2O (1) and [Cd(dca)(OAc) (tptz)(H2O)]·2H2O (2) (tptz=2,4,6-tri(2-pyridyl)-1,3,5-triazine and dca=dicyanamide anion). The compounds have been studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. Due to the presence of multidentate N-donor ligand, coordinated water molecule and nitrate or acetate groups together with the lattice water molecules their crystal structures are dominated by the hydrogen-bonding interactions that give rise to the supramolecular architectures. The luminescent properties of compounds 1 and 2 have been studied in solution and solid state and compared with the free ligand. The studies revealed that the fluorescence of tptz ligand and complexes 1 and 2 was concentration and solvent dependent. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(dca)(NO3)(tptz)(H2O)] and [Cd(dca)(OAc) (tptz)(H2O)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. -- Highlights: • Two novel dicyanamide cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TDDFT level employing B3LYP/LANL2DZ

  15. 2,4,6-Triaminopyrimidine as a Novel Hinge Binder in a Series of PI3Kδ Selective Inhibitors.

    Science.gov (United States)

    Patel, Leena; Chandrasekhar, Jayaraman; Evarts, Jerry; Haran, Aaron C; Ip, Carmen; Kaplan, Joshua A; Kim, Musong; Koditek, David; Lad, Latesh; Lepist, Eve-Irene; McGrath, Mary E; Novikov, Nikolai; Perreault, Stephane; Puri, Kamal D; Somoza, John R; Steiner, Bart H; Stevens, Kirk L; Therrien, Joseph; Treiberg, Jennifer; Villaseñor, Armando G; Yeung, Arthur; Phillips, Gary

    2016-04-14

    Inhibition of phosphoinositide 3-kinase δ (PI3Kδ) is an appealing target for several hematological malignancies and inflammatory diseases. Herein, we describe the discovery and optimization of a series of propeller shaped PI3Kδ inhibitors comprising a novel triaminopyrimidine hinge binder. Combinations of electronic and structural strategies were employed to mitigate aldehyde oxidase mediated metabolism. This medicinal chemistry effort culminated in the identification of 52, a potent and highly selective inhibitor of PI3Kδ that demonstrates efficacy in a rat model of arthritis. PMID:26980109

  16. Targeted cancer therapies

    Institute of Scientific and Technical Information of China (English)

    Li Yan; Neal Rosen; Carlos Arteaga

    2011-01-01

    With unprecedented understanding of molecular events underlying human cancer in this genomic era, a large number of drugs specifically targeting hypothesized oncogenic drivers to which tumors are potentially addicted to have been developed and continue to be developed. These targeted cancer therapies are being actively tested in clinical trials with mixed successes. This editorial provides an overview on successful targeted cancer drugs on the market and those drugs that are in late clinical development stages. Importantly, the article lays out main challenges in developing molecular targeted therapies and potential path forward to overcome these challenges, as well as opportunities for China in this new era of targeted agents. The editorial serves as an introduction to the Targeted Cancer Therapies serias that will review in depth of major pathways and drugs targeting these pathways to be published in the coming issues of the Chinese Journal of Cancer.

  17. Polarized targets and beams

    International Nuclear Information System (INIS)

    First the experimental situation of the single-pion photoproduction and the photodisintegration of the deuteron is briefly discussed. Then a description of the Bonn polarization facilities is given. The point of main effort is put on the polarized target which plays a vital role in the program. A facility for photon induced double polarization experiments at ELSA will be presented in section 4. Properties of a tensor polarized deuteron target are discussed in section 5. The development in the field of polarized targets, especially on new target materials, enables a new generation of polarized target experiments with (polarized) electrons. Some comments on the use of a polarized target in combination with electron beams will be discussed in section 6. Electron deuteron scattering from a tensor polarized deuteron target is considered and compared with other experimental possibilities. (orig./HSI)

  18. 1,3,5-Triazine-2,4,6-triyltrisulfamic acid (TTSA): A new organic solid acid for the nitrosation of secondary amines and oxidation of urazoles in the presence of NaNO2 under mild and heterogeneous conditions

    Indian Academy of Sciences (India)

    Gholamabbas Chehardoli; Mohammad Ali Zolfigol; Toktam Faal-Rastegar; Shadpour Mallakpour; Arash Ghorbani-Choghamarani

    2009-07-01

    Melamine reacted with chlorosufonic acid (ClSO3H) to form a new sulfamic-type acid, 1,3,5-triazine-2,4,6-triyltrisulfamic acid (TTSA). Both nitrosation of secondary amines and oxidation of urazoles were accomplished by using TTSA/NaNO2 system under mild and heterogeneous conditions with good to excellent yields.

  19. Molecular dynamics and first-principles studies of structural change in 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) in crystalline state under high pressure: Comparison of hydrogen bond systems of TATB versus 1,3-diamino-2,4,6-trinitrobenzene (DATB)

    Science.gov (United States)

    Kohno, Yuji; Mori, Kazuki; Hiyoshi, Reiko I.; Takahashi, Osamu; Ueda, Kazuyoshi

    2016-06-01

    Classical molecular dynamics (MD) calculations were performed to reveal the effect of high pressure on the crystal structure of 1,3,5-triamino-2,4,6-trinitrobenzene (TATB), an insensitive energetic material. The primary simulation cell consisted of 54 molecules in a triclinic cell, corresponding to 27 unit cells obtained by replicating the experimentally determined unit cell. Inter- and intra-molecular hydrogen bonds were maintained in the range of 1.0 atm to 20.0 GPa as pressure was incremented by 0.5 GPa. The pressure dependence of the interlayer distances (h1) and farthest intermolecular distance (d1) between nitro groups in the TATB crystal's unit cell was investigated in the same range. h1 decreased monotonously from 3.50 to 2.90 Å as pressure increased to 20.0 GPa. However, d1 increased considerably with pressure up to 4.0 GPa, most remarkably between 2.0 and 4.0 GPa. Thus, a unique structural change occurred in TATB crystal in this range. On the other hand, 1,3-diamino-2,4,6-trinitrobenzene (DATB) crystal showed a unique structural change between 7.0 and 8.0 GPa. These discrepancies are attributed to the different network systems of hydrogen bonding of these two molecules. To validate the MD calculation results, we conducted first-principles calculations. MD and first-principles calculations showed good agreement with previous experimental results.

  20. GWAS and drug targets

    OpenAIRE

    Cao, Chen; Moult, John

    2014-01-01

    Background Genome wide association studies (GWAS) have revealed a large number of links between genome variation and complex disease. Among other benefits, it is expected that these insights will lead to new therapeutic strategies, particularly the identification of new drug targets. In this paper, we evaluate the power of GWAS studies to find drug targets by examining how many existing drug targets have been directly 'rediscovered' by this technique, and the extent to which GWAS results may ...

  1. Deuterium high pressure target

    International Nuclear Information System (INIS)

    The design of the deuterium high-pressure target is presented. The target having volume of 76 cm3 serves to provide the experimental research of muon catalyzed fusion reactions in ultra-pure deuterium in the temperature range 80-800 K under pressures of up to 150 MPa. The operation of the main systems of the target is described: generation and purification of deuterium gas, refrigeration, heating, evacuation, automated control system and data collection system

  2. Inertial Confinement fusion targets

    Science.gov (United States)

    Hendricks, C. D.

    1982-01-01

    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques were devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems, and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented.

  3. Deuterium High Pressure Target

    CERN Document Server

    Perevozchikov, V; Vinogradov, Yu I; Vikharev, M D; Ganchuk, N S; Golubkov, A N; Grishenchkin, S K; Demin, A M; Demin, D L; Zinov, V G; Kononenko, A A; Lobanov, V N; Malkov, I L; Yukhimchuk, S A

    2001-01-01

    The design of the deuterium high-pressure target is presented. The target having volume of 76 cm^3 serves to provide the experimental research of muon catalyzed fusion reactions in ultra-pure deuterium in the temperature range 80-800 K under pressures of up to 150 MPa. The operation of the main systems of the target is described: generation and purification of deuterium gas, refrigeration, heating, evacuation, automated control system and data collection system.

  4. The ISOLDE target robots

    CERN Multimedia

    Maximilein Brice

    2002-01-01

    ISOLDE targets need to be changed frequently, around 80 times per year. The high radiation levels do not permit this to be done by human hands and the target changes are effected by 2 industrial robots (picture _01). On the left, in the distance, the front-end of the GPS (General Purpose Separator) is seen, while the HRS (High Resolution Separator) is at the right. Also seen are the doors to the irradiated-target storage.

  5. Moving Target Defense

    CERN Document Server

    Jajodia, Sushil; Swarup, Vipin; Wang, Cliff; Wang, X Sean

    2011-01-01

    Moving Target Defense: Creating Asymmetric Uncertainty for Cyber Threats was developed by a group of leading researchers. It describes the fundamental challenges facing the research community and identifies new promising solution paths. Moving Target Defense which is motivated by the asymmetric costs borne by cyber defenders takes an advantage afforded to attackers and reverses it to advantage defenders. Moving Target Defense is enabled by technical trends in recent years, including virtualization and workload migration on commodity systems, widespread and redundant network connectivity, instr

  6. Target Window Reliability

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    The target window design implemented and tested in experiments at ANL have performed without failure for the available beam of 6 mm FWHM on a 12 mm diameter target. However, scaling that design to a 25 mm diameter target size for a 12 mm FWHM beam has proven problematic. Combined thermal and mechanical (pressure induced) stresses and strains are too high to maintain the small coolant gaps and provide adequate fatigue lifetime.

  7. Target Assembly Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  8. Targeting the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kenny, P.A.; Lee, G.Y.; Bissell, M.J.

    2006-11-07

    Despite some notable successes cancer remains, for the most part, a seemingly intractable problem. There is, however, a growing appreciation that targeting the tumor epithelium in isolation is not sufficient as there is an intricate mutually sustaining synergy between the tumor epithelial cells and their surrounding stroma. As the details of this dialogue emerge, new therapeutic targets have been proposed. The FDA has already approved drugs targeting microenvironmental components such as VEGF and aromatase and many more agents are in the pipeline. In this article, we describe some of the 'druggable' targets and processes within the tumor microenvironment and review the approaches being taken to disrupt these interactions.

  9. Bayesian multiple target tracking

    CERN Document Server

    Streit, Roy L

    2013-01-01

    This second edition has undergone substantial revision from the 1999 first edition, recognizing that a lot has changed in the multiple target tracking field. One of the most dramatic changes is in the widespread use of particle filters to implement nonlinear, non-Gaussian Bayesian trackers. This book views multiple target tracking as a Bayesian inference problem. Within this framework it develops the theory of single target tracking, multiple target tracking, and likelihood ratio detection and tracking. In addition to providing a detailed description of a basic particle filter that implements

  10. The Target Visitation Problem

    OpenAIRE

    Hildenbrandt, Achim

    2015-01-01

    The thesis considers the target visitation problem, a combinatorial optimization problem, which merges the classical traveling salesman problem with the linear ordering problem. In more detail, we are looking for a tour which visits a set of targets and which is optimal with respect to two different aspects: On the one hand, we have given a travel cost from each target to every other. On the other hand, we have preference values which tell us how much we would like to visit one target before ...

  11. Strategic Targeted Advertising

    NARCIS (Netherlands)

    A. Galeotti; J.L. Moraga-Gonzalez (José Luis)

    2003-01-01

    textabstractWe present a strategic game of pricing and targeted-advertising. Firms can simultaneously target price advertisements to different groups of customers, or to the entire market. Pure strategy equilibria do not exist and thus market segmentation cannot occur surely. Equilibria exhibit rand

  12. Pure HD polarized targets

    International Nuclear Information System (INIS)

    The HD polarized target project is now ready to use a target in a physics experiment. This must be done in early 1998 at LEGS (BNL). The IPN cryogenic group takes its part in this venture by doing the transfer and in-beam cryostats. (authors)

  13. The CNGS target

    CERN Multimedia

    Patrice Loïez

    2005-01-01

    The CERN Neutrinos to Gran Sasso (CNGS) target ‘magazine’ of five target units. Each unit contains a series of 10-cm long graphite rods distributed over a length of 2 m. It is designed to maximize the number of secondary particles produced and hence the number of neutrinos. One unit is used at a time to prevent over heating.

  14. Survey of potential markets for devices using Californium-252

    International Nuclear Information System (INIS)

    Potential applications for devices or systems containing 252Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252Cf, which have been two to four times greater in Europe than in the US

  15. The protective cell petrus for the production of californium 252

    International Nuclear Information System (INIS)

    The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 109 n.cm-2.s-1. The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors)

  16. Californium-252 neutron activation facility at the Savannah River Laboratory

    International Nuclear Information System (INIS)

    A neutron irradiation facility has been established to develop new analytical methods and for the support of research programs. A major component of this facility is a 252Cf source which provides both fission spectrum and thermal neutrons. (U.S.)

  17. Californium-252 brachytherapy for anal and ano-rectal carcinoma

    International Nuclear Information System (INIS)

    Surgery has historically been the standard treatment for anal, ano-rectal and rectal carcinoma but is prone to local or regional failure. Over the past 15 years there has been increasing interest in and success with radiation therapy and combined chemoradiotherapy for treatment of anal and ano-rectal cancers. Cf-252 brachytherapy combined with external beam teletherapy has been investigated for anal and ano-rectal lesions at the Univ. of Kentucky with encouraging results

  18. Mobile equipment for neutron radiography using a californium-252 source

    International Nuclear Information System (INIS)

    The basic requirements for successful neutron radiography are first summarised and the use of 252Cf is placed in perspective by comparing its properties with those of sources based on the Be (γ, n) and Be (α, n) reactions which have a broadly similar range of applications. The more essential design features of mobile neutron radiography equipment are next examined in some detail, to show how the often conflicting requirements of optimum beam production and adequate shielding may be reconciled. An assembly with a maximum dimension around 1 m with a source of 1 mg is used as an example. The design data used are reproduced in graphical form to permit designs to be scaled to suit the source available and the requirements. The selection of suitable image recorders for 252Cf radiography is discussed with the conclusion that the gadolinium foil-film combinations are likely to remain the normal choice. Demonstration radiographs are presented with particular reference to the location of residual casting sand in gas-cooled turbine blades. Finally, it is suggested that other applications for mobile 252Cf-based neutron radiography equipment will be found in the ordnance, aero-space, chemical and nuclear fuel manufacturing industries. (author)

  19. Automated absolute activation analysis with californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    MacMurdo, K.W.; Bowman, W.W.

    1978-09-01

    A 100-mg /sup 252/Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from /sup 17/O. Detection sensitivities of < or = 400 ppB for natural uranium and 8 ppB (< or = 0.5 (nCi/g)) for /sup 239/Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level.

  20. Californium-based neutron radiography for corrosion detection in aircraft

    International Nuclear Information System (INIS)

    In support of an overall program aimed at minimizing disassembly and reducing inspection time during aircraft maintenance, a series of projects has been carried out to determine the feasibility of applying neutron radiographic techniques to the nondestructive (NDT) inspection of aircraft and aircraft components. These investigations have clearly demonstrated the superiority of neutron radiography over all other NDT techniques in its ability to detect surface and subsurface corrosion in aircraft structure. This capability is particularly significant where the corrosion is hidden behind thick metallic structural members. The neutron radiographic technique has been applied successfully to detect corrosion in the wing tank of E-2C, C-130, and DC-9 aircraft; rear stabilators of F-4 and F-111 aircraft; aft spar, starboard and port wing, and rudder of the F-8; fuselage skin of the 727; rotary blades of AH-1 and SH-3 helicopters; rotary tail flaps of the UH-2 helicopter; and nose landing gear of A-7 aircraft

  1. Automated absolute activation analysis with californium-252 sources

    International Nuclear Information System (INIS)

    A 100-mg 252Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from 17O. Detection sensitivities of 239Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level

  2. Targeted therapy in lymphoma

    Directory of Open Access Journals (Sweden)

    Cavalli Franco

    2010-11-01

    Full Text Available Abstract Discovery of new treatments for lymphoma that prolong survival and are less toxic than currently available agents represents an urgent unmet need. We now have a better understanding of the molecular pathogenesis of lymphoma, such as aberrant signal transduction pathways, which have led to the discovery and development of targeted therapeutics. The ubiquitin-proteasome and the Akt/mammalian target of rapamycin (mTOR pathways are examples of pathological mechanisms that are being targeted in drug development efforts. Bortezomib (a small molecule protease inhibitor and the mTOR inhibitors temsirolimus, everolimus, and ridaforolimus are some of the targeted therapies currently being studied in the treatment of aggressive, relapsed/refractory lymphoma. This review will discuss the rationale for and summarize the reported findings of initial and ongoing investigations of mTOR inhibitors and other small molecule targeted therapies in the treatment of lymphoma.

  3. A facile synthesis of highly luminescent nitrogen-doped graphene quantum dots for the detection of 2,4,6-trinitrophenol in aqueous solution

    Science.gov (United States)

    Lin, Liping; Rong, Mingcong; Lu, Sisi; Song, Xinhong; Zhong, Yunxin; Yan, Jiawei; Wang, Yiru; Chen, Xi

    2015-01-01

    A facile bottom-up method for the synthesis of highly fluorescent nitrogen-doped graphene quantum dots (N-GQDs) has been developed via a one-step pyrolysis of citric acid and tris(hydroxymethyl)aminomethane. The obtained N-GQDs emitted strong blue fluorescence under 365 nm UV light excitation with a high quantum yield of 59.2%. They displayed excitation-independent behavior, high resistance to photobleaching and high ionic strength. In addition to the good linear relationship between the fluorescence intensity of the N-GQDs and pH in the range 2-7, the fluorescence intensity of the N-GQDs could be greatly quenched by the addition of a small amount of 2,4,6-trinitrophenol (TNP). A sensitive approach has been developed for the detection of TNP with a detection limit of 0.30 μM, and a linearity ranging from 1 to 60 μM TNP could be obtained. The approach was highly selective and suitable for TNP analysis in natural water samples.A facile bottom-up method for the synthesis of highly fluorescent nitrogen-doped graphene quantum dots (N-GQDs) has been developed via a one-step pyrolysis of citric acid and tris(hydroxymethyl)aminomethane. The obtained N-GQDs emitted strong blue fluorescence under 365 nm UV light excitation with a high quantum yield of 59.2%. They displayed excitation-independent behavior, high resistance to photobleaching and high ionic strength. In addition to the good linear relationship between the fluorescence intensity of the N-GQDs and pH in the range 2-7, the fluorescence intensity of the N-GQDs could be greatly quenched by the addition of a small amount of 2,4,6-trinitrophenol (TNP). A sensitive approach has been developed for the detection of TNP with a detection limit of 0.30 μM, and a linearity ranging from 1 to 60 μM TNP could be obtained. The approach was highly selective and suitable for TNP analysis in natural water samples. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr06365a

  4. AA antiproton production target

    CERN Multimedia

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing of stainless steel. At the entrance to the target assembly was a scintillator screen, imprinted with circles every 5 mm in radius, which allowed to precisely aim the 26 GeV high-intensity proton beam from the PS onto the centre of the target rod. The scintillator screen was a 1 mm thick plate of Cr-doped alumina. See also 7903034 and 7905091.

  5. Stand-off imaging Raman spectroscopy for forensic analysis of post-blast scenes: trace detection of ammonium nitrate and 2,4,6-trinitrotoluene

    Science.gov (United States)

    Ceco, Ema; Önnerud, Hans; Menning, Dennis; Gilljam, John L.; Bââth, Petra; Östmark, Henric

    2014-05-01

    The following paper presents a realistic forensic capability test of an imaging Raman spectroscopy based demonstrator system, developed at FOI, the Swedish Defence Research Agency. The system uses a 532 nm laser to irradiate a surface of 25×25mm. The backscattered radiation from the surface is collected by an 8" telescope with subsequent optical system, and is finally imaged onto an ICCD camera. We present here an explosives trace analysis study of samples collected from a realistic scenario after a detonation. A left-behind 5 kg IED, based on ammonium nitrate with a TNT (2,4,6-trinitrotoluene) booster, was detonated in a plastic garbage bin. Aluminum sample plates were mounted vertically on a holder approximately 6 m from the point of detonation. Minutes after the detonation, the samples were analyzed with stand-off imaging Raman spectroscopy from a distance of 10 m. Trace amounts could be detected from the secondary explosive (ammonium nitrate with an analysis time of 1 min. Measurement results also indicated detection of residues from the booster (TNT). The sample plates were subsequently swabbed and analyzed with HPLC and GC-MS analyses to confirm the results from the stand-off imaging Raman system. The presented findings indicate that it is possible to determine the type of explosive used in an IED from a distance, within minutes after the attack, and without tampering with physical evidence at the crime scene.

  6. Impaired epithelial differentiation of induced pluripotent stem cells from ectodermal dysplasia-related patients is rescued by the small compound APR-246/PRIMA-1MET.

    Science.gov (United States)

    Shalom-Feuerstein, Ruby; Serror, Laura; Aberdam, Edith; Müller, Franz-Josef; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing; Aberdam, Daniel; Petit, Isabelle

    2013-02-01

    Ectodermal dysplasia is a group of congenital syndromes affecting a variety of ectodermal derivatives. Among them, ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome is caused by single point mutations in the p63 gene, which controls epidermal development and homeostasis. Phenotypic defects of the EEC syndrome include skin defects and limbal stem-cell deficiency. In this study, we designed a unique cellular model that recapitulated major embryonic defects related to EEC. Fibroblasts from healthy donors and EEC patients carrying two different point mutations in the DNA binding domain of p63 were reprogrammed into induced pluripotent stem cell (iPSC) lines. EEC-iPSC from both patients showed early ectodermal commitment into K18(+) cells but failed to further differentiate into K14(+) cells (epidermis/limbus) or K3/K12(+) cells (corneal epithelium). APR-246 (PRIMA-1(MET)), a small compound that restores functionality of mutant p53 in human tumor cells, could revert corneal epithelial lineage commitment and reinstate a normal p63-related signaling pathway. This study illustrates the relevance of iPSC for p63 related disorders and paves the way for future therapy of EEC. PMID:23355677

  7. Fluorescent Detection of 2,4-DNT and 2,4,6-TNT in Aqueous Media by Using Simple Water-Soluble Pyrene Derivatives.

    Science.gov (United States)

    Kovalev, Igor S; Taniya, Olga S; Slovesnova, Nataliya V; Kim, Grigory A; Santra, Sougata; Zyryanov, Grigory V; Kopchuk, Dmitry S; Majee, Adinath; Charushin, Valery N; Chupakhin, Oleg N

    2016-03-01

    Pyrene-containing water-soluble probes for the fluorescent detection of nitroaromatic compounds (NACs), such as explosive components (2,4-DNT and 2,4,6-TNT) and herbicides (2,4-dinitrocresol, 2,4-DNOC), in aqueous media are reported. In the probes, the introduction of surface-active hydrophilic "heads" at the periphery of lipophilic (i.e., hydrophobic) pyrene "tails" resulted in the formation of highly fluorescent micelle-like aggregates/pre-associates in aqueous solutions at concentrations of ≤10(-5)  m. The enhanced fluorescence quenching of the herein reported architectures is achieved in the presence of ultra-trace amounts of TNT or 2,4-DNT with values of Stern-Volmer quenching constant close to 1×10(5)  m(-1) and a detection limit as low as 182 ppb. The most hydrophilic probes demonstrated higher response to 2,4-DNT over TNT. Filter paper test strips impregnated with 1×10(-5)  m solutions of the probes were able to detect TNT, 2,4-DNT, and other NACs at levels as low as 50 ppb in water. PMID:26757403

  8. Bis[1,3-bis(2,4,6-trimethylphenyl-2,3-dihydro-1H-imidazol-2-ylidene]dichloridodinitrosyltungsten(II tetrahydrofuran-d8 monosolvate

    Directory of Open Access Journals (Sweden)

    Heinz Berke

    2011-01-01

    Full Text Available The molecular structure of the title compound, [WCl2(NO2(C21H24N22]·C4D8O, displays a distorted octahedral arrangement around the W atom with two trans 1,3-bis(2,4,6-trimethylphenylimidazol-2-ylidene (IMes carbene ligands in axial positions. The four equatorial positions are occupied by nitrosyl and chloride ligands, which are trans to each other. The Ccarbene—W—Ccarbene bond angle of 173.44 (18° and the Cl—W—Nnitrosyl bond angles of 171.34 (11 and 171.32 (13° deviate only slightly from linearity. The distortion comes from the nitrosyl and chloride ligands which are not fully coplanar since the two N atoms deviate from the WCl2 plane by −0.279 (4 and 0.272 (4 Å, respectively. An intermolecular C—H...O interaction connects the organometallic molecule and the tetrahydrofuran-d8 solvent molecule.

  9. Tracing the Cycling and Fate of the Explosive 2,4,6-Trinitrotoluene in Coastal Marine Systems with a Stable Isotopic Tracer, (15)N-[TNT].

    Science.gov (United States)

    Smith, Richard W; Vlahos, Penny; Böhlke, J K; Ariyarathna, Thivanka; Ballentine, Mark; Cooper, Christopher; Fallis, Stephen; Groshens, Thomas J; Tobias, Craig

    2015-10-20

    2,4,6-Trinitrotoluene (TNT) has been used as a military explosive for over a hundred years. Contamination concerns have arisen as a result of manufacturing and use on a large scale; however, despite decades of work addressing TNT contamination in the environment, its fate in marine ecosystems is not fully resolved. Here we examine the cycling and fate of TNT in the coastal marine systems by spiking a marine mesocosm containing seawater, sediments, and macrobiota with isotopically labeled TNT ((15)N-[TNT]), simultaneously monitoring removal, transformation, mineralization, sorption, and biological uptake over a period of 16 days. TNT degradation was rapid, and we observed accumulation of reduced transformation products dissolved in the water column and in pore waters, sorbed to sediments and suspended particulate matter (SPM), and in the tissues of macrobiota. Bulk δ(15)N analysis of sediments, SPM, and tissues revealed large quantities of (15)N beyond that accounted for in identifiable derivatives. TNT-derived N was also found in the dissolved inorganic N (DIN) pool. Using multivariate statistical analysis and a (15)N mass balance approach, we identify the major transformation pathways of TNT, including the deamination of reduced TNT derivatives, potentially promoted by sorption to SPM and oxic surface sediments. PMID:26375037

  10. Quasi-monoenergetic neutron energy spectra for 246 and 389 MeV (7)Li(p,n) reactions at angles from 0 degrees to 300 degrees

    CERN Document Server

    Iwamoto, Y; Nakamura, T; Nakashima, H; Mares, V; Itoga, T; Matsumoto, T; Nakane, Y; Feldbaumer, E; Jaegerhofer, L; Pioch, C; Tamii, A; Satoh, D; Masuda, A; Sato, T; Iwase, H; Yashima, H; Nishiyama, J; Hagiwara, M; Hatanaka, K; Sakamoto, Y

    2011-01-01

    The authors measured the neutron energy spectra of a quasi-monoenergetic (7)Li(p,n) neutron source with 246 and 389 MeV protons set at seven angles (0 degrees, 2.5 degrees, 5 degrees, 10 degrees, 15 degrees, 20 degrees and 30 degrees), using a time-of-flight (TOF) method employing organic scintillators NE213 at the Research Center for Nuclear Physics (RCNP) of Osaka University. The energy spectra of the source neutrons were precisely deduced down to 2 MeV at 0 degrees and 10 MeV at other angles. The cross-sections of the peak neutron production reaction at 0 degrees were on the 35-40 mb line of other experimental data, and the peak neutron angular distribution agreed well with the Taddeucci formula. Neutron energy spectra below 100 MeV at all angles were comparable, but the shapes of the continuum above 150 MeV changed considerably with the angle. In order to consider the correction required to derive the response in the peak region from the measured total response for high-energy neutron monitors such as DAR...

  11. Degradation pathway, toxicity and kinetics of 2,4,6-trichlorophenol with different co-substrate by aerobic granules in SBR.

    Science.gov (United States)

    Khan, Mohammad Zain; Mondal, Pijush Kanti; Sabir, Suhail; Tare, Vinod

    2011-07-01

    The present study deals with cultivation of 2,4,6-trichlorophenol (TCP) degrading aerobic granules in two SBR systems based on glucose and acetate as co-substrate. Biodegradation of TCP containing wastewater starting from 10 to 360 mg L(-1) with more than 90% efficiency was achieved. Sludge volume index decreases as the operation proceeds to stabilize at 35 and 30 mL g(-1) while MLVSS increases from 4 to 6.5 and 6.2 g L(-1) for R1 (with glucose as co-substrate) and R2 (with sodium acetate as co-substrate), respectively. FTIR, GC and GC/MS spectral studies shows that the biodegradation occurred via chlorocatechol pathway and the cleavage may be at ortho-position. Haldane model for inhibitory substrate was applied to the system and it was observed that glucose fed granules have a high specific degradation rate and efficiency than acetate fed granules. Genotoxicity studies shows that effluent coming from SBRs was non-toxic. PMID:21565491

  12. Utility of four strains of white-rot fungi for the detoxification of 2,4,6-trinitrotoluene in liquid culture

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, K.C.; Chen, J.C.; Huebner, H.J.; Brown, K.W.; Autenrieth, R.L.; Bonner, J.S. [Texas A and M Univ., College Station, TX (United States)

    1997-06-01

    The purpose of this study was to investigate the potential of four different strains of white-rot fungi (Phanerochaete chrysosporium, Phanerochaete sordida, Phlebia brevispora, and Cyathus stercoreus) to degrade 2,4,6-trinitrotoluene (TNT) in liquid medium. Loss of TNT from the culture medium was determined using high-performance liquid chromatography (HPLC), while the mutagenicity of the medium residues were evaluated using the Salmonella/microsome bioassay. The data indicate that within 21 d of incubation, all fungi were able to reduce the TNT concentration in the liquid medium to below detection limits. In this study, P. sordida showed a relatively high growth rate and the fastest rate of TNT degradation. The fungal treatment also produced a significant reduction of TNT mutagenicity. Treatment with C. stercoreus, P. brevispora, P. sordida, and P. chrysosporium resulted in the elimination of 94%, 90%, 87%, and 67% of the initial TNT-amended medium mutagenicity, respectively. The data also demonstrate that during incubation, TNT was eliminated from the culture medium two to eight times faster than the reduction in mutagenic potential. These results suggest that TNT disappearance alone cannot be used as the sole criterion in TNT remediation. Chemical analysis revealed that the major metabolites in the initial transformation of TNT were the monoamino-dinitrotoluenes, which were also degraded by the selected white-rot fungi. The study demonstrated that the white-rot fungi are capable of metabolizing and detoxifying TNT under aerobic conditions in nonligninolytic liquid medium.

  13. Fabrication of an SPR Sensor Surface with Antifouling Properties for Highly Sensitive Detection of 2,4,6-Trinitrotoluene Using Surface-Initiated Atom Transfer Polymerization

    Directory of Open Access Journals (Sweden)

    Kiyoshi Toko

    2013-07-01

    Full Text Available In this study, we modified a surface plasmon resonance immunosensor chip with a polymer using surface-initiated atom transfer polymerization (SI-ATRP for the highly sensitive detection of 2,4,6-trinitrotoluene (TNT. To immobilize a TNT analogue on the polymer, mono-2-(methacryloyloxyethylsuccinate (MES, which has a carboxyl group, was used in this study. However, the anti-TNT antibody may adsorb non-specifically on the polymer surface by an electrostatic interaction because MES is negatively charged. Therefore, a mixed monomer with MES and diethylaminoethylmethacrylate (DEAEM, which has a tertiary amino group and is positively charged, was prepared to obtain electroneutrality for suppressing the nonspecific adsorption. The detection of TNT was performed by inhibition assay using the polymer surface. To ensure high sensitivity to TNT, the affinity between the surface and the antibody was optimized by controlling the density of the initiator for ATRP by mixing two types of self-assembled monolayer reagents. As a result, a limit of detection of 5.7 pg/mL (ppt for TNT was achieved using the optimized surface.

  14. Chandra Observation of 3C288 - Reheating the Cool Core of a 3 keV Cluster from a Nuclear Outburst at z = 0.246

    CERN Document Server

    Lal, D V; Forman, W R; Hardcastle, M J; Jones, C; Nulsen, P E J; Evans, D A; Croston, J H; Lee, J C

    2010-01-01

    We present results from a 42 ks Chandra/ACIS-S observation of the transitional FRI/FRII radio galaxy 3C288 at z = 0.246. We detect $\\sim$3 keV gas extending to a radius of $\\sim$0.5 Mpc with a 0.5-2.0 keV luminosity of 6.6 $\\times$ 10$^{43}$ ergs s$^{-1}$, implying that 3C288 lies at the center of a poor cluster. We find multiple surface brightness discontinuities in the gas indicative of either a shock driven by the inflation of the radio lobes or a recent merger event. The temperature across the discontinuities is roughly constant with no signature of a cool core, thus disfavoring either the merger cold-front or sloshing scenarios. We argue therefore that the discontinuities are shocks due to the supersonic inflation of the radio lobes. If they are shocks, the energy of the outburst is $\\sim$10^{60} ergs, or roughly 30% of the thermal energy of the gas within the radius of the shock, assuming that the shocks are part of a front produced by a single outburst. The cooling time of the gas is $\\sim$10^8 yrs, so...

  15. Liquid chromatographic enantioseparation of the brominated flame retardant 2,3-dibromopropyl-2,4,6-tribromophenyl ether (DPTE) and enantiomer fractions in seal blubber.

    Science.gov (United States)

    Vetter, Walter; Recke, Roland von der; Ostrowicz, Patrizia; Rosenfelder, Natalie

    2010-01-01

    Enantioselective analyses of the chiral brominated flame retardant 2,3-dibromopropyl-2,4,6-tribromophenyl ether (DPTE) are the focus of this work. High performance liquid chromatography (HPLC) equipped with a column that had a chiral stationary phase consisting of a modified cellulose derivative allowed for the fractionation of the enantiomers of DPTE. The enantiomeric excess was 98.2% for enantiomer 1 and 99% for enantiomer 2. Polarimetric measurements verified that the first eluting enantiomer originated from (-)-DPTE and the second peak originated from (+)-DPTE. Two gas chromatographic columns allowed for the direct enantioresolution of DPTE. The elution order of DPTE enantiomers was the same as observed in the chiral HPLC system ((-)-DPTE before (+)-DPTE). The best enantioseparation was achieved on a Chirasil-DEX CB column, which was used to analyze the enantiomer fractions of DPTE in blubber and brain samples of hooded seals (Cystophora cristata) and harp seals (Phoca groenlandica) from the Barents and Greenland Seas. Analyses were carried out by means of gas chromatography/electron capture negative ion mass spectrometry operated in the selected ion monitoring (GC/ECNI-MS-SIM) mode. In both matrices, only minute deviations from the racemate were observed (maximum +/-3% excess of (-)-DPTE). However, the samples from the Barents Sea were either racemic or showed a slight excess of (+)-DPTE (up to 2.5%), whereas all samples from the Greenland Sea contained a slight excess (up to 4%) of (-)-DPTE. PMID:19863996

  16. Evaluation of tissue and cellular biomarkers to assess 2,4,6-trinitrotoluene (TNT) exposure in earthworms: effects-based assessment in laboratory studies using Eisenia andrei.

    Science.gov (United States)

    Robidoux, Pierre Yves; Svendsen, Claus; Sarrazin, Manon; Hawari, Jalal; Thiboutot, Sonia; Ampleman, Guy; Weeks, Jason M; Sunahara, Geoffrey I

    2002-01-01

    The lysosomal neutral red retention time (NRRT) assay, a biomarker for lysosomal membrane stability, and the total immune activity (TIA) assay, a measure of non-specific immune system activity, were used in laboratory studies to assess the toxic effects of 2,4,6-trinitrotoluene (TNT) on earthworms (Eisenia andrei) in vivo. The results were compared with the concentration of TNT and its metabolites in earthworm tissue, as well as standard sublethal toxicity endpoints including growth (i.e. weight change) and reproduction effects from previously published studies. Filter paper experiments indicated a significant decrease in NRRT at >or=1.8 micro g TNT cm(-2), whereas sublethal (weight loss) and lethal effects to earthworms were detected at >or=3.5 and 7.1 micro g TNT cm(-2), respectively. Experiments in artificial soil showed that NRRT effects could be detected at lower TNT concentrations (>or=55 mg TNT kg(-1) soil dry weight) compared with other sublethal endpoints (effects on growth and reproduction). The TIA biomarker did not significantly respond to TNT. Copper (as CuSO4, filter paper contact tests) and 2-chloroacetamide (soil tests), which were used as reference toxicants, also decreased the NRRT. The use of the NRRT assay linked with tissue concentrations of TNT metabolites in earthworms was identified as a potentially appropriate biomarker approach for TNT exposure assessment under laboratory conditions and a novel tool for effects-based risk assessment. PMID:12171758

  17. Tetrakis(2,4,6-triamino-1,3,5-triazin-1-ium tris(pyridine-2,6-dicarboxylatocalcate(II hexahydrate

    Directory of Open Access Journals (Sweden)

    Hossein Aghabozorg

    2008-08-01

    Full Text Available The title compound, (C3H7N64[Ca(C7H3NO43]·6H2O or (tataH4[Ca(pydc3]·6H2O (where tata is 2,4,6-triamino-1,3,5-triazine and pydcH2 is pyridine-2,6-dicarboxylic acid, was obtained by reaction of Ca(NO32·4H2O with the proton-transfer compound (tataH2(pydc in aqueous solution. The [Ca(pydc3]4− anion has twofold crystallographic symmetry. It is a nine-coordinate CaII complex with a distorted tricapped trigonal-prismatic coordination geometry. The structure also contains four tataH+ cations and six uncoordinated water molecules. There are extensive O—H...O, O—H...N, N—H...O, N—H...N and C—H...O hydrogen bonds in the crystal structure.

  18. Dibromido(2,4,6-tri-2-pyridyl-1,3,5-triazine-κ3N2,N1,N6manganese(II

    Directory of Open Access Journals (Sweden)

    Kwang Ha

    2011-12-01

    Full Text Available The MnII ion in the title complex, [MnBr2(C18H12N6], is five-coordinated in a distorted square-pyramidal geometry by three N atoms of the tridentate 2,4,6-tri-2-pyridyl-1,3,5-triazine (tptz ligand and two bromide anions. In the crystal, the pyridyl rings coordinated to the Mn atom are inclined slightly to their carrier triazine ring [dihedral angles = 8.0 (3 and 7.5 (3°], whereas the uncoordinated pyridyl ring is located approximately parallel to the triazine ring [dihedral angle = 3.7 (3°]. The complexes are stacked in columns along the a axis and linked by intermolecular C—H...Br hydrogen bonds, forming chains. In the column, intermolecular π–π interactions between the six-membered rings are present, the shortest centroid–centroid distance being 3.750 (4 Å.

  19. Facile Synthesis, Characterization, and In Vitro Antimicrobial Screening of a New Series of 2,4,6-Trisubstituted-s-triazine Based Compounds

    Directory of Open Access Journals (Sweden)

    Ravi Bhushan Singh

    2015-01-01

    Full Text Available A series of new 2,4,6-trisubstituted-s-triazine was synthesized, assessed for antimicrobial activity, and characterized by FTIR, 1HNMR, 13CNMR, and elemental analysis. The tested compounds, 4d, 4g, 4h, 4k, and 4n, have shown considerable in vitro antibacterial efficacy with reference to the standard drug ciprofloxacin (MIC 3.125 μgmL−1 against B. subtilis, E. coli, and K. pneumoniae. It was observed that compounds 4d and 4h displayed equipotent antibacterial efficacy against B. subtilis (MIC 3.125 μgmL−1 and S. aureus (MIC 6.25 μgmL−1. The studies demonstrated that the para-fluorophenylpiperazine substituted s-triazine (4n was potent and exhibited broad spectrum antibacterial activity against S. epidermidis, K. pneumoniae, and P. aeruginosa with MIC of 6.25 μgmL−1 and for E. coli, it showed an MIC of 3.125 μgmL−1 equipotent with reference to the standard drug. Among all the compounds under investigation, compound 4g also demonstrated significant antifungal activity (3.125 μgmL−1 against C. albicans.

  20. Preconcentration of ruthenium on activated carbon impregnated with 2,4,6-tri-2-pyridyl-1,3,5-triazine/graphite furnace AAS

    International Nuclear Information System (INIS)

    Ruthenium is adsorbed on activated carbon impregnated with 2,4,6-tri-2-pyridyl-1,3,5-triazine (TPTZ-AC). A simple and rapid determination method for trace amounts of Ru by graphite furnace AAS using direct heating of Ru adsorbed TPTZ-AC was investigated. The proposed method is as follows. A sample solution of 100-1000 cm3 containing Ru is mixed with 50 mg of TPTZ-AC. The pH is then adjusted to 7.0 with phosphate buffer solution, and stirred for 10 min. The Ru adsorbed TPTZ-AC was separated from the sample solution by filtration. The TPTZ-AC on membrane filter is dispersed in 5.0 cm3 water. After shaking, 10 μl of the resulting suspension is injected directly into the graphite furnace. The absorbance is measured at 349.9 nm. The pyrocarbon treated graphite tube was most effective for the measurement of Ru. The calibration curve was liner below 2.5 μg/100 cm3 (aqueous phase). The determination limits (3σ) were 0.08 μg/100 cm3 (aqueous phase). The presence of such as Cu, Ni did not interfere. Interference by Fe could be masked by adding thiourea and 1,10-phenanthroline and ammonium fluoride. The proposed method was applied to the determination of Ru in several water samples. (author)

  1. Spectrophotometric analysis of vitamin E using Cu(I)-Bathocuproine or/and Fe(II)-2,4,6-tris-(2'-pyridyl)-s-triazine complexes

    International Nuclear Information System (INIS)

    Vitamin E (tocopherols and tocotrienols) antioxidants are determined by reducing Cu(II) to Cu(I) or Fe(III) to Fe(II) in presence of vitamin E and subsequent complexation of Cu(I) with bathocuproine and/or Fe(II) with 2,4,6-tris-(2'-pyridyl)-s-triazine (TPTZ). Both the reactions are monitored separately, Cu(I)-bathocuproine at 479 nm where as, Fe(II)-(TPTZ) at 595 nm spectrophotometrically. Linear calibration curves are achieved for both complexes between I to 5mu g ml-1 for vitamin E. The methods were applied for the determination of vitamin E in pharmaceutical preparations and edible oils. Vitamin E, from edible oils, was solvent extracted into n-hexane prior to saponification. Furthermore, a single lined flow was also examined. A larger excess of Cu(II) or Fe =(II) with different concentrations of vitamin E in buffer pH 4 was run on the line and constant amounts of reagent bathocuproine or TPTZ in each case was injected through the injector. The peak height shows a linear relationship for vitamin E between 0.5 to 2.5 mu g ml-1 for both complexes. (author)

  2. Photoluminescence detection of 2,4,6-trinitrotoluene (TNT) binding on diatom frustule biosilica functionalized with an anti-TNT monoclonal antibody fragment.

    Science.gov (United States)

    Zhen, Le; Ford, Nicole; Gale, Debra K; Roesijadi, Guritno; Rorrer, Gregory L

    2016-05-15

    A selective and label-free biosensor for detection of the explosive compound 2,4,6-trinitrotoluene (TNT) in aqueous solution was developed based on the principle of photoluminescence quenching of upon immunocomplex formation with antibody-functionalized diatom frustule biosilica. The diatom frustule is an intricately nanostructured, highly porous biogenic silica material derived from the shells of microscopic algae called diatoms. This material emits strong visible blue photoluminescence (PL) upon UV excitation. PL-active frustule biosilica was isolated from cultured cells of the marine diatom Pinnularia sp. and functionalized with a single chain variable fragment (scFv) derived from an anti-TNT monoclonal antibody. When TNT was bound to the anti-TNT scFv-functionalized diatom frustule biosilica, the PL emission from the biosilica was partially quenched due to the electrophilic nature of the nitro (-NO2) groups on the TNT molecule. The dose-response curve for immunocomplex formation of TNT on the scFv-functionalized diatom frustule biosilica had a half-saturation binding constant of 6.4 ± 2.4·10(-8)M and statistically-significant measured detection limit of 3.5·10(-8)M. The binding and detection were selective for TNT and TNB (trinitrobenzene) but not RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) or 2,6-DNT (2,6-dinitrotoluene). PMID:26774089

  3. COD, 2,4,6-trichlorophenol (TCP) and toxicity removal from synthetic wastewater in a rotating perforated-tubes biofilm reactor

    International Nuclear Information System (INIS)

    Synthetic wastewater containing different concentrations of 2,4,6-trichlorophenol (TCP) was biologically treated using a novel rotating perforated-tubes biofilm reactor (RTBR) for chemical oxygen demand (COD), TCP and toxicity removal. Performance of the reactor was investigated as function of major operating variables such as the feed TCP and COD concentrations and A/Q (biofilm surface area/feed flow rate) ratio. A Box-Behnken statistical experiment design method was used by considering the feed TCP (0-400 mg L-1), COD (1000-4000 mg L-1) and A/Q ratio (23-163 m2 d m-3) as the independent variables while percent TCP, COD, and toxicity removals were the objective functions. The results were correlated with the quadratic model since this was found to be the most suitable one. Response function coefficients were determined by correlating the experimental data with the response function. Percent TCP, COD and toxicity removals estimated from the response functions were in good agreement with the experimental results. TCP, COD and toxicity removals increased with increasing A/Q ratio and decreasing feed TCP concentrations. Percent toxicity removals were always lower than TCP removals indicating presence or formation of some toxic by products from TCP biodegradation. For the feed TCP of 400 mg L-1, the optimum conditions resulting in maximum COD (99%), TCP (100%) and toxicity (93%) removals were A/Q ratio of nearly 165 m2 d m-3 and feed COD of 2985 mg L-1

  4. 2,4,6-Tribromophenol Interferes with the Thyroid Hormone System by Regulating Thyroid Hormones and the Responsible Genes in Mice

    Science.gov (United States)

    Lee, Dongoh; Ahn, Changhwan; Hong, Eui-Ju; An, Beum-Soo; Hyun, Sang-Hwan; Choi, Kyung-Chul; Jeung, Eui-Bae

    2016-01-01

    2,4,6-Tribromophenol (TBP) is a brominated flame retardant (BFR). Based on its affinity for transthyretin, TBP could compete with endogenous thyroid hormone. In this study, the effects of TBP on the thyroid hormone system were assessed in mice. Briefly, animals were exposed to 40 and 250 mg/kg TBP. Thyroid hormones were also administered with or without TBP. When mice were treated with TBP, deiodinase 1 (Dio1) and thyroid hormone receptor β isoform 2 (Thrβ2) decreased in the pituitary gland. The levels of deiodinase 2 (Dio2) and growth hormone (Gh) mRNA increased in response to 250 mg/kg of TBP, and the relative mRNA level of thyroid stimulating hormone β (Tshβ) increased in the pituitary gland. Dio1 and Thrβ1 expression in the liver were not altered, while Dio1 decreased in response to co-treatment with thyroid hormones. The thyroid gland activity decreased in response to TBP, as did the levels of free triiodothyronine and free thyroxine in serum. Taken together, these findings indicate that TBP can disrupt thyroid hormone homeostasis and the presence of TBP influenced thyroid actions as regulators of gene expression. These data suggest that TBP interferes with thyroid hormone systems PMID:27420076

  5. 2,4,6-tris[dialkyl(diaryl)phosphoryl]-1,3,5-triazines as extractants for transplutonium and rare-earth elements

    International Nuclear Information System (INIS)

    The extraction ability and selectivity of 2,4,6-tris[dialkyl(diaryl)phosphoryl]-1,3,5-triazines with various substituents on the P atoms for trivalent transplutonium (TPE) and rare-earth (REE) elements are studied. The most effective reagent is the toluene-substituted one. The TPE and REE are extracted much more effectively from SCN-HCl solution than from HNO3 solutions. IR spectroscopy using Nd as an example demonstrated that two phosphoryl groups and not the nitrogens form a chelate complex with the elements. The basicity of the reagents is determined. IR spectroscopy can detect the hydrolysis products of the reagents, cyanuric acid, after contact with 0.1 M HNO3 but not after contact with 3 M acid. The reagents exhibit selectivity for the TPE during extraction from HNO3 and especially from SCN solutions. The intergroup separation factor, defines as the ratio of the distribution coefficients of Cm and Ce, reaches ∼10 on extraction from SCN solutions

  6. A New Indirect Spectrofluorimetric Method for Determination of Ascorbic Acid with 2,4,6-Tripyridyl-S-Triazine in Pharmaceutical Samples

    Directory of Open Access Journals (Sweden)

    Lejla Klepo

    2016-01-01

    Full Text Available Ascorbic acid (AA is a water-soluble vitamin which shows no fluorescence. However, in reaction with iron(III, AA is oxidised to dehydroascorbic acid and iron(III is reduced to iron(II which forms a complex with 2,4,6-tripyridyl-S-triazine (TPTZ in buffered medium. The relative fluorescence intensity of the resulting Fe(TPTZ22+ complex can be measured at excitation and emission wavelengths of 393 and 790 nm, respectively. Based on this data, a new indirect spectrofluorimetric method for the determination of AA in pharmaceutical samples was proposed. Influence of the reaction conditions, such as acidity of acetic buffer, concentration of TPTZ and iron(III, reaction time and instrumental parameters were investigated in detail. The linear range was from 5.4 × 10−4 to 5.4 × 10−6 mol·L−1 (R = 0.9971. The LOD was 7.7 × 10−7 mol·L−1 and LOQ was 2.3 × 10−4 mol·L−1. Fourteen pharmaceutical samples containing various amounts of AA were analysed. Influences of potential interfering substances were also examined. Analysis of commercial pharmaceutical formulations showed good correlation with the nominal values given by the manufacturers and with the results obtained by a titration method. The proposed method can be applied in routine quality control in the pharmaceutical industry due to its sensitivity, simplicity, selectivity and low cost.

  7. Performance of a hybrid-loop bioreactor system in biological treatment of 2,4,6-tri-chlorophenol containing synthetic wastewater: Effects of hydraulic residence time

    International Nuclear Information System (INIS)

    A hybrid-loop bioreactor system consisting of a packed column biofilm and an aerated tank bioreactor with effluent recycle was used for biological treatment of 2,4,6-tri-chlorophenol (TCP) containing synthetic wastewater. Effects of hydraulic residence time (HRT) on COD, TCP and toxicity removal performance of the reactor were investigated for the HRT values between 5 and 30 h, while the feed COD (2700 ± 100 mg l-1), TCP (300 ± 10 mg l-1) and the solids retention time (sludge age, SRT, 20 d) were constant. Percent TCP, COD and toxicity removals increased with increasing HRT resulting in more than 90% COD, TCP and toxicity removals at HRT values above 25 h. Biomass concentrations in the packed column and in the aeration tank increased with increasing HRT resulting in low reactor TCP concentrations and therefore high TCP, COD and toxicity removals at high HRT values. Volumetric and specific rates of TCP and COD removals decreased with increasing HRT due to increased biomass and decreased flow rates at high HRT levels. Volumetric and specific removal rates of COD and TCP were maximum at an HRT of 5 h

  8. Prednisolone-appended alpha-cyclodextrin: alleviation of systemic adverse effect of prednisolone after intracolonic administration in 2,4,6-trinitrobenzenesulfonic acid-induced colitis rats.

    Science.gov (United States)

    Yano, H; Hirayama, F; Arima, H; Uekama, K

    2001-12-01

    The titled compound is a cyclodextrin derivative in which prednisolone 21-succinate (PDsuc) is covalently bound to one of the secondary hydroxyl groups of alpha-cyclodextrin (alpha-CyD) via an ester linkage. In this study, the PDsuc-appended alpha-CyD ester conjugate (PDsuc/alpha-CyD conjugate) was intracolonically administered to rats with 2,4,6-trinitrobenzensulfonic acid-induced colitis, and its antiinflammatory and systemic adverse effects were compared with those of prednisolone (PD) alone and the PD/2-hydroxypropyl-beta-CyD complex (PD/HP-beta-CyD complex), which is a noncovalent inclusion complex. Colonic damage score, ratio of distal colon wet weight to body weight, and myeloperoxidase activity were evaluated as measures of the therapeutic effect of PD, whereas the ratio of thymus wet weight to body weight was evaluated as a measure of the side effect of PD. The local antiinflammatory activity increased in the order of PD alone approximately PDsuc/alpha-CyD conjugate keeps the local concentration in the colon at a low but constant level. The results suggest that the PDsuc/alpha-CyD conjugate can alleviate the systemic adverse effect of PD while maintaining the therapeutic activity of PD. This kind of knowledge will be useful in the rational design of steroid prodrugs for the colon-specific drug delivery system. PMID:11745769

  9. Absorption spectroscopic and FTIR studies on EDA complexes between TNT (2,4,6-trinitrotoluene) with amines in DMSO and determination of the vertical electron affinity of TNT

    Science.gov (United States)

    Sharma, S. P.; Lahiri, S. C.

    2008-06-01

    TNT (2,4,6-trinitrotoluene) formed deep red 1:1 CT complexes with chromogenic agents like isopropylamine, ethylenediamine, bis(3-aminopropyl)amine and tetraethylenepentamine in DMSO. The complexes were also observed in solvents like methanol, acetone, etc. when the amines were present in large excess. The isopropylamine, complex showed three absorption peaks (at 378, 532 and 629 nm) whereas higher amines showed four peaks (at 370, 463, 532 and 629 nm). The peak at 463 nm vanished rapidly. The peak of the complexes near 530 nm required about 8-10 min to develop and the complexes were stable for about an hour but the peak slowly shifted towards 500 nm and the complexes were found to be stable for more than 24 h. The evidence of complex formation was obtained from distinct spots in HPTLC plates and from the shifts in frequencies and formation of new peaks in FTIR spectra. The peaks near 460 nm (transient) and 530 nm may be due to Janovsky reaction but could not be established. The extinction coefficients of the complexes were determined directly which enabled the accurate determination of the association constants KDA with TNT and amines in stoichiometric ratios. The results were verified using iterative method. The quantfication of TNT was made using ɛ value of the complex with ethylenediamine. The vertical electron affinity ( EA) of TNT was calculated using the method suggested by Mulliken.

  10. Adsorption isotherms, kinetics, thermodynamics and desorption studies of 2,4,6-trichlorophenol on oil palm empty fruit bunch-based activated carbon

    International Nuclear Information System (INIS)

    The adsorption characteristics of 2,4,6-trichlorophenol (TCP) on activated carbon prepared from oil palm empty fruit bunch (EFB) were evaluated. The effects of TCP initial concentration, agitation time, solution pH and temperature on TCP adsorption were investigated. TCP adsorption uptake was found to increase with increase in initial concentration, agitation time and solution temperature whereas adsorption of TCP was more favourable at acidic pH. The adsorption equilibrium data were best represented by the Freundlich and Redlich-Peterson isotherms. The adsorption kinetics was found to follow the pseudo-second-order kinetic model. The mechanism of the adsorption process was determined from the intraparticle diffusion model. Boyd plot revealed that the adsorption of TCP on the activated carbon was mainly governed by particle diffusion. Thermodynamic parameters such as standard enthalpy (ΔHo), standard entropy (ΔSo), standard free energy (ΔGo) and activation energy were determined. The regeneration efficiency of the spent activated carbon was high, with TCP desorption of 99.6%.

  11. Targeted therapies for cancer

    Science.gov (United States)

    ... to be untrue. Possible side effects from targeted therapies include: Diarrhea Liver problems Skin problems such as rash, dry skin, and nail changes Problems with blood clotting and wound healing High blood pressure As with any treatment, you ...

  12. SETI target selection.

    Science.gov (United States)

    Latham, D. W.; Soderblom, D. R.

    1995-06-01

    The NASA High Resolution Microwave Survey consists of two complementary elements: a Sky Survey of the entire sky to a moderate level of sensitivity; and a Targeted Search of nearby stars, one at a time, to a much deeper level of sensitivity. The authors propose strategies for target selection with two goals: to improve the chances of successful detection of signals from technical civilizations that inhabit planets around solar-type stars, and to minimize the chances of missing signals from unexpected sites.

  13. High pressure gas target

    Science.gov (United States)

    Gelbart, W.; Johnson, R. R.; Abeysekera, B.

    2012-12-01

    Compact, high pressure, high current gas target features all metal construction and semi-automatic window assembly change. The unique aspect of this target is the domed-shaped window. The Havar alloy window is electron beam welded to a metal ring, thus forming one, interchangeable assembly. The window assembly is sealed by knife-edges locked by a pneumatic toggle allowing a quick, in situ window change.

  14. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  15. Radar target detection simulation

    Directory of Open Access Journals (Sweden)

    Tarig Ibrahim Osman

    2014-12-01

    Full Text Available Standard radar detection process requires that the sensor output is compared to a predetermined threshold. The threshold is selected based on a-priori knowledge available and/or certain assumptions. However, any knowledge and/or assumptions become in adequate due to the presence of multiple targets with varying signal return and usually non stationary background. Thus, any predetermined threshold may result in either increased false alarm rate or increased track loss. Even approaches where the threshold is adaptively varied will not perform well in situations when the signal return from the target of interest is too low compared to the average level of the background .Track-before-detect techniques eliminate the need for a detection threshold and provide detecting and tracking targets with lower signal-to-noise ratios than standard methods. However, although trackbefore-detect techniques eliminate the need for detection threshold at sensor's signal processing stage, they often use tuning thresholds at the output of the filtering stage .This paper presents a computerized simulation model for target detection process. Moreover, the proposed model method is based on the target motion models, the output of the detection process can easily be employed for maneuvering target tracking.

  16. DECHLORINATION OF 2,4,6-TRICHLOROPHENOL BY FREE AND IMMOBILIZED LACCASE FROM TRAMETES VERSICOLOR IN A LAB SCALE BIOREACTOR Arzu ÜNAL, Ahmet ÇABUK, Nazif KOLONKAYA

    Directory of Open Access Journals (Sweden)

    Nazif KOLANKAYA

    2011-08-01

    Full Text Available Detoxification of a chlorinated phenolic compound, 2,4,6- trichlorophenol through treatment with laccase enzyme produced by a white rot fungus, Trametes versicolor was investigated. Enzymaticdechlorination experiments by using free and immobilized laccase have been performed in a lab scale bioreactor. Chlorine ion and dissolved oxygen electrodes mounted to the bioreactor were used continuouslyto detect the profiles of chlorine ions and oxygen consumption, respectively, in reaction medium. The maximum dechlorination activity of laccase for free and immobilized form was determined as 160 μM of substrate concentration at pH 5.0, 25 °C, and 30 min of incubation time. Also, GC/MS analyses of enzymatic degradation products indicated that chlorine removal was a result of degradation of 2,4,6- trichlorophenol by the laccase under the determined optimum conditions.

  17. Research Progress in New Detection Technology of2,4,6-Trichloroanisole in Grape Wine%葡萄酒中2,4,6-三氯苯甲醚(TCA)检测新技术的研究进展

    Institute of Scientific and Technical Information of China (English)

    周立华; 牟德华; 李艳

    2016-01-01

    2,4,6-trichloroanisole (TCA) is a substance harmful to wine sensory quality. It usually comes from wine corks, and possibly comes from grape or wine-making process contamination. Its existence results in bad odor and bad taste in wine. In this paper, the new methods and in-struments for the detection of TCA in wine in recent years were introduced including the extraction technology and detection technology of TCA in wine. And the characteristics, principles and application advantages of these new technologies were elaborated for the purpose of pro-viding useful reference for achieving high-precision, low-detection-limit and high-sensitivity qualitative and quantitative determination of TCA in wine, further monitoring TCA in wine, and ultimately improving wine quality.%2,4,6-三氯苯甲醚(TCA)是危害葡萄酒感官品质的一种物质,通常来自于葡萄酒封装所用的软木塞,也可能来自葡萄原料或酿酒过程中的污染,它的存在使葡萄酒产生不良气味和口感.简介了最近十几年来检测葡萄酒中TCA的新方法和新仪器,包括葡萄酒中TCA的萃取技术和检测技术.并对这些新技术的特点、原理及应用优势进行了阐述.目的是为对葡萄酒中的TCA做到精确、低检出限和高灵敏性的定性及定量测定提供参考,从而对葡萄酒中的TCA进行准确的监测,最终提高葡萄酒的品质.

  18. Induction by phenobarbital of aniline-p-hydroxylase in mouse liver under the influence of X-irradiation and 2,4,6-triethyleneimino-1,3,5-triazine

    International Nuclear Information System (INIS)

    The phenobarbital-induced activity of aniline-p-hydroxylase in livers of mice was enhanced additionally when the animals were X-irradiated 4-16 hours before the administration of the inducer. The same effect could be demonstrated after repeated irradiation with low doses. 2,4,6-triethyleneimino-1,3,5-triazine (tretamine) inhibited the induction of aniline-p-hydroxylase only when administered in extremely high doses. Lower doses resulted in 'superinduciton'. (orig.)

  19. Synthesis, Crystal Structure and Thermal Stability of a One-dimensional Chain Cobalt Coordination Polymer [ Co( 4,4 '-bipy)( 2,4,6- TMBA)2( CH3CH2OH)2]n

    Institute of Scientific and Technical Information of China (English)

    LI Wei; LI Chang-Hong; YANG Ying-Qun; CHEN Zhi-Min; KUANG Dai-Zhi; ZHANG Chun-Hua; KANG Yun-Fei

    2006-01-01

    A one-dimensional chain cobalt(Ⅱ) coordination polymer with 2,4,6-trimethylbenzoic acid, 4,4'-bipyridine and cobalt perchlorate anhydrous has been synthesized and characterized in the mixture solvent of water and alcohol. Crystal data for this complex: monoclinic, space group C2/c, a = 2.3805(8), b = 1.1464(4), c = 1.5807(5) nm, γ = 128.435(4)°, V= 3.3791(18) nm3,Dc = 1.246 g/cm3, Z = 4, F(000) = 1340, final GooF = 1.009, R = 0.0504 and wR = 0.1287.Structural analysis shows that the cobalt ion is coordinated with two nitrogen atoms of one 4,4'-bipyridine molecule and four oxygen atoms from two 2,4,6-trimethylbenzoic acid molecules and two alcohol molecules, giving a distorted octahedral coordination geometry. The result of TG analysis indicates that the title complex is stable till 200 ℃.

  20. Synthesis and characterization of -phosphorylated thioureas RNHC(S)NHP(O)(OPr)2 (R = 2-MeC6H4, 2,6-Me2C6H3, 2,4,6-Me3C6H2)

    Indian Academy of Sciences (India)

    Damir A Safin; Maria G Babashkina; Michael Bolte; Axel Klein

    2010-05-01

    Reaction of O,O'-diisopropylphosphoric acid isothiocyanate (PrO)2P(O)NCS with 2-methylaniline 2-MeC6H4NH2, 2,6-dimethylaniline 2,6-Me2C6H3NH2 or 2,4,6-trimethylaniline 2,4,6-Me3C6H2NH2 leads to the -phosphorylated thioureas RNHC(S)NHP(O)(OPr)2 (R = 2-MeC6H4-, HLI; 2,6-Me2C6H3-, HLII; 2,4,6-Me3C6H2-, HLIII). The new compounds were investigated by 1H and 31P{1H} NMR spectroscopy, and microanalysis. The molecular structure of the thiourea HLIII was elucidated by single crystal X-ray diffraction analysis. Single crystal X-ray diffraction studies showed HLIII forms both intra- and intermolecular hydrogen bonds, which in turn leads to the formation of polymeric chains. One of the intermolecular hydrogen bonds is of the type N-H$\\cdots$S. Moreover, the formation of intermolecular C-H$\\cdots$ 6 -phenyl interactions was established.

  1. The Sinuous Target

    Energy Technology Data Exchange (ETDEWEB)

    Zwaska, R. [Fermilab

    2015-06-01

    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  2. Targeted assets risk analysis.

    Science.gov (United States)

    Bouwsema, Barry

    2013-01-01

    Risk assessments utilising the consolidated risk assessment process as described by Public Safety Canada and the Centre for Security Science utilise the five threat categories of natural, human accidental, technological, human intentional and chemical, biological, radiological, nuclear or explosive (CBRNE). The categories of human intentional and CBRNE indicate intended actions against specific targets. It is therefore necessary to be able to identify which pieces of critical infrastructure represent the likely targets of individuals with malicious intent. Using the consolidated risk assessment process and the target capabilities list, coupled with the CARVER methodology and a security vulnerability analysis, it is possible to identify these targeted assets and their weaknesses. This process can help emergency managers to identify where resources should be allocated and funding spent. Targeted Assets Risk Analysis (TARA) presents a new opportunity to improve how risk is measured, monitored, managed and minimised through the four phases of emergency management, namely, prevention, preparation, response and recovery. To reduce risk throughout Canada, Defence Research and Development Canada is interested in researching the potential benefits of a comprehensive approach to risk assessment and management. The TARA provides a framework against which potential human intentional threats can be measured and quantified, thereby improving safety for all Canadians. PMID:23615063

  3. Production Target Design Report

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dale, Gregory E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Olivas, Eric Richard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-07-28

    The Northstar 99Mo production target, a cylindrical length of 100Mo rod, has evolved considerably since its first conception.  The cylinder was very early sliced into disks to increase the heat transfer area, first to 1 mm thick disks then to the current 0.5 mm thick.  The coolant was changed early in the target development from water to helium to eliminate corrosion and dissolution.  The diameter has increased from initially 6 mm to 12 mm, the current diameter of the test target now at ANL, to nominally 28 mm (26-30.6 mm, depending upon optimal beam spot size and shape).  The length has also changed to improve the production to cost ratio, so now the target is nominally 41 mm long (excluding coolant gaps between disks), and irradiated on both ends.  This report summarizes the current status of the plant target design.

  4. Inflation Forecast Targeting: Implementing and Monitoring Inflation Targets

    OpenAIRE

    Lars E.O. Svensson

    1996-01-01

    Inflation targeting is shown to imply inflation forecast targeting: the central bank's inflation forecast becomes an intermediate target. Inflation forecast targeting simplifies both implementing and monitoring of monetary policy. The inflation forecast is actually an ideal intermediate target: it is most correlated with the goal, easier to control than the goal, more observable than the goal, and very transparent. Money growth targeting generally leads to higher inflation variability than in...

  5. Setting reference targets

    International Nuclear Information System (INIS)

    Reference Targets are used to represent virtual quantities like the magnetic axis of a magnet or the definition of a coordinate system. To explain the function of reference targets in the sequence of the alignment process, this paper will first briefly discuss the geometry of the trajectory design space and of the surveying space, then continue with an overview of a typical alignment process. This is followed by a discussion on magnet fiducialization. While the magnetic measurement methods to determine the magnetic centerline are only listed (they will be discussed in detail in a subsequent talk), emphasis is given to the optical/mechanical methods and to the task of transferring the centerline position to reference targets

  6. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.

    2014-01-01

    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses...... how the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish...

  7. Targeted Phototherapy (newer phototherapy

    Directory of Open Access Journals (Sweden)

    Zonunsanga

    2015-04-01

    Full Text Available Conventional phototherapy uses a whole body cabinet or body part machine such as hand, foot or scalp machines. They have many disadvantages due to which new phototherapy technique was then developed to overcome this situation. This new technique is called targeted phototherapy which includes excimer laser, intense pulse light system (IPL, photodynamic therapy and ultraviolet (UV light source with a sophisticated delivery system which is easy to be operated by hands. The mechanisms of action of targeted phototherapy systems are similar to those in conventional UVB/UVA therapy. They have many advantages like less chances of side effects, avoidance of exposure of unnecessary sites, faster response, shortening of the duration of treatments. But they have disadvantages like high costs and inability to use for extensive areas. This review article discusses targeted phototherapy in considerable to the mechanism of actions and advantages and disadvantages in comparison to the conventional phototherapy.

  8. Phoenix Color Targets

    Science.gov (United States)

    2008-01-01

    These images of three Phoenix color targets were taken on sols 1 and 2 by the Surface Stereo Imager (SSI) on board the Phoenix lander. The bottom target was imaged in approximate color (SSI's red, green, and blue filters: 600, 530, and 480 nanometers), while the others were imaged with an infrared filter (750 nanometers). All of them will be imaged many times over the mission to monitor the color calibration of the camera. The two at the top show grains 2 to 3 millimeters in size that were likely lifted to the Phoenix deck during landing. Each of the large color chips on each target contains a strong magnet to protect the interior material from Mars' magnetic dust. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  9. Influence of Halogen Substituents on the Catalytic Oxidation of 2,4,6-Halogenated Phenols by Fe(III-Tetrakis(p-hydroxyphenyl porphyrins and Potassium Monopersulfate

    Directory of Open Access Journals (Sweden)

    Seiya Nagao

    2011-12-01

    Full Text Available The influence of halogen substituents on the catalytic oxidation of 2,4,6-trihalogenated phenols (TrXPs by iron(III-porphyrin/KHSO5 catalytic systems was investigated. Iron(III-5,10,15,20-tetrakis(p-hydroxyphenylporphyrin (FeTHP and its supported variants were employed, where the supported catalysts were synthesized by introducing FeTHP into hydroquinone-derived humic acids via formaldehyde poly-condensation. F (TrFP, Cl (TrCP, Br (TrBP and I (TrIP were examined as halogen substituents for TrXPs. Although the supported catalysts significantly enhanced the degradation and dehalogenation of TrFP and TrCP, the oxidation of TrBP and TrIP was not enhanced, compared to the FeTHP catalytic system. These results indicate that the degree of oxidation of TrXPs is strongly dependent on the types of halogen substituent. The order of dehalogenation levels for halogen substituents in TrXPs was F > Cl > Br > I, consistent with their order of electronegativity. The electronegativity of a halogen substituent affects the nucleophilicity of the carbon to which it is attached. The levels of oxidation products in the reaction mixtures were analyzed by GC/MS after extraction with n-hexane. The most abundant dimer product from TrFP via 2,6-difluoroquinone is consistent with a scenario where TrXP, with a more electronegative halogen substituent, is readily oxidized, while less electronegative halogen substituents are oxidized less readily by iron(III-porphyrin/KHSO5 catalytic systems.

  10. Development of a microwave assisted extraction method for the analysis of 2,4,6-trichloroanisole in cork stoppers by SIDA-SBSE-GC-MS

    International Nuclear Information System (INIS)

    The aim of this research work was focused on the replacement of the time-consuming soaking of cork stoppers which is mainly used as screening method for cork lots in connection with sensory analysis and/or analytical methods to detect releasable 2,4,6-trichloroanisole (TCA) of natural cork stoppers. Releasable TCA from whole cork stoppers was analysed with the application of a microwave assisted extraction method (MAE) in combination with stir bar sorptive extraction (SBSE). The soaking of corks (SOAK) was used as a reference method to optimise MAE parameters. Cork lots of different quality and TCA contamination levels were used to adapt MAE. Pre-tests indicated that an MAE at 40 deg. C for 120 min with 90 min of cooling time are suitable conditions to avoid an over-extraction of TCA of low and medium tainted cork stoppers in comparison to SOAK. These MAE parameters allow the measuring of almost the same amounts of releasable TCA as with the application of the soaking procedure in the relevant range (-1 releasable TCA from one cork) to evaluate the TCA level of cork stoppers. Stable isotope dilution assay (SIDA) was applied to optimise quantification of the released TCA with deuterium-labelled TCA (TCA-d5) using a time-saving GC-MS technique in single ion monitoring (SIM) mode. The developed MAE method allows the measuring of releasable TCA from the whole cork stopper under improved conditions and in connection with a low use of solvent and a higher sample throughput.

  11. Luminescence properties and crystal structure of europium complexes with phenoxyacetic acid and 2,4,6-tri(2-pyridyl)-s-triazine

    International Nuclear Information System (INIS)

    Using anion ligand phenoxyacetic acid (HPOA) and neutral ligand 2,4,6-tri(2-pyridyl)-s-triazine (TPTZ), two complexes Eu2(TPTZ)2(POA)6·6H2O and EuY(TPTZ)2(POA)6·6H2O have been synthesized and one crystal EuY(TPTZ)2(POA)6·2CH3OH has been obtained. These complexes are characterized by elemental analysis, ICP-AES, IR and UV absorption spectroscopy. The luminescence spectra, luminescence lifetimes and emission quantum efficiencies of the complexes have been studied. The results show that the complex EuY(TPTZ)2(POA)6·6H2O exhibits stronger luminescence intensity, longer luminescent lifetime and higher emission quantum efficiency than Eu2(TPTZ)2(POA)6·6H2O. The single-crystal X-ray diffraction of EuY(TPTZ)2(POA)6·2CH3OH reveals that the crystal is heteronuclear and crystallizes in the triclinic space group P-1 with following unit cell parameters a=12.2411(10) Å, b=13.2294(11) Å, c=13.5232(11) Å, α=74.8596(13)°, β=82.9593(16)°, γ=87.1641(14)°, and V=2097.7(3) Å3. Each metal ion coordinates with three nitrogen atoms of one TPTZ and seven oxygen atoms of three POA− ions. And there exist two coordination forms between POA− and metal ions in the crystal. One is chelating bidentate, the other is the single-atom bridge. - Highlights: • One Eu/Y heteronuclear crystal and two complexes with HPOA and TPTZ were prepared. • Each metal ion in the crystal coordinates with three nitrogen and seven oxygen atoms. • The two complexes exhibit strong luminescence emissions. • The heteronuclear complex shows better luminescent properties than the homonuclear one. • The structure of the crystal and the sensitization mechanism are deeply discussed

  12. Effects of sinomenine on the expression of microRNA-155 in 2,4,6-trinitrobenzenesulfonic acid-induced colitis in mice.

    Directory of Open Access Journals (Sweden)

    Qiao Yu

    Full Text Available BACKGROUND: Sinomenine, a pure alkaloid isolated in Chinese medicine from the root of Sinomenium acutum, has been demonstrated to have anti-inflammatory and immunosuppressive effects. MicroRNAs (miRNAs are gradually being recognized as critical mediators of disease pathogenesis via coordinated regulation of molecular effector pathways. METHODOLOGY/FINDINGS: After colitis was induced in mice by instillation of 5% (w/v 2,4,6-trinitrobenzenesulfonic acid (TNBS, sinomenine at a dose of 100 or 200 mg/kg was orally administered once daily for 7 days. We evaluated body weight, survival rate, diarrhea score, histological score and myeloperoxidase (MPO activity. The mRNA and protein expression levels of miR-155, c-Maf, TNF-α and IFN-γ were determined by quantitative RT-PCR and immunohistochemistry, respectively. Sinomenine (100 or 200 mg/kg-treated mice with TNBS-induced colitis were significantly improved in terms of body weight, survival rate, diarrhea score, histological score and MPO activity compared with untreated mice. Both dosages of sinomenine significantly decreased the mRNA and protein expression levels of c-Maf, TNF-α and IFN-γ, which elevated in TNBS-induced colitis. Furthermore, sinomenine at a dose of 200 mg/kg significantly decreased the level of miR-155 expression by 71% (p = 0.025 compared with untreated TNBS-induced colitis in mice. CONCLUSIONS/SIGNIFICANCE: Our study evaluated the effects and potential mechanisms of sinomenine in the anti-inflammatory response via miRNA-155 in mice with TNBS-induced colitis. Our findings suggest that sinomenine has anti-inflammatory effects on TNBS-induced colitis by down-regulating the levels of miR-155 and several related inflammatory cytokines.

  13. Targeted polypeptide degradation

    Science.gov (United States)

    Church, George M.; Janse, Daniel M.

    2008-05-13

    This invention pertains to compositions, methods, cells and organisms useful for selectively localizing polypeptides to the proteasome for degradation. Therapeutic methods and pharmaceutical compositions for treating disorders associated with the expression and/or activity of a polypeptide by targeting these polypeptides for degradation, as well as methods for targeting therapeutic polypeptides for degradation and/or activating therapeutic polypeptides by degradation are provided. The invention provides methods for identifying compounds that mediate proteasome localization and/or polypeptide degradation. The invention also provides research tools for the study of protein function.

  14. Fine target of deuterium

    International Nuclear Information System (INIS)

    A fine target of deuterium on a tantalum plate by the absorption method is obtained. In order to obtain the de gasification temperature an induction generator of high frequency is used and the deuterium pass is regulated by means of a palladium valve. Two vacuum measures are available, one to measure the high vacuum in the de gasification process of the tantalum plate and the other, for low vacuum, to measure the deuterium inlet in the installation and the deuterium pressure change in the installation after the absorption in the tantalum plate. A target of 48 μ gr/cm2 thick is obtained. (Author) 1 refs

  15. AA antiproton production target

    CERN Multimedia

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long (actually a row of 11 rods, each 1 cm long) and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing made of stainless steel. The casing had fins for forced-air cooling. In this picture, the 26 GeV high-intensity beam from the PS enters from the right, where a scintillator screen, with circles every 5 mm in radius, permits precise aim at the target centre. See also 7903034 and 7905094.

  16. Major Targets for 2010

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    @@ This year, the main targets we have set for economic and social development are: increasing GDP by approximately 8 percent, creating jobs for more than 9 million people, keeping the urban registered unemployment rate no higher than 4.6 percent, holding the rise in consumer prices to around 3 percent, and improving the balance of payments.

  17. 12. Target fabrication

    International Nuclear Information System (INIS)

    This series of papers presents the requirements and critical issues for IFE (inertial fusion energy) target fabrication and injection. The critical issues for target fabrication are: -) ability to fabricate target capsules and hohlraums, -) ability to fabricate them economically, and -) ability to fabricate, assemble, fill and layer at the required rate. Potential fabrication processes or methodologies include: micro-encapsulation (for foam shells and thick ablators), phase-inversion technique (for CH foams), super-fast cooling techniques, emulsion technique, injection molding (for higher density foam shells), sputter coating (for density high-Z coating), permeation (for DT filling) and cryogenic fluidized beds (for layering of individual capsules). The cooling-induced deformation (CID) of polystyrene shells is characterized in detail (2 papers). Another paper deals with the fabrication of hollow pellets with high Z metal oxide coating of the inner surface. In order to achieve high density compression in laser experiments, the non-contact suspension of pellets is required, Japanese teams propose 2 ways to get it: magnetic suspension and the use of electromagnetic force. The last paper summarizes the major steps in cost reduction that will be taken to economically supply targets for IFE power plants. (A.C.)

  18. Target Chamber Manipulator

    Science.gov (United States)

    Tantillo, Anthony; Watson, Matthew

    2015-11-01

    A system has been developed to allow remote actuation of sensors in a high vacuum target chamber used with a particle accelerator. Typically, sensors of various types are placed into the target chamber at specific radial and angular positions relative to the beam line and target. The chamber is then evacuated and the experiments are performed for those sensor positions. Then, the chamber is opened, the sensors are repositioned to new angles or radii, and the process is repeated, with a separate pump-down cycle for each set of sensor positions. The new sensor positioning system allows scientists to pre-set the radii of up to a dozen sensors, and then remotely actuate their angular positions without breaking the vacuum of the target chamber. This reduces the time required to reposition sensors from 6 hours to 1 minute. The sensors are placed into one of two tracks that are separately actuated using vacuum-grade stepping motors. The positions of the sensors are verified using absolute optical rotary encoders, and the positions are accurate to 0.5 degrees. The positions of the sensors are electronically recorded and time-stamped after every change. User control is through a GUI using LabVIEW.

  19. ISOLDE back on target

    CERN Multimedia

    Anaïs Schaeffer

    2014-01-01

    Today, Friday 1 August, the ISOLDE installation, supplied by the beams of the PS Booster, restarted its physics programme. After a shutdown of almost a year and a half, there was a real buzz in the air as the first beam of protons hit the target of the first post-LS1 ISOLDE experiment.   One of the new target-handling robots installed by ISOLDE during LS1. Many improvements have been made to the ISOLDE installation during LS1. One of the main projects was the installation of new robots for handling the targets (see photo 1). “Our targets are bombarded by protons from the PS Booster’s beams and become very radioactive,” explains Maria Jose Garcia Borge, spokesperson for the ISOLDE collaboration. “They therefore need to be handled carefully, which is where the robots come in. The robots we had until now were already over 20 years old and were starting to suffer from the effects of radiation. So LS1 was a perfect opportunity to replace them with more moder...

  20. Enhanced target factor analysis.

    Science.gov (United States)

    Rostami, Akram; Abdollahi, Hamid; Maeder, Marcel

    2016-03-10

    Target testing or target factor analysis, TFA, is a well-established soft analysis method. TFA answers the question whether an independent target test vector measured at the same wavelengths as the collection of spectra in a data matrix can be excluded as the spectrum of one of the components in the system under investigation. Essentially, TFA cannot positively prove that a particular test spectrum is the true spectrum of one of the components, it can, only reject a spectrum. However, TFA will not reject, or in other words TFA will accept, many spectra which cannot be component spectra. Enhanced Target Factor Analysis, ETFA addresses the above problem. Compared with traditional TFA, ETFA results in a significantly narrower range of positive results, i.e. the chance of a false positive test result is dramatically reduced. ETFA is based on feasibility testing as described in Refs. [16-19]. The method has been tested and validated with computer generated and real data sets. PMID:26893084

  1. The targets of curcumin.

    Science.gov (United States)

    Zhou, Hongyu; Beevers, Christopher S; Huang, Shile

    2011-03-01

    Curcumin (diferuloylmethane), an orange-yellow component of turmeric or curry powder, is a polyphenol natural product isolated from the rhizome of the plant Curcuma longa. For centuries, curcumin has been used in some medicinal preparation or used as a food-coloring agent. In recent years, extensive in vitro and in vivo studies suggested curcumin has anticancer, antiviral, antiarthritic, anti-amyloid, antioxidant, and anti-inflammatory properties. The underlying mechanisms of these effects are diverse and appear to involve the regulation of various molecular targets, including transcription factors (such as nuclear factor-kB), growth factors (such as vascular endothelial cell growth factor), inflammatory cytokines (such as tumor necrosis factor, interleukin 1 and interleukin 6), protein kinases (such as mammalian target of rapamycin, mitogen-activated protein kinases, and Akt) and other enzymes (such as cyclooxygenase 2 and 5 lipoxygenase). Thus, due to its efficacy and regulation of multiple targets, as well as its safety for human use, curcumin has received considerable interest as a potential therapeutic agent for the prevention and/or treatment of various malignant diseases, arthritis, allergies, Alzheimer's disease, and other inflammatory illnesses. This review summarizes various in vitro and in vivo pharmacological aspects of curcumin as well as the underlying action mechanisms. The recently identified molecular targets and signaling pathways modulated by curcumin are also discussed here. PMID:20955148

  2. Polarization discrimination between repeater false-target and radar target

    Institute of Scientific and Technical Information of China (English)

    SHI LongFei; WANG XueSong; XIAO ShunPing

    2009-01-01

    High fidelity repeater false-target badly affects a radar system's detecting, tracking, and data processing. It is an available approach of confronting false-target for radar that discriminates firstly and then eliminates. Whereas for the technique progress about the repeater false-target jam, it is more and more difficult to discriminate this jam in the time-domain, frequency-domain, or space-domain. The technique using polarization information to discriminate the target and false-target is discussed in this paper. With the difference that false-target signal vector's polarization ratio is fixed and target echo signal vector's polarization ratio is variational along with radar transmission signal's polarization, we transform the discrimination problem to beeline distinguish problem in the 2-dim complex space. The distributing characteristic expression of the false-target discrimination statistic is constructed, with which the discrimination ratio of false-target is analyzed. For the target case, the decomposed model of target scattering matrix and the concept of distinguish quantity are proposed. Then, the discrimination ratio of target can be forecasted according to target distinguish quantity. Thus, the performance of discrimination method has been analyzed integrally. The simulation results demonstrate the method in this paper is effective on the discrimination of target and false-target.

  3. Evolution with Drifting Targets

    CERN Document Server

    Kanade, Varun; Vaughan, Jennifer Wortman

    2010-01-01

    We consider the question of the stability of evolutionary algorithms to gradual changes, or drift, in the target concept. We define an algorithm to be resistant to drift if, for some inverse polynomial drift rate in the target function, it converges to accuracy 1 -- \\epsilon , with polynomial resources, and then stays within that accuracy indefinitely, except with probability \\epsilon , at any one time. We show that every evolution algorithm, in the sense of Valiant (2007; 2009), can be converted using the Correlational Query technique of Feldman (2008), into such a drift resistant algorithm. For certain evolutionary algorithms, such as for Boolean conjunctions, we give bounds on the rates of drift that they can resist. We develop some new evolution algorithms that are resistant to significant drift. In particular, we give an algorithm for evolving linear separators over the spherically symmetric distribution that is resistant to a drift rate of O(\\epsilon /n), and another algorithm over the more general prod...

  4. Physics of polarized targets

    CERN Document Server

    Niinikoski, Tapio

    2014-01-01

    For developing, building and operating solid polarized targets we need to understand several fields of physics that have seen sub stantial advances during the last 50 years. W e shall briefly review a selection of those that are important today. These are: 1) quantum statistical methods to describe saturation and relaxation in magnetic resonance; 2) equal spin temperature model for dy namic nuclear polarization; 3 ) weak saturation during NMR polarization measurement; 4 ) refrigeration using the quantum fluid properties of helium isotopes. These, combined with superconducting magnet technologies, permit today to reach nearly complete pola rization of almost any nuclear spins. Targets can be operated in frozen spin mode in rather low and inhomogeneous field of any orientation, and in DNP mode in beams of high intensity. Beyond such experiments of nuclear and particle physics, applications a re also emerging in macromolecular chemistry and in magnetic resonance imaging. This talk is a tribute to Michel Borghini...

  5. Autonomous Target Ranging Techniques

    DEFF Research Database (Denmark)

    Jørgensen, Peter Siegbjørn; Jørgensen, John Leif; Denver, Troelz;

    2003-01-01

    determination two ranging strategies are presented. One is an improved laser ranger with an effective range with non-cooperative targets of at least 10,000 km, demonstrated in ground tests. The accuracy of the laser ranging will be approximately 1 m. The laser ranger may furthermore be used for trajectory...... determination of nano-gravity probes, which will perform direct mass measurements of selected targets. The other is triangulation from two spacecraft. For this method it is important to distinguish between detection and tracking range, which will be different for Bering since different instruments are used for......For the deep space asteroid mission, Bering, the main goal is the detection and tracking of near Earth objects (NEOs) and asteroids. One of the key science instruments is the 0.3-m telescope used for imaging and tracking of the detected asteroidal objects. For efficient use of the observation time...

  6. Careful price level targeting

    OpenAIRE

    Waters , George A.

    2012-01-01

    This paper examines a class of interest rate rules that respond to public expectations and to lagged variables. Varying levels of commitment correspond to varying degrees of response to lagged output and targeting of the price level. If the response rises (unintentionally) above the optimal level, the outcome deteriorates severely. Hence, the optimal level of commitment is sensitive to the method of expectations formation and partial commitment is the robust, optimal policy.

  7. Targeting fragile X

    OpenAIRE

    Gantois, Ilse; Kooy, R. Frank

    2002-01-01

    Ten years after the identification of the gene responsible for fragile X syndrome, recent studies have revealed a list of mRNAs bound by the fragile X gene product and have identified specific sequences required for the interaction between the fragile X protein and its targets. These results are a breakthrough in understanding why absence of the fragile X protein leads to mental retardation.

  8. Association between Exposure to Benzodiazepines and Related Drugs and Survivorship of Total Hip Replacement in Arthritis: A Population-Based Cohort Study of 246,940 Patients.

    Directory of Open Access Journals (Sweden)

    Dan Beziz

    Full Text Available Total hip replacement (THR is successful in treating hip arthritis. Prosthetic survivorship may depend on the medications taken by the patient; particularly, the role of benzodiazepines and related drugs (Z-drugs with THR revision has been poorly investigated. Our objective was to compare THR short-term survivorship according to level of exposure to benzodiazepine and Z-drugs.All French patients aged 40 years or older, having undergone primary THR from January 1, 2009, through December 31, 2012, for arthritis according to French national health insurance databases were included in the cohort. Outcome of interest was THR revision, including any surgical procedure in which the implant or any component was changed or removed. Follow-up started the day the primary THR was performed. Observations were right-censored on December 31, 2014, if neither revision nor death had yet occurred. Exposure of interest was the cumulative defined daily doses per day (cDDD/day of benzodiazepines and Z-drugs dispensed within 6 months before or after inclusion. We defined four exposure groups; cDDD/d = 0: unexposed; 0.38: high exposure. THR survivorship was assessed according to level of exposure to benzodiazepines and Z-drugs in univariate and multivariate Cox models adjusted for patient, THR and implanting center characteristics.The study cohort comprised 246,940 individuals: mean age at baseline, 69.9 years; women, 57.9%; unexposed: 51.7%; low exposure: 16.7%; medium exposure: 15.9%; and high exposure: 15.7%. During the median 45-month follow-up, 9043 individuals underwent prosthetic revision. Adjusted hazard ratios in low, medium and high exposed groups were 1.18 (95%CI, 1.12-1.26; P<0.001, 1.32 (95%CI, 1.24-1.40; P<0.001 and 1.37 (95%CI, 1.29-1.45; P<0.001, respectively, compared to unexposed.Exposure to benzodiazepines and Z-drugs is associated with an increased risk of THR revision, with a dose-response relationship. Cautious prescribing might be needed as well

  9. Association between Exposure to Benzodiazepines and Related Drugs and Survivorship of Total Hip Replacement in Arthritis: A Population-Based Cohort Study of 246,940 Patients

    Science.gov (United States)

    Beziz, Dan; Colas, Sandrine; Collin, Cédric; Dray-Spira, Rosemary; Zureik, Mahmoud

    2016-01-01

    Background Total hip replacement (THR) is successful in treating hip arthritis. Prosthetic survivorship may depend on the medications taken by the patient; particularly, the role of benzodiazepines and related drugs (Z-drugs) with THR revision has been poorly investigated. Our objective was to compare THR short-term survivorship according to level of exposure to benzodiazepine and Z-drugs. Design, Setting and Participants All French patients aged 40 years or older, having undergone primary THR from January 1, 2009, through December 31, 2012, for arthritis according to French national health insurance databases were included in the cohort. Outcome of interest was THR revision, including any surgical procedure in which the implant or any component was changed or removed. Follow-up started the day the primary THR was performed. Observations were right-censored on December 31, 2014, if neither revision nor death had yet occurred. Exposure of interest was the cumulative defined daily doses per day (cDDD/day) of benzodiazepines and Z-drugs dispensed within 6 months before or after inclusion. We defined four exposure groups; cDDD/d = 0: unexposed; 0.38: high exposure. THR survivorship was assessed according to level of exposure to benzodiazepines and Z-drugs in univariate and multivariate Cox models adjusted for patient, THR and implanting center characteristics. Results The study cohort comprised 246,940 individuals: mean age at baseline, 69.9 years; women, 57.9%; unexposed: 51.7%; low exposure: 16.7%; medium exposure: 15.9%; and high exposure: 15.7%. During the median 45-month follow-up, 9043 individuals underwent prosthetic revision. Adjusted hazard ratios in low, medium and high exposed groups were 1.18 (95%CI, 1.12–1.26; P<0.001), 1.32 (95%CI, 1.24–1.40; P<0.001) and 1.37 (95%CI, 1.29–1.45; P<0.001), respectively, compared to unexposed. Conclusion and Relevance Exposure to benzodiazepines and Z-drugs is associated with an increased risk of THR revision, with a

  10. Luminescence properties and crystal structure of europium complexes with phenoxyacetic acid and 2,4,6-tri(2-pyridyl)-s-triazine

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ai-Ling; Zhou, Dan; Wei, Xiao-Yan; Wang, Zhong-Xia; Qu, Yan-Rong; Zhang, Hai-Xia; Chen, Ying-Nan; Li, Jing-Jing; Chu, Hai-Bin, E-mail: binghai99@gmail.com; Zhao, Yong-Liang, E-mail: hxzhaoyl@163.com

    2015-04-15

    Using anion ligand phenoxyacetic acid (HPOA) and neutral ligand 2,4,6-tri(2-pyridyl)-s-triazine (TPTZ), two complexes Eu{sub 2}(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O and EuY(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O have been synthesized and one crystal EuY(TPTZ){sub 2}(POA){sub 6}·2CH{sub 3}OH has been obtained. These complexes are characterized by elemental analysis, ICP-AES, IR and UV absorption spectroscopy. The luminescence spectra, luminescence lifetimes and emission quantum efficiencies of the complexes have been studied. The results show that the complex EuY(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O exhibits stronger luminescence intensity, longer luminescent lifetime and higher emission quantum efficiency than Eu{sub 2}(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O. The single-crystal X-ray diffraction of EuY(TPTZ){sub 2}(POA){sub 6}·2CH{sub 3}OH reveals that the crystal is heteronuclear and crystallizes in the triclinic space group P-1 with following unit cell parameters a=12.2411(10) Å, b=13.2294(11) Å, c=13.5232(11) Å, α=74.8596(13)°, β=82.9593(16)°, γ=87.1641(14)°, and V=2097.7(3) Å{sup 3}. Each metal ion coordinates with three nitrogen atoms of one TPTZ and seven oxygen atoms of three POA{sup −} ions. And there exist two coordination forms between POA{sup −} and metal ions in the crystal. One is chelating bidentate, the other is the single-atom bridge. - Highlights: • One Eu/Y heteronuclear crystal and two complexes with HPOA and TPTZ were prepared. • Each metal ion in the crystal coordinates with three nitrogen and seven oxygen atoms. • The two complexes exhibit strong luminescence emissions. • The heteronuclear complex shows better luminescent properties than the homonuclear one. • The structure of the crystal and the sensitization mechanism are deeply discussed.

  11. Dextran sulfate sodium and 2,4,6-trinitrobenzene sulfonic acid induce lipid peroxidation by the proliferation of intestinal gram-negative bacteria in mice

    Directory of Open Access Journals (Sweden)

    Hyun Yang-Jin

    2010-02-01

    Full Text Available Abstrect Background To understand whether TLR-4-linked NF-kB activation negatively correlates with lipid peroxidation in colitic animal models, we caused colitis by the treatment with dextran sulfate sodium (DSS or 2,4,6-trinitrobenzenesulfonic acid (TNBS to C3H/HeJ (TLR-4-defective and C3H/HeN (wild type mice, investigated inflammatory markers, lipid peroxidation, proinflammatory cytokines and TLR-4-linked NF-κB activation, in colon and intestinal bacterial composition in vivo. Methods Orally administered DSS and intrarectally injected TNBS all caused severe inflammation, manifested by shortened colons in both mice. These agents increased intestinal myeloperoxidase activity and the expression of the proinflammatory cytokines, IL-1β, TNF-α and IL-6, in the colon. Results DSS and TNBS induced the protein expression of TLR-4 and activated transcription factor NF-κB. However, these colitic agents did not express TLR-4 in C3H/HeJ mice. Of proinflammatory cytokines, IL-1β was most potently expressed in C3H/HeN mice. IL-1β potently induced NF-κB activation in CaCo-2 cells, but did not induce TLR-4 expression. DSS and TNBS increased lipid peroxide (malondialdehyde and 4-hydroxy-2-nonenal content in the colon, but reduced glutathione content and superoxide dismutase and catalase activities. These colitic inducers increased the number of Enterobacteriaceae grown in DHL agar plates in both mice, although the number of anaerobes and bifidobacteria grown in GAM and BL agar plates was reduced. E. coli, K. pneumoniae and Proteus mirabilis isolated in DHL agar plates increased lipid peroxidation in liposomes prepared by L-α-phosphatidylcholine, but B. animalis and B. cholerium isolated from BL agar plates inhibited it. Discussion These findings suggest that DSS and TNBS may cause colitis by inducing lipid peroxidation and enterobacterial proliferation, which may deteriorate the colitis by regulating proinflammatory cytokines via TLR-4-linked NF

  12. Inflation targeting and core inflation

    OpenAIRE

    Julie Smith

    2005-01-01

    This paper examines the interaction of core inflation and inflation targeting as a monetary policy regime. Interest in core inflation has grown because of inflation targeting. Core inflation is defined in numerous ways giving rise to many potential measures; this paper defines core inflation as the best forecaster of inflation. A cross-country study finds before the start of inflation targeting, but not after, core inflation differs between non-inflation targeters and inflation targeters. Thr...

  13. Targeted therapy for sarcomas

    Directory of Open Access Journals (Sweden)

    Forscher C

    2014-03-01

    Full Text Available Charles Forscher,1 Monica Mita,2 Robert Figlin3 1Sarcoma Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 2Experimental Therapeutics Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 3Academic Development Program, Samuel Oschin Comprehensive Cancer Institute, and Division of Hematology/Oncology, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: Sarcomas are tumors of mesenchymal origin that make up approximately 1% of human cancers. They may arise as primary tumors in either bone or soft tissue, with approximately 11,280 soft tissue tumors and 2,650 bone tumors diagnosed each year in the United States. There are at least 50 different subtypes of soft tissue sarcoma, with new ones described with ever-increasing frequency. One way to look at sarcomas is to divide them into categories on the basis of their genetic make-up. One group of sarcomas has an identifiable, relatively simple genetic signature, such as the X:18 translocation seen in synovial sarcoma or the 11:22 translocation seen in Ewing's sarcoma. These specific abnormalities often lead to the presence of fusion proteins, such as EWS-FLI1 in Ewing's sarcoma, which are helpful as diagnostic tools and may become therapeutic targets in the future. Another group of sarcomas is characterized by complex genetic abnormalities as seen in leiomyosarcoma, osteosarcoma, and undifferentiated sarcoma. It is important to keep these distinctions in mind when contemplating the development of targeted agents for sarcomas. Different abnormalities in sarcoma could be divided by tumor subtype or by the molecular or pathway abnormality. However, some existing drugs or drugs in development may interfere with or alter more than one of the presented pathways. Keywords: sarcoma, targeted agents, tyrosine kinase inhibitors, mTor inhibition

  14. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1511, LB4517_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1511, LB4517_V)' providing data from direct measurement of low-pressure thermodynamic speed of sound at variable mole fraction and constant temperature, in the single-phase region(s).

  15. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1212, LB4519_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1212, LB4519_V)' providing data by calculation of molar excess volume from low-pressure density measurements at variable mole fraction and constant temperature.

  16. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1111, LB4518_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1111, LB4518_V)' providing data from direct low-pressure measurement of mass density at variable mole fraction and constant temperature, in the single-phase region(s).

  17. Molecular interactions in (2,4,6-trimethyl-1,3,5-trioxane + n-alkyl acetates) at T = (298.15, 303.15, and 308.15) K

    Energy Technology Data Exchange (ETDEWEB)

    Wankhede, N.N. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India); Wankhede, D.S. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India); Lande, M.K. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India); Arbad, B.R. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India)]. E-mail: nil_w@rediffmail.com

    2006-12-15

    Densities and viscosities of the binary mixtures of 2,4,6-trimethyl-1,3,5-trioxane with methyl acetate, ethyl acetate, and 1-butyl acetate were measured over the entire mole fractions at (298.15, 303.15, and 308.15) K. Using the experimental values of densities {rho} and viscosities {eta}, excess molar volumes V {sup E}, viscosity deviations {delta}{eta} were calculated. The values of excess molar volumes V {sup E} and viscosity deviations {delta}{eta} were fitted to the Redlich-Kister polynomial.

  18. (E-N-[2-(9-Fluorenylidene-3a,5,7-trimethyl-3,3a-dihydro-2H-indol-3-ylidene]-2,4,6-trimethylaniline

    Directory of Open Access Journals (Sweden)

    Norihiro Tokitoh

    2008-02-01

    Full Text Available The title compound, C33H30N2, has an E configuration at the imine double bond. The angle between the least-squares planes of the imine C=N—C group and the benzene ring of the 2,4,6-trimethylphenyl substituent is 85.38 (11°. The crystal structure is sustained mainly by intermolecular π–π interactions (3.510 Å between the two fluorene rings and some C—H...π interactions.

  19. Synthesis of 1,3–bis(2,4,6–trimethylphenyl)–imidazolinium salts : SIMes.HCl, SIMes.HBr, SIMes.HBF4 and SIMes.HPF6.

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Arnaud Gautier, Federico Cisnetti, Silvia Díez-González & Clémentine Gibard ### Abstract N,N’–bis–(2,4,6–trimethylphenylamino)ethane dihydrobromide is obtained in a single step through the dialkylation of dibromoethane. It serves as a versatile starting material for the synthesis of imidazolium salts: SIMes.HBr, SIMes.HCl, SIMes.HPF6 and SIMes.HBF4. ### Introduction Azolium salts have become indispensable starting materials in N–heterocyclic carbene (NHC) chem...

  20. Synthesis of a new tripodal chemosensor based on 2,4,6-triethyl-1,3,5-trimethylbencene scaffolding bearing thiourea and fluorescein for the chromo-fluorogenic detection of anions

    OpenAIRE

    Moragues Pons, María Esperanza; Santos Figueroa, Luis Enrique; Abalos Aguado, Tatiana; Sancenón Galarza, Félix; Martínez Mañez, Ramón

    2012-01-01

    A tripodal receptor containing thiourea as binding site and fluorescein as signalling subunit has been designed, synthesized and used for the colorimetric detection of basic anions in DMSO solutions. (C) 2012 Elsevier Ltd. All rights reserved. Moragues Pons, ME.; Santos Figueroa, LE.; Abalos Aguado, T.; Sancenón Galarza, F.; Martínez Mañez, R. (2012). Synthesis of a new tripodal chemosensor based on 2,4,6-triethyl-1,3,5-trimethylbencene scaffolding bearing thiourea and fluorescein for the ...

  1. Conceptual design study of an accelerator-based actinide transmutation plant with sodium-cooled solid target/core

    International Nuclear Information System (INIS)

    Research and development works on accelerator-based nuclear waste transmutation are carried out at JAERI under the national program OMEGA. The preliminary design of the proposed minor actinide transmutation plant with a solid target/core is described. The plant consists of a high intensity proton accelerator, spallation target of solid tungsten, and subcritical core loaded with actinide alloy fuel. Minor actinides are transmuted by fast fission reactions. The target and core are cooled by the forced flow of liquid sodium coolant. Thermal energy is recovered to supply electricity to power its own accelerator. The core with an effective multiplication factor of about 0.9 generates. The thermal power of 820 MW by using a 1.5 GeV proton beam with a current of 39 mA. The average burnup is about 8%, about 250 kg of actinides, after one year operation at an 80% of load factor. With the conventional steam turbine cycle, electric output of about 246 MW is produced. The design of the transmutation plant with sodium-cooled solid target/core is mostly based on the well-established technology of current LMFRs. Advantages and disadvantages of solid target/core are discussed. Recent progress in the development of intense proton accelerator, the development of simulation code system, and the spallation integral experiment is also presented. (author)

  2. Low intensity beam target unit

    CERN Multimedia

    1976-01-01

    This is a wheel fitted with many targets around its periphery (each with three longitudinally arranged thin rods) of which one is placed into the beam via a rotation of the wheel. Upstream of each target is placed a luminescent screen, aligbed on each target axis and viewed with a TV camera, to make sure that one is hitting the target. This target unit was probably used to study target's behaviour (like beam heating). Gualtiero Del Torre stands on the left, Pierre Gerdil on the right.

  3. Target Housing Material Options

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    With gas cooling, heat transfer coefficients are low compared to water. The benefit of gas from a heat transfer point of view is that there is really no upper temperature limit for the coolant, as compared to water, which is limited ultimately by the critical point, and in practice the critical heat flux. In our case with parallel flow channels, water is limited to even lower operating limits by nucleate boiling. So gas can get as hot as the containment material will allow, but to get the density and heat transfer up to something reasonable, we must also increase pressure, thus increasing stress on the containment, namely the front and back faces. We are designing to ASME BPVC, which, for most materials allows a maximum stress of UTS/3. So we want the highest possible UTS. For reference, the front face stress in the 12 mm target at 300 psi was about 90 MPa. The inconel 718 allowable stress at 900°C is 1/3 of 517 or 172 MPa. So we are in a very safe place, but the uTS is dropping rapidly with temperature above 900°C. As we increase target diameter, the challenge will be to keep the stress down. We are probably looking at keeping the allowable at or above the present value, and at as high a temperature as possible.

  4. Some Issues in Inflation Targeting

    OpenAIRE

    Andrew Haldane

    1997-01-01

    This paper discusses some of the operational issues relevant to the implementation of an inflation-targeting regime. In particular it focuses on: whether inflation targeting is 'new'; whether (and how) the forward-looking nature of inflation-targeting helps to prevent instabilities in inflation; whether inflation-targeting potentially destabilises output; and whether it requires too much knowledge on the part of the authorities. The paper argues that none of these propositions is in general c...

  5. Targeting of Antibodies using Aptamers

    OpenAIRE

    Missailidis, Sotiris

    2003-01-01

    The chapter presents a methodology for the rapid selection of aptamers against antibody targets. It is a detailed account of the various methodological steps that describe the selection of aptamers, including PCR steps, buffers to be used, target immobilisation, partitioning and amplification of aptamers, clonning and sequencing, to results in high affinity and specificity ligands for the chosen target antibody.

  6. STRATEGIES (LEVELS) OF TARGET MARKET

    OpenAIRE

    Ramakrishna Mohan Rao Munaga

    2015-01-01

    Generally target marketing can be carried out in several different levels. They are Target-Market Strategies or Mass (Undifferentiated) Marketing: Choosing the Number of Markets to Target, Multi segment (Differentiated) Marketing, Concentrated Marketing or Niche Marketing, Micro Marketing or Single or Individual Marketing. Firms that compete in the global marketplace can use any combination of the segmenting strategies or none at all.

  7. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza;

    2012-01-01

    rheumatologists who have recently formed a research network - the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using...

  8. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza;

    2012-01-01

    rheumatologists who have recently formed a research network--the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using...

  9. Targets for heavy ion fusion

    International Nuclear Information System (INIS)

    This paper describes some of the basic principles of fusion target implosions, using some simple targets designed for irradiation by ion beams. Present estimates are that ion beams with 1-5 MJ, and 100-500 TW will be required to ignite high gain targets. (orig.)

  10. ORION laser target diagnostics

    International Nuclear Information System (INIS)

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  11. ORION laser target diagnosticsa)

    Science.gov (United States)

    Bentley, C. D.; Edwards, R. D.; Andrew, J. E.; James, S. F.; Gardner, M. D.; Comley, A. J.; Vaughan, K.; Horsfield, C. J.; Rubery, M. S.; Rothman, S. D.; Daykin, S.; Masoero, S. J.; Palmer, J. B.; Meadowcroft, A. L.; Williams, B. M.; Gumbrell, E. T.; Fyrth, J. D.; Brown, C. R. D.; Hill, M. P.; Oades, K.; Wright, M. J.; Hood, B. A.; Kemshall, P.

    2012-10-01

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  12. ORION laser target diagnostics.

    Science.gov (United States)

    Bentley, C D; Edwards, R D; Andrew, J E; James, S F; Gardner, M D; Comley, A J; Vaughan, K; Horsfield, C J; Rubery, M S; Rothman, S D; Daykin, S; Masoero, S J; Palmer, J B; Meadowcroft, A L; Williams, B M; Gumbrell, E T; Fyrth, J D; Brown, C R D; Hill, M P; Oades, K; Wright, M J; Hood, B A; Kemshall, P

    2012-10-01

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics. PMID:23126904

  13. Hypoxia targeting copper complexes

    International Nuclear Information System (INIS)

    The importance and incidence of tumour hypoxia, its measurement and current treatments available, including pharmacological and radiopharmacological methods of targeting hypoxia, are discussed. A variety of in vitro and in vivo methods for imposing hypoxia have been developed and are reviewed. Copper, its chemistry, biochemistry and radiochemistry, the potential for use of copper radionuclides and its use to date in this field is considered with particular reference to the thiosemicarbazones. Their biological activity, metal chelation, in vitro and in vivo studies of their radiocopper complexes and the potential for their use as hypoxia targeting radiopharmaceuticals is described. The reduction of the copper(II) complex to copper(l), its pivotal importance in their biological behaviour, and the potential for manipulation of this to effect hypoxia selectivity are described. An in vitro method for assessing the hypoxia selectivity of radiopharmaceuticals is reported. The rapid deoxygenation and high viability of a mammalian cell culture in this system is discussed and factors which may affect the cellular uptake of a radiopharmaceutical are described. The design, synthesis and complexation with copper and radiocopper of a range of bis(thiosemicarbazones) is reported. Synthesis of these compounds is simple giving high yields of pure products. The characteristics of the radiocopper complexes (64Cu) including lipophilicity and redox activity are reported (reduction potentials in the range -0.314 - -0.590 V). High cellular uptakes of the radiocopper complexes of the ligands, in hypoxic and normoxic EMT6 and CHO320 cells, were observed. Extremes of selectivity are shown ranging from the hypoxia selective 64Cu(II)ATSM to normoxic cell selective 64Cu(II)GTS. The selectivities observed are compared with the physico chemical characteristics of the complexes. A good correlation exists between selectivity of the complex and its Cu(II)/Cu(I) reduction potential, with hypoxia

  14. Hypoxia targeting copper complexes

    Energy Technology Data Exchange (ETDEWEB)

    Dearling, J.L

    1998-11-01

    The importance and incidence of tumour hypoxia, its measurement and current treatments available, including pharmacological and radiopharmacological methods of targeting hypoxia, are discussed. A variety of in vitro and in vivo methods for imposing hypoxia have been developed and are reviewed. Copper, its chemistry, biochemistry and radiochemistry, the potential for use of copper radionuclides and its use to date in this field is considered with particular reference to the thiosemicarbazones. Their biological activity, metal chelation, in vitro and in vivo studies of their radiocopper complexes and the potential for their use as hypoxia targeting radiopharmaceuticals is described. The reduction of the copper(II) complex to copper(l), its pivotal importance in their biological behaviour, and the potential for manipulation of this to effect hypoxia selectivity are described. An in vitro method for assessing the hypoxia selectivity of radiopharmaceuticals is reported. The rapid deoxygenation and high viability of a mammalian cell culture in this system is discussed and factors which may affect the cellular uptake of a radiopharmaceutical are described. The design, synthesis and complexation with copper and radiocopper of a range of bis(thiosemicarbazones) is reported. Synthesis of these compounds is simple giving high yields of pure products. The characteristics of the radiocopper complexes ({sup 64}Cu) including lipophilicity and redox activity are reported (reduction potentials in the range -0.314 - -0.590 V). High cellular uptakes of the radiocopper complexes of the ligands, in hypoxic and normoxic EMT6 and CHO320 cells, were observed. Extremes of selectivity are shown ranging from the hypoxia selective {sup 64}Cu(II)ATSM to normoxic cell selective {sup 64}Cu(II)GTS. The selectivities observed are compared with the physico chemical characteristics of the complexes. A good correlation exists between selectivity of the complex and its Cu(II)/Cu(I) reduction potential

  15. Molecularly targeted therapeutic radiopharmaceuticals

    International Nuclear Information System (INIS)

    Full text: It is generally agreed that current focus of nuclear medicine development should be on molecular imaging and therapy. Though, the widespread use of the terminology 'molecular imaging' is quite recent, nuclear medicine has used molecular imaging techniques for more than 20 years ago. A variety of radiopharmaceuticals have been introduced for the internal therapy of malignant and inflammatory lesions in nuclear medicine. In the field of bio/medical imaging, nuclear medicine is one of the disciplines which has the privilege of organized and well developed chemistry/ pharmacy section; radio-chemistry/radiopharmacy. Fundamental principles have been developed more than 40 years ago and advanced research is going well into postgenomic era. The genomic revolution and dramatically increased insight in the molecular mechanisms underlying pathology have led to paradigm shift in drug development. Likewise does in the nuclear medicine. Here, the author will present current clinical and pre-clinical therapeutic radiopharmaceuticals based on molecular targets such as membrane-bound receptors, enzymes, nucleic acids, sodium iodide symporter, etc, in correlation with fundamentals of radiopharmacy. (author)

  16. Magnetic targeted drug delivery

    Directory of Open Access Journals (Sweden)

    Timothy Wiedmann

    2009-10-01

    Full Text Available Lung cancer is the most common cause of death from cancer in both men and women. Treatment by intravenous or oral administration of chemotherapy agents results in serious and often treatment-limiting side effects. Delivery of drugs directly to the lung by inhalation of an aerosol holds the promise of achieving a higher concentration in the lung with lower blood levels. To further enhance the selective lung deposition, it may be possible to target deposition by using external magnetic fields to direct the delivery of drug coupled to magnetic particles. Moreover, alternating magnetic fields can be used to induce particle heating, which in turn controls the drug release rate with the appropriate thermal sensitive material.With this goal, superparamagetic nanoparticles (SPNP were prepared and characterized, and enhanced magnetic deposition was demonstrated in vitro and in vivo. SPNPs were also incorporated into a lipid-based/SPNP aerosol formulation, and drug release was shown to be controlled by thermal activation. Because of the inherent imaging potential of SPNPs, this use of nanotechnology offers the possibility of coupling the diagnosis of lung cancer to drug release, which perhaps will ultimately provide the “magic bullet” that Paul Ehrlich originally sought.

  17. ICF target positioning robot system

    International Nuclear Information System (INIS)

    Based on the function analysis of target positioner for inertial confinement fusion, a kind of ICF target positioning robot system is designed to realize the adjustment and the alignment of a target. The robot system includes a target storage sub-system, a target exchange subsystem, a target transport subsystem and a 6-degree of freedom precision parallel robot subsystem, the structure and principle of every subsystem are dissertated. The system realizes micro scale position by parallel structure which is in the front of the system, and has the advantages of low mass, high stiffness, small cone angle, small volume and high precision. The robot system can position a target into a very small micro scale scope around the center of the target chamber whose diameter is several meters, the precision of the position reaches micro scale. Motion parameter of the positioning robot system has been tested. Experiment proves that the robot system has realized precision target position and target exchange on the condition of vacuum. (authors)

  18. Windowless target: Design of the XT-ADS spallation target

    International Nuclear Information System (INIS)

    The design of the XT-ADS spallation target is performed within the European integrated project EUROTRANS (FP6 Contract FI6W-516520) that has started in April 2005. At the current status of the spallation target design process, the boundary conditions for the spallation target loop with respect to the XT-ADS performance requirements and the design of the subcritical core and primary system have been established. The next steps will concentrate on further development of the spallation target nozzle, the vacuum and spallation product confinement system and the pumping, LIDAR (LIght Detection And Ranging) and cooling system

  19. SRNL Development of Recovery Processes for Mark-18A Heavy Actinide Targets

    Energy Technology Data Exchange (ETDEWEB)

    Allender, Jeffrey S. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Bridges, Nicholas J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Loftin, Bradley M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Dunsmuir, Michael D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-07-14

    Savannah River National Laboratory (SRNL) and Oak Ridge National Laboratory (ORNL) are developing plans for the recovery of rare and unique isotopes contained within heavy-actinide target assemblies, specifically the Mark-18A. Mark-18A assemblies were irradiated in Savannah River Site (SRS) reactors in the 1970s under extremely high neutron-flux conditions and produced, virtually, the world's supply of plutonium-244, an isotope of key importance to high-precision actinide measurement and other scientific and nonproliferation uses; and curium highly enriched in heavy isotopes (e.g., curium-246 and curium-248). In 2015 and 2016, SRNL is pursuing tasks that would reduce program risk and budget requirements, including further characterization of unprocessed targets; engineering studies for the use of the SRNL Shielded Cells Facility (SCF) for recovery; and development of onsite and offsite shipping methods including a replacement for the heavy (70 ton) cask previously used for onsite transfer of irradiated items at SRS. A status update is provided for the characterization, including modeling using the Monte Carlo N-Particle Transport Code (MCNP); direct non-destructive assay measurements; and cask design.

  20. Facility target insert shielding assessment

    Energy Technology Data Exchange (ETDEWEB)

    Mocko, Michal [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-06

    Main objective of this report is to assess the basic shielding requirements for the vertical target insert and retrieval port. We used the baseline design for the vertical target insert in our calculations. The insert sits in the 12”-diameter cylindrical shaft extending from the service alley in the top floor of the facility all the way down to the target location. The target retrieval mechanism is a long rod with the target assembly attached and running the entire length of the vertical shaft. The insert also houses the helium cooling supply and return lines each with 2” diameter. In the present study we focused on calculating the neutron and photon dose rate fields on top of the target insert/retrieval mechanism in the service alley. Additionally, we studied a few prototypical configurations of the shielding layers in the vertical insert as well as on the top.

  1. Oxide Fiber Targets at ISOLDE

    CERN Document Server

    Köster, U; Carminati, D; Catherall, R; Cederkäll, J; Correia, J G; Crepieux, B; Dietrich, M; Elder, K; Fedosseev, V; Fraile-Prieto, L M; Franchoo, S; Fynbo, H O U; Georg, U; Giles, T; Joinet, A; Jonsson, O C; Kirchner, R; Lau, C; Lettry, Jacques; Maier, H J; Mishin, V I; Oinonen, M; Peräjärvi, K; Ravn, H L; Rinaldi, T; Santana-Leitner, M; Wahl, U; Weissman, L

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxyde fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some contact points. The experience with various oxyde fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process or by burning commercial gas lantern mantle cloth. In the future a beryllia fiber target could be used to produce...

  2. The OLYMPUS Internal Hydrogen Target

    CERN Document Server

    Bernauer, J C; Ciullo, G; Henderson, B S; Ihloff, E; Kelsey, J; Lenisa, P; Milner, R; Schmidt, A; Statera, M

    2014-01-01

    An internal hydrogen target system was developed for the OLYMPUS experiment at DESY, in Hamburg, Germany. The target consisted of a long, thin-walled, tubular cell within an aluminum scattering chamber. Hydrogen entered at the center of the cell and exited through the ends, where it was removed from the beamline by a multistage pumping system. A cryogenic coldhead cooled the target cell to counteract heating from the beam and increase the density of hydrogen in the target. A fixed collimator protected the cell from synchrotron radiation and the beam halo. A series of wakefield suppressors reduced heating from beam wakefields. The target system was installed within the DORIS storage ring and was successfully operated during the course of the OLYMPUS experiment in 2012. Information on the design, fabrication, and performance of the target system is reported.

  3. Target support for inertial confinement fusion

    International Nuclear Information System (INIS)

    General Atomics (GA) plays an important industrial support role for the US Inertial Confinement Fusion (ICF) program in the area of target technology. This includes three major activities: target fabrication support, target handling systems development, and target chamber design. The work includes target fabrication for existing ICF experiments, target and target system development for future experiments, and target research and target chamber design for experiments on future machines, such as the National Ignition Facility (NIF)

  4. Target properties and nuclear data

    International Nuclear Information System (INIS)

    The influence of the properties of the target on nuclear data was shown. In the case of targets consisting of fissionable material, this influence was demonstrated in experiments involving fission cross-section, average number of neutrons, and prompt fission neutron spectrum. The experimental methods for determining certain corrections were analysed. The method of tritium density determination for a solid target used as neutron source was likewise demonstrated. (author). 10 refs, 4 figs

  5. 'Inflation Targeting and Inflation Persistence'

    OpenAIRE

    George J. Bratsiotis; Jakob Madsen; Christopher Martin

    2015-01-01

    This paper argues that the adoption of an inflation target reduces the persistence of inflation. We develop the theoretical literature on inflation persistence by introducing a Taylor rule for monetary policy into a model of persistence and showing that inflation targets reduce inflation persistence. We investigate changes in the time series properties of inflation in seven countries that introduced inflation targets in the late 1980s or early 1990s. We find that the persistenc...

  6. Learning About Intervention Target Zones

    OpenAIRE

    Michael W. Klein; Karen K. Lewis

    1991-01-01

    This paper provides a framework for evaluating how market participants' beliefs about foreign exchange target zones change as they learn about central bank intervention policy. In order to examine this behavior, we first generalize the standard target zone model to allow for intra-marginal intervention. Intra-marginal intervention implies that the position of market participants' beliefs about the target zone can be determined from their beliefs about the likelihood of intervention. As an app...

  7. Target repurposing for neglected diseases

    OpenAIRE

    Pollastri, Michael P.; Campbell, Robert K.

    2011-01-01

    Infectious diseases are an enormous burden to global health and since drug discovery is costly, those infectious diseases that affect the developing world are often not pursued by commercial drug-discovery efforts. Therefore, pragmatic means by which new therapeutics can be discovered are needed. One such approach is target repurposing, where pathogen targets are matched with homologous human targets that have been pursued for drug discovery for other indications. In many cases, the medicinal...

  8. Targeting Nominal Income: A Note

    OpenAIRE

    Kenneth D. West

    1986-01-01

    This paper compares nominal income and monetary targets in a standard aggregate demand - aggregate supply framework. If the desirability of policies is measured by their effect on the unconditional variance of output, nominal income targeting is preferable if and only if the aggregate elasticity of demand for real balances is greater than one. This is precisely the opposite of the condition that in Bean (1984) is sufficient to make nominal income targeting preferable.This points out the impor...

  9. Nominal Income and Inflation Targeting

    OpenAIRE

    Arayssi, Mahmoud

    2014-01-01

    In this paper a macro- economic model in the area of monetary policy game theory is extended to one-sided dismissal rules concerning observed nominal output and inflation targets for the central banker. These rules specify firing the central banker if some observed policy targets have been exceeded. Such rules are shown to reduce inflationary bias if the central banker perceives her reappointment chances as being strong and is preferred to discretionary monetary policy. Various policy targets...

  10. The Bering Target Tracking Instrumentation

    OpenAIRE

    Denver, Troelz; Jørgensen, John Leif; Betto, Maurizio; Jørgensen, Peter Siegbjørn

    2003-01-01

    The key science instrument on the Bering satellite mission is a relative small telescope with an entrance aperture of 300 mm and a focal length between 500 and 1000 mm. The detection of potential targets is performed by one of the target scanning advanced stellar compasses (ASCs). This procedure results in a simple prioritized list of right ascension, declination, proper motion and intensity of each prospective target. The telescope itself has a dedicated ASC Camera Head Unit (CHU) mounted on...

  11. Inertial-confinement-fusion targets

    International Nuclear Information System (INIS)

    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques have been devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented

  12. Limits of Inflation Targeting Strategy

    Directory of Open Access Journals (Sweden)

    Aura Niculescu

    2006-03-01

    Full Text Available This paper evaluates the trade-off between output volatility and the variability of the inflation rate around its target (Romanian case. The optimal choice for National Bank of Romania (NBR, in our opinion, is the flexible inflation targeting. For this purpose, NBR must explain the loss function and the optimal monetary policy rule. We then argued that this Romanian authority – NBR – can substantially improve its credibility under inflation targeting policy regime by becoming more accountable and transparent. Is the direct inflation targeting the best choice for the monetary policy regime in Romanian economy?

  13. Targeted Therapies for Kidney Cancer

    Science.gov (United States)

    ... for kidney cancer Targeted therapies for kidney cancer Biologic therapy (immunotherapy) for kidney cancer Chemotherapy for kidney cancer Pain control for kidney cancer Treatment choices by stage for ...

  14. The Bering Target Tracking Instrumentation

    DEFF Research Database (Denmark)

    Denver, Troelz; Jørgensen, John Leif; Betto, Maurizio; Jørgensen, Peter Siegbjørn

    2003-01-01

    's pointing direction. To achieve fast tracking over a large solid angle, the telescope pointing is achieved by means of a folding mirror in the optical pathway. When a prospective target approaches the telescope FOV, the ASC on the secondary will guide the folding mirror into position such that the target is...... inside the telescope FOV. During the telescope observation time, the ASC will constantly control the folding mirror to correctly position the target at the center of the telescope, basically performing a standard telescope tracking service. The telescope will alter the initial target acquisition track...

  15. Therapeutic Targeting of Telomerase.

    Science.gov (United States)

    Jäger, Kathrin; Walter, Michael

    2016-01-01

    Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT), which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination methods, and

  16. Therapeutic Targeting of Telomerase

    Science.gov (United States)

    Jäger, Kathrin; Walter, Michael

    2016-01-01

    Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT), which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination methods, and

  17. Therapeutic Targeting of Telomerase

    Directory of Open Access Journals (Sweden)

    Kathrin Jäger

    2016-07-01

    Full Text Available Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT, which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination

  18. Associations Between Target Lesion Restenosis and Drug-Eluting Balloon Use: An Observational Study.

    Science.gov (United States)

    Lee, Wei-Chieh; Wu, Chiung-Jen; Chen, Yung-Lung; Chung, Wen-Jung; Hsueh, Shu-Kai; Hang, Chi-Ling; Fang, Chih-Yuan; Fang, Hsiu-Yu

    2016-01-01

    Percutaneous coronary interventions (PCIs) with drug-eluting balloons (DEBs) have emerged as an adjunctive treatment for in-stent restenosis (ISR) lesions. However, recurrent restenosis still occurs following DEB use. Our study aimed to identify the associations of target lesion restenosis following DEB use over a 1-year clinical follow-up.Between November 2011 and May 2014, 246 patients were diagnosed with coronary artery ISR in our hospital. A total of 335 coronary ISR lesions were treated with DEBs. The 1-year patent coronary artery group was defined as those with negative noninvasive examinations and no clinical symptoms, or those with no angiographic restenosis. The 1-year current restenosis group was defined as those with angiographic restenosis. Clinical results were compared between 2 groups. Univariate and multivariate cox regression analyses were performed to identify the associations of target lesion restenosis following DEB use.Patients' average age was 64.96 ± 10.68 years, and 77.2% were men. Non-ST segment elevation myocardial infarction was more frequent as the clinical presentation in the 1-year current restenosis group, whereas stable angina was more frequent in the 1-year patent coronary artery group. The 1-year current restenosis group exhibited higher percentages of comorbidities, including hypertension, diabetes, prior myocardial infarction, heart failure, prior coronary artery bypass grafting, and end-stage renal disease (ESRD). Regardless of ostial ISR or nonostial ISR, the results of drug-eluting stent ISR were worse than those for bare-metal stent ISR. Multivariate analysis revealed that ESRD, and coronary ostial lesion, and the severity of pre-PCI stenosis were independently associated with target lesion restenosis following DEB use (P = 0.020, P = 0.009, P = 0.026, respectively).ESRD, and coronary ostial lesion, and the severity of pre-PCI stenosis were independently associated with recurrent target lesion restenosis

  19. Bis[1,3-bis(2,4,6-trimethylphenyl-2,3-dihydro-1H-imidazol-2-ylidene]dinitrosyl(tetrahydroborato-κ2H,H′tungsten(0

    Directory of Open Access Journals (Sweden)

    Heinz Berke

    2011-01-01

    Full Text Available In the title paramagnetic 19-electron neutral complex, [W(BH4(C21H24N22(NO2], the W(0 atom is coordinated by two 1,3-bis(2,4,6-trimethylphenylimidazol-2-ylidene (IMes carbene ligands, two NO groups and two H atoms of an η2-tetrahydroborate ligand. Depending on the number of coordination sites (n assigned to the BH4− ligand, the coordination geometry of the W atom may either be described as approximately trigonal–bipyramidal (n = 1 or as very distorted octahedral with the bridging H atoms filling two coordination positions (n = 2. In the latter case, the coplanar NO groups and bridging H atoms (r.m.s. deviation = 0.032 Å form one octahedral plane, with mutually trans-oriented carbene ligands. In the crystal, molecules are connected via C—H...O interactions.

  20. Binding of 2'(3')-O-(2,4-6-trinitrophenyl) ADP to soluble alpha beta protomers of Na, K-ATPase modified with fluorescein isothiocyanate. Evidence for two distinct nucleotide sites.

    Science.gov (United States)

    Ward, D G; Cavieres, J D

    1996-05-24

    The overall reaction of well-defined solubilized protomers of Na,K-ATPase (one alpha plus one beta subunit) retains the dual ATP dependence observed with the membrane-bound enzyme, with distinctive ATP effects in the submicromolar and submillimolar ranges (Ward, D. G., and Cavieres, J. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5332-5336). We have now found that the K+/-phosphatase activity of the alpha beta protomers is still inhibited by 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-diphosphate (TNP-ADP). What is most significant is that the TNP-ADP effect can be observed clearly with protomeric enzyme whose high affinity ATP site has been blocked covalently with fluorescein isothiocyanate. We conclude that nucleotides can bind at two discrete sites in each protomeric unit of Na,K-ATPase. PMID:8647832

  1. Localization of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) in poplar and switchgrass plants using phosphor imager autoradiography

    International Nuclear Information System (INIS)

    Phosphor imager autoradiography is a technique for rapid, sensitive analysis of the localization of xenobiotics in plant tissues. Use of this technique is relatively new to research in the field of plant science, and the potential for enhancing visualization and understanding of plant uptake and transport of xenobiotics remains largely untapped. Phosphor imager autoradiography is used to investigate the uptake and translocation of the explosives 1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene within Populus deltoides x nigra DN34 (poplar) and Panicum vigratum Alamo (switchgrass). In both plant types, TNT and/or TNT-metabolites remain predominantly in root tissues while RDX and/or RDX-metabolites are readily translocated to leaf tissues. Phosphor imager autoradiography is further investigated for use in semi-quantitative analysis of uptake of TNT by switchgrass. - Phosphor imager autoradiography allows for rapid localization and quantification of RDX, TNT, and/or metabolites in plant tissues.

  2. Group separation of transplutonium and rare earth elements by liquid chromatography with free stationary phase using 2,4,6-tris[ditolylphosphoryl] - 1,3,5 - triazine as extractant

    International Nuclear Information System (INIS)

    Methods of group separation of trace amounts of transplutonium elements (TPE) and weight amounts of rare earth elements (REE) in the systems on the basis of bifunctional neutral organophosphoric compounds by the method of liquid chromatography with a free stationary phase have been developed. When solution of 2,4,6 - tris[ditolylphosphoryl] - 1,3,5 - triazine in chloroform was used as stationary phase, REE were the first to be washed out by 0.5 mol/l NH4SCN-1 mol/l HCl solution, then TPE - by 0.025 mol/l of oxyethylidenediphosphonic acid in water. the fractions contained about 100% of one of the groups without impurity of the other. 7 refs.; 6 figs

  3. Radiopharmaceuticals targeting melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Pham, T.Q.; Berghofer, P.; Liu, X.; Greguric, I.; Dikic, B.; Ballantyne, P.; Mattner, F.; Nguyen, V.; Loc' h, C.; Katsifis, A. [Radiopharmaceuticals Research Institute, Australian Nuclear Science and Technology Organisation, Menai, N.S.W., Sydney (Australia)

    2008-02-15

    Melanoma is one of the most aggressive cancers known with a high rate of mortality and increasing global incidence. So, the development of radiopharmaceuticals for either diagnostic or therapeutic purposes could make enormous contributions to melanoma patient health care. We have been studying melanoma tumours through several targeting mechanisms including melanin or specific receptor based radiopharmaceuticals Structure activity studies indicate that the substitution patterns on radioiodinated benzamides significantly influence the uptake mechanism from melanin to sigma-receptor binding. Furthermore, the position of the iodine as well as the presence of key functional groups and substituents has resulted in compounds with varying degrees of activity uptake and retention in tumours. From these results, a novel molecule 2-(2-(4-(4-iodo benzyl)piperazin-1-yl)-2-oxo-ethyl)isoindoline- 1,3-dione (M.E.L.037) was synthesized, labelled with iodine-123 and evaluated for application in melanoma tumour scintigraphy and radiotherapy. The tumour imaging potential of {sup 123}IM.E.L.037 was studied in vivo in C.57 B.L./ 6 J female mice bearing the B.16 F.0. murine melanoma tumour and in BALB/c nude mice bearing the A.375 human amelanotic melanoma tumour by biodistribution, competition studies and by SPECT imaging. {sup 123}I-M.E.L.037 exhibited high and rapid uptake in the B.16 F.0 melanoma tumour at 1 h (13 % I.D./g) increasing with time to reach 25 % I.D./g at 6 h. A significant uptake was also observed in the eyes (2% I.D., at 3-6 h p.i.) of black mice. No uptake was observed in the tumour or in the eyes of nude mice bearing the A.375 tumour. Due to high uptake and long retention in the tumour and rapid body clearance, standardized uptake values(S.U.V.) of {sup 123}I-M.E.L.037 were 30 and 60, at 24 and 48 h p.i.,respectively. SPECT imaging of mice bearing the B.16 melanoma indicated the radioactivity was predominately located in the tumour followed by the eyes, while no

  4. LAMPF polarized 13C targets

    International Nuclear Information System (INIS)

    Ethylene glycol, 1-butanol, and toluene highly enriched in 13C have been used at LAMPF to produce dynamically polarized 13C targets for scattering experiments with protons and pions. Preparation of the materials and characteristic properties of these targets are described. 17 refs., 1 fig

  5. High performance inertial fusion targets

    International Nuclear Information System (INIS)

    Inertial confinement fusion (ICF) target designs are considered which may have very high gains (approximately 1000) and low power requirements (< 100 TW) for input energies of approximately one megajoule. These include targets having very low density shells, ultra thin shells, central ignitors, magnetic insulation, and non-ablative acceleration

  6. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Aletaha, Daniel; Bijlsma, Johannes W J;

    2010-01-01

    BACKGROUND: Aiming at therapeutic targets has reduced the risk of organ failure in many diseases such as diabetes or hypertension. Such targets have not been defined for rheumatoid arthritis (RA). OBJECTIVE: /st> To develop recommendations for achieving optimal therapeutic outcomes in RA. METHODS...

  7. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Breedveld, Ferdinand C; Burmester, Gerd R;

    2016-01-01

    BACKGROUND: Reaching the therapeutic target of remission or low-disease activity has improved outcomes in patients with rheumatoid arthritis (RA) significantly. The treat-to-target recommendations, formulated in 2010, have provided a basis for implementation of a strategic approach towards this...

  8. Targeted anti-cancerous therapies

    International Nuclear Information System (INIS)

    Crowning decades of efforts in fundamental and applied research, the first generation of targeted anti cancerous drugs is now on the market. Drugs coming from a new approach, conceived from molecular knowledge of cancer and directed against beforehand identified targets. In theory: a miracle of precision and technical success. In practice: a new sources of questions and new problems. (N.C.)

  9. Target recognition by wavelet transform

    CERN Document Server

    Li Zheng Dong; He Wu Liang; Pei Chun Lan; Peng Wen; SongChen; Zheng Xiao Dong

    2002-01-01

    Wavelet transform has an important character of multi-resolution power, which presents pyramid structure, and this character coincides the way by which people distinguish object from coarse to fineness and from large to tiny. In addition to it, wavelet transform benefits to reducing image noise, simplifying calculation, and embodying target image characteristic point. A method of target recognition by wavelet transform is provided

  10. High-Purity Chromium Targets

    OpenAIRE

    Rudoy, A.; Milman, Yu.; Korzhova, N.

    1995-01-01

    A procedure for producing large-scale chromium ingots by means of induction-arc melting was developed. From the high-purity, low-alloyed chromium ingots obtained, chromium targets were produced by of thermoplastic treatment techniques. The method of electron-beam evaporation of high-purity chromium was also used for production of targets.

  11. Nominal GDP: Target or Benchmark?

    OpenAIRE

    Hetzel, Robert L.

    2015-01-01

    Some observers have argued that the Federal Reserve would best fulfill its mandate by adopting a target for nominal gross domestic product (GDP). Insights from the monetarist tradition suggest that nominal GDP targeting could be destabilizing. However, adopting benchmarks for both nominal and real GDP could offer useful information about when monetary policy is too tight or too loose.

  12. Target recognition by wavelet transform

    International Nuclear Information System (INIS)

    Wavelet transform has an important character of multi-resolution power, which presents pyramid structure, and this character coincides the way by which people distinguish object from coarse to fineness and from large to tiny. In addition to it, wavelet transform benefits to reducing image noise, simplifying calculation, and embodying target image characteristic point. A method of target recognition by wavelet transform is provided

  13. ISOLDE target zone control room

    CERN Multimedia

    2016-01-01

    Operating the ISOLDE target handling robots from the dedicated control room in building 197. Monitors showing the movements of the robots (GPS in this case) in the target zone. The footage shows the actual operation by the operator as well as the different equipment such as camera electronics, camera motor controls, camera monitors and Kuka robot controls touch panel.

  14. Quasi-monoenergetic neutron energy spectra for 246 and 389 MeV {sup 7}Li(p,n) reactions at angles from 0{sup o} to 30{sup o}

    Energy Technology Data Exchange (ETDEWEB)

    Iwamoto, Yosuke, E-mail: iwamoto.yosuke@jaea.go.j [Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai, Naka, Ibaraki 319-1195 (Japan); Hagiwara, Masayuki [High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Satoh, Daiki [Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai, Naka, Ibaraki 319-1195 (Japan); Iwase, Hiroshi [High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Yashima, Hiroshi [Research Reactor Institute, Kyoto University, 2-1010 Asashiro-nishi, Kumatori-cho, Sennnan-gun, Osaka 590-0494 (Japan); Itoga, Toshiro [RIKEN, 1-1-1 Kouto, Sayo-cho, Sayo-gun, Hyogo 679-5148 (Japan); Sato, Tatsuhiko; Nakane, Yoshihiro; Nakashima, Hiroshi; Sakamoto, Yukio [Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai, Naka, Ibaraki 319-1195 (Japan); Matsumoto, Tetsuro; Masuda, Akihiko; Nishiyama, Jun [National Institute of Advanced Industrial Science and Technology, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8561 (Japan); Tamii, Atsushi; Hatanaka, Kichiji [Research Center for Nuclear Physics (RCNP), 10-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); Theis, C.; Feldbaumer, E.; Jaegerhofer, L. [CERN, CH-1211 Geneve 23 (Switzerland); Pioch, C.; Mares, V. [German Research Center for Environmental Health, Institute of Radiation Protection, Ingolstaedter Landstr. 1, 85764 Neuherberg (Germany)

    2011-02-11

    The authors measured the neutron energy spectra of a quasi-monoenergetic {sup 7}Li(p,n) neutron source with 246 and 389 MeV protons set at seven angles (0{sup o}, 2.5{sup o}, 5{sup o}, 10{sup o}, 15{sup o}, 20{sup o} and 30{sup o}), using a time-of-flight (TOF) method employing organic scintillators NE213 at the Research Center for Nuclear Physics (RCNP) of Osaka University. The energy spectra of the source neutrons were precisely deduced down to 2 MeV at 0{sup o} and 10 MeV at other angles. The cross-sections of the peak neutron production reaction at 0{sup o} were on the 35-40 mb line of other experimental data, and the peak neutron angular distribution agreed well with the Taddeucci formula. Neutron energy spectra below 100 MeV at all angles were comparable, but the shapes of the continuum above 150 MeV changed considerably with the angle. In order to consider the correction required to derive the response in the peak region from the measured total response for high-energy neutron monitors such as DARWIN and Wendi-2, the authors showed the subtractions of H*(10) obtained at larger angles (10{sup o}, 15{sup o}, 20{sup o} and 30{sup o}) from the 0{sup o} data in the continuum part for the 246 and 389 MeV {sup 7}Li(p,n) reactions. It was found that subtracting the dose equivalent at about 20{sup o} from the 0{sup o} data almost eliminates the continuum component. This method has potential to eliminate problems associated with continuum correction for high-energy neutron monitors.

  15. The proteome targets of intracellular targeting antimicrobial peptides.

    Science.gov (United States)

    Shah, Pramod; Hsiao, Felix Shih-Hsiang; Ho, Yu-Hsuan; Chen, Chien-Sheng

    2016-04-01

    Antimicrobial peptides have been considered well-deserving candidates to fight the battle against microorganisms due to their broad-spectrum antimicrobial activities. Several studies have suggested that membrane disruption is the basic mechanism of AMPs that leads to killing or inhibiting microorganisms. Also, AMPs have been reported to interact with macromolecules inside the microbial cells such as nucleic acids (DNA/RNA), protein synthesis, essential enzymes, membrane septum formation and cell wall synthesis. Proteins are associated with many intracellular mechanisms of cells, thus protein targets may be specifically involved in mechanisms of action of AMPs. AMPs like pyrrhocoricin, drosocin, apidecin and Bac 7 are documented to have protein targets, DnaK and GroEL. Moreover, the intracellular targeting AMPs are reported to influence more than one protein targets inside the cell, suggesting for the multiple modes of actions. This complex mechanism of intracellular targeting AMPs makes them more difficult for the development of resistance. Herein, we have summarized the current status of AMPs in terms of their mode of actions, entry to cytoplasm and inhibition of macromolecules. To reveal the mechanism of action, we have focused on AMPs with intracellular protein targets. We have also included the use of high-throughput proteome microarray to determine the unidentified AMP protein targets in this review. PMID:26648572

  16. Oxide fiber targets at ISOLDE

    DEFF Research Database (Denmark)

    Köster, U.; Bergmann, U.C.; Carminati, D.; Catherall, R.; Cederkäll, J.; Correia, J.G.; Crepieux, B.; Dietrich, M.; Elder, K.; Fedoseyev, V.N.; Fraile, L.; Franchoo, S.; Fynbo, Hans Otto Uldall; Georg, U.; Giles, T.; Joinet, A.; Jonsson, Olle; Lau, Ch.; Lettry, J.; Oinonen, M.; Peräjärvi, K.; Ravn, H.L.; Rinaldi, T.; Santana-Leitner, M.; Weissman, L.; Mishin, V.I.; Kirchner, R.; Maier, H.J.; Wahl, U.; Rinaldi Barkat, Tania

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxide fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some...... contact points. The experience with various oxide fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils......, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process...

  17. Target-Searching on Percolation

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    We study target-searching processes on a percolation, on which a hunter tracks a target by smelling odors it emits. The odor intensity is supposed to be inversely proportional to the distance it propagates. The Monte Carlo simulation is performed on a 2-dimensional bond-percolation above the threshold. Having no idea of the location of the target, the hunter determines its moves only by random attempts in each direction. For lager percolation connectivity p (>~) 0.90, it reveals a scaling law for the searching time versus the distance to the position of the target. The scaling exponent is dependent on the sensitivity of the hunter. For smaller p, the scaling law is broken and the probability of finding out the target significantly reduces. The hunter seems trapped in the cluster of the percolation and can hardly reach the goal.

  18. Target animacy influences gorilla handedness.

    Science.gov (United States)

    Forrester, Gillian S; Leavens, David A; Quaresmini, Caterina; Vallortigara, Giorgio

    2011-11-01

    We investigated the unimanual actions of a biological family group of twelve western lowland gorillas (Gorilla gorilla gorilla) using a methodological approach designed to assess behavior within social context from a bottom-up perspective. Measures of both the lateralization of unimanual actions (left, right) and the target of the action (animate, inanimate) were assessed during dual, synchronized video observations of naturalistic behavior. This paper demonstrates a corelationship between handedness and the animate quality of the target object. Analyses demonstrated a significant interaction between lateralized unimanual actions and target animacy and a right-hand bias for actions directed toward inanimate targets. We suggest that lateralized motor preference reflects the different processing capabilities of the left and right hemispheres, as influenced by the emotive (animate) and/or functional (inanimate) characteristics of the target, respectively. PMID:21562817

  19. Structural and Catalytic Differences between Two FADH2-Dependent Monooxygenases: 2,4,5-TCP 4-Monooxygenase (TftD from Burkholderia cepacia AC1100 and 2,4,6-TCP 4-Monooxygenase (TcpA from Cupriavidus necator JMP134

    Directory of Open Access Journals (Sweden)

    ChulHee Kang

    2012-08-01

    Full Text Available 2,4,5-TCP 4-monooxygenase (TftD and 2,4,6-TCP 4-monooxygenase (TcpA have been discovered in the biodegradation of 2,4,5-trichlorophenol (2,4,5-TCP and 2,4,6-trichlorophenol (2,4,6-TCP. TcpA and TftD belong to the reduced flavin adenine dinucleotide (FADH2-dependent monooxygenases and both use 2,4,6-TCP as a substrate; however, the two enzymes produce different end products. TftD catalyzes a typical monooxygenase reaction, while TcpA catalyzes a typical monooxygenase reaction followed by a hydrolytic dechlorination. We have previously reported the 3D structure of TftD and confirmed the catalytic residue, His289. Here we have determined the crystal structure of TcpA and investigated the apparent differences in specificity and catalysis between these two closely related monooxygenases through structural comparison. Our computational docking results suggest that Ala293 in TcpA (Ile292 in TftD is possibly responsible for the differences in substrate specificity between the two monooxygenases. We have also identified that Arg101 in TcpA could provide inductive effects/charge stabilization during hydrolytic dechlorination. The collective information provides a fundamental understanding of the catalytic reaction mechanism and the parameters for substrate specificity. The information may provide guidance for designing bioremediation strategies for polychlorophenols, a major group of environmental pollutants.

  20. Preparation of thin nuclear targets

    International Nuclear Information System (INIS)

    Thin film backings, sources and targets are needed for many applications in low energy nuclear physics and nuclear chemistry experiments. A survey of techniques used in the preparation of nuclear targets is first briefly discussed. These are classified as chemical, mechanical and physical preparations. Vacuum evaporation, being the most generally used technique, is discussed in detail. It is highly desirable to monitor the film thickness and control the deposition rate during evaporation and to measure the final target thickness after deposition has concluded. The relative merits of various thickness measuring techniques are described. Stages in the fabrication and mounting of self-supporting foils are described in detail, with emphasis given to the preparation of thin self-supporting carbon foils used as target backings and stripper foils. Various target backings, and the merits of the more generally used release agents are described in detail. The preparations of more difficult elemental targets are discussed, and a comprehensive list of the common targets is presented

  1. Tracking Target and Spiral Waves

    DEFF Research Database (Denmark)

    Jensen, Flemming G.; Sporring, Jon; Nielsen, Mads;

    2002-01-01

    A new algorithm for analyzing the evolution of patterns of spiral and target waves in large aspect ratio chemical systems is introduced. The algorithm does not depend on finding the spiral tip but locates the center of the pattern by a new concept, called the spiral focus, which is defined...... by the evolutes of the actual spiral or target wave. With the use of Gaussian smoothing, a robust method is developed that permits the identification of targets and spirals foci independently of the wave profile. Examples of an analysis of long image sequences from experiments with the Belousov...

  2. Mycothiol: a promising antitubercular target.

    Science.gov (United States)

    Nilewar, S S; Kathiravan, M K

    2014-02-01

    Tuberculosis (TB) is the world's second commonest cause of death next to HIV/AIDS. The increasing emergence of multi drug resistance and the recalcitrant nature of persistent infections pose an additional challenge for the treatment of TB. Due to the development of resistance to conventional antibiotics there is a need for new therapeutic strategies to combat M. tuberculosis. One such target is Mycothiol (MSH), a major low molecular-mass thiol in mycobacteria, an important cellular anti-oxidant. MSH is present only in actinomycetes and hence is a good target. This review explores mycothiol as a potential target against tuberculosis and various research ongoing worldwide. PMID:24368170

  3. Development of targeted radiotherapy systems

    International Nuclear Information System (INIS)

    Conventional or external beam radiotherapy, has been a viable alternative for cancer treatment. Although this technique is effective, its use is limited if the patient has multiple malignant lesions (metastases). An alternative approach is based on the design of radiopharmaceuticals that, to be administered in the patient, are directed specifically toward the target cell producing a selective radiation delivery. This treatment is known as targeted radiotherapy. We have summarized and discussed some results related to our investigations on the development of targeted radiotherapy systems, including aspects of internal dosimetry

  4. Targeted therapy: tailoring cancer treatment

    Institute of Scientific and Technical Information of China (English)

    Min Yan; Quentin Qiang Liu

    2013-01-01

    Targeted therapies include small-molecule inhibitors and monoclonal antibodies,have made treatment more tumor-specific and less toxic,and have opened new possibilities for tailoring cancer treatment.Nevertheless,there remain several challenges to targeted therapies,including molecular identification,drug resistance,and exploring reliable biomarkers.Here,we present several selected signaling pathways and molecular targets involved in human cancers including Aurora kinases,PI3K/mTOR signaling,FOXO-FOXM1 axis,and MDM2/MDM4-p53 interaction.Understanding the molecular mechanisms for tumorigenesis and development of drug resistance will provide new insights into drug discovery and design of therapeutic strategies for targeted therapies.

  5. Heavy flavors at fixed target

    International Nuclear Information System (INIS)

    The current situation of Heavy Flavor physics at fixed target experiments is reviewed. High statistics charm production and decay data are summarized and new results on beauty physics are presented. (author)

  6. Physics of Automatic Target Recognition

    CERN Document Server

    Sadjadi, Firooz

    2007-01-01

    Physics of Automatic Target Recognition addresses the fundamental physical bases of sensing, and information extraction in the state-of-the art automatic target recognition field. It explores both passive and active multispectral sensing, polarimetric diversity, complex signature exploitation, sensor and processing adaptation, transformation of electromagnetic and acoustic waves in their interactions with targets, background clutter, transmission media, and sensing elements. The general inverse scattering, and advanced signal processing techniques and scientific evaluation methodologies being used in this multi disciplinary field will be part of this exposition. The issues of modeling of target signatures in various spectral modalities, LADAR, IR, SAR, high resolution radar, acoustic, seismic, visible, hyperspectral, in diverse geometric aspects will be addressed. The methods for signal processing and classification will cover concepts such as sensor adaptive and artificial neural networks, time reversal filt...

  7. Special hydrogen target (Prop. 210)

    International Nuclear Information System (INIS)

    This guide contains a description of the electrical control and automatic vacuum systems for the Special Hydrogen Target (Prop. 210) together with the flow diagram and the mimic control panel layout for the system. (U.K.)

  8. Inertial-confinement-fusion targets

    International Nuclear Information System (INIS)

    Much of the research in laser fusion has been done using simple ball on-stalk targets filled with a deuterium-tritium mixture. The targets operated in the exploding pusher mode in which the laser energy was delivered in a very short time (approx. 100 ps or less) and was absorbed by the glass wall of the target. The high energy density in the glass literally exploded the shell with the inward moving glass compressing the DT fuel to high temperatures and moderate densities. Temperatures achieved were high enough to produce DT reactions and accompanying thermonuclear neutrons and alpha particles. The primary criteria imposed on the target builders were: (1) wall thickness, (2) sphere diameter, and (3) fuel in the sphere

  9. IUCF liquid hydrogen target system

    International Nuclear Information System (INIS)

    A liquid hydrogen or deuterium target system is described for use with intermediate energy light ion beams at IUCF. In its present use as a production target for polarized neutrons, the target cell is mounted within the beamline. Thus, certain safety features are required which prevent a possible hydrogen explosion inside the beamline or the cyclotron. These safety devices include an acoustical delay line which slows the hydrogen gas shock wave and a fast valve which closes before any large volume of escaping gas reaches it. Other safety interlocks to reduce the chances of target cell breakage and to quickly shut off ignition sources are discussed. A device involving a variable heat load which is coupled directly to the cryocondenser and is used to continually monitor and stabilize the pressure and temperature of the liquid hydrogen is described here

  10. National Ignition Facility Target Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Wavrik, R W; Cox, J R; Fleming, P J

    2000-10-05

    On June 11, 1999 the Department of Energy dedicated the single largest piece of the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) in Livermore, California. The ten (10) meter diameter aluminum target high vacuum chamber will serve as the working end of the largest laser in the world. The output of 192 laser beams will converge at the precise center of the chamber. The laser beams will enter the chamber in two by two arrays to illuminate 10 millimeter long gold cylinders called hohlraums enclosing 2 millimeter capsule containing deuterium, tritium and isotopes of hydrogen. The two isotopes will fuse, thereby creating temperatures and pressures resembling those found only inside stars and in detonated nuclear weapons, but on a minute scale. The NIF Project will serve as an essential facility to insure safety and reliability of our nation's nuclear arsenal as well as demonstrating inertial fusion's contribution to creating electrical power. The paper will discuss the requirements that had to be addressed during the design, fabrication and testing of the target chamber. A team from Sandia National Laboratories (SNL) and LLNL with input from industry performed the configuration and basic design of the target chamber. The method of fabrication and construction of the aluminum target chamber was devised by Pitt-Des Moines, Inc. (PDM). PDM also participated in the design of the chamber in areas such as the Target Chamber Realignment and Adjustment System, which would allow realignment of the sphere laser beams in the event of earth settlement or movement from a seismic event. During the fabrication of the target chamber the sphericity tolerances had to be addressed for the individual plates. Procedures were developed for forming, edge preparation and welding of individual plates. Construction plans were developed to allow the field construction of the target chamber to occur parallel to other NIF construction activities. This

  11. National Ignition Facility Target Chamber

    International Nuclear Information System (INIS)

    On June 11, 1999 the Department of Energy dedicated the single largest piece of the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) in Livermore, California. The ten (10) meter diameter aluminum target high vacuum chamber will serve as the working end of the largest laser in the world. The output of 192 laser beams will converge at the precise center of the chamber. The laser beams will enter the chamber in two by two arrays to illuminate 10 millimeter long gold cylinders called hohlraums enclosing 2 millimeter capsule containing deuterium, tritium and isotopes of hydrogen. The two isotopes will fuse, thereby creating temperatures and pressures resembling those found only inside stars and in detonated nuclear weapons, but on a minute scale. The NIF Project will serve as an essential facility to insure safety and reliability of our nation's nuclear arsenal as well as demonstrating inertial fusion's contribution to creating electrical power. The paper will discuss the requirements that had to be addressed during the design, fabrication and testing of the target chamber. A team from Sandia National Laboratories (SNL) and LLNL with input from industry performed the configuration and basic design of the target chamber. The method of fabrication and construction of the aluminum target chamber was devised by Pitt-Des Moines, Inc. (PDM). PDM also participated in the design of the chamber in areas such as the Target Chamber Realignment and Adjustment System, which would allow realignment of the sphere laser beams in the event of earth settlement or movement from a seismic event. During the fabrication of the target chamber the sphericity tolerances had to be addressed for the individual plates. Procedures were developed for forming, edge preparation and welding of individual plates. Construction plans were developed to allow the field construction of the target chamber to occur parallel to other NIF construction activities. This was

  12. Targeting cancer with peptide aptamers

    OpenAIRE

    Seigneuric, Renaud; Gobbo, Jessica; Colas, Pierre; Garrido, Carmen

    2011-01-01

    A major endeavour in cancer chemotherapy is to develop agents that specifically target a biomolecule of interest. There are two main classes of targeting agents: small molecules and biologics. Among biologics (e.g.: antibodies), DNA, RNA but also peptide aptamers are relatively recent agents. Peptide aptamers are seldom described but represent attractive agents that can inhibit a growing panel of oncotargets including Heat Shock Proteins. Potential pitfalls and coming challenges towards succe...

  13. Proactive Steering Toward Oriented Targets

    OpenAIRE

    Boulic, R

    2005-01-01

    In this paper we introduce a real-time steering controller ensuring the reach of a (possible mobile) target position and orientation, without requiring to build/update the full trajectory to that target. We name it the funnelling control. The final orientation is achieved through the continuous adjustment of the heading direction. This control mode is proactive in the sense that it anticipates the success/failure of the reach and adjusts the desired speed accordingly. Both features rely on an...

  14. Plug Off: Target Group Perception

    OpenAIRE

    Kortbaek, Allan; Neubauer, Nathalie; Carreras, Barbara

    2012-01-01

    This project is a study of how a sample of defined target group of a campaign, build meaning through their introduction to such a campaign. With ethno-methodology as a focal point within the overlying context of discourse psychology and more importantly, social constructivism, the aim is to analyze how a defined target group make sense of a proto awareness raising campaign. Proto in this case denotes a planned communication effort in the form of a campaign encouraging responsible use of wirel...

  15. A Theory of Child Targeting

    OpenAIRE

    Donni, Olivier; Bargain, Olivier

    2007-01-01

    There is a large empirical literature on policy measures targeted at children but surprisingly very little theoretical foundation to ground the debate on the optimality of the different instruments. In the present paper, we examine the merit of targeting children through two general policies, namely selective commodity taxation and cash transfer to family with children. We consider a household that comprises an adult and a child. The household behavior is described by the ma...

  16. Targeted immunotherapy in Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hutchings, Martin

    2015-01-01

    In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13.......In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13....

  17. Twenty years of inflation targeting

    OpenAIRE

    David Baqaee; Christie Smith

    2010-01-01

    In December 2009 the Reserve Bank of New Zealand, in conjunction with Northwestern University’s Centre for International Economics and Development (CIED), hosted a monetary policy conference to mark the 20th anniversary of the Reserve Bank of New Zealand Act. Passed in December 1989, the Act was one of the seminal events in the development of inflation targeting as a monetary policy regime. As of 2009, 26 countries have explicitly adopted inflation targeting, including Canada, the UK, Austral...

  18. Inflation Targeting in Latin America

    OpenAIRE

    Vittorio Corbo; Klaus Schmidt-Hebbel

    2002-01-01

    This paper analyzes Latin America’s recent experience with the use of inflation targeting (IT) while the region has made substantial progress toward eradicating high inflation. The paper assesses the implementation and results of inflation targeting in Latin America from a broad perspective. It starts by reviewing the issues relevant for the choice of exchange-rate regimes and monetary frameworks, documenting the evolution of exchange rate and monetary regimes in Latin America during the last...

  19. Polarized atomic beams for targets

    International Nuclear Information System (INIS)

    The basic principle of the production of polarized atomic hydrogen and deuterium beams are reviewed. The status of the present available polarization, density and intensity are presented. The improvement of atomic beam density by cooling the hydrogen atoms to low velocity is discussed. The possible use of polarized atomic beams as targets in storage rings is shown. It is proposed that polarized atomic beams can be used to produce polarized gas targets with high polarization and greatly improved density

  20. Symmetric solid target transport system

    OpenAIRE

    Tomov, D.; Lawrence, L; Gaehle, G.

    2015-01-01

    Introduction The expansion of our PET isotope production with a new TR-19 cyclotron necessitated a suitable solid target transport system. None of the known existing and proposed solid target transport systems (STTS) was able to meet the technical and budget requirements of the MIR cyclotron facility [5]. A unique carrier design allowed us to develop a fully automated 50.8 mm inner diameter pneumatic tube STTS with an in-hot-cell compact form factor receiving station. The cyclotron or v...

  1. Ion stopping in heated targets

    International Nuclear Information System (INIS)

    Ion stopping departs from classical, cold material values as the target material heats to appreciable ionization levels. The authors are investigating this phenomenon experimentally on the Proto I accelerator with a radial, Applied-B field ion diode. When the beam is focused to 0.5 TW/cm3 on thin aluminum foil targets the time-resolved departure from cold stopping is clear. Their observations and early interpretations will be presented. 9 references, 9 figures

  2. 阻燃剂三嗪三苯基次膦酸叔丁酯的合成及应用%Synthesis and Application of Flame Retardant 2-4-6-three(O-tertiary butyl-phenyl phosphinic acyl)-1,3,5-triazine

    Institute of Scientific and Technical Information of China (English)

    李果; 胡新利; 王彦林

    2015-01-01

    A novel flame retardant,2,4,6-three(O-tertiary butyl-phenyl phosphinic acyl)-1,3,5-triazine was synthesized from cyanuric chloride and phenyl phosphonic acid two tert-butyl ester. Effects of reaction time,reaction temperature,phenyl phosphonic acid two tert-butyl ester dropping speed and material proportion on yield of product were investigated. The product reached 90.6%under the optimal conditions of r(phenyl phosphonic acid two tert-butyl ester)∶r(cyanuric chloride)=3.4,dropping phenyl phosphonic acid two tert-butyl ester at twice,then keeping the reaction going at 100℃for 5 h. The target compound was characterized by means of FTIR,1H NMR,TG–DTA analysis and limiting oxygen index technique. The results show that the product have the high flame retardance,good compatibility with PE and have high fire retardance when mix with MCA and MPP.%以三聚氯氰和苯基次膦酸二叔丁酯为原料,合成新型阻燃剂三嗪三苯基次膦酸叔丁酯2,4,6-三(O-叔丁基–苯基次膦酰基)-1,3,5-三嗪化合物。讨论了反应时间、反应温度、原料配比等对合成反应的影响。其最佳反应条件为:三聚氯氰与苯基次膦酸二叔丁酯的物质的量之比为1∶3.4,分两次滴加苯基次膦酸二叔丁酯,在100℃反应5 h,收率为90.6%。采用傅里叶变换红外光谱、核磁共振、差热分析及极限氧指数等表征了产品的结构及阻燃应用性能。研究表明,该化合物对PE阻燃效能高,相容性好,且与MCA,MPP复配有很好的协同阻燃效果。

  3. Target assignment for security officers to K targets (TASK)

    International Nuclear Information System (INIS)

    A probabilistic algorithm is developed to provide an optimal Target Assignment for Security officers to K targets (TASK) using a maximin criterion. Under the assumption of only a limited number (N) of security officers, the TASK computer model determines deployment assignments which maximize the system protection against sabotage by an adversary who may select any link in the system, including the weakest, for the point of attack. Applying the TASK model to a hypothetical nuclear facility containing a nine-level building reveals that aggregate targets covering multiple vital areas should be utilized to reduce the number of possible target assignments to a value equal to or only slightly larger than N. The increased probability that a given aggregate target is covered by one or more security officers offsets the slight decrease in interruption probability due to its occurring earlier in the adversary's path. In brief, the TASK model determines the optimal maximin deployment strategy for limited numbers of security officers and calculates a quantitative measure of the resulting system protection

  4. Unification of automatic target tracking and automatic target recognition

    Science.gov (United States)

    Schachter, Bruce J.

    2014-06-01

    The subject being addressed is how an automatic target tracker (ATT) and an automatic target recognizer (ATR) can be fused together so tightly and so well that their distinctiveness becomes lost in the merger. This has historically not been the case outside of biology and a few academic papers. The biological model of ATT∪ATR arises from dynamic patterns of activity distributed across many neural circuits and structures (including retina). The information that the brain receives from the eyes is "old news" at the time that it receives it. The eyes and brain forecast a tracked object's future position, rather than relying on received retinal position. Anticipation of the next moment - building up a consistent perception - is accomplished under difficult conditions: motion (eyes, head, body, scene background, target) and processing limitations (neural noise, delays, eye jitter, distractions). Not only does the human vision system surmount these problems, but it has innate mechanisms to exploit motion in support of target detection and classification. Biological vision doesn't normally operate on snapshots. Feature extraction, detection and recognition are spatiotemporal. When vision is viewed as a spatiotemporal process, target detection, recognition, tracking, event detection and activity recognition, do not seem as distinct as they are in current ATT and ATR designs. They appear as similar mechanism taking place at varying time scales. A framework is provided for unifying ATT and ATR.

  5. Measurement of the solar 8B neutrino flux with 246 live days of Borexino and observation of the MSW vacuum-matter transition

    CERN Document Server

    Bellini, G; Bonetti, S; Buizza Avanzini, M; Caccianiga, B; Cadonati, L; Calaprice, F; Carraro, C; Chavarria, A; Dalnoki-Veress, F; D'Angelo, D; De Kerret, H; Derbin, A; Etenko, A; Fomenko, K; Franco, D; Galbiati, C; Gazzana, S; Giammarchi, M; Goeger-Neff, M; Goretti, A; Grieb, C; Hardy, a S; Aldo, Ianni; Andrea, Ianni; Joyce, M; Kobychev, V; Korga, G; Kryn, D; Laubenstein, M; Leung, M; Lewke, T; Litvinovich, E; Loer, B; Lombardi, P; Ludhova, L; Machulin, I; Manecki, S; Maneschg, W; Manuzio, G; Masetti, F; McCarty, K; Meindl, Q; Meroni, E; Miramonti, L; Misiaszek, M; Montanari, D; Muratova, V; Oberauer, L; Obolensky, M; Ortica, F; Pallavicini, M; Papp, L; Perasso, L; Perasso, S; Pocar, A; Raghavan, b R S; Ranucci, G; Razeto, A; Risso, P; Romani, A; Rountree, D; Sabelnikov, A; Saldanha, R; Salvo, C; Schönert, S; Simgen, H; Skorokhvatov, M; Smirnov, O; Sotnikov, A; Sukhotin, S; Suvorov, Y; Tartaglia, R; Testera, G; Vignaud, D; Vogelaar, R B; Von Feilitzsch, F; Wójcik, M; Wurm, M; Zaimidoroga, O; Zavatarelli, S; Zuzel, G

    2008-01-01

    We report the measurement of the 8B solar neutrinos interaction rate with the Borexino detector. The threshold energy of 2.8 MeV is the lowest for 8B achieved so far. The rate of 8B solar neutrino interaction as measured through their scattering on the target electrons is 0.26+-0.04(stat)+-0.02(syst) c/d/100 tons. This corresponds to an equivalent electron neutrino flux of (2.65+-0.44(stat)+-0.18(syst))x10^6 cm^-2 s^-1, as derived from the elastic scattering only, in good agreement with existing measurements and predictions. The corresponding 8B mean electron neutrino survival probability, assuming the BS07(GS98) Standard Solar Model, is 0.35+-0.10 at the effective energy of 8.6 MeV. The survival probability of the 0.862 MeV 7Be neutrinos was previously reported with a subset of these data as 0.56+-0.10. Eliminating the common sources of systematic errors, the ratio between the measured survival probabilities for 7Be and 8B neutrinos is 1.60+-0.33, 1.8 sigmas different form unity. For the first time we confir...

  6. CPHD filter derivation for extended targets

    OpenAIRE

    Orguner, Umut

    2010-01-01

    This document derives the CPHD filter for extended targets. Only the update step is derived here. Target generated measurements, false alarms and prior are all assumed to be independent identically distributed cluster processes. We also prove here that the derived CPHD filter for extended targets reduce to PHD filter for extended targets and CPHD filter for standard targets under suitable assumptions.

  7. Monoclonal antibodies in targeted therapy

    Directory of Open Access Journals (Sweden)

    Beata Powroźnik

    2012-09-01

    Full Text Available Targeted therapy is a new therapeutic method consisting in the inhibition of specific molecular pathways. In modern therapy, the key role is played by monoclonal antibodies, included in the group of biological agents. The success of molecularly targeted therapy is to define the proper “molecular target”, selecting the right drug active against a specific “target” and selecting a group of patients who benefit from treatment. Introduction of targeted therapy resulted in improved results of the treatment of many serious and chronic diseases. In general, targeted molecular therapies have good toxicity profiles, but some patients are exquisitely sensitive to these drugs and can develop particular and severe toxicities. Patient selection and proper monitoring significantly decrease the risk of life-threatening adverse events. Data concerning late side effects are still unavailable because of the short follow-up of molecularly targeted therapy. Currently in the U.S. and Europe there are approximately 31 registered therapeutic monoclonal antibodies, while 160 are subjected to clinical trials. This paper presents an overview of therapeutic monoclonal antibodies currently used in therapy and the present state of knowledge about them. 

  8. Infrared Targeting System (IRTS) demonstration

    Science.gov (United States)

    Ohair, Mark A.; Eucker, Shelly S.; Eucker, Brad A.; Lewis, Tim

    1992-02-01

    The objective of the Infrared Targeting System (IRTS) is to successfully demonstrate the mission performance that can be achieved in manned air-to-ground targeting applications utilizing a synergistic combination of state of the art active/passive infrared sensor and automatic target recognizer (ATR) technologies. The IRTS program is centered around a demonstration FLIR/Laser Radar/ATR (FLASHER). The FLASHER consists of a dual field of view (2 x 2 degree and 6 x 6 degree) second generation FLIR pixel mapped to a CO2 laser radar, with a FLIR ATR processor, a laser radar ATR processor, and a sensor fusion ATR processor. Following construction and laboratory testing of the IRTS, the system will be installed on a test aircraft and demonstrated in flight against realistic tactical, strategic, and special operations scenarios.

  9. Target-Centric Network Modeling

    DEFF Research Database (Denmark)

    Mitchell, Dr. William L.; Clark, Dr. Robert M.

    In Target-Centric Network Modeling: Case Studies in Analyzing Complex Intelligence Issues, authors Robert Clark and William Mitchell take an entirely new approach to teaching intelligence analysis. Unlike any other book on the market, it offers case study scenarios using actual intelligence...... reporting formats, along with a tested process that facilitates the production of a wide range of analytical products for civilian, military, and hybrid intelligence environments. Readers will learn how to perform the specific actions of problem definition modeling, target network modeling, and...... collaborative sharing in the process of creating a high-quality, actionable intelligence product. The case studies reflect the complexity of twenty-first century intelligence issues by dealing with multi-layered target networks that cut across political, economic, social, technological, and military issues...

  10. Ribosome Assembly as Antimicrobial Target.

    Science.gov (United States)

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  11. Target identification by image analysis.

    Science.gov (United States)

    Fetz, V; Prochnow, H; Brönstrup, M; Sasse, F

    2016-05-01

    Covering: 1997 to the end of 2015Each biologically active compound induces phenotypic changes in target cells that are characteristic for its mode of action. These phenotypic alterations can be directly observed under the microscope or made visible by labelling structural elements or selected proteins of the cells with dyes. A comparison of the cellular phenotype induced by a compound of interest with the phenotypes of reference compounds with known cellular targets allows predicting its mode of action. While this approach has been successfully applied to the characterization of natural products based on a visual inspection of images, recent studies used automated microscopy and analysis software to increase speed and to reduce subjective interpretation. In this review, we give a general outline of the workflow for manual and automated image analysis, and we highlight natural products whose bacterial and eucaryotic targets could be identified through such approaches. PMID:26777141

  12. Integrin Targeted Delivery of Radiotherapeutics

    Directory of Open Access Journals (Sweden)

    Zhaofei Liu, Fan Wang, Xiaoyuan Chen

    2011-01-01

    Full Text Available Targeted radionuclide therapy, which is based on the selective delivery of a sufficient radiation dose to tumors without significantly affecting normal tissues, is a promising therapeutic approach for the treatment of a wide variety of malignancies. Integrins, a family of cell adhesion molecules, play key roles during tumor angiogenesis and metastasis. Among all the integrins, αvβ3 seems to be the most important in the process of tumor angiogenesis. Integrin αvβ3 is highly expressed on activated endothelial cells, new-born vessels as well as some tumor cells, but is not present in resting endothelial cells and most normal organ systems, making it a suitable target for anti-tumor therapy. In this review, we summarize the current development and applications of antibody-, peptide-, and other ligand-based integrin targeted radiotherapeutics for tumor radiation therapy.

  13. High-efficiency target-ion sources for RIB generation

    Energy Technology Data Exchange (ETDEWEB)

    Alton, G.D.

    1993-12-31

    A brief review is given of high-efficiency ion sources which have been developed or are under development at ISOL facilities which show particular promise for use at existing, future, or radioactive ion beam (RIB) facilities now under construction. Emphasis will be placed on those sources which have demonstrated high ionization efficiency, species versatility, and operational reliability and which have been carefully designed for safe handling in the high level radioactivity radiation fields incumbent at such facilities. Brief discussions will also be made of the fundamental processes which affect the realizable beam intensities in target-ion sources. Among the sources which will be reviewed will be selected examples of state-of-the-art electron-beam plasma-type ion sources, thermal-ionization, surface-ionization, ECR, and selectively chosen ion source concepts which show promise for radioactive ion beam generation. A few advanced, chemically selective target-ion sources will be described, such as sources based on the use of laser-resonance ionization, which, in principle, offer a more satisfactory solution to isobaric contamination problems than conventional electromagnetic techniques. Particular attention will be given to the sources which have been selected for initial or future use at the Holifield Radioactive Ion Beam Facility now under construction at the Oak Ridge National Laboratory.

  14. Inflation Targeting at 20 - Achievements and Challenges

    OpenAIRE

    Scott Roger

    2009-01-01

    This paper provides an overview of inflation targeting frameworks and macroeconomic performance under inflation targeting. Inflation targeting frameworks are generally quite similar across countries, and a broad consensus has developed in favor of "flexible" inflation targeting. The evidence shows that, although inflation target ranges are missed frequently in most countries, the inflation and growth performance under inflation targeting compares very favorably with performance under alternat...

  15. USING OPTIMAL FEEDBACK CONTROL FOR CHAOS TARGETING

    Institute of Scientific and Technical Information of China (English)

    PENG ZHAO-WANG; ZHONG TING-XIU

    2000-01-01

    Since the conventional open-loop optimal targeting of chaos is very sensitive to noise, a close-loop optimal targeting method is proposed to improve the targeting performance under noise. The present optimal targeting model takes into consideration both precision and speed of the targeting procedure. The parameters, rather than the output, of the targeting controller, are directly optimized to obtain optimal chaos targeting. Analysis regarding the mechanism is given from physics aspect and numerical experiment on the Hénon map is carried out to compare the targeting performance under noise between the close-loop and the open-loop methods.

  16. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  17. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio;

    2003-01-01

    telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...

  18. Target selection for direct marketing.

    NARCIS (Netherlands)

    Bult, Jan Roelf

    1993-01-01

    In this thesis we concentrated on the use ol direct mail for targeting potential buyers. The major characteristics that influences the success of a plomotional direct mail campaign are the of-fbr,the communication elements, the timing or sequence of these communication elements, and the list of cus

  19. Particle physics using nuclear targets

    Energy Technology Data Exchange (ETDEWEB)

    Ferbel, T.

    1978-01-01

    The use of nuclear targets in particle physics is discussed and some recent results obtained in studies of hadronic interactions on nuclei summarized. In particular experimental findings on inclusive production and on coherent dissociation of mesons and baryons at high energies are presented. 41 references.

  20. Tumor targeting via integrin ligands

    Directory of Open Access Journals (Sweden)

    HorstKessler

    2013-08-01

    Full Text Available Selective and targeted delivery of drugs to tumors is a major challenge for an effective cancer therapy and also to overcome the side effects associated with current treatments. Overexpression of various receptors on tumor cells is a characteristic structural and biochemical aspect of tumors and distinguishes them from physiologically normal cells. This abnormal feature is therefore suitable for selectively directing anticancer molecules to tumors by using ligands that can preferentially recognize such receptors. Several subtypes of integrin receptors that are crucial for cell adhesion, cell signaling, cell viability and motility have been shown to have an upregulated expression on cancer cells. Thus, ligands that recognize specific integrin subtypes represent excellent candidates to be conjugated to drugs or drug carrier systems and be targeted to tumors. In this regard, integrins recognizing the RGD cell adhesive sequence have been extensively targeted for tumor specific drug delivery. Here we review key recent examples on the presentation of RGD-based integrin ligands by means of distinct drug delivery systems, and discuss the prospects of such therapies to specifically target tumor cells.