WorldWideScience

Sample records for californium 246 target

  1. Magnetism in californium

    International Nuclear Information System (INIS)

    A SQUID-based magnetic susceptometer has been constructed for studying small radioactive samples at temperatures below 350 K and in magnetic fields up to 50 kilogauss. The device has been used to study californium (element 98) in a number of solid-state forms: the dhcp metal, several oxides (Cf2O3 in both the bcc and monoclinic structures, Cf7O12, CfO2 and BaCfO3), several monopnictides (CfN, CfAs and CfSb) and the trichloride (in both the hexagonal and orthorhombic structures). All of these materials were studied in polycrystalline form, and hexagonal CfCl3 was studied in single-crystal form as well. The susceptometer has the sensitivity to measure samples containing less than 10 micrograms of californium. The magnetic susceptibilities of all of the californium materials at temperatures above about 100 K are described well by the Curie-Weiss relationship. This behavior is consistent with the assumption that the magnetic 5f electrons are localized and that the paramagnetic behavior can be interpreted in terms of the properties of the free ion. The measured values of the effective paramagnetic moment, μ/sub eff/, for all the californium materials that were studied are reasonably consistent with theoretical values based on intermediate coupling models. All of the californium materials showed some indications of cooperative magnetic effects. The dhcp metal was observed to order ferromagnetically at 52 K, and all of the californium compounds studied showed signs of antiferromagnetic ordering, mostly at temperatures below 25 K. 91 refs., 50 figs., 19 tabs

  2. Californium Multiplier (CFX)

    International Nuclear Information System (INIS)

    The availability of 252Cf as an economical high-intensity neutron source has made it possible to construct compact neutron irradiation devices with widespread applications. The simplest such device consists of a single 252Cf source within a moderating and shielding medium. Higher neutron flux levels can be attained either through the use of more 252Cf or through source multiplication by means of a subcritical uranium assembly. Although the use of larger 252Cf sources to achieve higher neutron flux is technically straightforward, an economic penalty is paid as the source strength is increased. Larger californium sources imply larger initial investments to cover the cost of source material and larger operating costs resulting from the decay of the 252Cf source. A Californium Multiplier, the CFX, which produces a flux enhancement of 30 when compared to a conventional moderated 252Cf system has been designed, licensed, built, and tested by IRT Corporation. Such systems are now available on a commercial basis for both neutron radiography and neutron activation analysis. The first commercial CFX system was installed at the Research Laboratories of Eastman Kodak Company in Rochester, NY, in March 1975. This device, using 1 mg of 252Cf, is very stable and the neutron flux generated by the CFX is very reproducible. The performance characteristics of this system are summarized

  3. Californium--palladium metal neutron source material

    Science.gov (United States)

    Dahlen, B.L.; Mosly, W.C. Jr.; Smith, P.K.; Albenesius, E.L.

    1974-01-22

    Californium, as metal or oxide, is uniformly dispersed throughout a noble metal matrix, provided in compact, rod or wire form. A solution of californium values is added to palladium metal powder, dried, blended and pressed into a compact having a uni-form distribution of californium. The californium values are decomposed to californium oxide or metal by heating in an inert or reducing atmosphere. Sintering the compact to a high density closes the matrix around the dispersed californium. The sintered compact is then mechanically shaped into an elongated rod or wire form. (4 claims, no drawings) (Official Gazette)

  4. Californium Electrodepositions at Oak Ridge National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Boll, Rose Ann [ORNL

    2015-01-01

    Electrodepositions of californium isotopes were successfully performed at Oak Ridge National Laboratory (ORNL) during the past year involving two different types of deposition solutions, ammonium acetate (NH4C2H3O2) and isobutanol ((CH3)2CHCH2OH). A californium product that was decay enriched in 251Cf was recovered for use in super-heavy element (SHE) research. This neutron-rich isotope, 251Cf, provides target material for SHE research for the potential discovery of heavier isotopes of Z=118. The californium material was recovered from aged 252Cf neutron sources in storage at ORNL. These sources have decayed for over 30 years, thus providing material with a very high 251Cf-to-252Cf ratio. After the source capsules were opened, the californium was purified and then electrodeposited using the isobutanol method onto thin titanium foils for use in an accelerator at the Joint Institute for Nuclear Research in Dubna, Russia. Another deposition method, ammonium acetate, was used to produce a deposition containing 1.7 0.1 Ci of 252Cf onto a stainless steel substrate. This was the largest single electrodeposition of 252Cf ever prepared. The 252Cf material was initially purified using traditional ion exchange media, such as AG50-AHIB and AG50-HCl, and further purified using a TEVA-NH4SCN system to remove any lanthanides, resulting in the recovery of 3.6 0.1 mg of purified 252Cf. The ammonium acetate deposition was run with a current of 1.0 amp, resulting in a 91.5% deposition yield. Purification and handling of the highly radioactive californium material created additional challenges in the production of these sources.

  5. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)

    1971-12-31

    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  6. Historical Review of Californium-252 Discovery and Development

    Science.gov (United States)

    Stoddard, D. H.

    1985-01-01

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed. (PLG)

  7. Historical review of californium-252 discovery and development

    International Nuclear Information System (INIS)

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

  8. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.

    1995-10-10

    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  9. Californium-252: a remarkable versatile radioisotope

    International Nuclear Information System (INIS)

    A product of the nuclear age, Californium-252 (252Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252Cf from ORNL is summarized herein

  10. Californium-252 Neutron Therapy in China

    International Nuclear Information System (INIS)

    Californium-252 brachytherapy, believed to be the most successful source for neutron therapy, gives most of the cures as well as long-term and complication-free survivals. Chinese radiation oncologists were interested in californium neutron therapy (Cf-NT) in the early 1980s, but 252Cf sources for medical use were not available in China until 1992 when a californium joint venture was established by the China Institute of Atomic Energy (Beijing) and the Research Institute for Nuclear Reactors (Dimitrovgrad) of Russia. In 1995, 25 seeds of 252Cf with a strength of 3 μg each were sent to China for preclinical investigation. Three years later, a high dose rate (HDR) 252Cf source was imported and transferred into a home-made remote after-loader for intracavitary treatment in Chongqing, and a clinical trail was started in February 1999. This is the first time that Cf-NT was performed for cancer patients in China. Since then, Cf-NT in China has developed rapidly. It is estimated that one-tenth of those radiation oncology centers with brachytherapy practice will be equipped with californium units in 5 yr. That means more than 30 units will be in use in hospitals. That is significant compared with other countries, but it is just one, on average, for each province or one per 40 million people in China. Progress also has been achieved in the 252Cf treatment delivery equipment. Preliminary clinical trails showed complete response observed in all cases treated, with a rapid clearance of tumors and mild reactions in normal tissues. The short-term results are quite encouraging. To deal with problems due to the demand for Cf-NT in China, attention should be paid to the following particulars: (1) A high-strength miniature source is needed for HDR/MDR interstitial therapy to extend the Cf-NT coverage. (2) Basic work on radiophysics and radiobiology needs to be done, including source calibration, clinical dosimetry, clinical RBE determination, and Cf-NT quality assurance

  11. Californium-252 sales and loans at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    The production and distribution in the United States of 252Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252Cf Industrial Sales/Loan Program and the 252Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point

  12. Californium-252 encapsulation at the Savannah River Laboratory

    International Nuclear Information System (INIS)

    More than 1 g of the neutron-emitting isotope californium-252 has been encapsulated at SRL for worldwide medical, industrial, and research uses. Bulk sales packages have been prepared for the USDOE sales program since 1971. Doubly-encapsulated sources have been prepared for USDOE's market evaluation program since 1968. Californium-252 sources for loan and sales packages satisfy the criteria for Special Form Radioactive Material. Encapsulation is performed in special neutron-shielded containment facilities at SRL. Development of improved source and shipping package designs and processes is continuing. 17 figures

  13. Production, distribution and applications of californium-252 neutron sources

    International Nuclear Information System (INIS)

    The radioisotope 252Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-yr half-life. A source the size of a person's little finger can emit up to 1011 neutrons s-1. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement and minerals, as well as for detection and identification of explosives, land mines and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 yr of experience and by US Bureau of Mines tests of source survivability during explosions. The production and distribution center for the US Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252Cf to commercial reencapsulators domestically and internationally. Sealed 252Cf sources are also available for loan to agencies and subcontractors of the US government and to universities for educational, research and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments and irradiation of rice to induce genetic mutations

  14. Production, distribution and applications of californium-252 neutron sources.

    Science.gov (United States)

    Martin, R C; Knauer, J B; Balo, P A

    2000-01-01

    The radioisotope 252Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-yr half-life. A source the size of a person's little finger can emit up to 10(11) neutrons s(-1). Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement and minerals, as well as for detection and identification of explosives, land mines and unexploded military ordinance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 yr of experience and by US Bureau of Mines tests of source survivability during explosions. The production and distribution center for the US Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252Cf to commercial reencapsulators domestically and internationally. Sealed 252Cf sources are also available for loan to agencies and subcontractors of the US government and to universities for educational, research and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments and irradiation of rice to induce genetic mutations. PMID:11003521

  15. Production, Distribution, and Applications of Californium-252 Neutron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.

    1999-10-03

    The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10{sup 11} neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6- year half-life. A source the size of a person's little finger can emit up to 10 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory(ORNL). DOE sells {sup 252}Cf to commercial

  16. Anti-leukaemic effects induced by APR-246 are dependent on induction of oxidative stress and the NFE2L2/HMOX1 axis that can be targeted by PI3K and mTOR inhibitors in acute myeloid leukaemia cells.

    Science.gov (United States)

    Ali, Dina; Mohammad, Dara K; Mujahed, Huthayfa; Jonson-Videsäter, Kerstin; Nore, Beston; Paul, Christer; Lehmann, Sören

    2016-07-01

    The small molecule APR-246 (PRIMA-1(MET) ) is a novel drug that restores the activity of mutated and unfolded TP53 protein. However, the mechanisms of action and potential off-target effects are not fully understood. Gene expression profiling in TP53 mutant KMB3 acute myeloid leukaemia (AML) cells showed that genes which protected cells from oxidative stress to be the most up-regulated. APR-246 exposure also induced reactive oxygen species (ROS) formation and depleted glutathione in AML cells. The genes most up-regulated by APR-246, confirmed by quantitative real time polymerase chain reaction, were heme oxygenase-1 (HMOX1, also termed HO-1), SLC7A11 and RIT1. Up-regulation of HMOX1, a key regulator of cellular response to ROS, was independent of TP53 mutational status. NFE2L2 (also termed Nrf2), a master regulator of HMOX1 expression, showed transcriptional up-regulation and nuclear translocation by APR-246. Down-regulation of NFE2L2 by siRNA in AML cells significantly increased the antitumoural effects of APR-246. The PI3K inhibitor wortmannin and the mTOR inhibitor rapamycin inhibited APR-246-induced nuclear translocation of NFE2L2 and counteracted the protective cellular responses to APR-246, resulting in synergistic cell killing together with APR-246. In conclusion, ROS induction is important for antileukaemic activities of APR-246 and inhibiting the protective response of the Nrf-2/HMOX1 axis using PI3K inhibitors, enhances the antileukaemic effects. PMID:26991755

  17. Production of extra pure curium and californium preparations

    International Nuclear Information System (INIS)

    Preparations of curium-244,245,248 and californium-249,252 are used for the production of ionizing radiation sources for different applications and fundamental nuclear-physical investigations, placing high requirements on the radiochemical and chemical purity of the preparations. Extraction chromatography using di-(2-ethylhexyl)phosphoric acid (D2EHPA) as extractant was chosen to prepare extra pure curium and californium preparations. In order to identify the optimal conditions of Cm-Cf separation and to remove impurities from them (reagent and other impurities), investigations were performed into the effect of impurities (Na+, Ca2+, Al3+, Fe2+, Fe3+ taken as example), extractant and eluent concentration and solution flow rate on the efficiency of mutual purification of Cm and Cf. Both theoretical and experimental estimations were made of the maximum concentration at which the impurities do not affect the process. The conditions chosen allow mutual purification of milligram amounts of Cm and Cf from impurity elements at E(pur) =102 - 103 during a single chromatographic cycle (E(pur) =>103) using a column with 5 - 10 cm3 volume. In this case the production yield exceeds 98%. The purification of milligram amounts of curium and californium from fission products (lanthanides in general, cerium in particular) was performed in D2EHPA-decane-PbO2-HNO3 and D2EHPA-decane-DTPA-H3-Cit extraction chromatography systems. In order to establish the optimal conditions, the effect of [D2EHPA] and eluent on the mutual purification of Cm and Cf and on their purification from cerium and impurity elements was studied in the D2EHPA-decane-PbO2-HNO3 system. During a single chromatographic cycle the mutual purification factors of TPE and of their purification from impurity cations achieve 102-103, from cerium - E(pur) > 10. In the D2EHPA-decane-DTPA-H3Cit system, the effect of concentration of extractant and eluent pH on the efficiency of Cm and Cf purification from lanthanides was

  18. Prompt neutron spectrum of the spontaneous fission of californium-252

    International Nuclear Information System (INIS)

    The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references

  19. Separation of californium from actinides and lanthanides in aqueous solution by electrochemical formation of amalgams

    International Nuclear Information System (INIS)

    The electrochemical reduction of transneptunium elements (Pu to Cf) and rare earths (Eu, Tm) from aqueous complexing solutions to amalgams was studied over a wide range of cathodic potentials in order to achieve optimal separation of californium. The reduction in acetate media (pH 4.5-4.6) at potentials around -1.7 to -1.9 V1 leads to a quantitative extraction of californium into the mercury phase, while more negative potentials are required for the reduction of the lighter transuranium elements and of the lanthanides. Hence, the optimal conditions for the separation of californium from the investigated actinides and lanthanides were determined. Separation factors α between 25 and 90 were found except in the case of Cf/Eu, where poor values (α varying from 7 to 12) were observed. More negative cathodic potentials decrease the selectivity of the reduction process. A similar study with lithium citrate solutions (pH ∝6) shows that satisfactory separation of californium from lighter and heavier actinides is achievable. A separation factor of 88 is obtained for Cf/Am at -1.98 V. The anodic stripping of mixed amalgams (Pu, Am, Cm, Bk, Tm and Cf) Hg in nitric and acetic acid soultions at potentials ranging from +0.1 to -0.7 V proceeds slowly and proved to be ineffective for the separation of californium from light actinides under conditions described. (orig.)

  20. Biomedical neutron research at the Californium User Facility for neutron science

    International Nuclear Information System (INIS)

    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252Cf sources. Three projects at the CUF that demonstrate the versatility of 252Cf for biological and biomedical neutron-based research are described: future establishment of a 252Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy

  1. Biomedical neutron research at the Californium User Facility for neutron science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R.C. [Oak Ridge National Lab., TN (United States); Byrne, T.E. [Roane State Community College, Harriman, TN (United States); Miller, L.F. [Univ. of Tennessee, Knoxville, TN (United States)

    1997-04-01

    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact {sup 252}Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with {sup 252}Cf sources. Three projects at the CUF that demonstrate the versatility of {sup 252}Cf for biological and biomedical neutron-based research are described: future establishment of a {sup 252}Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded {sup 252}Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy.

  2. Emergence of californium as the second transitional element in the actinide series.

    Science.gov (United States)

    Cary, Samantha K; Vasiliu, Monica; Baumbach, Ryan E; Stritzinger, Jared T; Green, Thomas D; Diefenbach, Kariem; Cross, Justin N; Knappenberger, Kenneth L; Liu, Guokui; Silver, Mark A; DePrince, A Eugene; Polinski, Matthew J; Van Cleve, Shelley M; House, Jane H; Kikugawa, Naoki; Gallagher, Andrew; Arico, Alexandra A; Dixon, David A; Albrecht-Schmitt, Thomas E

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resultant complex with respect to that predicted for the free ion. We expand on this by characterizing the americium and curium analogues for comparison, and show that these pronounced effects result from a second transition in periodicity in the actinide series that occurs, in part, because of the stabilization of the divalent oxidation state. The metastability of californium(II) is responsible for many of the unusual properties of californium including the green photoluminescence. PMID:25880116

  3. Fissile analysis of Hanford waste using Californium Multiplier/Delayed Neutron Counter system

    International Nuclear Information System (INIS)

    Measurement of low-level (10 ng/g or lower) fissile material (mainly plutonium) in Hanford waste and process samples is becoming increasingly important. A system has been designed consisting of a Californium Multiplier (CFX) and a Delayed Neutron Counter (DNC) to characterize these samples. This report describes hardware and analytical capability of the CFX/DNC system

  4. 32 CFR 246.5 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 246.5 Section 246.5 National... STARS AND STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS § 246.5 Responsibilities. (a) The Assistant to the Secretary of Defense (Public Affairs), under 32 CFR part 375, as the principal staff assistant...

  5. 42 CFR 431.246 - Corrective action.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Corrective action. 431.246 Section 431.246 Public... Recipients Procedures § 431.246 Corrective action. The agency must promptly make corrective payments, retroactive to the date an incorrect action was taken, and, if appropriate, provide for admission...

  6. 48 CFR 2453.246 - Quality Assurance.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Quality Assurance. 2453.246 Section 2453.246 Federal Acquisition Regulations System DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT CLAUSES AND FORMS FORMS Prescription of Forms 2453.246 Quality Assurance....

  7. 7 CFR 246.11 - Nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nutrition education. 246.11 Section 246.11 Agriculture... Participant Benefits § 246.11 Nutrition education. (a) General. (1) Nutrition education shall be considered a benefit of the Program, and shall be made available at no cost to the participant. Nutrition...

  8. Emergence of californium as the second transitional element in the actinide series

    OpenAIRE

    Cary, Samantha K.; Vasiliu, Monica; Baumbach, Ryan E.; Stritzinger, Jared T.; GREEN, THOMAS D.; Diefenbach, Kariem; Cross, Justin N.; Knappenberger, Kenneth L.; Liu, Guokui; Silver, Mark A.; DePrince, A. Eugene; Polinski, Matthew J.; Van Cleve, Shelley M.; House, Jane H.; Kikugawa, Naoki

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resu...

  9. Dicty_cDB: CHR246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR246 (Link to dictyBase) - - - Contig-U16475-1 CHR246P (Link to Original site) CHR...246F 145 CHR246Z 524 CHR246P 649 - - Show CHR246 Library CH (Link to library) Clone ID CHR... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR2-B/CHR246Q.Seq.d/ Representative seq. ID CHR...246P (Link to Original site) Representative DNA sequence >CHR246 (CHR246Q) /CSM/CH/CHR2-B/CHR2...equences producing significant alignments: (bits) Value N AC116957 |AC116957.2 Dictyostelium discoideum chro

  10. Dicty_cDB: AFM246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM246 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...246Z 559 - - - - Show AFM246 Library AF (Link to library) Clone ID AFM246 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM2-B/AFM...246Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...246 (AFM246Q) /CSM/AF/AFM2-B/AFM246Q.Seq.d/ XXXXXXXXXXAGATTAAACAATTCATTCTTGATGAATGTGATACC

  11. Dicty_cDB: SSC246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSC246 (Link to dictyBase) - - - Contig-U16350-1 - (Link to Original site) SSC...246F 463 - - - - - - Show SSC246 Library SS (Link to library) Clone ID SSC246 (Link to dicty...iol.tsukuba.ac.jp/CSM/SS/SSC2-B/SSC246Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >SSC246 (SSC246Q) /CSM/SS/SSC2-B/SSC246Q.Seq.d/ TNAAATACCAAATATAA...lli*y ihtyiyfkyyfncnnklfkikiapiliffffkk--- Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SSC

  12. 32 CFR 246.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... STARS AND STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS § 246.3 Definitions. (a) Adverse Conditions... position on the newspaper editorial staff of the S&S to which he or she is assigned. All mention of...

  13. Spontaneous Partitioning of Californium from Curium: Curious Cases from the Crystallization of Curium Coordination Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Cary, Samantha K.; Silver, Mark A.; Liu, Guokui; Wang, Jamie C.; Bogart, Justin A.; Stritzinger, Jared T.; Arico, Alexandra A.; Hanson, Kenneth; Schelter, Eric J.; Albrecht-Schmitt, Thomas E.

    2015-12-07

    The reaction of 248CmCl3 with excess 2,6-pyridinedicarboxylic acid (DPA) under mild solvothermal conditions results in crystallization of the tris-chelate complex Cm(HDPA)3·H2O. Approximately half of the curium remains in solution at the end of this process, and evaporation of the mother liquor results in crystallization of the bis-chelate complex [Cm(HDPA)- (H2DPA)(H2O)2Cl]Cl·2H2O. 248Cm is the daughter of the α decay of 252Cf and is extracted in high purity from this parent. However, trace amounts of 249,250,251Cf are still present in all samples of 248Cm. During the crystallization of Cm(HDPA)3·H2O and [Cm(HDPA)(H2DPA)(H2O)2Cl]Cl·2H2O, californium(III) spontaneously separates itself from the curium complexes and is found doped within crystals of DPA in the form of Cf(HDPA)3. These results add to the growing body of evidence that the chemistry of californium is fundamentally different from that of earlier actinides.

  14. 48 CFR 252.246-7002 - Warranty of construction (Germany).

    Science.gov (United States)

    2010-10-01

    ... (Germany). 252.246-7002 Section 252.246-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.246-7002 Warranty of construction (Germany). As prescribed in 246.710(4), use the following clause: Warranty of Construction (Germany) (JUN 1997) (a) In addition to any...

  15. 48 CFR 246.408-71 - Aircraft.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Aircraft. 246.408-71... Aircraft. (a) The Federal Aviation Administration (FAA) has certain responsibilities and prerogatives in connection with some commercial aircraft and of aircraft equipment and accessories (Pub. L. 85-726 (72...

  16. 32 CFR 246.4 - Policy.

    Science.gov (United States)

    2010-07-01

    ... through newspaper sales, resale of commercial publications, authorized advertising, job printing, and... STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS § 246.4 Policy. It is DoD policy that: (a) The U.S... the Stars and Stripes editorial staffs the same help provided to commercial newspapers, in...

  17. 32 CFR 246.1 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... establish and maintain a S&S board of directors to address S&S business operations in their Unified Commands. ... STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS § 246.1 Purpose. This part: (a) Establishes policy... Commands consistent with 32 CFR part 372. (b) Supersedes policies and procedures in 32 CFR part 247...

  18. 48 CFR 246.371 - Notification of potential safety issues.

    Science.gov (United States)

    2010-10-01

    ... safety issues. 246.371 Section 246.371 Federal Acquisition Regulations System DEFENSE ACQUISITION... Notification of potential safety issues. (a) Use the clause at 252.246-7003, Notification of Potential Safety Issues, in solicitations and contracts for the acquisition of— (1) Repairable or consumable...

  19. 7 CFR 246.13 - Financial management system.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Financial management system. 246.13 Section 246.13... State Agency Provisions § 246.13 Financial management system. (a) Disclosure of expenditures. The State agency shall maintain a financial management system which provides accurate, current and...

  20. 40 CFR 86.246-94 - Intermediate temperature testing.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Intermediate temperature testing. 86.246-94 Section 86.246-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.246-94...

  1. 48 CFR 52.246-14 - Inspection of Transportation.

    Science.gov (United States)

    2010-10-01

    ... Transportation. 52.246-14 Section 52.246-14 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION....246-14 Inspection of Transportation. As prescribed in 46.314, insert the following clause in solicitations and contracts for freight transportation services (including local drayage) by rail,...

  2. 40 CFR 246.202-5 - Recommended procedures: Transportation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation. 246.202-5 Section 246.202-5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.202-5 Recommended procedures: Transportation. Transportation to market may be supplied by...

  3. 40 CFR 246.200-7 - Recommended procedures: Transportation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation. 246.200-7 Section 246.200-7 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.200-7 Recommended procedures: Transportation. Transportation to market may be supplied by...

  4. 42 CFR 24.6 - Pay and compensation.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Pay and compensation. 24.6 Section 24.6 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES PERSONNEL SENIOR BIOMEDICAL RESEARCH SERVICE § 24.6 Pay and compensation. The SBRS is an ungraded system, with a single, flexible...

  5. 40 CFR 246.201-4 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.201-4 Section 246.201-4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.201-4 Recommended procedures: Market study. An investigation of markets should be made for...

  6. 40 CFR 246.202-3 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.202-3 Section 246.202-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.202-3 Recommended procedures: Market study. An investigation of markets should be made by...

  7. 40 CFR 246.200-3 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.200-3 Section 246.200-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.200-3 Recommended procedures: Market study. An investigation of markets should be made by...

  8. 7 CFR 246.16a - Infant formula cost containment.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Infant formula cost containment. 246.16a Section 246..., DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN State Agency Provisions § 246.16a Infant formula cost containment. (a) Who must use...

  9. 48 CFR 1852.246-73 - Human space flight item.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Human space flight item. 1852.246-73 Section 1852.246-73 Federal Acquisition Regulations System NATIONAL AERONAUTICS AND SPACE... 1852.246-73 Human space flight item. As prescribed in 1845.370(b), insert the following clause:...

  10. Occurrence of earthy and musty odor compounds (geosmin, 2-methylisoborneol and 2,4,6-trichloroanisole) in biologically treated wastewater.

    Science.gov (United States)

    Urase, T; Sasaki, Y

    2013-01-01

    The concentrations of earthy and musty odor compounds (2-methylisoborneol (2-MIB), geosmin and 2,4,6-trichloroanisole (TCA)) in treated wastewater were measured. Concentrations of 2,4,6-TCA (4.3-37.7 ng/L) and geosmin (3.7-42.2 ng/L) higher than their odor thresholds were detected for effluents from large-scale treatment plants. The effluent from a small-scale wastewater plant treating toilet and kitchen wastewater contained the target earthy and musty odor compounds below the odor thresholds. The ozonation applied as an advanced wastewater treatment process was considerably more effective for the removal of 2,4,6-TCA than for the removal of 2-MIB and geosmin. The measured concentrations of 2,4,6-TCA in river environments without the influence of large-scale wastewater effluents were less than the odor threshold.

  11. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source

    International Nuclear Information System (INIS)

    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction 55Mn (n.gamma)56 Mn, high concentration of manganese in the matrix and short half - life of 56Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions 56Fe(n,p)56Mn and 59 Co (n, α)56 were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  12. Long-term effects of an intracavitary treatment with californium-252 on normal tissue

    International Nuclear Information System (INIS)

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252Cf and 7000 rad from 226Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252Cf and 5000 rad from 226Ra

  13. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    Energy Technology Data Exchange (ETDEWEB)

    Cebulska-Wasilewska, A.; Rekas, K. [Institute of Nuclear Physics, Cracow (Poland); Kim, J.K. [Korea Atomic Energy Research Inst., Taejon (Korea, Republic of)

    1997-12-31

    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  14. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    International Nuclear Information System (INIS)

    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  15. Oxygen enhancement ratio (OER) and therapeutic gain factor (GF) for californium-252 at low dose rate

    International Nuclear Information System (INIS)

    The potential benefit of the introduction of californium-252 in interstitial and intracavitary therapy is related to the greater efficiency of its neutron emission against anoxic cancer cells. In that respect, the oxygen enhancement ratio (OER) of the 252Cf emission has been determined for a continuous low dose rate irradiation. The biological system is growth inhibition in Vicia faba bean roots. A new Vicia faba ''BelB'' strain has been used, which better tolerates long periods (up to about 10 hours) of anoxia. In a first series of experiments, for a 252Cf (Dsub(n+γ)) dose rate of 0.11 Gy.h-1, an OER of 1.4+-0.1 was observed (the γ contribution Dγ to the total absorbed dose Dsub(n+γ) was 0.35 at the position of the root tips). In a second series of experiments, in somewhat different geometrical conditions with a 252Cf (Dsub(n+γ)) dose rate of 0.13 Gy.h-1, an OER of 1.5+-0.1 was observed (Dγ/Dsub(n+γ)=0.42). The OER values observed for similar irradiation times, with iridium-192 γ-rays, were 2.3+-0.2 and 2.6+-0.1 respectively, which leads to therapeutic gain factors (GF) of 1.6 and 1.7 respectively. These GF values are slightly lower than those previously obtained (GF=1.8) on the same system, with d(50)-Be p(75)-Be and 15 MeV neutron beams

  16. Clinical Report on Californium-252 Neutron Intraluminal Brachytherapy Combined with External Irradiation for Cervical Carcinoma Treatment

    Institute of Scientific and Technical Information of China (English)

    Huanyu Zhao; Keming Wang; Jian Sun; Xin Geng; Weiming Zhang

    2006-01-01

    OBJECTIVE To observe the curative effects and complications of californium-252 (252Cf) neutron intraluminal brachytherapy (IBT) combined with external irradiation (El) for treatment of cervical carcinoma.METHODS From December 2000 to December 2004, 128 cases of cervical carcinoma staged into ⅡA~ⅢB according to the International Federation of Gynecology and Obstetrics (FIGO) standards were treated with 252Cf neutron IBT using 8~10 Gy per fraction, once a week. The total dose at reference A point was 36~40 Gy in 4~5 fractions. From the second day after 252Cf neutron IBT treatment, the whole pelvic cavity was treated with 60Co γ-ray El, applying 2 Gy per fraction, 4 times per week. After 20~25 Gy of El, the center of the whole pelvic field was blocked with 4 cm of lead in width. The total dose of El was 45~50 Gy.RESULTS The short-term therapeutic effects were CR 95.3% and PR 4.7%. The 3 and 5-year local control rates were 93.5% and 87.9%. The overall 3-year survival rate was 87.5% and for Stages Ⅱ and Ⅲ , 90.9%and 81.5% respectively; the overall 5-year survival rate was 70% and for Stages Ⅱ and Ⅲ, 76.2% and 61% respectively. The rate of radiation complications was 4.7% for radiation cystitis, 7.8% for radiation proctitis, 6.3%for vagina contracture and adhesion and 5.5% for protracted radiation proctitis.CONCLUSION An combination of 252Cf neutron IBT with El for treatment of cervical carcinoma can be well-tolerated by cervical carcinoma patients. The rate of local tumor control is high and radiation complications are few.

  17. Divalent and trivalent gas-phase coordination complexes of californium: evaluating the stability of Cf(ii).

    Science.gov (United States)

    Dau, Phuong D; Shuh, David K; Sturzbecher-Hoehne, Manuel; Abergel, Rebecca J; Gibson, John K

    2016-08-01

    The divalent oxidation state is increasingly stable relative to the trivalent state for the later actinide elements, with californium the first actinide to exhibit divalent chemistry under moderate conditions. Although there is evidence for divalent Cf in solution and solid compounds, there are no reports of discrete complexes in which Cf(II) is coordinated by anionic ligands. Described here is the divalent Cf methanesulfinate coordination complex, Cf(II)(CH3SO2)3(-), prepared in the gas phase by reductive elimination of CH3SO2 from Cf(III)(CH3SO2)4(-). Comparison with synthesis of the corresponding Sm and Cm complexes reveals reduction of Cf(III) and Sm(III), and no evidence for reduction of Cm(III). This reflects the comparative 3+/2+ reduction potentials: Cf(3+) (-1.60 V) ≈ Sm(3+) (-1.55 V) ≫ Cm(3+) (-3.7 V). Association of O2 to the divalent complexes is attributed to formation of superoxides, with recovery of the trivalent oxidation state. The new gas-phase chemistry of californium, now the heaviest element to have been studied in this manner, provides evidence for Cf(II) coordination complexes and similar chemistry of Cf and Sm. PMID:27424652

  18. Mesityl(2,4,6-trimethoxyphenylborinic acid

    Directory of Open Access Journals (Sweden)

    Sergiusz Luliński

    2010-07-01

    Full Text Available In the title molecule, C18H23BO4, the dihedral angle between the least-squares planes of the aromatic rings is 84.88 (3°. The B atom deviates by 0.202 (1 Å from the least-squares plane of the mesityl ring. All of the methoxy groups are approximately coplanar with the 2,4,6-trimethoxyphenyl ring, whereas the BOH group is twisted with respect to it by 19.5°. The borinic OH group is engaged in an intramolecular O—H...O hydrogen bond with one of ortho-methoxy groups. The molecular structure is stabilized by weak C—H...O contacts. In the crystal, molecules are linked by weak C—H...O and C—H...π interactions, generating a three-dimensional network.

  19. 48 CFR 852.246-72 - Frozen processed foods.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Frozen processed foods. 852.246-72 Section 852.246-72 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS... Frozen processed foods. As prescribed in 846.302-72, insert the following clause: Frozen Processed...

  20. 40 CFR 98.246 - Data reporting requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Data reporting requirements. 98.246 Section 98.246 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... device. These values may be estimated based on engineering analyses. These values are not to be used...

  1. Solving the Hydration Structure of the Heaviest Actinide Aqua Ion Known: The Californium(III) Case

    Energy Technology Data Exchange (ETDEWEB)

    Den Auwer, Ch.; Guillaumont, D. [CEA Marcoule, Nucl Energy Div, Radiochem Proc Dept, SCPS LILA, 30 (France); Galbis, E.; Pappalardo, Rafael R.; Marcos Sanchez, E. [Univ Seville, Dept Quim Fis, E-41012 Seville (Spain); Hernandez-Cobos, J. [Inst Ciencias Fis, Cuernavaca 62251, Morelos (Mexico); Le Naour, C.; Simoni, E. [Univ Paris Sud, Inst Phys Nucl Orsay, Paris (France)

    2010-07-01

    In summary, the first MC simulation of the trivalent cation of californium, based on an exchangeable hydrated ion-water intermolecular potential, has been shown to extend and improve the hydrated ion model. Likewise, the CfL{sub III}-edge EXAFS spectrum of an acidic 1 mm Cf(ClO{sub 4}){sub 3} aqueous solution recorded under optimized experimental conditions has greatly improved the signal/noise ratio of the only previously recorded spectrum. The comparison of the experimental EXAFS spectrum with the two computed ones, obtained from two different intermolecular potentials that predict eight (BP86) or nine (MP2) water molecules in the first coordination shell, leads to the conclusion that the lowest hydration number is preferred. Then, as Cf{sup III} is the heaviest actinide aqua ion for which there is experimental information, the actinide contraction is supported by the present study. (For U{sup III}, R{sub U-O}=2.56 Angstroms, and CN=9{+-}1; for Pu{sup III}, R{sub Pu-O}=2.51 Angstroms and CN=9{+-}1; for Cm{sup III}, R{sub Cm-O}=2.47 Angstroms and CN=9{+-}1). The role of the second hydration shell is important in defining the structure and dynamics of the Cf{sup III} aqua ion, but the contribution of second-shell water molecules to the EXAFS signal as back-scatters is marginal. Finally, this work gives an illustrative example of the benefits which can be achieved from the combination of experimental X-ray absorption spectroscopy and computer simulations. The usefulness of the simultaneous analysis of the results as well as the importance of the structural statistical average has been clearly demonstrated herein. Each technique independently was not adequate. We believe that this study traces out a still poorly explored combined methodology which may be extremely useful for many other complexes and chemical problems. A systematic theoretical and experimental examination of the other known actinide cations on the same basis should be undertaken to confirm the

  2. 48 CFR 246.704 - Authority for use of warranties.

    Science.gov (United States)

    2010-10-01

    ... acquisitions for— (i) Commercial items (see FAR 46.709); (ii) Technical data, unless the warranty provides for extended liability (see 246.708); (iii) Supplies and services in fixed-price type contracts...

  3. 48 CFR 252.246-7003 - Notification of Potential Safety Issues.

    Science.gov (United States)

    2010-10-01

    ... Safety Issues. 252.246-7003 Section 252.246-7003 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.246-7003 Notification of Potential Safety Issues. As prescribed in 246.371(a), use the following clause: Notification of Potential Safety Issues (JAN 2007)...

  4. Development of electron beam ion source charge breeder for rare isotopes at Californium Rare Isotope Breeder Upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Kondrashev, S.; Dickerson, C.; Levand, A.; Ostroumov, P. N.; Pardo, R. C.; Savard, G.; Vondrasek, R. [Physics Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Alessi, J.; Beebe, E.; Pikin, A. [Collider-Accelerator Department, Brookhaven National Laboratory, Upton, New York 11973 (United States); Kuznetsov, G. I.; Batazova, M. A. [Budker Institute of Nuclear Physics, Novosibirsk 630090 (Russian Federation)

    2012-02-15

    Recently, the Californium Rare Isotope Breeder Upgrade (CARIBU) to the Argonne Tandem Linac Accelerator System (ATLAS) was commissioned and became available for production of rare isotopes. Currently, an electron cyclotron resonance ion source is used as a charge breeder for CARIBU beams. To further increase the intensity and improve the purity of neutron-rich ion beams accelerated by ATLAS, we are developing a high-efficiency charge breeder for CARIBU based on an electron beam ion source (EBIS). The CARIBU EBIS charge breeder will utilize the state-of-the-art EBIS technology recently developed at Brookhaven National Laboratory (BNL). The electron beam current density in the CARIBU EBIS trap will be significantly higher than that in existing operational charge-state breeders based on the EBIS concept. The design of the CARIBU EBIS charge breeder is nearly complete. Long-lead components of the EBIS such as a 6-T superconducting solenoid and an electron gun have been ordered with the delivery schedule in the fall of 2011. Measurements of expected breeding efficiency using the BNL Test EBIS have been performed using a Cs{sup +} surface ionization ion source for external injection in pulsed mode. In these experiments we have achieved {approx}70% injection/extraction efficiency and breeding efficiency into the most abundant charge state of {approx}17%.

  5. Development of electron beam ion source charge breeder for rare isotopes at Californium Rare Isotope Breeder Upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Kondrashev S.; Alessi J.; Dickerson, C.; Levand, A.; Ostroumov, P.N.; Pardo, R.C.; Savard, G.; Vondrasek, R.; Beebe, E.; Pikin, A.; Kuznetsov, G.I.; Batazova, M.A.

    2012-02-03

    Recently, the Californium Rare Isotope Breeder Upgrade (CARIBU) to the Argonne Tandem Linac Accelerator System (ATLAS) was commissioned and became available for production of rare isotopes. Currently, an electron cyclotron resonance ion source is used as a charge breeder for CARIBU beams. To further increase the intensity and improve the purity of neutron-rich ion beams accelerated by ATLAS, we are developing a high-efficiency charge breeder for CARIBU based on an electron beam ion source (EBIS). The CARIBU EBIS charge breeder will utilize the state-of-the-art EBIS technology recently developed at Brookhaven National Laboratory (BNL). The electron beam current density in the CARIBU EBIS trap will be significantly higher than that in existing operational charge-state breeders based on the EBIS concept. The design of the CARIBU EBIS charge breeder is nearly complete. Long-lead components of the EBIS such as a 6-T superconducting solenoid and an electron gun have been ordered with the delivery schedule in the fall of 2011. Measurements of expected breeding efficiency using the BNL Test EBIS have been performed using a Cs{sup +} surface ionization ion source for external injection in pulsed mode. In these experiments we have achieved {approx}70% injection/extraction efficiency and breeding efficiency into the most abundant charge state of {approx}17%.

  6. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

    1976-01-01

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  7. Preparation of actinide targets by electrodeposition

    Science.gov (United States)

    Trautmann, N.; Folger, H.

    1989-10-01

    Actinide targets with varying thicknesses on different substrates have been prepared by electrodeposition either from aqueous solutions or from solutions of their nitrates in isopropyl alcohol. With these techniques the actinides can be deposited almost quantitatively on various backing materials within 15 to 30 min. Targets of thorium, uranium, neptunium, plutonium, americium, curium and californium with areal densities from almost carrier-free up to 1.4 mg/cm 2 on thin beryllium, carbon, titanium, tantalum and platinum foils have been prepared. In most cases, prior to the deposition, the actinides had to be purified chemically and for some of them, due to the limited amount of material available, recycling procedures were required. Applications of actinide targets in heavy-ion reactions are briefly discussed.

  8. 48 CFR 452.246-70 - Inspection and Acceptance.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Inspection and Acceptance... AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 452.246-70 Inspection and Acceptance. As prescribed in 446.370, insert the following clause: Inspection and...

  9. 48 CFR 1352.246-70 - Place of acceptance.

    Science.gov (United States)

    2010-10-01

    ... under this contract. (b) The place of acceptance will be: (End of clause) ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Place of acceptance. 1352... FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 1352.246-70 Place...

  10. 7 CFR 246.6 - Agreements with local agencies.

    Science.gov (United States)

    2010-01-01

    ... nutrition education services to participants, in compliance with § 246.11 and FNS guidelines and... Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND...

  11. 48 CFR 52.246-17 - Warranty of Supplies of a Noncomplex Nature.

    Science.gov (United States)

    2010-10-01

    ... Noncomplex Nature. 52.246-17 Section 52.246-17 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.246-17 Warranty of Supplies of a Noncomplex Nature. As prescribed in 46.710(a)(1), insert a clause substantially as follows: Warranty of Supplies of a Noncomplex Nature (JUN 2003) (a)...

  12. 48 CFR 552.246-77 - Additional Contract Warranty Provisions for Supplies of a Noncomplex Nature.

    Science.gov (United States)

    2010-10-01

    ... Warranty Provisions for Supplies of a Noncomplex Nature. 552.246-77 Section 552.246-77 Federal Acquisition... a Noncomplex Nature. As prescribed in 546.710(a), insert the following clause in solicitations and contracts that include FAR 52.246-17, Warranty of Supplies of a Noncomplex Nature. Additional...

  13. 48 CFR 52.246-18 - Warranty of Supplies of a Complex Nature.

    Science.gov (United States)

    2010-10-01

    ... Complex Nature. 52.246-18 Section 52.246-18 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.246-18 Warranty of Supplies of a Complex Nature. As prescribed in 46.710(b)(1), insert a clause substantially as follows: Warranty of Supplies of a Complex Nature (MAY 2001) (a) Definitions. As used in...

  14. 10 CFR 431.246 - Energy conservation standards and their effective dates.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy conservation standards and their effective dates. 431.246 Section 431.246 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY EFFICIENCY PROGRAM FOR CERTAIN COMMERCIAL AND INDUSTRIAL EQUIPMENT Unit Heaters Energy Conservation Standards § 431.246...

  15. Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

    Science.gov (United States)

    Amari, S.; Bouhafs, B.

    2016-09-01

    Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young's modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

  16. Determination of 2,4,6-trichloroanisole by cyclic voltammetry

    OpenAIRE

    Freitas, Patrícia; Dias, L.G.; Peres, António M.; Luís M. de Castro; Veloso, Ana C. A.

    2012-01-01

    The electrochemical reduction of 2,4,6-trichloroanisole (TCA), which is a chlorinated arene with electron-donating substituents, was evaluated by cyclic voltammetry (CV). TCA is a major concern for the winery industry since it is related with “cork taint”, a wine defect. The results obtained in this work showed that CV could be used to detect and quantify TCA in preparative standard solutions. Linear relationships could be set between the current amplitude and TCA concentration (R...

  17. Photocatalytic degradation of 2,4,6-trinitrotoluene

    Institute of Scientific and Technical Information of China (English)

    LIU XiuHua; FU YiBei; WANG HeYi; ZHONG ZhiJing; XU YunShu

    2008-01-01

    A Pt/TiO2 photocatalyst was used in the photocatalytic degradation of 2,4,6-trinitrotoluene (TNT) under the irradiation of the simulated sunlight. The results show that the destruction of TNT is faster and more complete with the photocatalyst. The photocatalytic degradation of TNT follows first order kinetics. The transformation of nitryl groups of TNT molecules into nitrite and nitrate ions may be accelerated in the presence of the Pt/TiO2 photocatalyst. Compared with that without the catalyst, the concentration of nitrate ions was improved 32.3 times within 2.5 h.

  18. Photocatalytic degradation of 2,4,6-trinitrotoluene

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    A Pt/TiO2 photocatalyst was used in the photocatalytic degradation of 2,4,6-trinitrotoluene (TNT) under the irradiation of the simulated sunlight. The results show that the destruction of TNT is faster and more complete with the photocatalyst. The photocatalytic degradation of TNT follows first order kinet-ics. The transformation of nitryl groups of TNT molecules into nitrite and nitrate ions may be acceler-ated in the presence of the Pt/TiO2 photocatalyst. Compared with that without the catalyst, the concentration of nitrate ions was improved 32.3 times within 2.5 h.

  19. Anatomy of a controversy: Application of the Langevin technique to the analysis of the Californium-252 Source-Driven Noise Analysis method for subcriticality determination

    International Nuclear Information System (INIS)

    The expressions for the power spectral density of the noise equivalent sources have been calculated explicitly for the (a) stochastic transport equation, (b) the one-speed transport equaton, (c) the one-speed P1 equations, (d) the one-speed diffusion equation and (e) the point kinetic equation. The stochastic nature of Fick's law in (d) has been emphasized. The Langevin technique has been applied at various levels of approximation to the interpretation of the Californium-252 Source-Driven Noise Analysis (CSDNA) experiment for determining the reactivity in subcritical media. The origin of the controversy surrounding this method has been explained. The foundations of the CSDNA method as a viable experimental technique to infer subcriticality from a measured ratio of power spectral densities of the outputs of two neutron detectors and a third external source detector has been examined by solving the one-speed stochastic diffusion equation for a point external Californium-252 source and two detectors in an infinite medium. The expression relating reactivity to the measured ratio of PSDs was found to depend implicitly on k itself. Through a numerical analysis fo this expression, the authors have demonstrated that for a colinear detector-source-detector configuration for neutron detectors far from the source, the expression for the subcritical multiplication factor becomes essentially insensitive to k, hence, demonstrating some possibility for the viability of this technique. However, under more realistic experimental conditions, i.e., for finite systems in which diffusion theroy is not applicable, the measurement of the subcritical multiplication factor from a single measured ratio of PSDs, without extensive transport calculations, remains doubtful

  20. Headspace-multicapillary column-ion mobility spectrometry for the direct analysis of 2,4,6-trichloroanisole in wine and cork samples.

    Science.gov (United States)

    Márquez-Sillero, Isabel; Cárdenas, Soledad; Valcárcel, Miguel

    2012-11-23

    Headspace-multicapillary column-ion mobility spectrometry coupling has been evaluated for the direct analysis of wine and cork stopper samples for the determination of 2,4,6-trichloroanisole (2,4,6-TCA). The instrumental configuration permits the sample to be introduced in headspace vials which are placed into the autosampler oven in order to facilitate the transference of the volatile compounds from the sample to its headspace. Further, an aliquot of 200 μL of the homogenized gaseous phase is injected into the multicapillary column in order to separate the target compounds from potential interferents. The detection of 2,4,6-TCA was carried out in an ion mobility spectrometer with a radioactive source and working under negative mode. All the system was computer controlled, including data acquisition and treatment. The limits of detection achieved were 0.012 ng L(-1) for wine and 0.28 ng g(-1) for the cork stopper. The procedure was applied to the analysis of commercial wine samples in different packages and 2,4,6-TCA was found in all of those closed with a cork stopper. The excellent recovery values obtained testify for the goodness of the method as no interference from the sample matrix exits.

  1. Californium-252 neutron sources

    International Nuclear Information System (INIS)

    Major production programs for the Savannah River reactors and the High Flux Isotopes Reactor at Oak Ridge have made 252Cf one of the most available and, at the USAEC's sales price of $10/μg, one of the least-expensive isotopic neutron sources. Reactor production has totaled approximately 2 g, and, based on expected demand, an additional 10 g will be produced in the next decade. The approximately 800 mg chemically separated to date has been used to prepare over 600 neutron sources. Most, about 500, have been medical sources containing 1 to 5 μg of 252Cf plated in needles for experimental cancer therapy studies. The remainder have generally been point sources containing 10 μg to 12 mg of oxide for activation, well logging, or radiography uses. Bulk sources have also been supplied to the commercial encapsulators. The latest development has been the production of 252Cf cermet wire which can be cut into almost contamination-free lengths of the desired 252Cf content. Casks are available for transport of sources up to 50 mg. Subcritical assemblies have been developed to multiply the source neutrons by a factor of 10 to 40, and collimators and thermalizers have also been extensively developed to shape the neutron flux and energy distributions for special applications. (U.S.)

  2. 32 CFR Appendix E to Part 246 - Stars and Stripes (S&S) Board of Directors

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Stars and Stripes (S&S) Board of Directors E... DEFENSE (CONTINUED) MISCELLANEOUS STARS AND STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS Pt. 246, App. E Appendix E to Part 246—Stars and Stripes (S&S) Board of Directors A. Organization and...

  3. 25 CFR 1000.246 - Must an AFA that contains a construction project or activity incorporate provisions of Federal...

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Must an AFA that contains a construction project or activity incorporate provisions of Federal construction standards? 1000.246 Section 1000.246 Indians OFFICE... Construction § 1000.246 Must an AFA that contains a construction project or activity incorporate provisions...

  4. 33 CFR 148.246 - When is a document considered filed and where should I file it?

    Science.gov (United States)

    2010-07-01

    ... filed and where should I file it? 148.246 Section 148.246 Navigation and Navigable Waters COAST GUARD... Formal Hearings § 148.246 When is a document considered filed and where should I file it? (a) If a document to be filed is submitted by mail, it is considered filed on the date it is postmarked. If...

  5. Feasibility of fluoroelastomer-246B as the substitute of bile duct%氟橡胶246B作为胆管替代物的可行性

    Institute of Scientific and Technical Information of China (English)

    刘凯; 王广义; 刘松阳

    2008-01-01

    BACKGROUND: Fluoroelastomer-246B has better histocompatibility than polyethylene and polypropylene, which is the same as expanded polytetrafiuoroethylene (ePTFE). Besides, fluoroelastomer-246B has better rigidity than ePTFE, so it is hard to deform.OBJECTIVE: To investigate the feasibility of fluoroelastomer-246B as a human implant in vivo and a substitute of human bile duct by the test of bile soak, routine sterilized method, and implantation into rat abdominal cavity.DESIGN: A controlled observation.SETTING: First Hospital of Jilin University & Key Laboratory of Education Ministry for Supramolecular Structure and Material of Jilin University.MATERIALS: This study was performed at the Key Laboratory of Education Ministry for Supramolecular Structure and Material of Jilin University from June 2006 to March 2007. A total of 35 male Wistar rats of clean grade, aged 4-5 weeks,weighing 140-160 g, were provided by Laboratory Animal Center, School of Basic Medical Sciences, Jilin University [Permission No. SCXK (Ji) 2003-0001]. Prior to surgery, the Wistar rats were fasted for 5 hours, but they were allowed to access to water freely. The main materials used in the present study were as follows: fluoroelastomer-246B (Yangzhong Municipal Rubber & Plastics Plant, China), ePTFE(Shanghai Suo-Kang Medical Implants Co.,Ltd., China).METHODS: Rectangular fluoroelastomer-246B thin slices (50 mm×10 mm×0.5 mm) made were placed in a beaker filled with fresh bile, and preserved in a 37 ℃ thermostat container. The tensile strength, thermal decomposition temperature and glass transition temperature of fluoroelastomer-246B were tested after 30 days, and the results were compared to those before soaking to investigate whether the physical-chemical properties of fluoroelastomer-246B slices would change after soaking in the bile environment for a long time. The rectangular fluoroelastomer-246B thin slices made as above were sterilized by boiling method, formaldehyde vapors fumigating

  6. Two new polytypes of 2,4,6-tribromobenzonitrile

    Directory of Open Access Journals (Sweden)

    Doyle Britton

    2016-02-01

    Full Text Available Three polymorphs of 2,4,6-tribromobenzonitrile (RCN, C7H2Br3N, two of which are novel and one of which is a redetermination of the original structure first determined by Carter & Britton [(1972. Acta Cryst. B28, 945–950] are found to be polytypic. Each has a layer structure which differs only in the stacking of the layers. Each layer is composed of molecules associated through C[triple-bond]N...Br contacts which form R22(10 rings. Two such rings are associated with each N atom; one with each ortho-Br atom. No new polytypes of 1,3,5-tribromo-2-isocyanobenzene (RNC were found but a re-determination of the original structure by Carter et al. [(1977. Cryst. Struct. Commun. 6, 543–548] is presented. RNC was found to be isostructural with one of the novel polytypes of RCN. Unit cells were determined for 23 RCN samples and 11 RNC samples. Polytypes could not be distinguished based on crystal habits. In all four structures, each molecule of the asymmetric unit lies across a mirror plane.

  7. Californium interrogation prompt neutron (CIPN) instrument for non-destructive assay of spent nuclear fuel-Design concept and experimental demonstration

    Science.gov (United States)

    Henzlova, D.; Menlove, H. O.; Rael, C. D.; Trellue, H. R.; Tobin, S. J.; Park, Se-Hwan; Oh, Jong-Myeong; Lee, Seung-Kyu; Ahn, Seong-Kyu; Kwon, In-Chan; Kim, Ho-Dong

    2016-01-01

    This paper presents results of the first experimental demonstration of the Californium Interrogation Prompt Neutron (CIPN) instrument developed within a multi-year effort launched by the Next Generation Safeguards Initiative Spent Fuel Project of the United States Department of Energy. The goals of this project focused on developing viable non-destructive assay techniques with capabilities to improve an independent verification of spent fuel assembly characteristics. For this purpose, the CIPN instrument combines active and passive neutron interrogation, along with passive gamma-ray measurements, to provide three independent observables. This paper describes the initial feasibility demonstration of the CIPN instrument, which involved measurements of four pressurized-water-reactor spent fuel assemblies with different levels of burnup and two initial enrichments. The measurements were performed at the Post-Irradiation Examination Facility at the Korea Atomic Energy Institute in the Republic of Korea. The key aim of the demonstration was to evaluate CIPN instrument performance under realistic deployment conditions, with the focus on a detailed assessment of systematic uncertainties that are best evaluated experimentally. The measurements revealed good positioning reproducibility, as well as a high degree of insensitivity of the CIPN instrument's response to irregularities in a radial burnup profile. Systematic uncertainty of individual CIPN instrument signals due to assembly rotation was found to be orientation in the instrument.

  8. 10 CFR 72.246 - Issuance of amendment to a certificate of compliance.

    Science.gov (United States)

    2010-01-01

    ... INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of Spent Fuel Storage Casks § 72.246 Issuance of amendment to a certificate...

  9. Pathway of the ozonation of 2,4,6-trichlorophenol in aqueous solution

    Institute of Scientific and Technical Information of China (English)

    PI Yunzheng; WANG Jianlong

    2007-01-01

    The reaction mechanism and pathway of the ozonation of 2,4,6-trichlorophenol(2,4,6-TCP)in aqueous solution were investigated.The removal efficiency and the variation of H2O2,Cl-,formic acid,and oxalic acid were studied during the semi-batch ozonation experiments(continuous for ozone gas supply,fixed volume of water sample).The results showed that when there was no scavenger,the removal efficiency of 0.1 mmol/L 2,4,6-TCP could reach 99% within 6 min by adding 24 mg/L ozone.The reaction of molecular ozone with 1 2,4,6-TCP resulted in the formation of H2O2.The maximal concentration of H2O2 detected during the ozonation could reach 22.5% of the original concentration of 2,4,6-TCP.The reaction of ozone with H2O2 resulted in the molecule firstly degraded 2,4,6-TCP to form chlorinated quinone,which was subsequently oxidized to formic acid and oxalic acid.Two reaction pathways of the degradation of 2,4,6-TCP by ozone and O2/OH·were proposed in this study.

  10. Inhibitory activities against rice pathogens of 8-hydroxy-2,4,6-octatriynamide from Agrocybe sp.

    Science.gov (United States)

    Zheng, Yongbiao; Xu, Xiaoping; Wu, Yabin

    2016-03-01

    8-Hydroxy-2,4,6-octatriynamide, a natural polyacetylene with inhibitory activities against rice pathogens, was isolated from the liquid fermentation broth of strain Agrocybe sp. YB2005 during screening for new natural chemical agents to control rice pathogens. 8-hydroxy-2,4,6-octatriynamide was purified by consecutive chromatography over a Cl8 reversed phase silica gel, sephadex LH-20 and silica gel. The chemical structure of 8-hydroxy-2,4,6-octatriynamide was elucidated through spectroscopic analyses, including 1D- and 2D-NMR, ESI mass spectrometry and X-ray single crystal diffraction. Bioassays showed that 8-hydroxy-2,4,6-octatriynamide could significantly inhibit growth of Xanthomonas oryzae with an MIC of 53.1 μM in a 96-well plate and the growth of Rhizoctonia solani at 1.02 mM in a 24-well plate. When rice leaves were inoculated with Magnaporthe grisea and cultured in artificial nutrition liquid containing 0.34 mM 8-hydroxy-2,4,6-octatriynamide, no rice blast was observed. The present study implied that 8-hydroxy-2,4,6-octatriynamide could be a candidate agent against rice pathogens. PMID:26861586

  11. Biological Efficiency of Californium-252 Source Evaluated by Comet Assay, Classical Cytogenetics and FISH in Human Lymphocytes Irradiated without and with BSH Pretreatment

    International Nuclear Information System (INIS)

    Biological effectiveness of californium-252 source was evaluated after irradiations in vitro of normal or pre-treated with compound enriched in B-10 ion cells. Peripheral blood lymphocytes were used as a model for human cells. DNA and chromosomal damage were studied to compare biological effectiveness of irradiation. Human blood samples or isolated lymphocytes were irradiated with the isotopic source of 252Cf, at the Faculty of Physics and Nuclear Techniques at the University of Mining and Metallurgy (both neutron source and samples were placed in ''infinite'' polyethylene block). Chemical pretreatment with Na210B12H11SH (BSH) was performed to introduce boron-10 ion into cells in order to check any enhancement effect due to the process of boron neutron capture. Single cell gel electrophoresis also known as the Comet assay was done to investigate the DNA damage. Classical cytogenetic analysis was applied to assess the frequencies of unstable aberrations (dicentrics, rings and a centric fragments). To evaluate the frequencies of stable aberrations the fluorescence in situ hybridisation (FISH) with probes for chromosomes 1, 4 (14.3% of the whole genome) was performed. Linear (or close to linear) increase with radiation dose were observed for the DNA damage and aberration frequencies in lymphocytes both untreated or pre-treated with BSH. Levels of translocations evaluated for the whole genome were comparable with the frequencies of dicentrics and rings. No significant differences were detected due to radiation dose in the frequencies of sister chromatid exchanges (SCE) detected in the second mitosis. No statistically significant differences were observed in various biological end-points between normal or boron pre-treated cells. (author)

  12. Isolation of Pseudomonas pickettii strains that degrade 2,4,6-trichlorophenol and their dechlorination of chlorophenols.

    OpenAIRE

    Kiyohara, H.; Hatta, T; Ogawa, Y.; T Kakuda; H. Yokoyama; Takizawa, N

    1992-01-01

    Three strains of Pseudomonas pickettii that can grow with 2,4,6-trichlorophenol (2,4,6-TCP) as the sole source of carbon and energy were isolated from different mixed cultures of soil bacterial populations that had been acclimatized to 2,4,6-TCP. These strains released 3 mol of chloride ion from 1 mol of 2,4,6-TCP during the complete degradation of the TCP. Of these strains, P. pickettii DTP0602 in high-cell-density suspension cultures dechlorinated various chlorophenols (CPs). Cells that wer...

  13. Functions of Flavin Reductase and Quinone Reductase in 2,4,6-Trichlorophenol Degradation by Cupriavidus necator JMP134▿

    OpenAIRE

    Belchik, Sara Mae; Xun, Luying

    2007-01-01

    The tcpRXABCYD operon of Cupriavidus necator JMP134 is involved in the degradation of 2,4,6-trichlorophenol (2,4,6-TCP), a toxic pollutant. TcpA is a reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenase that converts 2,4,6-TCP to 6-chlorohydroxyquinone. It has been implied via genetic analysis that TcpX acts as an FAD reductase to supply TcpA with FADH2, whereas the function of TcpB in 2,4,6-TCP degradation is still unclear. In order to provide direct biochemical evidence for t...

  14. Condensation monomers and polymers based on 2,4,6-trinitrotoluene

    International Nuclear Information System (INIS)

    The feasibility of conversion of 2,4,6-trinitrotoluene into condensation monomers (nitro compounds, diamines, etc.) and their applications in the synthesis of aromatic polymers has been analysed within the framework of a general problem of 2,4,6-trinitroluene conversion. The use of aromatic dinitro compounds and diamines for the preparation of oligomeric polyethers and polyamides (or polyimides), respectively, is considered. The possibility of the synthesis of polyamides and polyimides containing side aliphatic and aromatic groups and possessing better (in comparison with the corresponding unsubstituted polymers) characteristics is demonstrated.

  15. Coordination chemistry of 2,4,6-tri(pyridyl)-1,3,5-triazine ligands

    OpenAIRE

    Therrien, Bruno

    2012-01-01

    This review covers the rich coordination chemistry of 2,4,6-tri(pyridyl)-1,3,5-triazine ligands. These polypyridyl derivatives have been coupled to transition metals and lanthanides, and the complexes obtained have been used in various fields such as luminescent materials, for the preparation of coordination polymers and networks as well as for the synthesis of discrete metalla-assemblies. The synthetic and structural aspects of the different isomers of 2,4,6-tri(pyridyl)-1,3,5-triazine are p...

  16. A systematic study on the absorption and fluorescence properties of 2,4,6-triaryl and tripyridylpyridines

    OpenAIRE

    FINDIK, Esra; ARIK, Mustafa; Ceylan, Mustafa

    2009-01-01

    Eight different 2,4,6-triaryl, and tripyridylpridines compounds were synthesized and their fluorescent properties were studied by using steady-state and time-resolved fluorescence and UV-Vis absorption spectroscopy techniques in 6 different solvents. Especially, 2,4,6-triarylpyridines showed strong fluorescence properties with high fluorescence quantum yields but small Stokes shifts.

  17. 48 CFR 52.246-19 - Warranty of Systems and Equipment under Performance Specifications or Design Criteria.

    Science.gov (United States)

    2010-10-01

    ... Equipment under Performance Specifications or Design Criteria. 52.246-19 Section 52.246-19 Federal... under Performance Specifications or Design Criteria. As prescribed in 46.710(c)(1), the contracting officer may insert a clause substantially as follows: Warranty of Systems and Equipment Under...

  18. APR-246/PRIMA-1(MET) rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations.

    Science.gov (United States)

    Shen, Jinfeng; van den Bogaard, Ellen H; Kouwenhoven, Evelyn N; Bykov, Vladimir J N; Rinne, Tuula; Zhang, Qiang; Tjabringa, Geuranne S; Gilissen, Christian; van Heeringen, Simon J; Schalkwijk, Joost; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing

    2013-02-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome patients with p63 mutations as an in vitro human model to study the disease mechanism in the skin of EEC patients. We show that these patient keratinocytes cultured either in submerged 2D cultures or in 3D skin equivalents have impaired epidermal differentiation and stratification. Treatment of these patient keratinocytes with the mutant p53-targeting compound APR-246/PRIMA-1(MET) (p53 reactivation and induction of massive apoptosis) that has been successfully tested in a phase I/II clinical trial in cancer patients partially but consistently rescued morphological features and gene expression during epidermal stratification in both 2D and 3D models. This rescue coincides with restoration of p63 target-gene expression. Our data show that EEC patient keratinocytes with p63 mutations can be used for characterization of the abnormal molecular circuitry in patient skin and may open possibilities for the design of novel pharmacological treatment strategies for patients with mutant p63-associated developmental abnormalities. PMID:23355676

  19. Complete dissipation of 2,4,6-trinitrotoluene by in-vessel composting

    NARCIS (Netherlands)

    Gumuscu, Burcu; Cekmecelioglu, Deniz; Tekinay, Turgay

    2016-01-01

    We demonstrate complete removal of 2,4,6-trinitrotoluene (TNT) in 15 days using an in-vessel composting system, which is amended with TNT-degrading bacteria strains. A mixture of TNT, food waste, manure, wood chips, soil and TNT-degrading bacteria consortium are co-composted for 15 days in an aerobi

  20. 8 CFR 246.4 - Immigration judge's authority; withdrawal and substitution.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Immigration judge's authority; withdrawal... IMMIGRATION REGULATIONS RESCISSION OF ADJUSTMENT OF STATUS § 246.4 Immigration judge's authority; withdrawal and substitution. In any proceeding conducted under this part, the immigration judge shall...

  1. SAGE ANALYSIS OF TRANSCRIPTOME RESPONSES IN ARABIDOPSIS ROOTS EXPOSED TO 2,4,6-TRINITROTOLUENE

    Science.gov (United States)

    Serial Analysis of Gene Expression (SAGE) was used to profile transcript levels in Arabidopsis thaliana roots and assess their responses to 2,4,6-trinitrotoluene (TNT) exposure. SAGE libraries representing control and TNT-exposed seedling root transcripts were constructed, and ea...

  2. Oral exposure of adult zebrafish (Danio rerio) to 2,4,6-tribromophenol affects reproduction

    DEFF Research Database (Denmark)

    Halden, Anna Norman; Nyholm, Jenny Rattfelt; Andersson, Patrik L;

    2010-01-01

    The bromophenol 2,4,6-tribromophenol (TBP) is widely used as an industrial chemical, formed by degradation of tetrabromobisphenol-A, and it occurs naturally in marine organisms. Concentrations of TBP in fish have been related to intake via feed, but little is known about effects on fish health...

  3. 32 CFR Appendix C to Part 246 - Personnel Policies and Procedures

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) MISCELLANEOUS STARS AND STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS Pt. 246, App. C Appendix... of personnel management concepts. The system shall provide maximum authority and accountability to... employees, the S&S civilian personnel shall abide by 32 CFR part 40, the Department of Defense, the...

  4. Levan-type fructooligosaccharide production using Bacillus licheniformis RN-01 levansucrase Y246S immobilized on chitosan beads

    Directory of Open Access Journals (Sweden)

    Surawut Sangmanee

    2016-06-01

    Full Text Available Bacillus licheniformis RN-01 levansucrase Y246S (LsRN-Y246S was immobilized by covalently linking onto chitosan, Sepabead EC-EP, and Sepabead EC-HFA, beads. The stability of immobilized LsRN-Y246S was found to be the highest with chitosan beads, retaining more than 70% activity after 13 weeks storage at 4 oC, and 68% activity after 12 hours incubation at 40°C. LsRN-Y246S immobilized on chitosan beads withstands sucrose concentrations up to 70% (w/v, retaining over 85% of its activity, significantly better than LsRN-Y246S immobilized on others supporting matrices. LsRN-Y246S immobilized on chitosan showed a 2.4 fold increase in activity in the presence of Mn2+, and gave slight protection against deactivation by of Cu2+, Zn2+, Fe3+, SDS and EDTA. A maximum of 8.36 g and an average of 7.35 g LFOS yield at least up to DP 11 can be produced from 25 g of sucrose, during five production cycles. We have demonstrated that LFOS can be effectively produced by chitosan immobilized LsRN-Y246S and purified.

  5. Theoretical design of energetic nitrogen-rich derivatives of 1,7-diamino-1,7-dinitrimino-2,4,6-trinitro-2,4,6-triazaheptane.

    Science.gov (United States)

    Wu, Qiong; Zhu, Weihua; Xiao, Heming

    2013-08-01

    The heats of formation (HOFs), energetic properties, and thermal stability of a series of 1,7-diamino-1,7-dinitrimino-2,4,6-trinitro-2,4,6-triazaheptane derivatives with different substituents, different numbers of substituents, and different original chains are found by using the DFT-B3LYP method. The results show that -NO2 or -NH2 is an effective substituent for increasing the gas-phase HOFs of the title compounds, especially -NO2 group. As the numbers of substitutents increase, their HOFs enhance obviously. Increasing the length of original chain is helpful for improving their HOFs. The substitution of -NO2 is useful for enhancing their detonation performances and the effects of the length of original chains on detonation properties are coupled with those of the substituents. An analysis of the BDE of the weakest bonds indicates that the substitution of the -NH2 groups and replacing the -NO2 groups of N-NO2 by the -NH2 groups are favorable for improving their thermal stability, while the substitution of -NO2 and increasing the length of original chain decrease their thermal stability. Considering the detonation performance and thermal stability, seven compounds may be considered as the potential candidates of high energy density compounds. PMID:23559097

  6. White upconversion luminescence nanocrystals for the simultaneous and selective detection of 2,4,6-trinitrotoluene and 2,4,6-trinitrophenol.

    Science.gov (United States)

    Ma, Yingxin; Huang, Sheng; Deng, Mingliang; Wang, Leyu

    2014-05-28

    A highly water stable and strong upconversion (UC) luminescence NaYF4@PSI-NH nanosensor for the simultaneous and selective detection of 2,4,6-trinitrotoluene (TNT) and 2,4,6-trinitrophenol (TNP) was successfully developed. Via the 980 nm near-infrared (NIR) irradiation, these nanosensors emit strong white UC luminescence with five typical emission peaks centered at 363, 455, 475, 546, and 654 nm. The UC emission at both 363 and 546 nm was quenched by the addition of TNT; however, the ratio of luminescence intensity at 363 nm to 546 nm (I363/I546) had no change with the increase of TNT concentration. Meanwhile, only violet UC emission at 363 nm was dramatically quenched via the addition of TNP, and the I363/I546 ratio is negatively proportional to the TNP concentration in the range of 0.01-4.5 μg/mL of TNP. On the other hand, the green UC emission intensity at 546 nm is in negative proportion to the concentration of TNT. Moreover, cyclohexane, toluene, and other nitroaromatics (such as 2,4-dinitrotoluene (DNT) and nitrobenzene (NB)) have no influence on the detection. Therefore, we developed a facile method for the simultaneous and selective detection of TNT and TNP in the mixture solution of nitroaromatics independent of complicated instruments and sample pretreatment. PMID:24734988

  7. A facile synthesis of 2,4,6-trichloroborazine from boron trichloride-dimethylsulfide complex and ammonium chloride

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    2,4,6-Trichloroborazine has been recognized as a desirable monomer for the preparation of high-performance boron nitride fibers through polymer derived ceramics route.So a high yield and facile synthesis of 2,4,6-trichloroborazine is essential in practice. Using boron trichloride-dimethylsulfide complex((CH_3)_2S·BCl_3) and ammonium chloride(NH_4Cl) as starting materials and toluene(C_6H_5CH_3) as solvent,the synthesis of 2,4,6-trichloroborazine to give high yield is reported.

  8. Synthesis and structure of diorganotin dibromides, R2SnBr2 (R = 2,4,6-trimethylphenyl or 2,4,6-trimethylbenzyl): Hydrolysis of (2,4,6-Me3C6H2)2SnBr2

    Indian Academy of Sciences (India)

    Vadapalli Chandrasekhar; Ramalingam Thirumoorthi

    2010-09-01

    The reaction of SnBr4 with in situ generated 2,4,6-trimethylphenylmagnesium bromide afforded a mixture of (2,4,6-Me3C6H2)2SnBr2 (1) and (2,4,6-Me3C6H2)3SnBr (2) which could be separated from each other by their solubility differences in diethyl ether. On the other hand, the reaction of tin metal with 2,4,6-Me3C6H2CH2Br afforded (2,4,6-Me3C6H2CH2)2SnBr2 (3). Hydrolysis of the latter using triethylamine as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(Br)(-OH)]2.2CH2Cl2 (4) while the use of NaOH as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(OH)(-OH)]2.2CH2Cl2 (5). Compounds 4 and 5 are dimeric tetraorganodistannoxanes consisting of a central distannoxane (Sn2O2) motif.

  9. 2,4,6-三硝基-2,4,6-三氮杂环己酮的合成Ⅰ.以乌洛托品为原料的合成%Synthesis of 2,4,6-trinitro-2,4,6-triazacyclo-hexanone(keto-RDX)

    Institute of Scientific and Technical Information of China (English)

    张跃军

    1999-01-01

    报道了以乌洛托品、脲或硝基脲为原料在几种硝化剂中合成产物2,4,6-三硝基-2,4,6-三氮杂环己酮(RDX酮)的方法.使用含多聚磷酸的硝硫混酸硝化剂,RDX酮的单分子得率超过100%.使用硝硫混酸硝化剂,RDX酮的得率在90%以上.在上述两种硝化剂中得到的产物为RDX酮与RDX的晶体混合物.使用纯硝酸硝化剂,RDX酮的得率50%左右.此外,对影响RDX酮得率的几种因素和反应历程作了初步的分析.

  10. Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

    Science.gov (United States)

    Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

    2014-07-01

    2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure.

  11. 1,2-Bis(dimethylamino-1,2-bis(2,4,6-triisopropylphenyldiborane(4

    Directory of Open Access Journals (Sweden)

    Alexander Damme

    2010-12-01

    Full Text Available In the molecular structure of the title compound, C34H58B2N2, each B atom of the diborane(4 is connected to one dimethylamino group and one Tip ligand (Tip = 2,4,6-triisopropylphenyl. These findings indicate that the increased steric demand of the Tip groups exerts influence solely on the B—B separation but not on the overall geometry of the title compound.

  12. Californium Recovery from Palladium Wire

    Energy Technology Data Exchange (ETDEWEB)

    Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-08-01

    The recovery of 252Cf from palladium-252Cf cermet wires was investigated to determine the feasibility of implementing it into the cermet wire production operation at Oak Ridge National Laboratory’s Radiochemical Engineering Development Center. The dissolution of Pd wire in 8 M HNO3 and trace amounts of HCl was studied at both ambient and elevated temperatures. These studies showed that it took days to dissolve the wire at ambient temperature and only 2 hours at 60°C. Adjusting the ratio of the volume of solvent to the mass of the wire segment showed little change in the kinetics of dissolution, which ranged from 0.176 mL/mg down to 0.019 mL/mg. A successful chromatographic separation of 153Gd, a surrogate for 252Cf, from Pd was demonstrated using AG 50x8 cation exchange resin with a bed volume of 0.5 mL and an internal diameter of 0.8 cm.

  13. Monoklonale Antikörper zum Nachweis von 2,4,6-Trichloranisol in Kork

    OpenAIRE

    Lausterer, Ralph

    2005-01-01

    Die Verbindung 2,4,6-Trichloranisol (TCA) kann in Kork und Wein vorkommen. TCA entsteht durch mikrobielle Umsetzung von Chlorphenolen. In den betroffenen Industrien führt TCA zu jährlichen Verlusten von mehr als einer Milliarde €. Zur Bestimmung von TCA sollten enzymkoppelte Immunabsorptionstest (ELISAs) mit monoklonalen Antikörpern (mAk) entwickelt werden. Es wurden drei TCA-spezifische mAk-produzierende Zelllinien gewonnen. Mit diesen mAk wurden hochsensitive ELISAs hergstellt, die eine Nac...

  14. Thermal Decomposition Kinetics of Lead 2,4,6-Trinitroresorcinate Monohydrate

    Institute of Scientific and Technical Information of China (English)

    HU Rong-zu; YAO Pu; LI Jing; CHEN San-ping; GAO Sheng-li; ZHAO Feng-qi; SONG Ji-rong; SHI Qi-zhen; CHEN Pei; LUO Yang; ZHAO Hong-an

    2004-01-01

    The non-isothermal decomposition of lead 2,4,6-trinitroresorcinate monohydrate, Pb (TNR) · H2O. was investigated by means of TG-DTA, DSC and IR. The thermal decomposition mechanism and the dissociated kinetics were also investigated. The kinetic parameters were obtained from the analysis of the DSC curves by integral and differential methods. The most probable kinetic model function of the dehydration reaction of Pb(TNR) · H2O was suggested by the comparison of the kinetic parameters.

  15. Fermi LAT Detection of a Gamma-ray Flare from the BL Lac Object ON 246

    Science.gov (United States)

    Becerra, Josefa

    2015-06-01

    The Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope has observed increasing gamma-ray flux from a source positionally consistent with the BL Lac object ON 246 (RA=187.55871 deg, Dec=25.30198 deg, J2000, Beasley et al. 2002, ApJS, 141, 13; with redshift z=0.135, Nass et al. 1996, A&A, 309, 419), also known as S3 1227+25 and 3FGL J1230.3+2519 (3FGL; Acero et al. 2015, arXiv:1501.02003).

  16. Concentrations of organochlorine pesticides and 2,4,6-trichloroanisole in cork bark.

    Science.gov (United States)

    Olivella, M Àngels; Caixach, Josep; Planas, Carles; Oliveras, Anna; Jové, Patrícia

    2012-02-01

    Organochlorine pesticides are persistent lipophilic organic pollutants and tend to accumulate in growing plants. During growth, cork is in contact with the open air for long periods (9-12 years). Owing to the previous widespread use of organochlorine pesticides and their high persistence in the environment, there is a risk that residues of such pesticides may be present in cork. In this study, the concentrations of 14 organochlorine pesticides-all of which are indicators of environmental pollution-were analyzed in cork bark samples from three regions in Spain and one in Portugal. In addition, the concentrations of 2,4,6-trichlorophenol (TCP) and 2,4,6-trichloroanisole (TCA) were also analyzed. Our results show only very low concentrations of lindane, γ-HCH (cork sample from Extremadura (0.1 ng g(-1)) and p,p'-DDE was present at a maximum concentration of 2.9 ng g(-1) in a cork sample from Castile-La Mancha. However, all concentrations were well below the legal limit established by Regulation (EC) No. 396/2005 (10 ng g(-1) in foodstuffs). We can conclude, therefore, that the cork samples we studied complied with food safety standards.

  17. WE-A-18A-01: TG246 On Patient Dose From Diagnostic Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Supanich, M [Rush University Medical Center, Chicago, IL (United States); Dong, F [The Cleveland Clinic, Solon, OH (United States); Andersson, J [Umea University, Umea (Sweden); Pavlicek, W [Mayo Clinic Arizona, Scottsdale, AZ (United States); Bolch, W [University Florida, Gainesville, FL (United States); Fetterly, K [Mayo Clinic, Rochester, MN (United States)

    2014-06-15

    Radiation dose from diagnostic and interventional radiations continues to be a focus of the regulatory, accreditation and standards organizations in the US and Europe. A Joint AAPM/EFOMP effort has been underway in the past year — having the goal to assist the clinical medical physicist with communicating optional and varied approaches in estimating (and validating) patient dose. In particular, the tools provided by DICOM Radiation Dose Structured Reports, either by themselves or as part of a networked data repository of dose related information are a rich source of actionable information. The tools of the medical physicist have evolved to include using DICOM data in meaningful ways to look at patient dose with respect to imaging practices. In addition to how accurate or reproducible a dose value is (totally necessary and our traditional workspace) it is now being asked how reproducible (patient to patient, device to device) are the delivered doses (new tasking)? Clinical medical physicists are best equipped to assist our radiology and technologist colleagues with this effort. The purpose of this session is to review the efforts of TG246 - bringing forward a summary content of the TG246 Report including specific dose descriptors for CT and Fluoroscopy — particularly in a focus of leveraging the RDSR as a means for monitoring good practices ALARA. Additionally, rapidly evolving technologies for more refined dose estimates are now in use. These will be presented as they look to having highly patient specific dose estimates in automated use.

  18. Synthesis of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide – a tailor-made photoinitiator for dental adhesives

    OpenAIRE

    Moszner, Norbert; Lamparth, Iris; Angermann, Jörg; Fischer, Urs Karl; Zeuner, Frank; Bock, Thorsten; Liska, Robert; Rheinberger, Volker

    2010-01-01

    Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide (WBAPO) was synthesized starting from 3-(chloromethyl)-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxy)ethanol. In the second step, 3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated...

  19. 儿童支气管异物246例临床分析%Clinical analysis of bronchial foreign bodies in 246 children

    Institute of Scientific and Technical Information of China (English)

    马渝燕; 焦安夏; 江沁波; 饶小春; 潘跃娜; 刘玺诚

    2010-01-01

    目的 回顾性研究儿童支气管异物的临床特点以及电子支气管镜在诊断治疗儿童支气管异物中的作用.方法 2000年1月至2009年8月北京儿童医院经支气管镜诊断治疗的支气管异物患儿246例,应用Olympus电子支气管镜,在局部黏膜麻醉下经鼻插入支气管镜逐级观察支气管结构,使用篮状异物钳或齿状异物钳钳取异物.结果 246例患儿中,支气管异物以果仁或果壳类(230例,占93.5%)最为常见,异物嵌顿位置以右下叶支气管开口(98例,占39.8%)为最多.钳取异物手术次数平均为(1.9±1.3)次,一次取出率为58.5%(144例).阻塞于左右主支气管、右中叶和右下叶支气管的异物一次取出率较高,分别为91.1%、60.0%和55.1%.篮状异物钳钳取所需次数(1.4±0.9)明显低于齿状异物钳所需次数(2.1±1.4),差异有统计学意义(P=0.000).结论 儿童支气管异物种类以果仁或果壳类植物性异物为主,阻塞部位以右下支气管为多见.位于左右主支气管异物一次取出率明显高于其他部位.用篮状异物钳钳取异物所需手术次数明显少于使用齿状异物钳.%Objective To analyze the characters of bronchial foreign bodies in children and the utilization of bronchoscope in the treatment of bronchial foreign bodies. Methods A total of 246 children were diagnosed with bronchial foreign bodies at our hospital during January 2000 until August 2009. Under local mucosal anesthesia, a bronchoscope was inserted through nasal cavity into bronchi. After identifying the site of foreign body, grasping forceps was guided through bronchoscope to remove the foreign body from airway. Results Among 246 cases, hard nut and skin of melon seed were found ( n = 230, 93.5% ). The most common site of foreign body was in right lower lobe bronchi ( n =98, 38.9% ). The average operative frequency was 1.9 ± 1.3 and one-time extraction ratio 58.5% ( n = 144). The one-time extraction ratio of patients with foreign

  20. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: ce_delgado89@hotmail.com [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)

    2015-10-15

    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  1. Reliability of optical fibres and components final report of COST 246

    CERN Document Server

    Griffioen, Willem; Gadonna, Michel; Limberger, Hans; Heens, Bernard; Knuuttila, Hanna; Kurkjian, Charles; Mirza, Shehzad; Opacic, Aleksandar; Regio, Paola; Semjonov, Sergei

    1999-01-01

    Reliability of Optical Fibres and Components reports the findings of COST 246 (1993-1998) - European research initiative in the field of optical telecommunications. Experts in the materials and reliability field of optical fibres and components have contributed to this unique study programme. The results, conclusions and achievements of their work have been obtained through joint experimentation and discussion with representatives from manufacturing and research groups. Topics covered include: Lifetime estimation; Failure mechanisms; Ageing test methods; Field data and service environments for components. For the first time the reader can explore the reliability of products and examine the results and conclusions in published form. This comprehensive volume is intended to provide a deeper understanding of the reliability of optical fibres and components. The book will be extremely useful to all scientists and practitioners involved in the industry.

  2. The high-pressure phase behavior and compressibility of 2,4,6-trinitrotoluene

    Energy Technology Data Exchange (ETDEWEB)

    Stevens, Lewis L.; Velisavljevic, Nenad; Hooks, Daniel E.; Dattelbaum, Dana M. (LANL)

    2008-10-24

    The phase stability and isothermal compression behavior of 2,4,6-trinitrotoluene (TNT) have been established to 26.5 GPa using angle-dispersive x-ray diffraction. P-V isotherms derived from the high-pressure x-ray spectra displayed a slight density hysteresis around 4.0 GPa and a sharp discontinuity at - 20.0 GPa. The latter transition is ascribed to a monoclinic-to-orthorhombic first-order phase transition in TNT. The conversion of the isothermal P-V data to the shock velocity-particle velocity plane revealed a deviation from linearity at low u{sub p}, a cusp associated with the phase transition at high u{sub p}, and general agreement with the wealth of unreacted Hugoniot data on TNT.

  3. 2-Carboxyquinolinium–2,4,6-trinitrobenzenesulfonate–quinolinium-2-carboxylate (1/1/1

    Directory of Open Access Journals (Sweden)

    Graham Smith

    2008-01-01

    Full Text Available The structure of the title adduct compound, C10H8NO2+·C6H2N3O9S−·C10H7NO2, from the reaction of 2,4,6-trinitrobenzenesulfonic acid (picrylsulfonic acid with quinoline-2-carboxylic acid (quinaldic acid in 2-propanol–water, has been determined at 130 (2 K. The cation and the adduct species form a twisted cyclic hydrogen-bonded R22(10 pseudo-dimer which is extended into a one-dimensional chain structure through short head-to-tail carboxylic acid O—H...Ocarboxyl associations [O...O = 2.4711 (19 Å]. The picrylsulfonate anions are attached peripherally by single N—H...Osulfonate hydrogen bonds [N...O = 2.8643 (19 Å].

  4. 78 FR 42451 - Listing of Color Additives Exempt From Certification; Reactive Blue 246 and Reactive Blue 247...

    Science.gov (United States)

    2013-07-16

    ... HUMAN SERVICES Food and Drug Administration 21 CFR Part 73 Listing of Color Additives Exempt From... color additive regulations in Sec. Sec. 73.3100 and 73.3106 (21 CFR 73.3100 and 73.3106), respectively... Blue 246), as color additives in contact lenses. We also corrected the nomenclature for Reactive...

  5. Effective biodegradation of 2,4,6-trinitrotoluene using a novel bacterial strain isolated from TNT-contaminated soil

    NARCIS (Netherlands)

    Gumuscu, Burcu; Tekinay, Turgay

    2013-01-01

    In this environmental-sample based study, rapid microbial-mediated degradation of 2,4,6-trinitrotoluene (TNT) contaminated soils is demonstrated by a novel strain, Achromobacter spanius STE 11. Complete removal of 100 mg L−1 TNT is achieved within only 20 h under aerobic conditions by the isolate. I

  6. BIOTRANSFORMATION OF 2,4,6-TRINITROTOLUENE IN A CONTINUOUS-FLOW ANABAENA SP. SYSTEM. (R825513C013)

    Science.gov (United States)

    Reductive transformation of 2,4,6-trinitrotoluene (TNT) was observed in a continuous-flow system of Anabaena sp. operated for 33 d with a 5.7 d hydraulic retention time and a range of influent TNT concentrations of 1–58 mg/l. The TNT removal effici...

  7. Cyclic voltammetry: a tool to quantify 2,4,6-trichloroanisole in aqueous samples from cork planks boiling industrial process.

    Science.gov (United States)

    Peres, António M; Freitas, Patrícia; Dias, Luís G; Sousa, Mara E B C; Castro, Luís M; Veloso, Ana C A

    2013-12-15

    Chloroanisoles, namely 2,4,6-trichloroanisole, are pointed out as the primary responsible of the development of musty off-flavours in bottled wine, due to their migration from cork stoppers, which results in huge economical losses for wine industry. A prevention step is the detection of these compounds in cork planks before stoppers are produced. Mass spectrometry gas chromatography is the reference method used although it is far beyond economical possibilities of the majority of cork stoppers producers. In this work, a portable cyclic voltammetry approach was used to detect 2,4,6-trichloroanisole extracted from natural cork planks to the aqueous phase during the cork boiling industrial treatment process. Analyses were carried out under ambient conditions, in less than 15 min with a low use of solvent and without any sample pre-treatment. The proposed technique had detection (0.31±0.01 ng/L) and quantification (0.95±0.05 ng/L) limits lower than the human threshold detection level. For blank solutions, without 2,4,6-trichloroanisole addition, a concentration in the order of the quantification limit was estimated (1.0±0.2 ng/L), which confirms the satisfactory performance of the proposed methodology. For aqueous samples from the industrial cork planks boiling procedure, intra-day repeatabilities were lower than 3%, respectively. Also, 2,4,6-trichloroanisole contents in the aqueous samples determined by this novel approach were in good agreement with those obtained by GC-MS (correlation coefficient equal to 0.98), confirming the satisfactory accuracy of the proposed methodology. So, since this novel approach is a fast, low-cost, portable and user-friendly method, it can be an alternative and helpful tool for in-situ industrial applications, allowing accurate detection of releasable 2,4,6-trichloroanisole in an earlier phase of cork stoppers production, which may allow implementing more effective cork treatments to reduce or avoid future 2,4,6-trichloroanisole

  8. Susceptibility of male and female Japanese medaka (Oryzias latipes) to 2,4,6-trichlorophenol-induced micronuclei in peripheral erythrocytes

    Institute of Scientific and Technical Information of China (English)

    Nannan LIU; Mei MA; Yiping XU; Jinmiao ZHA; Kaifeng RAO; Zijian WANG

    2013-01-01

    2,4,6-trichlorophenol (2,4,6-TCP) is a wide- spread probable human carcinogen and has been proven to have genotoxicity in in vitro assays. However, little genotoxicity information and no micronuclei induction data for 2,4,6-TCP is available from in vivo tests, especially for sex-specific differences. Following a preliminary test, a piscine peripheral erythrocyte micro- nucleus assay was conducted on medaka (Oryzias latipes) after a 28-day exposure to 2,4,6-TCE In the present study, the mean micronuclei (MNC) frequencies of all of the groups increased in a dose-dependent manner, which indicated the potential genotoxicity of 2,4,6-TCE More- over, males were found to be more susceptible compared with females after a 28-day exposure to 2,4,6-TCP in all of the dosed groups above 10 ~tg-L-1. This is the first report on the potential of micronuclei induction and a sex-susceptible effect in the peripheral erythrocytes of mature fish after 2,4,6-TCP in vivo exposure.

  9. CERN: Fixed target targets

    International Nuclear Information System (INIS)

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become

  10. Highly sensitive detection of 2,4,6-trichlorophenol based on HS-β-cyclodextrin/gold nanoparticles composites modified indium tin oxide electrode

    International Nuclear Information System (INIS)

    Graphical abstract: Display Omitted -- Highlights: •A novel electrochemical sensing platform by self-assembling of HS-β-cyclodextrin/gold nanoparticles onto indium tin oxide electrode (HS-β-CD/AuNPs/SAM/ITO electrode) surface was constructed. •The proposed electrochemical sensor exhibited high sensitivity for the determination 2,4,6-trichlorophenol which electrochemical activity is very weak. •The newly developed method was successfully applied to quantitatively determine 2,4,6-trichlorophenol in tap water samples. -- ABSTRACT: A new electrochemical sensor for determination of 2,4,6-trichlorophenol (2,4,6-TCP) was fabricated. The characterization of the sensor was studied by scanning electron microscopy, electrochemical impedance spectroscopy and cyclic voltammetry techniques. The electrochemical behavior of 2,4,6-TCP was investigated using cyclic voltammetry and differential pulse voltammetry at the HS-β-cyclodextrin (HS-β-CD)/gold nanoparticles (AuNPs) composite modified indium tin oxide (ITO) electrode. The results showed that the current responses of 2,4,6-TCP greatly enhanced due to the high catalytic activity and enrichment capability of composites. The peak current of 2,4,6-TCP increases linearly with the increase of the 2,4,6-TCP concentration from 3.0 × 10−9 to 2.8 × 10−8 M, with the limit of detection of 1.0 × 10−9. Further more, the modified electrode was successfully applied to detect the level of 2,4,6-TCP in tap water samples with excellent sensitivity

  11. Integrated photocatalytic-biological reactor for accelerated 2,4,6-trichlorophenol degradation and mineralization.

    Science.gov (United States)

    Zhang, Yongming; Sun, Xia; Chen, Lujun; Rittmann, Bruce E

    2012-02-01

    An integrated photocatalytic-biological reactor (IPBR) was used for accelerated degradation and mineralization of 2,4,6-trichlorophenol (TCP) through simultaneous, intimate coupling of photocatalysis and biodegradation in one reactor. Intimate coupling was realized by circulating the IPBR's liquid contents between a TiO(2) film on mat glass illuminated by UV light and honeycomb ceramics as biofilm carriers. Three protocols-photocatalysis alone (P), biodegradation alone (B), and integrated photocatalysis and biodegradation (photobiodegradation, P&B)-were used for degradation of different initial TCP concentrations. Intimately coupled P&B also was compared with sequential P and B. TCP removal by intimately coupled P&B was faster than that by P and B alone or sequentially coupled P and B. Because photocatalysis relieved TCP inhibition to biodegradation by decreasing its concentration, TCP biodegradation could become more important over the full batch P&B experiments. When phenol, an easy biodegradable compounds, was added to TCP in order to promote TCP mineralization by means of secondary utilization, P&B was superior to P and B in terms of mineralization of TCP, giving 95% removal of chemical oxygen demand. Cl(-) was only partially released during P experiments (24%), and this corresponded to its poor mineralization in P experiments (32%). Thus, intimately coupled P&B in the IPBR made it possible obtain the best features of each: rapid photocatalytic transformation in parallel with mineralization of photocatalytic products.

  12. Phototransformation of 2,4,6-trinitrotoluene: Sensitized by riboflavin under different irradiation spectral range

    Energy Technology Data Exchange (ETDEWEB)

    Yang Xin [Department of Biology, Jackson State University, Jackson, MS 39217 (United States); Beijing Institute of Pharmacology and Toxicology, Beijing 100850 (China); Zhao Xueheng [Department of Biology, Jackson State University, Jackson, MS 39217 (United States); Hwang, H.-M. [Department of Biology, Jackson State University, Jackson, MS 39217 (United States)]. E-mail: hwang@jsums.edu

    2007-05-08

    Riboflavin-sensitized phototransformation of 2,4,6-trinitrotoluene (TNT) under natural sunlight was investigated with reverse-phase high performance liquid chromatography/mass spectrometry (HPLC/MS) and gas chromatography/mass spectrometry (GC/MS). The effect of different spectral region of sunlight on TNT phototransformation in the absence or presence of riboflavin was also investigated by using optical filters with cut-off at 400 or 455 nm. The concentration of riboflavin in the phototransformation of TNT was optimized. Concentration of riboflavin and TNT was 1.0 and 50 {mu}M, respectively. The rates of phototransformation of TNT under natural sunlight in the presence or absence of riboflavin were conformed to initial pseudo-first-order rate equation. The photolysis half life of TNT in the presence of riboflavin was 21.87 min, compared to 39 min in the absence of riboflavin under natural sunlight. Two major phototransformation products of TNT, 3,5-dinitroaniline (3,5-DNA) and 1,3,5-trinitrobenzene (1,3,5-TNB), were detected in the samples in the presence of riboflavin receiving irradiation at full wavelength or wavelength >400 nm. The results indicate that riboflavin mediates TNT sensitized-phototransfomation under natural sunlight or near-UV-vis light.

  13. Using corona discharge-ion mobility spectrometry for detection of 2,4,6-Trichloroanisole.

    Science.gov (United States)

    Lichvanová, Zuzana; Ilbeigi, Vahideh; Sabo, Martin; Tabrizchi, Mahmoud; Matejčík, Stefan

    2014-09-01

    In this work possible application of the corona discharge-ion mobility spectrometer (CD-IMS) for detection of 2,4,6-Trichloroanisole (TCA) has been investigated. We applied CD-IMS interfaced with orthogonal acceleration time of flight mass spectrometer (CD-IMS-oaTOF) to study the ion processes within the CD-IMS technique. The CD-IMS instrument was operated in two modes, (i) standard and (ii) reverse flow modes resulting in different chemical ionisation schemes by NO3(-)(HNO3)n (n=0,1,2) and O2(-)(H2O)n (n=0,1,2), respectively. The O2(-)(H2O)n ionisation was associated with formation of Cl(-) and (TCA-CH3)(-) ions from TCA. The NO3(-)(HNO3)n ionisation, resulted in formation of NO3(-)(HNO3)(TCA-Cl) adduct ions. Limit of detection (LOD) for TCA was determined in gas (100 ppb) and solid phases (150 ng). PMID:24913882

  14. HIP 3678: a hierarchical triple stellar system in the centre of the planetary nebula NGC 246

    CERN Document Server

    Adam, C

    2014-01-01

    We report the detection of a new low-mass stellar companion to the white dwarf HIP 3678 A, the central star of the planetary nebula NGC 246. The newly found companion is located about 1 arcsec (at projected separation of about 500 au) north-east of HIP 3678 A, and shares a common proper motion with the white dwarf and its known comoving companion HIP 3678 B. The hypothesis that the newly detected companion is a non-moving background object can be rejected on a significance level of more than 8 $\\sigma$, by combining astrometric measurements from the literature with follow-up astrometry, obtained with Wild Field Planetary Camera 2/\\textit{Hubble Space Telescope} and NACO/Very Large Telescope. From our deep NACO imaging data, we can rule out additional stellar companions of the white dwarf with projected separations between 130 up to 5500 au. In the deepest high-contrast NACO observation, we achieve a detection limit in the \\textit{Ks} band of about 20 mag, which allows the detection of brown dwarf companions w...

  15. Degradation of 2,4,6-trinitrotoluene by P. aeruginosa and characterization of some metabolites

    Directory of Open Access Journals (Sweden)

    Hatice Aysun Mercimek

    2015-03-01

    Full Text Available Degradation of 2,4,6-trinitrotoluene (TNT, a nitroaromatic explosive found in the soil and ground water, was investigated using Pseudomonas aeruginosa in in vitroexperiments. Biodegradable abilitiy of this bacteria was performed with 50 and 75 mg L−1 TNT concentrations in a defined liquid medium for 96 h time period. Treatment of TNT in supernatant samples taken at 0, 6, 12, 24, 48, 72 and 96 h from agitated vessels was followed by reverse-phase high-performance liquid chromatography (HPLC. In cultures supplemented with 50 and 75 mgL−1 TNT, after 96 h of incubation 46% and 59% reduction were detected respectively. Two metabolites as degradation intermediates with nitrite release into the medium, 2,4-dinitrotoluene (2,4-DNT and 4-aminodinitrotoluene (4-ADNT, were elucidated by thin layer chromatography (TLC and gas chromatography-mass spectrometry (GC-MS. These findings clearly indicate that Pseudomonas aeruginosa can be used in bioremediation of TNT contaminated sites.

  16. Molecularly Imprinted Nanofiber Film for Sensitive Sensing 2,4,6-Tribromophenol

    Directory of Open Access Journals (Sweden)

    Limei Huang

    2016-06-01

    Full Text Available The determination of brominated flame retardants is of great importance, but remains a challenge. Particularly, universal and facile approaches are limited. Here we report a new general approach, combining molecular imprinting and electrospinning, for the efficient and facile imprinting sensor of 2,4,6-tribromophenol (TBP, which was used as a “novel” brominated flame retardant. With TBP as the template molecular, β-cyclodextrin (β-CD as the functional monomer, and poly-vinylbutyral (PVB as the electro-spinning matrix, the nanofiber film was deposited on the glassy carbon electrode (GCE via electrospinning technique directly. The β-CD-PVB/GCE sensor system exhibited excellent TBP sensing performances, such as a low detection limit (6.29 × 10−10 mol·L−1 at room temperature, selective recognition to TBP/phenol/4-methyl-phenol, and good regeneration performance. The approach of fabricating a molecular imprinting nanofiber sensor may shed new light in the detection of other phenolic pollutants.

  17. Degradation mechanism of 2,4,6-trinitrotoluene in supercritical water oxidation

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The 2,4,6-trinitrotoluene (TNT) is a potential carcinogens and TNT contaminated wastewater, which could not be effectively disposed with conventional treatments. The supercritical water oxidation (SCWO) to treat TNT contaminated wastewater was studied in this article. The TNT concentration in wastewater was measured by high-performance liquid chromatograph (HPLC) and the degraded intermediates were analyzed using GC-MS. The results showed that SCWO could degrade TNT efficiently with O2. The reaction temperature, pressure, residence time and oxygen excess were the main contributing factors in the process. The decomposition of TNT was accelerated as the temperature or residence time increases. At 550℃, 24 MPa, 120 s and oxygen excess 300%, TNT removal rate could exceed 99.9%. Partial oxidation occurs in SCWO without oxygen. It was concluded that supercritical water was a good solvent and had excellent oxidation capability in the existence of oxygen. The main intermediates of TNT during SCWO include toluene, 1,3,5-trinitrobenzene, nitrophenol, naphthalene, fluorenone, dibutyl phthalate, alkanes and several dimers based on the intermediate analysis. Some side reactions, such as coupled reaction, hydrolysis reaction and isomerization reaction may take place simultaneously as TNT is oxidized by SCWO.

  18. Transformation of 2,4,6-trinitrotoluene (TNT) by Raoultella terrigena.

    Science.gov (United States)

    Claus, H; Bausinger, T; Lehmler, I; Perret, N; Fels, G; Dehner, U; Preuss, J; König, H

    2007-02-01

    Manufacture of nitroorganic explosives generates toxic wastes leading to contamination of soils and waters, especially groundwater. For that reason bacteria living in environments highly contaminated with 2,4,6-trinitrotoluene (TNT) and other nitroorganic compounds were investigated for their capacity for TNT degradation. One isolate, Raoultella terrigena strain HB, removed TNT at concentrations between 10 and 100 mg l(-1) completely from culture supernatants under optimum aerobic conditions within several hours. Only low concentrations of nutrient supplements were needed for the cometabolic transformation process. Radioactivity measurements with ring-labelled (14)C-TNT detected about 10-20% of the initial radioactivity in the culture supernatant and the residual 80-90% as water-insoluble organic compounds in the cellular pellet. HPLC analysis identified aminodinitrotoluenes (2-ADNT, 4-ADNT) and diaminonitrotoluenes (2,4-DANT) as the metabolites which remained soluble in the culture medium and azoxy-dimers as the main products in the cell extracts. Hence, the new isolate could be useful for the removal of TNT from contaminated waters.

  19. Soil sorption and plant uptake of 2,4,6-trinitrotoluene

    Energy Technology Data Exchange (ETDEWEB)

    Pennington, J.C.

    1988-01-01

    Potential environmental hazards are posed by the presence of 2,4,6-trinitrotoluene (TNT) contamination in soils of US Army Ammunition Plants (AAPs). Adsorption and desorption studies were conducted on soil samples collected from 13 AAPs. TNT adsorption correlated most highly with cation exchange capacity, extractable iron, clay content, and percent organic carbon. Sequential desorption indicated that almost all of the adsorbed TNT was desorbed after three sequential desorption cycles. Plant uptake of TNT and two of its principal degradation products, 4-amino-2,6-dinitrotoluene (4ADNT) and 2-amino-4,6-dinitrotoluene (2ADNT), was also investigated. Results indicated that little TNT and 4ADNT, and no 2ADNT was absorbed by leafy portions of the test plant, yellow nutsedge (Cyperus esculentus). Plant uptake was greatest from 4ADNT-treated silts, an indication that 4ADNT is more readily mobilized into the plant than TNT or 2ANDT. Greater plant uptake from silt than from clay indicated that bioavailability is reduced in the clay. The reduction in bioavailability may be due to an increase in soil sorption of TNT and its degradation products over time.

  20. High uptake of 2,4,6-trinitrotoluene by vetiver grass - Potential for phytoremediation?

    Energy Technology Data Exchange (ETDEWEB)

    Makris, Konstantinos C. [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Shakya, Kabindra M. [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Datta, Rupali [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Sarkar, Dibyendu [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States)]. E-mail: dibyendu.sarkar@utsa.edu; Pachanoor, Devanand [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States)

    2007-03-15

    2,4,6-Trinitrotoluene (TNT) is a potent mutagen, and a Group C human carcinogen that has been widely used to produce munitions and explosives. Vast areas that have been previously used as ranges, munition burning, and open detonation sites are heavily contaminated with TNT. Conventional remediation activities in such sites are expensive and damaging to the ecosystem. Phytoremediation offers a cost-effective, environment-friendly solution, utilizing plants to extract TNT from contaminated soil. We investigated the potential use of vetiver grass (Vetiveria zizanioides) to effectively remove TNT from contaminated solutions. Vetiver grass plants were grown in hydroponic systems containing 40 mg TNT L{sup -1} for 8 d. Aqueous concentrations of TNT reached the method detection limit ({approx}1 {mu}g L{sup -1}) within the 8-d period, demonstrating high affinity of vetiver for TNT, without any visible toxic effects. Results from this preliminary hydroponic study are encouraging, but in need of verification using TNT-contaminated soils. - Vetiver grass demonstrates ability to absorb TNT in aqueous media.

  1. Chemically catalyzed uptake of 2,4,6-trinitrotoluene by Vetiveria zizanioides

    Energy Technology Data Exchange (ETDEWEB)

    Makris, Konstantinos C. [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Shakya, Kabindra M. [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Datta, Rupali [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Sarkar, Dibyendu [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States)]. E-mail: dibyendu.sarkar@utsa.edu; Pachanoor, Devanand [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States)

    2007-07-15

    The efficiency of vetiver grass (Vetiveria zizanioides) in removing 2,4,6-trinitrotoluene (TNT) from aqueous media was explored in the presence of a common agrochemical, urea, used as a chaotropic agent. Chaotropic agents disrupt water structure, increasing solubilization of hydrophobic compounds (TNT), thus, enhancing plant TNT uptake. The primary objectives of this study were to: (i) characterize TNT absorption by vetiver in hydroponic media, and (ii) determine the effect of urea on chemically catalyzing TNT uptake by vetiver grass in hydroponic media. Results showed that vetiver exhibited a high TNT uptake capacity (1.026 mg g{sup -1}), but kinetics were slow. Uptake was considerably enhanced in the presence of urea, which significantly (p<0.001) increased the 2nd-order reaction rate constant over that of the untreated (no urea) control. Three major TNT metabolites were detected in the roots, but not in the shoot, namely 1,3,5-trinitrobenzene, 4-amino 2,6-dinitrotoluene, and 2-amino 4,6-dinitrotoluene, indicating TNT degradation by vetiver grass. - A common agrochemical, urea catalyzes TNT removal by vetiver grass in aqueous media.

  2. PBCDD/F formation from radical/radical cross-condensation of 2-Chlorophenoxy with 2-Bromophenoxy, 2,4-Dichlorophenoxy with 2,4-Dibromophenoxy, and 2,4,6-Trichlorophenoxy with 2,4,6-Tribromophenoxy

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Xiangli [Environment Research Institute, Shandong University, Jinan 250100 (China); Yu, Wanni [Environment Research Institute, Shandong University, Jinan 250100 (China); College of Resources and Environment, Linyi University, Linyi 276000 (China); Xu, Fei [Environment Research Institute, Shandong University, Jinan 250100 (China); Zhang, Qingzhu, E-mail: zqz@sdu.edu.cn [Environment Research Institute, Shandong University, Jinan 250100 (China); Hu, Jingtian; Wang, Wenxing [Environment Research Institute, Shandong University, Jinan 250100 (China)

    2015-09-15

    Highlights: • We studied the formation of PBCDD/Fs from the reaction of three CPRs with BPRs. • The substitution pattern of halogenated phenols determines those of PBCDD/Fs. • The substitution of halogenated phenols influence the coupling of phenoxy radicals. • The rate constants of the crucial elementary steps were evaluated. - Abstract: Quantum chemical calculations were carried out to investigate the homogeneous gas-phase formation of mixed polybrominated/chlorinated dibenzo-p-dioxins/benzofurans (PBCDD/Fs) from the cross-condensation of 2-chlorophenoxy radical (2-CPR) with 2-bromophenoxy radical (2-BPR), 2,4-dichlorophenoxy radical (2,4-DCPR) with 2,4-dibromophenoxy radical (2,4-DBPR), and 2,4,6-trichlorophenoxy radical (2,4,6-TCPR) with 2,4,6-tribromophenoxy radical (2,4,6-TBPR). The geometrical parameters and vibrational frequencies were calculated at the MPWB1K/6-31+G(d,p) level, and single-point energy calculations were performed at the MPWB1K/6-311+G(3df,2p) level of theory. The rate constants of the crucial elementary reactions were evaluated by the canonical variational transition-state (CVT) theory with the small curvature tunneling (SCT) correction over a wide temperature range of 600–1200 K. Studies show that the substitution pattern of halogenated phenols not only determines the substitution pattern of the resulting PBCDD/Fs, but also has a significant influence on the formation mechanism of PBCDD/Fs, especially on the coupling of the halogenated phenoxy radicals.

  3. Sputter target

    Science.gov (United States)

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  4. Study on the Synthesis of Phenyl- thio- phosphine Acyl bis ( 2,4,6 - tribromophenyl) amine%苯基硫代膦酰二(2,4,6-三溴苯基)胺的合成研究

    Institute of Scientific and Technical Information of China (English)

    王彦林; 张艳丽; 陈小慧; 季勇

    2011-01-01

    文章以苯胺,溴素,苯基硫代膦酰二氯等为原料,合成了P,N,S,Br四元素协同阻燃的新型高效阻燃剂苯基硫代膦酰二(2,4,6-三溴苯基)胺,最佳工艺条件为以二甲苯做溶剂,吡啶做缚酸剂,低水合硼酸锌作催化剂,苯基硫代膦酰二氯与2,4,6-三溴苯胺的摩尔比为1:2.1,回流反应12 h,产率可达81.21%.并通过IR和NMR对产品的结构进行了表征.%In this paper, a novel high effective flame retardant which collaborated by P, N,S, Br was prepared via the reaction of aniline, bromide and phenylthiophosphonic dichloride. The optimum reaction conditions were: Xylene as the solvent , pyridine as aci - binding agent, low hydrated zinc borate as catalyst, while the molar ratio for the phenylthiophosphonic dichloride and 2,4,6 - tribromoaniline wasl: 2. 1, and the reaction time is 12 h, the yield was 81.21%. The structure of product were characterized by 1R and NMR.

  5. The statistical model calculation of prompt neutron spectra from spontaneous fission of {sup 244}Cm and {sup 246}Cm

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimenko, B.F. [V.G. Khlopin Radium Inst., Saint Peterburg (Russian Federation)

    1997-03-01

    The calculations of integral spectra of prompt neutrons of spontaneous fission of {sup 244}Cm and {sup 246}Cm were carried out. The calculations were done by the Statistical Computer Code Complex SCOFIN applying the Hauser-Feschbach method as applied to the description of the de-excitation of excited fission fragments by means of neutron emission. The emission of dipole gamma-quanta from these fragments was considered as a competing process. The average excitation energy of a fragment was calculated by two-spheroidal model of tangent fragments. The density of levels in an excited fragment was calculated by the Fermi-gas model. The quite satisfactory agreement was reached between theoretical and experimental results obtained in frames of Project measurements. The calculated values of average multiplicities of neutron number were 2,746 for {sup 244}Cm and 2,927 for {sup 246}Cm that was in a good accordance with published experimental figures. (author)

  6. Transformation of 2,4,6-trinitrotoluene (TNT) by actinomycetes isolated from TNT-contaminated and uncontaminated environments.

    OpenAIRE

    Pasti-Grigsby, M B; Lewis, T A; Crawford, D L; Crawford, R L

    1996-01-01

    Actinomycete strains isolated from 2,4,6-trinitrotoluene (TNT)-contaminated and uncontaminated environments were compared for TNT tolerance and abilities to transform TNT. Regardless of previous TNT exposure history, no significant differences in TNT tolerance were seen among strains. Selected strains did not significantly mineralize [14C]TNT. The actinomycetes did, however, transform TNT into reduced intermediates. The data indicate that, in actinomycete-rich aerobic environments like compos...

  7. Beijing liangxiang area of clinical analysis of 246 cases of dental truma.%北京良乡地区牙外伤246例临床分析

    Institute of Scientific and Technical Information of China (English)

    张欣

    2011-01-01

    Objective Since 2008 liangxiang hospital of stomatology,Dental admissions incidence of 246 cases of truma patients. So that effective prevention, Reduce the probability of the Occurrence of dental truma. Methods Occording to the emergence department registered 246cases of dental truma on retrospective clinic analysis, including age, gender, injury cause, teeth, truma type. Time of occurrence of post - trumatice take their own first aid measure etc. Results The 246 patiences, dental truma occurs beacause there is a fall, fighting, sports, car accidents, and so on. Most likely the maxxilary central incisor injury. Trauma occurred more holidays, more man than woman. Conclusion Dental truma caused by various reasons, the time is more concentrated, but people understand the dangers of lack of dental injury, should arouse the attention of medical workers.%目的 分析2008~2010年良乡医院口腔科接诊的牙外伤病例的发生情况,以期做到有效预防,减少牙外伤的发生.方法 根据科室急诊登记,对246例牙外伤患者进行回顾性临床分析,包括患者的年龄、性别、外伤原因、牙位、外伤类型、外伤发生时间、外伤后自行采取的急救措施等.结果 246例患者中,发生牙外伤的原因有摔伤、打架、运动、车祸等,上颌中切牙受伤几率最大,节假日期间发生牙外伤较多,男性一般多于女性.结论 造成牙外伤的原因多样,时间较为集中,但人们对牙外伤的危害认知程度较低,应引起医务工作者的注意.

  8. Arvustus. Katri Lõhmus. Caring Autonomy. European Human Rights Law and the Challenge of Individualism. Cambridge University Press 2015, 246 lk / Lauri Mälksoo

    Index Scriptorium Estoniae

    Mälksoo, Lauri, 1975-

    2016-01-01

    Arvustus: Katri Lõhmus. Caring Autonomy. European Human Rights Law and the Challenge of Individualism. Cambridge University Press 2015, 246 lk. Euroopa inimõiguste ja põhivabaduste kaitse konventsiooni artikli 8 sisustamisest

  9. Development of a cellular biosensor for the detection of 2,4,6-trichloroanisole (TCA).

    Science.gov (United States)

    Varelas, Vassileios; Sanvicens, Nuria; M-Pilar-Marco; Kintzios, Spiridon

    2011-05-15

    2,4,6-trichloroanisole (TCA) is a microbial metabolite formed from chlorophenols through the activity of several natural fungal strains present on the cork oak bark. TCA is the primary compound responsible for the mousty/mould off-odour known as "cork taint" present in cork stoppers, wine, water and alcoholic beverages. Chromatographic and electrochemical methods are currently used for the determination of TCA, however its detection at low concentrations remains a technical challenge. The aim of this study was the development of a rapid novel biosensor system based on the Bioelectric Recognition Assay (BERA). The sensor measured the electric response of cultured membrane-engineered fibroblast cells suspended in an alginate gel matrix due to the change of their membrane potential in the presence of the analyte. Membrane-engineered cells were prepared by osmotic insertion of 0.5 μg/l of specific TCA antibodies into the membrane of the cells. The BERA-based sensor was able to detect TCA in a few minutes (3-5 min) at extremely low concentrations (10(-1)ppt), thus demonstrating higher sensitivity than the human sensory threshold. In addition, the assay was quite selective against other haloanisoles and halophenols structurally related to or co-occurring with TCA. Finally the sensor was tested against real white wine samples from cork soaks. At this real test, the BERA sensor was able to detect TCA from cork soaks rapidly (3-5 min) at very low concentrations (1.02-12 ng/l), covering the whole range for the detection threshold for wines (1.4-10 ng/l). Therefore, this novel biosensor offers new perspectives for ultra-rapid, ultra-sensitive and low-cost monitoring of TCA presence in cork and wine and possibly also other food commodities. PMID:21482306

  10. Dual role of endogenous serotonin in 2,4,6-trinitrobenzene sulfonic acid-induced colitis

    Directory of Open Access Journals (Sweden)

    Alberto eRapalli

    2016-03-01

    Full Text Available Background and Aims: Changes in gut serotonin content have been described in Inflammatory Bowel Disease and in different experimental models of colitis: the critical role of this monoamine in the pathogenesis of chronic gastrointestinal inflammation is gradually emerging. Aim of the present study was to evaluate the contribution of endogenous serotonin through the activation of its specific receptor subtypes to the local and systemic inflammatory responses in an experimental model of Inflammatory Bowel Disease. Methods: Colitis was induced by intrarectal 2,4,6-TriNitroBenzene Sulfonic acid in mice subacutely treated with selective antagonists of 5-HT1A (WAY100135, 5-HT2A (Ketanserin, 5-HT3 (Ondansetron, 5-HT4 (GR125487, 5-HT7 (SB269970 receptors and with 5-HT1A agonist 8-Hydroxy-2-(di-n-propylaminotetralin. Results: Blockade of 5-HT1A receptors worsened TNBS-induced local and systemic neutrophil recruitment while 5-HT1A agonist delayed and mitigated the severity of colitis, counteracting the increase in colonic 5-HT content. On the contrary, blockade of 5-HT2A receptors improved global health conditions, reduced colonic morphological alterations, down-regulated neutrophil recruitment, inflammatory cytokines levels and colonic apoptosis. Antagonism of 5-HT3, 5-HT4 and 5-HT7 receptor sites did not remarkably affect the progression and outcome of the pathology or only slightly improved it.Conclusions: The prevailing deleterious contribution given by endogenous serotonin to inflammation in TNBS-induced colitis is seemingly mediated by 5-HT2A and, to a lesser extent, by 5-HT4 receptors and coexists with the weak beneficial effect elicited by 5-HT1A stimulation. These findings suggest how only a selective interference with 5-HT pro-inflammatory actions may represent an additional potential therapeutic option for intestinal inflammatory disorders.

  11. 2,4,6-Trichlorophenol mediated increases in extracellular peroxidase activity in three species of Lemnaceae.

    Science.gov (United States)

    Biswas, Dilip K; Scannell, Gillian; Akhmetov, Nurlan; Fitzpatrick, Dara; Jansen, Marcel A K

    2010-11-01

    Chlorinated phenols, or chlorophenols, are persistent priority pollutants that are widespread in the environment. Class III peroxidases are well-characterised plant enzymes that can catalyse the oxidative dechlorination of chlorophenols. Expression of these enzymes by plants is commonly associated with plant stress, therefore limiting scope for phytoremediation. In this study, we have quantitatively compared peroxidase activity and phytotoxicity as a function of 2,4,6-trichlorophenol (TCP) concentration in three species of Lemnaceae; Lemna minor, Lemna gibba and Landoltia punctata. Effects of TCP on the growth rates of the three species differed considerably with L. punctata being the most tolerant species. TCP also affected photosynthetic parameters, causing a decrease in open photosystem II reaction centres (qP) and, in L. punctata only, a decrease in non-photochemical quenching (qN). In parallel, TCP exposure resulted in increased peroxidase activity in all three species. Peroxidase activity in L. minor and L. gibba displayed an inverse relationship with biomass accumulation, i.e. the more growth reduction the more peroxidase activity. In contrast, induction of peroxidase activity in L. punctata was bi-phasic, with a TCP-induced activity peak at concentrations that had no major effect on growth, and further induction under phytotoxic concentrations. The mechanism by which L. punctata recognises and responds to low concentrations of an anthropogenic compound, in the absence of wide-ranging stress, remains enigmatic. However, we conclude that this "window" of peroxidase production in the absence of major growth inhibition offers potential for the development of sustainable, peroxidise-mediated phytoremediation systems. PMID:20810175

  12. Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation

    International Nuclear Information System (INIS)

    For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high AD/AR ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values εG, and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies (∼95%), and by the stoichiometric release of chloride ions from the halogenated compound (∼80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions)

  13. Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-De Jesus, A.; Romano-Baez, F.J.; Leyva-Amezcua, L.; Juarez-Ramirez, C.; Ruiz-Ordaz, N. [Departamento de Ingenieria Bioquimica, Escuela Nacional de Ciencias Biologicas, IPN. Prol. Carpio y Plan de Ayala, Colonia Santo Tomas, s/n. CP 11340, Mexico, D.F. (Mexico); Galindez-Mayer, J. [Departamento de Ingenieria Bioquimica, Escuela Nacional de Ciencias Biologicas, IPN. Prol. Carpio y Plan de Ayala, Colonia Santo Tomas, s/n. CP 11340, Mexico, D.F. (Mexico)], E-mail: cmayer@encb.ipn.mx

    2009-01-30

    For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high A{sub D}/A{sub R} ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values {epsilon}{sub G}, and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies ({approx}95%), and by the stoichiometric release of chloride ions from the halogenated compound ({approx}80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions)

  14. 40 CFR 721.7280 - 1,3-Propanediamine, N,N′-1,2-ethanediylbis-, polymer with 2,4,6-trichloro-1,3,5-triazine...

    Science.gov (United States)

    2010-07-01

    ...-ethanediylbis-, polymer with 2,4,6-trichloro-1,3,5-triazine, reaction products with N-butyl-2,2,6,6-tetramethyl...-, polymer with 2,4,6-trichloro-1,3,5-triazine, reaction products with N-butyl-2,2,6,6-tetramethyl-4... identified as 1,3-propanediamine, N,N′-1,2-ethanediylbis-, polymer with...

  15. 异位妊娠246例临床资料回顾与分析%Review and analysis of clinical data of 246 cases of ectopic pregnancy

    Institute of Scientific and Technical Information of China (English)

    周正; 王鑫; 沈旭娜

    2012-01-01

    目的 探讨异位妊娠的主要病因及各种治疗方法对异位妊娠治疗的临床价值,提高对异位妊娠的认识.方法 回顾分析2010年1-12月1年间所收治的246例异位妊娠病例的临床资料,其中药物保守治疗136例,转手术治疗33例.手术治疗共141例,55例腹腔镜下病灶切除或输卵管造口.结果 本研究246例异位妊娠患者,有人流或药流病史的190例,占77.24%,腹腔镜下病灶切除或输卵管造口术55例,占手术比例的41.78%.结论 人流或药流若并发感染可造成慢性输卵管炎、盆腔炎等增加异位妊娠的发病率.腹腔镜技术损伤小,恢复快,住院时间短,用药少,外观好,在治疗异位妊娠中已发挥越来越重要的作用.%Objective To find the main causes of ectopic pregnancy and the various methods of treatment of ectopic pregnancy treatment to better understand ectopic pregnancy. Methods Retrospective analysis of hospital treated 246 cases of ectopic pregnancy cases from January to December of 2010, including 136 cases of the conservative treatment ,33 cases turn to operation treatment. 141 cases of operation treatment, 55 cases of laparoscopic resection of lesions or tubal ostomy. Results In the 246 cases of patients with ectopic pregnancy 190 cases had abortion or medical abortion history, accounting for 77. 24% , laparoscopic resection of lesions or salpingostomy in 55 cases, accounting for the proportion of operation 41. 78%. Conclusions Abortion or medical abortion with concurrent infection can cause chronic tubal inflammation of pelvic inflammatory disease and increase the incidence of ectopic pregnancies. As laparoscopic technique has little injury, quick recovery, shorter hospitalization time, appearance in treatment of ectopic pregnancy has played an increasingly important role.

  16. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  17. A Nodule-Specific Lipid Transfer Protein AsE246 Participates in Transport of Plant-Synthesized Lipids to Symbiosome Membrane and Is Essential for Nodule Organogenesis in Chinese Milk Vetch1[C][W][OPEN

    Science.gov (United States)

    Lei, Lei; Chen, Ling; Shi, Xiaofeng; Li, Yixing; Wang, Jianyun; Chen, Dasong; Xie, Fuli; Li, Youguo

    2014-01-01

    Rhizobia in legume root nodules fix nitrogen in symbiosomes, organelle-like structures in which a membrane from the host plant surrounds the symbiotic bacteria. However, the components that transport plant-synthesized lipids to the symbiosome membrane remain unknown. This study identified and functionally characterized the Chinese milk vetch (Astragalus sinicus) lipid transfer protein AsE246, which is specifically expressed in nodules. It was found that AsE246 can bind lipids in vitro. More importantly, AsE246 can bind the plant-synthesized membrane lipid digalactosyldiacylglycerol in vivo. Immunofluorescence and immunoelectron microscopy showed that AsE246 and digalactosyldiacylglycerol localize in the symbiosome membrane and are present in infection threads. Overexpression of AsE246 resulted in increased nodule numbers; knockdown of AsE246 resulted in reduced nodule numbers, decreased lipids contents in nodules, diminished nitrogen fixation activity, and abnormal development of symbiosomes. AsE246 knockdown also resulted in fewer infection threads, nodule primordia, and nodules, while AsE246 overexpression resulted in more infection threads and nodule primordia, suggesting that AsE246 affects nodule organogenesis associated with infection thread formation. Taken together, these results indicate that AsE246 contributes to lipids transport to the symbiosome membrane, and this transport is required for effective legume-rhizobium symbiosis. PMID:24367021

  18. Suppression of PCDD/Fs formation because of the presence of DEHP during the model slow combustion of 2,4,6-trichlorophenol.

    Science.gov (United States)

    Kishi, Tomohiro; Shinkura, Toshinori; Suzuki, Shota; Kawakami, Tsuyoshi; Takeda, Ken; Onodera, Sukeo

    2010-03-01

    The thermal reactions of 2,4,6-T(3)CP in the presence and absence of DEHP in a dry air stream was investigated using a silica flow reactor at a residence time of 10s and a temperature range from 450 degrees C to 850 degrees C. Two isomers of T(4)CDDs (1,3,6,8- and 1,3,7,9-T(4)CDDs) were the most abundant products during the combustion of 2,4,6-T(3)CP alone and were observed at temperatures ranging from 550 degrees C to 800 degrees C. In the presence of DEHP, we observed a remarkable decrease in the yields of T(4)CDDs during the combustion of 2,4,6-T(3)CP. The suppression ratio of the T(4)CDDs formation was more than 90% in the case of the co-combustion with 10% DEHP in molar ratio. Other PCDD/Fs except for 2,7-/2,8-DCDD and 2,8-DCDF also decreased upon the combustion of 2,4,6-T(3)CP in the presence of DEHP. During the co-combustion of 2,4,6-T(3)CP and DEHP, the residual ratio of 2,4,6-T(3)CP increased slightly and formations of lower chlorinated phenols were observed. The suppression of the T(4)CDDs was strongly dependent on the DEHP ratio in the starting material. The prospective pathways of the suppressions of the T(4)CDDs formations during the combustion of 2,4,6-T(3)CP in the presence of DEHP were proposed. PMID:20080281

  19. Structural studies of the polysaccharides from the lipopolysaccharides of Azospirillum brasilense Sp246 and SpBr14.

    Science.gov (United States)

    Sigida, Elena N; Fedonenko, Yuliya P; Shashkov, Alexander S; Grinev, Vyacheslav S; Zdorovenko, Evelina L; Konnova, Svetlana A; Ignatov, Vladimir V; Knirel, Yuriy A

    2014-10-29

    Lipopolysaccharides from closely related Azospirillum brasilense strains, Sp246 and SpBr14, were obtained by phenol-water extraction. Mild acid hydrolysis of the lipopolysaccharides followed by GPC on Sephadex G-50 resulted in polysaccharide mixtures. On the basis of sugar and methylation analyses, Smith degradation and (1)H and (13)C NMR spectroscopy data, it was concluded that both bacteria possess the same two distinct polysaccharides having structures 1 and 2: [structure: see text]. Structure 1 has been reported earlier for a polysaccharide of A. brasilense 54 [Fedonenko et al., 2011] whereas to our knowledge structure 2 has not been hitherto found in bacterial polysaccharides.

  20. Synthesis of bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine oxide – a tailor-made photoinitiator for dental adhesives

    Directory of Open Access Journals (Sweden)

    Norbert Moszner

    2010-03-01

    Full Text Available Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine oxide (WBAPO was synthesized starting from 3-(chloromethyl-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxyethanol. In the second step, 3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated. The formed acid chloride showed an unexpected low thermal stability. Its thermal rearrangement at 180 °C resulted in a fast formation of 3-(chloromethyl-2,4,6-trimethylbenzoic acid 2-(allyloxyethyl ester. In the third step, the acid chloride was reacted with phenylphosphine dilithium with the formation of bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine, which was oxidized to WBAPO. The structure of WBAPO was confirmed by 1H NMR, 13C NMR, 31P NMR, and IR spectroscopy, as well as elemental analysis. WBAPO, a yellow liquid, possesses improved solubility in polar solvents and shows UV–vis absorption, and a high photoreactivity comparable with the commercially available bisacylphosphine oxides. A sufficient storage stability was found in dental acidic aqueous primer formulations.

  1. Synthesis of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide - a tailor-made photoinitiator for dental adhesives.

    Science.gov (United States)

    Moszner, Norbert; Lamparth, Iris; Angermann, Jörg; Fischer, Urs Karl; Zeuner, Frank; Bock, Thorsten; Liska, Robert; Rheinberger, Volker

    2010-01-01

    Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide (WBAPO) was synthesized starting from 3-(chloromethyl)-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxy)ethanol. In the second step, 3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated. The formed acid chloride showed an unexpected low thermal stability. Its thermal rearrangement at 180 ° C resulted in a fast formation of 3-(chloromethyl)-2,4,6-trimethylbenzoic acid 2-(allyloxy)ethyl ester. In the third step, the acid chloride was reacted with phenylphosphine dilithium with the formation of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine, which was oxidized to WBAPO. The structure of WBAPO was confirmed by ¹H NMR, ¹³C NMR, ³¹P NMR, and IR spectroscopy, as well as elemental analysis. WBAPO, a yellow liquid, possesses improved solubility in polar solvents and shows UV-vis absorption, and a high photoreactivity comparable with the commercially available bisacylphosphine oxides. A sufficient storage stability was found in dental acidic aqueous primer formulations. PMID:20502649

  2. Targeted Learning

    CERN Document Server

    van der Laan, Mark J

    2011-01-01

    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  3. New aminating reagents forthe synthesis of 1,3,5-Triamino-2,4,6-Trinitrobenzene (TATB) and other insensitive energetic materials

    Energy Technology Data Exchange (ETDEWEB)

    Pagoria, P.F.; Mitchell, A.R.; Schmidt, R.D.

    1995-09-19

    We are investigating the amination of electrophilic aromatic systems through the use of Vicarious Nucleophilic Substitution (VNS) chemistry. This research has led to a new synthesis of 1,3,5-Triamino-2,4,6-trinitrobenzene (TATB) and 1,3-diamino-2,4,6-trinitrobenzene (DATB) which uses 2,4,6-trinitroaniline (picramide) or 1,3,5-trinitrobenzene as starting materials. We also describe the development of a new class of VNS aminating reagents based on quarternary hydrazinium halides. 1,1,1-Trimethylhydrazinium iodide (TMHI), available from the methylation of the surplus propellant uns-dimethylhydrazine (UDMH), was used in a new synthesis of TATB. The advantages, scope and limitations of the VNS approach to the synthesis of TATB and other amino-substituted nitroarenes are discussed.

  4. Simultaneous determination of 2,4,6-trichlorophenol and pentachlorophenol based on poly(Rhodamine B)/graphene oxide/multiwalled carbon nanotubes composite film modified electrode

    Science.gov (United States)

    Zhu, Xiaolin; Zhang, Kexin; Lu, Nan; Yuan, Xing

    2016-01-01

    In the present study, a poly(Rhodamine B)/graphene oxide/multiwalled carbon nanotubes nanocomposite modified glass carbon electrode (PRhB/GO/MWCNTs/GCE) was developed for the simultaneous determination of 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP). The PRhB/GO/MWCNTs film was extensively characterized by emission scanning electron microscopy (SEM), X-ray diffraction (XRD), Raman spectroscopy and electrochemical impedance spectroscopy (EIS). The electrochemical behaviors of 2,4,6-TCP and PCP were investigated by cyclic voltammetry, linear sweep voltammetry and differential pulse voltammetry. Due to the synergistic effect, the PRhB/GO/MWCNTs/GCE significantly facilitated the simultaneous electro-oxidation of 2,4,6-TCP and PCP with peak potential difference of 160 mV and enhanced oxidation currents. Under optimum conditions, the oxidation current of 2,4,6-TCP was linear to its concentration in the ranges of 4.0 × 10-9 to 1.0 × 10-7 M and 1.0 × 10-7 to 1.0 × 10-4 M with the detection limit (S/N = 3) of 8.0 × 10-10 M. And the linear concentration ranges for PCP were 2.0 × 10-9 to 1.0 × 10-7 M and 1.0 × 10-7 to 9.0 × 10-5 M with the detection limit of 5.0 × 10-10 M. Moreover, the proposed PRhB/GO/MWCNTs/GCE was successfully applied to the simultaneous determination of 2,4,6-TCP and PCP in practical water samples.

  5. Ecotoxicological evaluation of in situ bioremediation of soils contaminated by the explosive 2,4,6-trinitrotoluene (TNT)

    Energy Technology Data Exchange (ETDEWEB)

    Frische, Tobias

    2003-01-01

    The luminescent bacteria assay, using soil leachates, was the most sensitive toxicity indicator. - To evaluate the environmental relevance of in situ bioremediation of contaminated soils, effective and reliable monitoring approaches are of special importance. The presented study was conducted as part of a research project investigating in situ bioremediation of topsoils contaminated by the explosive 2,4,6-trinitrotoluene (TNT). Changes in soil toxicity within different experimental fields at a former ordnance factory were evaluated using a battery of five bioassays (plant growth, Collembola reproduction, soil respiration, luminescent bacteria acute toxicity and mutagenicity test) in combination to chemical contaminant analysis. Resulting data reveal clear differences in sensitivities between methods with the luminescent bacteria assay performed with soil leachates as most sensitive toxicity indicator. Complete test battery results are presented in so-called soil toxicity profiles to visualise and facilitate the interpretation of data. Both biological and chemical monitoring results indicate a reduction of soil toxicity within 17 months of remediation.

  6. Bis (3-methoxy-4-hydroxybenzaldehyde-2,4,6-trinitrophenol) organic cocrystal: Synthesis and physico-chemical properties

    Science.gov (United States)

    Sudharsana, N.; Krishnakumar, V.; Nagalakshmi, R.

    2016-10-01

    A 3-methoxy-4-hydroxybenzaldehyde-2,4,6-trinitrophenol (mhba-tnp) cocrystal was grown by the slow evaporation solution growth technique using ethanol as a solvent. As-grown crystals were characterized by single crystal X-ray diffraction (XRD) study and crystallized with a centrosymmetric space group. Optical properties of the grown crystal have been studied by Ultraviolet-Visible (UV-Vis) absorption spectra in the range from 200 to 800nm and the band gap energy of the crystal was obtained as 2.8eV. Fourier transform infrared (FTIR) and micro Raman spectral analyses have been carried out to confirm the functional groups present in the title compound. Differential scanning calorimetry (DSC) and polarized light thermomicroscopy (PLTM) analyses were carried out to find the melting point. In addition, the optimized geometric parameters and the molecular orbitals were calculated using density functional theory (DFT) with the help of the Gaussian 03W software.

  7. Application of a Homogenous Assay for the Detection of 2,4,6-Trinitrotoluene to Environmental Water Samples

    Directory of Open Access Journals (Sweden)

    Ellen R. Goldman

    2005-01-01

    Full Text Available A homogeneous assay was used to detect 2,4,6-trinitrotoluene (TNT spiked into environmental water samples. This assay is based on changes in fluorescence emission intensity when TNT competitively displaces a fluorescently labeled, TNT analog bound to an anti-TNT antibody. The effectiveness of the assay was highly dependent on the source of the sample being tested. As no correlation between pH and assay performance was observed, ionic strength was assumed to be the reason for variation in assay results. Addition of 10x phosphate-buffered saline to samples to increase their ionic strength to that of our standard laboratory buffer (about 0.17 M significantly improved the range over which the assay functioned in several river water samples.

  8. Aquatrinitrato[2,4,6-tris(pyridin-2-yl-1,3,5-triazine]neodymium(III dihydrate

    Directory of Open Access Journals (Sweden)

    Jin Zhou

    2011-06-01

    Full Text Available In the title compound, [Nd(NO33(C18H12N6(H2O]·2H2O, the Nd3+ ion is in a distorted bicapped square-antiprismatic geometry formed by three N atoms from the 2,4,6-tris(pyridin-2-yl-1,3,5-triazine (TPTZ ligand, six O atoms from the three nitrate anions and one O atom from the aqua ligand. The molecules are linked by O—H...O and O—H...N hydrogen bonds. Two types of π–π stacking interactions occur between the TPTZ ligands of adjacent complexes [centroid-to-centroid distances = 3.760 (4 and 3.870 (3 Å].

  9. Green and solvent-free procedure for microwave-assisted synthesis of 2,4,6-triarylpyridines catalysed using MgAl2O4 nanocrystals

    Indian Academy of Sciences (India)

    Javad Safari; Soheila Gandomi-Ravandi; Mahmoud Borjian Borujeni

    2013-09-01

    Design and development of a heterogeneous nanocatalyst for condensation reaction of acetophenone derivatives, aromatic aldehydes, and ammonium acetate to yield 2,4,6-triarylpyridines followed by microwave irradiation is described. Nanocrystalline MgAl2O4 as a novel heterogeneous recyclable catalyst shows high activity for the above reaction. In addition, the easily recoverable nanosized catalysts showed good reusability.

  10. A convenient route to symmetrically and unsymmetrically substituted 3,5-diaryl-2,4,6-trimethylpyridines via Suzuki–Miyaura cross-coupling reaction

    Science.gov (United States)

    Szawkało, Joanna; Czarnocki, Zbigniew

    2016-01-01

    Summary A series of differently substituted 3,5-diaryl-2,4,6-trimethylpyridines were prepared and characterized using the Suzuki–Miyaura coupling reaction with accordingly selected bromo-derivatives and arylboronic acids. The reaction conditions were carefully optimized allowing high yield of isolated products and also the construction of unsymmetrically substituted diarylpyridines, difficult to access by other methods. PMID:27340474

  11. Synthesis, Crystal Structure and Electrochemical Properties of a One-dimensional Chain Coordination Polymer [Mn(phen)(2,4,6-TMBA)2(H2O)]n

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A one-dimensional chain-like coordination polymer [Mn(phen)(2,4,6-TMBA)2(H2O)]n has been synthesized from 2,4,6-trimethylbenzoic acid, 1,10-phenanthioline and anhydrous manganese(Ⅱ) sulfate and then characterized. Crystal data for this complex: tetragonal, space group I41, a = 2.05643(16), b = 2.05643(16), c = 1.3939(2) nm, V= 5.8946(11) nm3, Mr = 579.54, Z = 8, Dc = 1.306 g/cm3, λ(MoKα) = 0.490 mm-1, F(000) = 2424, S = 0.985, the final R = 0.0411 and wR = 0.0950. The Flack factor is -0.01(2). The crystal structure shows that two neighboring man-ganese(Ⅱ) ions are linked together by one bridge-chelating 2,4,6-trimethylbenzoic group, forming a one-dimensional chain structure. The manganese(Ⅱ) ion is coordinated with two nitrogen atoms of one 1,10-phenanthroline, three oxygen atoms from three 2,4,6-trimethylbenzoic acids and one water oxygen atom, giving a distorted octahedral coordination geometry. The cyclic voltametric behavior of the complex was also investigated.

  12. Degradation of 2,4,6-Trichlorophenol Using Hydrogen Peroxide Catalyzed by Nanoscale Zero-Valent Iron Supported on Ion Exchange Resin.

    Science.gov (United States)

    Tai, Chao; She, Jiaping; Yin, Yongguang; Zhao, Tongqian; Wu, Li

    2016-06-01

    Nanoscale zero-valent iron (NZVI) supported on ion exchange resin was prepared and characterized by scanning electron microscope and energy dispersive spectroscopy, with a simple model developed for describing the catalyst. The degradation of 2,4,6-trichlorophenol (2,4,6-TCP) by hydrogen peroxide using NZVI supported on ion exchange resin as the catalyst, was studied. The results showed that 2,4,6-TCP with a concentration of 1 mmol L(-1) could be well degraded into low molecule weight organic acids in two hours. The optimized condition was as follows: pH, 3.0; temperature, 35 degrees C; catalyst dosage, 1.5 g; and hydrogen peroxide, 0.16 mmol L(-1). The catalyst has good reusability, with no catalytic efficiency decreasing even after ten times recycles. A possible mechanism of 2,4,6-TCP degradation was proposed, based on the products indentified by GC-MS after derived using trimethylsulfonium hydroxide. PMID:27427643

  13. 1,1´,1´´-(2,4,6-Trihydroxybenzene-1,3,5-triyl)triethanone tautomerism revisited

    DEFF Research Database (Denmark)

    Hansen, Poul Erik; Kamounah, Fadhil S.; Zhiryakova, Diana;

    2014-01-01

    It has recently been suggested that 1,1′,1′′-(2,4,6-trihydroxybenzene-1,3,5-triyl)triethanone may be tautomeric. Using 13C NMR chemical shifts and deuterium isotope effects on 13C chemical shifts, it is demonstrated that this is not the case. This compound occurs as a strongly hydrogen bonded ben...

  14. 2,4,6-Trichloro-1,3,5-triazine/dimethylformamide as an efficient reagent for one-pot conversion of alcohols into N-alkylphthalimides

    Institute of Scientific and Technical Information of China (English)

    Babak; Mokhtari; Roya; Azadi; Aseieh; Azhdari

    2010-01-01

    An efficient and mild method for the direct conversion of alcohols into N-alkylphthalimides using 2,4,6-trichloro-1,3,5-triazine and dimethylformamide was described.The reaction was preceded via(alcoxymethylene) dimethylammonium chloride intermediate and produced corresponding N-alkylphthalimides in good-to-excellent yields.

  15. Anaerobic mineralization of 2,4,6-tribromophenol to CO2 by a synthetic microbial community comprising Clostridium, Dehalobacter, and Desulfatiglans.

    Science.gov (United States)

    Li, Zhiling; Yoshida, Naoko; Wang, Aijie; Nan, Jun; Liang, Bin; Zhang, Chunfang; Zhang, Dongdong; Suzuki, Daisuke; Zhou, Xue; Xiao, Zhixing; Katayama, Arata

    2015-01-01

    Anaerobic mineralization of 2,4,6-tribromophenol (2,4,6-TBP) was achieved by a synthetic anaerobe community comprising a highly enriched culture of Dehalobacter sp. phylotype FTH1 acting as a reductive debrominator; Clostridium sp. strain Ma13 acting as a hydrogen supplier via glucose fermentation; and a novel 4-chlorophenol-degrading anaerobe, Desulfatiglans parachlorophenolica strain DS. 2,4,6-TBP was debrominated to phenol by the combined action of Ma13 and FTH1, then mineralized into CO2 by sequential introduction of DS, confirmed using [ring-(14)C(U)] phenol. The optimum concentrations of glucose, SO4(2-), and inoculum densities were 0.5 or 2.5mM, 1.0 or 2.5mM, and the densities equivalent to 10(4)copiesmL(-1) of the 16S rRNA genes, respectively. This resulted in the complete mineralization of 23μM 2,4,6-TBP within 35days (0.58μmolL(-1)d(-1)). Thus, using a synthetic microbial community of isolates or highly enriched cultures would be an efficient, optimizable, low-cost strategy for anaerobic bioremediation of halogenated aromatics.

  16. Synthesis and Docking Studies of 2,4,6-Trihydroxy-3-Geranylacetophenone Analogs as Potential Lipoxygenase Inhibitor

    Directory of Open Access Journals (Sweden)

    Chean Hui Ng

    2014-08-01

    Full Text Available The natural product molecule 2,4,6-trihydroxy-3-geranyl-acetophenone (tHGA isolated from the medicinal plant Melicope ptelefolia was shown to exhibit potent lipoxygenase (LOX inhibitory activity. It is known that LOX plays an important role in inflammatory response as it catalyzes the oxidation of unsaturated fatty acids, such as linoleic acid to form hydroperoxides. The search for selective LOX inhibitors may provide new therapeutic approach for inflammatory diseases. Herein, we report the synthesis of tHGA analogs using simple Friedel-Craft acylation and alkylation reactions with the aim of obtaining a better insight into the structure-activity relationships of the compounds. All the synthesized analogs showed potent soybean 15-LOX inhibitory activity in a dose-dependent manner (IC50 = 10.31–27.61 μM where compound 3e was two-fold more active than tHGA. Molecular docking was then applied to reveal the important binding interactions of compound 3e in soybean 15-LOX binding site. The findings suggest that the presence of longer acyl bearing aliphatic chain (5Cs and aromatic groups could significantly affect the enzymatic activity.

  17. Molecular and Crystal Structure of 1,3,5 Tris(benzimidazol-1-ylmethyl)-2,4,6-Trimethylbenzene

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The compound 1,3,5-tris(benzimidazol-l-ylmethyl)-2,4,6-trimethylbenzene, crystallizes in the monoclinic system, space group P2rC, with a = 17.571(4), b = 10.860(2), c = 14.126(3) A; β = 92.89(3)°, V= 2692(1)A3, De = 1.260 g/cm3, Z = 4, C33H30N6, Mr. = 510.63, μ(MoKα) = 0.077mm-1, F(000) = 1080. The structure was refined to R = 0.0592, wR = 0.1379 for 1492 (I>2σ(I)) reflections. The title molecule has cis, trans, trans-conformation about the central phenyl ring. The screw-related molecules are connected by hydrogen bonds C-H...N (x,-0.5-y, 0.5+z) and form the infinite helical chains. The polar molecular chains are antiparallelly stacked through edge-to-face C-H… π interactions.

  18. Highly selective detection of 2,4,6-trinitrophenol by using newly developed terbium-doped blue carbon dots.

    Science.gov (United States)

    Chen, Bin Bin; Liu, Ze Xi; Zou, Hong Yan; Huang, Cheng Zhi

    2016-04-25

    The detection of nitroaromatic explosives is of great importance owing to their strong explosive power and harmfulness in terms of the environment, homeland security and public safety. Herein, rare earth-doped carbon dots with multifunctional features were firstly prepared by simply keeping the mixture of terbium(iii) nitrate pentahydrate and citric acid at 190 °C for 30 min. The as-prepared terbium doped carbon dots (Tb-CDs), through a rapid and simple direct carbonization route, have a size of about 3 nm, and exhibit excitation wavelength dependent emission of blue fluorescence, are stable, and can be applied for the selective and colorimetric detection of 2,4,6-trinitrophenol (TNP) in the range of 500 nM-100 μM with a limit of detection of 200 nM based on the inner filtering effect (IFE) of the excitation and emission bands of Tb-CDs by TNP and the electron transfer (ET) from Tb-CDs to TNP, giving a precise and highly reproducible result for detecting complex water samples. PMID:27109163

  19. The renaissance of 2,4,6-tris(2-pyrimidyl)-1,3,5-triazine (TPymT) coordination chemistry.

    Science.gov (United States)

    Safin, Damir A; Frost, Jamie M; Murugesu, Muralee

    2015-12-21

    In this perspective we report on recently accumulated data on the synthesis and coordination chemistry of 2,4,6-tris(2-pyrimidyl)-1,3,5-triazine (TPymT). Although a highly attractive ligand, owing to the presence of three fused terpyridine-like coordination pockets, the coordination chemistry of TPymT has something of a chequered past. This can principally be attributed to the hydrolysis of the ligand, which readily occurs under mild conditions. Thus, after first being synthesised in 1959 it had only been used a handful of times to synthesise coordination compounds until we began reinvestigating its chemistry in early 2013. Despite the significant challenges associated with its use, our work over the past two years has demonstrated that coordination chemistry with TPymT is indeed possible. Herein, we describe an overview of this body of work as it stands, and discuss its potential impact in a variety of areas including porous materials, catalysis and crystal engineering.

  20. 2,4,6-Trinitrotoluene mineralization and bacterial production rates of natural microbial assemblages from coastal sediments

    International Nuclear Information System (INIS)

    The nitrogenous energetic constituent, 2,4,6-Trinitrotoluene (TNT), is widely reported to be resistant to bacterial mineralization (conversion to CO2); however, these studies primarily involve bacterial isolates from freshwater where bacterial production is typically limited by phosphorus. This study involved six surveys of coastal waters adjacent to three biome types: temperate broadleaf, northern coniferous, and tropical. Capacity to catabolize and mineralize TNT ring carbon to CO2 was a common feature of natural sediment assemblages from these coastal environments (ranging to 270+/-38 μg C kg-1 d-1). More importantly, these mineralization rates comprised a significant proportion of total heterotrophic production. The finding that most natural assemblages surveyed from these ecosystems can mineralize TNT ring carbon to CO2 is consistent with recent reports that assemblage components can incorporate TNT ring carbon into bacterial biomass. These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - Highlights: → TNT mineralization is a common feature of natural bacterial assemblages in coastal sediments. → TNT mineralization rates comprised a significant proportion of total heterotrophic production. → These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - The capacity to mineralize TNT ring carbon to CO2 is a common feature of natural bacterial assemblages in coastal sediment.

  1. In vitro study to determine decontamination of 3,5-dichloro-2,4,6-trifluoropyridine (DCTFP) from human skin.

    Science.gov (United States)

    Hui, Xiaoying; Domoradzki, Jeanne Y; Maibach, Howard C

    2012-07-01

    This in vitro study determined the decontamination potential of soap and water, D-TAM skin cleanser, corn oil and the O'Dell reactive skin decontamination system to remove 3,5-dichloro-2,4,6-trifluoropyridine (DCTFP) from human skin after short exposure periods (10 and 30 min). The main result turned out to be the rapid volatility of DCTFP where half of the dose evaporated within 10 min and most of the dose was evaporated after 30 min. This rapid volatility was confirmed in an additional study where DCTFP rapidly evaporated from inert plastic disks (70% loss in 10 min). Despite rapid evaporation and short exposure periods, some DCTFP entered into the human skin epidermis, dermis and receptor fluid. Less DCTFP reached the receptor fluid with the 10 min decontamination (0.13%) than the 30 min decontamination (0.27%). Statistically, all tested decontamination systems performed the same (P>0.05). For human risk the volatility of DCTFP seems paramount. For skin decontamination any of the tested systems will work. An important point is that they should be used within minutes of skin exposure. This study exhibits the dynamics of evaporation, substantivity (skin binding), percutaneous absorption and decontamination of a volatile chemical. PMID:22504088

  2. Thermal decomposition and kinetic evaluation of decanted 2,4,6-trinitrotoluene (TNT) for reutilization as composite material

    Science.gov (United States)

    Ahmed, M. F.; Hussain, A.; Malik, A. Q.

    2016-08-01

    Use of energetic materials has long been considered for only military purposes. However, it is very recent that their practical applications in wide range of commercial fields such as mining, road building, under water blasting and rocket propulsion system have been considered. About 5mg of 2,4,6-trinitrotoluene (TNT) in serviceable (Svc) as well as unserviceable (Unsvc) form were used for their thermal decomposition and kinetic parameters investigation. Thermogravimetric/ differential thermal analysis (TG/DTA), X-ray diffraction (XRD) and Scanning electron microscope (SEM) were used to characterize two types of TNT. Arrhenius kinetic parameters like activation energy (E) and enthalpy (AH) of both TNT samples were determined using TG curves with the help of Horowitz and Metzger method. Simultaneously, thermal decomposition range was evaluated from DTA curves. Distinct diffraction peaks showing crystalline nature were obtained from XRD analysis. SEM results indicated that Unsvc TNT contained a variety of defects like cracks and porosity. Similarly, it is observed that thermal as well as kinetic behavior of both TNT samples vary to a great extent. Likewise, a prominent change in the activation energies (E) of both samples is observed. This in-depth study provides a way forward in finding solutions for the safe reutilization of decanted TNT.

  3. Highly Photoluminescent Molybdenum Oxide Quantum Dots: One-Pot Synthesis and Application in 2,4,6-Trinitrotoluene Determination.

    Science.gov (United States)

    Xiao, Sai Jin; Zhao, Xiao Jing; Hu, Ping Ping; Chu, Zhao Jun; Huang, Cheng Zhi; Zhang, Li

    2016-03-30

    As a well-studied transition-metal semiconductor material, MoOx has a wider band gap than molybdenum disulfide (MoS2), and its property varies dramatically for the existence of several different allotropes and suboxide phases of molybdenum oxides (MoOx, x synthesis of highly photoluminescent MoOx quantum dots (MoOx QDs), in which commercial molybdenum disulfide (MoS2) powder and hydrogen peroxide (H2O2) are employed as the precursor and oxidant, respectively. The obtained MoOx QDs can be further utilized as an efficient photoluminescent probe, and a new turn-off sensor is developed for 2,4,6-trinitrotoluene (TNT) determination based on the fact that the photoluminescence of MoOx QDs can be quenched by the Meisenheimer complexes formed in the strong alkali solution through the inner filter effect (IFE). Under the optimal conditions, the decreased photoluminescence of MoOx QDs shows a good linear relationship to the concentration of TNT ranging from 0.5 to 240.0 μM, and the limit of detection was 0.12 μM (3σ/k). With the present turn-off sensor, TNT in river water samples can be rapidly and selectively detected without tedious sample pretreatment processes. PMID:26954663

  4. Aniline and 2,4,6-trinitrotoluene associate preferentially to low molecular weight fractions of dissolved soil organic matter

    International Nuclear Information System (INIS)

    Aniline and 2,4,6-trinitrotoluene (TNT) were equilibrated with particulate (POM) and dissolved organic matter (DOM) from an organic soil at different compositions of adsorbed major cations (Na, Al) and pH (aniline: 3.7-5.1, TNT: 4.8-5.0). After separation of POM, concentrations of 14C-labelled aniline and TNT* (including TNT degradation products) were determined in DOM size fractions using size-exclusion chromatography (SEC) and UV-detection. Concentrations in the 40 kDa fraction. Thus, both aniline and TNT* were preferentially associated to the smallest DOM size fraction. The significant binding to DOM (similar extent as to POM) and the fact that the <3.5 kDa DOM fraction was less susceptible to flocculation by major metals suggests that the mobility of aniline and TNT is highly affected by the solubility of soil organic matter. - Concentrations of aniline and TNT associated with dissolved organic matter (DOM) was shown to increase with decreasing apparent molecular mass of DOM.

  5. 2,4,6-Trinitrotoluene mineralization and bacterial production rates of natural microbial assemblages from coastal sediments

    Energy Technology Data Exchange (ETDEWEB)

    Montgomery, Michael T., E-mail: michael.montgomery@nrl.navy.mil [Naval Research Laboratory, Marine Biogeochemistry Section, Code 6114, 4555 Overlook Avenue, Washington, DC 20375 (United States); Coffin, Richard B., E-mail: richard.coffin@nrl.navy.mil [Naval Research Laboratory, Marine Biogeochemistry Section, Code 6114, 4555 Overlook Avenue, Washington, DC 20375 (United States); Boyd, Thomas J., E-mail: thomas.boyd@nrl.navy.mil [Naval Research Laboratory, Marine Biogeochemistry Section, Code 6114, 4555 Overlook Avenue, Washington, DC 20375 (United States); Smith, Joseph P., E-mail: joseph.smith@nrl.navy.mil [Naval Research Laboratory, Marine Biogeochemistry Section, Code 6114, 4555 Overlook Avenue, Washington, DC 20375 (United States); Walker, Shelby E., E-mail: Shelby.Walker@noaa.gov [Naval Research Laboratory, Marine Biogeochemistry Section, Code 6114, 4555 Overlook Avenue, Washington, DC 20375 (United States); Osburn, Christopher L., E-mail: chris_osburn@ncsu.edu [Marine, Earth and Atmospheric Sciences, North Carolina State University, Raleigh, NC 27695 (United States)

    2011-12-15

    The nitrogenous energetic constituent, 2,4,6-Trinitrotoluene (TNT), is widely reported to be resistant to bacterial mineralization (conversion to CO{sub 2}); however, these studies primarily involve bacterial isolates from freshwater where bacterial production is typically limited by phosphorus. This study involved six surveys of coastal waters adjacent to three biome types: temperate broadleaf, northern coniferous, and tropical. Capacity to catabolize and mineralize TNT ring carbon to CO{sub 2} was a common feature of natural sediment assemblages from these coastal environments (ranging to 270+/-38 {mu}g C kg{sup -1} d{sup -1}). More importantly, these mineralization rates comprised a significant proportion of total heterotrophic production. The finding that most natural assemblages surveyed from these ecosystems can mineralize TNT ring carbon to CO{sub 2} is consistent with recent reports that assemblage components can incorporate TNT ring carbon into bacterial biomass. These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - Highlights: > TNT mineralization is a common feature of natural bacterial assemblages in coastal sediments. > TNT mineralization rates comprised a significant proportion of total heterotrophic production. > These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - The capacity to mineralize TNT ring carbon to CO{sub 2} is a common feature of natural bacterial assemblages in coastal sediment.

  6. Laccase-polyacrylonitrile nanofibrous membrane: highly immobilized, stable, reusable, and efficacious for 2,4,6-trichlorophenol removal.

    Science.gov (United States)

    Xu, Ran; Chi, Chenglong; Li, Fengting; Zhang, Bingru

    2013-12-11

    Increasing attention has been given to nanobiocatalysis for commercial applications. In this study, laccase was immobilized on polyacrylonitrile (PAN) nanofibrous membranes through ethanol/HCl method of amidination reaction and successfully applied for removal of 2,4,6-trichlorophenol (TCP) from water. PAN membranes with fiber diameters from 200 nm to 300 nm were fabricated via electrospinning and provided a large surface area for enzyme immobilization and catalytic reactions. Images of scanning electron microscope demonstrated the enzyme molecules were aggregated on the nanofiber surface. The immobilized laccase exhibited 72% of the free enzyme activity and kept 60% of its initial activity after 10 operation cycles. Moreover, the storage stability of the immobilized laccase was considered excellent because they maintained more than 92% of the initial activity after 18 days of storage, whereas the free laccase retained only 20%. The laccase-PAN nanofibrous membranes exhibited high removal efficiency of TCP under the combined actions of biodegradation and adsorption. More than 85% of the TCP was removed under optimum conditions. Effects of various factors on TCP removal efficiency of the immobilized laccase were analyzed. Results suggest that laccase-PAN nanofibrous membranes can be used in removing TCP from aqueous sources and have potential for use in other commercial applications. PMID:24245853

  7. Effectiveness of urea in enhancing the extractability of 2,4,6-trinitrotoluene from chemically variant soils.

    Science.gov (United States)

    Das, Padmini; Sarkar, Dibyendu; Makris, Konstantinos C; Punamiya, Pravin; Datta, Rupali

    2013-11-01

    One of the major challenges in developing an effective phytoremediation technology for 2,4,6-trinitrotoluene (TNT) contaminated soils is limited plant uptake resulting from low solubility of TNT. The effectiveness of urea as a solubilizing agent in increasing plant uptake of TNT in hydroponic systems has been documented. Our preliminary greenhouse experiments using urea were also very promising, but further characterization of the performance of urea in highly-complex soil-solution was necessary. The present study investigated the natural retention capacity of four chemically variant soils and optimized the factors influencing the effectiveness of urea in enhancing TNT solubility in the soil solutions. Results show that the extent of TNT sorption and desorption varies with the soil properties, and is mainly dependent on soil organic matter (SOM) content. Hysteretic desorption of TNT in all tested soils suggests irreversible sorption of TNT and indicates the need of using an extractant to increase the release of TNT in soil solutions. Urea significantly (porganic matter content and urea application rates showed significant effects, whereas pH did not exert any significant effect on urea catalysis of TNT extraction from soil. The optimum urea application rates (125 or 350 mg kg(-1)) for maximizing TNT extraction were within the limits set by the agronomic fertilizer-N rates used for major agricultural crops. The data obtained from this batch study will facilitate the optimization of a chemically-catalyzed phytoremediation model for cleaning up TNT-contaminated soils. PMID:23835412

  8. 40 CFR 721.5356 - Ethanol, 2,2′2″-nitrilotris-, compound with alpha-2,4,6-tris (1-phenylethyl)phenyl]-omega...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Ethanol, 2,2â²2â³-nitrilotris... Substances § 721.5356 Ethanol, 2,2′2″-nitrilotris-, compound with alpha-2,4,6-tris (1-phenylethyl)phenyl... subject to reporting. (1) The chemical substance identified as ethanol, 2,2′2″-nitrilotris-, compound...

  9. Application of Novel Amino-Functionalized NZVI@SiO2 Nanoparticles to Enhance Anaerobic Granular Sludge Removal of 2,4,6-Trichlorophenol

    Directory of Open Access Journals (Sweden)

    Zeyu Guan

    2015-01-01

    Full Text Available A novel amino-functionalized silica-coated nanoscale zerovalent iron (NZVI@SiO2-NH2 was successfully synthesized by using one-step liquid-phase method with the surface functionalization of nanoscale zerovalent iron (NZVI to enhance degradation of chlorinated organic contaminants from anaerobic microbial system. NZVI@SiO2-NH2 nanoparticles were synthesized under optimal conditions with the uniform core-shell structure (80–100 nm, high loading of amino functionality (~0.9 wt%, and relatively large specific surface area (126.3 m2/g. The result demonstrated that well-dispersed NZVI@SiO2-NH2 nanoparticle with nFe0-core and amino-functional silicon shell can effectively remove 2,4,6-trichlorophenol (2,4,6-TCP in the neutral condition, much higher than that of NZVI. Besides, the surface-modified nanoparticles (NZVI@SiO2-NH2 in anaerobic granule sludge system also showed a positive effect to promote anaerobic biodechlorination system. More than 94.6% of 2,4,6-TCP was removed from the combined NZVI@SiO2-NH2-anaerobic granular sludge system during the anaerobic dechlorination processes. Moreover, adding the appropriate concentration of NZVI@SiO2-NH2 in anaerobic granular sludge treatment system can decrease the toxicity of 2,4,6-TCP to anaerobic microorganisms and improved the cumulative amount of methane production and electron transport system activity. The results from this study clearly demonstrated that the NZVI@SiO2-NH2/anaerobic granular sludge system could become an effective and promising technology for the removal of chlorophenols in industrial wastewater.

  10. Dichlorido{(E-2,4,6-trimethyl-N-[phenyl(2-pyridylmethylidene]aniline-κ2N,N′}palladium(II

    Directory of Open Access Journals (Sweden)

    Cheng-Hsien Yang

    2010-06-01

    Full Text Available The title complex, [PdCl2(C21H20N2], contains a PdII atom in a slightly distorted square-planar coordination environment defined by two N atoms from one 2,4,6-trimethyl-N-[phenyl(2-pyridylmethylidene]aniline ligand and two Cl atoms, forming a five-membered ring (N—Pd—N—C—C.

  11. 含不同水溶性基团的三聚氰氯衍生物的合成%Synthesis of 2,4,6-Trichloro-1,3,5-triazine Derivatives with Different Water-Soluble Groups

    Institute of Scientific and Technical Information of China (English)

    刘琳; 田秀枝; 蒋学

    2015-01-01

    The key of producing fuel ethanol with lignocellulose is how to hydrolyze cellulose into fermentable sugars efficiently, but the low yield of fermentable sugar in cellulose hydrolysis is the bottle-neck problem in biomass utilization. A creative idea was proposed that based on the cellulose fabric dyed reactive dyes owns the character of“reactive tendering”, the yield of hydrolysis can be improved by the crystal structural change of cellulose based on chemical modification. 2,4,6-trichloro-1,3,5-triazine derivatives with different water-soluble groups were synthesized successfully through nucleophilic substitution reaction between cyanuric chloride and aminopropionic acid or aminoethanesulfonic acid. These 2,4,6-trichloro-1,3,5-triazine derivatives were used as modifiers and reacted with lignocellulose under chemical modification. The structure of the target products were determined by IR, HPLC/MS and 13C NMR spectrometer.%木质纤维素制备乙醇最关键的步骤是使纤维素水解成可发酵糖,但目前纤维素水解效率很低,是生物质能源化利用的瓶颈。依据活性染料染色纤维素类织物具有“活性脆损”的性质提出一种新思路——以化学改性的方法改变纤维素的结晶结构从而提高其水解效率。采用三聚氰氯与氨基丙酸、氨基乙磺酸中的-NH2发生亲核取代反应,制备含有不同水溶性基团的三聚氰氯衍生物作为木质纤维素化学改性的改性剂。通过红外光谱、高效液相色谱质谱联用、13C NMR谱对其进行结构验证。

  12. Chemical and physical data collected aboard the THOMAS G. THOMPSON during cruise TN246 in the South Atlantic Ocean and South Pacific Ocean from 2010-01-15 to 2010-03-05 (NODC Accession 0117396)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0117396 includes chemical and physical data collected aboard the THOMAS G. THOMPSON during cruise TN246 in the South Atlantic Ocean and South Pacific...

  13. Pharmacokinetics and interspecies allometric scaling of ST-246, an oral antiviral therapeutic for treatment of orthopoxvirus infection.

    Directory of Open Access Journals (Sweden)

    Adams Amantana

    Full Text Available Plasma pharmacokinetics of ST-246, smallpox therapeutic, was evaluated in mice, rabbits, monkeys and dogs following repeat oral administrations by gavage. The dog showed the lowest Tmax of 0.83 h and the monkey, the highest value of 3.25 h. A 2- to 4-fold greater dose-normalized Cmax was observed for the dog compared to the other species. The mouse showed the highest dose-normalized AUC, which was 2-fold greater than that for the rabbit and monkey both of which by approximation, recorded the lowest value. The Cl/F increased across species from 0.05 L/h for mouse to 42.52 L/h for dog. The mouse showed the lowest VD/F of 0.41 L and the monkey, the highest VD/F of 392.95 L. The calculated extraction ratios were 0.104, 0.363, 0.231 and 0.591 for mouse, rabbit, monkey and dog, respectively. The dog showed the lowest terminal half-life of 3.10 h and the monkey, the highest value of 9.94 h. The simple allometric human VD/F and MLP-corrected Cl/F were 2311.51 L and 51.35 L/h, respectively, with calculated human extraction ratio of 0.153 and terminal half-life of 31.20 h. Overall, a species-specific difference was observed for Cl/F with this parameter increasing across species from mouse to dog. The human MLP-corrected Cl/F, terminal half-life, extraction ratios were in close proximity to the observed estimates. In addition, the first-in-humans (FIH dose of 485 mg, determined from the MLP-corrected allometry Cl/F, was well within the dose range of 400 mg and 600 mg administered in healthy adult human volunteers.

  14. Vibrational spectroscopic study of new promising materials for non-linear optics. Phosphates of 2,4,6-triaminopyrimidine

    International Nuclear Information System (INIS)

    Complete text of publication follows. The searching for new materials exhibiting nonlinear optical properties (e.g. second harmonic generation - SHG) in combination with other desirable properties (optical transparency, thermal, optical and mechanical stability) continues to be an important research goal in nonlinear optics (NLO). Essential applications of these materials lie in the areas of optical communications and optical signal processing, as well as storage and other information processing tasks. Interesting class of NLO compounds is based on salts combining a cation derived from a polarizable organic molecule with an inorganic anion capable of forming hydrogen-bonded crystal structures. The bonding energy present in the hydrogen bonds can counteract the tendencies of the organic dipoles to form centrosymmetric pairs. It is assumed that the acid part of such molecular complex is responsible for favourable chemical, mechanical and thermal properties, due to strong hydrogen bond interactions which stabilize the crystal lattice and also contributes to the second-order NLO coefficient of the crystal. The organic part is mainly responsible for the nonlinear optical properties of the crystal. Full assignment of vibrational spectra (employing quantum-chemical computational methods) of crystalline materials with promising SHG activity is very useful not only for their identification but also with respect to their nonlinear optical properties. In this contribution we are presenting results concerning three novel phosphates of 2,4,6-triaminopyrimidine. Assignment of vibrational spectra is based on results of X-ray structural analysis and quantum-chemical computations. Efficiency of SHG for polycrystalline samples is also presented and discussed. This work was supported by the Grant Agency of Czech Republic (grant No. 203/09/0878 and is part of the long term Research Plan of the Ministry of Education of the Czech Republic No. MSM0021620857.

  15. Absorption, tissue distribution, and elimination of residues after 2,4,6-trinitro[14C]toluene administration to sheep.

    Science.gov (United States)

    Smith, D J; Craig, A M; Duringer, J M; Chaney, R L

    2008-04-01

    The compound 2,4,6-trinitrotoluene (TNT) is a persistent contaminant of some industrial and military sites. Biological bioremediation techniques typically rely on the immobilization of TNT reduction products rather than on TNT mineralization. We hypothesized that sheep ruminal microbes would be suitable for TNT destruction after phytoremediation of TNT-contaminated soils by cool-season grasses. Therefore we investigated the fate of [14C]TNT in ruminating sheep to determine the utility of ruminant animals as a portion of the bioremediation process. Three wether sheep were dosed with 35.5 mg each of dietary unlabeled TNT for 21 consecutive days. On day 22 sheep (41.9 +/- 3.0 kg) were orally dosed with 35.5 mg of [14C]TNT (129 microCi; 99.1% radiochemical purity). Blood, urine, and feces were collected at regular intervals for 72 h. At slaughter, tissues were quantitatively collected. Tissues and blood were analyzed for total radioactive residues (TRR); excreta were analyzed for TRR, bound residues, and TNT metabolites. Plasma radioactivity peaked within 1 h of dosing and was essentially depleted within 18 h. Approximately 76% of the radiocarbon was excreted in feces, 17% in urine, with 5% being retained in the gastrointestinal tract and 1% retained in tissues. Parent TNT, dinitroamino metabolites, and diaminonitro metabolites were not detected in excreta. Ruminal and fecal radioactivity was essentially nonextractable using ethyl acetate, acetone, and methanol; covalent binding of fecal radioactive residues was evenly distributed among extractable organic molecules (i.e., soluble organic matter, soluble carbohydrate, protein, lipid, and nucleic acid fractions) and undigested fibers (cellulose, hemicellulose, and lignin). This study demonstrated that TNT reduction within the ruminant gastrointestinal tract leads to substantial immobilization of residues to organic matter, a fate similar to TNT in other strongly reducing environments. PMID:18504997

  16. Transformation of 2,4,6-trinitrotoluene in soil in the presence of the earthworm Eisenia andrei

    Energy Technology Data Exchange (ETDEWEB)

    Renoux, A.Y.; Sarrazin, M.; Hawari, J.; Sunahara, G.I.

    2000-06-01

    The ability of the earthworm Eisenia andrei to metabolize 2,4,6-trinitrotoluene (TNT) was studied in experiments with TNT-spiked soils, dermal contact tests, and with an in vitro assay. Lethality of TNT in a forest sandy soil was first determined. Then TNT at lethal and sublethal concentrations was applied to the same soil and was monitored along with its metabolites in extracts of soil and earthworm tissue for up to 14 d post application. High performance liquid chromatography-ultra violet analyses indicated that TNT was transformed in the presence of E. andrei by a reductive pathway to 2-amino-3,6-dinitrotoluene (2-ADNT), 4-amino-2,6-dinitrotoluene (4-ADNT), 2,4-diamino-6-nitrotoluene (2.4-DANT), and traces of 2,6-diamino-4-nitrotoluene (2,6-DANT) in earthworm tissues. This transformation could be explained by either a metabolic mechanism within the earthworm or by the enhancement of an earthworm-associated microbial activity or both. The TNT concentrations decreased from the spiked soils. However, the monoamino-dinitrotoluene (2-ADNT and 4-ADNT) concentrations increased with exposure duration and were dependent on the initial TNT soil concentrations. This was also observed to a lesser extent in the TNT-spiked soils with no earthworms present. The biotransformation of TNT into 2-ADNT, 4-ADNT, and 2,4-DANT and the presence of these metabolites in E. andrei after dermal contact on TNT-spiked filter paper showed that dermal uptake can be a significant exposure route for TNT. In vitro experiments showed that earthworm homogenate could metabolize TNT and form 2-ADNT and 4-ADNT at room temperature and at 37 C. This effect was inhibited by heat inactivation prior to incubation or by incubation at 4 C, suggesting that the biotransformation of TNT in the presence of E. andrei may be enzymatic in nature.

  17. Transplacental transport and fetal localization of bispehnol A, tetrabromobisphenol A and 2,4,6-tribromophenol in mice

    Energy Technology Data Exchange (ETDEWEB)

    Sundberg, A.; Brunstroem, B.; Brandt, I. [Uppsala Univ. (Sweden). Dept. of Environmental Toxicology; Cantillana, T.; Bergman, Aa. [Stockholm Univ. (Sweden). Dept. of Environmental Chemistry

    2004-09-15

    Bisphenol A (BPA) is an intermediate in the production of epoxy resins, while its brominated derivative tetrabromobishenol A (TBBPA) and its photolysis degradation product 2,4,6-tribromophenol (TBP) are widely used flame retardants. These brominated compounds have been identified in human blood. TBBPA, TBP and a number of 4-hydroxy-PCBs (e.g. 4-OH-CB107) are high affinity ligands for the thyroxin (T4) transporter transthyretin (TTR) in rodents and other species. Displacement of T4 from the TTR binding site has been proposed as an important mechanism of endocrine disruption by certain halogenated phenolic environmental pollutants. BPA is a fairly potent environmental estrogen receptor agonist that can induce an array of estrogenic effects in several species including mammals, birds and fish. Although the estrogenic activity of TBBPA is less obvious, this brominated BPA analog has been reported to interact with the estrogen receptor and induce estrogenic effects in some in vitro test systems. While the reproductive and developmental toxicity of BPA is well documented, there is evidence that also halogenated phenolic compounds can pass the placental barrier and induce such toxicity. Within the objectives of the COMPARE EU project we study the fetal and maternal kinetics and transplacental transport of phenolic environmental pollutants in pregnant mice. To explore the role of TTR in the placental and blood-brain barrier transport, we employ TTR-deficient mice. For comparative reasons, we also explore the transfer to bird embryos following injection into the yolk or administration to the egg-laying bird. In the present communication, we report on the disposition of BPA, TBBPA and TBP in the fetoplacental unit in pregnant wild-type mice.

  18. Alkaline Hydrolysis/Polymerization of 2,4,6-Trinitrotoluene: Characterization of Products by 13C and 15N NMR

    Science.gov (United States)

    Thorn, K.A.; Thorne, P.G.; Cox, L.G.

    2004-01-01

    Alkaline hydrolysis has been investigated as a nonbiological procedure for the destruction of 2,4,6-trinitrotoluene (TNT) in explosives contaminated soils and munitions scrap. Nucleophilic substitutions of the nitro and methyl groups of TNT by hydroxide ion are the initial steps in the alkaline degradation of TNT. Potential applications of the technique include both in situ surface liming and ex situ alkaline treatment of contaminated soils. A number of laboratory studies have reported the formation of an uncharacterized polymeric material upon prolonged treatment of TNT in base. As part of an overall assessment of alkaline hydrolysis as a remediation technique, and to gain a better understanding of the chemical reactions underlying the hydrolysis/polymerization process, the soluble and precipitate fractions of polymeric material produced from the calcium hydroxide hydrolysis of unlabeled and 15N-labeled TNT were analyzed by elemental analysis and 13C and 15N nuclear magnetic resonance spectroscopy. Spectra indicated that reactions leading to polymerization included nucleophilic displacement of nitro groups by hydroxide ion, formation of ketone, carboxyl, alcohol, ether, and other aliphatic carbons, conversion of methyl groups to diphenyl methylene carbons, and recondensation of aromatic amines and reduced forms of nitrite, including ammonia and possibly hydroxylamine, into the polymer. Compared to the distribution of carbons in TNT as 14% sp 3- and 86% sp2-hybridized, the precipitate fraction from hydrolysis of unlabeled TNT contained 33% sp3- and 67% sp 2-hybridized carbons. The concentration of nitrogen in the precipitate was 64% of that in TNT. The 15N NMR spectra showed that, in addition to residual nitro groups, forms of nitrogen present in the filtrate and precipitate fractions include aminohydroquinone, primary amide, indole, imine, and azoxy, among others. Unreacted nitrite was recovered in the filtrate fraction. The toxicities and susceptibilities to

  19. Degradation of 2,4,6-trinitrotoluene in water and soil slurry utilizing a calcium peroxide compound.

    Science.gov (United States)

    Arienzo, M

    2000-02-01

    The degradation of 2,4,6-trinitrotoluene was examined in pure water and contaminated soil slurry using calcium peroxide as a source of solid hydrogen peroxide and oxygen. The extent of TNT oxidation was compared with that obtained by using hydrated lime, which is normally generated by slurrying CaO2 in water and contained in CaO2 technical formulation (approximately 50%, w/w). Complete TNT degradation occurred between 280 min, 0.1% CaO2/Ca(OH)2 and 20 min, 1% CaO2/Ca(OH)2. A large part of the generated oxidation products, 80-90%, were absorbed on the solid calcium hydroxide, whereas the remaining 10-20% was detected in solution until 48 h. Removal of nitro groups was extremely effective in CaO2 slurry, where all the nitrogen (3 mol per mol of TNT) was removed from TNT within 240 min. Respect to calcium hydroxide, the peroxy compound liberated H2O2 in solution, 370 mg l-1 at 0.2% CaO2, w/v, which then decomposed within 480 min. Most of the 14C-TNT was retained more strongly on the calcium hydroxide generated by slurrying CaO2. This pool remained adsorbed on the solid until pH dropped below 5.8. The treatment of a contaminated soil slurry, 700 mg TNT kg-1, reduced CH3CN extractable TNT below 20 mg kg-1 at very low concentration of CaO2/Ca(OH)2, approximately 0.2%, w/w. Both oxidants do not lead to soil sterilization as the phosphorus added to neutralize the pH serves as a source of nutrient for the soil biomass. PMID:10665396

  20. Uptake of 2,4,6-Trinitrotoluene (TNT) by Vetiver grass (Vetiviera ziznoides L.) -- Preliminary results from a hydroponic study

    Science.gov (United States)

    Shakya, K. M.; Sarkar, D.; Datta, R.; Makris, K.; Pachanoor, D.

    2006-05-01

    2,4,6-Trinitrotoluene(TNT) is a potent mutagen and a Group C human carcinogen that has been widely used to produce munitions and explosives. As a result, vast areas that have been previously used as military ranges, munition burning and open detonation sites have been heavily contaminated with TNT. Conventional remedial activities in such contaminated sites commonly rely on methods such as incineration, land filling and soil composting. Phytoremediation offers a cost-effective solution, utilizing plants to phytoextract TNT from the contaminated soil. We propose the use of vetiver grass (Vetiveria zizanoides) to remove TNT from such contaminated soils. Vetiver is a fast-growing and adaptive grass, enabling its use in TNT-contaminated sites in a wide variety of soil types and climate. We also hypothesized that TNT removal by vetiver grass will be enhanced by utilizing a chaotropic agent (urea) to alter rhizosphere/root hair chemical environment. The objectives of this preliminary hydroponic study were: i) to investigate the effectiveness of vetiver grass in removing TNT from solution, and ii) to evaluate the use of a common agrochemical (urea) in enhancing TNT removal by vetiver grass. Vetiver plants were grown in a hydroponic system with five different TNT concentrations (0, 5, 10, 25, and 50 mg TNT L-1) and three urea concentrations (0, 0.01 and 0.1%). A plant density of 10 g L-1 and three replicate vessels per treatment were used. Aliquots were collected at several time intervals up to 192 hour, and were analyzed for TNT with HPLC. Results showed that vetiver was able to remove TNT from hydroponic solutions. The overall magnitude and kinetics of TNT removal by vetiver grass was enhanced in the presence of urea. TNT removal kinetics depended on TNT and urea initial concentrations, suggestive of second-order kinetic reactions. Preliminary results are encouraging, but in need for verification using more detailed studies involving TNT-contaminated soils. Ongoing

  1. Visceral hypersensitivity is provoked by 2,4,6-trinitrobenzene sulfonic acid-induced ileitis in rats

    Directory of Open Access Journals (Sweden)

    Manoj Kumar Shah

    2016-07-01

    Full Text Available Background and Aims: Crohn’s Disease (CD, a chronic Inflammatory Bowel Disease, can occur in any part of the gastrointestinal tract, but most frequently in the ileum. Visceral hypersensitivity contributes for development of chronic abdominal pain in this disease. Currently, the understanding of the mechanism underlying hypersensitivity of Crohn’s ileitis has been hindered by a lack of specific animal model. The present study is undertaken to investigate the visceral hypersensitivity provoked by 2,4,6-trinitrobenzene sulfonic (TNBS-induced ileitis rats.Methods: Male Sprague-Dawley rats were anaesthetized and laparotomized for intraileal injection of TNBS (0.6 ml, 80 mg/kg body weight in 30% ethanol, n = 48, an equal volume of 30% Ethanol (n = 24 and Saline (n = 24, respectively. Visceral hypersensitivity was assessed by visceromotor responses (VMR to 20, 40, 60, 80 and 100 mmHg colorectal distension pressure (CRD at day 1, 3, 7, 14, 21 and 28. Immediately after CRD test, the rats were euthanized for collecting the terminal ileal segment for histopathological examinations and ELISA of myleoperoxidase and cytokines (TNF-α, IL-1β, IL-6, and dorsal root ganglia (T11 for determination of calcitonin gene-related peptide by immunohistochemistry, respectively. Results: Among all groups, TNBS-treatment showed transmural inflammation initially at 3 days, reached maximum at 7 days and persisted up to 21 days. The rats with ileitis exhibited (P < 0.05 VMR to CRD at day 7 to day 21. The calcitonin gene-related peptide-immunoreactive positive cells increased (P < 0.05 in dorsal root ganglia at day 7 to 21, which was persistently consistent with visceral hypersensitivity in TNBS-treated rats.Conclusions: TNBS injection into the ileum induced transmural ileitis including granuloma and visceral hypersensitivity. As this model mimics clinical manifestations of CD, it may provide a road map to probe the pathogenesis of gut inflammation and visceral

  2. Wet oxidative method for removal of 2,4,6-trichlorophenol in water using Fe(III), Co(II), Ni(II) supported MCM41 catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Chaliha, Suranjana [Department of Chemistry, Gauhati University, Guwahati 781014, Assam (India); Bhattacharyya, Krishna Gopal [Department of Chemistry, Gauhati University, Guwahati 781014, Assam (India)], E-mail: krishna2604@sify.com

    2008-02-11

    Chlorophenols in water are resistant to biological oxidation and they have to be destroyed by chemical oxidation. In the present work, Fe(III), Co(II) and Ni(II) incorporated MCM41 mesoporous solids were used as catalysts for oxidation of 2,4,6-trichlorophenol in water with or without the oxidant, H{sub 2}O{sub 2}. The catalysts were prepared by impregnation and were characterized by XRD and FTIR measurements. The parent MCM41, Fe(III), Co(II) and Ni(II) impregnated MCM41 had cation exchange capacity of 20.5, 25.5, 24.2, 26.0 mequiv./100 g, respectively. The catalysts were used after calcination at 773-873 K for 5 h. The reactions were carried out in a high pressure stirred reactor at 0.2 MPa (autogenous) and 353 K under various reaction conditions. The conversion achieved with Fe(III), Co(II) and Ni(II) incorporated MCM41 in 5 h is respectively 59.4, 50.0 and 65.6% with 2,4,6-TCP:H{sub 2}O{sub 2} molar ratio of 1:1, and 60.2, 60.9 and 68.8% in absence of H{sub 2}O{sub 2}. The oxidation has a first order rate coefficient of (1.2-4.8) x 10{sup -3} min{sup -1}. The results show that introduction of Fe(III), Co(II) and Ni(II) into MCM-41 through impregnation produces very effective catalysts for wet oxidation of 2,4,6-trichlorophenol.

  3. Photophysical Diversity of Water-Soluble Fluorescent Conjugated Polymers Induced by Surfactant Stabilizers for Rapid and Highly Selective Determination of 2,4,6-Trinitrotoluene Traces.

    Science.gov (United States)

    Alizadeh, Naader; Akbarinejad, Alireza; Ghoorchian, Arash

    2016-09-21

    The increasing application of fluorescence spectroscopy in development of reliable sensing platforms has triggered a lot of research interest for the synthesis of advanced fluorescent materials. Herein, we report a simple, low-cost strategy for the synthesis of a series of water-soluble conjugated polymer nanoparticles with diverse emission range using cationic (hexadecyltrimethylammonium bromide, CTAB), anionic (sodium dodecylbenzenesulfonate, SDBS), and nonionic (TX114) surfactants as the stabilizing agents. The role of surfactant type on the photophisical and sensing properties of resultant polymers has been investigated using dynamic light scattering (DLS), FT-IR, UV-vis, fluorescence, and energy dispersive X-ray (EDS) spectroscopies. The results show that the surface polarity, size, and spectroscopic and sensing properties of conjugated polymers could be well controlled by the proper selection of the stabilizer type. The fluorescent conjugated polymers exhibited fluorescence quenching toward nitroaromatic compounds. Further studies on the fluorescence properties of conjugated polymers revealed that the emission of the SDBS stabilized polymer, N-methylpolypyrrole-SDBS (NMPPY-SDBS), is strongly quenched by 2,4,6-trinitrotoluene molecule with a large Stern -Volmer constant of 59 526 M(-1) and an excellent detection limit of 100 nM. UV-vis and cyclic voltammetry measurements unveiled that fluorescence quenching occurs through a charge transfer mechanism between electron rich NMPPY-SDBS and electron deficient 2,4,6-trinitrotoluene molecules. Finally, the as-prepared conjugated polymer and approach were successfully applied to the determination of 2,4,6-trinitrotoluene in real water samples.

  4. Highly efficient and easy synthesis of 2,4,6-triarylpyridines catalyzed by pentafluorophenylammonium triflate (PFPAT) as a new recyclable solid acid catalyst in solvent-free conditions

    Institute of Scientific and Technical Information of China (English)

    Naser Montazeri; Saber Mahjoob

    2012-01-01

    Pentafluorophenylammonium triflate (PFPAT) was found to be a highly efficient catalyst for the preparation of 2,4,6-triarylpyridines from the reaction of acetophenone derivatives,aromatic aldehydes and ammonium acetate.Present methodology offers several advantages,such as short reaction time,high yields,simple procedure with an easy work-up and the absence of any volatile and hazardous organic solvent.In addition,this catalytic system can act as an active,inexpensive,metal-free,recoverable and recyclable catalyst.

  5. Assessing the acid properties of desilicated ZSM-5 by FTIR using CO and 2,4,6-trimethylpyridine (collidine) as molecular probes

    DEFF Research Database (Denmark)

    Holm, Martin Spangsberg; Svelle, S.; Joensen, F.;

    2009-01-01

    . Clearly, defects represented by internal Si-OH sites are removed upon NaOH treatment. In a parallel manner, free Si-OH sites increase in concentration and the results point to a selective mechanism for formation of mesopores as the framework dissolution preferentially takes place at defective sites...... in the crystallites. The acid properties of the desilicated materials were investigated by applying CO and collidine (2,4.6-trimethylpyridine) as molecular probes. Monitoring the induced frequency shifts upon CO adsorption at liquid N-2 temperature revealed that the desilication procedure did not alter the acid...

  6. Detecció de compostos volàtils, clorofenols, cloroanisoles i 2,4,6-tribromoanisole, relacionats amb el "gust del suro"

    OpenAIRE

    Insa Aguilar, Sara

    2006-01-01

    D'entre els defectes organolèptics associats al vi, en destaca l'anomenat "gust de suro" habitualment vinculat a la presència de cloroanisoles, els quals són productes de l'activitat microbiana formats a partir dels corresponents clorofenols. La present tesi doctoral recull, en primer lloc, metodologies analítiques adreçades principalment a la determinació dels compostos clorofenòlics (2,4,6-triclorofenol, 2,3,4,6-tetraclorofenol i pentaclorofenol) en el control de qualitat dels taps suro, em...

  7. Theoretical Study on the Structures and Electronic Spectra of the Derivatives of C60-P-2,4,6-Triphenyl Borazinc

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The structures and electronic spectra of the derivatives of C6o-P-2,4,6-triphenyl borazinc have been studied by using AM1 method. The calculated results indicate that this kind of compounds has a lower energy difference between HOMO and LUMO. It is found that the electron cloud on unoccupied frontier orbital mainly comes from the contribution of C6o, while that on occupied frontier orbital mainly concentrates on the side chain. A long-lived charge-separated state may occur in the objective compounds.

  8. PRIMA-1Met/APR-246 induces apoptosis and tumor growth delay in small cell lung cancer expressing mutant p53

    DEFF Research Database (Denmark)

    Zandi, Roza; Selivanova, Galina; Christensen, Camilla Laulund;

    2011-01-01

    Small cell lung cancer (SCLC) is a highly malignant disease with poor prognosis, necessitating the need to develop new and efficient treatment modalities. PRIMA-1(Met) (p53-dependent reactivation of massive apoptosis), also known as APR-246, is a small molecule, which restores tumor suppressor...... function to mutant p53 and induces cancer cell death in various cancer types. Since p53 is mutated in more than 90% of SCLC, we investigated the ability of PRIMA-1(Met) to induce apoptosis and inhibit tumor growth in SCLC with different p53 mutations....

  9. catena-Poly[[diaquabis(formato-κOnickel(II]-μ-2,4,6-tris(4-pyridyl-1,3,5-triazine-κ2N2:N4

    Directory of Open Access Journals (Sweden)

    Miao Feng

    2011-05-01

    Full Text Available In the title compound, [Ni(CHO22(C18H12N6(H2O2]n, the NiII ion, lying on a crystallographic inversion center, has a distorted octahedral coordination comprising two water ligands, two O-atom donors from formate ligands and two N-atom donors from the 2,4,6-tris(4-pyridyl-1,3,5-triazine ligands. These ligands bridge the NiII complex units, forming zigzag chains along the c axis. Adjacent chains are linked by O—H...O hydrogen bonds, forming a three-dimensional supramolecular network.

  10. Fe(III) mineral reduction followed by partial dissolution and reactive oxygen species generation during 2,4,6-trinitrotoluene transformation by the aerobic yeast Yarrowia lipolytica

    OpenAIRE

    Ziganshin, Ayrat M; Ziganshina, Elvira E; Byrne, James; Gerlach, Robin; Struve, Ellen; Biktagirov, Timur; Rodionov, Alexander; Kappler, Andreas

    2015-01-01

    Understanding the factors that influence pollutant transformation in the presence of ferric (oxyhydr)oxides is crucial to the efficient application of different remediation strategies. In this study we determined the effect of goethite, hematite, magnetite and ferrihydrite on the transformation of 2,4,6-trinitrotoluene (TNT) by Yarrowia lipolytica AN-L15. The presence of ferric (oxyhydr)oxides led to a small decrease in the rate of TNT removal. In all cases, a significant release of NO2 − fro...

  11. Electrically charged targets

    Science.gov (United States)

    Goodman, Ronald K.; Hunt, Angus L.

    1984-01-01

    Electrically chargeable laser targets and method for forming such charged targets in order to improve their guidance along a predetermined desired trajectory. This is accomplished by the incorporation of a small amount of an additive to the target material which will increase the electrical conductivity thereof, and thereby enhance the charge placed upon the target material for guidance thereof by electrostatic or magnetic steering mechanisms, without adversely affecting the target when illuminated by laser energy.

  12. Thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine – Synthesis, structure and luminescence properties

    Energy Technology Data Exchange (ETDEWEB)

    Nawrot, I. [Department of Crystallography, Institute of Chemistry, University of Silesia, ul. Szkolna 9, 40-006 Katowice (Poland); Machura, B., E-mail: basia@ich.us.edu.pl [Department of Crystallography, Institute of Chemistry, University of Silesia, ul. Szkolna 9, 40-006 Katowice (Poland); Kruszynski, R., E-mail: rafal.kruszynski@p.lodz.pl [Department of X-ray Crystallography and Crystal Chemistry, Institute of General and Ecological Chemistry, Lodz University of Technology, ul. Żeromskiego 116, 90-924 Łódź (Poland)

    2014-12-15

    Two new thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized and characterized. The resulted complexes [Cd(SCN)(NO{sub 3})(tptz)(H{sub 2}O)] (1) and [Cd(SCN){sub 2}(tptz)(MeOH)] (2) were studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. The luminescent properties of 1 and 2 were studied in solution and solid state and compared with the free ligand. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(SCN)(NO{sub 3})(tptz)(H{sub 2}O)] and [Cd(SCN){sub 2}(tptz)(MeOH)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. - Highlights: • Two novel thiocyanate cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TD-DFT level employing B3LYP/LANL2DZ.

  13. Hexaaquabis[3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanido-κ2N3,O4]barium tetrahydrate

    Directory of Open Access Journals (Sweden)

    Nguyen Dinh Do

    2013-11-01

    Full Text Available In the title compound, [Ba(C7H5N2O52(H2O6]·4H2O, the Ba2+ cation lies on a twofold rotation axis and is ten-coordinated by two 3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanide oxo O atoms [Ba—O = 2.8715 (17 Å], two hydroxyimino N atoms [Ba—N = 3.036 (2 Å], and six water molecules [Ba—O = 2.847 (2, 2.848 (2, and 2.880 (2 Å]. The 3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanide monoanions act in a bidentate chelating manner, coordinating through an N atom of the non-deprotonated hydroxyimino group and an O atom of the neighboring oxo group. Two lattice water molecules are located in the cavities of the framework and are involved in hydrogen bonding to O atoms of one of the coordinating water molecules and the O atom of a keto group of the ligand. As a result, a three-dimensional network is formed.

  14. Syntheses, Characterization and Antitumour Activities of Rare Earth Metal Complexes with 2-(((4,6-dimethyl)-2-Pyrimidinyl)thio)-Acetic Acid

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Eight rare earth metal (Ⅲ) complexes with 2-(((4,6-dimethyl)-2-pyrimidinyl)thio)-acetic acid, LnL3*nH2O [HL=2-(((4,6-dimethyl)-2-pyrimidinyl)thio)-acetic acid; Ln=La, Ce, Pr, Nd, Sm Eu, Gd, Tb; n=4 or 5], were prepared and characterized by elemental analysis, complexometric titration, thermal analysis, conductivity, IR and 1H-NMR. The results reveal that carboxyl group of the ligand coordinates with rare earth ions in bidentate mode after deprotonated. The water molecules exist as crystal water in the complexes. The anti-tumour activities of HL and some complexes were tested by both the MTT and SRB methods. The results show that the suppression ratios of some complexes against the tested tumour cells (HL-60 human leukemia cell lines, BGC-823 human gastric carcinoma cell lines, hela human cervix adenocarcinoma cell lines and Bel-7402 human hepatic carcinoma cell lines) are superior to HL.

  15. Decomposition of dinitrotoluene isomers and 2,4,6-trinitrotoluene in spent acid from toluene nitration process by ozonation and photo-ozonation.

    Science.gov (United States)

    Chen, Wen-Shing; Juan, Chien-Neng; Wei, Kuo-Ming

    2007-08-17

    Ozone and UV/O3 were employed to mineralize dinitrotoluene (DNT) isomers and 2,4,6-trinitrotoluene (TNT) in spent acid from toluene nitration process. The oxidative degradation tests were carried out to elucidate the influence of various operating variables on the performance of mineralization of total organic compounds (TOC) in spent acid, including reaction temperature, intensity of UV (254 nm) irradiation, dosage of ozone and concentration of sulfuric acid. It is remarkable that the nearly complete mineralization of organic compounds can be achieved by ozonation combined with UV irradiation. Nevertheless, the hydroxyl radicals (*OH) would not be generated by either ozone decomposition or photolysis of ozone under the experimental condition of this study. According to the spectra identified by gas chromatograph/mass spectrometer (GC/MS) and further confirmed by gas chromatograph/flame ionization detector (GC/FID), the multiple oxidation pathways of DNT isomers are given, which include o-, m-, p-mononitrotoluene (MNT) and 1,3-dinitrobenzene, respectively. In addition, oxidative degradation of 2,4,6-TNT leads to a 1,3,5-trinitrobenzene intermediate.

  16. Thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine – Synthesis, structure and luminescence properties

    International Nuclear Information System (INIS)

    Two new thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized and characterized. The resulted complexes [Cd(SCN)(NO3)(tptz)(H2O)] (1) and [Cd(SCN)2(tptz)(MeOH)] (2) were studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. The luminescent properties of 1 and 2 were studied in solution and solid state and compared with the free ligand. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(SCN)(NO3)(tptz)(H2O)] and [Cd(SCN)2(tptz)(MeOH)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. - Highlights: • Two novel thiocyanate cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TD-DFT level employing B3LYP/LANL2DZ

  17. Synthesis and Crystal Structure of a Novel Ladder-like Organooxotin Cluster from 2,4,6-Trimethylbenzolic Acid and N-Benzylhydroxylamine

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-Hua; CHEN Man-Sheng; LI Wei; YANG Ying-Qun; KUANG Dai-Zhi; DENG Yi-Fang

    2007-01-01

    The title complex {[(C6H5CH2)4Sn2(OOCC9H11)(ONHCH2C6H5)]O}2 (C9H11COO= 2,4,6- trimethylbenzolicate) has been synthesized by the reaction of bis-benzyltin oxide with 2,4,6-trimethylbenzolic acid and N-benzylhydroxylamine in 1:1:1 molar radio (C45H47NO4Sn2) and characterized by IR,1H NMR spectra and elemental analysis,and its crystal structure was determined by X-ray diffraction.It crystallizes in monoclinic,space group P21/c with a = 1.5654(5),b = 1.6467(6),c = 1.7433(6) nm,β = 111.729(5)°,Z= 2,V= 4.175(2) nm3,Mr = 903.22,Dc = 1.437g/cm3,μ = 1.238 mm-1,F(000) = 1824,R = 0.0440 and wR = 0.0906.The structure shows that the central tin atom is five-coordinated to assume a distorted trigonal bipyramidal configuration.The compound belongs to centrosymmetric dimer structure with four-membered central endo-cyclic Sn2O2 units in which the bridging oxygen atoms are tri-coordinated.

  18. TARGET COSTING FUNCTIONS

    OpenAIRE

    Dimi OFILEANU

    2015-01-01

    This article aims to highlight the concept of Target Costing. Based on the characteristics of Target Costing, identified in specialized literature, the article presents its main advantages and disadvantages. Also, a comparison is being made between Target Cost and Traditional Cost (in its traditional form, the cost represents an independent variable on the basis of which the sell price is established; and in the Target Cost form the cost represents a dependent variable which is determined on ...

  19. Multilayer polymer microspot targets

    International Nuclear Information System (INIS)

    Last year the authors reported on the development of a seeded microspot x-ray diagnostic target. This target consisted of a 300-μm-diam, 2-μm-thick disk of silicon or sulfur-seeded hydrocarbon polymer nested tightly in a hole in a 2-μm-thick film of pure hydrocarbon polymer. This year they extended our work on the microspot target, fully encapsulating the microspot in what they call the multilayer polymer microspot target

  20. The Targeting of Advertising

    OpenAIRE

    Ganesh Iyer; David Soberman; J. Miguel Villas-Boas

    2005-01-01

    An important question that firms face in advertising is developing effective media strategy. Major improvements in the quality of consumer information and the growth of targeted media vehicles allow firms to precisely target advertising to consumer segments within a market. This paper examines advertising strategy when competing firms can target advertising to different groups of consumers within a market. With targeted advertising, we find that firms advertise more to consumers who have a st...

  1. Target Price Accuracy

    OpenAIRE

    Alexander G. Kerl

    2011-01-01

    This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown) 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio). However, target price accuracy is positive...

  2. An actionable climate target

    Science.gov (United States)

    Geden, Oliver

    2016-05-01

    The Paris Agreement introduced three mitigation targets. In the future, the main focus should not be on temperature targets such as 2 or 1.5 °C, but on the target with the greatest potential to effectively guide policy: net zero emissions.

  3. High Power Cryogenic Targets

    Energy Technology Data Exchange (ETDEWEB)

    Gregory Smith

    2011-08-01

    The development of high power cryogenic targets for use in parity violating electron scattering has been a crucial ingredient in the success of those experiments. As we chase the precision frontier, the demands and requirements for these targets have grown accordingly. We discuss the state of the art, and describe recent developments and strategies in the design of the next generation of these targets.

  4. Targeted cancer therapies

    Institute of Scientific and Technical Information of China (English)

    Li Yan; Neal Rosen; Carlos Arteaga

    2011-01-01

    With unprecedented understanding of molecular events underlying human cancer in this genomic era, a large number of drugs specifically targeting hypothesized oncogenic drivers to which tumors are potentially addicted to have been developed and continue to be developed. These targeted cancer therapies are being actively tested in clinical trials with mixed successes. This editorial provides an overview on successful targeted cancer drugs on the market and those drugs that are in late clinical development stages. Importantly, the article lays out main challenges in developing molecular targeted therapies and potential path forward to overcome these challenges, as well as opportunities for China in this new era of targeted agents. The editorial serves as an introduction to the Targeted Cancer Therapies serias that will review in depth of major pathways and drugs targeting these pathways to be published in the coming issues of the Chinese Journal of Cancer.

  5. Polarized targets and beams

    International Nuclear Information System (INIS)

    First the experimental situation of the single-pion photoproduction and the photodisintegration of the deuteron is briefly discussed. Then a description of the Bonn polarization facilities is given. The point of main effort is put on the polarized target which plays a vital role in the program. A facility for photon induced double polarization experiments at ELSA will be presented in section 4. Properties of a tensor polarized deuteron target are discussed in section 5. The development in the field of polarized targets, especially on new target materials, enables a new generation of polarized target experiments with (polarized) electrons. Some comments on the use of a polarized target in combination with electron beams will be discussed in section 6. Electron deuteron scattering from a tensor polarized deuteron target is considered and compared with other experimental possibilities. (orig./HSI)

  6. Bis(2,4,6-triamino-1,3,5-triazin-1-ium) tris(pyridine-2,6-dicarboxylato)zirconate(IV) tetrahydrate

    OpenAIRE

    Faranak Manteghi; Hossein Aghabozorg; Shirin Daneshvar

    2008-01-01

    The title compound, (C3H7N6)2[Zr(C7H3NO4)3]·4H2O or (tataH)2[Zr(pydc)3]·4H2O (tata is 2,4,6-triamino-1,3,5-triazine and pydcH2 is pyridine-2,6-dicarboxylic acid), was obtained by reaction between pydcH2, tata and zirconyl chloride octahydrate in aqueous solution. In the structure, the ZrIV atom is nine-coordinated by three (pydc)2− groups, resulting in an anionic complex which is balanced by two (tataH)+ cations. One of the NH2 groups shows positional disorder, with site occup...

  7. Synthesis, characterization and evaluation of 1,2-bis(2,4,6-trinitrophenyl) hydrazine: a key precursor for the synthesis of high performance energetic materials.

    Science.gov (United States)

    Badgujar, D M; Talawar, M B; Harlapur, Sujata F; Asthana, S N; Mahulikar, P P

    2009-12-15

    1,2-Bis(2,4,6-trinitrophenyl) hydrazine (3) is one of the precursors in the synthesis of an important energetic material viz., hexanitrazobenzene. The simple and convenient lab scale synthesis of title compound (3) was carried out by the condensation of picryl chloride (2) with hydrazine hydrate at 30-50 degrees C in methanol based on the lines of scanty literature reports. Picryl chloride was synthesized by the reaction of picric acid (1) with phosphorous oxychloride based on the lines of reported method. The synthesized compound (3) was characterized by IR and 1H NMR spectral data. Some of the energetic properties of the synthesized compound have also been studied. The theoretically computed energetic properties of the title compound (3) indicated the superior performance in comparison to tetranitrodibenzo tetraazapentalene (TACOT) and hexanitrostilbene (HNS) in terms of velocity of detonation.

  8. Fluorescence-based Sensing of 2,4,6-Trinitrotoluene (TNT Using a Multi-channeled Poly(methyl methacrylate (PMMA Microimmunosensor

    Directory of Open Access Journals (Sweden)

    Anne W. Kusterbeck

    2010-01-01

    Full Text Available Fluorescence immunoassays employing monoclonal antibodies directed against the explosive 2,4,6-trinitrotoluene (TNT were conducted in a multi-channel microimmunosensor. The multi-channel microimmunosensor was prepared in poly (methyl methacrylate (PMMA via hot embossing from a brass molding tool. The multi-channeled microfluidic device was sol-gel coated to generate a siloxane surface that provided a scaffold for antibody immobilization. AlexaFluor-cadaverine-trinitrobenzene (AlexaFluor-Cad-TNB was used as the reporter molecule in a displacement immunoassay. The limit of detection was 1-10 ng/mL (ppb with a linear dynamic range that covered three orders of magnitude. In addition, antibody crossreactivity was investigated using hexahydro-1,3,5-triazine (RDX, HMX, 2,4-dinitrotoluene (DNT, 4-nitrotoluene (4-NT and 2-amino-4,6-DNT.

  9. Magnetism of 1,3,5-trithia-2,4,6-triazapentalenyl (TTTA) and bis(hexafluoroacetylacetonato)copper(II) (Cu(hfac)2)

    International Nuclear Information System (INIS)

    An accurate full-potential density-functional method is used to study the mechanism of the origin of magnetism and the magnetic interactions in 1,3,5-Trithia-2,4,6-triazapentalenyl (TTTA) and Bis(hexafluoroacetylacetonato)copper(II) (Cu(hfac)2). The results revealed that the spontaneous magnetic moments for the TTTA.Cu(hfac)2 mainly come from Cu and N1 atoms, and the O1, O2, O3, O4 and N2, N3, S1, S2 atoms also contribute to the magnetism. In TTTA.Cu(hfac)2, there would be ferromagnetic interaction between the Cu(II) ion and the N1atom of TTTAA, and there exists antiferromagnetic interaction between the intramolecular organic ligands

  10. Synthesis of novel tripodal-benzimidazole from 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine: Structural, electrochemical and antimicrobial studies

    Energy Technology Data Exchange (ETDEWEB)

    Koc, Ziya Erdem, E-mail: zerdemkoc@gmail.com [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey); Bingol, Haluk; Saf, Ahmet O. [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey); Torlak, Emrah [Provincial Control Laboratory, Konya (Turkey); Coskun, Ahmet [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey)

    2010-11-15

    Four new tripodal-benzimidazole derivatives were synthesized by Schiff base reaction between 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine (TRIPOD) and different diamine derivatives. The structures of the obtained compounds were identified by FT-IR, {sup 1}H NMR, {sup 13}C NMR and UV-vis spectral data, thermal analysis and elemental analysis. Electrochemical behaviors of the compounds were studied by cyclic voltammetry in DMF including 0.1 M [NBu{sub 4}] [PF{sub 6}]. The voltammograms showed peaks having similar characteristics except tripodal-benzimidazole including -NO{sub 2} derivative. In addition, their antimicrobial activities were evaluated by using the standard disk diffusion method in dimethylformamide media. The activities were determined against 4 bacteria cultures by comparing to those of gentamycin.

  11. FTIR and Raman spectra, DFT and normal coordinate computations of 2,4,5- and 2,4,6-tri-fluoroanilines

    Science.gov (United States)

    Mukherjee, V.; Singh, N. P.; Yadav, R. A.

    2009-07-01

    FTIR and Raman spectra of the 2,4,5- and 2,4,6-tri-fluoroaniline molecules have been reported. Density functional method has been employed to calculate the optimized geometrical parameters, atomic charges and vibrational frequencies. In addition, SQM force field method has also been employed to calculate potential energy distribution matrix. The observed and calculated IR and Raman spectra have been simulated. Each normal mode has been assigned using observed and calculated vibrational frequencies, IR and Raman intensities, depolarization ratios for the Raman lines, vector displacements and potential energy distributions. Optimized geometrical parameters, atomic charges and vibrational frequencies have been compared for the title molecules. The influences of presence of fluorine atoms to the geometries and normal modes of the aniline molecule have also been discussed.

  12. Synthesis of novel tripodal-benzimidazole from 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine: Structural, electrochemical and antimicrobial studies

    International Nuclear Information System (INIS)

    Four new tripodal-benzimidazole derivatives were synthesized by Schiff base reaction between 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine (TRIPOD) and different diamine derivatives. The structures of the obtained compounds were identified by FT-IR, 1H NMR, 13C NMR and UV-vis spectral data, thermal analysis and elemental analysis. Electrochemical behaviors of the compounds were studied by cyclic voltammetry in DMF including 0.1 M [NBu4] [PF6]. The voltammograms showed peaks having similar characteristics except tripodal-benzimidazole including -NO2 derivative. In addition, their antimicrobial activities were evaluated by using the standard disk diffusion method in dimethylformamide media. The activities were determined against 4 bacteria cultures by comparing to those of gentamycin.

  13. Crystal structure of 4,4′,4′′-(1,3,5-triazine-2,4,6-triyltripyridinium trichloride 2.5-hydrate

    Directory of Open Access Journals (Sweden)

    Bo-Kai Ling

    2015-11-01

    Full Text Available The asymmetric unit of the title compound, C18H15N63+·3Cl−·2.5H2O, contains two independent (1,3,5-triazine-2,4,6-triyltripyridinium cations. Both cations are approximately planar, the r.m.s. deviations of fitted non-H atoms being 0.045 and 0.051 Å. In the crystal, extensive O—H...Cl, O—H...O, N—H...Cl and N—H...O hydrogen bonds and weak C—H...Cl and C—H...O interactions link the organic cations, Cl− anions and water molecules into a three-dimensional supramolecular architecture. π–π stacking between the pyridine rings of adjacent cations is also observed, the centroid-to-centroid distance being 3.7578 (8 Å.

  14. Fabrication of surface plasmon resonance sensor surface with control of the nonspecific adsorption and affinity for the detection of 2,4,6-trinitrotoluene using an antifouling copolymer

    Directory of Open Access Journals (Sweden)

    Rui eYatabe

    2014-04-01

    Full Text Available We fabricated a surface plasmon resonance (SPR sensor using a hydrophilic polymer for the highly sensitive detection of 2,4,6-trinitrotoluene (TNT. The hydrophilic polymer was made from mono-2-(methacryloyloxyethylsuccinate (MES and 2-hydroxyethylmethacrylate (HEMA by surface-initiated atom transfer radical polymerization (SI-ATRP. The detection of TNT was carried out by displacement assay with the SPR measurement. In displacement assay, the affinity between anti-TNT antibody and the sensor surface, affects to the sensitivity. In the SPR measurement, nonspecific adsorption should be controlled because SPR sensor cannot discriminate between specific and nonspecific adsorption. Therefore, the affinity and nonspecific adsorption were controlled by changing the ratio of HEMA to MES. A detection limit of 0.4 ng/ml (ppb for TNT was achieved using a sensor surface with the lowest affinity without nonspecific adsorption.

  15. 2,4,6-Triaminopyrimidine as a Novel Hinge Binder in a Series of PI3Kδ Selective Inhibitors.

    Science.gov (United States)

    Patel, Leena; Chandrasekhar, Jayaraman; Evarts, Jerry; Haran, Aaron C; Ip, Carmen; Kaplan, Joshua A; Kim, Musong; Koditek, David; Lad, Latesh; Lepist, Eve-Irene; McGrath, Mary E; Novikov, Nikolai; Perreault, Stephane; Puri, Kamal D; Somoza, John R; Steiner, Bart H; Stevens, Kirk L; Therrien, Joseph; Treiberg, Jennifer; Villaseñor, Armando G; Yeung, Arthur; Phillips, Gary

    2016-04-14

    Inhibition of phosphoinositide 3-kinase δ (PI3Kδ) is an appealing target for several hematological malignancies and inflammatory diseases. Herein, we describe the discovery and optimization of a series of propeller shaped PI3Kδ inhibitors comprising a novel triaminopyrimidine hinge binder. Combinations of electronic and structural strategies were employed to mitigate aldehyde oxidase mediated metabolism. This medicinal chemistry effort culminated in the identification of 52, a potent and highly selective inhibitor of PI3Kδ that demonstrates efficacy in a rat model of arthritis. PMID:26980109

  16. Preparation, Crystal Structure and Thermal Analyses of 1,5-Diamino-4-hydro-1,2,3,4-tetrazolium 3,5-Dihydroxy-2,4,6-trinitrophenolate

    Institute of Scientific and Technical Information of China (English)

    CUI Yan; ZHANG Tong-Lai; ZHANG Jian-Guo; HU Xiao-Chun; ZHANG Jin; HUANG Hui-Sheng

    2008-01-01

    A novel energetic salt 1,5-diamino-4-hydro-1,2,3,4-tetrazolium 3,5-dihydroxy-2,4,6-trinitrophenolate was synthesized by the reaction of 1,5-diamino-1,2,3,4-tetrazole (DAT) with 2,4,6-trinitro-1,3,5-trihydroxybenzene (trinitrophloroglucinol, TNPG). It was characterized by X-ray single crystal diffraction, elemental analysis, FT-IR spectroscopy and 1H NMR. The title compound crystallizes in monoclinic system, P2(1)/c space group with crystal parameters of a=1.3399(3) nm, b=0.47088(9) nm, c=2.0127(4) nm, β=92.83(3)°, V= 1.2684(4) nm3, Z=4. Hydrogen bonds, electrostatic interactions, and weak van der Waals' forces make the molecules form a stable threedimensional net structure. Mulliken charge distribution and overlap population of DAT and DATH+TNPG- in bulk state have been obtained from the density functional theory (DFT) with the B3LYP method employing the 6-31G**basis sets to interpret the reason why the protonation site of DAT is N(4) atom of the tetrazole ring. Thermal decomposition of the title compound was studied by using differential scanning calorimetry (DSC) and thermogravimetric analysis (TG) techniques. The high enthalpy change and leaving no solid residue after thermal decomposition indicate that the title compound can be used as a promising energetic material or gas-generating composition.The kinetic parameters of the exothermic process of DATH+TNPG- were studied by using Kissinger's and Ozawa-Doyle's methods and the Arrhenius equation of this process was obtained.

  17. Synthesis, structure and luminescence properties of cadmium(II) complexes with 2,4,6-tri(2-pyridyl)-1,3,5-triazine

    International Nuclear Information System (INIS)

    The paper presents a combined experimental and computational study for two cadmium(II) complexes [Cd(dca)(NO3)(tptz)(H2O)]·2H2O (1) and [Cd(dca)(OAc) (tptz)(H2O)]·2H2O (2) (tptz=2,4,6-tri(2-pyridyl)-1,3,5-triazine and dca=dicyanamide anion). The compounds have been studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. Due to the presence of multidentate N-donor ligand, coordinated water molecule and nitrate or acetate groups together with the lattice water molecules their crystal structures are dominated by the hydrogen-bonding interactions that give rise to the supramolecular architectures. The luminescent properties of compounds 1 and 2 have been studied in solution and solid state and compared with the free ligand. The studies revealed that the fluorescence of tptz ligand and complexes 1 and 2 was concentration and solvent dependent. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(dca)(NO3)(tptz)(H2O)] and [Cd(dca)(OAc) (tptz)(H2O)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. -- Highlights: • Two novel dicyanamide cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TDDFT level employing B3LYP/LANL2DZ

  18. Synthesis,Crystal Structure and Electrochemical Properties of a One-dimensional Chain Coordination Polymer[Cu(phen)(2,4,6-TMBA)2(H2O)]n

    Institute of Scientific and Technical Information of China (English)

    LI Wei; LI Chang-Hong; YANG Ying-Qun; KUANG Yun-Fei

    2008-01-01

    A one-dimensional chain coordination polymer[Cu(phen)(2,4,6-TMBA)2(H2O)]n has been synthesized by reacting 2,4,6-trimethyl-benzoic acid,1,10-phenanthroline and Cu(Ⅱ)per-chlorate and its structure Was characterized.Crystal data for this complex:tetragonal,space group I41,a=2.0293(3),b=2.0293(3),c=113758(2)nm,a=β=γ=90°,V=5.6657(13)nm3,Dc=1.379g/cm3,Z=8,μ(MoKa)=0.815mm-1,Mr=588.14,F(000)=2456,S=1.047,R=0.0459 and wR=O.1053.The crystal structure shows that two neighboring Cu(Ⅱ)ions are linked together by one bridging-chelating 2,4,6-trimethyl-benzoic group,forming a one-dimensional chain structure.Each Cu(Ⅱ)ion is coordinated with two nitrogen atoms from one 1,10-phenanthroline molecule,three oxygen atoms from three 2,4,6-trimethyl-benzoic acid molecules and one oxygen atom from one water molecule,giving a six-coordinate distorted octahedral coordination geometry.The cyclic voltamrnetry behavior of the complex was also investigated.

  19. 1,3,5-Triazine-2,4,6-triyltrisulfamic acid (TTSA): A new organic solid acid for the nitrosation of secondary amines and oxidation of urazoles in the presence of NaNO2 under mild and heterogeneous conditions

    Indian Academy of Sciences (India)

    Gholamabbas Chehardoli; Mohammad Ali Zolfigol; Toktam Faal-Rastegar; Shadpour Mallakpour; Arash Ghorbani-Choghamarani

    2009-07-01

    Melamine reacted with chlorosufonic acid (ClSO3H) to form a new sulfamic-type acid, 1,3,5-triazine-2,4,6-triyltrisulfamic acid (TTSA). Both nitrosation of secondary amines and oxidation of urazoles were accomplished by using TTSA/NaNO2 system under mild and heterogeneous conditions with good to excellent yields.

  20. Targeted tumor radiotherapy

    Directory of Open Access Journals (Sweden)

    Unak Perihan

    2002-01-01

    Full Text Available Targeted tumor radiotherapy is selectively delivery of curative doses of radiation to malignant sites. The aim of the targeted tumor radiotherapy is to use the radionuclides which have high LET particle emissions conjugated to appropriate carrier molecules. The radionuclides are selectively collected by tumor cells, depositing lethal doses to tumor cells while no admission occur to normal cells. In theory, targeted radiotherapy has several advantages over conventional radiotherapy since it allows a high radiation dose to be administered without causing normal tissue toxicity, although there are some limitations in the availability of appropriate targeting agents and in the calculations of administered doses. Therefore, for routine clinical applications more progress is still needed. In this article, the potential use of targeted tumor radiotherapy is briefly reviewed. More general aspects and considerations, such as potential radionuclides, mechanisms of tumor targeting was also outlined.

  1. Moving Target Defense

    CERN Document Server

    Jajodia, Sushil; Swarup, Vipin; Wang, Cliff; Wang, X Sean

    2011-01-01

    Moving Target Defense: Creating Asymmetric Uncertainty for Cyber Threats was developed by a group of leading researchers. It describes the fundamental challenges facing the research community and identifies new promising solution paths. Moving Target Defense which is motivated by the asymmetric costs borne by cyber defenders takes an advantage afforded to attackers and reverses it to advantage defenders. Moving Target Defense is enabled by technical trends in recent years, including virtualization and workload migration on commodity systems, widespread and redundant network connectivity, instr

  2. Deuterium High Pressure Target

    CERN Document Server

    Perevozchikov, V; Vinogradov, Yu I; Vikharev, M D; Ganchuk, N S; Golubkov, A N; Grishenchkin, S K; Demin, A M; Demin, D L; Zinov, V G; Kononenko, A A; Lobanov, V N; Malkov, I L; Yukhimchuk, S A

    2001-01-01

    The design of the deuterium high-pressure target is presented. The target having volume of 76 cm^3 serves to provide the experimental research of muon catalyzed fusion reactions in ultra-pure deuterium in the temperature range 80-800 K under pressures of up to 150 MPa. The operation of the main systems of the target is described: generation and purification of deuterium gas, refrigeration, heating, evacuation, automated control system and data collection system.

  3. Deuterium high pressure target

    International Nuclear Information System (INIS)

    The design of the deuterium high-pressure target is presented. The target having volume of 76 cm3 serves to provide the experimental research of muon catalyzed fusion reactions in ultra-pure deuterium in the temperature range 80-800 K under pressures of up to 150 MPa. The operation of the main systems of the target is described: generation and purification of deuterium gas, refrigeration, heating, evacuation, automated control system and data collection system

  4. Target Window Reliability

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    The target window design implemented and tested in experiments at ANL have performed without failure for the available beam of 6 mm FWHM on a 12 mm diameter target. However, scaling that design to a 25 mm diameter target size for a 12 mm FWHM beam has proven problematic. Combined thermal and mechanical (pressure induced) stresses and strains are too high to maintain the small coolant gaps and provide adequate fatigue lifetime.

  5. The ISOLDE target robots

    CERN Multimedia

    Maximilein Brice

    2002-01-01

    ISOLDE targets need to be changed frequently, around 80 times per year. The high radiation levels do not permit this to be done by human hands and the target changes are effected by 2 industrial robots (picture _01). On the left, in the distance, the front-end of the GPS (General Purpose Separator) is seen, while the HRS (High Resolution Separator) is at the right. Also seen are the doors to the irradiated-target storage.

  6. Targeted Radionuclide Therapy

    Directory of Open Access Journals (Sweden)

    David Cheng

    2011-10-01

    Full Text Available Targeted radiotherapy is an evolving and promising modality of cancer treatment. The killing of cancer cells is achieved with the use of biological vectors and appropriate radionuclides. Among the many advantages of this approach are its selectiveness in delivering the radiation to the target, relatively less severe and infrequent side effects, and the possibility of assessing the uptake by the tumor prior to the therapy. Several different radiopharmaceuticals are currently being used by various administration routes and targeting mechanisms. This article aims to briefly review the current status of targeted radiotherapy as well as to outline the advantages and disadvantages of radionuclides used for this purpose.

  7. Bayesian multiple target tracking

    CERN Document Server

    Streit, Roy L

    2013-01-01

    This second edition has undergone substantial revision from the 1999 first edition, recognizing that a lot has changed in the multiple target tracking field. One of the most dramatic changes is in the widespread use of particle filters to implement nonlinear, non-Gaussian Bayesian trackers. This book views multiple target tracking as a Bayesian inference problem. Within this framework it develops the theory of single target tracking, multiple target tracking, and likelihood ratio detection and tracking. In addition to providing a detailed description of a basic particle filter that implements

  8. Target Assembly Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  9. Targeting the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kenny, P.A.; Lee, G.Y.; Bissell, M.J.

    2006-11-07

    Despite some notable successes cancer remains, for the most part, a seemingly intractable problem. There is, however, a growing appreciation that targeting the tumor epithelium in isolation is not sufficient as there is an intricate mutually sustaining synergy between the tumor epithelial cells and their surrounding stroma. As the details of this dialogue emerge, new therapeutic targets have been proposed. The FDA has already approved drugs targeting microenvironmental components such as VEGF and aromatase and many more agents are in the pipeline. In this article, we describe some of the 'druggable' targets and processes within the tumor microenvironment and review the approaches being taken to disrupt these interactions.

  10. The CNGS target

    CERN Multimedia

    Patrice Loïez

    2005-01-01

    The CERN Neutrinos to Gran Sasso (CNGS) target ‘magazine’ of five target units. Each unit contains a series of 10-cm long graphite rods distributed over a length of 2 m. It is designed to maximize the number of secondary particles produced and hence the number of neutrinos. One unit is used at a time to prevent over heating.

  11. Strategic Targeted Advertising

    NARCIS (Netherlands)

    A. Galeotti; J.L. Moraga-Gonzalez (José Luis)

    2003-01-01

    textabstractWe present a strategic game of pricing and targeted-advertising. Firms can simultaneously target price advertisements to different groups of customers, or to the entire market. Pure strategy equilibria do not exist and thus market segmentation cannot occur surely. Equilibria exhibit rand

  12. Targeted therapy in lymphoma

    Directory of Open Access Journals (Sweden)

    Cavalli Franco

    2010-11-01

    Full Text Available Abstract Discovery of new treatments for lymphoma that prolong survival and are less toxic than currently available agents represents an urgent unmet need. We now have a better understanding of the molecular pathogenesis of lymphoma, such as aberrant signal transduction pathways, which have led to the discovery and development of targeted therapeutics. The ubiquitin-proteasome and the Akt/mammalian target of rapamycin (mTOR pathways are examples of pathological mechanisms that are being targeted in drug development efforts. Bortezomib (a small molecule protease inhibitor and the mTOR inhibitors temsirolimus, everolimus, and ridaforolimus are some of the targeted therapies currently being studied in the treatment of aggressive, relapsed/refractory lymphoma. This review will discuss the rationale for and summarize the reported findings of initial and ongoing investigations of mTOR inhibitors and other small molecule targeted therapies in the treatment of lymphoma.

  13. Nuclear target development

    Energy Technology Data Exchange (ETDEWEB)

    Greene, J.P.; Thomas, G.E.

    1995-08-01

    The Physics Division operates a target development laboratory that produces thin foil targets needed for experiments performed at the ATLAS and Dynamitron accelerators. Targets are not only produced for the Physics Division but also for other divisions and occasionally for other laboratories and universities. In the past year, numerous targets were fabricated by vacuum evaporation either as self-supporting foils or on various substrates. Targets produced included Ag, Au, {sup 10,11}B, {sup 138}Ba, Be, {sup 12}C, {sup 40}Ca, {sup 116}Cd, {sup 155,160}Gd, {sup 76}Ge, In, LID, {sup 6}LiH, Melamine, Mg, {sup 142,150}Nd, {sup 58}Ni, {sup 206,208}Pb, {sup 194}Pt, {sup 28}Si, {sup 144,148}Sm, {sup 120,122,124}Sn, Ta, {sup 130}Te, ThF{sub 4}, {sup 46,50}Ti, TiH, U, UF{sub 4}, {sup 182}W and {sup 170}Yb. Polypropylene and aluminized polypropylene, along with metallized Mylar were produced for experiments at ATLAS. A number of targets of {sup 11}B of various thickness were made for the DEP 2-MeV Van de Graff accelerator. An increased output of foils fabricated using our small rolling mill included targets of Au, C, {sup 50}Cr, Cu, {sup 155,160}Gd, Mg, {sup 58}Ni, {sup 208}Pb, {sup 105,110}Pd. Sc, Ti, and {sup 64,66}Zn.

  14. Safety and tolerability of sitagliptin in clinical studies: a pooled analysis of data from 10,246 patients with type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Guo Hua

    2010-04-01

    Full Text Available Abstract Background In a previous pooled analysis of 12 double-blind clinical studies that included data on 6,139 patients with type 2 diabetes, treatment with sitagliptin, a dipeptidyl peptidase-4 (DPP-4 inhibitor, was shown to be generally well tolerated compared with treatment with control agents. As clinical development of sitagliptin continues, additional studies have been completed, and more patients have been exposed to sitagliptin. The purpose of the present analysis is to update the safety and tolerability assessment of sitagliptin by pooling data from 19 double-blind clinical studies. Methods The present analysis included data from 10,246 patients with type 2 diabetes who received either sitagliptin 100 mg/day (N = 5,429; sitagliptin group or a comparator agent (placebo or an active comparator (N = 4,817; non-exposed group. The 19 studies from which this pooled population was drawn represent the double-blind, randomized studies that included patients treated with the usual clinical dose of sitagliptin (100 mg/day for between 12 weeks and 2 years and for which results were available as of July 2009. These 19 studies assessed sitagliptin taken as monotherapy, initial combination therapy with metformin or pioglitazone, or as add-on combination therapy with other antihyperglycemic agents (metformin, pioglitazone, a sulfonylurea ± metformin, insulin ± metformin, or rosiglitazone + metformin. Patients in the non-exposed group were taking placebo, metformin, pioglitazone, a sulfonylurea ± metformin, insulin ± metformin, or rosiglitazone + metformin. The analysis used patient-level data from each study to evaluate between-group differences in the exposure-adjusted incidence rates of adverse events. Results Summary measures of overall adverse events were similar in the sitagliptin and non-exposed groups, except for an increased incidence of drug-related adverse events in the non-exposed group. Incidence rates of specific adverse events were

  15. A facile synthesis of highly luminescent nitrogen-doped graphene quantum dots for the detection of 2,4,6-trinitrophenol in aqueous solution

    Science.gov (United States)

    Lin, Liping; Rong, Mingcong; Lu, Sisi; Song, Xinhong; Zhong, Yunxin; Yan, Jiawei; Wang, Yiru; Chen, Xi

    2015-01-01

    A facile bottom-up method for the synthesis of highly fluorescent nitrogen-doped graphene quantum dots (N-GQDs) has been developed via a one-step pyrolysis of citric acid and tris(hydroxymethyl)aminomethane. The obtained N-GQDs emitted strong blue fluorescence under 365 nm UV light excitation with a high quantum yield of 59.2%. They displayed excitation-independent behavior, high resistance to photobleaching and high ionic strength. In addition to the good linear relationship between the fluorescence intensity of the N-GQDs and pH in the range 2-7, the fluorescence intensity of the N-GQDs could be greatly quenched by the addition of a small amount of 2,4,6-trinitrophenol (TNP). A sensitive approach has been developed for the detection of TNP with a detection limit of 0.30 μM, and a linearity ranging from 1 to 60 μM TNP could be obtained. The approach was highly selective and suitable for TNP analysis in natural water samples.A facile bottom-up method for the synthesis of highly fluorescent nitrogen-doped graphene quantum dots (N-GQDs) has been developed via a one-step pyrolysis of citric acid and tris(hydroxymethyl)aminomethane. The obtained N-GQDs emitted strong blue fluorescence under 365 nm UV light excitation with a high quantum yield of 59.2%. They displayed excitation-independent behavior, high resistance to photobleaching and high ionic strength. In addition to the good linear relationship between the fluorescence intensity of the N-GQDs and pH in the range 2-7, the fluorescence intensity of the N-GQDs could be greatly quenched by the addition of a small amount of 2,4,6-trinitrophenol (TNP). A sensitive approach has been developed for the detection of TNP with a detection limit of 0.30 μM, and a linearity ranging from 1 to 60 μM TNP could be obtained. The approach was highly selective and suitable for TNP analysis in natural water samples. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr06365a

  16. AA antiproton production target

    CERN Multimedia

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing of stainless steel. At the entrance to the target assembly was a scintillator screen, imprinted with circles every 5 mm in radius, which allowed to precisely aim the 26 GeV high-intensity proton beam from the PS onto the centre of the target rod. The scintillator screen was a 1 mm thick plate of Cr-doped alumina. See also 7903034 and 7905091.

  17. Internal polarized targets

    Energy Technology Data Exchange (ETDEWEB)

    Kinney, E.R.; Coulter, K.; Gilman, R.; Holt, R.J.; Kowalczyk, R.S.; Napolitano, J.; Potterveld, D.H.; Young, L. (Argonne National Lab., IL (USA)); Mishnev, S.I.; Nikolenko, D.M.; Popov, S.G.; Rachek, I.A.; Temnykh, A.B.; Toporkov, D.K.; Tsentalovich, E.P.; Wojtsekhowski, B.B. (AN SSSR, Novosibirsk (USSR). Inst. Yadernoj Fiziki)

    1989-01-01

    Internal polarized targets offer a number of advantages over external targets. After a brief review of the basic motivation and principles behind internal polarized targets, the technical aspects of the atomic storage cell will be discussed in particular. Sources of depolarization and the means by which their effects can be ameliorated will be described, especially depolarization by the intense magnetic fields arising from the circulating particle beam. The experience of the Argonne Novosibirsk collaboration with the use of a storage cell in a 2 GeV electron storage ring will be the focus of this technical discussion. 17 refs., 11 figs.

  18. STIS target acquisition

    Science.gov (United States)

    Kraemer, Steve; Downes, Ron; Katsanis, Rocio; Crenshaw, Mike; McGrath, Melissa; Robinson, Rich

    1997-01-01

    We describe the STIS autonomous target acquisition capabilities. We also present the results of dedicated tests executed as part of Cycle 7 calibration, following post-launch improvements to the Space Telescope Imaging Spectrograph (STIS) flight software. The residual pointing error from the acquisitions are < 0.5 CCD pixels, which is better than preflight estimates. Execution of peakups show clear improvement of target centering for slits of width 0.1 sec or smaller. These results may be used by Guest Observers in planning target acquisitions for their STIS programs.

  19. Target Price Accuracy

    Directory of Open Access Journals (Sweden)

    Alexander G. Kerl

    2011-04-01

    Full Text Available This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio. However, target price accuracy is positively related to the level of detail of each report, company size and the reputation of the investment bank. The potential conflicts of interests between an analyst and a covered company do not bias forecast accuracy.

  20. Targeted therapies for cancer

    Science.gov (United States)

    ... to be untrue. Possible side effects from targeted therapies include: Diarrhea Liver problems Skin problems such as rash, dry skin, and nail changes Problems with blood clotting and wound healing High blood pressure As with any treatment, you ...

  1. Liposomes for cardiovascular targeting.

    Science.gov (United States)

    Levchenko, Tatyana S; Hartner, William C; Torchilin, Vladimir P

    2012-04-01

    Liposome-based pharmaceuticals used within the cardiovascular system are reviewed in this article. The delivery of diagnostic and therapeutic agents by plain liposomes and liposomes with surface-attached targeting antibodies or polyethylene glycol to prolong their circulation time and accumulation at vascular injuries, ischemic zones or sites of thrombi are also discussed. An overview of the advantages and disadvantages of liposome-mediated in vitro, ex vivo and in vivo targeting is presented, including discussion of the targeting of liposomes to pathological sites on the blood vessel wall and a description of liposomes that can be internalized by endothelial cells. Diagnostic liposomes used to target myocardial infarction and the relative importance of liposome size, targetability of immunoliposomes and prolonged circulation time on the efficiency of sealing hypoxia-induced plasma membrane damage to cardiocytes are discussed as a promising approach for therapy. The progress in the use of targeted liposomal plasmids for the transfection of hypoxic cardiomyocytes and myocardium is presented. Stent-mediated liposomal-based drug delivery is also reviewed briefly. PMID:22834079

  2. Radar target detection simulation

    Directory of Open Access Journals (Sweden)

    Tarig Ibrahim Osman

    2014-12-01

    Full Text Available Standard radar detection process requires that the sensor output is compared to a predetermined threshold. The threshold is selected based on a-priori knowledge available and/or certain assumptions. However, any knowledge and/or assumptions become in adequate due to the presence of multiple targets with varying signal return and usually non stationary background. Thus, any predetermined threshold may result in either increased false alarm rate or increased track loss. Even approaches where the threshold is adaptively varied will not perform well in situations when the signal return from the target of interest is too low compared to the average level of the background .Track-before-detect techniques eliminate the need for a detection threshold and provide detecting and tracking targets with lower signal-to-noise ratios than standard methods. However, although trackbefore-detect techniques eliminate the need for detection threshold at sensor's signal processing stage, they often use tuning thresholds at the output of the filtering stage .This paper presents a computerized simulation model for target detection process. Moreover, the proposed model method is based on the target motion models, the output of the detection process can easily be employed for maneuvering target tracking.

  3. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  4. 2,4,6-Tribromophenol Interferes with the Thyroid Hormone System by Regulating Thyroid Hormones and the Responsible Genes in Mice.

    Science.gov (United States)

    Lee, Dongoh; Ahn, Changhwan; Hong, Eui-Ju; An, Beum-Soo; Hyun, Sang-Hwan; Choi, Kyung-Chul; Jeung, Eui-Bae

    2016-07-12

    2,4,6-Tribromophenol (TBP) is a brominated flame retardant (BFR). Based on its affinity for transthyretin, TBP could compete with endogenous thyroid hormone. In this study, the effects of TBP on the thyroid hormone system were assessed in mice. Briefly, animals were exposed to 40 and 250 mg/kg TBP. Thyroid hormones were also administered with or without TBP. When mice were treated with TBP, deiodinase 1 (Dio1) and thyroid hormone receptor β isoform 2 (Thrβ2) decreased in the pituitary gland. The levels of deiodinase 2 (Dio2) and growth hormone (Gh) mRNA increased in response to 250 mg/kg of TBP, and the relative mRNA level of thyroid stimulating hormone β (Tshβ) increased in the pituitary gland. Dio1 and Thrβ1 expression in the liver were not altered, while Dio1 decreased in response to co-treatment with thyroid hormones. The thyroid gland activity decreased in response to TBP, as did the levels of free triiodothyronine and free thyroxine in serum. Taken together, these findings indicate that TBP can disrupt thyroid hormone homeostasis and the presence of TBP influenced thyroid actions as regulators of gene expression. These data suggest that TBP interferes with thyroid hormone systems.

  5. Accurate determination of 2,4,6-trichloroanisole in wines at low parts per trillion by solid-phase microextraction followed by GC-ECD.

    Science.gov (United States)

    Alzaga, Roberto; Ortiz, Laura; Sánchez-Baeza, Francisco; Marco, M-Pilar; Bayona, Josep Maria

    2003-06-01

    A headspace solid-phase microextraction (HS-SPME) procedure at 30 degrees C with a 100 microm PDMS fiber of a saturated NaCl solution stirred at 1100 rpm combined to GC-ECD for the 2,4,6-trichloroanisol (TCA) determination in wines has been developed. Due to the matrix complexity and ethanol absorption into the fiber, the internal standard selection was crucial to obtain unbiased results. Thus, matrix effects were observed when analyzing different types of Spanish wines (white, early, and vintage red wines) spiked with TCA at low concentration levels (i.e., wine within 2.9-18 ng L(-)(1), with a relative standard deviation of 2.5-13.4%, depending on the TCA concentration level and wine characteristics. This analytical method is comparable to the existing methodologies based on HS-SPME followed by GC-MS in terms of accuracy, precision, length of determination, and length of quantification; however, analysis cost is reduced.

  6. Fluorescent Detection of 2,4-DNT and 2,4,6-TNT in Aqueous Media by Using Simple Water-Soluble Pyrene Derivatives.

    Science.gov (United States)

    Kovalev, Igor S; Taniya, Olga S; Slovesnova, Nataliya V; Kim, Grigory A; Santra, Sougata; Zyryanov, Grigory V; Kopchuk, Dmitry S; Majee, Adinath; Charushin, Valery N; Chupakhin, Oleg N

    2016-03-01

    Pyrene-containing water-soluble probes for the fluorescent detection of nitroaromatic compounds (NACs), such as explosive components (2,4-DNT and 2,4,6-TNT) and herbicides (2,4-dinitrocresol, 2,4-DNOC), in aqueous media are reported. In the probes, the introduction of surface-active hydrophilic "heads" at the periphery of lipophilic (i.e., hydrophobic) pyrene "tails" resulted in the formation of highly fluorescent micelle-like aggregates/pre-associates in aqueous solutions at concentrations of ≤10(-5)  m. The enhanced fluorescence quenching of the herein reported architectures is achieved in the presence of ultra-trace amounts of TNT or 2,4-DNT with values of Stern-Volmer quenching constant close to 1×10(5)  m(-1) and a detection limit as low as 182 ppb. The most hydrophilic probes demonstrated higher response to 2,4-DNT over TNT. Filter paper test strips impregnated with 1×10(-5)  m solutions of the probes were able to detect TNT, 2,4-DNT, and other NACs at levels as low as 50 ppb in water. PMID:26757403

  7. Quasi-monoenergetic neutron energy spectra for 246 and 389 MeV (7)Li(p,n) reactions at angles from 0 degrees to 300 degrees

    CERN Document Server

    Iwamoto, Y; Nakamura, T; Nakashima, H; Mares, V; Itoga, T; Matsumoto, T; Nakane, Y; Feldbaumer, E; Jaegerhofer, L; Pioch, C; Tamii, A; Satoh, D; Masuda, A; Sato, T; Iwase, H; Yashima, H; Nishiyama, J; Hagiwara, M; Hatanaka, K; Sakamoto, Y

    2011-01-01

    The authors measured the neutron energy spectra of a quasi-monoenergetic (7)Li(p,n) neutron source with 246 and 389 MeV protons set at seven angles (0 degrees, 2.5 degrees, 5 degrees, 10 degrees, 15 degrees, 20 degrees and 30 degrees), using a time-of-flight (TOF) method employing organic scintillators NE213 at the Research Center for Nuclear Physics (RCNP) of Osaka University. The energy spectra of the source neutrons were precisely deduced down to 2 MeV at 0 degrees and 10 MeV at other angles. The cross-sections of the peak neutron production reaction at 0 degrees were on the 35-40 mb line of other experimental data, and the peak neutron angular distribution agreed well with the Taddeucci formula. Neutron energy spectra below 100 MeV at all angles were comparable, but the shapes of the continuum above 150 MeV changed considerably with the angle. In order to consider the correction required to derive the response in the peak region from the measured total response for high-energy neutron monitors such as DAR...

  8. Prednisolone-appended alpha-cyclodextrin: alleviation of systemic adverse effect of prednisolone after intracolonic administration in 2,4,6-trinitrobenzenesulfonic acid-induced colitis rats.

    Science.gov (United States)

    Yano, H; Hirayama, F; Arima, H; Uekama, K

    2001-12-01

    The titled compound is a cyclodextrin derivative in which prednisolone 21-succinate (PDsuc) is covalently bound to one of the secondary hydroxyl groups of alpha-cyclodextrin (alpha-CyD) via an ester linkage. In this study, the PDsuc-appended alpha-CyD ester conjugate (PDsuc/alpha-CyD conjugate) was intracolonically administered to rats with 2,4,6-trinitrobenzensulfonic acid-induced colitis, and its antiinflammatory and systemic adverse effects were compared with those of prednisolone (PD) alone and the PD/2-hydroxypropyl-beta-CyD complex (PD/HP-beta-CyD complex), which is a noncovalent inclusion complex. Colonic damage score, ratio of distal colon wet weight to body weight, and myeloperoxidase activity were evaluated as measures of the therapeutic effect of PD, whereas the ratio of thymus wet weight to body weight was evaluated as a measure of the side effect of PD. The local antiinflammatory activity increased in the order of PD alone approximately PDsuc/alpha-CyD conjugate keeps the local concentration in the colon at a low but constant level. The results suggest that the PDsuc/alpha-CyD conjugate can alleviate the systemic adverse effect of PD while maintaining the therapeutic activity of PD. This kind of knowledge will be useful in the rational design of steroid prodrugs for the colon-specific drug delivery system. PMID:11745769

  9. Utility of four strains of white-rot fungi for the detoxification of 2,4,6-trinitrotoluene in liquid culture

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, K.C.; Chen, J.C.; Huebner, H.J.; Brown, K.W.; Autenrieth, R.L.; Bonner, J.S. [Texas A and M Univ., College Station, TX (United States)

    1997-06-01

    The purpose of this study was to investigate the potential of four different strains of white-rot fungi (Phanerochaete chrysosporium, Phanerochaete sordida, Phlebia brevispora, and Cyathus stercoreus) to degrade 2,4,6-trinitrotoluene (TNT) in liquid medium. Loss of TNT from the culture medium was determined using high-performance liquid chromatography (HPLC), while the mutagenicity of the medium residues were evaluated using the Salmonella/microsome bioassay. The data indicate that within 21 d of incubation, all fungi were able to reduce the TNT concentration in the liquid medium to below detection limits. In this study, P. sordida showed a relatively high growth rate and the fastest rate of TNT degradation. The fungal treatment also produced a significant reduction of TNT mutagenicity. Treatment with C. stercoreus, P. brevispora, P. sordida, and P. chrysosporium resulted in the elimination of 94%, 90%, 87%, and 67% of the initial TNT-amended medium mutagenicity, respectively. The data also demonstrate that during incubation, TNT was eliminated from the culture medium two to eight times faster than the reduction in mutagenic potential. These results suggest that TNT disappearance alone cannot be used as the sole criterion in TNT remediation. Chemical analysis revealed that the major metabolites in the initial transformation of TNT were the monoamino-dinitrotoluenes, which were also degraded by the selected white-rot fungi. The study demonstrated that the white-rot fungi are capable of metabolizing and detoxifying TNT under aerobic conditions in nonligninolytic liquid medium.

  10. Stand-off imaging Raman spectroscopy for forensic analysis of post-blast scenes: trace detection of ammonium nitrate and 2,4,6-trinitrotoluene

    Science.gov (United States)

    Ceco, Ema; Önnerud, Hans; Menning, Dennis; Gilljam, John L.; Bââth, Petra; Östmark, Henric

    2014-05-01

    The following paper presents a realistic forensic capability test of an imaging Raman spectroscopy based demonstrator system, developed at FOI, the Swedish Defence Research Agency. The system uses a 532 nm laser to irradiate a surface of 25×25mm. The backscattered radiation from the surface is collected by an 8" telescope with subsequent optical system, and is finally imaged onto an ICCD camera. We present here an explosives trace analysis study of samples collected from a realistic scenario after a detonation. A left-behind 5 kg IED, based on ammonium nitrate with a TNT (2,4,6-trinitrotoluene) booster, was detonated in a plastic garbage bin. Aluminum sample plates were mounted vertically on a holder approximately 6 m from the point of detonation. Minutes after the detonation, the samples were analyzed with stand-off imaging Raman spectroscopy from a distance of 10 m. Trace amounts could be detected from the secondary explosive (ammonium nitrate with an analysis time of 1 min. Measurement results also indicated detection of residues from the booster (TNT). The sample plates were subsequently swabbed and analyzed with HPLC and GC-MS analyses to confirm the results from the stand-off imaging Raman system. The presented findings indicate that it is possible to determine the type of explosive used in an IED from a distance, within minutes after the attack, and without tampering with physical evidence at the crime scene.

  11. Chandra Observation of 3C288 - Reheating the Cool Core of a 3 keV Cluster from a Nuclear Outburst at z = 0.246

    CERN Document Server

    Lal, D V; Forman, W R; Hardcastle, M J; Jones, C; Nulsen, P E J; Evans, D A; Croston, J H; Lee, J C

    2010-01-01

    We present results from a 42 ks Chandra/ACIS-S observation of the transitional FRI/FRII radio galaxy 3C288 at z = 0.246. We detect $\\sim$3 keV gas extending to a radius of $\\sim$0.5 Mpc with a 0.5-2.0 keV luminosity of 6.6 $\\times$ 10$^{43}$ ergs s$^{-1}$, implying that 3C288 lies at the center of a poor cluster. We find multiple surface brightness discontinuities in the gas indicative of either a shock driven by the inflation of the radio lobes or a recent merger event. The temperature across the discontinuities is roughly constant with no signature of a cool core, thus disfavoring either the merger cold-front or sloshing scenarios. We argue therefore that the discontinuities are shocks due to the supersonic inflation of the radio lobes. If they are shocks, the energy of the outburst is $\\sim$10^{60} ergs, or roughly 30% of the thermal energy of the gas within the radius of the shock, assuming that the shocks are part of a front produced by a single outburst. The cooling time of the gas is $\\sim$10^8 yrs, so...

  12. Preconcentration of Co, Ni, Cd and Zn on naphthalene–2,4,6-trimorpholino-1,3,5-triazin adsorbent and flame atomic absorption determination

    Directory of Open Access Journals (Sweden)

    TAYYEBEH MADRAKIAN

    2010-05-01

    Full Text Available A preconcentration method was developed for the determination of trace amounts of Co, Ni, Cd and Zn by atomic absorption spectrometry. The method is based on the retention of the metal cations by naphthalene–2,4,6-trimorpholino-1,3,5-triazin adsorbent in a column. The adsorbed metals were then eluted from the column with hydrochloric acid and the Co, Ni, Cd and Zn were determined by flame atomic absorption spectrometry. The optimal extraction and elution conditions were studied. The effects of diverse ions on the preconcentration were also investigated. A preconcentration factor of 250 for Co(II, Ni(II and Zn(II, and 400 for Cd(II can easily be achieved. Calibration graphs were obtained and the detection limits of the method for Co(II, Ni(II, Cd(II and Zn(II were 0.51, 0.49, 0.17 and 0.10 ng mL-1, respectively. The relative standard deviations (RSD of 0.37–2.31 % for Co, 0.37–3.73 % for Ni, 2.20–2.40 % for Cd and 1.50–2.56 % for Zn were obtained. The method was also used for the simultaneous preconcentration of these elements and the method was successfully applied to their preconcentration and determination. The method was applied to the determination of Co, Ni, Cd and Zn in several real samples.

  13. Fabrication of an SPR Sensor Surface with Antifouling Properties for Highly Sensitive Detection of 2,4,6-Trinitrotoluene Using Surface-Initiated Atom Transfer Polymerization

    Directory of Open Access Journals (Sweden)

    Kiyoshi Toko

    2013-07-01

    Full Text Available In this study, we modified a surface plasmon resonance immunosensor chip with a polymer using surface-initiated atom transfer polymerization (SI-ATRP for the highly sensitive detection of 2,4,6-trinitrotoluene (TNT. To immobilize a TNT analogue on the polymer, mono-2-(methacryloyloxyethylsuccinate (MES, which has a carboxyl group, was used in this study. However, the anti-TNT antibody may adsorb non-specifically on the polymer surface by an electrostatic interaction because MES is negatively charged. Therefore, a mixed monomer with MES and diethylaminoethylmethacrylate (DEAEM, which has a tertiary amino group and is positively charged, was prepared to obtain electroneutrality for suppressing the nonspecific adsorption. The detection of TNT was performed by inhibition assay using the polymer surface. To ensure high sensitivity to TNT, the affinity between the surface and the antibody was optimized by controlling the density of the initiator for ATRP by mixing two types of self-assembled monolayer reagents. As a result, a limit of detection of 5.7 pg/mL (ppt for TNT was achieved using the optimized surface.

  14. Degradation pathway, toxicity and kinetics of 2,4,6-trichlorophenol with different co-substrate by aerobic granules in SBR.

    Science.gov (United States)

    Khan, Mohammad Zain; Mondal, Pijush Kanti; Sabir, Suhail; Tare, Vinod

    2011-07-01

    The present study deals with cultivation of 2,4,6-trichlorophenol (TCP) degrading aerobic granules in two SBR systems based on glucose and acetate as co-substrate. Biodegradation of TCP containing wastewater starting from 10 to 360 mg L(-1) with more than 90% efficiency was achieved. Sludge volume index decreases as the operation proceeds to stabilize at 35 and 30 mL g(-1) while MLVSS increases from 4 to 6.5 and 6.2 g L(-1) for R1 (with glucose as co-substrate) and R2 (with sodium acetate as co-substrate), respectively. FTIR, GC and GC/MS spectral studies shows that the biodegradation occurred via chlorocatechol pathway and the cleavage may be at ortho-position. Haldane model for inhibitory substrate was applied to the system and it was observed that glucose fed granules have a high specific degradation rate and efficiency than acetate fed granules. Genotoxicity studies shows that effluent coming from SBRs was non-toxic. PMID:21565491

  15. Structural stability, NH 2 inversion and vibrational assignments of 2,4,6-trichloroaniline and 2,3,5,6-tetrachloroaniline

    Science.gov (United States)

    Badawi, Hassan M.; Förner, Wolfgang; Al-Saadi, Abdulaziz A.

    2009-12-01

    The structural stability of aniline, 2,4,6-trichloroaniline and 2,3,5,6-tetrachloroaniline was investigated by DFT-B3LYP and ab initio MP2 and MP4(SDQ) calculations with the 6-311G∗∗ basis set. From the calculations the three molecules were predicted to exist predominantly in a symmetric near-planar structure. The NH 2 inversion barrier was estimated from the MP2/6-311G∗∗ level of theory to be about 9.6 kJ/mol for aniline, 5.9 kJ/mol for the trichloro and 4.6 kJ/mol for the tetrachloro derivatives. The line intensities of the ring breathing and the C sbnd Cl stretching modes were shown to have a great dependence on the number of chlorine atoms on the benzene ring. The relative change in Raman line intensity of the C sbnd Cl stretching mode was explained on the basis of the inductive effect of the chlorine atoms on the benzene ring. The vibrational frequencies were computed at the DFT-B3LYP level and the infrared and Raman spectra for each molecule were calculated. Complete vibrational assignments were made on the basis of normal coordinate analyses and potential energy distributions for the two chloroanilines.

  16. Tracing the Cycling and Fate of the Explosive 2,4,6-Trinitrotoluene in Coastal Marine Systems with a Stable Isotopic Tracer, (15)N-[TNT].

    Science.gov (United States)

    Smith, Richard W; Vlahos, Penny; Böhlke, J K; Ariyarathna, Thivanka; Ballentine, Mark; Cooper, Christopher; Fallis, Stephen; Groshens, Thomas J; Tobias, Craig

    2015-10-20

    2,4,6-Trinitrotoluene (TNT) has been used as a military explosive for over a hundred years. Contamination concerns have arisen as a result of manufacturing and use on a large scale; however, despite decades of work addressing TNT contamination in the environment, its fate in marine ecosystems is not fully resolved. Here we examine the cycling and fate of TNT in the coastal marine systems by spiking a marine mesocosm containing seawater, sediments, and macrobiota with isotopically labeled TNT ((15)N-[TNT]), simultaneously monitoring removal, transformation, mineralization, sorption, and biological uptake over a period of 16 days. TNT degradation was rapid, and we observed accumulation of reduced transformation products dissolved in the water column and in pore waters, sorbed to sediments and suspended particulate matter (SPM), and in the tissues of macrobiota. Bulk δ(15)N analysis of sediments, SPM, and tissues revealed large quantities of (15)N beyond that accounted for in identifiable derivatives. TNT-derived N was also found in the dissolved inorganic N (DIN) pool. Using multivariate statistical analysis and a (15)N mass balance approach, we identify the major transformation pathways of TNT, including the deamination of reduced TNT derivatives, potentially promoted by sorption to SPM and oxic surface sediments. PMID:26375037

  17. Tetrakis(2,4,6-triamino-1,3,5-triazin-1-ium tris(pyridine-2,6-dicarboxylatocalcate(II hexahydrate

    Directory of Open Access Journals (Sweden)

    Hossein Aghabozorg

    2008-08-01

    Full Text Available The title compound, (C3H7N64[Ca(C7H3NO43]·6H2O or (tataH4[Ca(pydc3]·6H2O (where tata is 2,4,6-triamino-1,3,5-triazine and pydcH2 is pyridine-2,6-dicarboxylic acid, was obtained by reaction of Ca(NO32·4H2O with the proton-transfer compound (tataH2(pydc in aqueous solution. The [Ca(pydc3]4− anion has twofold crystallographic symmetry. It is a nine-coordinate CaII complex with a distorted tricapped trigonal-prismatic coordination geometry. The structure also contains four tataH+ cations and six uncoordinated water molecules. There are extensive O—H...O, O—H...N, N—H...O, N—H...N and C—H...O hydrogen bonds in the crystal structure.

  18. Dibromido(2,4,6-tri-2-pyridyl-1,3,5-triazine-κ3N2,N1,N6manganese(II

    Directory of Open Access Journals (Sweden)

    Kwang Ha

    2011-12-01

    Full Text Available The MnII ion in the title complex, [MnBr2(C18H12N6], is five-coordinated in a distorted square-pyramidal geometry by three N atoms of the tridentate 2,4,6-tri-2-pyridyl-1,3,5-triazine (tptz ligand and two bromide anions. In the crystal, the pyridyl rings coordinated to the Mn atom are inclined slightly to their carrier triazine ring [dihedral angles = 8.0 (3 and 7.5 (3°], whereas the uncoordinated pyridyl ring is located approximately parallel to the triazine ring [dihedral angle = 3.7 (3°]. The complexes are stacked in columns along the a axis and linked by intermolecular C—H...Br hydrogen bonds, forming chains. In the column, intermolecular π–π interactions between the six-membered rings are present, the shortest centroid–centroid distance being 3.750 (4 Å.

  19. Facile Synthesis, Characterization, and In Vitro Antimicrobial Screening of a New Series of 2,4,6-Trisubstituted-s-triazine Based Compounds

    Directory of Open Access Journals (Sweden)

    Ravi Bhushan Singh

    2015-01-01

    Full Text Available A series of new 2,4,6-trisubstituted-s-triazine was synthesized, assessed for antimicrobial activity, and characterized by FTIR, 1HNMR, 13CNMR, and elemental analysis. The tested compounds, 4d, 4g, 4h, 4k, and 4n, have shown considerable in vitro antibacterial efficacy with reference to the standard drug ciprofloxacin (MIC 3.125 μgmL−1 against B. subtilis, E. coli, and K. pneumoniae. It was observed that compounds 4d and 4h displayed equipotent antibacterial efficacy against B. subtilis (MIC 3.125 μgmL−1 and S. aureus (MIC 6.25 μgmL−1. The studies demonstrated that the para-fluorophenylpiperazine substituted s-triazine (4n was potent and exhibited broad spectrum antibacterial activity against S. epidermidis, K. pneumoniae, and P. aeruginosa with MIC of 6.25 μgmL−1 and for E. coli, it showed an MIC of 3.125 μgmL−1 equipotent with reference to the standard drug. Among all the compounds under investigation, compound 4g also demonstrated significant antifungal activity (3.125 μgmL−1 against C. albicans.

  20. Preconcentration of ruthenium on activated carbon impregnated with 2,4,6-tri-2-pyridyl-1,3,5-triazine/graphite furnace AAS

    International Nuclear Information System (INIS)

    Ruthenium is adsorbed on activated carbon impregnated with 2,4,6-tri-2-pyridyl-1,3,5-triazine (TPTZ-AC). A simple and rapid determination method for trace amounts of Ru by graphite furnace AAS using direct heating of Ru adsorbed TPTZ-AC was investigated. The proposed method is as follows. A sample solution of 100-1000 cm3 containing Ru is mixed with 50 mg of TPTZ-AC. The pH is then adjusted to 7.0 with phosphate buffer solution, and stirred for 10 min. The Ru adsorbed TPTZ-AC was separated from the sample solution by filtration. The TPTZ-AC on membrane filter is dispersed in 5.0 cm3 water. After shaking, 10 μl of the resulting suspension is injected directly into the graphite furnace. The absorbance is measured at 349.9 nm. The pyrocarbon treated graphite tube was most effective for the measurement of Ru. The calibration curve was liner below 2.5 μg/100 cm3 (aqueous phase). The determination limits (3σ) were 0.08 μg/100 cm3 (aqueous phase). The presence of such as Cu, Ni did not interfere. Interference by Fe could be masked by adding thiourea and 1,10-phenanthroline and ammonium fluoride. The proposed method was applied to the determination of Ru in several water samples. (author)

  1. Spectrophotometric analysis of vitamin E using Cu(I)-Bathocuproine or/and Fe(II)-2,4,6-tris-(2'-pyridyl)-s-triazine complexes

    International Nuclear Information System (INIS)

    Vitamin E (tocopherols and tocotrienols) antioxidants are determined by reducing Cu(II) to Cu(I) or Fe(III) to Fe(II) in presence of vitamin E and subsequent complexation of Cu(I) with bathocuproine and/or Fe(II) with 2,4,6-tris-(2'-pyridyl)-s-triazine (TPTZ). Both the reactions are monitored separately, Cu(I)-bathocuproine at 479 nm where as, Fe(II)-(TPTZ) at 595 nm spectrophotometrically. Linear calibration curves are achieved for both complexes between I to 5mu g ml-1 for vitamin E. The methods were applied for the determination of vitamin E in pharmaceutical preparations and edible oils. Vitamin E, from edible oils, was solvent extracted into n-hexane prior to saponification. Furthermore, a single lined flow was also examined. A larger excess of Cu(II) or Fe =(II) with different concentrations of vitamin E in buffer pH 4 was run on the line and constant amounts of reagent bathocuproine or TPTZ in each case was injected through the injector. The peak height shows a linear relationship for vitamin E between 0.5 to 2.5 mu g ml-1 for both complexes. (author)

  2. Photoluminescence detection of 2,4,6-trinitrotoluene (TNT) binding on diatom frustule biosilica functionalized with an anti-TNT monoclonal antibody fragment.

    Science.gov (United States)

    Zhen, Le; Ford, Nicole; Gale, Debra K; Roesijadi, Guritno; Rorrer, Gregory L

    2016-05-15

    A selective and label-free biosensor for detection of the explosive compound 2,4,6-trinitrotoluene (TNT) in aqueous solution was developed based on the principle of photoluminescence quenching of upon immunocomplex formation with antibody-functionalized diatom frustule biosilica. The diatom frustule is an intricately nanostructured, highly porous biogenic silica material derived from the shells of microscopic algae called diatoms. This material emits strong visible blue photoluminescence (PL) upon UV excitation. PL-active frustule biosilica was isolated from cultured cells of the marine diatom Pinnularia sp. and functionalized with a single chain variable fragment (scFv) derived from an anti-TNT monoclonal antibody. When TNT was bound to the anti-TNT scFv-functionalized diatom frustule biosilica, the PL emission from the biosilica was partially quenched due to the electrophilic nature of the nitro (-NO2) groups on the TNT molecule. The dose-response curve for immunocomplex formation of TNT on the scFv-functionalized diatom frustule biosilica had a half-saturation binding constant of 6.4 ± 2.4·10(-8)M and statistically-significant measured detection limit of 3.5·10(-8)M. The binding and detection were selective for TNT and TNB (trinitrobenzene) but not RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) or 2,6-DNT (2,6-dinitrotoluene). PMID:26774089

  3. 2,4,6-Tribromophenol Interferes with the Thyroid Hormone System by Regulating Thyroid Hormones and the Responsible Genes in Mice

    Science.gov (United States)

    Lee, Dongoh; Ahn, Changhwan; Hong, Eui-Ju; An, Beum-Soo; Hyun, Sang-Hwan; Choi, Kyung-Chul; Jeung, Eui-Bae

    2016-01-01

    2,4,6-Tribromophenol (TBP) is a brominated flame retardant (BFR). Based on its affinity for transthyretin, TBP could compete with endogenous thyroid hormone. In this study, the effects of TBP on the thyroid hormone system were assessed in mice. Briefly, animals were exposed to 40 and 250 mg/kg TBP. Thyroid hormones were also administered with or without TBP. When mice were treated with TBP, deiodinase 1 (Dio1) and thyroid hormone receptor β isoform 2 (Thrβ2) decreased in the pituitary gland. The levels of deiodinase 2 (Dio2) and growth hormone (Gh) mRNA increased in response to 250 mg/kg of TBP, and the relative mRNA level of thyroid stimulating hormone β (Tshβ) increased in the pituitary gland. Dio1 and Thrβ1 expression in the liver were not altered, while Dio1 decreased in response to co-treatment with thyroid hormones. The thyroid gland activity decreased in response to TBP, as did the levels of free triiodothyronine and free thyroxine in serum. Taken together, these findings indicate that TBP can disrupt thyroid hormone homeostasis and the presence of TBP influenced thyroid actions as regulators of gene expression. These data suggest that TBP interferes with thyroid hormone systems PMID:27420076

  4. Impaired epithelial differentiation of induced pluripotent stem cells from ectodermal dysplasia-related patients is rescued by the small compound APR-246/PRIMA-1MET.

    Science.gov (United States)

    Shalom-Feuerstein, Ruby; Serror, Laura; Aberdam, Edith; Müller, Franz-Josef; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing; Aberdam, Daniel; Petit, Isabelle

    2013-02-01

    Ectodermal dysplasia is a group of congenital syndromes affecting a variety of ectodermal derivatives. Among them, ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome is caused by single point mutations in the p63 gene, which controls epidermal development and homeostasis. Phenotypic defects of the EEC syndrome include skin defects and limbal stem-cell deficiency. In this study, we designed a unique cellular model that recapitulated major embryonic defects related to EEC. Fibroblasts from healthy donors and EEC patients carrying two different point mutations in the DNA binding domain of p63 were reprogrammed into induced pluripotent stem cell (iPSC) lines. EEC-iPSC from both patients showed early ectodermal commitment into K18(+) cells but failed to further differentiate into K14(+) cells (epidermis/limbus) or K3/K12(+) cells (corneal epithelium). APR-246 (PRIMA-1(MET)), a small compound that restores functionality of mutant p53 in human tumor cells, could revert corneal epithelial lineage commitment and reinstate a normal p63-related signaling pathway. This study illustrates the relevance of iPSC for p63 related disorders and paves the way for future therapy of EEC. PMID:23355677

  5. A New Indirect Spectrofluorimetric Method for Determination of Ascorbic Acid with 2,4,6-Tripyridyl-S-Triazine in Pharmaceutical Samples

    Directory of Open Access Journals (Sweden)

    Lejla Klepo

    2016-01-01

    Full Text Available Ascorbic acid (AA is a water-soluble vitamin which shows no fluorescence. However, in reaction with iron(III, AA is oxidised to dehydroascorbic acid and iron(III is reduced to iron(II which forms a complex with 2,4,6-tripyridyl-S-triazine (TPTZ in buffered medium. The relative fluorescence intensity of the resulting Fe(TPTZ22+ complex can be measured at excitation and emission wavelengths of 393 and 790 nm, respectively. Based on this data, a new indirect spectrofluorimetric method for the determination of AA in pharmaceutical samples was proposed. Influence of the reaction conditions, such as acidity of acetic buffer, concentration of TPTZ and iron(III, reaction time and instrumental parameters were investigated in detail. The linear range was from 5.4 × 10−4 to 5.4 × 10−6 mol·L−1 (R = 0.9971. The LOD was 7.7 × 10−7 mol·L−1 and LOQ was 2.3 × 10−4 mol·L−1. Fourteen pharmaceutical samples containing various amounts of AA were analysed. Influences of potential interfering substances were also examined. Analysis of commercial pharmaceutical formulations showed good correlation with the nominal values given by the manufacturers and with the results obtained by a titration method. The proposed method can be applied in routine quality control in the pharmaceutical industry due to its sensitivity, simplicity, selectivity and low cost.

  6. Absorption spectroscopic and FTIR studies on EDA complexes between TNT (2,4,6-trinitrotoluene) with amines in DMSO and determination of the vertical electron affinity of TNT

    Science.gov (United States)

    Sharma, S. P.; Lahiri, S. C.

    2008-06-01

    TNT (2,4,6-trinitrotoluene) formed deep red 1:1 CT complexes with chromogenic agents like isopropylamine, ethylenediamine, bis(3-aminopropyl)amine and tetraethylenepentamine in DMSO. The complexes were also observed in solvents like methanol, acetone, etc. when the amines were present in large excess. The isopropylamine, complex showed three absorption peaks (at 378, 532 and 629 nm) whereas higher amines showed four peaks (at 370, 463, 532 and 629 nm). The peak at 463 nm vanished rapidly. The peak of the complexes near 530 nm required about 8-10 min to develop and the complexes were stable for about an hour but the peak slowly shifted towards 500 nm and the complexes were found to be stable for more than 24 h. The evidence of complex formation was obtained from distinct spots in HPTLC plates and from the shifts in frequencies and formation of new peaks in FTIR spectra. The peaks near 460 nm (transient) and 530 nm may be due to Janovsky reaction but could not be established. The extinction coefficients of the complexes were determined directly which enabled the accurate determination of the association constants KDA with TNT and amines in stoichiometric ratios. The results were verified using iterative method. The quantfication of TNT was made using ɛ value of the complex with ethylenediamine. The vertical electron affinity ( EA) of TNT was calculated using the method suggested by Mulliken.

  7. Survey of potential markets for devices using Californium-252

    International Nuclear Information System (INIS)

    Potential applications for devices or systems containing 252Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252Cf, which have been two to four times greater in Europe than in the US

  8. Automated absolute activation analysis with californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    MacMurdo, K.W.; Bowman, W.W.

    1978-09-01

    A 100-mg /sup 252/Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from /sup 17/O. Detection sensitivities of < or = 400 ppB for natural uranium and 8 ppB (< or = 0.5 (nCi/g)) for /sup 239/Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level.

  9. Californium-252 neutron activation facility at the Savannah River Laboratory

    International Nuclear Information System (INIS)

    A neutron irradiation facility has been established to develop new analytical methods and for the support of research programs. A major component of this facility is a 252Cf source which provides both fission spectrum and thermal neutrons. (U.S.)

  10. Crystal Structure and Thermal Behavior of Rubidium 3,5-dihydroxy-2,4,6-trinitrophenolate%3,5-二羟基-2,4,6-三硝基苯酚铷的晶体结构和热行为

    Institute of Scientific and Technical Information of China (English)

    陈红艳; 张同来; 乔小晶; 杨利; 张建国; 郁开北

    2006-01-01

    A novel energetic coordination compound, rubidium 3,5-dihydroxy-2,4,6-trinitrophenolate ([Rb(DHTNP)]n),has been synthesized by reaction of trinitrophloroglueinol with Rb2CO3 in aqueous solution. Its crystal structure has been determined. The crystal belongs to monoclinic system with space group C2/c. In the crystal the Rb cation is coordinated to ten oxygen atoms from seven different DHTNP- anions to form an irregular polyhedron.Two independent molecule geometry structures are found for DHTNP- anion in the complex, which differ in benzene ring and their pattern of intramolecular hydrogen bonds. The DHTNP- anion chains are interlaced with rubidium atoms as knots, and a three-dimensional infinite net structure is formed via coordination and hydrogen bonding. The hydrogen bond and cation-anion interactions are the predominant driving forces in the crystal packing. The thermal property of title complex was studied by using DSC and TG-DTG techniques. CCDC: 290623.

  11. Research Progress in New Detection Technology of2,4,6-Trichloroanisole in Grape Wine%葡萄酒中2,4,6-三氯苯甲醚(TCA)检测新技术的研究进展

    Institute of Scientific and Technical Information of China (English)

    周立华; 牟德华; 李艳

    2016-01-01

    2,4,6-trichloroanisole (TCA) is a substance harmful to wine sensory quality. It usually comes from wine corks, and possibly comes from grape or wine-making process contamination. Its existence results in bad odor and bad taste in wine. In this paper, the new methods and in-struments for the detection of TCA in wine in recent years were introduced including the extraction technology and detection technology of TCA in wine. And the characteristics, principles and application advantages of these new technologies were elaborated for the purpose of pro-viding useful reference for achieving high-precision, low-detection-limit and high-sensitivity qualitative and quantitative determination of TCA in wine, further monitoring TCA in wine, and ultimately improving wine quality.%2,4,6-三氯苯甲醚(TCA)是危害葡萄酒感官品质的一种物质,通常来自于葡萄酒封装所用的软木塞,也可能来自葡萄原料或酿酒过程中的污染,它的存在使葡萄酒产生不良气味和口感.简介了最近十几年来检测葡萄酒中TCA的新方法和新仪器,包括葡萄酒中TCA的萃取技术和检测技术.并对这些新技术的特点、原理及应用优势进行了阐述.目的是为对葡萄酒中的TCA做到精确、低检出限和高灵敏性的定性及定量测定提供参考,从而对葡萄酒中的TCA进行准确的监测,最终提高葡萄酒的品质.

  12. DECHLORINATION OF 2,4,6-TRICHLOROPHENOL BY FREE AND IMMOBILIZED LACCASE FROM TRAMETES VERSICOLOR IN A LAB SCALE BIOREACTOR Arzu ÜNAL, Ahmet ÇABUK, Nazif KOLONKAYA

    Directory of Open Access Journals (Sweden)

    Nazif KOLANKAYA

    2011-08-01

    Full Text Available Detoxification of a chlorinated phenolic compound, 2,4,6- trichlorophenol through treatment with laccase enzyme produced by a white rot fungus, Trametes versicolor was investigated. Enzymaticdechlorination experiments by using free and immobilized laccase have been performed in a lab scale bioreactor. Chlorine ion and dissolved oxygen electrodes mounted to the bioreactor were used continuouslyto detect the profiles of chlorine ions and oxygen consumption, respectively, in reaction medium. The maximum dechlorination activity of laccase for free and immobilized form was determined as 160 μM of substrate concentration at pH 5.0, 25 °C, and 30 min of incubation time. Also, GC/MS analyses of enzymatic degradation products indicated that chlorine removal was a result of degradation of 2,4,6- trichlorophenol by the laccase under the determined optimum conditions.

  13. Ab initio determination of the framework structure of the heavy-metal oxide Cs{sub x}Nb{sub 2.54}W{sub 2.46}O{sub 14} from 100kV precession electron diffraction data

    Energy Technology Data Exchange (ETDEWEB)

    Weirich, Thomas E. [Gemeinschaftslabor fuer Elektronenmikroskopie der Rheinisch-Westfaelischen Technischen Hochschule (RWTH) Aachen, Ahornstrasse 55, Aachen D-52074 (Germany)]. E-mail: weirich@gfe.rwth-aachen.de; Portillo, Joaquim [NanoMEGAS, Boulevard Edmond Machtens 79, Brussels B-1080 (Belgium); SERVEIS Cientificotecnics, Universitat de Barcelona/Sole i Sabaris s/n, Barcelona 08028 (Spain); Cox, Gerhard [BASF-AG, Polymer Physics Department, Ludwigshafen D-67065 (Germany); Hibst, Hartmut [BASF-AG, Catalysis Research Department Ludwigshafen D-67065 (Germany); Nicolopoulos, Stavros [NanoMEGAS, Boulevard Edmond Machtens 79, Brussels B-1080 (Belgium); Universidad Politecnica de Valencia /ITQ Avda de los Naranjos s/n, Valencia 46071 (Spain)

    2006-02-15

    The present work deals with the ab initio determination of the heavy metal framework in Cs{sub x}(Nb, W){sub 5}O{sub 14} from precession electron diffraction intensities. The target structure was first discovered by Lundberg and Sundberg [Ultramicroscopy 52 (1993) 429-435], who succeeded in deriving a tentative structural model from high-resolution electron microsopy (HREM) images. The metal framework of the compound was solved in this investigation via direct methods from hk0 precession electron diffraction intensities recorded with a Philips EM400 at 100kV. A subsequent (kinematical) least-squares refinement with electron intensities yielded slightly improved co-ordinates for the 11 heavy atoms in the structure. Chemical analysis of several crystallites by EDX is in agreement with the formula Cs{sub 0.44}Nb{sub 2.54}W{sub 2.46}O{sub 14}. Moreover, the structure was independently determined by Rietveld refinement from X-ray powder data obtained from a multi-phasic sample. The compound crystallises in the orthorhombic space group Pbam with refined lattice parameters a=27.145(2), b=21.603(2), and c=3.9463(3)A. Comparison of the framework structure from electron diffraction with the result from Rietveld refinement shows an average agreement for the heavy atoms within 0.09A.

  14. The Sinuous Target

    Energy Technology Data Exchange (ETDEWEB)

    Zwaska, R. [Fermilab

    2015-06-01

    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  15. Production Target Design Report

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dale, Gregory E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Olivas, Eric Richard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-07-28

    The Northstar 99Mo production target, a cylindrical length of 100Mo rod, has evolved considerably since its first conception.  The cylinder was very early sliced into disks to increase the heat transfer area, first to 1 mm thick disks then to the current 0.5 mm thick.  The coolant was changed early in the target development from water to helium to eliminate corrosion and dissolution.  The diameter has increased from initially 6 mm to 12 mm, the current diameter of the test target now at ANL, to nominally 28 mm (26-30.6 mm, depending upon optimal beam spot size and shape).  The length has also changed to improve the production to cost ratio, so now the target is nominally 41 mm long (excluding coolant gaps between disks), and irradiated on both ends.  This report summarizes the current status of the plant target design.

  16. Simultaneous dispersive liquid-liquid microextraction based on a low-density solvent and derivatization followed by gas chromatography for the simultaneous determination of chloroanisoles and the precursor 2,4,6-trichlorophenol in water samples.

    Science.gov (United States)

    Bai, Xiuzhi; Zhang, Ting; Li, Haipu; Yang, Zhaoguang

    2016-06-01

    Chloroanisoles, particularly 2,4,6-trichloroanisole, are commonly identified as major taste and odor compounds in water. In the present study, a simple and efficient method was established for the simultaneous determination of chloroanisoles and the precursor 2,4,6-trichlorophenol in water by using low-density-solvent-based simultaneous dispersive liquid-liquid microextraction and derivatization followed by gas chromatography with electron capture detection. 2,4-Dichloroanisole, 2,6-dichloroanisole, 2,4,6-trichloroanisole, 2,3,4-trichloroanisole, and 2,3,6-trichloroanisole were the chloroanisoles evaluated. Several important parameters of the extraction-derivatization procedures, including the types and volumes of extraction solvent and disperser solvent, concentrations of derivatization agent and base, salt addition, extraction-derivatization time, and temperature were optimized. Under the optimized conditions (80 μL of isooctane as extraction solvent, 500 μL of methanol as disperser solvent, 60 μL of acetic anhydride as derivatization agent, 0.75% of Na2 CO3 addition w/v, extraction-derivatization temperature of 25°C, without salt addition), a good linearity of the calibration curve was observed by the square of correlation coefficients (R(2) ) ranging from 0.9936 to 0.9992. Repeatability and reproducibility of the method were < 4.5% and <7.3%, respectively. Recovery rates ranged from 85.2 to 101.4%, and limits of detection ranged from 3.0 to 8.7 ng/L. The proposed method was applied successfully for the determination of chloroanisoles and 2,4,6-trichlorophenol in water samples.

  17. Induction by phenobarbital of aniline-p-hydroxylase in mouse liver under the influence of X-irradiation and 2,4,6-triethyleneimino-1,3,5-triazine

    International Nuclear Information System (INIS)

    The phenobarbital-induced activity of aniline-p-hydroxylase in livers of mice was enhanced additionally when the animals were X-irradiated 4-16 hours before the administration of the inducer. The same effect could be demonstrated after repeated irradiation with low doses. 2,4,6-triethyleneimino-1,3,5-triazine (tretamine) inhibited the induction of aniline-p-hydroxylase only when administered in extremely high doses. Lower doses resulted in 'superinduciton'. (orig.)

  18. Inflation Forecast Targeting: Implementing and Monitoring Inflation Targets

    OpenAIRE

    Lars E.O. Svensson

    1996-01-01

    Inflation targeting is shown to imply inflation forecast targeting: the central bank's inflation forecast becomes an intermediate target. Inflation forecast targeting simplifies both implementing and monitoring of monetary policy. The inflation forecast is actually an ideal intermediate target: it is most correlated with the goal, easier to control than the goal, more observable than the goal, and very transparent. Money growth targeting generally leads to higher inflation variability than in...

  19. Phoenix Color Targets

    Science.gov (United States)

    2008-01-01

    These images of three Phoenix color targets were taken on sols 1 and 2 by the Surface Stereo Imager (SSI) on board the Phoenix lander. The bottom target was imaged in approximate color (SSI's red, green, and blue filters: 600, 530, and 480 nanometers), while the others were imaged with an infrared filter (750 nanometers). All of them will be imaged many times over the mission to monitor the color calibration of the camera. The two at the top show grains 2 to 3 millimeters in size that were likely lifted to the Phoenix deck during landing. Each of the large color chips on each target contains a strong magnet to protect the interior material from Mars' magnetic dust. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  20. Targeted Phototherapy (newer phototherapy

    Directory of Open Access Journals (Sweden)

    Zonunsanga

    2015-04-01

    Full Text Available Conventional phototherapy uses a whole body cabinet or body part machine such as hand, foot or scalp machines. They have many disadvantages due to which new phototherapy technique was then developed to overcome this situation. This new technique is called targeted phototherapy which includes excimer laser, intense pulse light system (IPL, photodynamic therapy and ultraviolet (UV light source with a sophisticated delivery system which is easy to be operated by hands. The mechanisms of action of targeted phototherapy systems are similar to those in conventional UVB/UVA therapy. They have many advantages like less chances of side effects, avoidance of exposure of unnecessary sites, faster response, shortening of the duration of treatments. But they have disadvantages like high costs and inability to use for extensive areas. This review article discusses targeted phototherapy in considerable to the mechanism of actions and advantages and disadvantages in comparison to the conventional phototherapy.

  1. Setting reference targets

    International Nuclear Information System (INIS)

    Reference Targets are used to represent virtual quantities like the magnetic axis of a magnet or the definition of a coordinate system. To explain the function of reference targets in the sequence of the alignment process, this paper will first briefly discuss the geometry of the trajectory design space and of the surveying space, then continue with an overview of a typical alignment process. This is followed by a discussion on magnet fiducialization. While the magnetic measurement methods to determine the magnetic centerline are only listed (they will be discussed in detail in a subsequent talk), emphasis is given to the optical/mechanical methods and to the task of transferring the centerline position to reference targets

  2. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    hill, amanda; Leinikka Dall, Ole; Andersen, Frits Møller

    2014-01-01

    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses...... how the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish...

  3. Synthesis, Crystal Structure and Thermal Stability of a One-dimensional Chain Cobalt Coordination Polymer [ Co( 4,4 '-bipy)( 2,4,6- TMBA)2( CH3CH2OH)2]n

    Institute of Scientific and Technical Information of China (English)

    LI Wei; LI Chang-Hong; YANG Ying-Qun; CHEN Zhi-Min; KUANG Dai-Zhi; ZHANG Chun-Hua; KANG Yun-Fei

    2006-01-01

    A one-dimensional chain cobalt(Ⅱ) coordination polymer with 2,4,6-trimethylbenzoic acid, 4,4'-bipyridine and cobalt perchlorate anhydrous has been synthesized and characterized in the mixture solvent of water and alcohol. Crystal data for this complex: monoclinic, space group C2/c, a = 2.3805(8), b = 1.1464(4), c = 1.5807(5) nm, γ = 128.435(4)°, V= 3.3791(18) nm3,Dc = 1.246 g/cm3, Z = 4, F(000) = 1340, final GooF = 1.009, R = 0.0504 and wR = 0.1287.Structural analysis shows that the cobalt ion is coordinated with two nitrogen atoms of one 4,4'-bipyridine molecule and four oxygen atoms from two 2,4,6-trimethylbenzoic acid molecules and two alcohol molecules, giving a distorted octahedral coordination geometry. The result of TG analysis indicates that the title complex is stable till 200 ℃.

  4. Synthesis and characterization of -phosphorylated thioureas RNHC(S)NHP(O)(OPr)2 (R = 2-MeC6H4, 2,6-Me2C6H3, 2,4,6-Me3C6H2)

    Indian Academy of Sciences (India)

    Damir A Safin; Maria G Babashkina; Michael Bolte; Axel Klein

    2010-05-01

    Reaction of O,O'-diisopropylphosphoric acid isothiocyanate (PrO)2P(O)NCS with 2-methylaniline 2-MeC6H4NH2, 2,6-dimethylaniline 2,6-Me2C6H3NH2 or 2,4,6-trimethylaniline 2,4,6-Me3C6H2NH2 leads to the -phosphorylated thioureas RNHC(S)NHP(O)(OPr)2 (R = 2-MeC6H4-, HLI; 2,6-Me2C6H3-, HLII; 2,4,6-Me3C6H2-, HLIII). The new compounds were investigated by 1H and 31P{1H} NMR spectroscopy, and microanalysis. The molecular structure of the thiourea HLIII was elucidated by single crystal X-ray diffraction analysis. Single crystal X-ray diffraction studies showed HLIII forms both intra- and intermolecular hydrogen bonds, which in turn leads to the formation of polymeric chains. One of the intermolecular hydrogen bonds is of the type N-H$\\cdots$S. Moreover, the formation of intermolecular C-H$\\cdots$ 6 -phenyl interactions was established.

  5. AA antiproton production target

    CERN Multimedia

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long (actually a row of 11 rods, each 1 cm long) and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing made of stainless steel. The casing had fins for forced-air cooling. In this picture, the 26 GeV high-intensity beam from the PS enters from the right, where a scintillator screen, with circles every 5 mm in radius, permits precise aim at the target centre. See also 7903034 and 7905094.

  6. Targeting peroxiredoxins against leukemia.

    Science.gov (United States)

    Liu, Chuan-Xu; Zhou, Hu-Chen; Yin, Qian-Qian; Wu, Ying-Li; Chen, Guo-Qiang

    2013-01-15

    Peroxiredoxins (Prx), a family of small non-seleno peroxidases, are important regulators for cellular reactive oxygen species (ROS), which contribute to many signaling pathways and pathogenesis of diseases. Targeting redox homeostasis is being developed as a promising therapeutic strategy for many diseases such as cancers. This mini-review attempts to focus on our recent discoveries on adenanthin as the first natural molecule to specifically target the resolving cysteines of Prx I and Prx II and thus inhibit their peroxidase activities, and its role in differentiation induction in vitro and in vivo of acute myeloid leukemic cells.

  7. 1,3,5-Triferrocenyl-2,4,6-tris(ethynylferrocenyl)-benzene--a new member of the family of multiferrocenyl-functionalized cyclic systems.

    Science.gov (United States)

    Pfaff, Ulrike; Filipczyk, Grzegorz; Hildebrandt, Alexander; Korb, Marcus; Lang, Heinrich

    2014-11-21

    The consecutive synthesis of 1,3,5-triferrocenyl-2,4,6-tris(ethynylferrocenyl)benzene (6c) is described using 1,3,5-Cl3-2,4,6-I3-C6 (2) as starting compound. Subsequent Sonogashira C,C cross-coupling of 2 with FcC≡CH (3) in the molar ratio of 1:4 afforded solely 1,3,5-Cl3-2,4,6-(FcC≡C)3-C6 (4c) (Fc = Fe(η(5)-C5H4)(η(5)-C5H5)). However, when 2 is reacted with 3 in a 1:3 ratio a mixture of 1,3,5-Cl3-2-(FcC≡C)-4,6-I2-C6 (4a) and 1,3,5-Cl3-2,4-(FcC≡C)2-6-I-C6 (4b) is obtained. Negishi C,C cross-coupling of 4c with FcZnCl (5) in the presence of catalytic amounts of [Pd(CH2C(CH3)2P(tC4H9)2)(μ-Cl)]2 gave 1,3-Cl2-5-Fc-2,4,6-(FcC≡C)3-C6 (6a), 1-Cl-3,5-Fc2-2,4,6-(FcC≡C)3-C6 (6b) and 1,3,5-Fc3-2,4,6-(FcC≡C)3-C6 (6c) of which 6b is the main product. Column chromatography allowed the separation of these organometallic species. The structures of 4a,b and 6a in the solid state were determined by single crystal X-ray diffractometry showing a π–π interacting dimer (4b) and a complex π–π pattern for 6a. The electrochemical properties of 4a–c and 6a–c were studied by cyclic voltammetry (=CV) and square wave voltammetry (=SWV). It was found that the FcC≡C-substituted benzenes 4a–c show only one reversible redox event, indicating a simultaneous oxidation of all ferrocenyl units, whereby 4c is most difficult to oxidise (4a, E°′1 = 190, ΔEp = 71; 4b, E°′1 = 195, ΔEp = 59; 4c, E°′1 = 390, ΔEp = 59 mV). In case of 4c, the oxidation states 4c(n+) (n = 2, 3) are destabilised by the partial negative charge of the electronegative chlorine atoms, which compensates the repulsive electrostatic Fc+–Fc+ interactions with attractive electrostatic Fc+–Cl(δ−) interactions. When ferrocenyl units are directly attached to the benzene C6 core, organometallic 6a shows three, 6b five and 6c six separated reversible waves highlighting that the Fc units can separately be oxidised. UV-Vis/NIR spectroscopy allowed to determine IVCT absorptions (=Inter Valence

  8. Major Targets for 2010

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    @@ This year, the main targets we have set for economic and social development are: increasing GDP by approximately 8 percent, creating jobs for more than 9 million people, keeping the urban registered unemployment rate no higher than 4.6 percent, holding the rise in consumer prices to around 3 percent, and improving the balance of payments.

  9. Target chambers for gammashpere

    Energy Technology Data Exchange (ETDEWEB)

    Carpenter, M.P.; Falout, J.W.; Nardi, B.G. [and others

    1995-08-01

    One of our responsibilities for Gammasphere, was designing and constructing two target chambers and associated beamlines to be used with the spectrometer. The first chamber was used with the early implementation phase of Gammasphere, and consisted of two spun-Al hemispheres welded together giving a wall thickness of 0.063 inches and a diameter of 12 inches.

  10. Enhanced target factor analysis.

    Science.gov (United States)

    Rostami, Akram; Abdollahi, Hamid; Maeder, Marcel

    2016-03-10

    Target testing or target factor analysis, TFA, is a well-established soft analysis method. TFA answers the question whether an independent target test vector measured at the same wavelengths as the collection of spectra in a data matrix can be excluded as the spectrum of one of the components in the system under investigation. Essentially, TFA cannot positively prove that a particular test spectrum is the true spectrum of one of the components, it can, only reject a spectrum. However, TFA will not reject, or in other words TFA will accept, many spectra which cannot be component spectra. Enhanced Target Factor Analysis, ETFA addresses the above problem. Compared with traditional TFA, ETFA results in a significantly narrower range of positive results, i.e. the chance of a false positive test result is dramatically reduced. ETFA is based on feasibility testing as described in Refs. [16-19]. The method has been tested and validated with computer generated and real data sets. PMID:26893084

  11. Cancer immunotherapy targeting neoantigens.

    Science.gov (United States)

    Lu, Yong-Chen; Robbins, Paul F

    2016-02-01

    Neoantigens are antigens encoded by tumor-specific mutated genes. Studies in the past few years have suggested a key role for neoantigens in cancer immunotherapy. Here we review the discoveries of neoantigens in the past two decades and the current advances in neoantigen identification. We also discuss the potential benefits and obstacles to the development of effective cancer immunotherapies targeting neoantigens.

  12. ISOLDE back on target

    CERN Multimedia

    Anaïs Schaeffer

    2014-01-01

    Today, Friday 1 August, the ISOLDE installation, supplied by the beams of the PS Booster, restarted its physics programme. After a shutdown of almost a year and a half, there was a real buzz in the air as the first beam of protons hit the target of the first post-LS1 ISOLDE experiment.   One of the new target-handling robots installed by ISOLDE during LS1. Many improvements have been made to the ISOLDE installation during LS1. One of the main projects was the installation of new robots for handling the targets (see photo 1). “Our targets are bombarded by protons from the PS Booster’s beams and become very radioactive,” explains Maria Jose Garcia Borge, spokesperson for the ISOLDE collaboration. “They therefore need to be handled carefully, which is where the robots come in. The robots we had until now were already over 20 years old and were starting to suffer from the effects of radiation. So LS1 was a perfect opportunity to replace them with more moder...

  13. The problem of 2,4,6-trichloroanisole in cork planks studied by attenuated total reflection infrared spectroscopy: proof of concept.

    Science.gov (United States)

    Garcia, Ana R; Lopes, Luís F; Brito de Barros, Ricardo; Ilharco, Laura M

    2015-01-14

    Attenuated total reflection infrared spectroscopy (ATR-IR) proved to be a promising detection technique for 2,4,6-trichloroanisole (TCA), which confers organoleptic defects to bottled alcoholic beverages, allowing the proposal of a criterion for cork plank acceptance when meant for stopper production. By analysis of a significant number of samples, it was proved that the presence of TCA, even in very low concentrations, imparts subtle changes to the cork spectra, namely, the growth of two new bands at ∼1417 (νC═C of TCA ring) and 1314 cm–1 (a shifted νCC of TCA) and an increase in the relative intensities of the bands at ∼1039 cm–1 (δCO of polysaccharides) and ∼813 cm–1 (τCH of suberin), the latter by overlapping with intense bands of TCA. These relative intensities were evaluated in comparison to a fingerprint of suberin (νasC–O–C), at 1161 cm–1. On the basis of those spectral variables, a multivariate statistics linear analysis (LDA) was performed to obtain a discriminant function that allows classifying the samples according to whether they contain or not TCA. The methodology proposed consists of a demanding acceptance criterion for cork planks destined for stopper production (with the guarantee of nonexistence of TCA) that results from combining the quantitative results with the absence of the two TCA correlated bands. ATR infrared spectroscopy is a nondestructive and easy to apply technique, both on cork planks and on stoppers, and has proven more restrictive than other techniques used in the cork industry that analyze the cleaning solutions. At the level of proof of concept, the method here proposed is appealing for high-value stopper applications.

  14. Highly sensitive determination of 2,4,6-trinitrotoluene and related byproducts using a diol functionalized column for high performance liquid chromatography.

    Directory of Open Access Journals (Sweden)

    Burcu Gumuscu

    Full Text Available In this work, a new detection method for complete separation of 2,4,6-trinitrotoluene (TNT; 2,4-dinitrotoluene (2,4-DNT; 2,6-dinitrotoluene (2,6-DNT; 2-aminodinitrotoluene (2-ADNT and 4-aminodinitrotoluene (4-ADNT molecules in high-performance liquid-chromatography (HPLC with UV sensor has been developed using diol column. This approach improves on cost, time, and sensitivity over the existing methods, providing a simple and effective alternative. Total analysis time was less than 13 minutes including column re-equilibration between runs, in which water and acetonitrile were used as gradient elution solvents. Under optimized conditions, the minimum resolution between 2,4-DNT and 2,6-DNT peaks was 2.06. The recovery rates for spiked environmental samples were between 95-98%. The detection limits for diol column ranged from 0.78 to 1.17 µg/L for TNT and its byproducts. While the solvent consumption was 26.4 mL/min for two-phase EPA and 30 mL/min for EPA 8330 methods, it was only 8.8 mL/min for diol column. The resolution was improved up to 49% respect to two-phase EPA and EPA 8330 methods. When compared to C-18 and phenyl-3 columns, solvent usage was reduced up to 64% using diol column and resolution was enhanced approximately two-fold. The sensitivity of diol column was afforded by the hydroxyl groups on polyol layer, joining the formation of charge-transfer complexes with nitroaromatic compounds according to acceptor-donor interactions. Having compliance with current requirements, the proposed method demonstrates sensitive and robust separation.

  15. Luminescence properties and crystal structure of europium complexes with phenoxyacetic acid and 2,4,6-tri(2-pyridyl)-s-triazine

    International Nuclear Information System (INIS)

    Using anion ligand phenoxyacetic acid (HPOA) and neutral ligand 2,4,6-tri(2-pyridyl)-s-triazine (TPTZ), two complexes Eu2(TPTZ)2(POA)6·6H2O and EuY(TPTZ)2(POA)6·6H2O have been synthesized and one crystal EuY(TPTZ)2(POA)6·2CH3OH has been obtained. These complexes are characterized by elemental analysis, ICP-AES, IR and UV absorption spectroscopy. The luminescence spectra, luminescence lifetimes and emission quantum efficiencies of the complexes have been studied. The results show that the complex EuY(TPTZ)2(POA)6·6H2O exhibits stronger luminescence intensity, longer luminescent lifetime and higher emission quantum efficiency than Eu2(TPTZ)2(POA)6·6H2O. The single-crystal X-ray diffraction of EuY(TPTZ)2(POA)6·2CH3OH reveals that the crystal is heteronuclear and crystallizes in the triclinic space group P-1 with following unit cell parameters a=12.2411(10) Å, b=13.2294(11) Å, c=13.5232(11) Å, α=74.8596(13)°, β=82.9593(16)°, γ=87.1641(14)°, and V=2097.7(3) Å3. Each metal ion coordinates with three nitrogen atoms of one TPTZ and seven oxygen atoms of three POA− ions. And there exist two coordination forms between POA− and metal ions in the crystal. One is chelating bidentate, the other is the single-atom bridge. - Highlights: • One Eu/Y heteronuclear crystal and two complexes with HPOA and TPTZ were prepared. • Each metal ion in the crystal coordinates with three nitrogen and seven oxygen atoms. • The two complexes exhibit strong luminescence emissions. • The heteronuclear complex shows better luminescent properties than the homonuclear one. • The structure of the crystal and the sensitization mechanism are deeply discussed

  16. Effects of sinomenine on the expression of microRNA-155 in 2,4,6-trinitrobenzenesulfonic acid-induced colitis in mice.

    Directory of Open Access Journals (Sweden)

    Qiao Yu

    Full Text Available BACKGROUND: Sinomenine, a pure alkaloid isolated in Chinese medicine from the root of Sinomenium acutum, has been demonstrated to have anti-inflammatory and immunosuppressive effects. MicroRNAs (miRNAs are gradually being recognized as critical mediators of disease pathogenesis via coordinated regulation of molecular effector pathways. METHODOLOGY/FINDINGS: After colitis was induced in mice by instillation of 5% (w/v 2,4,6-trinitrobenzenesulfonic acid (TNBS, sinomenine at a dose of 100 or 200 mg/kg was orally administered once daily for 7 days. We evaluated body weight, survival rate, diarrhea score, histological score and myeloperoxidase (MPO activity. The mRNA and protein expression levels of miR-155, c-Maf, TNF-α and IFN-γ were determined by quantitative RT-PCR and immunohistochemistry, respectively. Sinomenine (100 or 200 mg/kg-treated mice with TNBS-induced colitis were significantly improved in terms of body weight, survival rate, diarrhea score, histological score and MPO activity compared with untreated mice. Both dosages of sinomenine significantly decreased the mRNA and protein expression levels of c-Maf, TNF-α and IFN-γ, which elevated in TNBS-induced colitis. Furthermore, sinomenine at a dose of 200 mg/kg significantly decreased the level of miR-155 expression by 71% (p = 0.025 compared with untreated TNBS-induced colitis in mice. CONCLUSIONS/SIGNIFICANCE: Our study evaluated the effects and potential mechanisms of sinomenine in the anti-inflammatory response via miRNA-155 in mice with TNBS-induced colitis. Our findings suggest that sinomenine has anti-inflammatory effects on TNBS-induced colitis by down-regulating the levels of miR-155 and several related inflammatory cytokines.

  17. Tumor-Targeted Nanomedicines

    Science.gov (United States)

    ElBayoumi, Tamer A.; Torchilin, Vladimir P.

    2009-01-01

    Purpose The efficacy of drug delivery systems can be enhanced by making them target-specific via the attachment of various ligands. We attempted to enhance tumor accumulation and therapeutic effect of doxorubicin-loaded long-circulating PEGylated liposomes (Doxil®, ALZA Corp.) by coupling to their surface the anti-cancer monoclonal antibody 2C5 (mAb 2C5) with nuclesome (NS)-restricted activity, that can recognize the surface of various tumor but not normal cells and specifically targets pharmaceutical carriers to tumor cells in vitro and in vivo. Following earlier in vitro results with various cancer cell lines, the mAb 2C5-liposomes were studied in vivo vs. plain and non-specific IgG-liposomes. Experimental design Antibody coupling to Doxil® was performed via the “post-insertion” technique. Using 111In-labeled liposomes, the tissue biodistribution and pharmacokinetic profile were studied, as well as their accumulation in tumors in mice was followed by the whole-body γ-scintigraphic imaging. Therapeutic efficacy of mAb 2C5-targeted Doxil® vs. non-specific IgG-modified and original Doxil® controls was followed by registering live tumor growth and determining tumor weights upon mice sacrifice. Results mAb2C5 antibody-targeted liposomes demonstrate enhanced accumulation in tumors, and the in vivo therapeutic activity of the mAb 2C5-Doxil® treatment was found to be significantly superior, resulting in final tumor weights of only 25-40% compared to all Doxil® control treatments, when tested against the subcutaneous primary murine tumors of 4T1 and C26 and human PC3 tumor in nude mice. Conclusions Our results demonstrate the remarkable capability of 2C5-targeted Doxil® to specifically deliver its cargo into various tumors significantly increasing the efficacy of therapy. PMID:19276264

  18. Polarization discrimination between repeater false-target and radar target

    Institute of Scientific and Technical Information of China (English)

    SHI LongFei; WANG XueSong; XIAO ShunPing

    2009-01-01

    High fidelity repeater false-target badly affects a radar system's detecting, tracking, and data processing. It is an available approach of confronting false-target for radar that discriminates firstly and then eliminates. Whereas for the technique progress about the repeater false-target jam, it is more and more difficult to discriminate this jam in the time-domain, frequency-domain, or space-domain. The technique using polarization information to discriminate the target and false-target is discussed in this paper. With the difference that false-target signal vector's polarization ratio is fixed and target echo signal vector's polarization ratio is variational along with radar transmission signal's polarization, we transform the discrimination problem to beeline distinguish problem in the 2-dim complex space. The distributing characteristic expression of the false-target discrimination statistic is constructed, with which the discrimination ratio of false-target is analyzed. For the target case, the decomposed model of target scattering matrix and the concept of distinguish quantity are proposed. Then, the discrimination ratio of target can be forecasted according to target distinguish quantity. Thus, the performance of discrimination method has been analyzed integrally. The simulation results demonstrate the method in this paper is effective on the discrimination of target and false-target.

  19. Evolution with Drifting Targets

    CERN Document Server

    Kanade, Varun; Vaughan, Jennifer Wortman

    2010-01-01

    We consider the question of the stability of evolutionary algorithms to gradual changes, or drift, in the target concept. We define an algorithm to be resistant to drift if, for some inverse polynomial drift rate in the target function, it converges to accuracy 1 -- \\epsilon , with polynomial resources, and then stays within that accuracy indefinitely, except with probability \\epsilon , at any one time. We show that every evolution algorithm, in the sense of Valiant (2007; 2009), can be converted using the Correlational Query technique of Feldman (2008), into such a drift resistant algorithm. For certain evolutionary algorithms, such as for Boolean conjunctions, we give bounds on the rates of drift that they can resist. We develop some new evolution algorithms that are resistant to significant drift. In particular, we give an algorithm for evolving linear separators over the spherically symmetric distribution that is resistant to a drift rate of O(\\epsilon /n), and another algorithm over the more general prod...

  20. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.

    2014-01-01

    the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish municipalities...... will need to make efforts to recover all recyclable fractions, and that the increased recycling efforts of only selected municipalities will not be sufficient to reach the target.......Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22...

  1. Physics of polarized targets

    CERN Document Server

    Niinikoski, Tapio

    2014-01-01

    For developing, building and operating solid polarized targets we need to understand several fields of physics that have seen sub stantial advances during the last 50 years. W e shall briefly review a selection of those that are important today. These are: 1) quantum statistical methods to describe saturation and relaxation in magnetic resonance; 2) equal spin temperature model for dy namic nuclear polarization; 3 ) weak saturation during NMR polarization measurement; 4 ) refrigeration using the quantum fluid properties of helium isotopes. These, combined with superconducting magnet technologies, permit today to reach nearly complete pola rization of almost any nuclear spins. Targets can be operated in frozen spin mode in rather low and inhomogeneous field of any orientation, and in DNP mode in beams of high intensity. Beyond such experiments of nuclear and particle physics, applications a re also emerging in macromolecular chemistry and in magnetic resonance imaging. This talk is a tribute to Michel Borghini...

  2. Gene Targeting in Neuroendocrinology.

    Science.gov (United States)

    Candlish, Michael; De Angelis, Roberto; Götz, Viktoria; Boehm, Ulrich

    2015-09-20

    Research in neuroendocrinology faces particular challenges due to the complex interactions between cells in the hypothalamus, in the pituitary gland and in peripheral tissues. Within the hypothalamus alone, attempting to target a specific neuronal cell type can be problematic due to the heterogeneous nature and level of cellular diversity of hypothalamic nuclei. Because of the inherent complexity of the reproductive axis, the use of animal models and in vivo experiments are often a prerequisite in reproductive neuroendocrinology. The advent of targeted genetic modifications, particularly in mice, has opened new avenues of neuroendocrine research. Within this review, we evaluate various mouse models used in reproductive neuroendocrinology and discuss the different approaches to generate genetically modified mice, along with their inherent advantages and disadvantages. We also discuss a variety of versatile genetic tools with a focus on their potential use in reproductive neuroendocrinology.

  3. Targeting fragile X

    OpenAIRE

    Gantois, Ilse; Kooy, R. Frank

    2002-01-01

    Ten years after the identification of the gene responsible for fragile X syndrome, recent studies have revealed a list of mRNAs bound by the fragile X gene product and have identified specific sequences required for the interaction between the fragile X protein and its targets. These results are a breakthrough in understanding why absence of the fragile X protein leads to mental retardation.

  4. Follicular penetration and targeting.

    Science.gov (United States)

    Lademann, Jürgen; Otberg, Nina; Jacobi, Ute; Hoffman, Robert M; Blume-Peytavi, Ulrike

    2005-12-01

    In the past, intercellular penetration was assumed to be the most important penetration pathway of topically applied substances. First hints that follicular penetration needs to be taken into consideration were confirmed by recent investigations, presented during the workshop "Follicular Penetration and Targeting" at the 4th Intercontinental Meeting of Hair Research Societies", in Berlin 2004. Hair follicles represent an efficient reservoir for the penetration of topically applied substances with subsequent targeting of distinct cell populations, e.g., nestin-expressing follicular bulge cells. The volume of this reservoir can be determined by differential stripping technology. The follicular penetration processes are significantly influenced by the state of the follicular infundibulum; recent experimental investigations could demonstrate that it is essential to distinguish between open and closed hair follicles. Topically applied substances can only penetrate into open hair follicle. Knowledge of follicular penetration is of high clinical relevance for functional targeting of distinct follicular regions. Human hair follicles show a hair-cycle-dependent variation of the dense neuronal and vascular network. Moreover, during hair follicle cycling with initiation of anagen, newly formed vessels occur. Thus, the potential of nestin-expressing hair follicle stem cells to form neurons and blood vessels was investigated.

  5. Inflation targeting and core inflation

    OpenAIRE

    Julie Smith

    2005-01-01

    This paper examines the interaction of core inflation and inflation targeting as a monetary policy regime. Interest in core inflation has grown because of inflation targeting. Core inflation is defined in numerous ways giving rise to many potential measures; this paper defines core inflation as the best forecaster of inflation. A cross-country study finds before the start of inflation targeting, but not after, core inflation differs between non-inflation targeters and inflation targeters. Thr...

  6. Association between Exposure to Benzodiazepines and Related Drugs and Survivorship of Total Hip Replacement in Arthritis: A Population-Based Cohort Study of 246,940 Patients.

    Directory of Open Access Journals (Sweden)

    Dan Beziz

    Full Text Available Total hip replacement (THR is successful in treating hip arthritis. Prosthetic survivorship may depend on the medications taken by the patient; particularly, the role of benzodiazepines and related drugs (Z-drugs with THR revision has been poorly investigated. Our objective was to compare THR short-term survivorship according to level of exposure to benzodiazepine and Z-drugs.All French patients aged 40 years or older, having undergone primary THR from January 1, 2009, through December 31, 2012, for arthritis according to French national health insurance databases were included in the cohort. Outcome of interest was THR revision, including any surgical procedure in which the implant or any component was changed or removed. Follow-up started the day the primary THR was performed. Observations were right-censored on December 31, 2014, if neither revision nor death had yet occurred. Exposure of interest was the cumulative defined daily doses per day (cDDD/day of benzodiazepines and Z-drugs dispensed within 6 months before or after inclusion. We defined four exposure groups; cDDD/d = 0: unexposed; 0.38: high exposure. THR survivorship was assessed according to level of exposure to benzodiazepines and Z-drugs in univariate and multivariate Cox models adjusted for patient, THR and implanting center characteristics.The study cohort comprised 246,940 individuals: mean age at baseline, 69.9 years; women, 57.9%; unexposed: 51.7%; low exposure: 16.7%; medium exposure: 15.9%; and high exposure: 15.7%. During the median 45-month follow-up, 9043 individuals underwent prosthetic revision. Adjusted hazard ratios in low, medium and high exposed groups were 1.18 (95%CI, 1.12-1.26; P<0.001, 1.32 (95%CI, 1.24-1.40; P<0.001 and 1.37 (95%CI, 1.29-1.45; P<0.001, respectively, compared to unexposed.Exposure to benzodiazepines and Z-drugs is associated with an increased risk of THR revision, with a dose-response relationship. Cautious prescribing might be needed as well

  7. Association between Exposure to Benzodiazepines and Related Drugs and Survivorship of Total Hip Replacement in Arthritis: A Population-Based Cohort Study of 246,940 Patients

    Science.gov (United States)

    Beziz, Dan; Colas, Sandrine; Collin, Cédric; Dray-Spira, Rosemary; Zureik, Mahmoud

    2016-01-01

    Background Total hip replacement (THR) is successful in treating hip arthritis. Prosthetic survivorship may depend on the medications taken by the patient; particularly, the role of benzodiazepines and related drugs (Z-drugs) with THR revision has been poorly investigated. Our objective was to compare THR short-term survivorship according to level of exposure to benzodiazepine and Z-drugs. Design, Setting and Participants All French patients aged 40 years or older, having undergone primary THR from January 1, 2009, through December 31, 2012, for arthritis according to French national health insurance databases were included in the cohort. Outcome of interest was THR revision, including any surgical procedure in which the implant or any component was changed or removed. Follow-up started the day the primary THR was performed. Observations were right-censored on December 31, 2014, if neither revision nor death had yet occurred. Exposure of interest was the cumulative defined daily doses per day (cDDD/day) of benzodiazepines and Z-drugs dispensed within 6 months before or after inclusion. We defined four exposure groups; cDDD/d = 0: unexposed; 0.38: high exposure. THR survivorship was assessed according to level of exposure to benzodiazepines and Z-drugs in univariate and multivariate Cox models adjusted for patient, THR and implanting center characteristics. Results The study cohort comprised 246,940 individuals: mean age at baseline, 69.9 years; women, 57.9%; unexposed: 51.7%; low exposure: 16.7%; medium exposure: 15.9%; and high exposure: 15.7%. During the median 45-month follow-up, 9043 individuals underwent prosthetic revision. Adjusted hazard ratios in low, medium and high exposed groups were 1.18 (95%CI, 1.12–1.26; P<0.001), 1.32 (95%CI, 1.24–1.40; P<0.001) and 1.37 (95%CI, 1.29–1.45; P<0.001), respectively, compared to unexposed. Conclusion and Relevance Exposure to benzodiazepines and Z-drugs is associated with an increased risk of THR revision, with a

  8. Luminescence properties and crystal structure of europium complexes with phenoxyacetic acid and 2,4,6-tri(2-pyridyl)-s-triazine

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ai-Ling; Zhou, Dan; Wei, Xiao-Yan; Wang, Zhong-Xia; Qu, Yan-Rong; Zhang, Hai-Xia; Chen, Ying-Nan; Li, Jing-Jing; Chu, Hai-Bin, E-mail: binghai99@gmail.com; Zhao, Yong-Liang, E-mail: hxzhaoyl@163.com

    2015-04-15

    Using anion ligand phenoxyacetic acid (HPOA) and neutral ligand 2,4,6-tri(2-pyridyl)-s-triazine (TPTZ), two complexes Eu{sub 2}(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O and EuY(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O have been synthesized and one crystal EuY(TPTZ){sub 2}(POA){sub 6}·2CH{sub 3}OH has been obtained. These complexes are characterized by elemental analysis, ICP-AES, IR and UV absorption spectroscopy. The luminescence spectra, luminescence lifetimes and emission quantum efficiencies of the complexes have been studied. The results show that the complex EuY(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O exhibits stronger luminescence intensity, longer luminescent lifetime and higher emission quantum efficiency than Eu{sub 2}(TPTZ){sub 2}(POA){sub 6}·6H{sub 2}O. The single-crystal X-ray diffraction of EuY(TPTZ){sub 2}(POA){sub 6}·2CH{sub 3}OH reveals that the crystal is heteronuclear and crystallizes in the triclinic space group P-1 with following unit cell parameters a=12.2411(10) Å, b=13.2294(11) Å, c=13.5232(11) Å, α=74.8596(13)°, β=82.9593(16)°, γ=87.1641(14)°, and V=2097.7(3) Å{sup 3}. Each metal ion coordinates with three nitrogen atoms of one TPTZ and seven oxygen atoms of three POA{sup −} ions. And there exist two coordination forms between POA{sup −} and metal ions in the crystal. One is chelating bidentate, the other is the single-atom bridge. - Highlights: • One Eu/Y heteronuclear crystal and two complexes with HPOA and TPTZ were prepared. • Each metal ion in the crystal coordinates with three nitrogen and seven oxygen atoms. • The two complexes exhibit strong luminescence emissions. • The heteronuclear complex shows better luminescent properties than the homonuclear one. • The structure of the crystal and the sensitization mechanism are deeply discussed.

  9. Targeted therapy for sarcomas

    Directory of Open Access Journals (Sweden)

    Forscher C

    2014-03-01

    Full Text Available Charles Forscher,1 Monica Mita,2 Robert Figlin3 1Sarcoma Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 2Experimental Therapeutics Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 3Academic Development Program, Samuel Oschin Comprehensive Cancer Institute, and Division of Hematology/Oncology, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: Sarcomas are tumors of mesenchymal origin that make up approximately 1% of human cancers. They may arise as primary tumors in either bone or soft tissue, with approximately 11,280 soft tissue tumors and 2,650 bone tumors diagnosed each year in the United States. There are at least 50 different subtypes of soft tissue sarcoma, with new ones described with ever-increasing frequency. One way to look at sarcomas is to divide them into categories on the basis of their genetic make-up. One group of sarcomas has an identifiable, relatively simple genetic signature, such as the X:18 translocation seen in synovial sarcoma or the 11:22 translocation seen in Ewing's sarcoma. These specific abnormalities often lead to the presence of fusion proteins, such as EWS-FLI1 in Ewing's sarcoma, which are helpful as diagnostic tools and may become therapeutic targets in the future. Another group of sarcomas is characterized by complex genetic abnormalities as seen in leiomyosarcoma, osteosarcoma, and undifferentiated sarcoma. It is important to keep these distinctions in mind when contemplating the development of targeted agents for sarcomas. Different abnormalities in sarcoma could be divided by tumor subtype or by the molecular or pathway abnormality. However, some existing drugs or drugs in development may interfere with or alter more than one of the presented pathways. Keywords: sarcoma, targeted agents, tyrosine kinase inhibitors, mTor inhibition

  10. Crystal structures of 2-[(4,6-di­amino­pyrimidin-2-yl)sulfan­yl]-N-(3-nitro­phen­yl)acetamide monohydrate and N-(2-chloro­phen­yl)-2-[(4,6-di­amino­pyrimidin-2-yl)sulfan­yl]acetamide

    Science.gov (United States)

    Subasri, S.; Timiri, Ajay Kumar; Barji, Nayan Sinha; Jayaprakash, Venkatesan; Vijayan, Viswanathan; Velmurugan, Devadasan

    2016-01-01

    The title compounds, C12H12N6O3S·H2O, (I), and C12H12ClN5OS, (II), are 2-[(4,6-di­amino­pyrimidin-2-yl)sulfan­yl]acetamides. Compound (I) crystallized as a monohydrate. In both compounds, the mol­ecules have a folded conformation, with the pyrimidine ring being inclined to the benzene ring by 56.18 (6)° in (I) and by 67.84 (6)° in (II). In both mol­ecules, there is an intra­molecular N—H⋯N hydrogen bond stabilizing the folded conformation. In (I), there is also a C—H⋯O intra­molecular short contact, and in (II) an intra­molecular N—H⋯Cl hydrogen bond is present. In the crystal of (I), mol­ecules are linked by a series of N—H⋯O, O—H⋯O and O—H⋯N hydrogen bonds, forming undulating sheets parallel to the (100). The sheets are linked via an N—H⋯Owater hydrogen bond, forming a three-dimensional network. In the crystal of (II), mol­ecules are linked by a series of N—H⋯O, N—H⋯N and C—H⋯O hydrogen bonds, forming slabs parallel to (001). PMID:27536406

  11. Crystal structures of 2-[(4,6-di-amino-pyrimidin-2-yl)sulfan-yl]-N-(3-nitro-phen-yl)acetamide monohydrate and N-(2-chloro-phen-yl)-2-[(4,6-di-amino-pyrimidin-2-yl)sulfan-yl]acetamide.

    Science.gov (United States)

    Subasri, S; Timiri, Ajay Kumar; Barji, Nayan Sinha; Jayaprakash, Venkatesan; Vijayan, Viswanathan; Velmurugan, Devadasan

    2016-08-01

    The title compounds, C12H12N6O3S·H2O, (I), and C12H12ClN5OS, (II), are 2-[(4,6-di-amino-pyrimidin-2-yl)sulfan-yl]acetamides. Compound (I) crystallized as a monohydrate. In both compounds, the mol-ecules have a folded conformation, with the pyrimidine ring being inclined to the benzene ring by 56.18 (6)° in (I) and by 67.84 (6)° in (II). In both mol-ecules, there is an intra-molecular N-H⋯N hydrogen bond stabilizing the folded conformation. In (I), there is also a C-H⋯O intra-molecular short contact, and in (II) an intra-molecular N-H⋯Cl hydrogen bond is present. In the crystal of (I), mol-ecules are linked by a series of N-H⋯O, O-H⋯O and O-H⋯N hydrogen bonds, forming undulating sheets parallel to the (100). The sheets are linked via an N-H⋯Owater hydrogen bond, forming a three-dimensional network. In the crystal of (II), mol-ecules are linked by a series of N-H⋯O, N-H⋯N and C-H⋯O hydrogen bonds, forming slabs parallel to (001).

  12. Low intensity beam target unit

    CERN Multimedia

    1976-01-01

    This is a wheel fitted with many targets around its periphery (each with three longitudinally arranged thin rods) of which one is placed into the beam via a rotation of the wheel. Upstream of each target is placed a luminescent screen, aligbed on each target axis and viewed with a TV camera, to make sure that one is hitting the target. This target unit was probably used to study target's behaviour (like beam heating). Gualtiero Del Torre stands on the left, Pierre Gerdil on the right.

  13. Target hepatic artery regional chemotherapy and bevacizumab perfusion in liver metastatic colorectal cancer after failure of first-line or second-line systemic chemotherapy.

    Science.gov (United States)

    Chen, Hui; Zhang, Ji; Cao, Guang; Liu, Peng; Xu, Haifeng; Wang, Xiaodong; Zhu, Xu; Gao, Song; Guo, Jianhai; Zhu, Linzhong; Zhang, Pengjun

    2016-02-01

    Colorectal cancer liver metastasis (CRLM) is a refractory disease after failure of first-line or second-line chemotherapy. Bevacizumab is recommended as first-line therapy for advanced colorectal cancer, but is unproven in CRLM through the hepatic artery. We report favorable outcomes with targeted vessel regional chemotherapy (TVRC) for liver metastatic gastric cancer. TVRC with FOLFOX and bevacizumab perfusion through the hepatic artery was attempted for CRLM for efficacy and safety evaluation. In a single-institution retrospective observational study, 246 patients with CRLM after at least first-line or second-line failure of systemic chemotherapy received TVRC with FOLFOX (i.e. oxaliplatin, leucovorin, and 5-fluorouracil). Of 246 patients, 63 were enrolled into two groups: group 1 (n=30) received bevacizumab and TVRC following tumor progression during previous TVRC treatments; group 2 (n=33) received TVRC plus bevacizumab for CRLM on initiating TVRC. There were no significant differences in the median survival time (14.7 vs. 13.2 months, P=0.367), although the median time to progression was significant (3.3 vs. 5.5 months, P=0.026) between groups. No severe adverse events related to TVRC plus bevacizumab perfusion occurred. Target vessel regional chemotherapy with FOLFOX plus bevacizumab perfusion through the hepatic artery was effective and safe in CRLM. The optimal combination of TVRC and bevacizumab needs further confirmation in future phase II-III clinical trials.

  14. Target Housing Material Options

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    With gas cooling, heat transfer coefficients are low compared to water. The benefit of gas from a heat transfer point of view is that there is really no upper temperature limit for the coolant, as compared to water, which is limited ultimately by the critical point, and in practice the critical heat flux. In our case with parallel flow channels, water is limited to even lower operating limits by nucleate boiling. So gas can get as hot as the containment material will allow, but to get the density and heat transfer up to something reasonable, we must also increase pressure, thus increasing stress on the containment, namely the front and back faces. We are designing to ASME BPVC, which, for most materials allows a maximum stress of UTS/3. So we want the highest possible UTS. For reference, the front face stress in the 12 mm target at 300 psi was about 90 MPa. The inconel 718 allowable stress at 900°C is 1/3 of 517 or 172 MPa. So we are in a very safe place, but the uTS is dropping rapidly with temperature above 900°C. As we increase target diameter, the challenge will be to keep the stress down. We are probably looking at keeping the allowable at or above the present value, and at as high a temperature as possible.

  15. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1511, LB4517_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1511, LB4517_V)' providing data from direct measurement of low-pressure thermodynamic speed of sound at variable mole fraction and constant temperature, in the single-phase region(s).

  16. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1212, LB4519_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1212, LB4519_V)' providing data by calculation of molar excess volume from low-pressure density measurements at variable mole fraction and constant temperature.

  17. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1111, LB4518_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C6H12O3 2,4,6-Trimethyl-1,3,5-trioxane (VMSD1111, LB4518_V)' providing data from direct low-pressure measurement of mass density at variable mole fraction and constant temperature, in the single-phase region(s).

  18. (E-N-[2-(9-Fluorenylidene-3a,5,7-trimethyl-3,3a-dihydro-2H-indol-3-ylidene]-2,4,6-trimethylaniline

    Directory of Open Access Journals (Sweden)

    Norihiro Tokitoh

    2008-02-01

    Full Text Available The title compound, C33H30N2, has an E configuration at the imine double bond. The angle between the least-squares planes of the imine C=N—C group and the benzene ring of the 2,4,6-trimethylphenyl substituent is 85.38 (11°. The crystal structure is sustained mainly by intermolecular π–π interactions (3.510 Å between the two fluorene rings and some C—H...π interactions.

  19. Synthesis of 1,3–bis(2,4,6–trimethylphenyl)–imidazolinium salts : SIMes.HCl, SIMes.HBr, SIMes.HBF4 and SIMes.HPF6.

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Arnaud Gautier, Federico Cisnetti, Silvia Díez-González & Clémentine Gibard ### Abstract N,N’–bis–(2,4,6–trimethylphenylamino)ethane dihydrobromide is obtained in a single step through the dialkylation of dibromoethane. It serves as a versatile starting material for the synthesis of imidazolium salts: SIMes.HBr, SIMes.HCl, SIMes.HPF6 and SIMes.HBF4. ### Introduction Azolium salts have become indispensable starting materials in N–heterocyclic carbene (NHC) chem...

  20. Synthesis of a new tripodal chemosensor based on 2,4,6-triethyl-1,3,5-trimethylbencene scaffolding bearing thiourea and fluorescein for the chromo-fluorogenic detection of anions

    OpenAIRE

    Moragues Pons, María Esperanza; Santos Figueroa, Luis Enrique; Abalos Aguado, Tatiana; Sancenón Galarza, Félix; Martínez Mañez, Ramón

    2012-01-01

    A tripodal receptor containing thiourea as binding site and fluorescein as signalling subunit has been designed, synthesized and used for the colorimetric detection of basic anions in DMSO solutions. (C) 2012 Elsevier Ltd. All rights reserved. Moragues Pons, ME.; Santos Figueroa, LE.; Abalos Aguado, T.; Sancenón Galarza, F.; Martínez Mañez, R. (2012). Synthesis of a new tripodal chemosensor based on 2,4,6-triethyl-1,3,5-trimethylbencene scaffolding bearing thiourea and fluorescein for the ...

  1. Molecular interactions in (2,4,6-trimethyl-1,3,5-trioxane + n-alkyl acetates) at T = (298.15, 303.15, and 308.15) K

    Energy Technology Data Exchange (ETDEWEB)

    Wankhede, N.N. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India); Wankhede, D.S. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India); Lande, M.K. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India); Arbad, B.R. [Department of Chemistry, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India)]. E-mail: nil_w@rediffmail.com

    2006-12-15

    Densities and viscosities of the binary mixtures of 2,4,6-trimethyl-1,3,5-trioxane with methyl acetate, ethyl acetate, and 1-butyl acetate were measured over the entire mole fractions at (298.15, 303.15, and 308.15) K. Using the experimental values of densities {rho} and viscosities {eta}, excess molar volumes V {sup E}, viscosity deviations {delta}{eta} were calculated. The values of excess molar volumes V {sup E} and viscosity deviations {delta}{eta} were fitted to the Redlich-Kister polynomial.

  2. A Note on Inflation Targeting.

    Science.gov (United States)

    Lai, Ching-chong; Chang, Juin-jen

    2001-01-01

    Presents a pedagogical graphical exposition to illustrate the stabilizing effect of price target zones. Finds that authorities' commitment to defend a price target zone affects the public's inflation expectations and, in turn, reduces actual inflation. (RLH)

  3. Some Issues in Inflation Targeting

    OpenAIRE

    Andrew Haldane

    1997-01-01

    This paper discusses some of the operational issues relevant to the implementation of an inflation-targeting regime. In particular it focuses on: whether inflation targeting is 'new'; whether (and how) the forward-looking nature of inflation-targeting helps to prevent instabilities in inflation; whether inflation-targeting potentially destabilises output; and whether it requires too much knowledge on the part of the authorities. The paper argues that none of these propositions is in general c...

  4. ORION laser target diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Bentley, C. D.; Edwards, R. D.; Andrew, J. E.; James, S. F.; Gardner, M. D.; Comley, A. J.; Vaughan, K.; Horsfield, C. J.; Rubery, M. S.; Rothman, S. D.; Daykin, S.; Masoero, S. J.; Palmer, J. B.; Meadowcroft, A. L.; Williams, B. M.; Gumbrell, E. T.; Fyrth, J. D.; Brown, C. R. D.; Hill, M. P.; Oades, K. [Plasma Physics Department, Atomic Weapons Establishment, Aldermaston, Reading, Berkshire RG7 4PR (United Kingdom); and others

    2012-10-15

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  5. Electromagnetic targeting of guns

    Energy Technology Data Exchange (ETDEWEB)

    Pogue, E.W.; Boat, R.M.; Holden, D.N.; Lopez, J.R. [and others

    1996-10-01

    This is the final report of a one-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). Electromagnetic pulse (EMP) signals produced from explosives being fired have been reported in the literature for fifty years. When a gun is fired it produces an EMP muzzle blast signal. The strength and nature of these signals was first analyzed in the early 1970s, while the results were interesting, no follow-up studies were conducted. With modern detection and signal processing technology, we believe that these signals could be used to instantaneously locate guns of virtually all calibers as they fire. The objective of our one-year project was to establish the basic nature of these signals and their utility in the concept of electromagnetic targeting of guns.

  6. ORION laser target diagnosticsa)

    Science.gov (United States)

    Bentley, C. D.; Edwards, R. D.; Andrew, J. E.; James, S. F.; Gardner, M. D.; Comley, A. J.; Vaughan, K.; Horsfield, C. J.; Rubery, M. S.; Rothman, S. D.; Daykin, S.; Masoero, S. J.; Palmer, J. B.; Meadowcroft, A. L.; Williams, B. M.; Gumbrell, E. T.; Fyrth, J. D.; Brown, C. R. D.; Hill, M. P.; Oades, K.; Wright, M. J.; Hood, B. A.; Kemshall, P.

    2012-10-01

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  7. ORION laser target diagnostics.

    Science.gov (United States)

    Bentley, C D; Edwards, R D; Andrew, J E; James, S F; Gardner, M D; Comley, A J; Vaughan, K; Horsfield, C J; Rubery, M S; Rothman, S D; Daykin, S; Masoero, S J; Palmer, J B; Meadowcroft, A L; Williams, B M; Gumbrell, E T; Fyrth, J D; Brown, C R D; Hill, M P; Oades, K; Wright, M J; Hood, B A; Kemshall, P

    2012-10-01

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics. PMID:23126904

  8. Targeting of Antibodies using Aptamers

    OpenAIRE

    Missailidis, Sotiris

    2003-01-01

    The chapter presents a methodology for the rapid selection of aptamers against antibody targets. It is a detailed account of the various methodological steps that describe the selection of aptamers, including PCR steps, buffers to be used, target immobilisation, partitioning and amplification of aptamers, clonning and sequencing, to results in high affinity and specificity ligands for the chosen target antibody.

  9. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza;

    2012-01-01

    rheumatologists who have recently formed a research network - the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using...

  10. Hypoxia targeting copper complexes

    International Nuclear Information System (INIS)

    The importance and incidence of tumour hypoxia, its measurement and current treatments available, including pharmacological and radiopharmacological methods of targeting hypoxia, are discussed. A variety of in vitro and in vivo methods for imposing hypoxia have been developed and are reviewed. Copper, its chemistry, biochemistry and radiochemistry, the potential for use of copper radionuclides and its use to date in this field is considered with particular reference to the thiosemicarbazones. Their biological activity, metal chelation, in vitro and in vivo studies of their radiocopper complexes and the potential for their use as hypoxia targeting radiopharmaceuticals is described. The reduction of the copper(II) complex to copper(l), its pivotal importance in their biological behaviour, and the potential for manipulation of this to effect hypoxia selectivity are described. An in vitro method for assessing the hypoxia selectivity of radiopharmaceuticals is reported. The rapid deoxygenation and high viability of a mammalian cell culture in this system is discussed and factors which may affect the cellular uptake of a radiopharmaceutical are described. The design, synthesis and complexation with copper and radiocopper of a range of bis(thiosemicarbazones) is reported. Synthesis of these compounds is simple giving high yields of pure products. The characteristics of the radiocopper complexes (64Cu) including lipophilicity and redox activity are reported (reduction potentials in the range -0.314 - -0.590 V). High cellular uptakes of the radiocopper complexes of the ligands, in hypoxic and normoxic EMT6 and CHO320 cells, were observed. Extremes of selectivity are shown ranging from the hypoxia selective 64Cu(II)ATSM to normoxic cell selective 64Cu(II)GTS. The selectivities observed are compared with the physico chemical characteristics of the complexes. A good correlation exists between selectivity of the complex and its Cu(II)/Cu(I) reduction potential, with hypoxia

  11. Hypoxia targeting copper complexes

    Energy Technology Data Exchange (ETDEWEB)

    Dearling, J.L

    1998-11-01

    The importance and incidence of tumour hypoxia, its measurement and current treatments available, including pharmacological and radiopharmacological methods of targeting hypoxia, are discussed. A variety of in vitro and in vivo methods for imposing hypoxia have been developed and are reviewed. Copper, its chemistry, biochemistry and radiochemistry, the potential for use of copper radionuclides and its use to date in this field is considered with particular reference to the thiosemicarbazones. Their biological activity, metal chelation, in vitro and in vivo studies of their radiocopper complexes and the potential for their use as hypoxia targeting radiopharmaceuticals is described. The reduction of the copper(II) complex to copper(l), its pivotal importance in their biological behaviour, and the potential for manipulation of this to effect hypoxia selectivity are described. An in vitro method for assessing the hypoxia selectivity of radiopharmaceuticals is reported. The rapid deoxygenation and high viability of a mammalian cell culture in this system is discussed and factors which may affect the cellular uptake of a radiopharmaceutical are described. The design, synthesis and complexation with copper and radiocopper of a range of bis(thiosemicarbazones) is reported. Synthesis of these compounds is simple giving high yields of pure products. The characteristics of the radiocopper complexes ({sup 64}Cu) including lipophilicity and redox activity are reported (reduction potentials in the range -0.314 - -0.590 V). High cellular uptakes of the radiocopper complexes of the ligands, in hypoxic and normoxic EMT6 and CHO320 cells, were observed. Extremes of selectivity are shown ranging from the hypoxia selective {sup 64}Cu(II)ATSM to normoxic cell selective {sup 64}Cu(II)GTS. The selectivities observed are compared with the physico chemical characteristics of the complexes. A good correlation exists between selectivity of the complex and its Cu(II)/Cu(I) reduction potential

  12. Preliminary Mark-18A (Mk-18A) Target Material Recovery Program Product Acceptance Criteria

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Sharon M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Patton, Bradley D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-09-01

    The U.S. Department of Energy (DOE) manages an inventory of materials that contains a range of long-lived radioactive isotopes that were produced from the 1960s through the 1980s by irradiating targets in production nuclear reactors at the Savannah River Site (SRS). One reactor was operated in a high-flux mode to produce heavy isotopes for defense purposes, DOE programmatic use, scientific research, and industrial and medical applications. In this reactor, eighty-six Mk-18A (Mk-18A) targets were subjected to long-term high neutron fluxes 47 years ago. Twentyone targets of these were processed to recover 244Pu, heavy curium (i.e., curium rich in 246-248Cm), and 252Cf. The plutonium fraction, which was rich in 244Pu, was electromagnetically enriched in the Oak Ridge National Laboratory (ORNL) calutrons to produce gram quantities of 244Pu. This high-purity 244Pu was portioned out to scientists for basic research and for nuclear nonproliferation safeguards programs. The recovered tails (designated as FP-33) contain 244Pu isotopic purities below 20% and are stored at ORNL. The processing of these 21 Mk-18A targets provided the supply of 244Pu and heavy curium in use today. The remaining 65 unprocessed targets are currently in a storage pool at SRS; they contain the world’s remaining supply of unseparated 244Pu and heavy curium.

  13. Magnetic targeted drug delivery

    Directory of Open Access Journals (Sweden)

    Timothy Wiedmann

    2009-10-01

    Full Text Available Lung cancer is the most common cause of death from cancer in both men and women. Treatment by intravenous or oral administration of chemotherapy agents results in serious and often treatment-limiting side effects. Delivery of drugs directly to the lung by inhalation of an aerosol holds the promise of achieving a higher concentration in the lung with lower blood levels. To further enhance the selective lung deposition, it may be possible to target deposition by using external magnetic fields to direct the delivery of drug coupled to magnetic particles. Moreover, alternating magnetic fields can be used to induce particle heating, which in turn controls the drug release rate with the appropriate thermal sensitive material.With this goal, superparamagetic nanoparticles (SPNP were prepared and characterized, and enhanced magnetic deposition was demonstrated in vitro and in vivo. SPNPs were also incorporated into a lipid-based/SPNP aerosol formulation, and drug release was shown to be controlled by thermal activation. Because of the inherent imaging potential of SPNPs, this use of nanotechnology offers the possibility of coupling the diagnosis of lung cancer to drug release, which perhaps will ultimately provide the “magic bullet” that Paul Ehrlich originally sought.

  14. ICF target positioning robot system

    International Nuclear Information System (INIS)

    Based on the function analysis of target positioner for inertial confinement fusion, a kind of ICF target positioning robot system is designed to realize the adjustment and the alignment of a target. The robot system includes a target storage sub-system, a target exchange subsystem, a target transport subsystem and a 6-degree of freedom precision parallel robot subsystem, the structure and principle of every subsystem are dissertated. The system realizes micro scale position by parallel structure which is in the front of the system, and has the advantages of low mass, high stiffness, small cone angle, small volume and high precision. The robot system can position a target into a very small micro scale scope around the center of the target chamber whose diameter is several meters, the precision of the position reaches micro scale. Motion parameter of the positioning robot system has been tested. Experiment proves that the robot system has realized precision target position and target exchange on the condition of vacuum. (authors)

  15. Windowless target: Design of the XT-ADS spallation target

    International Nuclear Information System (INIS)

    The design of the XT-ADS spallation target is performed within the European integrated project EUROTRANS (FP6 Contract FI6W-516520) that has started in April 2005. At the current status of the spallation target design process, the boundary conditions for the spallation target loop with respect to the XT-ADS performance requirements and the design of the subcritical core and primary system have been established. The next steps will concentrate on further development of the spallation target nozzle, the vacuum and spallation product confinement system and the pumping, LIDAR (LIght Detection And Ranging) and cooling system

  16. Facility target insert shielding assessment

    Energy Technology Data Exchange (ETDEWEB)

    Mocko, Michal [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-06

    Main objective of this report is to assess the basic shielding requirements for the vertical target insert and retrieval port. We used the baseline design for the vertical target insert in our calculations. The insert sits in the 12”-diameter cylindrical shaft extending from the service alley in the top floor of the facility all the way down to the target location. The target retrieval mechanism is a long rod with the target assembly attached and running the entire length of the vertical shaft. The insert also houses the helium cooling supply and return lines each with 2” diameter. In the present study we focused on calculating the neutron and photon dose rate fields on top of the target insert/retrieval mechanism in the service alley. Additionally, we studied a few prototypical configurations of the shielding layers in the vertical insert as well as on the top.

  17. The OLYMPUS internal hydrogen target

    Energy Technology Data Exchange (ETDEWEB)

    Bernauer, J.C., E-mail: bernauer@mit.edu [Massachusetts Institute of Technology, Laboratory for Nuclear Science, Cambridge, MA 02139 (United States); Carassiti, V.; Ciullo, G. [Istituto Nazionale di Fisica Nucleare and Università, 44100 Ferrara (Italy); Henderson, B.S. [Massachusetts Institute of Technology, Laboratory for Nuclear Science, Cambridge, MA 02139 (United States); Ihloff, E.; Kelsey, J. [Massachusetts Institute of Technology, Laboratory for Nuclear Science, Cambridge, MA 02139 (United States); MIT-Bates Linear Accelerator Center, Middleton, MA 01949 (United States); Lenisa, P. [Istituto Nazionale di Fisica Nucleare and Università, 44100 Ferrara (Italy); Milner, R. [Massachusetts Institute of Technology, Laboratory for Nuclear Science, Cambridge, MA 02139 (United States); MIT-Bates Linear Accelerator Center, Middleton, MA 01949 (United States); Schmidt, A. [Massachusetts Institute of Technology, Laboratory for Nuclear Science, Cambridge, MA 02139 (United States); Statera, M. [Istituto Nazionale di Fisica Nucleare and Università, 44100 Ferrara (Italy)

    2014-08-01

    An internal hydrogen target system was developed for the OLYMPUS experiment at DESY, in Hamburg, Germany. The target consisted of a long, thin-walled, tubular cell within an aluminum scattering chamber. Hydrogen entered at the center of the cell and exited through the ends, where it was removed from the beamline by a multistage pumping system. A cryogenic coldhead cooled the target cell to counteract heating from the beam and increase the density of hydrogen in the target. A fixed collimator protected the cell from synchrotron radiation and the beam halo. A series of wakefield suppressors reduced heating from beam wakefields. The target system was installed within the DORIS storage ring and was successfully operated during the course of the OLYMPUS experiment in 2012. Information on the design, fabrication, and performance of the target system is reported.

  18. The OLYMPUS Internal Hydrogen Target

    CERN Document Server

    Bernauer, J C; Ciullo, G; Henderson, B S; Ihloff, E; Kelsey, J; Lenisa, P; Milner, R; Schmidt, A; Statera, M

    2014-01-01

    An internal hydrogen target system was developed for the OLYMPUS experiment at DESY, in Hamburg, Germany. The target consisted of a long, thin-walled, tubular cell within an aluminum scattering chamber. Hydrogen entered at the center of the cell and exited through the ends, where it was removed from the beamline by a multistage pumping system. A cryogenic coldhead cooled the target cell to counteract heating from the beam and increase the density of hydrogen in the target. A fixed collimator protected the cell from synchrotron radiation and the beam halo. A series of wakefield suppressors reduced heating from beam wakefields. The target system was installed within the DORIS storage ring and was successfully operated during the course of the OLYMPUS experiment in 2012. Information on the design, fabrication, and performance of the target system is reported.

  19. Oxide Fiber Targets at ISOLDE

    CERN Document Server

    Köster, U; Carminati, D; Catherall, R; Cederkäll, J; Correia, J G; Crepieux, B; Dietrich, M; Elder, K; Fedosseev, V; Fraile-Prieto, L M; Franchoo, S; Fynbo, H O U; Georg, U; Giles, T; Joinet, A; Jonsson, O C; Kirchner, R; Lau, C; Lettry, Jacques; Maier, H J; Mishin, V I; Oinonen, M; Peräjärvi, K; Ravn, H L; Rinaldi, T; Santana-Leitner, M; Wahl, U; Weissman, L

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxyde fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some contact points. The experience with various oxyde fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process or by burning commercial gas lantern mantle cloth. In the future a beryllia fiber target could be used to produce...

  20. SRNL Development of Recovery Processes for Mark-18A Heavy Actinide Targets

    Energy Technology Data Exchange (ETDEWEB)

    Allender, Jeffrey S. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Bridges, Nicholas J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Loftin, Bradley M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Dunsmuir, Michael D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-07-14

    Savannah River National Laboratory (SRNL) and Oak Ridge National Laboratory (ORNL) are developing plans for the recovery of rare and unique isotopes contained within heavy-actinide target assemblies, specifically the Mark-18A. Mark-18A assemblies were irradiated in Savannah River Site (SRS) reactors in the 1970s under extremely high neutron-flux conditions and produced, virtually, the world's supply of plutonium-244, an isotope of key importance to high-precision actinide measurement and other scientific and nonproliferation uses; and curium highly enriched in heavy isotopes (e.g., curium-246 and curium-248). In 2015 and 2016, SRNL is pursuing tasks that would reduce program risk and budget requirements, including further characterization of unprocessed targets; engineering studies for the use of the SRNL Shielded Cells Facility (SCF) for recovery; and development of onsite and offsite shipping methods including a replacement for the heavy (70 ton) cask previously used for onsite transfer of irradiated items at SRS. A status update is provided for the characterization, including modeling using the Monte Carlo N-Particle Transport Code (MCNP); direct non-destructive assay measurements; and cask design.

  1. Australian dietary targets in 1995: their feasibility and pertinence to dietary goals for 2000.

    Science.gov (United States)

    Jamison, J R

    1995-10-01

    To ascertain whether the diet of young students in health-related courses conformed to Australian dietary targets for 1995 and to identify nutritional needs in view of dietary targets for 2000, 246 undergraduate students analysed their weighed diet for three or five days. Eight of ten male participants were meeting the dietary goals for 1995 for fibre and fat intake and six of ten were meeting the goals for 2000. More female participants were meeting the goals for fat, but less than half of the female were meeting the 1995 goals for fibre. Some 84 per cent of females, but only 29 percent of males, were meeting the 1995 dietary goals for sodium. Few participants derived 10 per cent or less of their energy from saturated fat or 10 per cent of their energy from polyunsaturated fatty acids. Substantial numbers of participants failed to meet the recommended daily intakes of zinc. calcium, magnesium and iron (females). Education of specific subgroups and modifications to food production and processing are proposed.

  2. Targeting Nominal Income: A Note

    OpenAIRE

    Kenneth D. West

    1986-01-01

    This paper compares nominal income and monetary targets in a standard aggregate demand - aggregate supply framework. If the desirability of policies is measured by their effect on the unconditional variance of output, nominal income targeting is preferable if and only if the aggregate elasticity of demand for real balances is greater than one. This is precisely the opposite of the condition that in Bean (1984) is sufficient to make nominal income targeting preferable.This points out the impor...

  3. Nominal Income and Inflation Targeting

    OpenAIRE

    Arayssi, Mahmoud

    2014-01-01

    In this paper a macro- economic model in the area of monetary policy game theory is extended to one-sided dismissal rules concerning observed nominal output and inflation targets for the central banker. These rules specify firing the central banker if some observed policy targets have been exceeded. Such rules are shown to reduce inflationary bias if the central banker perceives her reappointment chances as being strong and is preferred to discretionary monetary policy. Various policy targets...

  4. Target properties and nuclear data

    International Nuclear Information System (INIS)

    The influence of the properties of the target on nuclear data was shown. In the case of targets consisting of fissionable material, this influence was demonstrated in experiments involving fission cross-section, average number of neutrons, and prompt fission neutron spectrum. The experimental methods for determining certain corrections were analysed. The method of tritium density determination for a solid target used as neutron source was likewise demonstrated. (author). 10 refs, 4 figs

  5. Learning About Intervention Target Zones

    OpenAIRE

    Klein, Michael W; Karen K. Lewis

    1991-01-01

    This paper provides a framework for evaluating how market participants' beliefs about foreign exchange target zones change as they learn about central bank intervention policy. In order to examine this behavior, we first generalize the standard target zone model to allow for intra-marginal intervention. Intra-marginal intervention implies that the position of market participants' beliefs about the target zone can be determined from their beliefs about the likelihood of intervention. As an app...

  6. Inertial-confinement-fusion targets

    International Nuclear Information System (INIS)

    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques have been devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented

  7. 'Inflation Targeting and Inflation Persistence'

    OpenAIRE

    George J. Bratsiotis; Jakob Madsen; Christopher Martin

    2015-01-01

    This paper argues that the adoption of an inflation target reduces the persistence of inflation. We develop the theoretical literature on inflation persistence by introducing a Taylor rule for monetary policy into a model of persistence and showing that inflation targets reduce inflation persistence. We investigate changes in the time series properties of inflation in seven countries that introduced inflation targets in the late 1980s or early 1990s. We find that the persistenc...

  8. Target support for inertial confinement fusion

    International Nuclear Information System (INIS)

    General Atomics (GA) plays an important industrial support role for the US Inertial Confinement Fusion (ICF) program in the area of target technology. This includes three major activities: target fabrication support, target handling systems development, and target chamber design. The work includes target fabrication for existing ICF experiments, target and target system development for future experiments, and target research and target chamber design for experiments on future machines, such as the National Ignition Facility (NIF)

  9. Data Mining for Target Marketing

    Science.gov (United States)

    Levin, Nissan; Zahavi, Jacob

    Targeting is the core of marketing management. It is concerned with offering the right product/service to the customer at the right time and using the proper channel. In this chapter we discuss how Data Mining modeling and analysis can support targeting applications. We focus on three types of targeting models: continuous-choice models, discrete-choice models and in-market timing models, discussing alternative modeling for each application and decision making. We also discuss a range of pitfalls that one needs to be aware of in implementing a data mining solution for a targeting problem.

  10. Targets and Secondary Beam Extraction

    Science.gov (United States)

    Noah, Etam

    2014-02-01

    Several applications make use of secondary beams of particles generated by the interaction of a primary beam of particles with a target. Spallation neutrons, bremsstrahlung photon-produced neutrons, radioactive ions and neutrinos are available to users at state-of-the-art facilities worldwide. Plans for even higher secondary beam intensities place severe constraints on the design of targets. This article reports on the main targetry challenges and highlights a variety of solutions for targetry and secondary beam extraction. Issues related to target station layout, instrumentation at the beam-target interface, safety and radioprotection are also discussed.

  11. Targeted Therapies for Kidney Cancer

    Science.gov (United States)

    ... for kidney cancer Targeted therapies for kidney cancer Biologic therapy (immunotherapy) for kidney cancer Chemotherapy for kidney cancer Pain control for kidney cancer Treatment choices by stage for ...

  12. Limits of Inflation Targeting Strategy

    Directory of Open Access Journals (Sweden)

    Aura Niculescu

    2006-03-01

    Full Text Available This paper evaluates the trade-off between output volatility and the variability of the inflation rate around its target (Romanian case. The optimal choice for National Bank of Romania (NBR, in our opinion, is the flexible inflation targeting. For this purpose, NBR must explain the loss function and the optimal monetary policy rule. We then argued that this Romanian authority – NBR – can substantially improve its credibility under inflation targeting policy regime by becoming more accountable and transparent. Is the direct inflation targeting the best choice for the monetary policy regime in Romanian economy?

  13. Inflation Targeting and Inflation Persistence

    Institute of Scientific and Technical Information of China (English)

    GEORGE; J.BRATSIOTIS; JAKOB; MADSEN; CHRISTOPHER; MARTIN

    2015-01-01

    This paper argues that the adoption of an inflation target reduces the persistence of inflation.We develop the theoretical literature on inflation persistence by introducing a Taylor Rule for monetary policy into a model of persistence and showing that inflation targets reduce inflation persistence.We investigate changes in the time series properties of inflation in seven countries that introduced inflation targets in the late 1980s or early 1990s.We find that the persistence of inflation is greatly reduced or eliminated following the introduction of inflation targets.

  14. Therapeutic Targeting of Telomerase

    Directory of Open Access Journals (Sweden)

    Kathrin Jäger

    2016-07-01

    Full Text Available Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT, which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination

  15. Therapeutic Targeting of Telomerase.

    Science.gov (United States)

    Jäger, Kathrin; Walter, Michael

    2016-01-01

    Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT), which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination methods, and

  16. Therapeutic Targeting of Telomerase

    Science.gov (United States)

    Jäger, Kathrin; Walter, Michael

    2016-01-01

    Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT), which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination methods, and

  17. Transverse target spin asymmetries on a proton target at COMPASS

    CERN Document Server

    Richter, Andreas

    2009-01-01

    Transversity and transverse momentum-dependent parton distribution functions (TMDs) are been measured in semi-inclusive deep inelastic scattering (SIDIS) by using a transversely polarized target at the COMPASS experiment. COMPASS is a fixed target experiment at the CERN M2 beamline, which provides a 160GeV/c polarized m+ beam. In the years 2002-2004 COMPASS has collected data with a transversely polarized deuteron 6LiD target. In 2007, COMPASS has used for the first time a proton NH3 target. To access transversity COMPASS has used three different quark polarimeters: the Collins effect, responsible for an azimuthal asymmetry in the single hadron distribution, azimuthal target spin asymmetries of charged hadron pairs and the transverse polarisation of L hyperons. Beside this also the Sivers asymmetry arising from the correlation between the transverse nucleon spin and the quark intrinsic transverse momentum was measured. European

  18. Associations Between Target Lesion Restenosis and Drug-Eluting Balloon Use: An Observational Study.

    Science.gov (United States)

    Lee, Wei-Chieh; Wu, Chiung-Jen; Chen, Yung-Lung; Chung, Wen-Jung; Hsueh, Shu-Kai; Hang, Chi-Ling; Fang, Chih-Yuan; Fang, Hsiu-Yu

    2016-01-01

    Percutaneous coronary interventions (PCIs) with drug-eluting balloons (DEBs) have emerged as an adjunctive treatment for in-stent restenosis (ISR) lesions. However, recurrent restenosis still occurs following DEB use. Our study aimed to identify the associations of target lesion restenosis following DEB use over a 1-year clinical follow-up.Between November 2011 and May 2014, 246 patients were diagnosed with coronary artery ISR in our hospital. A total of 335 coronary ISR lesions were treated with DEBs. The 1-year patent coronary artery group was defined as those with negative noninvasive examinations and no clinical symptoms, or those with no angiographic restenosis. The 1-year current restenosis group was defined as those with angiographic restenosis. Clinical results were compared between 2 groups. Univariate and multivariate cox regression analyses were performed to identify the associations of target lesion restenosis following DEB use.Patients' average age was 64.96 ± 10.68 years, and 77.2% were men. Non-ST segment elevation myocardial infarction was more frequent as the clinical presentation in the 1-year current restenosis group, whereas stable angina was more frequent in the 1-year patent coronary artery group. The 1-year current restenosis group exhibited higher percentages of comorbidities, including hypertension, diabetes, prior myocardial infarction, heart failure, prior coronary artery bypass grafting, and end-stage renal disease (ESRD). Regardless of ostial ISR or nonostial ISR, the results of drug-eluting stent ISR were worse than those for bare-metal stent ISR. Multivariate analysis revealed that ESRD, and coronary ostial lesion, and the severity of pre-PCI stenosis were independently associated with target lesion restenosis following DEB use (P = 0.020, P = 0.009, P = 0.026, respectively).ESRD, and coronary ostial lesion, and the severity of pre-PCI stenosis were independently associated with recurrent target lesion restenosis

  19. Nominal GDP: Target or Benchmark?

    OpenAIRE

    Hetzel, Robert L.

    2015-01-01

    Some observers have argued that the Federal Reserve would best fulfill its mandate by adopting a target for nominal gross domestic product (GDP). Insights from the monetarist tradition suggest that nominal GDP targeting could be destabilizing. However, adopting benchmarks for both nominal and real GDP could offer useful information about when monetary policy is too tight or too loose.

  20. Oxide fiber targets at ISOLDE

    DEFF Research Database (Denmark)

    Köster, U.; Bergmann, U.C.; Carminati, D.;

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxide fiber targets are less critical since they may maintain their open structure even when starting to fuse together at so...

  1. Dual targeting of peroxisomal proteins

    Directory of Open Access Journals (Sweden)

    Julia eAst

    2013-10-01

    Full Text Available Cellular compartmentalization into organelles serves to separate biological processes within the environment of a single cell. While some metabolic reactions are specific to a single organelle, others occur in more than one cellular compartment. Specific targeting of proteins to compartments inside of eukaryotic cells is mediated by defined sequence motifs. To achieve multiple targeting to different compartments cells use a variety of strategies. Here, we focus on mechanisms leading to dual targeting of peroxisomal proteins. In many instances, isoforms of peroxisomal proteins with distinct intracellular localization are encoded by separate genes. But also single genes can give rise to differentially localized proteins. Different isoforms can be generated by use of alternative transcriptional start sites, by differential splicing or ribosomal read-through of stop codons. In all these cases different peptide variants are produced, of which only one carries a peroxisomal targeting signal. Alternatively, peroxisomal proteins contain additional signals that compete for intracellular targeting. Dual localization of proteins residing in both the cytoplasm and in peroxisomes may also result from use of inefficient targeting signals. The recent observation that some bona fide cytoplasmic enzymes were also found in peroxisomes indicates that dual targeting of proteins to both the cytoplasm and the peroxisome might be more widespread. Although current knowledge of proteins exhibiting only partial peroxisomal targeting is far from being complete, we speculate that the metabolic capacity of peroxisomes might be larger than previously assumed.

  2. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Aletaha, Daniel; Bijlsma, Johannes W J;

    2010-01-01

    BACKGROUND: Aiming at therapeutic targets has reduced the risk of organ failure in many diseases such as diabetes or hypertension. Such targets have not been defined for rheumatoid arthritis (RA). OBJECTIVE: /st> To develop recommendations for achieving optimal therapeutic outcomes in RA. METHODS...

  3. High performance inertial fusion targets

    International Nuclear Information System (INIS)

    Inertial confinement fusion (ICF) target designs are considered which may have very high gains (approximately 1000) and low power requirements (< 100 TW) for input energies of approximately one megajoule. These include targets having very low density shells, ultra thin shells, central ignitors, magnetic insulation, and non-ablative acceleration

  4. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Breedveld, Ferdinand C; Burmester, Gerd R;

    2016-01-01

    BACKGROUND: Reaching the therapeutic target of remission or low-disease activity has improved outcomes in patients with rheumatoid arthritis (RA) significantly. The treat-to-target recommendations, formulated in 2010, have provided a basis for implementation of a strategic approach towards this t...

  5. ISOLDE target zone control room

    CERN Multimedia

    2016-01-01

    Operating the ISOLDE target handling robots from the dedicated control room in building 197. Monitors showing the movements of the robots (GPS in this case) in the target zone. The footage shows the actual operation by the operator as well as the different equipment such as camera electronics, camera motor controls, camera monitors and Kuka robot controls touch panel.

  6. Target-Searching on Percolation

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    We study target-searching processes on a percolation, on which a hunter tracks a target by smelling odors it emits. The odor intensity is supposed to be inversely proportional to the distance it propagates. The Monte Carlo simulation is performed on a 2-dimensional bond-percolation above the threshold. Having no idea of the location of the target, the hunter determines its moves only by random attempts in each direction. For lager percolation connectivity p (>~) 0.90, it reveals a scaling law for the searching time versus the distance to the position of the target. The scaling exponent is dependent on the sensitivity of the hunter. For smaller p, the scaling law is broken and the probability of finding out the target significantly reduces. The hunter seems trapped in the cluster of the percolation and can hardly reach the goal.

  7. Type of Cancer Treatment: Targeted Therapy

    Science.gov (United States)

    Information about the role that targeted therapies play in cancer treatment. Includes how targeted therapies work against cancer, who receives targeted therapies, common side effects, and what to expect when having targeted therapies.

  8. Bis[1,3-bis(2,4,6-trimethylphenyl-2,3-dihydro-1H-imidazol-2-ylidene]dinitrosyl(tetrahydroborato-κ2H,H′tungsten(0

    Directory of Open Access Journals (Sweden)

    Heinz Berke

    2011-01-01

    Full Text Available In the title paramagnetic 19-electron neutral complex, [W(BH4(C21H24N22(NO2], the W(0 atom is coordinated by two 1,3-bis(2,4,6-trimethylphenylimidazol-2-ylidene (IMes carbene ligands, two NO groups and two H atoms of an η2-tetrahydroborate ligand. Depending on the number of coordination sites (n assigned to the BH4− ligand, the coordination geometry of the W atom may either be described as approximately trigonal–bipyramidal (n = 1 or as very distorted octahedral with the bridging H atoms filling two coordination positions (n = 2. In the latter case, the coplanar NO groups and bridging H atoms (r.m.s. deviation = 0.032 Å form one octahedral plane, with mutually trans-oriented carbene ligands. In the crystal, molecules are connected via C—H...O interactions.

  9. Localization of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) in poplar and switchgrass plants using phosphor imager autoradiography

    International Nuclear Information System (INIS)

    Phosphor imager autoradiography is a technique for rapid, sensitive analysis of the localization of xenobiotics in plant tissues. Use of this technique is relatively new to research in the field of plant science, and the potential for enhancing visualization and understanding of plant uptake and transport of xenobiotics remains largely untapped. Phosphor imager autoradiography is used to investigate the uptake and translocation of the explosives 1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene within Populus deltoides x nigra DN34 (poplar) and Panicum vigratum Alamo (switchgrass). In both plant types, TNT and/or TNT-metabolites remain predominantly in root tissues while RDX and/or RDX-metabolites are readily translocated to leaf tissues. Phosphor imager autoradiography is further investigated for use in semi-quantitative analysis of uptake of TNT by switchgrass. - Phosphor imager autoradiography allows for rapid localization and quantification of RDX, TNT, and/or metabolites in plant tissues.

  10. Group separation of transplutonium and rare earth elements by liquid chromatography with free stationary phase using 2,4,6-tris[ditolylphosphoryl] - 1,3,5 - triazine as extractant

    International Nuclear Information System (INIS)

    Methods of group separation of trace amounts of transplutonium elements (TPE) and weight amounts of rare earth elements (REE) in the systems on the basis of bifunctional neutral organophosphoric compounds by the method of liquid chromatography with a free stationary phase have been developed. When solution of 2,4,6 - tris[ditolylphosphoryl] - 1,3,5 - triazine in chloroform was used as stationary phase, REE were the first to be washed out by 0.5 mol/l NH4SCN-1 mol/l HCl solution, then TPE - by 0.025 mol/l of oxyethylidenediphosphonic acid in water. the fractions contained about 100% of one of the groups without impurity of the other. 7 refs.; 6 figs

  11. Preparation of thin nuclear targets

    International Nuclear Information System (INIS)

    Thin film backings, sources and targets are needed for many applications in low energy nuclear physics and nuclear chemistry experiments. A survey of techniques used in the preparation of nuclear targets is first briefly discussed. These are classified as chemical, mechanical and physical preparations. Vacuum evaporation, being the most generally used technique, is discussed in detail. It is highly desirable to monitor the film thickness and control the deposition rate during evaporation and to measure the final target thickness after deposition has concluded. The relative merits of various thickness measuring techniques are described. Stages in the fabrication and mounting of self-supporting foils are described in detail, with emphasis given to the preparation of thin self-supporting carbon foils used as target backings and stripper foils. Various target backings, and the merits of the more generally used release agents are described in detail. The preparations of more difficult elemental targets are discussed, and a comprehensive list of the common targets is presented

  12. Tracking Target and Spiral Waves

    DEFF Research Database (Denmark)

    Jensen, Flemming G.; Sporring, Jon; Nielsen, Mads;

    2002-01-01

    A new algorithm for analyzing the evolution of patterns of spiral and target waves in large aspect ratio chemical systems is introduced. The algorithm does not depend on finding the spiral tip but locates the center of the pattern by a new concept, called the spiral focus, which is defined...... by the evolutes of the actual spiral or target wave. With the use of Gaussian smoothing, a robust method is developed that permits the identification of targets and spirals foci independently of the wave profile. Examples of an analysis of long image sequences from experiments with the Belousov...

  13. Targeted biopharmaceuticals for cancer treatment.

    Science.gov (United States)

    Zhou, Lufang; Xu, Ningning; Sun, Yan; Liu, Xiaoguang Margaret

    2014-10-01

    Cancer is a complex invasive genetic disease that causes significant mortality rate worldwide. Protein-based biopharmaceuticals have significantly extended the lives of millions of cancer patients. This article reviews the biological function and application of targeted anticancer biopharmaceuticals. We first discuss the specific antigens and core pathways that are used in the development of targeted cancer therapy. The innovative monoclonal antibodies, non-antibody proteins, and small molecules targeting these antigens or pathways are then reviewed. Finally, the current challenges in anticancer biopharmaceuticals development and the potential solutions to address these challenges are discussed.

  14. Targeted therapy: tailoring cancer treatment

    Institute of Scientific and Technical Information of China (English)

    Min Yan; Quentin Qiang Liu

    2013-01-01

    Targeted therapies include small-molecule inhibitors and monoclonal antibodies,have made treatment more tumor-specific and less toxic,and have opened new possibilities for tailoring cancer treatment.Nevertheless,there remain several challenges to targeted therapies,including molecular identification,drug resistance,and exploring reliable biomarkers.Here,we present several selected signaling pathways and molecular targets involved in human cancers including Aurora kinases,PI3K/mTOR signaling,FOXO-FOXM1 axis,and MDM2/MDM4-p53 interaction.Understanding the molecular mechanisms for tumorigenesis and development of drug resistance will provide new insights into drug discovery and design of therapeutic strategies for targeted therapies.

  15. Targeted therapy for pediatric glioma

    NARCIS (Netherlands)

    A.K. Olow

    2015-01-01

    This thesis assesses molecular underpinnings of responses to promising targeted agents for pediatric tumors of Central Nervous System (CNS), incorporating preclinical testing of novel and translatable combination therapies to define the best therapy for each tumor cell specific molecular aberration.

  16. Strategically targeting MYC in cancer

    Science.gov (United States)

    Posternak, Valeriya; Cole, Michael D.

    2016-01-01

    MYC is a major driver of cancer cell growth and mediates a transcriptional program spanning cell growth, the cell cycle, metabolism, and cell survival. Many efforts have been made to deliberately target MYC for cancer therapy. A variety of compounds have been generated to inhibit MYC function or stability, either directly or indirectly. The most direct inhibitors target the interaction between MYC and MAX, which is required for DNA binding. Unfortunately, these compounds do not have the desired pharmacokinetics and pharmacodynamics for in vivo application. Recent studies report the indirect inhibition of MYC through the development of two compounds, JQ1 and THZ1, which target factors involved in unique stages of transcription. These compounds appear to have significant therapeutic value for cancers with high levels of MYC, although some effects are MYC-independent. These approaches serve as a foundation for developing novel compounds to pharmacologically target MYC-driven cancers. PMID:27081479

  17. Cavitation in a Mercury Target

    Energy Technology Data Exchange (ETDEWEB)

    West, C.D.

    2000-09-01

    Recent theoretical work on the formation of bubble nucleation centers by energetic particles leads to some reasonably credible calculations of the maximum negative pressure that might be sustained without bubble formation in the mercury target of the Spallation Neutron Source.

  18. "Cavitation in a Mercury Target"

    Energy Technology Data Exchange (ETDEWEB)

    West, C.D.

    2000-09-06

    Recent theoretical work on the formation of bubble nucleation centers by energetic particles leads to some reasonably credible calculations of the maximum negative pressure that might be sustained without bubble formation in the mercury target of the Spallation Neutron Source.

  19. Physics of Automatic Target Recognition

    CERN Document Server

    Sadjadi, Firooz

    2007-01-01

    Physics of Automatic Target Recognition addresses the fundamental physical bases of sensing, and information extraction in the state-of-the art automatic target recognition field. It explores both passive and active multispectral sensing, polarimetric diversity, complex signature exploitation, sensor and processing adaptation, transformation of electromagnetic and acoustic waves in their interactions with targets, background clutter, transmission media, and sensing elements. The general inverse scattering, and advanced signal processing techniques and scientific evaluation methodologies being used in this multi disciplinary field will be part of this exposition. The issues of modeling of target signatures in various spectral modalities, LADAR, IR, SAR, high resolution radar, acoustic, seismic, visible, hyperspectral, in diverse geometric aspects will be addressed. The methods for signal processing and classification will cover concepts such as sensor adaptive and artificial neural networks, time reversal filt...

  20. Heavy flavors at fixed target

    International Nuclear Information System (INIS)

    The current situation of Heavy Flavor physics at fixed target experiments is reviewed. High statistics charm production and decay data are summarized and new results on beauty physics are presented. (author)

  1. IUCF liquid hydrogen target system

    International Nuclear Information System (INIS)

    A liquid hydrogen or deuterium target system is described for use with intermediate energy light ion beams at IUCF. In its present use as a production target for polarized neutrons, the target cell is mounted within the beamline. Thus, certain safety features are required which prevent a possible hydrogen explosion inside the beamline or the cyclotron. These safety devices include an acoustical delay line which slows the hydrogen gas shock wave and a fast valve which closes before any large volume of escaping gas reaches it. Other safety interlocks to reduce the chances of target cell breakage and to quickly shut off ignition sources are discussed. A device involving a variable heat load which is coupled directly to the cryocondenser and is used to continually monitor and stabilize the pressure and temperature of the liquid hydrogen is described here

  2. National Ignition Facility Target Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Wavrik, R W; Cox, J R; Fleming, P J

    2000-10-05

    On June 11, 1999 the Department of Energy dedicated the single largest piece of the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) in Livermore, California. The ten (10) meter diameter aluminum target high vacuum chamber will serve as the working end of the largest laser in the world. The output of 192 laser beams will converge at the precise center of the chamber. The laser beams will enter the chamber in two by two arrays to illuminate 10 millimeter long gold cylinders called hohlraums enclosing 2 millimeter capsule containing deuterium, tritium and isotopes of hydrogen. The two isotopes will fuse, thereby creating temperatures and pressures resembling those found only inside stars and in detonated nuclear weapons, but on a minute scale. The NIF Project will serve as an essential facility to insure safety and reliability of our nation's nuclear arsenal as well as demonstrating inertial fusion's contribution to creating electrical power. The paper will discuss the requirements that had to be addressed during the design, fabrication and testing of the target chamber. A team from Sandia National Laboratories (SNL) and LLNL with input from industry performed the configuration and basic design of the target chamber. The method of fabrication and construction of the aluminum target chamber was devised by Pitt-Des Moines, Inc. (PDM). PDM also participated in the design of the chamber in areas such as the Target Chamber Realignment and Adjustment System, which would allow realignment of the sphere laser beams in the event of earth settlement or movement from a seismic event. During the fabrication of the target chamber the sphericity tolerances had to be addressed for the individual plates. Procedures were developed for forming, edge preparation and welding of individual plates. Construction plans were developed to allow the field construction of the target chamber to occur parallel to other NIF construction activities. This

  3. Targeted immunotherapy in Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hutchings, Martin

    2015-01-01

    In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13.......In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13....

  4. Targeting cancer with peptide aptamers

    OpenAIRE

    Seigneuric, Renaud; Gobbo, Jessica; Colas, Pierre; Garrido, Carmen

    2011-01-01

    A major endeavour in cancer chemotherapy is to develop agents that specifically target a biomolecule of interest. There are two main classes of targeting agents: small molecules and biologics. Among biologics (e.g.: antibodies), DNA, RNA but also peptide aptamers are relatively recent agents. Peptide aptamers are seldom described but represent attractive agents that can inhibit a growing panel of oncotargets including Heat Shock Proteins. Potential pitfalls and coming challenges towards succe...

  5. Nanotechnology of emerging targeting systems.

    Science.gov (United States)

    Smith, S S

    2008-09-01

    Recent developments in the design and testing of complex nanoscale payload-carrying systems (i.e. systems with payloads that do not exceed 100 nm in size) are the focus of this brief review. Emerging systems include targeted single-walled nanotubes, viral capsids, dendrimers, gold nanoparticles, milled boron carbide nanoparticles, and protein nucleic acid assemblies. Significant advances are emerging with each of these bionanotechnological approaches to cellular targeting.

  6. Proactive Steering Toward Oriented Targets

    OpenAIRE

    Boulic, R

    2005-01-01

    In this paper we introduce a real-time steering controller ensuring the reach of a (possible mobile) target position and orientation, without requiring to build/update the full trajectory to that target. We name it the funnelling control. The final orientation is achieved through the continuous adjustment of the heading direction. This control mode is proactive in the sense that it anticipates the success/failure of the reach and adjusts the desired speed accordingly. Both features rely on an...

  7. Inflation Targeting in Latin America

    OpenAIRE

    Vittorio Corbo; Klaus Schmidt-Hebbel

    2002-01-01

    This paper analyzes Latin America’s recent experience with the use of inflation targeting (IT) while the region has made substantial progress toward eradicating high inflation. The paper assesses the implementation and results of inflation targeting in Latin America from a broad perspective. It starts by reviewing the issues relevant for the choice of exchange-rate regimes and monetary frameworks, documenting the evolution of exchange rate and monetary regimes in Latin America during the last...

  8. Symmetric solid target transport system

    OpenAIRE

    Tomov, D.; Lawrence, L; Gaehle, G.

    2015-01-01

    Introduction The expansion of our PET isotope production with a new TR-19 cyclotron necessitated a suitable solid target transport system. None of the known existing and proposed solid target transport systems (STTS) was able to meet the technical and budget requirements of the MIR cyclotron facility [5]. A unique carrier design allowed us to develop a fully automated 50.8 mm inner diameter pneumatic tube STTS with an in-hot-cell compact form factor receiving station. The cyclotron or v...

  9. Plug Off: Target Group Perception

    OpenAIRE

    Kortbaek, Allan; Neubauer, Nathalie; Carreras, Barbara

    2012-01-01

    This project is a study of how a sample of defined target group of a campaign, build meaning through their introduction to such a campaign. With ethno-methodology as a focal point within the overlying context of discourse psychology and more importantly, social constructivism, the aim is to analyze how a defined target group make sense of a proto awareness raising campaign. Proto in this case denotes a planned communication effort in the form of a campaign encouraging responsible use of wirel...

  10. A Theory of Child Targeting

    OpenAIRE

    Donni, Olivier; Bargain, Olivier

    2007-01-01

    There is a large empirical literature on policy measures targeted at children but surprisingly very little theoretical foundation to ground the debate on the optimality of the different instruments. In the present paper, we examine the merit of targeting children through two general policies, namely selective commodity taxation and cash transfer to family with children. We consider a household that comprises an adult and a child. The household behavior is described by the ma...

  11. Ion stopping in heated targets

    International Nuclear Information System (INIS)

    Ion stopping departs from classical, cold material values as the target material heats to appreciable ionization levels. The authors are investigating this phenomenon experimentally on the Proto I accelerator with a radial, Applied-B field ion diode. When the beam is focused to 0.5 TW/cm3 on thin aluminum foil targets the time-resolved departure from cold stopping is clear. Their observations and early interpretations will be presented. 9 references, 9 figures

  12. Polarized atomic beams for targets

    International Nuclear Information System (INIS)

    The basic principle of the production of polarized atomic hydrogen and deuterium beams are reviewed. The status of the present available polarization, density and intensity are presented. The improvement of atomic beam density by cooling the hydrogen atoms to low velocity is discussed. The possible use of polarized atomic beams as targets in storage rings is shown. It is proposed that polarized atomic beams can be used to produce polarized gas targets with high polarization and greatly improved density

  13. Nanotechnology of emerging targeting systems

    Science.gov (United States)

    SMITH, S. S.

    2011-01-01

    Recent developments in the design and testing of complex nanoscale payload-carrying systems (i.e. systems with payloads that do not exceed 100 nm in size) are the focus of this brief review. Emerging systems include targeted single-walled nanotubes, viral capsids, dendrimers, gold nanoparticles, milled boron carbide nanoparticles, and protein nucleic acid assemblies. Significant advances are emerging with each of these bionanotechnological approaches to cellular targeting. PMID:21687833

  14. Oxide fiber targets at ISOLDE

    Energy Technology Data Exchange (ETDEWEB)

    Koester, U. E-mail: ulli.koster@cern.ch; Bergmann, U.C.; Carminati, D.; Catherall, R.; Cederkaell, J.; Correia, J.G.; Crepieux, B.; Dietrich, M.; Elder, K.; Fedoseyev, V.N.; Fraile, L.; Franchoo, S.; Fynbo, H.; Georg, U.; Giles, T.; Joinet, A.; Jonsson, O.C.; Kirchner, R.; Lau, Ch.; Lettry, J.; Maier, H.J.; Mishin, V.I.; Oinonen, M.; Peraejaervi, K.; Ravn, H.L.; Rinaldi, T.; Santana-Leitner, M.; Wahl, U.; Weissman, L

    2003-05-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxide fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some contact points. The experience with various oxide fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process or by burning commercial gas lantern mantle cloth. In the future a beryllia fiber target could be used to produce very intense {sup 6}He beams (order of 10{sup 13} ions per second) via the {sup 9}Be(n,{alpha}) reaction using spallation neutrons.

  15. Unification of automatic target tracking and automatic target recognition

    Science.gov (United States)

    Schachter, Bruce J.

    2014-06-01

    The subject being addressed is how an automatic target tracker (ATT) and an automatic target recognizer (ATR) can be fused together so tightly and so well that their distinctiveness becomes lost in the merger. This has historically not been the case outside of biology and a few academic papers. The biological model of ATT∪ATR arises from dynamic patterns of activity distributed across many neural circuits and structures (including retina). The information that the brain receives from the eyes is "old news" at the time that it receives it. The eyes and brain forecast a tracked object's future position, rather than relying on received retinal position. Anticipation of the next moment - building up a consistent perception - is accomplished under difficult conditions: motion (eyes, head, body, scene background, target) and processing limitations (neural noise, delays, eye jitter, distractions). Not only does the human vision system surmount these problems, but it has innate mechanisms to exploit motion in support of target detection and classification. Biological vision doesn't normally operate on snapshots. Feature extraction, detection and recognition are spatiotemporal. When vision is viewed as a spatiotemporal process, target detection, recognition, tracking, event detection and activity recognition, do not seem as distinct as they are in current ATT and ATR designs. They appear as similar mechanism taking place at varying time scales. A framework is provided for unifying ATT and ATR.

  16. 阻燃剂三嗪三苯基次膦酸叔丁酯的合成及应用%Synthesis and Application of Flame Retardant 2-4-6-three(O-tertiary butyl-phenyl phosphinic acyl)-1,3,5-triazine

    Institute of Scientific and Technical Information of China (English)

    李果; 胡新利; 王彦林

    2015-01-01

    A novel flame retardant,2,4,6-three(O-tertiary butyl-phenyl phosphinic acyl)-1,3,5-triazine was synthesized from cyanuric chloride and phenyl phosphonic acid two tert-butyl ester. Effects of reaction time,reaction temperature,phenyl phosphonic acid two tert-butyl ester dropping speed and material proportion on yield of product were investigated. The product reached 90.6%under the optimal conditions of r(phenyl phosphonic acid two tert-butyl ester)∶r(cyanuric chloride)=3.4,dropping phenyl phosphonic acid two tert-butyl ester at twice,then keeping the reaction going at 100℃for 5 h. The target compound was characterized by means of FTIR,1H NMR,TG–DTA analysis and limiting oxygen index technique. The results show that the product have the high flame retardance,good compatibility with PE and have high fire retardance when mix with MCA and MPP.%以三聚氯氰和苯基次膦酸二叔丁酯为原料,合成新型阻燃剂三嗪三苯基次膦酸叔丁酯2,4,6-三(O-叔丁基–苯基次膦酰基)-1,3,5-三嗪化合物。讨论了反应时间、反应温度、原料配比等对合成反应的影响。其最佳反应条件为:三聚氯氰与苯基次膦酸二叔丁酯的物质的量之比为1∶3.4,分两次滴加苯基次膦酸二叔丁酯,在100℃反应5 h,收率为90.6%。采用傅里叶变换红外光谱、核磁共振、差热分析及极限氧指数等表征了产品的结构及阻燃应用性能。研究表明,该化合物对PE阻燃效能高,相容性好,且与MCA,MPP复配有很好的协同阻燃效果。

  17. Integrin Targeted Delivery of Chemotherapeutics

    Directory of Open Access Journals (Sweden)

    Kai Chen, Xiaoyuan Chen

    2011-01-01

    Full Text Available Targeted delivery of chemotherapeutics is defined in the sense, that is, to maximize the therapeutic index of a chemotherapeutic agent by strictly localizing its pharmacological activity to the site or tissue of action. Integrins are a family of heterodimeric transmembrane glycoproteins involved in a wide range of cell-to-extracellular matrix (ECM and cell-to-cell interactions. As cell surface receptors, integrins readily interact with extracellular ligands and play a vital role in angiogenesis, leukocytes function and tumor development, which sets up integrins as an excellent target for chemotherapy treatment. The peptide ligands containing the arginine-glycine-aspartic acid (RGD, which displays a strong binding affinity and selectivity to integrins, particularly to integrin αvβ3, have been developed to conjugate with various conventional chemotherapeutic agents, such as small molecules, peptides and proteins, and nanoparticle-carried drugs for integtrin targeted therapeutic studies. This review highlights the recent advances in integrin targeted delivery of chemotherapeutic agents with emphasis on target of integrin αvβ3, and describes the considerations for the design of the diverse RGD peptide-chemotherapeutics conjugates and their major applications.

  18. CPHD filter derivation for extended targets

    CERN Document Server

    Orguner, Umut

    2010-01-01

    This document derives the CPHD filter for extended targets. Only the update step is derived here. Target generated measurements, false alarms and prior are all assumed to be independent identically distributed cluster processes. We also prove here that the derived CPHD filter for extended targets reduce to PHD filter for extended targets and CPHD filter for standard targets under suitable assumptions.

  19. The SPES direct UCx target

    Science.gov (United States)

    Andrighetto, A.; Antonucci, C.; Barbui, M.; Carturan, S.; Cervellera, F.; Cevolani, S.; Cinausero, M.; Colombo, P.; Dainelli, A.; di Bernardo, P.; Gramegna, F.; Maggioni, G.; Meneghetti, G.; Petrovich, C.; Piga, L.; Prete, G.; Rizzi, V.; Tonezzer, M.; Zafiropoulos, D.; Zanonato, P.

    2007-11-01

    A possible solution for a target system aimed at the production of exotic nuclei as a result of high energy fissions in 238U compounds has been analyzed. The proposed configuration is constituted by a primary proton beam (40 MeV, 0.2 mA) directly impinging on uranium carbide disks inserted within a cylindrical carbon box. This system has been conceived to obtain both a high number of neutron rich atoms (originated from about 1013 fissions/s) and a low power deposition in the target. In order to extract the fission fragments, the box has to be hold at 2000○C. The thermal analysis shows the capability of the thermal radiation to cool the disks with a reasonable margin below the material melting point. Moreover, the analyses of the thermo-mechanical behaviour and of the effusion times confirm the promising features of this target configuration.

  20. Target identification by image analysis.

    Science.gov (United States)

    Fetz, V; Prochnow, H; Brönstrup, M; Sasse, F

    2016-05-01

    Covering: 1997 to the end of 2015Each biologically active compound induces phenotypic changes in target cells that are characteristic for its mode of action. These phenotypic alterations can be directly observed under the microscope or made visible by labelling structural elements or selected proteins of the cells with dyes. A comparison of the cellular phenotype induced by a compound of interest with the phenotypes of reference compounds with known cellular targets allows predicting its mode of action. While this approach has been successfully applied to the characterization of natural products based on a visual inspection of images, recent studies used automated microscopy and analysis software to increase speed and to reduce subjective interpretation. In this review, we give a general outline of the workflow for manual and automated image analysis, and we highlight natural products whose bacterial and eucaryotic targets could be identified through such approaches. PMID:26777141

  1. Infrared Targeting System (IRTS) demonstration

    Science.gov (United States)

    Ohair, Mark A.; Eucker, Shelly S.; Eucker, Brad A.; Lewis, Tim

    1992-02-01

    The objective of the Infrared Targeting System (IRTS) is to successfully demonstrate the mission performance that can be achieved in manned air-to-ground targeting applications utilizing a synergistic combination of state of the art active/passive infrared sensor and automatic target recognizer (ATR) technologies. The IRTS program is centered around a demonstration FLIR/Laser Radar/ATR (FLASHER). The FLASHER consists of a dual field of view (2 x 2 degree and 6 x 6 degree) second generation FLIR pixel mapped to a CO2 laser radar, with a FLIR ATR processor, a laser radar ATR processor, and a sensor fusion ATR processor. Following construction and laboratory testing of the IRTS, the system will be installed on a test aircraft and demonstrated in flight against realistic tactical, strategic, and special operations scenarios.

  2. Ribosome Assembly as Antimicrobial Target.

    Science.gov (United States)

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  3. Target-Centric Network Modeling

    DEFF Research Database (Denmark)

    Mitchell, Dr. William L.; Clark, Dr. Robert M.

    In Target-Centric Network Modeling: Case Studies in Analyzing Complex Intelligence Issues, authors Robert Clark and William Mitchell take an entirely new approach to teaching intelligence analysis. Unlike any other book on the market, it offers case study scenarios using actual intelligence...... reporting formats, along with a tested process that facilitates the production of a wide range of analytical products for civilian, military, and hybrid intelligence environments. Readers will learn how to perform the specific actions of problem definition modeling, target network modeling......, and collaborative sharing in the process of creating a high-quality, actionable intelligence product. The case studies reflect the complexity of twenty-first century intelligence issues by dealing with multi-layered target networks that cut across political, economic, social, technological, and military issues...

  4. Targeted nanoparticles for colorectal cancer

    DEFF Research Database (Denmark)

    Cisterna, Bruno A.; Kamaly, Nazila; Choi, Won Il;

    2016-01-01

    Colorectal cancer (CRC) is highly prevalent worldwide, and despite notable progress in treatment still leads to significant morbidity and mortality. The use of nanoparticles as a drug delivery system has become one of the most promising strategies for cancer therapy. Targeted nanoparticles could...... take advantage of differentially expressed molecules on the surface of tumor cells, providing effective release of cytotoxic drugs. Several efforts have recently reported the use of diverse molecules as ligands on the surface of nanoparticles to interact with the tumor cells, enabling the effective...... delivery of antitumor agents. Here, we present recent advances in targeted nanoparticles against CRC and discuss the promising use of ligands and cellular targets in potential strategies for the treatment of CRCs....

  5. Cholinergic Targets in Lung Cancer.

    Science.gov (United States)

    Spindel, Eliot R

    2016-01-01

    Lung cancers express an autocrine cholinergic loop in which secreted acetylcholine can stimulate tumor growth through both nicotinic and muscarinic receptors. Because activation of mAChR and nAChR stimulates growth; tumor growth can be stimulated by both locally synthesized acetylcholine as well as acetylcholine from distal sources and from nicotine in the high percentage of lung cancer patients who are smokers. The stimulation of lung cancer growth by cholinergic agonists offers many potential new targets for lung cancer therapy. Cholinergic signaling can be targeted at the level of choline transport; acetylcholine synthesis, secretion and degradation; and nicotinic and muscarinic receptors. In addition, the newly describe family of ly-6 allosteric modulators of nicotinic signaling such as lynx1 and lynx2 offers yet another new approach to novel lung cancer therapeutics. Each of these targets has their potential advantages and disadvantages for the development of new lung cancer therapies which are discussed in this review. PMID:26818857

  6. Antibiotics that target protein synthesis.

    Science.gov (United States)

    McCoy, Lisa S; Xie, Yun; Tor, Yitzhak

    2011-01-01

    The key role of the bacterial ribosome makes it an important target for antibacterial agents. Indeed, a large number of clinically useful antibiotics target this complex translational ribonucleoprotein machinery. The majority of these compounds, mostly of natural origin, bind to one of the three key ribosomal sites: the decoding (or A-site) on the 30S, the peptidyl transferase center (PTC) on the 50S, and the peptide exit tunnel on the 50S. Antibiotics that bind the A-site, such as the aminoglycosides, interfere with codon recognition and translocation. Peptide bond formation is inhibited when small molecules like oxazolidinones bind at the PTC. Finally, macrolides tend to block the growth of the amino acid chain at the peptide exit tunnel. In this article, the major classes of antibiotics that target the bacterial ribosome are discussed and classified according to their respective target. Notably, most antibiotics solely interact with the RNA components of the bacterial ribosome. The surge seen in the appearance of resistant bacteria has not been met by a parallel development of effective and broad-spectrum new antibiotics, as evident by the introduction of only two novel classes of antibiotics, the oxazolidinones and lipopeptides, in the past decades. Nevertheless, this significant health threat has revitalized the search for new antibacterial agents and novel targets. High resolution structural data of many ribosome-bound antibiotics provide unprecedented insight into their molecular contacts and mode of action and inspire the design and synthesis of new candidate drugs that target this fascinating molecular machine. PMID:21957007

  7. Prediction of underwater target strength

    Institute of Scientific and Technical Information of China (English)

    WANG TongQing; Mohammad Amjad

    2001-01-01

    A model as well as its numerical method to calculate target strength of rigid body using Lighthill's acoustic analogy approach which developed from the propeller aircraft sound field study have been presented. The cases of ellipsoid target has been used to demonstrate the approach. The comparison of the numerical results with that of analytical formulation provides a satisfactory check for the validity of the approach. Some reasonable results have been discussed. The advantage of the present model is that it is suitable for any arbitrarily shaped rigid body moving with small Mach number.

  8. Dynamics of aerial target pursuit

    Science.gov (United States)

    Pal, S.

    2015-12-01

    During pursuit and predation, aerial species engage in multitasking behavior that involve simultaneous target detection, tracking, decision-making, approach and capture. The mobility of the pursuer and the target in a three dimensional environment during predation makes the capture task highly complex. Many researchers have studied and analyzed prey capture dynamics in different aerial species such as insects and bats. This article focuses on reviewing the capture strategies adopted by these species while relying on different sensory variables (vision and acoustics) for navigation. In conclusion, the neural basis of these capture strategies and some applications of these strategies in bio-inspired navigation and control of engineered systems are discussed.

  9. Radar Target Modelling Based on RCS Measurements

    OpenAIRE

    Wessling, Andreas

    2002-01-01

    When simulating target seekers, there is a great need for computationally efficient, target models. This report considers a study of radar target modelling based on Inverse Synthetic Aperture Radar (ISAR) measurements of generic aircraft. The results underlie future modelling of full-size air targets. A method is developed for two-dimensional modelling of aspect-dependent target scattering. The approach taken is to generate point-scatterer models of two targets, where each point scatterer is...

  10. Inflation Targeting at 20 - Achievements and Challenges

    OpenAIRE

    Scott Roger

    2009-01-01

    This paper provides an overview of inflation targeting frameworks and macroeconomic performance under inflation targeting. Inflation targeting frameworks are generally quite similar across countries, and a broad consensus has developed in favor of "flexible" inflation targeting. The evidence shows that, although inflation target ranges are missed frequently in most countries, the inflation and growth performance under inflation targeting compares very favorably with performance under alternat...

  11. USING OPTIMAL FEEDBACK CONTROL FOR CHAOS TARGETING

    Institute of Scientific and Technical Information of China (English)

    PENG ZHAO-WANG; ZHONG TING-XIU

    2000-01-01

    Since the conventional open-loop optimal targeting of chaos is very sensitive to noise, a close-loop optimal targeting method is proposed to improve the targeting performance under noise. The present optimal targeting model takes into consideration both precision and speed of the targeting procedure. The parameters, rather than the output, of the targeting controller, are directly optimized to obtain optimal chaos targeting. Analysis regarding the mechanism is given from physics aspect and numerical experiment on the Hénon map is carried out to compare the targeting performance under noise between the close-loop and the open-loop methods.

  12. Exploring targeted therapies in oncology

    NARCIS (Netherlands)

    Mom, Constantijne Helene

    2007-01-01

    Targeted therapy in oncology is treatment directed at specific biological pathways and processes that play a critical role in carcinogenesis. Increased knowledge regarding the molecular changes underlying tumor progression and metastatis has resulted in the development of agents that are designed to

  13. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  14. Target selection for direct marketing.

    NARCIS (Netherlands)

    Bult, Jan Roelf

    1993-01-01

    In this thesis we concentrated on the use ol direct mail for targeting potential buyers. The major characteristics that influences the success of a plomotional direct mail campaign are the of-fbr,the communication elements, the timing or sequence of these communication elements, and the list of cus

  15. Target-point formation control

    NARCIS (Netherlands)

    Mou, Shaoshuai; Cao, Ming; Morse, A. Stephen

    2015-01-01

    In this paper a new distributed feedback strategy is proposed for controlling a rigid, acyclic formation of kinematic point-modeled mobile autonomous agents in the plane. The strategy makes use of a new concept called a "target point" and is applicable to any two-dimensional, acyclic formation whose

  16. Toward targeted hypertension screening guidelines

    NARCIS (Netherlands)

    van Buuren, S; Boshuizen, HC; Reijneveld, SA

    2006-01-01

    Background. guidelines for screening and subsequent treatment of hypertension vary widely between countries. Part Of this variation can be attributed to systematic differences between Populations, but little is known about the way in which guidelines should be targeted to the population of interest.

  17. Uranium briquettes for irradiation target

    Energy Technology Data Exchange (ETDEWEB)

    Saliba-Silva, Adonis Marcelo; Garcia, Rafael Henrique Lazzari; Martins, Ilson Carlos; Carvalho, Elita Fontenele Urano de; Durazzo, Michelangelo, E-mail: saliba@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Direct irradiation on targets inside nuclear research or multiple purpose reactors is a common route to produce {sup 99}Mo-{sup 99m}Tc radioisotopes. Nevertheless, since the imposed limits to use LEU uranium to prevent nuclear armament production, the amount of uranium loaded in target meats has physically increased and new processes have been proposed for production. Routes using metallic uranium thin film and UAl{sub x} dispersion have been used for this purpose. Both routes have their own issues, either by bringing difficulties to disassemble the aluminum case inside hot cells or by generating great amount of alkaline radioactive liquid rejects. A potential route might be the dispersion of powders of LEU metallic uranium and nickel, which are pressed as a blend inside a die and followed by pulse electroplating of nickel. The electroplating provides more strength to the briquettes and creates a barrier for gas evolution during neutronic disintegration of {sup 235}U. A target briquette platted with nickel encapsulated in an aluminum case to be irradiated may be an alternative possibility to replace other proposed targets. This work uses pulse Ni-electroplating over iron powder briquette to simulate the covering of uranium by nickel. The following parameters were applied 10 times for each sample: 900Hz, -0.84A/square centimeters with duty cycle of 0.1 in Watts Bath. It also presented the optical microscopy analysis of plated microstructure section. (author)

  18. Cooling of the ISIS target

    International Nuclear Information System (INIS)

    The paper describes the methods used to analyse and predict cooling of the uranium target of the ISIS facility at the Rutherford Appleton Laboratory by means of a combination of computer models (using the PHOENICS finite difference package) and practical tests. (author)

  19. The Automatic Measurement of Targets

    DEFF Research Database (Denmark)

    Höhle, Joachim

    1997-01-01

    The automatic measurement of targets is demonstrated by means of a theoretical example and by an interactive measuring program for real imagery from a réseau camera. The used strategy is a combination of two methods: the maximum correlation coefficient and the correlation in the subpixel range...

  20. CERN neutrino project on target

    CERN Multimedia

    2005-01-01

    Scientists at CERN announced the completion of the target assembly for the CERN neutrinos to Gran Sasso project, CNGS. On schedule for start-up in May 2006, CNGS will send a beam of neutrinos through the Earth to the Gran Sasso laboratory 730 km away in Italy in a bid to unravel the mysteries of nature's most elusive particles (½ page)

  1. High power neutron production targets

    Energy Technology Data Exchange (ETDEWEB)

    Wender, S. [Los Alamos National Lab., NM (United States)

    1996-06-01

    The author describes issues of concern in the design of targets and associated systems for high power neutron production facilities. The facilities include uses for neutron scattering, accelerator driven transmutation, accelerator production of tritium, short pulse spallation sources, and long pulse spallation sources. Each of these applications requires a source with different design needs and consequently different implementation in practise.

  2. Targeted therapy using alpha emitters

    Science.gov (United States)

    Vaidyanathan, Ganesan; Zalutsky, Michael R.

    1996-10-01

    Radionuclides such as and which decay by the emission of -particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of and -particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the -particles emitted by radionuclides such as and , -particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with - and -labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of -emitting radiopharmaceuticals is meta-[]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by []thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[]iodobenzylguanidine. For meta-[]astatobenzylguanidine, the value was equivalent to only atoms bound per cell. These results suggest that meta-[]astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  3. Particle physics using nuclear targets

    International Nuclear Information System (INIS)

    The use of nuclear targets in particle physics is discussed and some recent results obtained in studies of hadronic interactions on nuclei summarized. In particular experimental findings on inclusive production and on coherent dissociation of mesons and baryons at high energies are presented. 41 references

  4. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio;

    2003-01-01

    autonomous star tracker the Advanced Stellar Compass (ASC). One feature of this instrument is that potential targets are registered directly in terms of date, right ascension, declination, and intensity, which greatly facilitates both tracking search and registering. Results from ground and inflight tests...... are encouraging, both with respect to robustness, speed and accuracy, and demonstrates the span and range of applications of this technology....

  5. Multi beam laser target illumination

    International Nuclear Information System (INIS)

    In order to compress matter to high densities by the application of intense pulses of laser energy it is necessary for the implosion of the target to be both stable and spherical. This imposes certain constraints on the uniformity of illumination of the target, and, this in turn places requirements on the illuminating optics and the laser beam quality. This report discusses the uniformity of illumination of a spherical target as provided by a variety of optical systems and for different numbers of laser beams and beam profiles. The results are compared with similar conclusions obtained by other workers. An alternative presentation of the calculations is given which is believed to be a more realistic estimate of the uniformity. Comments are made on the approximations that have been assumed and the results likely to be obtained from the full treatment are discussed. The effects of this non-uniform illumination on the target implosion are considered using the linear theory of the Rayleigh-Taylor instability. Finally, comments are made on other factors of a more practical nature which also govern the final choice of illumination system and the scope of experiments made possible by such a system. (author)

  6. Targeted Therapies in Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Selen Dogan

    2014-04-01

    Full Text Available Endometrial cancer is the most common genital cancer in developed world. It is generally diagnosed in early stage and it has a favorable prognosis. However, advanced staged disease and recurrences are difficult to manage. There are some common genetic alterations related to endometrial carcinogenesis in similar fashion to other cancers. Personalized medicine, which means selection of best suited treatment for an individual, has gain attention in clinical care of patients in recent years. Targeted therapies were developed as a part of personalized or %u201Ctailored%u201D medicine and specifically acts on a target or biologic pathway. There are quite a number of molecular alteration points in endometrial cancer such as PTEN tumor suppressor genes, DNA mismatch repair genes, PI3K/AKT/mTOR pathway and p53 oncogene which all might be potential candidates for tailored targeted therapy. In recent years targeted therapies has clinical application in ovarian cancer patients and in near future with the advent of new agents these %u201Ctailored%u201D drugs will be in market for routine clinical practice in endometrial cancer patients, in primary disease and recurrences as well.

  7. Targeted multi-pinhole SPECT

    NARCIS (Netherlands)

    Branderhorst, W.; Vastenhouw, B.; Van der Have, F.; Blezer, E.L.A.; Bleeker, W.K.; Beekman, F.J.

    2010-01-01

    Purpose: Small-animal single photon emission computed tomography (SPECT) with focused multi-pinhole collimation geometries allows scanning modes in which large amounts of photons can be collected from specific volumes of interest. Here we present new tools that improve targeted imaging of specific o

  8. Particle physics using nuclear targets

    Energy Technology Data Exchange (ETDEWEB)

    Ferbel, T.

    1978-01-01

    The use of nuclear targets in particle physics is discussed and some recent results obtained in studies of hadronic interactions on nuclei summarized. In particular experimental findings on inclusive production and on coherent dissociation of mesons and baryons at high energies are presented. 41 references.

  9. Polarized Sources, Targets and Polarimetry

    Science.gov (United States)

    Ciullo, Guiseppe; Contalbrigo, Marco; Lenisa, P.

    2011-01-01

    Remarks on the history of workshops on "spin tools" / E. Steffens -- Polarized proton beams in RHIC / A. Zelenski -- The COSY/Julich polarized H[symbol] and D[symbol] ion source / O. Felden -- The new source of polarized ions for the JINR accelerator complex / V. V. Fimushkin -- Resonance effects in nuclear dichroism - an inexpensive source of tensor-polarized deuterons / H. Seyfarth -- Polarized electrons and positrons at the MESA accelerator / K. Aulenbacher -- Status report of the Darmstadt polarized electron injector / Y. Poltoratska -- The Mott polarimeter at MAMI / V. Tioukine -- Proton polarimetry at the relativistic heavy ion collider / Y. Makdisi -- Polarisation and polarimetry at HERA / B. Sobloher -- Polarisation measurement at the ILC with a Compton polarimeter / C. Bartels -- Time evolution of ground motion-dependent depolarisation at linear colliders / A. Hartin -- Electron beam polarimetry at low energies and its applications / R. Barday -- Polarized solid targets: recent progress and future prospects / C. D. Keith -- HD gas distillation and analysis for HD frozen spin targets / A. D'Angelo -- Electron spin resonance study of hydrogen and alkyl free radicals trapped in solid hydrogen aimed for dynamic nuclear polarization of solid HD / T. Kumada -- Change of ultrafast nuclear-spin polarization upon photoionization by a short laser pulse / T. Nakajima -- Radiation damage and recovery in polarized [symbol]NH[symbol] ammonia targets at Jefferson lab / J. D. Maxwell.Polarized solid proton target in low magnetic field and at high temperature / T. Uesaka -- Pulse structure dependence of the proton spin polarization rate / T. Kawahara -- Proton NMR in the large COMPASS [symbol]NH[symbol] target / J. Koivuniemi -- DNP with TEMPO and trityl radicals in deuterated polystyrene / L. Wang -- The CLIC electron and positron polarized sources / L. Rinolfi -- Status of high intensity polarized electron gun at MIT-Bates / E. Tsentalovich -- Target section for spin

  10. One-pot, solvent-free, and efficient synthesis of 2,4,6-triarylpyridines using CoCl2.6H2O as a recyclable catalyst

    Directory of Open Access Journals (Sweden)

    Mahmood Kamali

    2016-12-01

    Full Text Available A one-pot, three components coupling of aryl aldehyde, acetophenone, and ammonium acetate was performed to afford the corresponding 2,4,6-triarylpyridines (TAP1–17. The TAP1–17 were synthesized in the presence of cobalt(II chloride hexahydrate (CoCl2.6H2O via an improved Chichibabin pyridine synthesis protocol. This study has shown that CoCl2.6H2O promotes this reaction in comparison to other transition metal salt such as with FeCl3, NiCl2.6H2O, CuCl2.2H2O, CdCl2.H2O, SbCl3, SnCl2.2H2O, and ZnCl2. This method has several advantages, for example, excellent yields, short reaction times, easy work up, and solvent-free condition. Also, this catalyst was recyclable for four consecutive runs.

  11. Ultrafast shock compression and shock-induced decomposition of 1,3,5-triamino-2,4,6-trinitrobenzene subjected to a subnanosecond-duration shock: an analysis of decomposition products.

    Science.gov (United States)

    Carter, Jeffrey A; Zaug, Joseph M; Nelson, A J; Armstrong, Michael R; Manaa, M Riad

    2012-05-24

    Shock compression studies of pressed and confined ultrafine 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) powder were conducted using ultrashort ~300 ps, ~50 GPa shock waves. The recovered decomposition products were characterized using X-ray photoelectron spectroscopy, infrared spectroscopy, and Raman spectroscopy. A substantial amount of shock-related chemistry was observed. Approximately 75% of the nitrogen atoms were liberated as gas-phase species, along with ~33% of the oxygen atoms, as a result of the applied shock. Furthermore, we observe C 1s binding energies suggesting the formation of sp(3) hybridized amorphous carbon. For comparison, a carbon nitride material was also prepared and characterized by thermally pyrolizing TATB. The shock-compressed TATB and the thermally pyrolized TATB are qualitatively different, suggesting that, carbon nitrides, a possible indicator of nitrogen-rich heterocycles precursors, are not a major product class for strongly overdriven shock conditions. These experimental conditions were, however, not detonation conditions, and the possible formation of nitrogen-rich heterocycles in actual detonations still exists. PMID:22554068

  12. NCX-1015, a nitric-oxide derivative of prednisolone, enhances regulatory T cells in the lamina propria and protects against 2,4,6-trinitrobenzene sulfonic acid-induced colitis in mice

    Science.gov (United States)

    Fiorucci, Stefano; Antonelli, Elisabetta; Distrutti, Eleonora; Del Soldato, Piero; Flower, Roderick J.; Clark, Mark J. Paul; Morelli, Antonio; Perretti, Mauro; Ignarro, Louis J.

    2002-01-01

    NCX-1015 is a nitric oxide (NO)-releasing derivative of prednisolone. In this study we show NCX-1015 protects mice against the S. A. development and induces healing of T helper cell type 1-mediated experimental colitis induced by intrarectal administration of 2,4,6-trinitrobenzene sulfonic acid (TNBS). The beneficial effect of NCX-1015 was reflected in increased survival rates, improvement of macroscopic and histologic scores, a decrease in the mucosal content of T helper cell type 1 cytokines (protein and mRNA), and diminished myeloperoxidase activity in the colon. In contrast to its NO derivative, only very high doses of prednisolone were effective in reproducing these beneficial effects. NCX-1015 was 10- to 20-fold more potent than the parent compound in inhibiting IFN-γ secretion by lamina propria mononuclear cells. Protection against developing colitis correlated with inhibition of nuclear translocation of p65/Rel A in these cells. In vivo treatment with NCX-1015 potently stimulated IL-10 production, suggesting that the NO steroid induces a regulatory subset of T cells that negatively modulates intestinal inflammation. PMID:12427966

  13. Simultaneous determination of three alternative flame retardants (dechlorane plus, 1,2-bis(2,4,6-tribromophenoxy) ethane, and decabromodiphenyl ethane) in soils by gas chromatography-high resolution mass spectrometry.

    Science.gov (United States)

    Xu, Pengjun; Tao, Bu; Ye, Zhiqiang; Qi, Li; Ren, Yue; Zhou, Zhiguang; Li, Nan; Huang, Yeru; Chen, Jiping

    2015-11-01

    A gas chromatography-high resolution mass spectrometry (GC-HRMS) method has been developed for the simultaneous determination of three alternative flame retardants, dechlorane plus (DP), 1,2-bis(2,4,6-tribromophenoxy) ethane (BTBPE), and decabromodiphenyl ethane (DBDPE) in soils. The soil samples were extracted by accelerated solvent extraction, followed by purification with concentrated sulfuric acid partitioning combined with acid-base silica gel column separation. The gas chromatography featured with a thermostable capillary column of short length and a thin stationary phase was operated in pulse injection mode. A double-focusing magnetic sector high resolution mass spectrometer with electron impact ionization was used for quantification of the analytes. The method detection limits were 0.27-0.33 pg for DPs, 0.41 pg for BTBPE, and 36 pg for DBDPE. The mean recoveries for DPs, BTBPE, and DBDPE in spiked soils were 88-107%, 78-97%, and 74-113%, respectively, with relative standard deviations ranging from 5.2% to 18%. The recoveries of (13)C-labeled standards for DPs, BTBPE, and DBDPE in soil samples were 45-110%, 67-118%, and 27-82%, respectively. These results met the acceptable range of labeled standards for analysis of polybrominated diphenyl ethers as specified by the USEPA 1614 method. PMID:26452921

  14. Synthesis, crystal structure, antibacterial activity and theoretical studies on a novel mononuclear cobalt(II) complex based on 2,4,6-tris(2-pyridyl)-1,3,5-triazine ligand

    Science.gov (United States)

    Maghami, Mahboobeh; Farzaneh, Faezeh; Simpson, Jim; Ghiasi, Mina; Azarkish, Mohammad

    2015-08-01

    A cobalt complex was prepared from CoCl2·6H2O and 2,4,6-tris(2-pyridyl)-1,3,5-triazine (tptz) in methanol and designated as [Co(tptz)(CH3OH)Cl2]·CH3OH·0.5H2O (1). It was characterized by several techniques including TGA analysis and FT-IR, UV-Vis and 1H NMR spectral studies. The crystal structure of 1 was determined by single-crystal X-ray diffraction. The Co(II) metal center in 1 is six coordinated with a distorted octahedral geometry. The tptz ligand is tridentate and coordinates to the cobalt through coplanar nitrogen atoms from the triazine and two pyridyl rings. Two chloride anions and a methanol molecule complete the inner coordination sphere of the metal ion. The optimized geometrical parameters obtained by DFT calculation are in good agreement with single XRD data. The in vitro antibacterial activity of various tptz complexes of Co(II), Ni(II), Cu(II), Mn(II) and Rh(III) were evaluated against Gram-positive (Bacillus subtilis, Staphylococcus aureus and Gram-negative (Escherichia coli and Pseudomonas aeruginosa) bacteria. Whereas all complexes exhibited good activity in comparison to standard antibacterial drugs, the inhibitory effects of complexes were found to be more than that of the parent ligand. Overall, the obtained results strongly suggest that the cobalt(II) complex is a suitable candidate for counteracting antibiotic resistant microorganisms.

  15. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides.

    Science.gov (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M

    2016-03-01

    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼15, ∼90, and ∼200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process. PMID:26907589

  16. Poly[[(1,10-phenanthroline{μ3-2,2′,2′′-[1,3,5-triazine-2,4,6-triyltris(sulfanediyl]triacetato}cadmium] 0.42-hydrate

    Directory of Open Access Journals (Sweden)

    Chun-Jing Chi

    2011-07-01

    Full Text Available The asymmetric unit of the title complex, {[Cd(C9H7N3O6S3(C12H8N2]·0.42H2O}n, contains a CdII atom, one doubly deprotonated 2,2′,2′′-[1,3,5-triazine-2,4,6-triyltris(sulfanediyl]triacetic acid ligand (HTTTA2−, a 1,10-phenanthroline (phen ligand and a fractionally occupied water molecule [site occupancy = 0.421 (15]. The CdII atom is six-coordinated within a distorted octahedral coordination geometry. Six coordination arises from four O atoms derived from three different HTTTA2− ligands, and two N atoms of the chelating phen molecule. The incompletely deprotonated triazine ligand adopts a μ3-η1:η1:η2 coordination mode, resulting in the formation of chains along the c axis based on Cd2O2 dimeric units. Adjacent chains are stacked through π–π stacking [3.533 (2 Å between phen and triazine rings] and C—H...O interactions, forming supramolecular sheets in the ab plane. Intra-and intermolecular O—H...O hydrogen bonds are also observed.

  17. One pot synthesis, molecular structure and spectroscopic studies (X-ray, IR, NMR, UV-Vis) of novel 2-(4,6-dimethoxy-1,3,5-triazin-2-yl) amino acid ester derivatives.

    Science.gov (United States)

    El-Faham, Ayman; Soliman, Saied M; Osman, Sameh M; Ghabbour, Hazem A; Siddiqui, Mohammed R H; Fun, Hoong-Kun; Albericio, Fernando

    2016-04-15

    Novel series of 2-(4,6-dimethoxy,1,3,5-triazin-2-yl) amino acid ester derivatives were synthesized using simple one pot method in methanol. The products were obtained in high yields and purities as observed from their spectral data, elemental analyses, GC-MS and X-ray crystallographic analysis. The B3LYP/6-311G(d,p) calculated molecular structures are well correlated with the geometrical parameters obtained from the X-ray analyses. The spectroscopic properties such as IR vibrational modes, NMR chemical shifts and UV-Vis electronic transitions were discussed both experimentally and theoretically. The IR vibrational frequencies showed good correlations with the experimental data (R(2)=0.9961-0.9995). The electronic spectra were assigned based on the TD-DFT results. Intense electronic transition band is calculated at 198.1 nm (f=0.1389), 204.2 nm (f=0.2053), 205.0 (f=0.1704) and 205.7 (0.2971) for compounds 6a-i, respectively. The molecular orbital energy levels contributed in the longest wavelength transition band were explained. For all compounds, the experimental wavelengths showed red shifts compared to the calculations due to the solvent effect. The NMR chemical shifts were calculated using GIAO method. The NBO analyses were performed to predict the stabilization energies due to the electron delocalization processes occur in the studied systems. PMID:26845586

  18. The inhibition effect of 2,4,6-tris (2-pyridyl)-1,3,5-triazine on corrosion of tin, indium and tin-indium alloys in hydrochloric acid solution

    International Nuclear Information System (INIS)

    The influence of 2,4,6-tris (2-pyridyl)-1,3,5-triazine (TPTZ) on the corrosion of tin, indium and tin-indium alloys in 0.5 M HCl solution at different temperatures was studied. Potentiodynamic cathodic polarization and extrapolation of cathodic and anodic Tafel lines techniques were used to obtained experimental data. In the case of tin, the percent inhibition efficiency (IE%) increases as both concentration of TPTZ and temperature are increased. The value of activation energy (Ea) is smaller in the presence of TPTZ than that in uninhibited solution, and decreases with increasing the concentration. However, the effect of TPTZ on indium and the investigated alloys exhibited similar behavior; so, the maximum inhibition efficiency is observed at lowest concentration (10-6 M) of TPTZ. Then, the value of inhibition efficiency starts to decrease gradually with increasing TPTZ concentration than that of 10-6 M. But at higher concentration (10-3 M) the corrosion current density (Icorr) is still lower than that in uninhibited solution. SEM photographs support that the higher inhibition efficiency is observed at 10-6 M of TPTZ. The plots of ln K versus 1/T in the presence of the TPTZ in the case of tin, the inhibitor showed linear behavior. The standard enthalpy, ΔHoads., entropy, ΔSoads. and free energy changes of adsorption ΔGoads. were evaluated using Frumkin adsorption isotherm.

  19. Nanodelivery System for Mitochondrial Targeting

    Science.gov (United States)

    Yoong, Sia Lee; Pastorin, Giorgia

    2014-02-01

    Mitochondria are indispensable in cellular functions such as energy production and death execution. They are emerging as intriguing therapeutic target as their dysregulation was found to be monumental in diseases such as neurodegenerative disease, obesity, and cancer etc. Despite tremendous interest being focused on therapeutically intervening mitochondrial function, few mito-active drugs were successfully developed, particularly due to challenges in delivering active compound to this organelle. In this review, effort in utilizing nanotechnology for targeted mitochondrial delivery of compound is expounded based on the nature of the nanomaterial used. The advantage and potential offered are discussed alongside the limitation. Finally the review is concluded with perspectives of the application of nanocarrier in mitochondrial medicine, given the unresolved concern on potential complications.

  20. Targeted Learning in Healthcare Research.

    Science.gov (United States)

    Gruber, Susan

    2015-12-01

    The increasing availability of Big Data in healthcare encourages investigators to seek answers to big questions. However, nonparametric approaches to analyzing these data can suffer from the curse of dimensionality, and traditional parametric modeling does not necessarily scale. Targeted learning (TL) combines semiparametric methodology with advanced machine learning techniques to provide a sound foundation for extracting information from data. Predictive models, variable importance measures, and treatment benefits and risks can all be addressed within this framework. TL has been applied in a broad range of healthcare settings, including genomics, precision medicine, health policy, and drug safety. This article provides an introduction to the two main components of TL, targeted minimum loss-based estimation and super learning, and gives examples of applications in predictive modeling, variable importance ranking, and comparative effectiveness research. PMID:27441404

  1. CNOOC Lifts 2011 Production Target

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    @@ China National Offshore Oil Corporation (CNOOC), China's top offshore oil and gas producer, has lifted its 2011 production target by up to 11 percent as new projects at home and overseas come on stream.The offshore oil giant, with a market capitalization of about US$105 billion, said in a statement released in late January 2011 that it aimed to produce between 355 and 365 million barrels of oil equivalent (BOE).Oil prices climbed 15 percent in 2010 on the back of expectations that a global economic recovery will drive the demand.Analysts are similarly bullish for 2011, predicting crude prices to trade at around US$100 for the year.CNOOC, the smallest of China's triumvirate of energy companies that also includes CNPC and Sinopee, said it targeted US$8.8 billion in capital expenditure for 2011.

  2. Antihyperlipidemic therapies targeting PCSK9.

    Science.gov (United States)

    Weinreich, Michael; Frishman, William H

    2014-01-01

    Hyperlipidemia is a major cause of cardiovascular disease despite the availability of first-line cholesterol-lowering agents such as statins. A new therapeutic approach to lowering low-density lipoprotein-cholesterol (LDL-C) acts by blocking LDL-receptor degradation by serum proprotein convertase subtilisin kexin 9 (PCSK9). Human monoclonal antibodies that target PCSK9 and its interaction with the LDL receptor are now in clinical trials (REGN727/SAR23653, AMG145, and RN316). These agents are administered by either subcutaneous or intravenous routes, and have been shown to have major LDL-C and apolipoprotein B effects when combined with statins. A phase III clinical trial program evaluating clinical endpoints is now in progress. Other PCSK9-targeted approaches are in early stages of investigation, including natural inhibitors of PCSK9, RNA interference, and antisense inhibitors.

  3. Anticancer Agents Targeted to Sirtuins

    Directory of Open Access Journals (Sweden)

    Tomohiro Kozako

    2014-12-01

    Full Text Available Sirtuins are nicotinamide adenine dinucleotide+-dependent deacetylases of which there are seven isoforms (SIRT1–7. Sirtuin activity is linked to gene expression, lifespan extension, neurodegeneration, and age-related disorders. Numerous studies have suggested that sirtuins could be of great significance with regard to both antiaging and tumorigenesis, depending on its targets in specific signaling pathways or in specific cancers. Recent studies have identified small chemical compounds that modulate sirtuins, and these modulators have enabled a greater understanding of the biological function and molecular mechanisms of sirtuins. This review highlights the possibility of sirtuins, especially SIRT1 and SIRT2, for cancer therapy targets, and focuses on the therapeutic potential of sirtuin modulators both in cancer prevention and treatment.

  4. Classical scattering from oscillating targets

    Energy Technology Data Exchange (ETDEWEB)

    Papachristou, P.K.; Diakonos, F.K.; Constantoudis, V.; Schmelcher, P.; Benet, L

    2002-12-30

    We study planar classical scattering from an oscillating heavy target whose dynamics defines a five-dimensional phase space. Although the system possesses no periodic orbits, and thus topological chaos is not present, the scattering functions display a variety of structures on different time scales. These structures are due to scattering events with a strong energy transfer from the projectile to the moving disk resulting in low-velocity peaks. We encounter initial conditions for which the projectile exhibits infinitely many bounces with the oscillating disk. Our numerical investigations are supported by analytical results on a specific model with a simple time-law. The observed properties possess universal character for scattering off oscillating targets.

  5. Downstream targets of WRKY33.

    Science.gov (United States)

    Petersen, Klaus; Fiil, Berthe Katrine; Mundy, John; Petersen, Morten

    2008-11-01

    Innate immunity signaling pathways in both animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. In a recent publication we show that MPK4 and its substrate MKS1 interact with WRKY33 in vivo, and that WRKY33 is released from complexes with MPK4 upon infection. Transcriptome analysis of a wrky33 loss-of-function mutant identified a subset of defense-related genes as putative targets of WRKY33. These genes include PAD3 and CYP71A13, which encode cytochrome P450 monoxygenases required for synthesis of the antimicrobial phytoalexin camalexin. Chromatin immunoprecipitation confirmed that WRKY33 bound the promoter of PAD3 when plants were inoculated with pathogens. Here we further discuss the involvement of two other targets of WRKY33, NUDT6 and ROF2 in defense responses against invading pathogens.

  6. Downstream targets of WRKY33

    DEFF Research Database (Denmark)

    Petersen, Klaus; Fiil, Berthe Katrine; Mundy, John;

    2008-01-01

    Innate immunity signaling pathways in both animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. In a recent publication we show that MPK4 and its substrate MKS1 interact with WRKY33 in vivo, and that WRKY33 is released from complexes with MPK4 upon infection....... Transcriptome analysis of a wrky33 loss-of-function mutant identified a subset of defense-related genes as putative targets of WRKY33. These genes include PAD3 and CYP71A13, which encode cytochrome P450 monoxygenases required for synthesis of the antimicrobial phytoalexin camalexin. Chromatin...... immunoprecipitation confirmed that WRKY33 bound the promoter of PAD3 when plants were inoculated with pathogens. Here we further discuss the involvement of two other targets of WRKY33, NUDT6 and ROF2 in defense responses against invading pathogens....

  7. Gastrointestinal hormones and their targets

    DEFF Research Database (Denmark)

    Rehfeld, Jens F.

    2014-01-01

    , paracrine, spermiocrine secretion etc.), so the same peptide may act as a blood-borne hormone, a neurotransmitter, a local growth factor, or a fertility factor. The molecular targets of each bioactive peptide are specific G-protein coupled receptors expressed in the cell membranes of different target cells......Gastrointestinal hormones are peptides released from endocrine cells and neurons in the digestive tract. More than 30 hormone genes are currently known to be expressed in the gastrointestinal tract, which makes the gut the largest hormone producing organ in the body. Modern biology makes...... it feasible to conceive the hormones under five headings: The structural homology groups a majority of the hormones into nine families, each of which is assumed to originate from one ancestral gene. The individual hormone gene often has multiple phenotypes due to alternative splicing, tandem organization...

  8. Recurring Utterances - Targeting a Breakthrough

    Directory of Open Access Journals (Sweden)

    Jacqueline Stark

    2014-05-01

    The most interesting phenomenon is KB’s production of words from former sessions indicating that they are still ‘active’ and the production of completely novel incorrect words. The observable features indicate that immediate auditory processing is possible in the form of repeating target words. However, as soon as KB must retrieve information from the (semantic lexicon, even after being able to correctly ‘repeat’ the target word several times, he responds with a RU, perseveration, or paraphasia. Several of his productions can be characterized as aphasic confabulations which stem from a memory gap. Thus, although KB’s language impairment is severe, his responses across time indicate that step-by-step a breakthrough is being made.

  9. FAST DETECTING TARGET GROUPS IN SAR IMAGES

    Institute of Scientific and Technical Information of China (English)

    Gao Gui; Kuang Gangyao; Jiang Yongmei; Wang Baosun; Gao Sheng

    2006-01-01

    A successful algorithm for detecting target groups is presented. Firstly, A global Constant False Alarm Rate (CFAR) detector is utilized to locate the potential target regions, and then the features are computed for target discrimination based on voting mechanism. Finally, Target groups are extracted. The results of experiments show the validity of this algorithm.

  10. Progress of gene targeting in mouse

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Gene targeting is a powerful approach of study- ing the genefunction in vivo. Specific genetic modifications, including simple gene disruption, point mutations, large chromosomal deletions and rearrangements, targeted incor- poration of foreign genes, could be introduced into the mouse genome by gene targeting. Recent studies make it possible to do the gene targeting with temporal and spatial control.

  11. Aptamers and aptamer targeted delivery

    OpenAIRE

    Yan, Amy C.; Levy, Matthew

    2009-01-01

    When aptamers first emerged almost two decades ago, most were RNA species that bound and tagged or inhibited simple target ligands. Very soon after, the ‘selectionologists’ developing aptamer technology quickly realized more potential for the aptamer. In recent years, advances in aptamer techniques have enabled the use of aptamers as small molecule inhibitors, diagnostic tools and even therapeutics. Aptamers are now being employed in novel applications. We review, herein, some of the recent a...

  12. Therapeutic targeting of Janus kinases

    OpenAIRE

    Pesu, Marko; Laurence, Arian; Kishore, Nandini; Zwillich, Sam; Chan, Gary; O’Shea, John J.

    2008-01-01

    Cytokines play pivotal roles in immunity and inflammation, and targeting cytokines and their receptors is an effective means of treating such disorders. Type I and II cytokine receptors associate with Janus family kinases (JAKs) to effect intracellular signaling. These structurally unique protein kinases play essential and specific roles in immune cell development and function. One JAK, JAK3, has particularly selective functions. Mutations of this kinase underlie severe combined immunodeficie...

  13. Cancer Immunotherapy of Targeting Angiogenesis

    Institute of Scientific and Technical Information of China (English)

    Jianmei Hou; Ling Tian; Yuquan Wei

    2004-01-01

    Tumor growth and metastasis are angiogenesis-dependent. Anti-angiogenic therapy may be a useful approach to cancer therapy. This review discussed tumor angiogenesis and immunotherapy of targeting tumor angiogenesis from two main aspects: (1) active vaccination to induce effective anti-angiogenesis immunity; (2) passive immunotherapy with anti-pro-angiogenic molecules relevant antibody. Evidence from the recent years suggested that anti-angiogenic therapy should be one of the most promising approaches to cancer therapy.

  14. Targeted advertising in magazine markets

    OpenAIRE

    Chandra, Ambarish; Kaiser, Ulrich

    2010-01-01

    We examine the scope and value of targeted advertising in the magazine industry. We use data on reader characteristics at individual media, in contrast to previous work that has needed to infer this information from aggregate data. Our results show a strong relationship between subscriber characteristics and advertising prices. Advertisers clearly value more homogenous groups of readers, measured according to income, gender and age. Our results explain recent trends of declining advertising e...

  15. Targeting the lysosome in cancer

    OpenAIRE

    Piao, Shengfu; Amaravadi, Ravi K.

    2015-01-01

    Lysosomes are membrane-bound intracellular organelles that receive macromolecules delivered by endocytosis, phagocytosis, and autophagy for degradation and recycling. Over the last decade, advances in lysosome research have established a broad role for the lysosome in the pathophysiology of disease. In this review, we highlight the recent discoveries in lysosome biology, with an emphasis on their implications for cancer therapy. We focus on targeting the lysosome in cancer by exploring lysoso...

  16. Toward targeted hypertension screening guidelines

    OpenAIRE

    Buuren, S. van; Boshuizen, HC; Reijneveld, SA

    2006-01-01

    Background. guidelines for screening and subsequent treatment of hypertension vary widely between countries. Part Of this variation can be attributed to systematic differences between Populations, but little is known about the way in which guidelines should be targeted to the population of interest. Optimal guidelines should have high yield and low complexity. The goal is to fit procedures for screening and subsequent treatment of hypertension optimally to a specific population. Methods. Simu...

  17. Anticancer Agents Targeted to Sirtuins

    OpenAIRE

    Tomohiro Kozako; Takayoshi Suzuki; Makoto Yoshimitsu; Naomichi Arima; Shin-ichiro Honda; Shinji Soeda

    2014-01-01

    Sirtuins are nicotinamide adenine dinucleotide+-dependent deacetylases of which there are seven isoforms (SIRT1–7). Sirtuin activity is linked to gene expression, lifespan extension, neurodegeneration, and age-related disorders. Numerous studies have suggested that sirtuins could be of great significance with regard to both antiaging and tumorigenesis, depending on its targets in specific signaling pathways or in specific cancers. Recent studies have identified small chemical compounds that m...

  18. Inflation Targeting in Latin America

    OpenAIRE

    Barajas, Adolfo; Steiner, Roberto; Villar, Leonardo; Pabon, Cesar

    2014-01-01

    Estimation of conventional Taylor rules for Brazil, Chile, Colombia and Peru shows that central banks increase their repo rate in response to increases in the output gap and, except in Peru, to deviations of inflation expectations from target. Using a Markov-Switching methodology, it is found that, in the presence of external shocks, Chile, Colombia and Peru temporarily abandoned their conventional reaction function. The Taylor Rule is expanded and variables are included related to exchange r...

  19. Inflation Targeting in Dollarized Economies

    OpenAIRE

    Leonardo Leiderman; Rodolfo Maino; Eric Parrado

    2006-01-01

    The shift to inflation targeting has contributed to the relatively low inflation observed in some emerging market economies although, as noted by many economists, the preconditions required for a successful implementation were not in place. The existence of managed exchange rate regimes, a narrow base of domestic nominal financial assets, the lack of market instruments to hedge exchange rate risks, together with fear of floating and dollarization, have been stressed as factors that might weak...

  20. Electronic warfare target location methods

    CERN Document Server

    Poisel, Richard

    2012-01-01

    Describing the mathematical development underlying current and classical methods of geolocating electronic systems that are emitting, this newly revised and greatly expanded edition of a classic Artech House book offers practical guidance in electronic warfare target location. The Second Edition features a wealth of additional material including new chapters on time delay estimation, direction finding techniques, and the MUSIC algorithm. This practical resource provides you with critical design information on geolocation algorithms, and establishes the fundamentals of existing algorithms as a

  1. Target Advertising and Market Transparency

    OpenAIRE

    Stühmeier, Torben

    2012-01-01

    This paper examines the effects of increased transparency over online news sources, e.g. due to news aggregators, on online news outlets and the advertising industry. The role of news aggregators is controversially discussed, where the discussion widely points on user side effect. The present paper widens the discussion on the advertising side and shows that aggregators can help to better target advertising messages to a more homogenous group of users and, in turn, may both benefit advertiser...

  2. Target fragmentation at intermediate energies

    International Nuclear Information System (INIS)

    We report the results of measurements of the average target fragment momenta and energies in the interaction of 12.0 and 18.4 MeV/u 160, and 45.4 and 83.8 MeV/u 12C with 197Au. We compare these data with previously published studies of the interaction of 380 MeV/u 20Ne and 400 and 2100 MeV/u 12C with 197Au

  3. Fixed target flammable gas upgrades

    International Nuclear Information System (INIS)

    In the past, fixed target flammable gas systems were not supported in an organized fashion. The Research Division, Mechanical Support Department began to support these gas systems for the 1995 run. This technical memo describes the new approach being used to supply chamber gasses to fixed target experiments at Fermilab. It describes the engineering design features, system safety, system documentation and performance results. Gas mixtures provide the medium for electron detection in proportional and drift chambers. Usually a mixture of a noble gas and a polyatomic quenching gas is used. Sometimes a small amount of electronegative gas is added as well. The mixture required is a function of the specific chamber design, including working voltage, gain requirements, high rate capability, aging and others. For the 1995 fixed target run all the experiments requested once through gas systems. We obtained a summary of problems from the 1990 fixed target run and made a summary of the operations logbook entries from the 1991 run. These summaries primarily include problems involving flammable gas alarms, but also include incidents where Operations was involved or informed. Usually contamination issues were dealt with by the experimenters. The summaries are attached. We discussed past operational issues with the experimenters involved. There were numerous incidents of drift chamber failure where contaminated gas was suspect. However analyses of the gas at the time usually did not show any particular problems. This could have been because the analysis did not look for the troublesome component, the contaminant was concentrated in the gas over the liquid and vented before the sample was taken, or that contaminants were drawn into the chambers directly through leaks or sub-atmospheric pressures. After some study we were unable to determine specific causes of past contamination problems, although in argon-ethane systems the problems were due to the ethane only

  4. A Cryogenic Infrared Calibration Target

    CERN Document Server

    Wollack, Edward J; Rinehart, Stephan A

    2014-01-01

    A compact cryogenic calibration target is presented that has a peak diffuse reflectance, $R \\le 0.003$, from $800-4,800\\,{\\rm cm}^{-1}$ $(12-2\\,\\mu$m). Upon expanding the spectral range under consideration to $400-10,000\\,{\\rm cm}^{-1}$ $(25-1\\,\\mu$m) the observed performance gracefully degrades to $R \\le 0.02$ at the band edges. In the implementation described, a high-thermal-conductivity metallic substrate is textured with a pyramidal tiling and subsequently coated with a thin lossy dielectric coating that enables high absorption and thermal uniformity across the target. The resulting target assembly is lightweight, has a low-geometric profile, and has survived repeated thermal cycling from room temperature to $\\sim4\\,$K. Basic design considerations, governing equations, and test data for realizing the structure described are provided. The optical properties of selected absorptive materials -- Acktar Fractal Black, Aeroglaze Z306, and Stycast 2850 FT epoxy loaded with stainless steel powder -- are character...

  5. Targeted therapies in hepatocellular carcinoma.

    Science.gov (United States)

    Bronte, F; Bronte, G; Cusenza, S; Fiorentino, E; Rolfo, C; Cicero, G; Bronte, E; Di Marco, V; Firenze, A; Angarano, G; Fontana, T; Russo, A

    2014-01-01

    The onset of hepatocellular carcinoma (HCC) is related to the development of non-neoplastic liver disease, such as viral infections and cirrhosis. Even though patients with chronic liver diseases undergo clinical surveillance for early diagnosis of HCC, this cancer is often diagnosed in advanced stage. In this case locoregional treatment is not possible and systemic therapies are the best way to control it. Until now sorafenib, a Raf and multi-kinase inhibitor has been the best, choice to treat HCC systemically. It showed a survival benefit in multicenter phase III trials. However the proper patient setting to treat is not well defined, since the results in Child-Pugh B patients are conflicting. To date various new target drugs are under developed and other biological treatments normally indicated in other malignancies are under investigation also for HCC. These strategies aim to target the different biological pathways implicated in HCC development and progression. The target drugs studied in HCC include anti-VEGF and anti-EGFR monoclonal antibodies, tyrosine kinase inhibitors and mTOR inhibitors. The most important challenge is represented by the best integration of these drugs with standard treatments to achieve improvement in overall survival and quality of life.

  6. Renal Toxicities of Targeted Therapies.

    Science.gov (United States)

    Abbas, Anum; Mirza, Mohsin M; Ganti, Apar Kishor; Tendulkar, Ketki

    2015-12-01

    With the incorporation of targeted therapies in routine cancer therapy, it is imperative that the array of toxicities associated with these agents be well-recognized and managed, especially since these toxicities are distinct from those seen with conventional cytotoxic agents. This review will focus on these renal toxicities from commonly used targeted agents. This review discusses the mechanisms of these side effects and management strategies. Anti-vascular endothelial growth factor (VEGF) agents including the monoclonal antibody bevacizumab, aflibercept (VEGF trap), and anti-VEGF receptor (VEGFR) tyrosine kinase inhibitors (TKIs) all cause hypertension, whereas some of them result in proteinuria. Monoclonal antibodies against the human epidermal growth factor receptor (HER) family of receptors, such as cetuximab and panitumumab, cause electrolyte imbalances including hypomagnesemia and hypokalemia due to the direct nephrotoxic effect of the drug on renal tubules. Cetuximab may also result in renal tubular acidosis. The TKIs, imatinib and dasatinib, can result in acute or chronic renal failure. Rituximab, an anti-CD20 monoclonal antibody, can cause acute renal failure following initiation of therapy because of the onset of acute tumor lysis syndrome. Everolimus, a mammalian target of rapamycin (mTOR) inhibitor, can result in proteinuria. Discerning the renal adverse effects resulting from these agents is essential for safe treatment strategies, particularly in those with pre-existing renal disease.

  7. Renal Toxicities of Targeted Therapies.

    Science.gov (United States)

    Abbas, Anum; Mirza, Mohsin M; Ganti, Apar Kishor; Tendulkar, Ketki

    2015-12-01

    With the incorporation of targeted therapies in routine cancer therapy, it is imperative that the array of toxicities associated with these agents be well-recognized and managed, especially since these toxicities are distinct from those seen with conventional cytotoxic agents. This review will focus on these renal toxicities from commonly used targeted agents. This review discusses the mechanisms of these side effects and management strategies. Anti-vascular endothelial growth factor (VEGF) agents including the monoclonal antibody bevacizumab, aflibercept (VEGF trap), and anti-VEGF receptor (VEGFR) tyrosine kinase inhibitors (TKIs) all cause hypertension, whereas some of them result in proteinuria. Monoclonal antibodies against the human epidermal growth factor receptor (HER) family of receptors, such as cetuximab and panitumumab, cause electrolyte imbalances including hypomagnesemia and hypokalemia due to the direct nephrotoxic effect of the drug on renal tubules. Cetuximab may also result in renal tubular acidosis. The TKIs, imatinib and dasatinib, can result in acute or chronic renal failure. Rituximab, an anti-CD20 monoclonal antibody, can cause acute renal failure following initiation of therapy because of the onset of acute tumor lysis syndrome. Everolimus, a mammalian target of rapamycin (mTOR) inhibitor, can result in proteinuria. Discerning the renal adverse effects resulting from these agents is essential for safe treatment strategies, particularly in those with pre-existing renal disease. PMID:25922090

  8. Drug targeting to the brain.

    Science.gov (United States)

    Pardridge, William M

    2007-09-01

    The goal of brain drug targeting technology is the delivery of therapeutics across the blood-brain barrier (BBB), including the human BBB. This is accomplished by re-engineering pharmaceuticals to cross the BBB via specific endogenous transporters localized within the brain capillary endothelium. Certain endogenous peptides, such as insulin or transferrin, undergo receptor-mediated transport (RMT) across the BBB in vivo. In addition, peptidomimetic monoclonal antibodies (MAb) may also cross the BBB via RMT on the endogenous transporters. The MAb may be used as a molecular Trojan horse to ferry across the BBB large molecule pharmaceuticals, including recombinant proteins, antibodies, RNA interference drugs, or non-viral gene medicines. Fusion proteins of the molecular Trojan horse and either neurotrophins or single chain Fv antibodies have been genetically engineered. The fusion proteins retain bi-functional properties, and both bind the BBB receptor, to trigger transport into brain, and bind the cognate receptor inside brain to induce the pharmacologic effect. Trojan horse liposome technology enables the brain targeting of non-viral plasmid DNA. Molecular Trojan horses may be formulated with fusion protein technology, avidin-biotin technology, or Trojan horse liposomes to target to brain virtually any large molecule pharmaceutical. PMID:17554607

  9. NEW DRUG TARGETING TREATMENT - GLIVEC

    Institute of Scientific and Technical Information of China (English)

    SUN Xue-mei(孙雪梅); BRADY Ben

    2003-01-01

    This review evaluates the role of Glivec in the treatment of chronic myelogenous leukemia and other malignant tumors. Preclinical and clinical evidence showed that Glivec demonstrated a potent and specific inhibition on BCR-ABL positive leukemias and other malignant tumors in which overexpression of c-kit and PDGFR-β played a major role in their pathogenesis. Glivec has induced complete hematologic responses in up to 98% of patients evaluated in clinical trials. It's a very successful drug that supported the idea of targeted therapy through inhibition of tyrosine kinases. Although it's still in the early stages of clinical development and the resistance to Glivec remains to be a problem needed further study, a great deal has been learned from these research and observation. And with the increasing data, molecular targeting therapy will play much more important role in the treatment of malignant tumors. With the better understanding of the pathogenesis of malignant tumors, well-designed drugs targeting the specific molecular abnormalities with higher efficacy and lower side effect will benefit numerous patients with malignant tumors.

  10. Experimental identification of microRNA targets

    DEFF Research Database (Denmark)

    Ørom, Ulf Andersson; Lund, Anders H

    2009-01-01

    of potential targets and constitutes a problem for computational target prediction. Although computational analyses have shed light on important aspects of microRNA target recognition, several questions remain regarding how microRNAs can recognize and regulate their targets. Forward experimental approaches...... allow for an unbiased study of microRNA target recognition and may unveil novel, rare or uncommon target binding patterns. In this review we focus on animal microRNAs and the experimental approaches that have been described for identification of their targets....

  11. Method for forming electrically charged laser targets

    Science.gov (United States)

    Goodman, Ronald K.; Hunt, Angus L.

    1979-01-01

    Electrically chargeable laser targets and method for forming such charged targets in order to improve their guidance along a predetermined desired trajectory. This is accomplished by the incorporation of a small amount of an additive to the target material which will increase the electrical conductivity thereof, and thereby enhance the charge placed upon the target material for guidance thereof by electrostatic or magnetic steering mechanisms, without adversely affecting the target when illuminated by laser energy.

  12. Three Essays on Analyst Target Prices

    OpenAIRE

    Hashim, Noor

    2012-01-01

    This thesis presents three essays on analyst target prices. The essays contribute to the major debate on the value of analyst target prices in the capital market by addressing the following three questions: Does a bull-bear valuation analysis increase the accuracy of analysts’ target prices? Does analyst ranking affect how informative target prices are to institutional investors? And, do analysts use their cash flow forecasts when setting target prices?In the first essay, I explore whether co...

  13. LIFE Target Fabrication Research Plan Sept 2008

    Energy Technology Data Exchange (ETDEWEB)

    Miles, R; Biener, J; Kucheyev, S; Montesanti, R; Satcher, J; Spadaccini, C; Rose, K; Wang, M; Hamza, A; Alexander, N; Brown, L; Hund, J; Petzoldt, R; Sweet, W; Goodin, D

    2008-11-10

    The target-system for the baseline LIFE fast-ignition target was analyzed to establish a preliminary estimate for the costs and complexities involved in demonstrating the technologies needed to build a prototype LIFE plant. The baseline fast-ignition target upon which this analysis was developed is shown in Figure 1.0-1 below. The LIFE target-system incorporates requirements for low-cost, high throughput manufacture, high-speed, high accuracy injection of the target into the chamber, production of sufficient energy from implosion and recovery and recycle of the imploded target material residue. None of these functions has been demonstrated to date. Existing target fabrication techniques which lead to current 'hot spot' target costs of {approx}$100,000 per target and at a production rate of 2/day are unacceptable for the LIFE program. Fabrication techniques normally used for low-cost, low accuracy consumer products such as toys must be adapted to the high-accuracy LIFE target. This will be challenge. A research program resulting is the demonstration of the target-cycle technologies needed for a prototype LIFE reactor is expected to cost {approx}$51M over the course of 5 years. The effort will result in targets which will cost an estimated $0.23/target at a rep-rate of 20 Hz or about 1.73M targets/day.

  14. Communicating to heterogeneous target groups

    DEFF Research Database (Denmark)

    Pedersen, Karsten

    very often have to communicate to rather heterogeneous target groups that have little more in common than a certain geographical habitat. That goes against most schoolbook teaching in the field of communication, but is none the less the terms with which that kind of communication has to live...... that such grammatical changes have positive effects on the intelligibility of texts. The attempts to document such effects are scarce and that is one of the backgrounds for my involvement in the project. If I am able to show that the changes do have an effect, the literature on conveying professional communication...

  15. Conotoxins: Molecular and Therapeutic Targets

    Science.gov (United States)

    Lewis, Richard J.

    Marine molluscs known as cone snails produce beautiful shells and a complex array of over 50,000 venom peptides evolved for prey capture and defence. Many of these peptides selectively modulate ion channels and transporters, making them a valuable source of new ligands for studying the role these targets play in normal and disease physiology. A number of conopeptides reduce pain in animal models, and several are now in pre-clinical and clinical development for the treatment of severe pain often associated with diseases such as cancer. Less than 1% of cone snail venom peptides are pharmacologically characterised.

  16. Introduction to radar target recognition

    CERN Document Server

    Tait, P

    2006-01-01

    This new text provides an overview of the radar target recognition process and covers the key techniques being developed for operational systems. It is based on the fundamental scientific principles of high resolution radar, and explains how the techniques can be used in real systems, taking into account the characteristics of practical radar system designs and component limitations. It also addresses operational aspects, such as how high resolution modes would fit in with other functions such as detection and tracking. Mathematics is kept to a minimum and the complex techniques and issues are

  17. Zinc metalloproteins as medicinal targets.

    Science.gov (United States)

    Anzellotti, A I; Farrell, N P

    2008-08-01

    Zinc bioinorganic chemistry has emphasized the role of the metal ion on the structure and function of the protein. There is, more recently, an increasing appreciation of the role of zinc proteins in a variety of human diseases. This critical review, aimed at both bioinorganic and medicinal chemists, shows how apparently widely-diverging diseases share the common mechanistic approaches of targeting the essential function of the metal ion to inhibit activity. Protein structure and function is briefly summarized in the context of its clinical relevance. The status of current and potential inhibitors is discussed along with the prospects for future developments (162 references).

  18. Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals.

    Science.gov (United States)

    Kroonblawd, Matthew P; Sewell, Thomas D; Maillet, Jean-Bernard

    2016-02-14

    In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linear and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock.

  19. THEORETICAL ASPECTS REGARDING THE NEW OFFENSE COVERED BY ART. 246 OF THE CRIMINAL CODE MISSAPPROPRIATION OF PUBLIC AUCTIONS AND OFFENCES COVERED BY ART. 65 OF LAW NO. 21/1996 REPUBLISHED. COMPETITION LAW

    Directory of Open Access Journals (Sweden)

    Rodica Aida POPA

    2016-06-01

    Full Text Available The present study aims to bring to the attention of the legal law specialists the theoretical aspects related to a new incrimination as the one covered by art. 246 of the Penal Code, the misappropriation of public auctions, as well as aspects of yet another incrimination, that is the one covered by art. 65 of Law no. 21/1996 republished-competition law, trying thus to prevent certain different interpretations about the typicality of the two incriminations and encourage the possibility of highlighting other arguments that will lead to an application as accurate as possible of the two incriminations. Presently there is no case law for the two incriminations therefore the theoretical analysis has to present interpretation arguments which will help the judicial bodies to easily classify the factual basis of the content of the two constitutive laws offering the possibility of a more detailed and contextual interpretation in relation to the reality. The way the public auctions take place is a constant preoccupation not only for the participants who are involved in the procedure and directly interested in abiding the under law and ensuring a fair competitive climate but also for the public opinion which is as equally interested in ensuring fair social-economical relationships based on the market principles. Simultaneously, the way the legal conditions of the second incriminations-that is the one from art.65 Law no.21/1996 republished - are interpreted in relation with the competition practices will lead to the clarification of the norm and its correct enforcement.

  20. Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals

    Energy Technology Data Exchange (ETDEWEB)

    Kroonblawd, Matthew P.; Sewell, Thomas D., E-mail: sewellt@missouri.edu [Department of Chemistry, University of Missouri-Columbia, Columbia, Missouri 65211-7600 (United States); Maillet, Jean-Bernard, E-mail: jean-bernard.maillet@cea.fr [CEA, DAM, DIF, F-91297 Arpajon (France)

    2016-02-14

    In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linear and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock.