WorldWideScience

Sample records for cadmium 131

  1. Cadmium

    NARCIS (Netherlands)

    Meulenbelt, Jan

    2017-01-01

    Together with zinc and mercury, cadmium belongs to group IIb of the periodic table. It can be found in rocks, soil, water, coal, zinc ore, lead ore, and copper ore. In the environment, cadmium is present predominantly as the oxide or as the chloride, sulfide, or sulfate salt. It has no recognizable

  2. Cadmium Alternatives

    Science.gov (United States)

    2012-08-01

    using for commercial applications Other zinc alloys Zinc cobalt , tin zinc, zinc iron Passivation Cadmium, ZnNi, SnZn, ZnCo, ZnFe, and...for Change Cadmium passivated with hexavalent chromium has been in use for many decades Cadmium is toxic, and is classified as a priority...Executive Orders 13514 & 13423 DoD initiatives – Young memo (April 2009) DFAR restricting use of hexavalent chromium Allows the use of hexavalent

  3. Cadmium sulfide membranes

    Science.gov (United States)

    Spanhel, Lubomir; Anderson, Marc A.

    1991-10-22

    A method is described for the creation of novel q-effect cadmium sulfide membranes. The membranes are made by first creating a dilute cadmium sulfide colloid in aqueous suspension and then removing the water and excess salts therefrom. The cadmium sulfide membrane thus produced is luminescent at room temperature and may have application in laser fabrication.

  4. Calcium enhances cadmium tolerance and decreases cadmium ...

    African Journals Online (AJOL)

    These results suggest that cadmium uptake in lettuce plants is negatively associated with the presence of calcium in the culture medium, maybe due to a competition between these two cations for binding and absorption sites in roots. In conclusion, the results suggest that fertilization with Ca2+ appears to be a promising ...

  5. 40 CFR 131.11 - Criteria.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Criteria. 131.11 Section 131.11... Establishment of Water Quality Standards § 131.11 Criteria. (a) Inclusion of pollutants: (1) States must adopt those water quality criteria that protect the designated use. Such criteria must be based on sound...

  6. 46 CFR 131.720 - Use.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Use. 131.720 Section 131.720 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Work Vests § 131.720 Use. (a) An approved buoyant work vest is an item of safety apparel and may be carried aboard for wear by a...

  7. 46 CFR 131.840 - Emergency lighting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Emergency lighting. 131.840 Section 131.840 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.840 Emergency lighting. Emergency lighting must be marked...

  8. 46 CFR 131.970 - Unauthorized lighting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Unauthorized lighting. 131.970 Section 131.970 Shipping... Miscellaneous § 131.970 Unauthorized lighting. No master of a vessel may authorize or permit the vessel's carrying of any lighting not required by law that will interfere in any way with any other vessel's ability...

  9. 46 CFR 502.131 - Requests; issuance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 9 2010-10-01 2010-10-01 false Requests; issuance. 502.131 Section 502.131 Shipping... § 502.131 Requests; issuance. Subpenas for the attendance of witnesses or the production of evidence shall be issued upon request of any party, without notice to any other party. Requests for subpenas for...

  10. 40 CFR 131.40 - Puerto Rico

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Puerto Rico 131.40 Section 131.40... Federally Promulgated Water Quality Standards § 131.40 Puerto Rico (a) Use designations for marine waters. In addition to the Commonwealth's adopted use designations, the following waterbodies in Puerto Rico...

  11. 46 CFR 131.899 - Fire dampers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire dampers. 131.899 Section 131.899 Shipping COAST... Equipment and Emergency Equipment § 131.899 Fire dampers. Each fire damper installed within the boundary of... whether the damper is open or closed and must be marked with red letters at least 13 millimeters (1/2-inch...

  12. 49 CFR 237.131 - Design.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Design. 237.131 Section 237.131 Transportation... TRANSPORTATION BRIDGE SAFETY STANDARDS Repair and Modification of Bridges § 237.131 Design. Each repair or... component of a bridge shall be designed by a railroad bridge engineer. The design shall specify the manner...

  13. 21 CFR 131.155 - Light cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light cream. 131.155 Section 131.155 Food and... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.155 Light cream. (a) Description. Light cream is cream which contains not less than 18 percent but less than 30 percent milkfat. It...

  14. 21 CFR 131.149 - Dry cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dry cream. 131.149 Section 131.149 Food and Drugs... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.149 Dry cream. (a) Description. Dry cream is the product obtained by removal of water only from pasteurized milk or cream or a...

  15. 21 CFR 131.150 - Heavy cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Heavy cream. 131.150 Section 131.150 Food and... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.150 Heavy cream. (a) Description. Heavy cream is cream which contains not less than 36 percent milkfat. It is pasteurized or ultra...

  16. 21 CFR 131.160 - Sour cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sour cream. 131.160 Section 131.160 Food and Drugs... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.160 Sour cream. (a) Description. Sour cream results from the souring, by lactic acid producing bacteria, of pasteurized cream...

  17. 9 CFR 3.131 - Sanitation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Sanitation. 3.131 Section 3.131... Mammals Animal Health and Husbandry Standards § 3.131 Sanitation. (a) Cleaning of enclosures. Excreta... being directly sprayed with the stream of water or wetted involuntarily. (b) Sanitation of enclosures...

  18. 19 CFR 191.131 - Drawback allowance.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Drawback allowance. 191.131 Section 191.131 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... Foreign Ownership and Account § 191.131 Drawback allowance. Section 313(g) of the Act, as amended (19 U.S...

  19. Toxicity of cadmium to grapevine

    Energy Technology Data Exchange (ETDEWEB)

    Rupp, D.; Ruehl, E.; Alleweldt, G.

    1985-01-01

    Cuttings of the cv. Riesling were cultivated in nutrient solutions with different amounts of cadmium. Cadmium inhibited the growth of shoot and of leaf area and produced chlorosis, necroses and leaf deformations. Old leaves showed no symptoms at all, but with high cadmium levels leaf fall occurred. The threshold of cadmium damage was beneath a level of 0.1 ppm Cd of the nutrient solution. The dry matter production of the plants was reduced by cadmium: 0.66 mg Cd/l of nutrient solution caused an inhibition of 50%. Cadmium reduced the chlorophyll content of the leaves. The transport of iron from roots to leaves was inhibited nearly completely by medium to high levels of cadmium (1.0, 3.0, 10.0 ppm). Iron was accumulated in the roots. Thus cadmium may have caused an iron deficiency chlorosis in grapevines. The uptake of cadmium showed a clear dependence on the amount of cadmium in the nutrient solution. Within the plants, decreasing amounts of cadmium were found following the pattern roots - stem - leaves.

  20. 29 CFR 1910.1027 - Cadmium.

    Science.gov (United States)

    2010-07-01

    ... battery Plate making, plate preparation 50 All other processes 15 Zinc/Cadmium refining* Cadmium refining... as an airborne concentration of cadmium of 2.5 micrograms per cubic meter of air (2.5 µg/m3... air cadmium level to which an employee is exposed means the exposure to airborne cadmium that would...

  1. Cadmium hazard in silver brazing.

    Science.gov (United States)

    Gan, S L; Tan, S H; Pinnagoda, J; Tan, K T

    1995-03-01

    This study evaluates the usage of cadmium-containing silver brazing alloys in Singapore and the potential cadmium hazard from its use. Of the 137 factories which responded to the survey questionnaire, only 28 (20.4%) carried out brazing. Of these, only 7 factories used cadmium-containing filler alloys. One hundred and six out of 123 workers from one of these factories had cadmium-in-blood concentrations exceeding 10 mcg/l. Thirty-one (29.2%) of the workers with excessive cadmium absorption had urinary beta-2 microglobulin levels exceeding 28 mcg/g creat. Workers in the other factories who were intermittently exposed had cadmium-in-blood concentrations of 10 mcg/l and below.

  2. Cadmium in Sweden - environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Parkman, H.; Iverfeldt, Aa. [Swedish Environmental Research Inst. (Sweden); Borg, H.; Lithner, G. [Stockholm Univ. (Sweden). Inst. for Applied Environmental Research

    1998-03-01

    This report aims at assessing possible effects of cadmium in the Swedish environment. Swedish soils and soft freshwater systems are, due to a generally poor buffering capacity, severely affected by acidification. In addition, the low salinity in the Baltic Sea imply a naturally poor organism structure, with some important organisms living close to their limit of physiological tolerance. Cadmium in soils is mobilized at low pH, and the availability and toxicity of cadmium in marine systems are enhanced at low salinity. The Swedish environment is therefore extra vulnerable to cadmium pollution. The average concentrations of cadmium in the forest mor layers, agricultural soils, and fresh-waters in Sweden are enhanced compared to `back-ground concentrations`, with a general increasing trend from the north to the south-west, indicating strong impact of atmospheric deposition of cadmium originating from the central parts of Europe. In Swedish sea water, total cadmium concentrations, and the fraction of bio-available `free` cadmium, generally increases with decreasing salinity. Decreased emissions of cadmium to the environment have led to decreasing atmospheric deposition during the last decade. The net accumulation of cadmium in the forest mor layer has stopped, and even started to decrease. In northern Sweden, this is due to the decreased deposition, but in southern Sweden the main reason is increased leakage of cadmium from the topsoil as a consequence of acidification. As a result, cadmium in the Swedish environments is undergoing an extended redistribution between different soil compartments, and from the soils to the aquatic systems. 90 refs, 23 figs, 2 tabs. With 3 page summary in Swedish

  3. Speciation of Dissolved Cadmium

    DEFF Research Database (Denmark)

    Holm, Peter Engelund; Andersen, Sjur; Christensen, Thomas Højlund

    1995-01-01

    Equilibrium dialysis and ion exchange methods, as well as computer calculations (GEOCHEM), were applied for speciation of dissolved cadmium (Cd) in test solutions and leachate samples. The leachate samples originated from soil, compost, landfill waste and industrial waste. The ion exchange (IE...... leachates showed different Cd speciation patterns as expected. Some leachates were dominated by free divalent Cd (1-70%), some by inorganic complexes (1-87%), and some by organic complexes (7-98%)....

  4. 40 CFR 131.31 - Arizona.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Arizona. 131.31 Section 131.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS..., 3033 North Central Ave., Phoenix, AZ 85012): COLORADO MAIN STEM RIVER BASIN: Hualapai Wash MIDDLE GILA...

  5. 7 CFR 4279.131 - Credit quality.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Credit quality. 4279.131 Section 4279.131 Agriculture... Credit quality. The lender is primarily responsible for determining credit quality and must address all of the elements of credit quality in a written credit analysis including adequacy of equity, cash...

  6. Quality control of iodine-131-labeled metaiodobenzylguanidine.

    Science.gov (United States)

    Taşdelen, Betül; Kam, Erol; Asliyuksek, Hızır

    2014-01-01

    Iodine-131-m-iodobenzylguanidine ([(131)I]mIBG) is used worldwide for the diagnosis and therapy of neuroendocrine tumors, particularly adrenal medullae tumors. After the synthesis and preparation of a radioiodinated MIBG drug formulation, quality control testing to determine its radiochemical purity (RCP) should be performed. European Pharmacopoeia 8.0 requires that the quality control include a test for RCP for the determination of [(131)I]mIBG. Previously reported procedures using reversed-phase conditions require long retention times. Our system enables the separation of [(131)I]mIBG within a few minutes. The aim of this work was to carry out RCP testing for [(131)I]mIBG without any type of sample pretreatment. RCP testing for ([(131)I]mIBG has been carried out using high-performance liquid chromatography and thin-layer chromatography methods. A simple and rapid reversed-phase isocratic system enables the HPLC investigation of RCP testing for [(131)I]mIBG used for therapy within a few minutes. From the point of view of radiation protection, this method is safer, especially for therapeutic amounts of [(131)I]mIBG.

  7. 40 CFR 417.131 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 417.131 Section 417.131 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Chlorosulfonic Acid Sulfation...

  8. Cadmium in blood and hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Ki-Do; Lee, Mi-Sun [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of); Paek, Domyung [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of)], E-mail: paekdm@snu.ac.kr

    2008-12-15

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 {mu}g/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 {mu}g/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population.

  9. Cadmium exposure in the Swedish environment

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This report gives a thorough description of cadmium in the Swedish environment. It comprises three parts: Cadmium in Sweden - environmental risks;, Cadmium in goods - contribution to environmental exposure;, and Cadmium in fertilizers, soil, crops and foods - the Swedish situation. Separate abstracts have been prepared for all three parts

  10. Oral cadmium chloride intoxication in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B; Svendsen, P

    1988-01-01

    Diethyldithiocarbamate (DDC) is known to alleviate acute toxicity due to injection of cadmium salts. However, when cadmium chloride was administered by the oral route, DDC enhanced rather than alleviated the acute toxicity; both oral and intraperitoneal (i.p.) administration of DDC had this effect....... Thus, orally administered DDC enhanced cadmium-induced duodenal and ileal tissue damage and inhibition of peristalsis, as indicated by an increased intestinal transit time. At low cadmium doses, the whole-body retention of cadmium was increased by oral DDC administration. Intraperitoneally administered...... DDC increased cadmium-induced acute mortality and testicular necrosis, and it enhanced cadmium-induced reduction of intestinal motility and increased the whole-body retention of cadmium, indicating increased intestinal cadmium absorption. Also, DDC changed the organ distribution of absorbed cadmium...

  11. Cadmium immobilization by hydroxyapatite

    Directory of Open Access Journals (Sweden)

    Smičiklas Ivana D.

    2003-01-01

    Full Text Available The contamination of air, soil and water by cadmium is a great environmental problem. If cadmium occurs in nature in ionic form, soluble in water, it easily enters into the food chain. Hydroxyapatite (HAP, Ca-o(POAe(OH2 is a sparingly soluble salt and an excellent matrix for the removal of heavy metals from solutions. Considerable research attention has been paid to the bond between Cc/2+ ions and synthetic hydroxyapatite of known composition. The sorption mechanism is complex. The dominant process is ion exchange, but surface adsorption, surface complexation and coprecipitation can also contribute to the overall mechanism. The sorption capacity depends on the characteristics of hydroxyapatite itself and on the experimental conditions. Under optimum conditions a maximum capacity of 0.8 mol Cd2+/mol HAP can be achieved. HAP is a potential sorbent for the remediation of contaminated water and soil, for industrial waste treatment, and it is also referenced as a material that can be used as a barrier around waste depositories.

  12. Cadmium colours: composition and properties

    Science.gov (United States)

    Paulus, J.; Knuutinen, U.

    The composition and the properties of cadmium aquarelle colours are discussed. The examined colours were 24 different aquarelle cadmium colours from six different manufacturers. The colours ranged from light, bright yellows to dark, deep-red tones. The aim of this research was to find out if the pigments contain cadmium salts: sulphides and/or selenides. This information will help in choosing watercolours in conservation processes. Today, aquarelle colours not containing cadmium pigments are being sold as cadmium colours; thus their properties might be different from actual cadmium colours. The aim of the research was to verify that the colour samples contained cadmium pigments and to estimate their compositions and ageing properties. Element analyses were performed from colour samples using micro-chemical tests and X-ray fluorescence measurements. Thin-layer chromatography was used for analysing gum Arabic as a possible binding medium in the chosen colour samples. Through ageing tests, the resistance of the colour samples to the exposure to light, heat and humidity was studied. Visible-light spectroscopy was used in determining the hues and hue changes of the aquarelle colour samples. The spectrophotometer used the CIE L*a*b* tone colour measuring system. From the colour measurements the changes in the lightness/darkness, the redness, the yellowness and the saturation of the samples were examined.

  13. Tositumomab and Iodine I 131 Tositumomab

    Science.gov (United States)

    This page contains brief information about tositumomab and iodine I 131 tositumomab and a collection of links to more information about the use of this drug combination, research results, and ongoing clinical trials.

  14. 28 CFR 13.1 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... Administration DEPARTMENT OF JUSTICE ATOMIC WEAPONS AND SPECIAL NUCLEAR MATERIALS REWARDS REGULATIONS § 13.1 Purpose. This part implements the responsibility given to the Attorney General under the Atomic Weapons... weapons and special nuclear material. ...

  15. Dicty_cDB: SLF131 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF131 (Link to dictyBase) - G22459 DDB0231642 Contig-U09191-1 SLF1...31P (Link to Original site) SLF131F 321 SLF131Z 552 SLF131P 873 - - Show SLF131 Library SL (Link to library) Clone ID SLF1...ontig-U09191-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLF1-B/SLF1...31Q.Seq.d/ Representative seq. ID SLF131P (Link to Original site) Representative DNA sequence >SLF131 (SLF131Q) /CSM/SL/SLF1...-B/SLF131Q.Seq.d/ GATTTTTGTGATTTGTTAAATAAAGCTGTGATGTTTTACAAAGTCCAACGTGCAGGTCGT TTACCAGA

  16. Dicty_cDB: CHR131 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR131 (Link to dictyBase) - - - Contig-U16471-1 - (Link to Original site) - - CHR...131Z 757 - - - - Show CHR131 Library CH (Link to library) Clone ID CHR131 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHR1-B/CHR131Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHR131 (CHR131Q) /CSM/CH/CHR1-B/CHR131Q.Seq.d/ XXXXXXXXXXTGAAAAT...A/SFC806Q.Seq.d/ 944 0.0 CHR131 (CHR131Q) /CSM/CH/CHR1-B/CHR131Q.Seq.d/ 944 0.0 CHQ337 (CHQ337Q) /CSM/CH/CHQ

  17. Association of total cancer and lung cancer with environmental exposure to cadmium: the meta-analytical evidence.

    Science.gov (United States)

    Nawrot, Tim S; Martens, Dries S; Hara, Azusa; Plusquin, Michelle; Vangronsveld, Jaco; Roels, Harry A; Staessen, Jan A

    2015-09-01

    Recent studies are indicative of substantial progress in understanding the dose-response relation between the incidence of total and lung cancer and environmental cadmium exposure. We conducted a meta-analysis of population studies that examined the risk of cancer in relation to lifetime exposure to cadmium. We searched MEDLINE, Web of Science, and relevant reviews until August 2014 for studies on the association between cancer risk and cadmium exposure. Eligible studies had to include an estimate of lifetime exposure to cadmium as reflected by the urinary cadmium concentration and adjustment of the cancer risk at least for age and smoking. We pooled relative risk across the studies estimates for cancer and lung cancer using variance-weighted random-effect models and expressed association sizes for a twofold increase in urinary cadmium, thereby respecting the continuous nature of the association. The meta-analysis included 20,459 participants from three prospective population studies. The average urinary cadmium concentration across populations ranged from 0.25 to 0.93 µg/g creatinine. The relative risk of total cancer, associated with a doubling of the urinary cadmium concentration, ranged across the different studies from 1.18 to 1.31, and the pooled relative risk was 1.22 (95% CI 1.13-1.31; p cancer, the relative risk ranged from 1.21 to 1.70 for a doubling of the urinary cadmium concentration, while the pooled relative risk amounted to 1.68 (1.47-1.92; p cancer and lung cancer.

  18. Zinc-induced protection against cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Early, J.L.; Schnell, R.C.

    1978-02-01

    Pretreatment of male rats with cadmium acetate potentiates the duration of hexobarbital hypnosis and inhibits the rate of hepatic microsomal drug metabolism. Pretreatment of rats with zinc acetate protects against these alterations in drug action elicited by cadmium.

  19. Cadmium uptake by plants

    Energy Technology Data Exchange (ETDEWEB)

    Haghiri, F.

    1973-01-01

    Absorption of /sup 115m/Cd by soybean (Gylcine max l.) plants via foliar and root systems and translocation into the seed was determined. The uptake of /sup 115m/Cd by soybeans via the root system was more efficient than that of the foliar placement. Growth and Cd concentrations of soybean and wheat (Triticum aestivum l.) tops were influenced by soil-applied Cd. In both crops, the Cd concentration of plant tops increased while yield decreased with increasing levels of applied Cd. Cadmium toxicitiy began to occur in both crops at the lowest level of soil applied Cd (2.5 ppM). With soybean plants, Cd toxicity symptoms resembled fe chlorosis. For wheat plants there were no visual symptoms other than the studied growth. The relative concentration of Cd found in several vegetable crops varied depending on the plant species. The relative Cd concentration in descending order for various vegetables was lettuce (Lactuca sativa l.) > radish top (Raphanus sativus l.) > celery stalk (Apium graveolens l.) > celery leaves greater than or equal to green pepper (Capsicum frutescens l.) > radish roots.

  20. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    In Denmark and EU the exposure of cadmium from food is at a level that is relatively close to the Tolerable Daily Intake (TDI). This report describes an investigation of the bioavailability of cadmium in selected food items known to contain high levels of cadmium. The purpose was to provide data ...... or crushed linseed nor the intake of cocoa and chocolate....

  1. 14 CFR 151.131 - Forms.

    Science.gov (United States)

    2010-01-01

    ...- ance to be executed by the sponsor and certified by its attorney. (b) Advance planning agreement, FAA... AID TO AIRPORTS Rules and Procedures for Advance Planning and Engineering Proposals § 151.131 Forms. The forms used for the purpose of obtaining an advance planning and engineering grant are as follows...

  2. 21 CFR 131.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION MILK AND CREAM General Provisions § 131.3 Definitions. (a) Cream means the liquid milk product high in fat separated from milk, which may have been adjusted by adding thereto: Milk, concentrated...

  3. Cytogenetic study on {sup 131} Iodine effects

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, Claudia Lopes; Mello, Rossana Corbo; Gutfilen, Bianca [Hospital Universitario Clementino Fraga Filho, Rio de Janeiro, RJ (Brazil). Dept. de Radiologia; Aranha, Ivar Pinheiro [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Dept. de Biologia Celular e Genetica

    2001-07-01

    There are no conclusive results, to these days, on the effect of {sup 131} I dosage used in scintigraphy on thyroid patients. The aim of this study was to evaluate the effect of that dosage on human lymphocyte chromosomes. Cells from 21 patients were placed in 1640 RPMI medium with bovine calf serum and incubated for 48 and 72 h at 37 deg C. Blood was collected 24 hours after administration of the radioisotope. Blood collected from the same patients prior to the administration of {sup 131} I was used as control. Chromosomes were stained with Giemsa Gurr 2% pH=6.8 and analyzed under optical microscope. Of the 6,300 metaphases analyzed from the 48 h cultures, 1,146 gaps and 682 breaks were found, in the test group. Of the 6,300 analyzed from the control group, 291 gaps and 119 breaks were observed. In the 72 h cultures, of 6,300 metaphases analyzed, 216 gaps and 52 breaks were found in the test group. Of 6,300 metaphases analyzed from the control group, 10 gaps and no breaks were found. These results were significant in a paired t-test (p < 0,05). Our results show that {sup 131} I is responsible for the observed chromosome alterations. We suggest re-evaluating the use of {sup 131} I, mainly on those patients at fertile age. (author)

  4. 14 CFR 13.131 - Other procedures.

    Science.gov (United States)

    2010-01-01

    ... Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES INVESTIGATIVE AND ENFORCEMENT PROCEDURES Formal Fact-Finding Investigation Under an Order of Investigation § 13.131 Other procedures. Any question concerning the scope or conduct of a formal investigation not...

  5. Removal of cadmium from acidic phosphatic solutions

    Energy Technology Data Exchange (ETDEWEB)

    Frankenfeld, K.; Brodt, P.; Eich, G.; Ruschke, P.

    1985-01-08

    The invention is concerned with a process of removing cadmium from acid, especially P/sub 2/O/sub 5/-containing solutions by liquid/liquid extraction with the aid of alkyl amine salts that are dissolved in an inert, organic solvent. The cadmium ions are removed from the acid, aqueous phase and are enriched in the organic phase. The cadmium-containing organic phase, subsequently, is re-extracted with an aqueous salt solution, with the cadmium ions migrating from the organic phase into the aqueous phase. The process is particularly suitable for extracting cadmium from concentrated, highly acid aqueous solutions.

  6. Magnesium supplements affect selected cadmium toxic actions and uptake of repeated doses of cadmium

    Directory of Open Access Journals (Sweden)

    Grosicki Andrzej

    2015-12-01

    Full Text Available The importance of magnesium supplements on organ retention of cadmium and allometric parameters after repeated exposure to cadmium chloride were studied in male Wistar rats. Magnesium chloride was given via drinking water (500 mg Mg/L to rats exposed intragastrically to cadmium chloride (labelled with cadmium 109 at a daily dose corresponding to 25 mg/kg diet for 7, 14, 21, and 28 d. Supplements of magnesium temporarily decreased cadmium retention in the duodenum and liver. No significant differences in cadmium retention were evidenced in the kidneys and testicles. The supplements of magnesium also retain more of the body weight gains and restore the relative liver and testicle weight in rats intoxicated with cadmium. Comparison of the present results with earlier reports suggests a relationship between doses of magnesium and cadmium; higher doses of cadmium need more magnesium to overcome toxic action of the heavy metal.

  7. Isolation, identification and cadmium adsorption of a high cadmium ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-27

    Sep 27, 2010 ... P. chrysosporium was used to biosorp cadmium (II), lead (II), copper (II) and the adsorption capacities reached 23.04, 69.77 and 20.33mg/g dry biomass, respectively (Say et al. 2001). The maximum experimental biosorption capacities for entrapped live and dead fungal mycelia of L. sajur-caju were found ...

  8. Aplicaciones clínicas del radioyodo 131 (I131 en las enfermedades del tiroides Clinical applications of radioiodine 131 (I131 in the thyroid diseases

    Directory of Open Access Journals (Sweden)

    Levi González Rivero

    2012-12-01

    Full Text Available El radioyodo 131 es un isótopo radioactivo que se emplea exitosamente en el diagnóstico y tratamiento de las enfermedades benignas y malignas del tiroides. Su propiedad de integrarse selectivamente al metabolismo del tiroides y emitir una señal, le permite describir el funcionamiento glandular mediante estudios de captación, y delimitar la morfología y localización de los tejidos que capten yodo, a través de la gammagrafía. Es además una radioterapia sencilla, segura y coste-efectiva, usada como primera línea terapéutica en el control del hipertiroidismo, cuya dosis y momento de aplicación debería individualizarse según la etiología y la clínica de cada paciente. El radioyodo 131 ofrece una alternativa eficaz para reducir el tamaño del bocio no tóxico; además, respalda el tratamiento quirúrgico del carcinoma diferenciado del tiroides, y destruye a dosis ablativa los restos tisulares y las lesiones metastásicas que puede identificar durante el seguimiento gammagráfico. El empleo de radioyodo 131 está sujeto al cumplimiento de regulaciones de protección contra la radioactividad.Radioiodine 131 is a radioactive isotope that is successfully used for the diagnosis and the treatment of benign and malignant thyroid diseases. Its quality of selectively integrating to the thyroid metabolism and emitting a signal allows it to describe the gland functioning through capture studies, and to delimit the morphology and location of the tissues that capture iodine by means of gammagraphy. It is also a simple, safe and cost-effective radiotherapy used as first-line therapeutics in the control of hyperthyroidism. The dose and right time of application should be individualized according to the etiology and the clinic of each patient. Radioiodine 131 offers an efficient alternative to reduce the size of non-toxic goiter in addition to supporting the surgical treatment of the differentiated thyroid carcinoma and destroying with ablative doses

  9. Mechanisms of cadmium induced genomic instability

    Energy Technology Data Exchange (ETDEWEB)

    Filipic, Metka, E-mail: metka.filipic@nib.si [National Institute of Biology, Department for Genetic Toxicology and Cancer Biology, Ljubljana (Slovenia)

    2012-05-01

    Cadmium is an ubiquitous environmental contaminant that represents hazard to humans and wildlife. It is found in the air, soil and water and, due to its extremely long half-life, accumulates in plants and animals. The main source of cadmium exposure for non-smoking human population is food. Cadmium is primarily toxic to the kidney, but has been also classified as carcinogenic to humans by several regulatory agencies. Current evidence suggests that exposure to cadmium induces genomic instability through complex and multifactorial mechanisms. Cadmium dose not induce direct DNA damage, however it induces increase in reactive oxygen species (ROS) formation, which in turn induce DNA damage and can also interfere with cell signalling. More important seems to be cadmium interaction with DNA repair mechanisms, cell cycle checkpoints and apoptosis as well as with epigenetic mechanisms of gene expression control. Cadmium mediated inhibition of DNA repair mechanisms and apoptosis leads to accumulation of cells with unrepaired DNA damage, which in turn increases the mutation rate and thus genomic instability. This increases the probability of developing not only cancer but also other diseases associated with genomic instability. In the in vitro experiments cadmium induced effects leading to genomic instability have been observed at low concentrations that were comparable to those observed in target organs and tissues of humans that were non-occupationally exposed to cadmium. Therefore, further studies aiming to clarify the relevance of these observations for human health risks due to cadmium exposure are needed.

  10. 27 CFR 19.131 - Restrictions as to locations.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Restrictions as to locations. 19.131 Section 19.131 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTILLED SPIRITS PLANTS Location and Use § 19.131...

  11. 19 CFR 181.131 - Rules of origin.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Rules of origin. 181.131 Section 181.131 Customs... (CONTINUED) NORTH AMERICAN FREE TRADE AGREEMENT Rules of Origin § 181.131 Rules of origin. (a) The regulations effective October 1, 1995, implementing the rules of origin provisions of General Note 12, HTSUS...

  12. 46 CFR 131.525 - Emergency lighting and power.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Emergency lighting and power. 131.525 Section 131.525..., Drills, and Inspections § 131.525 Emergency lighting and power. (a) The master of each vessel shall ensure that the emergency lighting and power systems are tested at least once each week that the vessel...

  13. 46 CFR 131.935 - Prevention of oil pollution.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Prevention of oil pollution. 131.935 Section 131.935... Miscellaneous § 131.935 Prevention of oil pollution. Each vessel must be operated in compliance with— (a) Section 311 of the Federal Water Pollution Control Act, as amended (33 U.S.C. 1321); and (b) 33 CFR parts...

  14. 9 CFR 2.131 - Handling of animals.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Handling of animals. 2.131 Section 2.131 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.131 Handling of animals. (a) All licensees who maintain wild...

  15. 12 CFR 225.131 - Activities closely related to banking.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Activities closely related to banking. 225.131 Section 225.131 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL... Holding Companies Interpretations § 225.131 Activities closely related to banking. (a) Bank management...

  16. Merkel cell carcinoma and iodine-131 metaiodobenzylguanidine scan

    Energy Technology Data Exchange (ETDEWEB)

    Castagnoli, A.; Biti, G.; De Cristofaro, M.T.R.; Papi, M.G. (Florence Univ. (Italy). Dipt. di Fisiopatologia); Ferri, P. (Florence Univ. (Italy). U.O. Medicina Nuclear USL 10D); Magrini, S.M. (Florence Univ. (Italy). U.O. Radioterapia USL 10D); Bianchi, S. (Florence Univ. (Italy). Ist. di Anatomia Patologica)

    1992-10-01

    Two cases of Merkel cell carcinoma, a neuroendocrine neoplasia of the skin, investigated with iodine, 131 metaiodobenzylguanidine ({sup 131}I-mIBG) scintigraphy, are reported. Uptake in the tumor was evident only in 1 case. The possible diagnostic and therapeutic role of {sup 131}I-mIBG in patients with this rare neoplasm is discussed. (orig.).

  17. 46 CFR 131.965 - Sounding of whistle.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Sounding of whistle. 131.965 Section 131.965 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.965 Sounding of whistle. No vessel may sound its whistle within any harbor limits of the...

  18. 46 CFR 131.555 - Spare parts and repair equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Spare parts and repair equipment. 131.555 Section 131... OPERATIONS Tests, Drills, and Inspections § 131.555 Spare parts and repair equipment. Spare parts and repair... wear or consumption or needs to be replaced regularly. These parts and equipment must be kept aboard...

  19. 46 CFR 131.960 - Use of auto-pilot.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Use of auto-pilot. 131.960 Section 131.960 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.960 Use of auto-pilot. When the automatic pilot is used in areas of high traffic density...

  20. 46 CFR 131.805 - General alarm bell, switch.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false General alarm bell, switch. 131.805 Section 131.805 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.805 General alarm bell, switch. The switch in the...

  1. 21 CFR 131.162 - Acidified sour cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Acidified sour cream. 131.162 Section 131.162 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.162 Acidified sour cream. (a) Description. Acidified sour cream results from the souring of pasteurized cream...

  2. 21 CFR 131.157 - Light whipping cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light whipping cream. 131.157 Section 131.157 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.157 Light whipping cream. (a) Description. Light whipping cream is cream which contains not less than 30 percent but...

  3. 46 CFR 131.940 - Marine sanitation device.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Marine sanitation device. 131.940 Section 131.940... Miscellaneous § 131.940 Marine sanitation device. Each vessel with installed toilet facilities must have a marine sanitation device in compliance with 33 CFR part 159. ...

  4. 46 CFR 131.835 - Portable fire extinguishers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Portable fire extinguishers. 131.835 Section 131.835... Markings for Fire Equipment and Emergency Equipment § 131.835 Portable fire extinguishers. (a) Except as provided by paragraph (b) of this section, ach portable fire extinguisher must be marked with a number, and...

  5. 27 CFR 70.131 - Conditions to allowance.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Conditions to allowance. 70.131 Section 70.131 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Excise and Special (Occupational) Tax Rule of Special Application § 70.131 Conditions to allowance. (a...

  6. 46 CFR 131.945 - Display of plans.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Display of plans. 131.945 Section 131.945 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.945 Display of plans. Each vessel must have a permanently exhibited, for the guidance of the...

  7. Bioaccumulation of cadmium by growing Zygosaccharomyces rouxii and Saccharomyces cerevisiae.

    Science.gov (United States)

    Li, Chunsheng; Jiang, Wei; Ma, Ning; Zhu, Yinglian; Dong, Xiaoyan; Wang, Dongfeng; Meng, Xianghong; Xu, Ying

    2014-03-01

    Bioaccumulation via growing cells is a potential technique for heavy metal removal from food materials. The cadmium bioaccumulation characteristics by growing Zygosaccharomyces rouxii and Saccharomyces cerevisiae were investigated. Z. rouxii displayed powerful cadmium removal ability at low cadmium concentrations, which mainly depended on the intracellular cadmium bioaccumulation. The percentage of intracellular cadmium bioaccumulation of both yeasts obviously decreased with the increase of initial biomass and cadmium concentrations. Low pH and elevated concentrations of zinc and copper significantly decreased the intracellular cadmium bioaccumulation of both yeasts but improved the cadmium tolerance and the cell-surface cadmium bioaccumulation of Z. rouxii. Cadmium removal of Z. rouxii was improved by zinc and copper conditionally. Z. rouxii that possessed more powerful cadmium tolerance and removal ability at low pH and high concentration of competing ions can be developed into a potential cadmium removal agent using in complex food environment in future. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Cadmium content of plants as affected by soil cadmium concentration

    Energy Technology Data Exchange (ETDEWEB)

    Lehoczky, E. [Pannon Univ. of Agricultural Sciences, Keszthely (Hungary); Szabados, I.; Marth, P. [Plant Health and Soil Conservation Station, Higany (Hungary)

    1996-12-31

    Pot experiments were conducted in greenhouse conditions to study the effects of increasing cadmium (Cd) levels on biomass production and Cd contents in corn, (Zea mays L.), garlic (Allium sativum L.), and spinach (Spinacia oleracea L.). Plants were grown in two soil types: Eutric cambisol soil and A gleyic luvisol soil. Spinach proved to be the most sensitive to Cd treatments as its biomass considerably decreased with the increasing Cd levels. Cadmium contents of the three crops increased with increasing levels of Cd applications. Statistical differences were observed in the Cd contents of crops depending on soil type. With the same Cd rates, Cd tissue concentration of test plants grown in the strongly acidic Gleyic luvisol soil were many times higher than that of plants grown in a neutral Eutric cambisol soil. 14 refs., 4 tabs.

  9. Cadmium and Cadmium/Zinc Ratios and Tobacco-Related Morbidities

    Science.gov (United States)

    Richter, Patricia; Faroon, Obaid; Pappas, R. Steven

    2017-01-01

    Metals are one of five major categories of carcinogenic or toxic constituents in tobacco and tobacco smoke. Cadmium is highly volatile and a higher percentage of the total tobacco cadmium content is efficiently transferred to mainstream tobacco smoke than many other toxic metals in tobacco. Inhaled cadmium bioaccumulates in the lungs and is distributed beyond the lungs to other tissues, with a total body biological half-life of one to two decades. Chronic cadmium exposure through tobacco use elevates blood and urine cadmium concentrations. Cadmium is a carcinogen, and an inducer of proinflammatory immune responses. Elevated exposure to cadmium is associated with reduced pulmonary function, obstructive lung disease, bronchogenic carcinoma, cardiovascular diseases including myocardial infarction, peripheral arterial disease, prostate cancer, cervical cancer, pancreatic cancer, and various oral pathologies. Cadmium and zinc have a toxicologically inverse relationship. Zinc is an essential element and is reportedly antagonistic to some manifestations of cadmium toxicity. This review summarizes associations between blood, urine, and tissue cadmium concentrations with emphasis on cadmium exposure due to tobacco use and several disease states. Available data about zinc and cadmium/zinc ratios and tobacco-related diseases is summarized from studies reporting smoking status. Collectively, data suggest that blood, urine, and tissue cadmium and cadmium/zinc ratios are often significantly different between smokers and nonsmokers and they are also different in smokers for several diseases and cancers. Additional biomonitoring data such as blood or serum and urine zinc and cadmium levels and cadmium/zinc ratios in smokers may provide further insight into the development and progression of diseases of the lung, cardiovascular system, and possibly other organs. PMID:28961214

  10. Cadmium and Cadmium/Zinc Ratios and Tobacco-Related Morbidities.

    Science.gov (United States)

    Richter, Patricia; Faroon, Obaid; Pappas, R Steven

    2017-09-29

    Metals are one of five major categories of carcinogenic or toxic constituents in tobacco and tobacco smoke. Cadmium is highly volatile and a higher percentage of the total tobacco cadmium content is efficiently transferred to mainstream tobacco smoke than many other toxic metals in tobacco. Inhaled cadmium bioaccumulates in the lungs and is distributed beyond the lungs to other tissues, with a total body biological half-life of one to two decades. Chronic cadmium exposure through tobacco use elevates blood and urine cadmium concentrations. Cadmium is a carcinogen, and an inducer of proinflammatory immune responses. Elevated exposure to cadmium is associated with reduced pulmonary function, obstructive lung disease, bronchogenic carcinoma, cardiovascular diseases including myocardial infarction, peripheral arterial disease, prostate cancer, cervical cancer, pancreatic cancer, and various oral pathologies. Cadmium and zinc have a toxicologically inverse relationship. Zinc is an essential element and is reportedly antagonistic to some manifestations of cadmium toxicity. This review summarizes associations between blood, urine, and tissue cadmium concentrations with emphasis on cadmium exposure due to tobacco use and several disease states. Available data about zinc and cadmium/zinc ratios and tobacco-related diseases is summarized from studies reporting smoking status. Collectively, data suggest that blood, urine, and tissue cadmium and cadmium/zinc ratios are often significantly different between smokers and nonsmokers and they are also different in smokers for several diseases and cancers. Additional biomonitoring data such as blood or serum and urine zinc and cadmium levels and cadmium/zinc ratios in smokers may provide further insight into the development and progression of diseases of the lung, cardiovascular system, and possibly other organs.

  11. Cadmium and Cadmium/Zinc Ratios and Tobacco-Related Morbidities

    Directory of Open Access Journals (Sweden)

    Patricia Richter

    2017-09-01

    Full Text Available Metals are one of five major categories of carcinogenic or toxic constituents in tobacco and tobacco smoke. Cadmium is highly volatile and a higher percentage of the total tobacco cadmium content is efficiently transferred to mainstream tobacco smoke than many other toxic metals in tobacco. Inhaled cadmium bioaccumulates in the lungs and is distributed beyond the lungs to other tissues, with a total body biological half-life of one to two decades. Chronic cadmium exposure through tobacco use elevates blood and urine cadmium concentrations. Cadmium is a carcinogen, and an inducer of proinflammatory immune responses. Elevated exposure to cadmium is associated with reduced pulmonary function, obstructive lung disease, bronchogenic carcinoma, cardiovascular diseases including myocardial infarction, peripheral arterial disease, prostate cancer, cervical cancer, pancreatic cancer, and various oral pathologies. Cadmium and zinc have a toxicologically inverse relationship. Zinc is an essential element and is reportedly antagonistic to some manifestations of cadmium toxicity. This review summarizes associations between blood, urine, and tissue cadmium concentrations with emphasis on cadmium exposure due to tobacco use and several disease states. Available data about zinc and cadmium/zinc ratios and tobacco-related diseases is summarized from studies reporting smoking status. Collectively, data suggest that blood, urine, and tissue cadmium and cadmium/zinc ratios are often significantly different between smokers and nonsmokers and they are also different in smokers for several diseases and cancers. Additional biomonitoring data such as blood or serum and urine zinc and cadmium levels and cadmium/zinc ratios in smokers may provide further insight into the development and progression of diseases of the lung, cardiovascular system, and possibly other organs.

  12. Relations between liver cadmium, cumulative exposure, and renal function in cadmium alloy workers.

    OpenAIRE

    Mason, H. J.; Davison, A G; Wright, A. L.; Guthrie, C J; Fayers, P M; Venables, K M; Smith, N J; Chettle, D R; Franklin, D M; Scott, M. C.

    1988-01-01

    Detailed biochemical investigations of renal function were made on 75 male workers exposed to cadmium and an equal number of referents matched for age, sex, and employment status. The exposed group consisted of current and retired workers who had been employed in the manufacture of copper-cadmium alloy at a single factory in the United Kingdom for periods of up to 39 years and for whom cumulative cadmium exposure indices could be calculated. In vivo measurements of liver and kidney cadmium bu...

  13. Cadmium resistance in Drosophila: a small cadmium binding substance

    Energy Technology Data Exchange (ETDEWEB)

    Jacobson, K.B.; Williams, M.W.; Richter, L.J.; Holt, S.E.; Hook, G.J.; Knoop, S.M.; Sloop, F.V.; Faust, J.B.

    1985-01-01

    A small cadmium-binding substance (CdBS) has been observed in adult Drosophila melanogaster that were raised for their entire growth cycle on a diet that contained 0.15 mM CdCl/sub 2/. Induction of CdBS was observed in strains that differed widely in their sensitivity of CdCl/sub 2/. This report describes the induction of CdBS and some of its characteristics. 17 refs., 4 figs., 1 tab.

  14. [Effects of cadmium on testis function].

    Science.gov (United States)

    Martynowicz, Helena; Skoczyńska, Anna; Karczmarek-Wdowiak, Beata; Andrzejak, Ryszard

    2005-01-01

    The deterioration of male fertility, reported in numerous epidemiological studies over past decades, can be connected with growing exposure to environmental toxins. Heavy metals, especially cadmium, is widely spread and extremely toxic. The mechanisms of cadmium toxic effects vary and involve the damage of vascular endothelium, intracellular junctions, germ cells, Leydig and Sertoli cells. Cadmium can increase activity of reactive oxygen species and induce changes in activity of enzymatic systems and inflammatory reactions. The morphological changes caused by cadmium included the necrosis of seminiferous tubiles and interstitial edema. This metal can reduce testosterone synthesis at various levels and deteriorate spermatogenesis. Cadmium is also acknowledged carcinogen with confirmed mutagenic and genotoxic activity. Increasing environmental exposure to cadmium, currently existing occupational exposure and the prevalence of tobacco smoking results in constant increase in the number of diagnosed fertility impairments.

  15. Electrodialytic Removal of Cadmium from Straw Ash

    DEFF Research Database (Denmark)

    Hansen, Henrik; Ottosen, Lisbeth M.; Villumsen, Arne

    1999-01-01

    A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days of remed......A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days...

  16. Interplay of calcium and cadmium in mediating cadmium toxicity.

    Science.gov (United States)

    Choong, Grace; Liu, Ying; Templeton, Douglas M

    2014-03-25

    The environmentally important toxic metal, cadmium, exists as the Cd(2+) ion in biological systems, and in this state structurally resembles Ca(2+). Thus, although cadmium exerts a broad range of adverse actions on cells by virtue of its propensity to bind to protein thiol groups, it is now well appreciated that Cd(2+) participates in a number of Ca(2+)-dependent pathways, attributable to its actions as a Ca(2+) mimetic, with a central role for calmodulin, and the Ca(2+)/calmodlin-dependent protein kinase II (CaMK-II) that mediates effects on cytoskeletal dynamics and apoptotic cell death. Cadmium interacts with receptors and ion channels on the cell surface, and with the intracellular estrogen receptor where it binds competitively to residues shared by Ca(2+). It increases cytosolic [Ca(2+)] through several mechanisms, but also decreases transcript levels of some Ca(2+)-transporter genes. It initiates mitochondrial apoptotic pathways, and activates calpains, contributing to mitochondria-independent apoptosis. However, the recent discovery of the role CaMK-II plays in Cd(2+)-induced cell death, and subsequent implication of CaMK-II in Cd(2+)-dependent alterations of cytoskeletal dynamics, has opened a new area of mechanistic cadmium toxicology that is a focus of this review. Calmodulin is necessary for induction of apoptosis by several agents, yet induction of apoptosis by Cd(2+) is prevented by CaMK-II block, and Ca(2+)-dependent phosphorylation of CaMK-II has been linked to increased Cd(2+)-dependent apoptosis. Calmodulin antagonism suppresses Cd(2+)-induced phosphorylation of Erk1/2 and the Akt survival pathway. The involvement of CaMK-II in the effects of Cd(2+) on cell morphology, and particularly the actin cytoskeleton, is profound, favouring actin depolymerization, disrupting focal adhesions, and directing phosphorylated FAK into a cellular membrane. CaMK-II is also implicated in effects of Cd(2+) on microtubules and cadherin junctions. A key question for

  17. Methodology to administer therapeutic dose of I-131; Metodologia para administrar dosis terapeutica de I-131

    Energy Technology Data Exchange (ETDEWEB)

    Basteris M, J.; Gomez D, R. [Universidad Autonoma de Yucatan, Facultad de Medicina, Merida, Yucatan (Mexico)

    2007-07-01

    The present work suggests the use of measures guided to eliminate the resulting chronic sialoadenitis of the treatment of the thyroid cancer with Iodine-131, as well as the use of citric fruits to stimulate the salivation, the post-dose administration of liquids to accelerate the gastric emptying avoiding the secondary effects as the vomit is included. (Author)

  18. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 28; Issue 3. Zone refining of cadmium and related characterization. N R Munirathnam ... The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma optical ...

  19. Cadmium Toxicity to Ringed Seals (Phoca hispida)

    DEFF Research Database (Denmark)

    Sonne, Christian; Dietz, R.; Riget, F. F.

    Cadmium concentrations in kidneys from ringed seals (Phoca hispida) from North West Greenland (Qaanaaq) are high. Concentrations range at level known to induce renal toxic effects (mainly tubulopathy) and demineralisation (osteopenia) of the skeletal system (Fanconi's Syndrome) in humans as well...... the absence of toxic effects of cadmium in ringed seal...

  20. Subcellular localization of cadmium in hyperaccumulator Populus ...

    African Journals Online (AJOL)

    ... of damage to organs of grey poplar was as follows: root > stem> leaves. It was suggested that the Populus × canescens as a renewable resource has the potential to decontaminate cadmium stress development, accumulation and distribution. Key words: Cadmium, phytoremediation, hyperaccumulator, grey poplar, organ.

  1. REMOVAL OF CADMIUM FROM AQUEOUS SOLUTION USING ...

    African Journals Online (AJOL)

    The uptake of cadmium from aqueous solution appeared to follow adsorption mechanism and not ion exchange as characteristic of many other divalent hexacyanoferrates. The sorption data were fitted with Langmuir adsorption isotherm. KEY WORDS: Cadmium removal, Potassium manganese hexacynoferrates(II)/(III) Bull.

  2. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    Unknown

    Abstract. We present the zone refining results of cadmium using horizontal resistive zone refiner under constant flow of moisture free hydrogen gas. The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma ...

  3. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene (cadA4) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette (cadA4C), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation.IMPORTANCEListeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and tolerate

  4. Volatility of radiopharmacy-prepared sodium iodide-131 capsules.

    Science.gov (United States)

    Bright, J M; Rees, T T; Baca, L E; Green, R L

    2000-03-01

    The aims of this study were to quantify the extent of volatilization from 131I-NaI therapeutic capsules prepared in a centralized radiopharmacy and to quantify the amount of volatile 131I released from a dispensing vial containing a compounded 131I-NaI therapy capsule. Therapy capsules were prepared by injecting 131I oral solution into capsules containing anhydrous dibasic sodium phosphate. Volatilized activity was obtained by filtering air drawn across samples that were placed open on the bottom of a sample holder cup. Volatile 131I was captured by filtering it through 3 triethylenediamine-impregnated carbon cartridge filters, arranged in series. To quantify the amount of volatile 131I released from a dispensing vial during a simulated patient administration, a vial containing a compounded 131I therapy capsule was opened inside a collapsible plastic bag and all the air was drawn across TEDA-impregnated carbon cartridge filters. The 370-MBq (10-mCi) 131I capsules from the first part of the experiment released an average of 0.035% (SD 0.031%) of the capsule activity on the first day, 0.012% (SD 0.002%) on the second day, and 0.012% (SD < 0.001%) for days 3 through 5. The 37-MBq (1-mCi) 131I capsules released an average of 0.058% (SD 0.025%) on the first day, 0.029% (SD 0.009%) on the second day, and 0.020% (SD 0.004%) on the third day. The activity released from the vial during a simulated patient administration was 0.00093% of the 131I capsule activity. The amount of 131I, which volatilized daily from the exposed therapy capsules, was a small percentage of the capsule activity. The volatile 131I that would be released during a patient administration was much less than the activity that volatilized from the exposed therapy capsules.

  5. Cadmium mobility and accumulation in soils of the European Communities

    NARCIS (Netherlands)

    Fraters B; van Beurden AUCJ

    1993-01-01

    In this overview of the effects of cadmium pollution on agricultural soils in the European Community, both the cadmium loads on agricultural land and the soil sensitivity to cadmium accumulation have been estimated. Cadmium loads have been estimated separately for arable land and grassland. The

  6. Escherichia coli ST131, an intriguing clonal group.

    Science.gov (United States)

    Nicolas-Chanoine, Marie-Hélène; Bertrand, Xavier; Madec, Jean-Yves

    2014-07-01

    In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extraintestinal pathogenic E. coli (ExPEC) isolates worldwide. Retrospective studies have suggested that it may originally have risen to prominence as early as 2003. Unlike other classical group B2 ExPEC isolates, ST131 isolates are commonly reported to produce extended-spectrum β-lactamases, such as CTX-M-15, and almost all are resistant to fluoroquinolones. Moreover, ST131 E. coli isolates are considered to be truly pathogenic, due to the spectrum of infections they cause in both community and hospital settings and the large number of virulence-associated genes they contain. ST131 isolates therefore seem to contradict the widely held view that high levels of antimicrobial resistance are necessarily associated with a fitness cost leading to a decrease in pathogenesis. Six years after the first description of E. coli ST131, this review outlines the principal traits of ST131 clonal group isolates, based on the growing body of published data, and highlights what is currently known and what we need to find out to provide public health authorities with better information to help combat ST131. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Escherichia coli ST131, an Intriguing Clonal Group

    Science.gov (United States)

    Bertrand, Xavier; Madec, Jean-Yves

    2014-01-01

    SUMMARY In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extraintestinal pathogenic E. coli (ExPEC) isolates worldwide. Retrospective studies have suggested that it may originally have risen to prominence as early as 2003. Unlike other classical group B2 ExPEC isolates, ST131 isolates are commonly reported to produce extended-spectrum β-lactamases, such as CTX-M-15, and almost all are resistant to fluoroquinolones. Moreover, ST131 E. coli isolates are considered to be truly pathogenic, due to the spectrum of infections they cause in both community and hospital settings and the large number of virulence-associated genes they contain. ST131 isolates therefore seem to contradict the widely held view that high levels of antimicrobial resistance are necessarily associated with a fitness cost leading to a decrease in pathogenesis. Six years after the first description of E. coli ST131, this review outlines the principal traits of ST131 clonal group isolates, based on the growing body of published data, and highlights what is currently known and what we need to find out to provide public health authorities with better information to help combat ST131. PMID:24982321

  8. Mercury, lead, and cadmium in blue crabs, Callinectes sapidus, from the Atlantic coast of Florida, USA: a multipredator approach.

    Science.gov (United States)

    Adams, Douglas H; Engel, Marc E

    2014-04-01

    Blue crabs, Callinectes sapidus, from the Atlantic coast of Florida were analyzed for total mercury, methylmercury, lead, and cadmium. Paired samples of two tissue types were analyzed for each crab, (1) muscle tissue (cheliped and body muscles) and (2) whole-body tissue (all organs, muscle tissue and connective tissue), for evaluation of the concentration of metals available to human consumers as well as estuarine predators. There were clear patterns of tissue-specific partitioning for each metal. Total mercury was significantly greater in muscle tissue (mean=0.078 µg/g) than in whole-body tissue (mean=0.055 µg/g). Conversely, whole-body concentrations of lead and cadmium (means=0.131 and 0.079 µg/g, respectively) were significantly greater than concentrations in muscle (means=0.02 and 0.029 µg/g, respectively). There were no significant correlations between any metal contaminant and crab size. Cadmium levels were significantly greater in the muscle tissue of females, but, no other sex-related differences were seen for other metals or tissue types. Methylmercury composed 93-100% of the total mercury in tissues. Compared to previous blue crab studies from different regions of the United States, mean concentrations of mercury, lead, and cadmium were relatively low, although isolated groups or individual blue crabs accumulated high metal concentrations. © 2013 Published by Elsevier Inc.

  9. Cadmium action in synapses in the brain

    Energy Technology Data Exchange (ETDEWEB)

    Minami, Akira; Takeda, Atsushi; Nishibaba, Daisuke; Tekefuta, Sachiyo; Oku, Naoto [Department of Radiobiochemistry, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka (Japan)

    2001-05-01

    Chronic exposure to cadmium causes central nervous system disorders, e.g., olfactory dysfunction. To clarify cadmium toxicity in synaptic neurotransmission in the brain, the movement and action of cadmium in the synapses was examined using in vivo microdialysis. One and 24 h after injection of {sup 109}CdCl{sub 2} into the amygdala of rats, {sup 109}Cd release into the extracellular space was facilitated by stimulation with high K{sup +}, suggesting that cadmium taken up in amygdalar neurons is released into the synaptic clefts in a calcium- and impulse-dependent manner. To examine the action of cadmium in the synapses, the amygdala was perfused with artificial cerebrospinal fluid containing 10-30 {mu}M CdCl{sub 2}. The release of excitatory neurotransmitters, i.e., glutamate and aspartate, into the extracellular space was decreased during perfusion with cadmium, while the release of inhibitory neurotransmitters, i.e., glycine and {gamma}-amino butyric acid (GABA), into the extracellular space was increased during the period. These results suggest that cadmium released from the amygdalar neuron terminals affects the degree and balance of excitation-inhibition in synaptic neurotransmission. (author)

  10. Response of Pleurotus ostreatus to cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    Favero, N.; Bressa, G.; Costa, P. (Univ. of Padua (Italy))

    1990-08-01

    The possibility of utilizing agroindustrial wastes in the production of edible, high-quality products (e.g., mushrooms) implies the risk of bringing toxic substances, such as heavy metals, into the human food chain. Thus, growth in the presence of cadmium and cadmium accumulation limits have been studied in the industrially cultivated fungus P. ostreatus. Fruit body production is substantially unaffected in the presence of 25, 139, and 285 mg Cd/kg of dried substrate. Cadmium concentration in fruit bodies is related to cadmium substrate level, the metal being present at higher levels in caps (22-56 mg/kg dry wt) than in stems (13-36 mg/kg dry wt). Concentration factor (CF), very low in the controls (about 2), further decreases in treated specimens. The presence of a cadmium control mechanism in this fungi species is suggested. Fruit body cadmium levels could, however, represent a risk for P. ostreatus consumers, according to FAO/WHO limits related to weekly cadmium intake.

  11. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail: luamatu@uol.com.br; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail: menezes@cdtn.br; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg

    2009-07-01

    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  12. [Cadmium and selenium interaction in mammals].

    Science.gov (United States)

    Lazarus, Maja

    2010-09-01

    Cadmium occurs in the environment naturally and as a pollutant. Its exposure is inevitable and may produce toxic effects in many organs and organ systems through binding to biological structures, accumulation in internal organs or induction of free radical production. Another important aspect of Cd toxicity is its interaction, often anthagonistic, with essential elements. Vice versa, additional intake of the essential elements may have beneficial influence on distribution and toxic effects of cadmium. Selenium is an essential microelement and a constituent of many selenoproteins with antioxidant properties that bind cadmium (and other toxic elements such as mercury or arsenic). This review summarizes results, to date, of cadmium toxicokinetics and toxicodinamics, selenium biokinetics and biodinamics, as well as mechanisms of cadmium-selenium interaction and their impact on the oxidative status derived from the studies based upon mainly on animal experiments and on limited number of human studies. The wide variety of different doses, dose ratios, element administration modes and exposure lenghts of cadmium and selenium often yielded contradictory results. Future studies should be focused on assessment of effects of cadmium and selenium interaction in sensitive population groups and mechanisms of that interaction. Regarding animal studies, doses and exposure should be adjusted to long-term low exposure levels that are usually found in human population.

  13. Renal 131I-hippuran extraction in man

    DEFF Research Database (Denmark)

    Hutchings, M; Hesse, B; Grønvall, J

    2002-01-01

    This study examined the 131I-hippuran extraction fraction during baseline renal blood flow rates and at high flow rates induced by dopamine.......This study examined the 131I-hippuran extraction fraction during baseline renal blood flow rates and at high flow rates induced by dopamine....

  14. 29 CFR 452.131 - Casting of ballots; delegate elections.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Casting of ballots; delegate elections. 452.131 Section 452... REPORTING AND DISCLOSURE ACT OF 1959 Election Procedures; Rights of Members § 452.131 Casting of ballots; delegate elections. The manner in which the votes of the representatives are cast in the convention is not...

  15. 46 CFR 131.320 - Safety orientation for offshore workers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Safety orientation for offshore workers. 131.320 Section... OPERATIONS Preparations for Emergencies § 131.320 Safety orientation for offshore workers. (a) Before a... informing each offshore worker of— (1) In general terms, emergency and evacuation procedures; (2) Locations...

  16. 28 CFR 35.131 - Illegal use of drugs.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Illegal use of drugs. 35.131 Section 35... STATE AND LOCAL GOVERNMENT SERVICES General Requirements § 35.131 Illegal use of drugs. (a) General. (1... an individual based on that individual's current illegal use of drugs. (2) A public entity shall not...

  17. 21 CFR 155.131 - Canned field corn.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned field corn. 155.131 Section 155.131 Food... Canned field corn. (a) Identity. (1) Canned field corn conforms to the definition and standard of... corn by § 155.130(a), except that the corn ingredient consists of succulent field corn or a mixture of...

  18. 41 CFR 105-71.131 - Real property.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Real property. 105-71.131 Section 105-71.131 Public Contracts and Property Management Federal Property Management... any actual and reasonable selling and fixing-up expenses. If the grant is still active, the net...

  19. 10 CFR 71.131 - Nonconforming materials, parts, or components.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Nonconforming materials, parts, or components. 71.131... RADIOACTIVE MATERIAL Quality Assurance § 71.131 Nonconforming materials, parts, or components. The licensee..., segregation, disposition, and notification to affected organizations. Nonconforming items must be reviewed and...

  20. 47 CFR 22.131 - Procedures for mutually exclusive applications.

    Science.gov (United States)

    2010-10-01

    .... 22.131 Section 22.131 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER... public in advance. (c) Procedures. Generally, the Commission may grant one application in a filing group... excluded by that grant, pursuant to § 1.945 of this chapter. (1) Selection methods. In selecting the...

  1. 46 CFR 131.545 - Maintenance in general.

    Science.gov (United States)

    2010-10-01

    ... points with the recommended lubricants. (5) A list of replaceable parts. (6) A list of sources of spare parts. (7) A log for records of inspections, maintenance, and repair. (b) The master shall ensure that... 46 Shipping 4 2010-10-01 2010-10-01 false Maintenance in general. 131.545 Section 131.545 Shipping...

  2. 45 CFR 96.131 - Treatment services for pregnant women.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Treatment services for pregnant women. 96.131... Substance Abuse Prevention and Treatment Block Grant § 96.131 Treatment services for pregnant women. (a) The State is required to, in accordance with this section, ensure that each pregnant woman in the State who...

  3. 46 CFR 131.955 - Display of merchant mariner credential.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Display of merchant mariner credential. 131.955 Section... OPERATIONS Miscellaneous § 131.955 Display of merchant mariner credential. Each officer on a vessel must conspicuously display his or her license or officer endorsements as required by 46 U.S.C. 7110. ...

  4. [sup 131]I-metaiodobenzylguanidine therapy for malignant pheochromocytoma

    Energy Technology Data Exchange (ETDEWEB)

    Sakahara, Harumi; Saga, Tsuneo; Hosono, Makoto; Kobayashi, Hisataka; Konishi, Junji (Kyoto Univ. (Japan). Faculty of Medicine); Endo, Keigo

    1994-05-01

    [sup 131]I-metaiodobenzylguanidine (MIBG) therapy was given to five patients with malignant pheochromocytoma. The patients received 1-3 doses of 3.33-4.625 GBq (total dose: 3.7 to 10.73 GBq). Partial tumor regression was observed in two patients, the tumor was unchanged in two patients, and slow progression was noted in one patient. Marked improvement in clinical symptoms was achieved in four patients. The other patients had no symptoms before [sup 131]I-MIBG treatment, but the serum epinephrine and dopamine decreased. There were no severe untoward responses in four patients. However, one patient developed transient but severe orthostatic hypotension, hypertension, and hyperglycemia from 1 week to 1 month after [sup 131]I-MIBG administration. Although complete remission was not obtained, all the patients achieved some benefit from [sup 131]I-MIBG therapy. Thus, [sup 131]I-MIBG appears to be useful for the palliation of malignant pheochromocytoma. (author).

  5. Low level determinations of environmental cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Rosman, K.J.R.; De Laeter, J.R.

    1976-06-24

    An isotope dilution technique has been developed to measure the concentration of cadmium in aqueous solutions with a sensitivity of 0.003 micrograms per liter. The concentrations of cadmium in two river systems in Western Australia has been measured to establish an accurate set of low level reference determinations in a region which is relatively free of sources of industrial pollution. The results of the study demonstrate that the cadmium content in the two major river systems in western Australia is about 100 times lower than the World Health Organization limits. The data indicate that the cadmium content tends to decrease upstream from the mouth of the river, and that in the reservoir areas the content is as low as 0.02 micrograms per liter. These values are substantially lower than waterways in other parts of the world. 13 references, 1 figure, 1 table.

  6. Cadmium substituted high permeability lithium ferrite

    Indian Academy of Sciences (India)

    , 0.5 and 0.6 were prepared by a double sintering ceramic technique and characterized by X-ray diffraction and scanning electron microscopy (SEM). The lattice parameter is found to increase monotonically with the cadmium content.

  7. Market for nickel-cadmium batteries

    Science.gov (United States)

    Putois, F.

    Besides the lead/acid battery market, which has seen a tremendous development linked with the car industry, the alkaline rechargeable battery market has also been expanded for more than twenty years, especially in the field of portable applications with nickel-cadmium batteries. Today, nickel-cadmium batteries have to face newcomers on the market, such as nickel-metal hydride, which is another alkaline couple, and rechargeable lithium batteries; these new battery systems have better performances in some areas. This work illustrates the status of the market for nickel-cadmium batteries and their applications. Also, for two major applications—the cordless tool and the electric vehicles—the competitive situation of nickel-cadmium batteries; facing new systems such as nickel-metal hydride and lithium ion cells are discussed.

  8. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Davila-Rangel, J.I. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico); Unidad Academica Centro Regional de Estudios Nucleares, Universidad Autonoma de Zacatecas Cipres 10, Frac. La Penuela, Zacatecas, Zacatecas 98068 (Mexico); Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, Instituto Literario No. 100 Col. Centro C.P. 50000, Toluca, Edo. de Mexico (Mexico); Solache-Rios, M. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico)], E-mail: msr@nuclear.inin.mx

    2008-10-15

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 {sup o}C), and the materials were then treated with NaCl (1 M and 5 M) and HNO{sub 3} (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 {sup o}C was higher than leaching from non-irradiated samples.

  9. Reviews of the environmental effects of pollutants: IV. Cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Hammons, A.S.; Huff, J.E.; Braunstein, H.M.; Drury, J.S.; Shriner, C.R.; Lewis, E.B.; Whitfield, B.L.; Towill, L.E.

    1978-06-01

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 ..mu..g per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels.

  10. Cadmium removal by Lemna minor and Spirodela polyrhiza.

    Science.gov (United States)

    Chaudhuri, Devaleena; Majumder, Arunabha; Misra, Amal K; Bandyopadhyay, Kaushik

    2014-01-01

    The present study investigates the ability of two genus of duckweed (Lemna minor and Spirodela polyrhiza) to phytoremediate cadmium from aqueous solution. Duckweed was exposed to six different cadmium concentrations, such as, 0.5,1.0,1.5, 2.0, 2.5, and 3.0 mg/L and the experiment was continued for 22 days. Water samples were collected periodically for estimation of residual cadmium content in aqueous solution. At the end of treatment period plant samples were collected and accumulated cadmium content was measured. Cadmium toxicity was observed through relative growth factor and changes in chlorophyll content Experimental results showed that Lemna minor and Spirodela polyrhiza were capable of removing 42-78% and 52-75% cadmium from media depending upon initial cadmium concentrations. Cadmium was removed following pseudo second order kinetic model Maximum cadmium accumulation in Lemna minor was 4734.56 mg/kg at 2 mg/L initial cadmium concentration and 7711.00 mg/kg in Spirodela polyrhiza at 3 mg/L initial cadmium concentration at the end of treatment period. Conversely in both cases maximum bioconcentration factor obtained at lowest initial cadmium concentrations, i.e., 0.5 mg/L, were 3295.61 and 4752.00 for Lemna minor and Spirodela polyrhiza respectively. The present study revealed that both Lemna minor and Spirodela polyrhiza was potential cadmium accumulator.

  11. Cigarette Smoke Cadmium Breakthrough from Traditional Filters: Implications for Exposure

    Science.gov (United States)

    Pappas, R. Steven; Fresquez, Mark R.; Watson, Clifford H.

    2015-01-01

    Cadmium, a carcinogenic metal, is highly toxic to renal, skeletal, nervous, respiratory, and cardiovascular systems. Accurate and precise quantification of mainstream smoke cadmium levels in cigarette smoke is important because of exposure concerns. The two most common trapping techniques for collecting mainstream tobacco smoke particulate for analysis are glass fiber filters and electrostatic precipitators. We observed that a significant portion of total cadmium passed through standard glass fiber filters that are used to trap particulate matter. We therefore developed platinum traps to collect the cadmium that passed through the filters and tested a variety of cigarettes with different physical parameters for quantities of cadmium that passed though the filters. We found less than 1% cadmium passed through electrostatic precipitators. In contrast, cadmium that passed through 92 mm glass fiber filters on a rotary smoking machine was significantly higher, ranging from 3.5% to 22.9% of total smoke cadmium deliveries. Cadmium passed through 44 mm filters typically used on linear smoking machines to an even greater degree, ranging from 13.6% to 30.4% of the total smoke cadmium deliveries. Differences in the cadmium that passed through from the glass fiber filters and electrostatic precipitator could be explained in part if cadmium resides in the smaller mainstream smoke aerosol particle sizes. Differences in particle size distribution could have toxicological implications and could help explain the pulmonary and cardiovascular cadmium uptake in smokers. PMID:25313385

  12. Dynamic of cadmium accumulation in the internal organs of rats after exposure to cadmium chloride and cadmium sulphide nanoparticules of various sizes

    Directory of Open Access Journals (Sweden)

    Apykhtina O.L.

    2017-06-01

    Full Text Available The article presents the results of study of cadmium accumulation in the internal organs of Wistar rats after prolonged intraperitoneal administration of cadmium chloride and cadmium sulphide nanoparticles of 4-6 nm and 9-11 nm in size in a dose of 0.08 mg /kg/day calculated as cadmium. Toxic effects were evaluated after 30 injections (1.5 months, 60 injections (3 months, and 1.5 months after the exposure has been ceased. The results of the study showed that the most intensive accumulation of cadmium was observed in the kidneys and liver of experimental animals, which is due to the peculiarities of the toxicokinetics and the route of administration of cadmium compounds. In the kidneys, spleen and thymus of animals exposed to cadmium sulphide nanoparticles, a greater concentration of cadmium than in the organs of animals exposed to cadmium chloride was found. Cadmium accumulated more intensively in the spleen after exposure to larger nanoparticles, than in the kidneys and thymus. In the liver, heart, aorta and brain significant accumulation was observed after cadmium chloride exposure.

  13. Adrenal scanning with {sup 131}I-cholesterol; Diagnostik von Nebennierenrindenerkrankungen mit {sup 131}I-Cholesterol

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, K. [Klinik und Poliklinik fuer Nuklearmedizin, Klinikum der Ludwig-Maximilians-Univ. Muenchen (Germany)

    2009-03-15

    Adrenal scanning with {sup 131}I-19-cholesterol is used in patients with various forms of adrenal malfunction (adreno-cortical carcinoma or adenoma, hypothalamic-hypophyseal form of Cushing's syndrome, adrenal hirsutism, primary or secondary adrenocortical insufficiency). Adrenal scanning is optimal between the fourth and tenth day after intravenous injection of {sup 131}I-19-cholesterol. This method makes it possible to estimate the size and functional status of the adrenals. Limitation of the method is the relatively high radiation dose of {sup 131}I-19-cholesterol. (orig.)

  14. Cadmium exposure induces hematuria in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seung Seok [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Kim, Myounghee, E-mail: dkkim73@gmail.com [Department of Dental Hygiene, College of Health Science, Eulji University, Gyeonggi-do 461-713 (Korea, Republic of); Lee, Su Mi [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lee, Jung Pyo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Sejoong [Department of Internal Medicine, Seoul National University Bundang Hospital, Gyeonggi-do 463-707 (Korea, Republic of); Joo, Kwon Wook [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lim, Chun Soo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Yon Su; Kim, Dong Ki [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of)

    2013-07-15

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; P{sub trend}=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk.

  15. Toxicity of cadmium to the developing lung

    Energy Technology Data Exchange (ETDEWEB)

    Daston, G.P.

    1981-01-01

    The effects of cadmium on the developing lung and pulmonary surfactant were studied. Pregnant rats received subcutaneous injections of cadmium chloride on days 12 to 15 of gestation and were sacrificed throughout late gestation. The treatment resulted in high embryonic mortality and growth regardation. Fetal lung weight was reduced 20 to 30% due to hypoplasia, as the number of lung cells (DNA/lung) but not cell size (protein/cell) was lowered. The ultrastructural development of alveolar epithelium was altered; cytodifferentiation was delayed; and the cytoplasmic inclusions which contain pulmonary surfactant, were reduced in the term fetus. Accumulation of phosphatidylcholine (PC), the major component of pulmonary surfactant, was diminished in the lungs of treated fetuses. The immediate cause of this lowered accumulation was a decreased rate of synthesis of PC from choline. Carbohydrates probably represent a major source of PC precursors and are present in large quantities in the fetal lung as glycogen. The pulmonary glycogen content of cadmium-exposed fetuses was diminished. It is postulated that this is a reason for the lowered rate of PC synthesis. Maternally administered cadmium did not pass through the placenta; thus, the mechanism of fetotoxicity was indirect. Maternal cadmium exposure did result in lowered fetal zinc levels. Coadministration of zinc with cadmium raised fetal zinc concentration to control values and alleviated all fetotoxicity. Fetal zinc deficiency is a possible mechanism for the toxic effects on the developing lung. Several dams were allowed to give birth and their offspring were observed for respiratory problems. Cadmium treatment delayed parturition by about a day. Symptoms of respiratory distress syndrome (RDS) were observed in 11% of the treated neonates. All but one of these individuals died and had lungs with hyaline membranes. This is the only known case of an environmental agent causing neonatal RDS.

  16. Get the Facts About Exposure to I-131 Radiation

    Science.gov (United States)

    ... the Fukushima accident in 2011 (primarily Americans in Japan) Releases from atomic weapons production plants (such as ... approximately 2 to 3 times more common in women Reliable information about I-131's impact on human ...

  17. The psychodynamics of work with iodine-131 in nuclear medicine

    National Research Council Canada - National Science Library

    Leila Cunha da Silveira; Maria Cristina Rodrigues Guilam; Sergio Ricardo de Oliveira

    2013-01-01

      This paper seeks to demonstrate to what extent alternative forms adopted in the working process of professionals with iodine-131 in nuclear medicine can assist in managing risks of ionizing radiation...

  18. Resveratrol Sensitizes Selectively Thyroid Cancer Cell to 131-Iodine Toxicity

    Directory of Open Access Journals (Sweden)

    Seyed Jalal Hosseinimehr

    2014-01-01

    Full Text Available Background. In this study, the radiosensitizing effect of resveratrol as a natural product was investigated on cell toxicity induced by 131I in thyroid cancer cell. Methods. Human thyroid cancer cell and human nonmalignant fibroblast cell (HFFF2 were treated with 131I and/or resveratrol at different concentrations for 48 h. The cell proliferation was measured by determination of the percent of the survival cells using 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Results. Findings of this study show that resveratrol enhanced the cell death induced by 131I on thyroid cancer cell. Also, resveratrol exhibited a protective effect on normal cells against 131I toxicity. Conclusion. This result indicates a promising effect of resveratrol on improvement of cellular toxicity during iodine therapy.

  19. Uptake of cadmium from hydroponic solutions by willows ( Salix spp ...

    African Journals Online (AJOL)

    Salix integra 'Weishanhu') and Yizhibi (S. integra 'Yizhibi') were chosen as model plants to evaluate their potential for uptake of cadmium from hydroponic culture and relative uptake mechanism. Cadmium uptake showed a linear increase in the ...

  20. SUBSTITUTION OF CADMIUM CYANIDE ELECTROPLATING WITH ZINC CHLORIDE ELECTROPLATING

    Science.gov (United States)

    The study evaluated the zinc chloride electroplating process as a substitute for cadmium cyanide electroplating in the manufacture of industrial connectors and fittings at Aeroquip Corporation. The process substitution eliminates certain wastes, specifically cadmium and cyanide, ...

  1. Genotoxic Effect of Atrazine, Arsenic, Cadmium and Nitrate ...

    African Journals Online (AJOL)

    ATZ), Cadmium (Cd), Arsenic (As) and Nitrate (NO3) have both estrogenic activity and carcinogenic potential. Atrazine has clastogenic effects and may also act as tumor promoter as it induces the aromatase enzyme. Arsenic and Cadmium ...

  2. Treatment of malignant pheochromocytomas with 131-I metaiodobenzylguanidine and chemotherapy.

    Science.gov (United States)

    Sisson, J C; Shapiro, B; Shulkin, B L; Urba, S; Zempel, S; Spaulding, S

    1999-08-01

    Malignant pheochromocytomas have exhibited partial responses to treatments with 131-I metaiodobenzylguanidine (MIBG) and with chemotherapy. The authors combined these two therapeutic methods to determine if beneficial effects from each would be additive. Patients with documented malignant pheochromocytomas were recruited with the intent of administering 131-I MIBG in three substantial amounts of radioactivity at 3-month intervals followed by a year of chemotherapy in which cyclophosphamide, dacarbazine, and vincristine were to be given in 21-day cycles. Six patients entered the protocol. After the 131-I MIBG treatments, three patients manifested declines in the presence of tumor (smaller tumor volume or abnormalities on bone and 131-I MIBG scans) and the function of tumor (decreased rate of normetanephrine excretion as the major index). Two patients completed at least 9 months of chemotherapy and showed further reductions in the presence and function of tumors and were classified as having partial responses. Progressive disease afflicted three of the other four subjects. Even though toxicity was minimal from 131-I MIBG, it was sufficient to force reduction in the dosages or duration of chemotherapy. A combination of 131-I MIBG treatments and chemotherapy produced additive effects in reducing malignant pheochromocytomas. Toxicity moderately curtailed the proposed chemotherapy protocol.

  3. Additional effective dose by patients undergoing NAI-131 capsules therapy

    Energy Technology Data Exchange (ETDEWEB)

    Orlic, M.; Jovanovic, M.; Spasic Jokic, V.; Cuknic, O.; Ilic, Z.; Vranjes Djuric, S. [VINCA - Institute of Nuclear Sciences, Belgrade, Serbia and Montenegro (Yugoslavia)

    2006-07-01

    Capsules or solutions containing Na{sup 131}I are indicated for the therapy of some thyroid carcinomas such as functioning metastatic papillary or follicular carcinoma of the thyroid; and for the treatment of hyperthyroidism (diffuse toxic goiter and single or multiple toxic nodular goiter). The recommended dosage ranges of Na{sup 131}I capsules or solution for the therapy of the average patient (70 kg) are: (3.7-5.55) GBq for ablation of normal thyroid tissue; (3.7-7.4) GBq for subsequent treatments; a (148-370) MBq for hyperthyroidism. The purpose of this paper is to calculate effective dose as a result of iodine-131 capsules remaining in stomach before absorption starts. This result can determine the disadvantage of capsule versus solution containing sodium iodine-131 (Na{sup 131}I) in radionuclide therapy application from radiation protection point of view. The Monte Carlo code MCNP4b was used to model transport of gamma and beta particles emitted by radionuclide {sup 131}I treated as a point source at the bottom of stomach. Absorbed energy per unit transformation in stomach and surrounding organs has been calculated. (authors)

  4. Cadmium exposure and health risks: Recent findings

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G. [Huddinge Hospital (Sweden). Dept. of Renal Medicine; Jaerup, L. [Stockholm City Council (Sweden). Dept. of Environmental Health

    1996-08-01

    Environmental and/or occupational exposure to cadmium give rise to a tubular kidney dysfunction which may proceed to more generalized renal damage and bone disease if exposure has been high and prolonged. Recent scientific work shows that early renal effects develop at lower levels of exposure than previously anticipated. Previous risk assessments for cadmium were mainly based on studies on healthy male workers. The general population, however, also include particularly susceptible groups such as elderly and individuals with illnesses (e.g. diabetes) that may predispose to cadmium-induced health effects. A significant proportion of the general population displays early signs of toxicity already at urinary cadmium concentrations around 3 nmol mmol{sup -1} creatinine. In addition to early tubular effects, cadmium may exert direct or indirect effects on mineral metabolism and the mineralization of the skeleton at relatively low levels of exposure. This may have important health implications, as poor and easily fractured bone is a major problem among the elderly in all industrialized countries. 41 refs, 4 figs

  5. Cadmium recycling in the United States in 2000

    Science.gov (United States)

    Plachy, Jozef

    2003-01-01

    Recycling of cadmium is a young and growing industry that has been influenced by environmental concerns and regulatory constraints. Domestic recycling of cadmium began in 1989 as a byproduct of processing of spent nickel-cadmium batteries. In 1995, International Metals Reclamation Co. Inc. expanded its operations by building a dedicated cadmium recycling plant. In 2000, an estimated 13 percent of cadmium consumption in the United States was sourced from recycled cadmium, which is derived mainly from old scrap or, to lesser degree, new scrap. The easiest forms of old scrap to recycle are small spent nickel-cadmium batteries followed by flue dust generated during recycling of galvanized steel and small amounts of alloys that contain cadmium. Most of new scrap is generated during manufacturing processes, such as nickel-cadmium battery production. All other uses of cadmium are in low concentrations and, therefore, difficult to recycle. Consequently, much of this cadmium is dissipated and lost. The amount of cadmium in scrap that was unrecovered in 2000 was estimated to be 2,030 metric tons, and an estimated 285 tons was recovered. Recycling efficiency was estimated to be about 15 percent.

  6. Cadmium uptake by the green alga Chlorella emersonii | Arikpo ...

    African Journals Online (AJOL)

    Investigations were carried out on the uptake of the heavy metal cadmium (Cd) by the green alga Chlorella emersonii with the aid of an ion selective electrode. Cadmium uptake by Chlorella was very rapid with 70% of total uptake occurring during the first 10 seconds. Uptake of cadmium by Chlorella showed a direct ...

  7. Cadmium affects the social behaviour of rainbow trout, Oncorhynchus mykiss

    Energy Technology Data Exchange (ETDEWEB)

    Sloman, Katherine A.; Scott, Graham R.; Diao Zhongyu; Rouleau, Claude; Wood, Chris M.; McDonald, D. Gord

    2003-10-29

    The present study investigated both the effects of cadmium on the social interactions of rainbow trout and the differential accumulation of waterborne cadmium among social ranks of fish. Fish exposed to waterborne cadmium concentrations of 2 {mu}g l{sup -1} for 24 h, followed by a 1, 2 or 3 day depuration period in clean water, had a decreased ability to compete with non-exposed fish. However, the competitive ability of exposed fish given a 5 day depuration period was not significantly impaired. Cadmium accumulated in the olfactory apparatus of fish exposed to waterborne cadmium for 24 h and decreased significantly only after 5 days depuration in clean water. Among groups of ten fish held in stream tanks, where all fish were exposed to cadmium, there were significant effects on social behaviour and growth rate. Dominance hierarchies formed faster among fish exposed to cadmium than among control fish, and overall growth rates were higher in the cadmium treatment. In groups of ten fish, social status also affected tissue accumulation of cadmium during waterborne exposure, with dominant fish accumulating more cadmium at the gill. In conclusion, exposure to low levels of cadmium, affects the social behaviour of fish, in part due to accumulation in the olfactory apparatus, and dominant fish accumulate more gill cadmium than subordinates during chronic waterborne exposure.

  8. Prevalence of Escherichia Coli sequence type 131 (ST131 among extraintestinal clinical isolates in different phylogenetic groups

    Directory of Open Access Journals (Sweden)

    Al-hetar Khadega Yahyah Abdullah

    2016-03-01

    Full Text Available Escherichia coli sequence type O25b-ST131 has emerged in recent years around the world in combination with CTX-M-15 among extra-intestinal infections and it has caused considerable morbidity and mortality. Management of infections can be done by controlling the source of infections or contamination. In India there are not many studies on O25b-ST131 clone, This study was done to investigate ST131’s prevalence in different phylogenetic groups among isolates from different extra-intestinal infections. Hundred E. coli isolates were isolated from different clinical samples including urine, blood, sputum and exudates from Krishna Rajendra (K.R Hospital, Mysore. Polymerase chain reaction (PCR method was used to determine the Phylogenetic groups and O25b-ST131 clone. Out of 100 E. coli strains 55%, 30%, 8% and 7% were isolated from urine, exudates, sputum, and blood respectively. Phylogenetically, B2 group was the dominant group (34% followed by D, B1 and A groups (28, 26, and12 respectively, 87% E. coli samples belonged to O25b-ST131 clone which were distributed among groups; B2, D, B1 and (32, 25, 22 and 8 isolates respectively. Diversity of Phylogenetic groups among O25b-ST131 E. coli strains may refer to the source of infections. Further studies are needed to highlight the source of infection which may help to control the dissemination of E. coli clone.

  9. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    Directory of Open Access Journals (Sweden)

    P. Bala Ramudu

    2007-09-01

    Full Text Available This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself was used as the purging solution. Results showed that 49% reduction of cadmium concentration was achieved in the case of soil saturated (washed with ammonium citrate as well as purging solution also was ammonium citrate. The soil pH and washing solutions were the most important factors in controlling the removal of cadmium in electrokinetic remediation process.

  10. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John

    2013-01-01

    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  11. Toxic effects of Cadmium on the garden snail (Helix aspersa)

    Energy Technology Data Exchange (ETDEWEB)

    Russell, L.K. (Northrop Services Inc., Corvallis, OR); DeHaven, J.I.; Botts, R.P.

    1981-05-01

    Spreading treated municipal wastes on agricultural and forest lands is becoming an established method of disposal. However, there is concern about the deleterious effects of toxicants, particularly cadmium, in the sludges. Cadmium concentrations in sewage sludge have been reported as high as 1500 ppM. The work reported here is a part of a larger project to investigate the ecological effects of municipal wastes on forest lands. Snails, Helix aspersa, were chosen to examine the entrance of cadmium into terrestrial food chains. This experiment was designed to determine cadmium accumulation, acute toxicity, and behavioral, reproductive and growth responses with increasing levels of cadmium.

  12. Cadmium-induced testicular injury.

    Science.gov (United States)

    Siu, Erica R; Mruk, Dolores D; Porto, Catarina S; Cheng, C Yan

    2009-08-01

    Cadmium (Cd) is an environmental toxicant and an endocrine disruptor in humans and rodents. Several organs (e.g., kidney, liver) are affected by Cd and recent studies have illustrated that the testis is exceedingly sensitive to Cd toxicity. More important, Cd and other toxicants, such as heavy metals (e.g., lead, mercury) and estrogenic-based compounds (e.g., bisphenols) may account for the recent declining fertility in men among developed countries by reducing sperm count and testis function. In this review, we critically discuss recent data in the field that have demonstrated the Cd-induced toxicity to the testis is probably the result of interactions of a complex network of causes. This is likely to involve the disruption of the blood-testis barrier (BTB) via specific signal transduction pathways and signaling molecules, such as p38 mitogen-activated protein kinase (MAPK). We also summarize current studies on factors that confer and/or regulate the testis sensitivity to Cd, such as Cd transporters and metallothioneins, the impact of Cd on the testis as an endocrine disruptor and oxidative stress inducer, and how it may disrupt the Zn(2+) and/or Ca(2+) mediated cellular events. While much work is needed before a unified mechanistic pathway of Cd-induced testicular toxicity emerges, recent studies have helped to identify some of the likely mechanisms and/or events that take place during Cd-induced testis injury. Furthermore, some of the recent studies have shed lights on potential therapeutic or preventive approaches that can be developed in future studies by blocking or minimizing the destructive effects of Cd to testicular function in men.

  13. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    Directory of Open Access Journals (Sweden)

    Brian G. Luckett

    2012-01-01

    Full Text Available Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana. We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P≤0.0001. Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88 and high consumption levels of red meat (4th quartile OR = 6.18 and grains (4th quartile OR = 3.38. Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen.

  14. Different outcomes for relapsed vs. refractory neuroblastoma after therapy with 131I-metaiodobenzylguanidine (131I-MIBG)

    Science.gov (United States)

    Zhou, Margaret J.; Doral, Michelle Y.; DuBois, Steven G.; Villablanca, Judith G.; Yanik, Gregory A.; Matthay, Katherine K.

    2015-01-01

    Background 131I-metaiodobenzylguanidine (131I-MIBG) is a targeted radiopharmaceutical with significant activity in high-risk relapsed and chemotherapy-refractory neuroblastoma. Our primary aim was to determine if there are differences in response rates to 131I-MIBG between patients with relapsed and treatment-refractory neuroblastoma. Methods This was a retrospective cohort analysis of 218 patients with refractory or relapsed neuroblastoma treated with 131I-MIBG at UCSF between 1996 and 2014. Results were obtained by chart review and database abstraction. Baseline characteristics and response rates between relapsed patients and refractory patients were compared using Fisher exact and Wilcoxon rank sum tests, and differences in overall survival (OS) were compared using the log-rank test. Results The response rate (complete and partial response) to 131I-MIBG-based therapies for all patients was 27%. There was no difference in response rates between relapsed and refractory patients. However, after 131I-MIBG, 24% of relapsed patients had progressive disease compared to only 9% of refractory patients, and 39% of relapsed patients had stable disease compared to 59% of refractory patients (p = 0.02). Among all patients, the 24-month OS was 47.0% (95% CI 39.9%–53.9%). The 24-month OS for refractory patients was significantly higher at 65.3% (95% CI 51.8%–75.9%), compared to 38.7% (95% CI 30.4%–46.8%) for relapsed patients (p refractory neuroblastoma, patients with prior relapse had higher rates of progressive disease and had lower 2-year overall survival after 131I-MIBG compared to patients with refractory disease. PMID:26254811

  15. In vivo biological evaluation of {sup 131}I radiolabeled-paclitaxel glucuronide ({sup 131}I-PAC-G)

    Energy Technology Data Exchange (ETDEWEB)

    Aslan, O.; Biber Muftuler, F.Z.; Yurt Kilcar, A.; Ichedef, C.; Unak, P. [Ege Univ., Izmir (Turkey). Dept. of Nuclear Applications

    2012-07-01

    Paclitaxel (PAC) is a natural occurring diterpene alkoloid originally isolated from the bark of Taxus Brevifolia. It is one of the most important antitumor agents for clinical treatment of ovarian, breast non-small cell lung and prostate cancers. It is known that these types of cancer cells have high {beta}-glucuronidase enzyme which can catalyze the hydrolysis of glucuronides. This is why the synthesis compounds which undergo glucuronidation come into question in the imaging and therapy of these cancer cells. The aim of current study is conjugation of glucuronic acid (G) to the starting substance PAC, labeling with {sup 131}I and to perform its in vivo biological evaluation. Glucuronic acid derived paclitaxel compound [paclitaxel-glucuronide (PAC-G)] was labeled with {sup 131}I using iodogen method. According to thin layer radio chromatography (TLRC) method, the radiochemical yield of {sup 131}I-PAC-G was 84.30 {+-} 7.40% (n=10). The biodistribution of {sup 131}I-PAC-G in healthy female and male Wistar Albino rats has been investigated. Imaging studies on male Balb-C mice were performed by using the Kodak FX PRO in vivo Imaging System. The range of the breast/blood, breast/muscle; ovary/blood, ovary/muscle ratios is approximately between 1.29 and 11.34 in 240 min, and between 0.71 and 8.24 in 240 min for female rats. The prostate/blood and prostate/muscle ratio is between 1.94 and 6.95 in 30 min for male rats. All these experimental studies indicate that {sup 131}I-PAC-G may potentially be used in breast, ovary and prostate tissues as an imaging agent. Also it is thought that {sup 131}I-PAC-G bears a therapy potential because of the {sup 131}I radionuclide and can be improved with further investigations. (orig.)

  16. Murine strain differences and the effects of zinc on cadmium concentrations in tissues after acute cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    King, L.M. [ARS USDA, Germplasm and Gamete Physiology Lab., Beltsville, MD (United States); Anderson, M.B. [Dept. of Anatomy, Tulane Univ. School of Medicine, New Orleans, LA (United States); Sikka, S.C. [Dept. of Urology, Tulane Univ. School of Medicine, New Orleans, LA (United States); George, W.J. [Dept. of Pharmacology, Tulane Univ. School of Medicine, New Orleans, LA (United States)

    1998-10-01

    The role of strain differences in cadmium tissue distribution was studied using sensitive (129/J) and resistant (A/J) mice. These murine strains have previously been shown to differ in their susceptibility to cadmium-induced testicular toxicity. Cadmium concentration was measured in testis, epididymis, seminal vesicle, liver, and kidney at 24 h after cadmium chloride exposure (4, 10, and 20 {mu}mol/kg CdCl{sub 2}). The 129/J mice exhibited a significant increase in cadmium concentration in testis, epididymis, and seminal vesicle at all cadmium doses used, compared to A/J mice. However, cadmium concentrations in liver and kidney were not different between the strains, at any dose, indicating that cadmium uptake is similar in these organs at 24 h. These murine strains demonstrate similar hepatic and renal cadmium uptake but significantly different cadmium accumulation in the reproductive organs at 24 h. The mechanism of the protective effect of zinc on cadmium toxicity was studied by assessing the impact of zinc acetate (ZnAc) treatment on cadmium concentrations in 129/J mice after 24 h. Zinc pretreatment (250 {mu}mol/kg ZnAc), given 24 h prior to 20 {mu}mol/kg CdCl{sub 2} administration, significantly decreased the amount of cadmium in the testis, epididymis, and seminal vesicle of 129/J mice, and significantly increased the cadmium content of the liver after 24 h. Cadmium levels in the kidney were unaffected at this time. Zinc pretreatment also prevented the cadmium-induced decrease in testicular sperm concentration and epididymal sperm motility seen in 129/J mice. These findings suggest that the differences in the two murine strains may be attributed partly to the differential accumulation of cadmium in murine gonads. This may be caused by strain differences in the specificity of cadmium transport mechanisms. The protective role of zinc in cadmium-induced testicular toxicity in the sensitive strain may be due to an interference in the cadmium uptake by susceptible

  17. Remediation of cadmium by Indian mustard (Brassica juncea L. from cadmium contaminated soil: a phytoextraction study

    Directory of Open Access Journals (Sweden)

    Rajeev Kumar Bhadkariya

    2014-05-01

    Full Text Available Cadmium is a toxic metal for living organisms and an environmental contaminant. Soils in many parts of the world are slightly too moderately contaminated by Cd due to long term use and disposal of Cd-contaminated wastes. Cost effective technologies are needed to remove cadmium from the contaminated sites. Soil phytoextraction is engineering based, low cost and socially accepted developing technology that uses plants to clean up contaminants in soils. This technology can be adopted as a remediation of cadmium from Cd-contaminated soils with the help of Brassica juncea plant. The objective of this work was to evaluate the cadmium (Cd accumulate and the tolerance of Brassica juncea. The Cd accumulates in all parts of plants (roots, stems and leaves. It was found that accumulating efficiency increased with the increase in the concentration of applied cadmium metal solution. Maximum accumulation of cadmium was found in roots than stem and leaves. Phytoextraction coefficient and translocation factor were highest to show the validity of the Brassica juncea species for hyperaccumulation of the Cd metal. These results suggested that Brassica juncea has a high ability to tolerate and accumulate Cd, so it might be a promising plant to be used for phytoextraction of Cd contaminated soil. DOI: http://dx.doi.org/10.3126/ije.v3i2.10533 International Journal of the Environment Vol.3(2 2014: 229-237

  18. 131I-induced changes in rat thyroid gland function

    Directory of Open Access Journals (Sweden)

    V. Torlak

    2007-08-01

    Full Text Available Therapeutic doses of 131I administered to thyrotoxic patients may cause thyroid failure. The present study used a rat model to determine thyroid function after the administration of different doses of 131I (64-277 µCi. Thirty male Fisher rats in the experimental group and 30 in the control group (untreated were followed for 6 months. The animals were 4 months old at the beginning of the experiment and were sacrificed at an age of 9 months. Hormone concentration was determined before 131I administration (4-month-old animals and three times following 131I administration, when the animals were 7, 8, and 9 months old. The thyroid glands were removed and weighed, their volume was determined and histopathological examination was performed at the end of the experiment. Significant differences in serum triiodothyronine and thyroid-stimulating hormone concentration, measured at the age of 7, 8, and 9 months, were found in the experimental group. During aging of the animals, the concentration of thyroxin fell from 64.8 ± 8.16 to 55.0 ± 6.1 nM in the control group and from 69.4 ± 6.9 to 25.4 ± 3.2 nM in the experimental group. Thyroid gland volume and weight were significantly lower in the experimental than in the control group. Thyroid glands from the experimental group showed hyaline thickness of the blood vessel wall, necrotic follicles, a strong inflammatory reaction, and peeling of necrotic cells in the follicles. In conclusion, significant differences in hormone levels and histopathological findings indicated prolonged hypothyroidism after 131I administration to rats, which was not 131I dose dependent.

  19. Phytotoxicity of cadmium on peroxidation, superoxide dismutase ...

    African Journals Online (AJOL)

    The results indicated that Cd destroyed the balance of free radical metabolisms, which resulted in increasing malondialdehyde (MDA) content and the relative cell membrane permeability (RMP). The kernel yield and kernel rate per pot showed significant decrease under cadmium stress (P < 0.05). The varieties FengHua3 ...

  20. Combustion synthesis of cadmium sulphide nanomaterials for ...

    Indian Academy of Sciences (India)

    Anion-doped cadmium sulphide nanomaterials have been synthesized by using combustionmethod at normal atmospheric conditions. Oxidant/fuel ratios have been optimized in order to obtain CdS with best characteristics. Formation of CdS and size of crystallite were identified by X-ray diffraction and confirmed by ...

  1. Mobiliteit van cadmium in de bodem

    NARCIS (Netherlands)

    Chardon, W.J.

    1984-01-01

    The adsorption of cadmium by twelve Dutch soils was investigated under widely varying circumstances. The adsorption can be described with the Freundlich equation; the parameters of this equation can be predicted using the properties of the soil (pH, organic carbon and clay

  2. Cadmium versus phosphate in the world ocean

    NARCIS (Netherlands)

    Baar, Hein J.W. de; Saager, Paul M.; Nolting, Rob F.; Meer, Jaap van der

    1994-01-01

    Cadmium (Cd) is one of the best studied trace metals in seawater and at individual stations exhibits a more or less linear relation with phosphate. The compilation of all data from all oceans taken from over 30 different published sources into one global dataset yields only a broad scatterplot of Cd

  3. Enhanced Electrokinetic Remediation of Cadmium Contaminated Soil

    African Journals Online (AJOL)

    In an attempt to remediate contaminated soil, a new technique of purging cadmium from soil is examined by enhanced electrokinetic method. It involves the passage of low level direct current between two electrodes in the soil to remove contaminant. An apparatus consisting of four principal parts; soil cell, electrode ...

  4. ( Rattus norvegicus ) Fed with Dietary Cadmium

    African Journals Online (AJOL)

    Histological changes in the kidney tissues of albino rats (Rattus norvegicus) fed 100mg/kg body weight of cadmium sulphate incorporated as food material has been studied in vivo in an acute toxicological experiment. The behavioural pattern and physical changes in the rats were also investigated. Loss of weight and ...

  5. Combustion synthesis of cadmium sulphide nanomaterials for ...

    Indian Academy of Sciences (India)

    The observed enhanced photocatalytic activity of the CdS nanomaterials for the hydrogen production from water (2120 μmol/h) can be attributed to high crystallinity, low band gap and less exciton recombination due to the C and N doping. Keywords. Cadmium sulphide; combustion synthesis; anion doping; water splitting; ...

  6. REPRODUCTIVE EFFECTS OF TRANSGENERATIONAL CADMIUM EXPOSURE

    Science.gov (United States)

    Japanese medaka (Oryzias latipes) were used to compare the effects of environmentally relevant cadmium (Cd) exposure on reproduction in adult animals previously exposed in ovo or as hatchlings. Adults were raised either from eggs produced during a two week exposure to 0, 1, 5, o...

  7. PHYSIOLOGICAL EFFECTS OF TRANSGENERATIONAL CADMIUM EXPOSURE.

    Science.gov (United States)

    A series of assays were modified or developed to use with small fish species, specifically Japanese medaka (Oryzias latipes). These assays were used to compare the effects of environmentally relevant cadmium (Cd) exposure on indicators of endocrine function in adult animals previ...

  8. Characterization of nanocrystalline cadmium telluride thin films ...

    Indian Academy of Sciences (India)

    Unknown

    tion method, successive ionic layer adsorption and reaction (SILAR), are described. For deposition of CdTe thin films, cadmium ... By conducting several trials optimization of the adsorption, reaction and rinsing time duration for CdTe thin film deposition was ... 3.1 Reaction mechanism. CdTe thin films were grown on micro ...

  9. antioxidants, cadmium-induced toxicity, serum biochemical

    African Journals Online (AJOL)

    Daniel Owu

    (1.51/gm) and selenium (0.25mg) which on their own had little or no effects on the serum basal phosphatases, hormonal and histological stability caused a reversal of the cadmium-induced biochemical, hormonal and histological toxicities of the ..... accessory sex tissues atrophy such as the prostate. (Waalkes et al 1997a).

  10. Rising environmental cadmium levels in developing countries ...

    African Journals Online (AJOL)

    Summary: Cadmium (Cd) is a ubiquitous environmental pollutant of increasing worldwide concern. It is thought to be of greater concern to rapidly industrializing developing countries because of the increasing pace of industrial activities in these countries with increasing consumption and release into the environment.

  11. Experimental release of 131I: the Green Run.

    Science.gov (United States)

    Robkin, M A

    1992-06-01

    In December 1949, a large amount of 131I was released to the air at Hanford during the dissolving of irradiated uranium fuel for a classified military experiment called the "Green Run." Reports of the release have varied from about 0.15-0.3 PBq. Using, as a guide, the reported measurements of 133Xe released during the experiment, the amount of 131I released has been reanalyzed. The results indicate that about 0.40 +/- 0.12 PBq (11 +/- 3 kCi) was released, somewhat larger than the largest previous estimates.

  12. Hepatoprotective activity of Moringa oleifera against cadmium toxicity in rats

    Directory of Open Access Journals (Sweden)

    Reetu Toppo

    2015-04-01

    Full Text Available Aim: The present investigation has been conducted to evaluate the hepatoprotective activity of Moringa oleifera against cadmium-induced toxicity in rats. Materials and Methods: For this study, 18 Wistar albino rats were taken. Control group, Group I rats were given cadmium chloride @ 200 ppm per kg and Group II rats were treated with M. oleifera extract @ 500 mg/kg along with cadmium chloride @ 200 ppm per kg (daily oral for 28 days. On 29th day, animals were slaughtered and various parameters were determined. Serum biomarkers, oxidative stress parameters, histomorphological examination were carried out with estimation of cadmium concentration in liver tissues. Results: Oral administration of cadmium chloride @ 200 ppm/kg for 28 days resulted in a significant increase in aspartate aminotransferase (AST, alanine transaminase (ALT, alkaline phosphatase (ALP, significant (p≤0.01 increase of lipid peroxidation (LPO and decrease in superoxide dismutase (SOD, and increase in cadmium accumulation in liver. Treatment with M. oleifera @ 500 mg/kg significantly (p<0.01 decreased the elevated ALP, AST, ALT, LPO levels and increase in SOD levels, and as compared to cadmium chloride treated group. However, there was no significant difference in cadmium concentration in liver when compared with cadmium chloride treated group. Conclusion: The study conclude that supplementation of M. oleifera (500 mg/kg, daily oral for 28 days has shown protection against cadmium-induced hepatotoxicity.

  13. Different outcomes for relapsed versus refractory neuroblastoma after therapy with (131)I-metaiodobenzylguanidine ((131)I-MIBG).

    Science.gov (United States)

    Zhou, Margaret J; Doral, Michelle Y; DuBois, Steven G; Villablanca, Judith G; Yanik, Gregory A; Matthay, Katherine K

    2015-11-01

    (131)I-metaiodobenzylguanidine ((131)I-MIBG) is a targeted radiopharmaceutical with significant activity in high-risk relapsed and chemotherapy-refractory neuroblastoma. Our primary aim was to determine if there are differences in response rates to (131)I-MIBG between patients with relapsed and treatment-refractory neuroblastoma. This was a retrospective cohort analysis of 218 patients with refractory or relapsed neuroblastoma treated with (131)I-MIBG at UCSF between 1996 and 2014. Results were obtained by chart review and database abstraction. Baseline characteristics and response rates between relapsed patients and refractory patients were compared using Fisher exact and Wilcoxon rank sum tests, and differences in overall survival (OS) were compared using the log-rank test. The response rate (complete and partial response) to (131)I-MIBG-based therapies for all patients was 27%. There was no difference in response rates between relapsed and refractory patients. However, after (131)I-MIBG, 24% of relapsed patients had progressive disease compared to only 9% of refractory patients, and 39% of relapsed patients had stable disease compared to 59% of refractory patients (p=0.02). Among all patients, the 24-month OS was 47.0% (95% confidence interval (CI) 39.9-53.9%). The 24-month OS for refractory patients was significantly higher at 65.3% (95% CI 51.8-75.9%), compared to 38.7% (95% CI 30.4-46.8%) for relapsed patients (prefractory disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Iodine-131 Tositumomab: (131)I-anti-B1 antibody, (131)I-tositumomab, anti-CD20 murine monoclonal antibody-I-131, B1, Bexxar, (131)I-anti-B1 antibody, iodine-131 tositumomab, iodine-131 anti-B1 antibody, tositumomab.

    Science.gov (United States)

    2003-01-01

    Iodine-131 tositumomab [B1, Bexxar , iodine-131 anti-B1 antibody] is a murine antibody conjugated to iodine 131 that recognises and binds to the B1 (CD20) antigen which is found specifically on B lymphocytes. Iodine-131 tositumomab has a dual mechanism of action. It is capable of initiating a host immune response to those B cells to which it is attached, and it also triggers apoptosis in a significant proportion of the cells to which it binds. The product was first discovered by Coulter Corporation, Miami, in collaboration with the Dana-Farber Cancer Institute and the University of Michigan. The spin-off company Coulter Pharmaceutical, upon its formation, obtained worldwide rights to iodine-131 tositumomab. (Coulter Corporation was acquired subsequently by Beckman Instruments in October 1997. The union of the two companies produced Beckman Coulter.) In December 2000, Coulter Pharmaceutical was acquired by, and merged into, Corixa Corporation.Iodine-131 tositumomab is available for licencing in Japan. Corixa Corporation and GlaxoSmithKline signed an agreement to jointly develop and commercialise iodine-131 tositumomab. The total agreement has a potential value of up to $US132 million, plus shared profits and royalties. The two companies will jointly market the antibody in the US following regulatory approval. Corixa Corporation has announced it expects iodine-131 tositumomab to be approved in the US for non-Hodgkin's lymphoma (NHL). Under the terms of the original agreement, GlaxoSmithKline will receive exclusive marketing rights outside the US, excluding Japan. However, an amended agreement between the two companies will allow Corixa Corporation to also market the product outside the US. In February 2003, the European Commission granted iodine-131 tositumomab orphan-drug designation. Corixa Corporation and GlaxoSmithKline also intend to jointly investigate the use of the product in other indications. GlaxoSmithKline may also receive access to second generation anti

  15. Comparative biodistribution profile of [131I]VIP and [131I]VIP10-28

    Directory of Open Access Journals (Sweden)

    Maria Tereza Colturato

    2005-10-01

    Full Text Available Various tumor cells express significantly higher amounts of VIP receptors (VIPR that provided the basis for the clinical use of radiolabeled VIP for the in vivo localization of tumors. This work studied the labeling of VIP and VIP10-28 with iodine-131 to compare the biological distribution of the labeled compounds in Nuce mice and the affinity for tumor cells. Both VIP and VIP10-28 peptides contain two tyrosine residues, in positions 10 and 22, that are theoretically equally susceptible to radioiodination employing oxidative electrophilic substitution using oxidizing agents like Chloramine T. Radiochemical purity of the reaction mixture was determined by electrophoresis and HPLC. The VIP peptide and the fragment were labeled with radioiodine with good radiochemical yield (above 96%. Suitable, but important differences can be observed in biological distribution studies. Comparatively, blood clearance was faster for labeled VIP and perhaps because of this, the uptake in tumor was lower, especially during the first hour. These differences observed in the biological distribution of the compounds can be related to the lipophilicity of the labeled compounds.Várias células tumorais expressam significantemente uma alta quantidade de receptores VIP (VIPR que determinam a base para o uso clínico de VIP radiomarcado para localização de tumores in vivo. Foi estudado neste trabalho a marcação do VIP e do fragmento VIP10-28 com iodo-131 comparando a distribuição biológica dos compostos marcados em camundongos Nude e sua afinidade pelas células tumorais. Ambos os peptídeos, VIP e VIP10-28. contém dois resíduos de tirosina nas posições 10 e 22, que teoricamente são igualmente susceptíveis pela substituição eletrofílica oxidativa do radioiodo utilizando Cloramina T como agente oxidante. A pureza radioquímica da mistura de reação foi determinada por eletroforese e cromatografia líquida de alta eficiência (CLAE. O VIP e fragmento foram

  16. 40 CFR 92.131 - Smoke, data analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Smoke, data analysis. 92.131 Section... analysis. The following procedure shall be used to analyze the smoke test data: (a) Locate each throttle... following procedure: (1) Locate the highest reading, and integrate the highest 3-second average reading...

  17. Growth and bacteriocin production kinetics of Leuconostoc mesenteroides E131.

    Science.gov (United States)

    Drosinos, E H; Mataragas, M; Nasis, P; Galiotou, M; Metaxopoulos, J

    2005-01-01

    The aim of this study was to investigate the effect of pH, temperature, sodium chloride, type and level of sugar used in fermented sausages, on the occurrence and the concentration of the maximum bacteriocin activity, in order to optimize the bacteriocin synthesis during the growth cycle of Leuconostoc mesenteroides E131. In order to study the effect of the environmental factors on growth and bacteriocin production of Leuc. mesenteroides E131 fermentations were carried out in fermentor as well as in flasks. Mathematical equations were used to describe the kinetic parameters of the strain. When the micro-organism was grown in lower pH value (5.5) than optimum for growth (pH 6.5) the bacteriocin production was enhanced. On the contrary, bacteriocin production was favoured when the micro-organism was grown at temperatures close to the optimum for growth (25 degrees C). Finally, the level and the type of the sugar used as carbon source affected both growth and bacteriocin production with glucose being better source for biomass production and fructose more suitable for bacteriocin production. Leuconostoc mesenteroides E131 has a potential use as protective culture or its bacteriocin as protective agent in combination with another starter culture in fermented meats. Better understanding of the influence of environmental factors, such as pH, temperature and carbon source on the kinetic behaviour of Leuc. mesenteroides E131.

  18. Iodine Symporter Targeting with 124I/131I Theranostics

    NARCIS (Netherlands)

    Nagarajah, J.; Janssen, M.; Hetkamp, P.; Jentzen, W.

    2017-01-01

    Theranostics, a modern approach combining therapeutics and diagnostics, is among the most promising concepts in nuclear medicine for optimizing and individualizing treatments for many cancer entities. Theranostics has been used in clinical routines in nuclear medicine for more than 60 y-as 131I for

  19. Microdeletion in distal 17p13.1

    DEFF Research Database (Denmark)

    Zeesman, Susan; Kjaergaard, Susanne; Hove, Hanne Buciek

    2012-01-01

    Array comparative genomic hybridization has led to the identification of new syndromes by identifying genomic imbalances not detectable by standard karyotyping methods and by allowing correlations with physical findings. Deletions in the 17p13.1 region have been reported in patients with dysmorph...

  20. Enhanced cadmium phytoremediation of Glycine max L. through bioaugmentation of cadmium-resistant bacteria assisted by biostimulation.

    Science.gov (United States)

    Rojjanateeranaj, Pongsarun; Sangthong, Chirawee; Prapagdee, Benjaphorn

    2017-10-01

    This study examined the potential of three strains of cadmium-resistant bacteria, including Micrococcus sp., Pseudomonas sp. and Arthrobacter sp., to promote root elongation of Glycine max L. seedlings, soil cadmium solubility and cadmium phytoremediation in G. max L. planted in soil highly polluted with cadmium with and without nutrient biostimulation. Micrococcus sp. promoted root length in G. max L. seedlings under toxic cadmium conditions. Soil inoculation with Arthrobacter sp. increased the bioavailable fraction of soil cadmium, particularly in soil amended with a C:N ratio of 20:1. Pot culture experiments observed that the highest plant growth was in Micrococcus sp.-inoculated plants with nutrient biostimulation. Cadmium accumulation in the roots, stems and leaves of G. max L. was significantly enhanced by Arthrobacter sp. with nutrient biostimulation. A combined use of G. max L. and Arthrobacter sp. with nutrient biostimulation accelerated cadmium phytoremediation. In addition, cadmium was retained in roots more than in stems and leaves and G. max L. had the lowest translocation factor at all growth stages, suggesting that G. max L. is a phytostabilizing plant. We concluded that biostimulation-assisted bioaugmentation is an important strategy for improving cadmium phytoremediation efficiency. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Data on repeated (131)I-WB scans and the incidence of positive Tg and negative (131)I-WBS in DTC patients from a 24 months study.

    Science.gov (United States)

    Adedapo, Kayode S; Vangu, Mboyo Di Tamba

    2011-01-01

    We present data on repeated iodine-131 whole body scans ((131)I-WBS) in differentiated thyroid cancer patients (DTC) after surgery and (131)I remnant ablation and on increased thyroglobulin (Tg) with negative (131)I-WBS, in a retrospective study at our hospital. A total of 106 patients (91 female and 15 male) treated with (131)I for DTC met the inclusion criteria. The mean age of the patients was 45 years, age range 16-81 years. A total of 101 patients had complete 24 months follow-up following (131)I remnant ablation treatment. The mean (131)I dose administered after the first 6 months of follow- up was 3GBq while mean total dose was 4.9GBq, range 1.1-7.4GBq. Our results showed that at the end of the first 6 months post treatment, 58/101 patients had a negative (131)I-WBS. By the end of the 4th (131)I treatment at 24th months, the remaining 43 patients became negative for (131)I-WBS. We found increased Tg and negative (131)I-WBS in 2 of the 101 patients at the 24th months examination the so called Tg elevated negative (131)I-WBS (TENIS syndrome). The possible explanation of this syndrome is discussed. In conclusion, our study in DTC operated patients does not support the use of repeated diagnostic (131)I-WBS after an undetectable Tg because we found no Tg rebound in patients with negative (131)I-WBS, after 24 months of follow-up with serial measurements of Tg on and of suppression with L thyroxine.

  2. Evaluation of {sup 131}I retention in several adsorbers

    Energy Technology Data Exchange (ETDEWEB)

    Catanoso, Marcela F.; Osso Junior, Joao Alberto, E-mail: marcela.forli@gmail.co, E-mail: jaosso@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil). Diretoria de Radiofarmacia

    2011-07-01

    Several iodine radioisotopes are used in nuclear medicine for treatment and diagnostic purposes. The radioisotope {sup 131}I is used both in diagnosis and therapy due to its physical characteristics of decay by {beta}{sup -} and its {gamma}-ray emissions suitable for diagnosis. It is routinely produced at IPEN through the irradiation of TeO{sub 2} targets in the IEA-R1m nuclear reactor. After the irradiation, the {sup 131}I is separated by dry distillation, where the targets are put in an oven, heated at 760 deg C for 2 hours and the {sup 131}I, volatile, is carried by an O{sub 2} gas stream. The aim of this work was to evaluate the retention and elution of {sup 131}I samples produced at IPEN in several adsorbers as part of a project aiming the purification of these radioisotopes, allowing the labeling of biomolecules. Samples of {sup 131}I were used for retention and elution studies with the following adsorbers: commercial cartridges, anionic resin columns and cationic resin column. The results showed that Ag cartridges and anionic resins Dowex 1X8, Dowex 3 and IRA 400 had a great iodine retention but no elution after using specific eluents. The QMA light, acid alumina, neutral alumina and cationic resin Dowex 50WX4 showed high retention and elution and QMA plus and cationic resin Dowex 50WX8 and Dowex 50WX12 had a good retention but lower elution. Regarding to the better retention and elution, Ag cartridges and resins showed a higher percentage of iodine retention but lower elution yield and QMA light, acid and neutral alumina cartridges showed better results. (author)

  3. Assessment and management of risk to wildlife from cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Burger, Joanna [Division of Life Sciences, Environmental and Occupational Health Sciences Institute, Consortium for Risk Evaluation with Stakeholder Participation, Rutgers University, Piscataway, New Jersey, 08854-8082 (United States)], E-mail: burger@biology.rutgers.edu

    2008-01-15

    Cadmium, a nonessential heavy metal that comes from natural and anthropogenic sources, is a teratogen, carcinogen, and a possible mutagen. Assessment of potential risk from cadmium requires understanding environmental exposure, mainly from ingestion, although there is some local exposure through inhalation. Chronic exposure is more problematic than acute exposure for wildlife. There is evidence for bioaccumulation, particularly in freshwater organisms, but evidence for biomagnification up the food chain is inconsistent; in some bird studies, cadmium levels were higher in species that are higher on the food chain than those that are lower. Some freshwater and marine invertebrates are more adversely affected by cadmium exposure than are birds and mammals. There is very little experimental laboratory research on the effects of cadmium in amphibians, birds and reptiles, and almost no data from studies of wildlife in nature. Managing the risk from cadmium to wildlife involves assessment (including ecological risk assessment), biomonitoring, setting benchmarks of effects, regulations and enforcement, and source reduction.

  4. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    Energy Technology Data Exchange (ETDEWEB)

    Koparanova, N.; Simov, S. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Fizika na Tvyrdoto Tyalo); Genchev, D. (Bylgarska Akademiya na Naukite, Sofia. Inst. za Yadrena Izsledvaniya i Yadrena Energetika); Metchenov, G. (Research Inst. of Criminalistics and Criminology, Sofia (Bulgaria))

    1985-02-01

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more.

  5. Methodology for management of therapeutic dose of I-131; Metodologia para administrar dosis terapeutica de I-131

    Energy Technology Data Exchange (ETDEWEB)

    Basteris M, J.; Gomez D, R. [Universidad Autonoma de Yucatan, Facultad de Medicina, Merida, Yucatan (Mexico)

    2007-07-01

    The present work suggests the use of measures guided to eliminate the resulting chronic sialoadenitis of the treatment previously described with a therapeutic dose bigger than ablative of Iodine 131, as well as the use of citric fruits to stimulate the salivation, the administration of liquid post-dose is included to accelerate the gastric emptying avoiding the secondary effects as the vomit. (Author)

  6. Treatment of hyperthyroidism by 131-iodine; Traitement des hyperthyroidies par l'iode 131: dose calculee versus dose fixe

    Energy Technology Data Exchange (ETDEWEB)

    Fieffe, S.; Cuif-Joba, A.; Testard, A.; Fortuna, I.; Pocharta, J.M.; Papathanassioua, D.; Schvartz, C. [Service d' endocrinologie et medecine nucleaires, institut Jean-Godinot, 1, rue du General Koeing, 51056 Reims, (France)

    2009-05-15

    In a first time, we chose to modify the dose to be administered, on using always the Marinelli formula but on increasing the absorbed dose. In a second time, we wanted to simplify the determination of the dose to be administered by modulating it only in function of the thyroid volume. Two groups of patients were managed for hyperthyroidism recurrence. In a first group the iodine dose ({sup 131}I) was determined with the help of the simplified Marinelli formula: chosen absorbed dose was 150 Gy, gland volume determined by echography, measurement of the fixation at the sixth hour. In the second group, the thyroid volume was determined by echography. The patients with a thyroid from 5 to 30 g received 185 MBq, from 30 to 50 g 370 MBq and superior to 50 g 555 MBq of iodine 131. The two groups of patients have the same characteristics. the results of treatment by iodine 131, evaluated on the dosages of T4L and TSH at three and six months, show the preservation of euthyroidism or the passage in hypothyroidism among 94% of patients in the group 1 and 80% of patients in the group 2. These results are not significantly different. The easiness of the realisation of the treatment in the group 2 lead us to continue this simplified therapy scheme that allows equally to improve the radiation protection of medical personnel by avoiding the use of iodine 131. (N.C.)

  7. Association of Environmental Cadmium Exposure with Pediatric Dental Caries

    OpenAIRE

    Arora, Manish; Weuve, Jennifer Lynn; Schwartz, Joel David; Robert O Wright

    2008-01-01

    Background: Although animal experiments have shown that cadmium exposure results in severe dental caries, limited epidemiologic data are available on this issue. Objectives: We aimed to examine the relationship between environmental cadmium exposure and dental caries in children 6–12 years of age. Methods: We analyzed cross-sectional data, including urine cadmium concentrations and counts of decayed or filled tooth surfaces, from the Third National Health and Nutrition Examination Survey. We ...

  8. Bioremoval of cadmium by lemna minor in different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Uysal, Yagmur [Dept. of Environmental Engineering, Kahramanmaras Sutcu Imam University, Kahramanmaras (Turkey); Taner, Fadime [Dept. of Environmental Engineering, Mersin University, Mersin (Turkey)

    2010-04-15

    This study was undertaken to determine the cadmium removal efficiency of Lemna minor when it was used for treatment of wastewater having different characteristics, i. e., pH, temperature and cadmium concentration. Plants were cultivated in different pH solutions (4.5-8.0) and temperatures (15-35 C) in the presence of cadmium (0.1-10.0 mg/L) for 168 h. The amount of biomass obtained in the study period, the concentrations of cadmium in the tissues and in the media and net uptake of cadmium by Lemna have been determined for each condition. The percentages of cadmium uptake (PMU) and bioconcentration factors (BCF) were also calculated. The highest accumulation was obtained for the highest cadmium concentration of 10.0 mg Cd/L as 11.668 mg Cd/g at pH 6.0, and as 38.650 mg Cd/g at 35 C and pH 5.0. The cadmium accumulation gradually increased with initial concentration of the medium, but the opposite trend was observed for the PMU. However, the maximum PMU was obtained as 52.2% in the solution with the lowest concentration of 0.1 mg Cd/L. A mathematical model was used to describe the cadmium uptake and the equation obtained was seen to fit the experimental data very well. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  9. Short Communication Acute toxicity of cadmium against catfish ...

    African Journals Online (AJOL)

    Short Communication Acute toxicity of cadmium against catfish Heteropneustes Fossilis (Siluriformes: Heteropneustidae) in static renewal bioassays. Rubi Rai, Diwakar Mishra, Sunil Kumar Srivastav, Ajai Kumar Srivastav ...

  10. Inactivation of cadmium in contaminated soils using synthetic zeolites.

    Science.gov (United States)

    Gworek, B

    1992-01-01

    The addition of synthetic zeolite pellets to soils contaminated with cadmium significantly reduced the concentrations of cadmium in the roots and shoots of a range of crop plants. Use of synthetic foyazite group zeolites types 4A and 13X, at application rates of 1% by soil weight, caused reductions in cadmium concentrations of up to 86% in leaves of lettuce grown in pots, compared to controls with no added zeolites. The potential of these substances to reduce cadmium entry into the food chain, and as a clean up method, is noted.

  11. Mercury Cadmium Selenide for Infrared Detection

    Science.gov (United States)

    2013-06-01

    were grown using elemental mercury (Hg), cadmium (Cd), and selenium (Se) sources. The beam equiva- lent pressure ( BEP ) emanating from all sources was...flux), the BEP measured for the cracker source was found to vary with the cracking zone temperature, tracking with the data found in Ref. 7. This sug...The Se BEP measured for the typical cracking zone temperature of 800 C was found to be close to a factor of two lower than at the typical effusion cell

  12. Cadmium-binding proteins from blue crabs (Callinectes sapidus) environmentally exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Wiedow, M.A.; Kneip, T.J.; Garte, S.J.

    1982-06-01

    Two heat-stable (90/sup 0/C) cadmium-binding proteins were isolated from the hepatopancreas of Hudson River blue crabs (Callinectes sapidus) by Sephadex G-75 gel filtration chromatography. These proteins have molecular weights of 10,600 and 9,400, and ultraviolet absorbance ratios at 250/280 nm of 12.4 and 5.4, respectively. Repeated freezing and thawing and prolonged (3-6 weeks) storage resulted in protein degradation or loss of Cd-binding activity. These proteins were induced by laboratory injection of CdCl/sub 2/ in blue crabs from pristine (Chesapeake Bay) areas; however, injection of CdCl/sub 2/ into Hudson River animals yielded anomalous chromatography profiles. Cadmium-binding proteins were also identified in blue crab thoracic muscle and gill. The possibility is discussed that these proteins are a type of metallothionein and could contribute to the human toxicity of this cadmium-contaminated edible crustacean.

  13. Cadmium concentrations in the testes, sperm, and spermatids of mice subjected to long-term cadmium chloride exposure.

    Science.gov (United States)

    Bench, G; Corzett, M H; Martinelli, R; Balhorn, R

    1999-01-01

    Exposures to cadmium have been reported to reduce male fertility and there are several hypotheses that suggest how reduced male fertility may result from incorporation of cadmium into sperm chromatin. The purpose of this study was to determine whether mice subjected to long-term intraperitoneal cadmium exposure incorporated cadmium into their sperm chromatin. Male mice were exposed to 0.1 mg/kg body weight cadmium in the form of CdCl2 via intraperitoneal injection once per week for 4, 10, 26, and 52 weeks and then sacrificed. The cadmium contents of the liver, testes, pooled sperm, and pooled spermatids from dosed and control animals were determined by atomic absorption spectroscopy. Cadmium and zinc contents in individual sperm and spermatid heads were determined by particle-induced x-ray emission. Atomic absorption spectroscopy revealed that although cadmium accumulated in the liver and testes, cadmium was not detected in pooled sperm or spermatid samples down to minimum detectable limits of 0.02 microg/g dry weight. Particle-induced x-ray emission analyses did not show the presence of cadmium in any sperm or spermatid head down to minimum detectable limits of 15 microg/g dry weight. Particle-induced x-ray emission analyses also demonstrated that phosphorus, sulfur, and zinc concentrations in individual sperm and spermatid heads were not altered by exposure to CdCl2. Because cadmium was not incorporated into sperm chromatin at levels above 0.02 microg/g dry weight, the data cast doubt on hypotheses that suggest that reduced male fertility may result from incorporation of cadmium into sperm chromatin.

  14. Bioaugmentation with cadmium-resistant plant growth-promoting rhizobacteria to assist cadmium phytoextraction by Helianthus annuus.

    Science.gov (United States)

    Prapagdee, Benjaphorn; Chanprasert, Maesinee; Mongkolsuk, Skorn

    2013-07-01

    Micrococcus sp. MU1 and Klebsiella sp. BAM1, the cadmium-resistant plant growth-promoting rhizobacteria (PGPR), produce high levels of indole-3-acetic acid (IAA) during the late stationary phase of their growth. The ability of PGPR to promote root elongation, plant growth and cadmium uptake in sunflowers (Helianthus annuus) was evaluated. Both species of bacteria were able to remove cadmium ions from an aqueous solution and enhanced cadmium mobilization in contaminated soil. Micrococcus sp. and Klebsiella sp. use aminocyclopropane carboxylic acid as a nitrogen source to support their growth, and the minimum inhibitory concentrations of cadmium for Micrococcus sp. and Klebsiella sp. were 1000 and 800mM, respectively. These bacteria promoted root elongation in H. annuus seedlings in both the absence and presence of cadmium compared to uninoculated seedlings. Inoculation with these bacteria was found to increase the root lengths of H. annuus that had been planted in cadmium-contaminated soil. An increase in dry weight was observed for H. annuus inoculated with Micrococcus sp. Moreover, Micrococcus sp. enhanced the accumulation of cadmium in the root and leaf of H. annuus compared to untreated plants. The highest cadmium accumulation in the whole plant was observed when the plants were treated with EDTA following the treatment with Micrococcus sp. In addition, the highest translocation of cadmium from root to the above-ground tissues of H. annuus was found after treatment with Klebsiella sp. in the fourth week after planting. Our results show that plant growth and cadmium accumulation in H. annuus was significantly enhanced by cadmium-resistant PGPRs, and these bacterial inoculants are excellent promoters of phytoextraction for the rehabilitation of heavy metal-polluted environments. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium chloride in rats. An experiment where 40 rats were divided into 4 groups and a control group and dosed...... with whole linseed, crushed linseed, cocoa and CdCl2 for 3 weeks was performed. Linseed or cocoa made up 10% of the feed (by weight) and was added as a replacement for carbohydrate source. The rats were dosed for 3 weeks and the cadmium content in the rats' kidneys was measured by ICPMS as a biomarker...... be measured in the kidney compared to the calculated total intake was as follows: Control 2.0 %, Crushed linseed 0.9 %, whole linseed, 1.5 %, cocoa 0.7 % and CdCl2 4.6 %. Based on this study it could not be concluded that the bioavailability in rats form whole linseed is lower that for crushed linseed...

  16. Acute fatal occupational cadmium poisoning by inhalation

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, K.; Ueda, M.; Kikuchi, H.; Hattori, H.; Hiraoka, Y.

    1983-01-01

    A 43-year-old male smelter was admitted to a hospital on account of severe dyspnea about 2 days after exposure to brownish-yellow smoke produced by melting of ''copper'' scrap. On admission pronounced hypoxemia was revealed, and an oxygen-enriched gas was administered after intubation. Although inspired oxygen concentration was gradually increased, hypoxemia progressed and he died on day 11 in hospital. The principal autopsy finding was chiefly confined to the lungs. Both lungs were heavy (the left weighing 1,470 g; the right 1,710 g) and firm to the touch. Histologically, no normal alveoli were found throughout the entire lung. Some alveolar spaces were occupied by pneumocytes, others by organized exudate with fibrosis. Interstitial fibrosis was present. Patchy areas of inflammatory cell infiltrations as well as intra-alveolar hemorrhages were observed. On the basis of the above findings a diagnosis of diffuse alveolar damage was made. Based on the available evidence (presence of cadmium in the ''copper'' scrap, feature of the smoke, clinical signs with latent time, and high cadmium concentration of the lung), the diffuse alveolar damage was considered to have been caused by inhaled cadmium. The pulmonary change of the present case was more advanced in pathologic stage in comparison with those reported in the literature.

  17. Sulfates, Clouds and Radiation Brazil (SCAR-B) University of Washington C131A Data

    Data.gov (United States)

    National Aeronautics and Space Administration — SCAR_B_UWC131A data are Smoke/Sulfates, Clouds and Radiation Experiment in Brazil data from instruments on board the University of Washington C131A aircraft in...

  18. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1993-03-01

    Detailed results of the Hanford Environmental Dose Reconstruction project (HEDR) iodine-131 release reconstruction are presented in this volume. Included are daily data on B, D, and F Plant, reactor operations from the P-Department Daily Reports (General Electric Company 1947). Tables of B and T Plant material processed from the three principal sources on separations plant operations: The Jaech report (Jaech undated), the 200 Area Report (Acken and Bird 1945; Bird and Donihee 1945), and the Metal History Reports (General Electric Company 1946). A transcription of the Jaech report is also provided because it is computer-generated and is not readily readable in its original format. The iodine-131 release data are from the STRM model. Cut-by-cut release estimates are provided, along with daily, monthly, and yearly summations. These summations are based on the hourly release estimates. The hourly data are contained in a 28 megabyte electronic file. Interested individuals may request a copy.

  19. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1992-10-01

    Detailed results of the Hanford Environmental Dose Reconstruction (HEDR) iodine-131 release reconstruction are presented in this volume. Included are daily data on B, D, and F Plant, reactor operations from the P-Department Daily Reports (General Electric Company 1947). Tables of B and T Plant material processed from the three principal sources on separations plant operations: The Jaech report (Jaech undated), the 200 Area Report (Acken and Bird 1945; Bird and Donihee 1945), and the Metal History Reports (General Electric Company 1946). A transcription of the Jaech report is also provided because it is computer-generated and is not readily readable in its original format. The iodine-131 release data are from the STRM model. Cut-by-cut release estimates are provided, along with daily, monthly, and yearly summations. These summations are based on the hourly release estimates. The hourly data are contained in a 28 megabyte electronic file. Interested individuals may request a copy.

  20. Choriocarcinoma: blocking factor and monoclonal antibody iodine 131 imaging

    Energy Technology Data Exchange (ETDEWEB)

    Pattillo, R.A.; Khazaeli, M.B.; Ruckert, A.C.; Hussa, R.O.; Collier, B.D.; Beierwaltes, W.; Mattingly, R.F.

    1984-04-01

    Postoperative iodine 131 monoclonal antibody localization in metastatic choriocarcinoma was accomplished in this study. The monoclonal antibody was prepared to male choriocarcinoma which cross reacted with gestational choriocarcinoma. The antibody was raised against whole choriocarcinoma cells and human chorionic gonadotropin (hCG) cross reactivity was excluded. The purified antibody was iodinated with /sup 131/I and successfully imaged BeWo choriocarcinoma transplanted in nude mice; however, imaging of choriocarcinoma in a patient was verified only after resection. It is our belief that failure to sufficiently concentrate the antibody in the tumor before operation was due to blocking factor in the serum of the patient. Blocking factor and hCG dropped postoperatively. Blocking factor activity in 15 patients with metastatic trophoblastic disease was monitored and, like hCG, was found to be a sensitive indicator of the presence of disease. Its efficacy may be in the small number of patients without hCG but with persistent disease.

  1. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1993-03-01

    Releases of fission product iodine-131 are calculated for the 1944 through 1947 period from the Hanford Reservation. Releases to the atmosphere were from the ventilation stacks of T and B separation plants. A reconstruction of daily separation plant operations forms the basis of the releases. The reconstruction traces the iodine-131 content of each fuel discharge from the B, D, and F Reactors to the dissolving step in the separation plants. Statistical computer modeling techniques are used to estimate hourly release histories based on sampling mathematical distribution functions that express the uncertainties in the source data and timing. The reported daily, monthly, and yearly estimates are averages and uncertainty ranges are based on 100 independent Monte Carlo realizations'' of the hourly release histories.

  2. Correlative characteristic of cadmium in soils of steppe Dnieper region

    Directory of Open Access Journals (Sweden)

    N. M. Tsvetkova

    2015-09-01

    Full Text Available Much attention is paid to searching for methods of establishing environmental standards for objective assessment of admissibility of anthropogenic load on the biosphere. The main pollutants of the environment are xenobiotics; heavy metals such as cadmium occupy hold a special place among them. Cadmium is one of the most dangerous environmental toxic agents, belonging to the 1stclass of hazard. Due to insufficient and fragmented information available on the distribution of cadmium in the city edaphotopes, it’s necessary to conduct additional research, taking into account the properties of soils and the biological characteristics of every element. The paper shows the ratio of cadmium in soils and soil-forming rocks of steppe Dnieper region. Environmental assessment of cadmium content in Dniprodzerzhinsk city soilsis made, and the problem of topsoil contamination of the city as a territory of high anthropogenic load is considered. It is found that the content of cadmium down the profile in natural soil increases. Enrichment of the topsoil with cadmium occurs due to contamination. The value of movable forms content, expressed as a percentage of the total content, varies from 12% to 70%, providing the evidence of the technogenic origin of cadmium in Dniprodzerzhinsk city topsoil. General and proximate correlation analyses of interrelation of soil cadmium and specifically selected characteristics of soil (pH, humus, sulfate ions, dry solid, chloride ions, total alkalinity, hygroscopic moisture were made. It is established that cadmium concentration in the movable forms of natural soils of the steppe Dnieper region depends primarily on pH value. With the increase in pH value, concentration of movable cadmium in soil increases.

  3. Mutagenic effect of cadmium on tetranucleotide repeats in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Slebos, Robbert J.C. [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States) and Department of Otolaryngology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States)]. E-mail: r.slebos@vanderbilt.edu; Li Ming [Department of Biostatistics, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Evjen, Amy N. [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Coffa, Jordy [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Shyr, Yu [Department of Biostatistics, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Yarbrough, Wendell G. [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Department of Otolaryngology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States)

    2006-12-01

    Cadmium is a human carcinogen that affects cell proliferation, apoptosis and DNA repair processes that are all important to carcinogenesis. We previously demonstrated that cadmium inhibits DNA mismatch repair (MMR) in yeast cells and in human cell-free extracts (H.W. Jin, A.B. Clark, R.J.C. Slebos, H. Al-Refai, J.A. Taylor, T.A. Kunkel, M.A. Resnick, D.A. Gordenin, Cadmium is a mutagen that acts by inhibiting mismatch repair, Nat. Genet. 34 (3) (2003) 326-329), but cadmium also inhibits DNA excision repair. For this study, we selected a panel of three hypermutable tetranucleotide markers (MycL1, D7S1482 and DXS981) and studied their suitability as readout for the mutagenic effects of cadmium. We used a clonal derivative of the human fibrosarcoma cell line HT1080 to assess mutation levels in microsatellites after cadmium and/or N-methyl-N-nitro-N-nitrosoguanidine (MNNG) exposure to study effects of cadmium in the presence or absence of base damage. Mutations were measured in clonally expanded cells obtained by limiting dilution after exposure to zero dose, 0.5 {mu}M cadmium, 5 nM MNNG or a combination of 0.5 {mu}M cadmium and 5 nM MNNG. Exposure of HT1080-C1 to cadmium led to statistically significant increases in microsatellite mutations, either with or without concurrent exposure to MNNG. A majority of the observed mutant molecules involved 4-nucleotide shifts consistent with DNA slippage mutations that are normally repaired by MMR. These results provide evidence for the mutagenic effects of low, environmentally relevant levels of cadmium in intact human cells and suggest that inhibition of DNA repair is involved.

  4. Cadmium induces transcription independently of intracellular calcium mobilization.

    Directory of Open Access Journals (Sweden)

    Brooke E Tvermoes

    Full Text Available BACKGROUND: Exposure to cadmium is associated with human pathologies and altered gene expression. The molecular mechanisms by which cadmium affects transcription remain unclear. It has been proposed that cadmium activates transcription by altering intracellular calcium concentration ([Ca(2+](i and disrupting calcium-mediated intracellular signaling processes. This hypothesis is based on several studies that may be technically problematic; including the use of BAPTA chelators, BAPTA-based fluorescent sensors, and cytotoxic concentrations of metal. METHODOLOGY/PRINCIPAL FINDING: In the present report, the effects of cadmium on [Ca(2+](i under non-cytotoxic and cytotoxic conditions was monitored using the protein-based calcium sensor yellow cameleon (YC3.60, which was stably expressed in HEK293 cells. In HEK293 constitutively expressing YC3.60, this calcium sensor was found to be insensitive to cadmium. Exposing HEK293::YC3.60 cells to non-cytotoxic cadmium concentrations was sufficient to induce transcription of cadmium-responsive genes but did not affect [Ca(2+](i mobilization or increase steady-state mRNA levels of calcium-responsive genes. In contrast, exposure to cytotoxic concentrations of cadmium significantly reduced intracellular calcium stores and altered calcium-responsive gene expression. CONCLUSIONS/SIGNIFICANCE: These data indicate that at low levels, cadmium induces transcription independently of intracellular calcium mobilization. The results also support a model whereby cytotoxic levels of cadmium activate calcium-responsive transcription as a general response to metal-induced intracellular damage and not via a specific mechanism. Thus, the modulation of intracellular calcium may not be a primary mechanism by which cadmium regulates transcription.

  5. Transcriptional response to 131I exposure of rat thyroid gland.

    Science.gov (United States)

    Rudqvist, Nils; Spetz, Johan; Schüler, Emil; Parris, Toshima Z; Langen, Britta; Helou, Khalil; Forssell-Aronsson, Eva

    2017-01-01

    Humans are exposed to 131I in medical diagnostics and treatment but also from nuclear accidents, and better knowledge of the molecular response in thyroid is needed. The aim of the study was to examine the transcriptional response in thyroid tissue 24 h after 131I administration in rats. The exposure levels were chosen to simulate both the clinical situation and the case of nuclear fallout. Thirty-six male rats were i.v. injected with 0-4700 kBq 131I, and killed at 24 h after injection (Dthyroid = 0.0058-3.0 Gy). Total RNA was extracted from individual thyroid tissue samples and mRNA levels were determined using oligonucleotide microarray technique. Differentially expressed transcripts were determined using Nexus Expression 3.0. Hierarchical clustering was performed in the R statistical computing environment. Pathway analysis was performed using the Ingenuity Pathway Analysis tool and the Gene Ontology database. T4 and TSH plasma concentrations were measured using ELISA. Totally, 429 differentially regulated transcripts were identified. Downregulation of thyroid hormone biosynthesis associated genes (e.g. thyroglobulin, thyroid peroxidase, the sodium-iodine symporter) was identified in some groups, and an impact on thyroid function was supported by the pathway analysis. Recurring downregulation of Dbp and Slc47a2 was found. Dbp exhibited a pattern with monotonous reduction of downregulation with absorbed dose at 0.0058-0.22 Gy. T4 plasma levels were increased and decreased in rats whose thyroids were exposed to 0.057 and 0.22 Gy, respectively. Different amounts of injected 131I gave distinct transcriptional responses in the rat thyroid. Transcriptional response related to thyroid function and changes in T4 plasma levels were found already at very low absorbed doses to thyroid.

  6. 10 CFR 1.31 - Office of the Chief Financial Officer.

    Science.gov (United States)

    2010-01-01

    ... comply with the Federal Manager's Financial Integrity Act of 1982; (e) Develops and manages an agencywide... 10 Energy 1 2010-01-01 2010-01-01 false Office of the Chief Financial Officer. 1.31 Section 1.31... Financial Officer § 1.31 Office of the Chief Financial Officer. The Office of the Chief Financial Officer...

  7. 40 CFR 131.42 - Antidegradation Implementation Methods for the Commonwealth of Puerto Rico.

    Science.gov (United States)

    2010-07-01

    ... for the Commonwealth of Puerto Rico. 131.42 Section 131.42 Protection of Environment ENVIRONMENTAL... Standards § 131.42 Antidegradation Implementation Methods for the Commonwealth of Puerto Rico. (a) General... February 2, 1989 Resolution R-89-2-2 of the Governing Board of the Puerto Rico Environmental Quality Board...

  8. 26 CFR 1.381(c)(13)-1 - Involuntary conversions.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Involuntary conversions. 1.381(c)(13)-1 Section 1.381(c)(13)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Insolvency Reorganizations § 1.381(c)(13)-1 Involuntary conversions...

  9. Transcription pattern of UL131A-128 mRNA in clinical strains of ...

    Indian Academy of Sciences (India)

    Mean while, clones containing UL131A-128 transcripts in an HCMV cDNA library of a clinical strain were selected and sequenced. It was demonstrated that UL131A-128 mRNA was expressed with immediately early, early and late kinetics. Sequences obtained by RT-PCR showed that the UL131A gene consisted of two ...

  10. 21 CFR 516.131 - Refuse to file a request for determination of eligibility for indexing.

    Science.gov (United States)

    2010-04-01

    ... eligibility for indexing. 516.131 Section 516.131 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... § 516.131 Refuse to file a request for determination of eligibility for indexing. (a) If a request for determination of eligibility for indexing contains all of the information required by § 516.129, FDA shall file...

  11. 42 CFR 137.131 - When should a final offer be submitted?

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false When should a final offer be submitted? 137.131 Section 137.131 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE Final Offer § 137.131 When should...

  12. Interventional therapy for human breast cancer in nude mice with 131I gelatin microspheres (131I-GMSs) following intratumoral injection

    OpenAIRE

    Li, Chuan-Chao; Chi, Jun-Lin; Ma, Yu; Li, Jian-Hong; Xia, Chuan-Qin; LI, Lin; Chen, Zhuo; Chen, Xiao-li

    2014-01-01

    Introduction The aim of this study was to investigate the effects of 131I gelatin microspheres (131I-GMS) on human breast cancer cells (MCF-7) in nude mice and the biodistribution of 131I-GMSs following intratumoral injections. Methods A total of 20 tumor-bearing mice were divided into a treatment group and control group and received intratumoral injections of 2.5 mci 131I-GMSs and nonradioactive GMSs, respectively. Tumor size was measured once per week. Another 16 mice received intratumoral ...

  13. Epidemiology and characteristics of Escherichia coli sequence type 131 (ST131) from long-term care facility residents colonized intestinally with fluoroquinolone-resistant Escherichia coli.

    Science.gov (United States)

    Han, Jennifer H; Garrigan, Charles; Johnston, Brian; Nachamkin, Irving; Clabots, Connie; Bilker, Warren B; Santana, Evelyn; Tolomeo, Pam; Maslow, Joel; Myers, Janice; Carson, Lesley; Lautenbach, Ebbing; Johnson, James R

    2017-03-01

    The objective of this study was to evaluate molecular and epidemiologic factors associated with Escherichia coli sequence type 131 (ST131) among long-term care facility (LTCF) residents who acquired gastrointestinal tract colonization with fluoroquinolone-resistant E. coli (FQREC). Colonizing isolates from 37 residents who newly developed FQREC colonization at three LTCFs from 2006 to 2008 were evaluated. Twenty-nine (78%) of 37 total FQREC colonizing isolates were ST131. Most ST131 isolates had a distinctive combination of gyrA and parC replacement mutations. The ST131 and non-ST131 isolates differed significantly for the prevalence of many individual virulence factors but not for the proportion that qualified molecularly as extraintestinal pathogenic E. coli (ExPEC) or aggregate virulence factor scores. E. coli ST131 was highly prevalent among LTCF residents with FQREC colonization. Future studies should determine the risk factors for infection among ST131-colonized residents, and assess the potential for increased transmissibility of ST131 in the long-term care setting. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Determination of cadmium, lead and mercury residual levels in meat ...

    African Journals Online (AJOL)

    Determination of cadmium, lead and mercury residual levels in meat of canned light tuna ( Katsuwonus pelamis and Thunnus albacares ) and fresh little tunny ( Euthynnus alletteratus ) in Libya. ... Surveillance for mercury (Hg), lead (Pb) and cadmium (Cd) contamination in tuna products is crucial for consumer food safety.

  15. Biosorption of arsenic and cadmium from aqueous solutions ...

    African Journals Online (AJOL)

    The biosorption of cadmium and arsenic from aqueous solutions onto the unmodified compact biomass of microscopic filamentous fungus Aspergillus clavatus DESM. was studied in the concentration range of 0.25 – 100 mg.l-1. The experimental biosorption results for arsenic and cadmium followed well the Freundlich ...

  16. Synthesis and characterization of cadmium doped lead–borate ...

    Indian Academy of Sciences (India)

    Unknown

    No boroxol ring formation was observed in the structure of these glasses. Furthermore, doped cadmium atoms were not seen in tetrahedral coordination. But the conversion of three-fold to four-fold coordination of boron atoms in the structure of glasses was observed. Keywords. Cadmium; lead borate glasses. 1. Introduction.

  17. Cadmium ion removal using biosorbents derived from fruit peel wastes

    Directory of Open Access Journals (Sweden)

    Wanna Saikaew

    2009-11-01

    Full Text Available The ability of fruit peel wastes, corn, durian, pummelo, and banana, to remove cadmium ions from aqueous solution by biosorption were investigated. The experiments were carried out by batch method at 25oC. The influence of particle sizes, solution pH, and initial cadmium ion concentrations were evaluated on the biosorption studies. The result showed that banana peel had the highest cadmium ions removal followed by durian, pummelo, and corn peels at cadmium ions removal of 73.15, 72.17, 70.56, and 51.22%, respectively. There was a minimal effect when using different particle sizes of corn peel as biosorbent, while the particle size of the others had no influence on the removal of cadmium ions. The cadmium ions removal increased significantly as the pH of the solution increased rapidly from 1 to 5. At pH 5, the cadmium ions removal reached a maximum value. The equilibrium process was best described by the Langmuir isotherms, with maximum biosorption capacities of durian, pummelo, and banana peel of 18.55, 21.83, and 20.88 mg/g respectively. Fourier Transform Infrared Spectroscopy revealed that carboxyl, hydroxyl, and amide groups on the fruit peels’ surface and these groups were involved in the adsorption of the cadmium ions.

  18. Levels of cadmium in cigarette brands found in Zamfara state ...

    African Journals Online (AJOL)

    The levels of cadmium were determined in some cigarette brands found in Zamfara state, North-west Nigeria. The solutions of the samples were prepared using the dry-ash method. The levels of cadmium in the solution were determined using atomic absorption spectrometer. The absorbance readings of the elements were ...

  19. Levels of Lead, Cadmium and Chromium in Oreochromis Niloticus ...

    African Journals Online (AJOL)

    Lead (Pb), Cadmium (Cd) and Chromium (Cr) levels in Oreochromis niloticus, aquatic plants, water and sawdust were collected and analyzed for Lead, Cadmium and Chromium using atomic absorption spectroscopy. Results obtained showed that sawdust had the highest Lead and Chromium contents of 32.0 + 0.99 μg/g ...

  20. Evaluation of serum levels of cadmium and Lead in occupationally ...

    African Journals Online (AJOL)

    Cadmium and Lead are extremely toxic metals found in industrial workplaces. They are also found in some industrial paints and may represent hazards when sprayed.Exposure to Cadmium fumes may cause flu-like symptoms including chills, fever and muscle ache sometimes reffered to as "the cadium blues." Occupational ...

  1. Cadmium verification measurements of HFIR shroud assembly 22

    Energy Technology Data Exchange (ETDEWEB)

    Chapman, J.A.; Schultz, F.J.

    1994-04-01

    This report discusses radiation-based nondestructive examination methods which have been used to successfully verify the presence of cadmium in High Flux Isotope Reactor (HFIR) spent-fuel shroud assembly number 22 (SA22). These measurements show, in part, that SA22 is certified to meet the criticality safety specifications for a proposed reconfiguration of the HFIR spent-fuel storage array. Measurement of the unique 558.6-keV gamma-ray from neutron radiative capture on cadmium provided conclusive evidence for the presence of cadmium in the outer shroud of the assembly. Cadmium verification in the center post and outer shroud was performed by measuring the degree of neutron transmission in SA22 relative to two calibration shroud assemblies. Each measurement was performed at a single location on the center post and outer shroud. These measurements do not provide information on the spatial distribution or uniformity of cadmium within an assembly. Separate measurements using analog and digital radiography were performed to (a) globally map the continuity of cadmium internal mass, and (b) locally determine the thickness of cadmium. Radiography results will be reported elsewhere. The measurements reported here should not be used to infer the thickness of cadmium in either the center post or outer shroud of an assembly.

  2. The relationship between maternal blood cadmium, zinc levels and ...

    African Journals Online (AJOL)

    The delivery of babies with low birth weight is a prognosis of neonatal mortality, morbidity and poor health outcomes later in life. This study evaluates the levels of cadmium, zinc and calculated cadmium/zinc ratio in non-occupationally exposed pregnant women at delivery and their relationship with birth weight of babies.

  3. Elevated cadmium exposure may be associated with periodontal bone loss.

    Science.gov (United States)

    Dye, Bruce A; Dillon, Charles F

    2010-06-01

    Association of environmental cadmium exposure with periodontal disease in US adults. Arora M, Weuve J, Schwartz J, Wright RO. Environ Health Perspect 2009;117:739-44. Bruce A. Dye, DDS, MPH, Charles F. Dillon, MD, PhD. Is environmental cadmium associated with periodontal disease? Information not available. Cross-sectional study. Level 3: Other evidence. Not applicable.

  4. Cadmium, an Environmental Pollutant: A Review | Adedapo | West ...

    African Journals Online (AJOL)

    Cadmium (Cd) is a toxic heavy metal and is considered to be an environmental pollutant. Cadmium levels in the environment vary widely. Several sources of human exposure to Cd, including employment in primary metal industries, production of certain batteries, foods, soil and cigarette smoke, are known. Its inhalation has ...

  5. Comparative Hepatotoxicity Test of Cadmium and Lead in Rats ...

    African Journals Online (AJOL)

    Conclusion: Studies indicate that liver function is impeded particularly with respect to protein synthesis, detoxification processes and the cellular integrity of the organ is damaged in the group that cadmium and lead were added (p<0.05). But the water sample from the mining pond, though containing higher cadmium and ...

  6. Effect of cadmium stress on antioxidative enzymes during the ...

    African Journals Online (AJOL)

    In this work, the influence of high cadmium concentrations on percentage germination, specific activities and isoenzyme patterns of catalase (CAT), superoxide dismutase (SOD), and peroxidase (POD) during the germination of Serbian spruce [Picea omorika (Pan..) Purkynĕ] was studied. Cadmium chloride concentrations ...

  7. Levels of Cadmium and Lead in Water, Sediments and Selected ...

    African Journals Online (AJOL)

    Keywords: heavy metals, cadmium, lead, water, sediment, fish, Kenya coast. Flame absorption spectrophotometry was used to investigate the concentration and distribution of cadmium and lead in water, sediments and selected fish species in Makupa and Tudor creeks in Mombasa, Kenya between May 1997 and March ...

  8. Determination and estimation of Cadmium intake from Tarom rice 1 ...

    African Journals Online (AJOL)

    DR. MIKE HORSFALL

    Malaysia. 27.74. Spain. 0.85. Philippines. 20.14. USA. 7.43. Dietary intake of Cadmium: The intake of Cd was estimated by multiplication of daily consumption ... cereals such as rice. JECFA has set PTWI for the. Cadmium at 7 µg/kg of body weight (WHO., 2004). According to the published papers, daily consumption of rice ...

  9. nitrosoguanidine-induced cadmium resistant mutants of Aspergillus ...

    Indian Academy of Sciences (India)

    Unknown

    of S. cerevisiae (Inouhe et al 1989) were used for under- standing the molecular genetics of cadmium toxicity and ... The pH of the medium was adjusted to 6⋅4 before autoclaving. Cadmium-resistant mutants after isolation ..... Saccharomyces cerevisiae; Biochem. Biophys. Acta 993 51–55. Kimura M, Otaki N and Imano M ...

  10. induced by cadmium using random amplified polymorphic DNA

    African Journals Online (AJOL)

    darya

    2013-04-17

    Apr 17, 2013 ... Jin YH, Clark AB, Slebos, RJC, Al-Refai H, Taylor JA, Kunkel TA,. Resnick MA, Gordenin DA (2003). Cadmium is a mutagen that acts by inhibiting mismatch repair. Nat. Genet. 34(3):326-329. Joseph P (2009). Mechanisms of cadmium carcinogenesis. Toxicol. Appl. Pharmacol. 238:272-279. Azimi et al.

  11. Effects of Cadmium Exposure on Bone and Kidney Alkaline ...

    African Journals Online (AJOL)

    This paper examines the effects of varying doses of cadmium on bone and kidney alkaline phosphatase and on testis and prostate acid phosphatase after 4 weeks of administration to separate groups of rats. Relative to the cadmium-free control rats femur bone alkaline phosphatase activity was significantly (P<0.05) ...

  12. Cadmium Removal from Aqueous Solutions by Ground Pine Cone

    Directory of Open Access Journals (Sweden)

    H Izanloo, S Nasseri

    2005-01-01

    Full Text Available A study on the removal of cadmium ions from aqueous solutions by pine cone was conducted in batch conditions. Kinetic data and equilibrium removal isotherms were obtained. The influence of different experimental parameters such as contact time, initial concentration of cadmium, pine cone mass and particle size, and temperature on the kinetics of cadmium removal was studied. Results showed that the main parameters that played an important role in removal phenomenon were initial cadmium concentration, particle size and pine cone mass. The necessary time to reach equilibrium was between 4 and 7 hours based on the initial concentration of cadmium. The capacity of cadmium adsorption at equilibrium increased with the decrease of pine cone particle size. The capacity of cadmium adsorption at equilibrium by pine cone increased with the quantity of pine cone introduced (1–4 g/L. Temperature in the range of 20-30°C showed a restricted effect on the removal kinetics (13.56 mg/g at 20°C and a low capacity of adsorption about 11.48 mg/g at 30°C. The process followed pseudo second-order kinetics. The cadmium uptake of pine cone was quantitatively evaluated using adsorption isotherms. Results indicated that the Langmuir model gave a better fit to the experimental data in comparison with the Freundlich equation.

  13. Cadmium chronic administration to lactating ewes. Reproductive performance, cadmium tissue accumulation and placental transfer

    Energy Technology Data Exchange (ETDEWEB)

    Floris, B.; Bomboi, G.; Sechi, P.; Marongiu, M. L. [Sassari Univ., Sassari (Italy). Dipt. di Biologia Animale; Pirino, S. [Sassari Univ., Sassari (Italy). Ist. di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-chirurgica Veterinaria

    2000-12-01

    20 lactating ewes were allotted to two groups: 10 subjects received orally 100 mg/day of CdCl{sub 2} for 108 consecutive days, and the remaining 10 acted as control. Reproductive performance in ewes and cadmium tissue accumulation, both in ewes and their lambs, were investigated. The results showed that in ewes: 1) the regular cadmium intestinal intake negatively influences all reproductive parameters; 2) cadmium is particularly accumulated in kidney and liver, bur also in mammary gland, although at distinctly lower level; 3) chronic administration does not increase cadmium placental transfer in lactating pregnant subjects. [Italian] 20 pecore in lattazione sono state suddivise in 2 gruppi: 10 soggetti ricevettero per os 100 mg/giorno di CdCl{sub 2} per 108 giorni consecutivi, e i restanti 10 funsero da controllo. Sono stati studiati i parametri riproduttivi delle pecore e l'accumulo di cadmio nei tessuti, sia delle pecore che dei loro agnelli. I risultati hanno mostrato che negli ovini: 1) il regolare assorbimento intestinale di cadmio influenza negativamente tutti i parametri riproduttivi; 2) il cadmio viene accumulato principalmente nei reni e nel fegato, ma anche dalla ghiandola mammaria, sebbene in misura nettamente inferiore; 3) la somministrazione cronica di cadmio nei soggetti gravidi non incrementa il suo passaggio transplacentare.

  14. The effect of phosphate fertilizer cadmium on cadmium in soils and crops

    NARCIS (Netherlands)

    Smilde, K.W.; Luit, van B.

    1983-01-01

    Een van de oorzaken, waardoor bodemvervuiling met cadmium optreedt en dus een bevordering van cadmiumopname door het gewas, is toepassing van fosfaatkunstmest, waarin zich verschillende gehaltes van dit zware metaal bevinden. Dit rapport behandelt het onderzoek naar de stijging van het

  15. Cadmium content in soil at Heirisson Island, Western Australia

    Energy Technology Data Exchange (ETDEWEB)

    Hosie, D.J.; Bogoiais, A.; De Laeter, J.R.; Rosman, K.J.R.

    1978-01-01

    A study was initiated to determine the cadmium level of soil samples from Heirisson Island, western Australia. Cadmium is a particularly toxic element considered harmful to humans and vegetation. Experimental methods and materials are described. Results indicate that cadmium concentrations decrease markedly with distance from road edges, where the cadmium is thought to originate from automobile tires. Other results are detailed. Despite the fact that the amount of cadmium fallout from vehicular traffic is considerably smaller in Australia than was expected on the basis of overseas studies, it is still apparent that the accession rate in soil adjoining busy highways is sufficiently large to demand that care is taken to avoid growing vegetation for human consumption too close to such roadside locations. (3 graphs, 8 references)

  16. Effect of cadmium chloride on hepatic lipid peroxidation in mice

    DEFF Research Database (Denmark)

    Andersen, H R; Andersen, O

    1988-01-01

    Intraperitoneal administration of cadmium chloride to 8-12 weeks old CBA-mice enhanced hepatic lipid peroxidation. A positive correlation between cadmium chloride dose and level of peroxidation was observed in both male and female mice. A sex-related difference in mortality was not observed...... but at a dose of 25 mumol CdCl2/kg the level of hepatic lipid peroxidation was higher in male mice than in female mice. The hepatic lipid peroxidation was not increased above the control level in 3 weeks old mice, while 6 weeks old mice responded with increased peroxidation as did 8-12 weeks old mice....... The mortality after an acute toxic dose of cadmium chloride was the same in the three age groups. Pretreatment of mice with several low intraperitoneal doses of cadmium chloride alleviated cadmium induced mortality and lipid peroxidation. The results demonstrate both age dependency and a protective effect...

  17. Synthesis of cadmium chalcogenide nanotubes at room temperature

    KAUST Repository

    Pan, Jun

    2012-10-01

    Cadmium chalcogenide (CdE, E=S, Se, Te) polycrystalline nanotubes have been synthesized from precursor of CdS/cadmium thiolate complex at room temperature. The precursor was hydrothermally synthesized at 180 °C using thioglycolic acid (TGA) and cadmium acetate as starting materials. The transformation from the rod-like precursor of CdS/cadmium thiolate complex to CdS, CdSe and CdTe nanotubes were performed under constant stirring at room temperature in aqueous solution containing S 2-, Se 2- and Te 2-, respectively. The nanotube diameter can be controlled from 150 to 400 nm related to the dimension of templates. The XRD patterns show the cadmium chalcogenide nanotubes all corresponding to face-centered cubic structure. © 2012 Elsevier B.V. All rights reserved.

  18. Adsorption of cadmium from aqueous solutions by perlite.

    Science.gov (United States)

    Mathialagan, T; Viraraghavan, T

    2002-10-14

    The present study examined the use of perlite for the removal of cadmium from aqueous solutions. The effects of pH and contact time on the adsorption process were examined. The optimum pH for adsorption was found to be 6.0. Residual cadmium concentration reached equilibrium in 6h and the rate of cadmium adsorption by perlite was rapid in the first hour of the reaction time. Ho's pseudo-second-order model best described the kinetics of the reaction. Batch adsorption experiments conducted at room temperature (22+/-1 degrees C) showed that the adsorption pattern followed the Freundlich isotherm model. The maximum removal of cadmium obtained from batch studies was 55%. Thomas model was used to describe the adsorption data from column studies. The results generally showed that perlite could be considered as a potential adsorbent for cadmium removal from aqueous solutions.

  19. Effect of pregnancy on cadmium-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Takizama, Y. (Akita Univ. School of Medicine, Japan); Nakamura, I.; Kurayama, R.; Hirasawa, F.; Kawai, K.

    1982-01-01

    It is well known that itai-itai disease with the osteopathy is broken out among multiparas, 40 years of age and up Japanese residents. In this paper we described an experimental study of effect of pregnancy on cadmium treated rats. Female mature rats were administered drinking water containing 50 and 200 ppm cadmium as CdCl/sub 2/. During 180 days of the experiment, three times of pregnancy were succesful, though slight depression of body weight gain was noticed in the 200 ppm group. The cadmium was accumulated in the kidneys, liver and bone proportionally to the amount of cadmium administered. No significant change was recognized in serum calcium, phosphorus and alkaline phosphatase levels after 180 days. Though cadmium 200 ppm treated rats showed slight histological lesions in the proximal convoluted tubules of the kidney, there appeared to be no osteomalacia including excess formation of osteoid tissue.

  20. Biochemical responses and accumulation of cadmium in Spirodela polyrhiza.

    Science.gov (United States)

    Rolli, N M; Suvarnakhandi, S S; Mulgund, G S; Ratageri, R H; Taranath, T C

    2010-07-01

    The present study focused on biochemical responses of Spirodela polyrhiza to cadmium stresses and its accumulation. The laboratory experiments were conducted for the assessment of biochemical responses and accumulation of cadmium in plants at its various concentrations (0.1, 0.5, 1.5 and 2.0 ppm) at the regular interval for twelve days exposure. Spirodela showed visible symptoms like withering of roots and chlorosis at higher concentration (2.0 ppm), however the plant showed normal growth at lower concentration (0.1 ppm). The estimation of biochemical parameters (total chlorophyll, protein and carbohydrate) of test plants showed a significant increase at lower concentration (0.1 ppm) of cadmium. The biochemical changes decrease with increase in exposure concentration and duration. The toxic effect of cadmium is directly proportional to its concentration and duration. The accumulation of cadmium by Spirodela polyrhiza was maximum at four days exposure duration and gradually decreases.

  1. Possible mechanism for cadmium-induced hypertension in rats

    Energy Technology Data Exchange (ETDEWEB)

    Revis, N.

    1978-01-01

    The mechanism of cadmium-induced hypertension was explored by measuring noradrenaline metabolism. Cadmium in vitro was shown to inhibit both monoamine oxidase and catechol-O-methyltransferase, the two enzymes which inactivate the neurotransmitters noradrenaline and adrenaline. However, rats which were injected or fed (via the drinking water) with cadmium showed that, among the tissues surveyed, these two enzymes were inhibited significantly only in the aorta. In vitro, cadmium was found to inhibit noradrenaline binding to membranes from the heart, lung, and kidney, while stimulating binding to aortic membranes, which suggests that the effects may be specific. These results suggest that, in the aorta, cadmium may inhibit the two catabolic enzymes of noradrenaline, while at the same time stimulating noradrenaline-binding. Thus the effects of noradrenaline on vascular smooth muscle would be increased as well as prolonged.

  2. Possible mechanism for cadmium-induced hypertension in rats

    Energy Technology Data Exchange (ETDEWEB)

    Revis, N.

    1978-02-13

    The mechanism of cadmium-induced hypertension was explored by measuring noradrenaline metabolism. Cadmium in vitro was shown to inhibit both monoamine oxidase and catechol-O-methyltransferase, the two enzymes which inactivate the neurotransmitters noradrenaline and adrenaline. However, rats which were injected or fed (via the drinking water) with cadmium showed that, among the tissues surveyed, these two enzymes were inhibited significantly only in the aorta. In vitro, cadmium was found to inhibit noradrenaline binding to membranes from the heart, lung, and kidney, while stimulating binding to aortic membranes, which suggests that the effects may be specific. These results suggest that, in the aorta, cadmium may inhibit the two catabolic enzymes of noradrenaline, while at the same time stimulating noradrenaline-binding. Thus the effects of noradrenaline on vascular smooth muscle would be increased as well as prolonged.

  3. Toxicity of upfront {sup 131}I-metaiodobenzylguanidine ({sup 131}I-MIBG) therapy in newly diagnosed neuroblastoma patients: a retrospective analysis

    Energy Technology Data Exchange (ETDEWEB)

    Bleeker, Gitta; Schoot, Reineke A.; Caron, Huib N.; Kraker, Jan de; Tytgat, Godelieve A. [Emma Children' s Hospital, Academic Medical Centre (AMC), Department of Paediatric Oncology, PO Box 22700, Amsterdam (Netherlands); Hoefnagel, Cees A. [National Cancer Institute (NKI-AvL), Department of Nuclear Medicine, Amsterdam (Netherlands); Eck, Berthe L. van [Academic Medical Centre (AMC), Department of Nuclear Medicine, Amsterdam (Netherlands)

    2013-10-15

    In the treatment of patients with high-risk neuroblastoma, different doses of {sup 131}I-metaiodobenzylguanidine ({sup 131}I-MIBG) are administered at different time points during treatment. Toxicity, mainly haematological (thrombocytopenia), from {sup 131}I-MIBG therapy is known to occur in extensively chemotherapy pretreated neuroblastoma patients. Up to now, acute toxicity from {sup 131}I-MIBG as initial treatment has never been studied in a large cohort. The aim of this retrospective study was to document acute toxicity related to upfront {sup 131}I-MIBG. All neuroblastoma patients (stages 1-4 and 4S) treated upfront with {sup 131}I-MIBG at the Emma Children's Hospital, Academic Medical Centre (1992 - 2008) were included in this retrospective analysis. The acute toxicity (during therapy) and short-term toxicity (1st month following therapy) of the first two {sup 131}I-MIBG therapies were studied. Of 66 patients (34 boys, 32 girls; median age 2.2 years, range 0.1 - 9.4 years), 49 had stage 4 disease, 5 stage 4S, 6 stage 3, 1 stage 2 and 5 stage 1. The median first dose was 441 MBq/kg (range 157 - 804 MBq/kg). The median second dose was 328 MBq/kg (range 113 - 727 MBq/kg). The most frequently observed symptoms were nausea and vomiting (21 %, maximum grade II). The main toxicity was grade IV haematological, occurring only in stage 4 patients, after the first and second {sup 131}I-MIBG therapies: anaemia (5 % and 4 %, respectively), leucocytopenia (3 % and 4 %) and thrombocytopenia (2 % and 4 %). No stem cell rescue was needed. The main acute toxicity observed was haematological followed by nausea and vomiting. One patient developed posterior reversible encephalopathy syndrome during {sup 131}I-MIBG therapy, possibly related to {sup 131}I-MIBG. We consider {sup 131}I-MIBG therapy to be a safe treatment modality. (orig.)

  4. Dislocation Etching Solutions for Mercury Cadmium Selenide

    Science.gov (United States)

    2014-09-01

    mercury cadmium telluride (Hg1–xCdxTe) for infrared (IR) sensor applications, but etch pit density ( EPD ) measurements are required to measure...dislocations that affect device performance. No EPD solutions have been reported for Hg1–xCdxSe, and standard EPD solutions for Hg1–xCdxTe have proved...ineffective. Thus, a new etching solution is required for EPD measurements of Hg1–xCdxSe. Samples were etched in various solutions and the resulting pits

  5. The Effect of Selenium and +(-)Catechin on Lipid Peroxidation and Glutathione in Cadmium Fed Rats

    Science.gov (United States)

    Özdemir, Semra; Dursun, Şefik

    2007-04-01

    Cadmium performs its effect on living organisms by accumulating in various tissues and effects tissue antioxidant enzyme systems. The testes are critical target organ following cadmium exposure. The present study was planned to determine the possible protective roles of selenium and +(-) catechin against the toxic effects of cadmium. The study has been performed in Wistar Albino rats which divided into four groups as control, cadmium, cadmium+selenium and cadmium+ catechin received groups. Each experimental group consisted of ten rats. The experimental group rats have received cadmium sulphate, sodium selenite and +(-) catechin via there drinking water for thirty days. Cadmium concentration, lipid peroxidation and glutathione were measured in the homogenate of testes and blood. As a result of the study it may be said that: The cadmium accumulates in testes and its concentration increases in blood and possibly selenium administration is helpful against cadmium but not +(-)catechin.

  6. Risk Factors of 131I-Induced Salivary Gland Damage in Thyroid Cancer Patients.

    Science.gov (United States)

    Hollingsworth, Brynn; Senter, Leigha; Zhang, Xiaoli; Brock, Guy N; Jarjour, Wael; Nagy, Rebecca; Brock, Pamela; Coombes, Kevin R; Kloos, Richard T; Ringel, Matthew D; Sipos, Jennifer; Lattimer, Ilene; Carrau, Ricardo; Jhiang, Sissy M

    2016-11-01

    Sialadenitis and xerostomia are major adverse effects of 131I therapy in thyroid cancer patients. The risk factors for these adverse effects, other than administered activity of 131I, have not been investigated. The aim of this study is to identify risk factors for 131I-induced salivary gland damage among follicular cell-derived thyroid cancer patients. We enrolled 216 thyroid cancer patients who visited The Ohio State University Wexner Medical Center between April 2013 and April 2014. Symptoms of xerostomia and sialadenitis were identified via questionnaire and medical record search. To validate the findings in a large cohort, we retrospectively searched for ICD-9/10 codes for sialadenitis, xerostomia, and autoimmune disease associated with Sjögren's syndrome (AID-SS) in our existing database (n = 1507). Demographic and clinical information was extracted from medical records. Multivariate analyses were performed to identify independent predictors for salivary gland damage. 131I treatment associated with higher incidence of xerostomia and sialadenitis. Patients with xerostomia had 46 mCi higher mean cumulative 131I activity and 21 mCi higher mean first-administered 131I activity than patients without xerostomia. Increased age associated with higher incidence of xerostomia, and females had a higher incidence of sialadenitis. Patients who experienced sialadenitis before 131I therapy had higher sialadenitis incidence after 131I therapy. 131I-treated patients diagnosed with AID-SS, whether before or after 131I treatment, had a higher incidence of xerostomia and sialadenitis among 131I-treated patients. Risk factors for 131I-induced salivary gland damage include administered 131I activity, age, gender, history of sialadenitis before 131I treatment, and AID-SS diagnosis.

  7. Sources of cadmium exposure among healthy premenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Scott V., E-mail: sadams@fhcrc.org [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Newcomb, Polly A. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Shafer, Martin M. [Environmental Chemistry and Technology Program, University of Wisconsin and Wisconsin State Laboratory of Hygiene, Madison, WI (United States); Atkinson, Charlotte [Department of Oral and Dental Science, Bristol Dental School, Bristol (United Kingdom); Bowles, Erin J. Aiello [Group Health Research Institute, Seattle, WA (United States); Newton, Katherine M. [Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Group Health Research Institute, Seattle, WA (United States); Lampe, Johanna W. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States)

    2011-04-01

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 {mu}g/g (95% confidence interval (CI): 0.38-0.48 {mu}g/g) and 0.30 {mu}g/g (0.27-0.33 {mu}g/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 {mu}g/g (95% CI: 0.06-0.15 {mu}g/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: {yields

  8. Iodine 131 ablation of an obstructive lingual thyroid

    Directory of Open Access Journals (Sweden)

    Lester Johnson

    2009-01-01

    Full Text Available A 48-year-old woman undergoing surgery could not be intubated because of an oropharyngeal mass. CT and MRI revealed a 3 cm possible lingual thyroid mass, confirmed by Iodine-123 SPECT/CT. The patient underwent successful Iodine-131 ablation and has done well on thyroid hormone-replacement therapy. This case also demonstrates how modern cross-sectional imaging like SPECT/CT can appropriately be used in the patient diagnosis and management, and is of additional interest for including pre- and post-therapy MRI documenting efficacy morphologically.

  9. How Does Oyster Shell Immobilize Cadmium?

    Science.gov (United States)

    Lee, Hyun Ho; Kim, Sang Yoon; Owens, Vance N; Park, Sungkyun; Kim, Jiwoong; Hong, Chang Oh

    2018-01-01

    The exact mechanism of cadmium (Cd) immobilization by oyster shell (OS) has not been reported. The effect of OS on Cd immobilization and the exact mechanism should be known before applying remediation technology using OS to Cd contaminated soils. Therefore, the objective of this study was to elucidate the mechanism of Cd immobilization by OS. Three grams of OS (< 0.84 mm) was reacted with 30 mL of 0-3.56 mg Cd L-1 solution at 25 °C for 48 h. Cadmium adsorption increased with increasing initial concentration of Cd in solution. The X-ray diffraction patterns clearly demonstrated that precipitation of CdCO3 did not take place in suspensions of OS after reacting with up to 3.56 mol Cd L-1. Interestingly, we found formation of Ca0.67Cd0.33CO3 crystalline in suspension of OS after reacting with maximum initial Cd concentrations. Precipitation and chemisorption might contribute to Cd immobilization together. However, we feel confident that chemisorption is the major mechanism by which Cd immobilization occurs with OS. In conclusion, OS could be an effective bioadsorbent to immobilize Cd through formation of geochemically stable Cd mineral.

  10. Cadmium hampers salt tolerance of Sesuvium portulacastrum.

    Science.gov (United States)

    Wali, Mariem; Martos, Soledad; Pérez-Martín, Laura; Abdelly, Chedly; Ghnaya, Tahar; Poschenrieder, Charlotte; Gunsé, Benet

    2017-06-01

    It is well known that salinity reduces cadmium toxicity in halophytes. However, the possible interference of Cd with the mechanisms of salt tolerance is poorly explored. The aim of this study was to see whether Cd affects salt tolerance mechanisms in the halophyte Sesuvium portulacastrum. S. portulacastrum plants obtained from cuttings were grown in hydroponics for 3 weeks and then exposed to low (0.09 mM) or moderate (200 mM) NaCl concentrations, alone or in combination with 25 μM CdCl 2 . Microscopy observation revealed two strategies of salt tolerance: euhalophytism and secretion of salt by bladder cells. Cadmium exposure hardly influenced the total leaf Na + concentrations. However, Cd supply delayed the salt-induced upregulation of AHA1 (plasma membrane H + -ATPase 1) and SOS1 (plasma membrane Na + transporter "Salt Overly Sensitive 1"), genes that are essential for salt tolerance. Moreover, Cd induced the activation of BADH, coding for betaine aldehyde dehydrogenase, indicating enhanced osmotic stress due to Cd. Sodium-green fluorescence in protoplasts from plants grown with low or high NaCl, alone or in combination with Cd, revealed higher Na + concentrations in the cytoplasm of Cd-exposed plants. Taken together the results indicate interference of Cd with salt tolerance mechanisms in S. portulacastrum. This may have consequences for the efficient use of halophytes in phytoremediation of Cd-contaminated saline soils. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. Cadmium-Sensitive Mutants of Arabidopsis thaliana.

    Science.gov (United States)

    Howden, R; Cobbett, C S

    1992-09-01

    A screening procedure for identifying Cd-sensitive mutants of Arabidopsis thaliana is described. With this procedure, two Cd-sensitive mutants were isolated. These represent independent mutations in the same locus, referred to as CAD1. Genetic analysis has shown that the sensitive phenotype is recessive to the wild type and segregates as a single Mendelian locus. Crosses of the mutant to marker strains showed that the mutation is closely linked to the tt3 locus on chromosome 5. In addition to Cd, the mutants are also significantly more sensitive to mercuric ions and only slightly more sensitive to Cu and Zn, while being no more sensitive than the wild type to Mn, thus indicating a degree of specificity in the mechanism affected by the mutation. Undifferentiated callus tissue is also Cd sensitive, suggesting that the mutant phenotype is expressed at the cellular level. Both wild-type and mutant plants showed increased sensitivity to Cd in the presence of buthionine sulfoximine, an inhibitor of the biosynthesis of the cadmium-binding (gamma-glutamylcysteine)(n)-glycine peptides, suggesting that the mutant is still able to synthesize these peptides. However, the effects of a cad1 mutation and buthionine sulfoximine together on cadmium sensitivity are essentially nonadditive, indicating that they may affect different aspects of the same detoxification mechanism. Assays of Cd uptake by intact plants indicate that the mutant is deficient in its ability to sequester Cd.

  12. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  14. Protective effect of cannabidiol against cadmium hepatotoxicity in rats.

    Science.gov (United States)

    Fouad, Amr A; Al-Mulhim, Abdulruhman S; Gomaa, Wafaey

    2013-10-01

    The protective effect of cannabidiol, the non-psychoactive component of Cannabis sativa, against liver toxicity induced by a single dose of cadmium chloride (6.5 mgkg(-1) i.p.) was investigated in rats. Cannabidiol treatment (5 mgkg(-1)/day, i.p.) was applied for five days starting three days before cadmium administration. Cannabidiol significantly reduced serum alanine aminotransferase, and suppressed hepatic lipid peroxidation, prevented the depletion of reduced glutathione and nitric oxide, and catalase activity, and attenuated the elevation of cadmium level in the liver tissue resulted from cadmium administration. Histopathological examination showed that cadmium-induced liver tissue injury was ameliorated by cannabidiol treatment. Immunohistochemical analysis revealed that cannabidiol significantly decreased the cadmium-induced expression of tumor necrosis factor-α, cyclooxygenase-2, nuclear factor-κB, caspase-3, and caspase-9, and increased the expression of endothelial nitric oxide synthase in liver tissue. It was concluded that cannabidiol may represent a potential option to protect the liver tissue from the detrimental effects of cadmium toxicity. Copyright © 2013 Elsevier GmbH. All rights reserved.

  15. Blood cadmium concentration and lipid profile in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kisok, E-mail: kimkisok@kmu.ac.kr [Department of Public Health, Keimyung University, 1000 Shindang-dong, Daegu 704-701 (Korea, Republic of)

    2012-01-15

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03-1.79 for fourth quintile and OR=1.41; 95% CI, 1.07-1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  16. Accumulation and distribution of arsenic and cadmium by tea plants*

    Science.gov (United States)

    Shi, Yuan-zhi; Ruan, Jian-yun; Ma, Li-feng; Han, Wen-yan; Wang, Fang

    2008-01-01

    It is important to research the rules about accumulation and distribution of arsenic and cadmium by tea plants, which will give us some scientific ideas about how to control the contents of arsenic and cadmium in tea. In this study, by field investigation and pot trial, we found that mobility of arsenic and cadmium in tea plants was low. Most arsenic and cadmium absorbed were fixed in feeding roots and only small amount was transported to the above-ground parts. Distribution of arsenic and cadmium, based on their concentrations of unit dry matter, in tea plants grown on un-contaminated soil was in the order: feeding roots>stems≈main roots>old leaves>young leaves. When tea plants were grown on polluted soils simulated by adding salts of these two metals, feeding roots possibly acted as a buffer and defense, and arsenic and cadmium were transported less to the above-ground parts. The concentration of cadmium in soil significantly and negatively correlated with chlorophyll content, photosynthetic rate, transpiration rate and biomass production of tea plants. PMID:18357630

  17. Absorption of cadmium in bean cultivars variety black Jamapa

    Science.gov (United States)

    Ibarra, M. C. V.; Gomez, R.; Arriaga, R. M.

    2003-05-01

    (4) The cadmium is highly toxic and for all biota in very small concentrations, these study was to know the limit of phitotoxicity and nutrition of cadmium in bean cultivars variety black Jamapa, and to measure absorption of cadmium in roots, stem, leaves and grain. The experiment was carried out in plots with bean of the black variety Jamapa, in greenhouse, 6 treatments in the water of irrigation with 0, 25, 50, 100 y 200 micromoles of cadmium, to quantification of cadmium in plant, is carried out with ICP previous acid digest(I) method D4638-86 of ASTM 1990. Was carried out analysis of variation and results indicate that, there were been significant for the variables : number of leaves, foliate area, dry weight from root, height of plant; the threshold of toxicity for the plant in the condition that it was carried out the experiment were 100 200micromoles of cadmium applied in water of irrigation weekly, the visual symptom were: yellow of leaves, morphologic changes in leaves showed leaves bi-foliate and tetra-foliate in treatments upper of 100micromoles of cadmium.

  18. Association of environmental cadmium exposure with pediatric dental caries.

    Science.gov (United States)

    Arora, Manish; Weuve, Jennifer; Schwartz, Joel; Wright, Robert O

    2008-06-01

    Although animal experiments have shown that cadmium exposure results in severe dental caries, limited epidemiologic data are available on this issue. We aimed to examine the relationship between environmental cadmium exposure and dental caries in children 6-12 years of age. We analyzed cross-sectional data, including urine cadmium concentrations and counts of decayed or filled tooth surfaces, from the Third National Health and Nutrition Examination Survey. We used logistic and zero-inflated negative binomial (ZINB) regression to estimate the association between urine cadmium concentrations and caries experience, adjusting these analyses for potential confounders including environmental tobacco smoke (ETS). Urine cadmium concentrations ranged from 0.01 to 3.38 ng/mL. Approximately 56% of children had experienced caries in their deciduous teeth, and almost 30% had been affected by caries in their permanent dentition. An interquartile range (IQR) increase in creatinine-corrected cadmium concentrations (0.21 microg/g creatinine) corresponded to a 16% increase in the odds of having experienced caries in deciduous teeth [prevalence odds ratio (OR)=1.16; 95% confidence interval (CI), 0.96-1.40]. This association was statistically significant in children with low ETS exposure (prevalence OR=1.30; 95% CI, 1.01-1.67). The results from the ZINB regression indicated that, among children with any caries history in their deciduous teeth, an IQR increase in cadmium was associated with 17% increase in the number of decayed or filled surfaces. We observed no association between cadmium and caries experience in permanent teeth. Environmental cadmium exposure may be associated with increased risk of dental caries in deciduous teeth of children.

  19. Removal of cadmium and cyanide from aqueous solutions through electrodialysis

    Directory of Open Access Journals (Sweden)

    Marder Luciano

    2003-01-01

    Full Text Available The discharge of galvanic industry wastewaters containing heavy metals and cyanide is one of the largest sources of water pollution. The use of the electrodialysis technique for the treatment of a synthetic wastewater containing approximately 0.0089 mol L-1 cadmium and 0.081 mol L-1 cyanide was studied using a five-compartment electrodialysis cell. The results demonstrate that the removal of cadmium and cyanide depends on the applied current density and it is limited by the precipitation of cadmium on the cation-exchange membrane in the diluate central cell compartment.

  20. Cadmium free lead alloy for reusable radiotherapy shielding.

    Science.gov (United States)

    Blackwell, C R; Amundson, K D

    1990-01-01

    A low melting point cadmium free fusible lead alloy suitable for custom radiotherapy shielding blocks is described. The alloy, referred to here as Alloy-203, differs in composition from the more common Lipowitz's metal (Cerrobend) by being cadmium free, having a slightly higher lead content and a 203 degrees F melting temperature. Attenuation properties have been studied for 4-18 MV X-rays. Alloy-203 has lower transmission than Lipowitz's metal, primarily due to the higher content of lead and bismuth. Daily use for the past 2 years at Mayo Clinic has not indicated any major problems associated with the use of this cadmium free alloy for custom shield fabrication.

  1. Effect of Chlorella intake on Cadmium metabolism in rats

    OpenAIRE

    Shim, Jee Ae; Son, Young Ae; Park, Ji Min; Kim, Mi Kyung

    2009-01-01

    This study was performed to investigate the effect of chlorella on cadmium (Cd) toxicity in Cd- administered rats. Sixty male Sprague-Dawley rats (14 week-old) were blocked into 6 groups. Cadmium chloride was given at levels of 0 or 325 mg (Cd: 0, 160 ppm), and chlorella powder at levels of 0, 3 and 5%. Cadmium was accumulated in blood and tissues (liver, kidney and small intestine) in the Cd-exposed groups, while the accumulation of Cd was decreased in the Cd-exposed chlorella groups. Fecal ...

  2. Exposure dose response relationships of the freshwater bivalve Hyridella australis to cadmium spiked sediments

    Energy Technology Data Exchange (ETDEWEB)

    Marasinghe Wadige, Chamani P.M., E-mail: chamani.marasinghe.wadige@canberra.edu.au; Maher, William A.; Taylor, Anne M.; Krikowa, Frank

    2014-07-01

    Highlights: • The exposure–dose–response approach was used to assess cadmium exposure and toxicity. • Accumulated cadmium in H. australis reflected the sediment cadmium exposure. • Spill over of cadmium into the biologically active pool was observed. • Increased cadmium resulted in measurable biological effects. • H. australis has the potential to be a cadmium biomonitor in freshwater environments. - Abstract: To understand how benthic biota may respond to the additive or antagonistic effects of metal mixtures in the environment it is first necessary to examine their responses to the individual metals. In this context, laboratory controlled single metal-spiked sediment toxicity tests are useful to assess this. The exposure–dose–response relationships of Hyridella australis to cadmium-spiked sediments were, therefore, investigated in laboratory microcosms. H. australis was exposed to individual cadmium spiked sediments (<0.05 (control), 4 ± 0.3 (low) and 15 ± 1 (high) μg/g dry mass) for 28 days. Dose was measured as cadmium accumulation in whole soft body and individual tissues at weekly intervals over the exposure period. Dose was further examined as sub-cellular localisation of cadmium in hepatopancreas tissues. The biological responses in terms of enzymatic and cellular biomarkers were measured in hepatopancreas tissues at day 28. H. australis accumulated cadmium from spiked sediments with an 8-fold (low exposure organisms) and 16-fold (high exposure organisms) increase at day 28 compared to control organisms. The accumulated tissue cadmium concentrations reflected the sediment cadmium exposure at day 28. Cadmium accumulation in high exposure organisms was inversely related to the tissue calcium concentrations. Gills of H. australis showed significantly higher cadmium accumulation than the other tissues. Accumulated cadmium in biologically active and biologically detoxified metal pools was not significantly different in cadmium exposed

  3. Inclusion free cadmium zinc tellurium and cadmium tellurium crystals and associated growth method

    Science.gov (United States)

    Bolotnikov, Aleskey E [South Setauket, NY; James, Ralph B [Ridge, NY

    2010-07-20

    The present disclosure provides systems and methods for crystal growth of cadmium zinc tellurium (CZT) and cadmium tellurium (CdTe) crystals with an inverted growth reactor chamber. The inverted growth reactor chamber enables growth of single, large, high purity CZT and CdTe crystals that can be used, for example, in X-ray and gamma detection, substrates for infrared detectors, or the like. The inverted growth reactor chamber enables reductions in the presence of Te inclusions, which are recognized as an important limiting factor in using CZT or CdTe as radiation detectors. The inverted growth reactor chamber can be utilized with existing crystal growth techniques such as the Bridgman crystal growth mechanism and the like. In an exemplary embodiment, the inverted growth reactor chamber is a U-shaped ampoule.

  4. Studies on growth and nucleation kinetics of cadmium thiourea sulphate and magnesium cadmium thiourea sulphate

    Energy Technology Data Exchange (ETDEWEB)

    Daniel, Mekala [Quaid-e-Milleth College, Chennai 600002 (India)], E-mail: mekaladaniel@rediffmail.com; Malliga, M. Jeyarani [Bharathi Women College, Chennai 600108 (India); Sankar, R. [Kings Engineering College, Irungatukottai, Sriperumbudhur, Chennai 602105 (India); Jayaraman, D. [Presidency College, Chennai 600 004 (India)

    2009-03-15

    Semiorganic materials, in general possess high non-linear coefficient and mechanical strength which will be more applicable for device fabrication. Cadmium thiourea sulphate (CTS) and magnesium cadmium thiourea sulphate (MCTS) are better semiorganic materials which find applications in the field of optoelectronics. Single crystals of CTS and MCTS have been successfully grown from aqueous solution by slow evaporation technique using predetermined solubility data. The basic growth parameters of the crystal nuclei of the grown crystals of CTS and MCTS were evaluated based on the classical theory of homogeneous nucleation. The classical nucleation theory makes use of capillarity approximation which has certain limitations. A correction has to be applied for it and the classical nucleation theory has been suitably modified in order to calculate the critical nucleus parameters.

  5. Blood and urine cadmium and bioelements profile in nickel-cadmium battery workers in Serbia.

    Science.gov (United States)

    Bulat, Z Plamenac; Dukic-Cosic, D; Dokic, M; Bulat, P; Matovic, V

    2009-03-01

    Although cadmium (Cd) is extensively used for nickel-cadmium battery production, few recent reports are available on the effect of this toxic metal on the imbalance of biometals in occupational exposure. The current study was carried out to determine the Cd level and its effect on the content of bioelements: zinc, cooper, magnesium, and iron in blood and urine of workers exposed to Cd during nickel-cadmium battery production. beta(2)-microglobulins (beta(2)-MG), as indicators of kidney damage, were determined in urine.The study group comprised 32 male nickel-cadmium battery workers, and the control group had 15 male construction workers with no history of Cd exposure. Levels of Cd and bioelements were determined in blood and urine by atomic absorption spectrophotometry.Cd concentration in blood of exposed workers was around 10 microg/L and in urine ranged from 1.93 to 8.76 microg/g creatinine (cr). Urine Cd concentration was significantly higher in exposed workers than in the controls, although no statistical difference in beta(2)-MG content was observed in urine between the two groups. Blood Zn and Mg level were significantly reduced and urine Zn level was increased in Cd-exposed group when compared with controls.The mean Cd concentrations in blood and urine did not exceed the recommended reference values of 10 microg/L in blood and 10 microg/g cr in urine. Cd exposure resulted in disturbances of Zn in blood and urine and Mg in blood but had no effect on Cu and Fe content in biological fluids.

  6. Interactive effects of cadmium and Microcystis aeruginosa (cyanobacterium) on the growth, antioxidative responses and accumulation of cadmium and microcystins in rice seedlings.

    Science.gov (United States)

    Kuang, Xiaolin; Gu, Ji-Dong; Tie, BaiQing; Yao, Bangsong; Shao, Jihai

    2016-10-01

    Cadmium pollution and harmful cyanobacterial blooms are two prominent environmental problems. The interactive effects of cadmium(II) and harmful cyanobacteria on rice seedlings remain unknown. In order to elucidate this issue, the interactive effects of cadmium(II) and Microcystis aeruginosa FACHB905 on the growth and antioxidant responses of rice seedling were investigated in this study, as well as the accumulation of cadmium(II) and microcystins. The results showed that the growth of rice seedlings was inhibited by cadmium(II) stress but promoted by inoculation of M. aeruginosa FACHB905. cadmium(II) stress induced oxidative damage on rice seedlings. Inoculation of M. aeruginosa FACHB905 alleviated the toxicity of cadmium(II) on rice seedlings. The accumulation of cadmium(II) in rice seedlings was decreased by M. aeruginosa FACHB905, but the translocation of cadmium(II) from root to shoot was increased by this cyanobacterium. The accumulation of microcystins in rice seedlings was decreased by cadmium(II). Results presented in this study indicated that cadmium(II) and M. aeruginosa had antagonistic toxicity on rice seedlings. The findings of this study throw new light on evaluation of ecological- and public health-risks for the co-contamination of cadmium(II) and harmful cyanobacteria.

  7. Study on workers exposed to cadmium in alkaline storage battery manufacturing and PVC compounding

    Energy Technology Data Exchange (ETDEWEB)

    Chan, O.Y.; Tan, K.T.; Kwok, S.F.; Chio, L.F.

    1982-01-01

    The extent of cadmium exposure was studied in a cadmium-nickel battery factory and 8 PVC factories using cadmium stabilisers in the compounding of PVC. A total of 101 cadmium-exposed workers and 21 control subjects matched by sex, age, ethnic group and smoking history was investigated. Blood and urine cadmium levels were considerably elevated in the battery workers but were not raised in the PVC workers. These findings were consistent with the results of cadmium-in-air assessments. Among the female battery workers, urine cadmium excretion increased significantly with employment time. There was good correlation between blood and urine cadmium levels among the female subjects. A significant association between blood cadmium levels and prevalence of chest pain was also noted among the females. No low molecular weight proteinuria was detected, but two female battery workers had slight albuminuria and one male PVC worker had glucosuria but had abnormal GTT results.

  8. Integrated photovoltaics in nickel cadmium battery electric vehicles.

    Science.gov (United States)

    2008-12-01

    This research report presents Connecticut Department of Transportations (ConnDOTs) : evaluation of preproduction prototype nickel-cadmium (NiCd) battery-powered electric : vehicles (BEVs) as an alternative-fuel (alt-fuel) option for local trips...

  9. Low molecular weight organic acids in root exudates and cadmium ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    –234. Cieslinski G, Van Rees KCJ, Szmigielska AM, Krishnamurti GSR,. Huang PM (1998). Lowmolecular-weight organic acids in rhizosphere soils of durum wheat and their effect on cadmium bioaccumulation. Plant Soil, 203: ...

  10. Protective effect of zinc against cadmium toxicity on pregnant rats ...

    African Journals Online (AJOL)

    Protective effect of zinc against cadmium toxicity on pregnant rats and their fetuses at morphological, physiological and molecular level. Ashraf El-Sayed, Salem M Salem, Amany A El-Garhy, Zeinab A Rahman, Asmaa M Kandil ...

  11. Two new hexacoordinated coordination polymers of cadmium (II ...

    Indian Academy of Sciences (India)

    Two new hexacoordinated coordination polymers of cadmium(II) containing bridging units only: Syntheses, structures and molecular properties. DIPU SUTRADHAR HABIBAR CHOWDHURY SUSHOVAN KONER SUBHASIS ROY BARINDRA KUMAR GHOSH. Regular Article Volume 128 Issue 9 September 2016 pp 1377- ...

  12. Transfer and accumulation of lead, zinc, cadmium and copper in ...

    African Journals Online (AJOL)

    Transfer and accumulation of lead, zinc, cadmium and copper in plants growing in abandoned mining-district area. HK Chakroun, F Souissi, JL Bouchardon, R Souissi, J Moutte, O Faure, E Remon, S Abdeljaoued ...

  13. Cadmium affects the mitochondrial viability and the acid soluble ...

    African Journals Online (AJOL)

    Cadmium affects the mitochondrial viability and the acid soluble thiols concentration in liver, kidney, heart and gills of Ancistrus brevifilis (Eigenmann, 1920). P Velasquez-Vottelerd, Y Anton, R Salazar-Lugo ...

  14. Analysis and determination of mercury, cadmium and lead in ...

    African Journals Online (AJOL)

    Analysis and determination of mercury, cadmium and lead in canned tuna fish marketed in Iran. E Rahimi, M Hajisalehi, HR Kazemeini, A Chakeri, A Khodabakhsh, M Derakhshesh, M Mirdamadi, AG Ebadi, A Rezvani, FM Kashkahi ...

  15. EFFECTS OF CADMIUM ON THE REPRODUCTIVE AXIS OF JAPANESE MEDAKA

    Science.gov (United States)

    Cadmium (Cd) is a ubquitous element and a significant inorganic pollutant that has previously been found to bioaccumulate in reproductive organs of fish and disrupt important endocrine processes, especially those involved in synthesis, release and metabolism of hormones. Clearly,...

  16. Cadmium-binding in the pregnant and fetal rat

    Energy Technology Data Exchange (ETDEWEB)

    Kelman, B.J.; Ozga, J.A.; Walter, B.K.; Sasser, L.B.

    1979-01-01

    A cadmium-binding moiety with properties in common with adult cadmium-thionein was identified in the livers of fetal rats at day 18 of gestation. Pregnant rats (approx. 200 g) were subcutaneously injected with 50 ..mu..g of radiolabeled cadmium in the form of /sup 115m/CdCl/sub 2/ daily from days 11 through 15 of gestation. Maternal liver contained 14 to 18 ..mu..g Cd/g tissue; fetal liver contained 44 to 70 ng Cd/g tissue. A soluble (aqueous), heat stable, cadmium-binding molecule(s) was found which had an apparent molecular weight of approx. 10,000 in adult livers and 6000 in fetal livers by gel filtration chromatography. Both fetal and adult proteins absorbed maximally at 254 but not 280 nm.

  17. Polycrystalline Thin-Film Research: Cadmium Telluride (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2011-06-01

    Capabilities fact sheet that includes scope, core competencies and capabilities, and contact/web information for Polycrystalline Thin-Film Research: Cadmium Telluride at the National Center for Photovoltaics.

  18. Polycrystalline Thin-Film Research: Cadmium Telluride (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2013-06-01

    This National Center for Photovoltaics sheet describes the capabilities of its polycrystalline thin-film research in the area of cadmium telluride. The scope and core competencies and capabilities are discussed.

  19. Levels of Cadmium and Lead in Water, Sediments and Selected ...

    African Journals Online (AJOL)

    Daisy Ouya

    Key words: heavy metals, cadmium, lead, water, sediment, fish, Kenya coast. Abstract—Flame absorption ... known essential role in living organisms, and are toxic at even low ... Changes in. pH and electrode potential (Eh) can mobilise heavy.

  20. Electrodialytic removal of cadmium from straw combustion fly ash

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Ottosen, Lisbeth M.; Villumsen, Arne

    2004-01-01

    Fly ash from straw combustion contains valuable nutrients when returned to agricultural soils. In many instances, however, this fly ash may contain heavy metals, such as cadmium, at levels which often exceed the limits given by the Danish legislation. Thus before utilizing the nutrients, cadmium...... must be removed from these ashes. The use of an electrodialytic remediation method to remove cadmium from fly ash arising from straw combustion and containing 11.2 mg Cd kg$+-1$/ DM (dry matter) was accessed. After 36 days of remediation at a constant current density of 5.6 mA cm$+-2$/ more than 97......% of the cadmium had been removed from around 150 g ash on a dry basis. $CPY 2004 Society of Chemical Industry....

  1. Soil biogeochemistry, plant physiology and phytoremediation of cadmium contaminated soils

    Science.gov (United States)

    Cadmium (Cd) loading in soil and the environment has been accelerated worldwide due to enhanced industrialization and intensified agricultural production, particularly in the developing countries. Soil Cd pollution, resulting from both anthropogenic and geogenic sources, has posed an increasing chal...

  2. Cadmium-induced oxidative stress in potato tuber

    OpenAIRE

    Andrzej Stroiński; Monika Kozłowska

    2014-01-01

    Short-term treatment of tuber discs of potato (Solanum tuberosum L.) with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202) and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP) and catalase (CAT) was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dism...

  3. Protective effect of pre-supplementation with selenium on cadmium ...

    African Journals Online (AJOL)

    The effect of the antioxidant nutrient selenium, Se, on biologic response to cadmium-induced oxidative cytotoxicity was investigated in rats pretreated with Se prior to exposure to mild doses of Cd. Male wistar strain rats (200-250 g b.wt) were exposed to a single daily oral dose of cadmium (3 mg CdCl2/kg) in drinking water ...

  4. Diazinon and Cadmium Neurotoxicity in Rats after an Experimental Administration

    OpenAIRE

    Róbert Toman; Svätoslav Hluchý; Jozef Golian; Michal Cabaj; Mária Adamkovičová

    2012-01-01

    The aim of this study was to describe the changes in cholinesterase activity in separate doses and after coadministration of cadmium and diazinon intraperitoneally and to assess toxicity and interactions of diazinon and cadmium on the nervous system in male rats. 40 male rats were randomly divided into three experimental and one control group (10 rats in each group). Blood analyzes were performed 36 hours after an intraperitoneal administration of observed compounds. The statistical evaluatio...

  5. Cadmium, lead and bromine in beached microplastics.

    Science.gov (United States)

    Massos, Angelo; Turner, Andrew

    2017-08-01

    Samples of microplastic (n = 924) from two beaches in south west England have been analysed by field-portable-x-ray fluorescence (FP-XRF) spectrometry, configured in a low-density mode and with a small-spot facility, for the heavy metals, Cd and Pb, and the halogen, Br. Primary plastics in the form of pre-production pellets were the principal type of microplastic (>70%) on both beaches, with secondary, irregularly-shaped fragments representing the remainder of samples. Cadmium and Pb were detected in 6.9% and 7.5% of all microplastics, respectively, with concentrations of either metal that exceeded 103 μg g-1 usually encountered in red and yellow pellets or fragments. Respective correlations of Cd and Pb with Se and Cr were attributed to the presence of the coloured, inorganic pigments, cadmium sulphoselenide and lead chromate. Bromine, detected in 10.4% of microplastics and up to concentrations of about 13,000 μg g-1, was mainly encountered in neutrally-coloured pellets. Its strong correlation with Sb, whose oxides are effective fire suppressant synergists, suggests the presence of a variety of brominated flame retardants arising from the recycling of plastics originally used in casings for heat-generating electrical equipment. The maximum bioaccessible concentrations of Cd and Pb, evaluated using a physiological extraction based on the chemical characteristics of the proventriculus-gizzard of the northern fulmar, were about 50 μg g-1 and 8 μg g-1, respectively. These concentrations exceed those estimated for the diet of local seabirds by factors of about 50 and 4, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Cadmium in goods - contribution to environmental exposure

    Energy Technology Data Exchange (ETDEWEB)

    Bergbaeck, B.; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science

    1998-03-01

    The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs

  7. /sup 131/I uptake in a benign serous crystadenoma of the ovary

    Energy Technology Data Exchange (ETDEWEB)

    Kim, E.E.; Pjura, G.; Gobuty, A.; Verani, R.

    1984-09-01

    A patient with well-differentiated thyroid carcinoma had a whole body scan using 5 mCi /sup 131/I which demonstrated abnormal uptake of /sup 131/I in a palpable pelvic mass. Approximately 24 years ago the patient had a total thyroidectomy followed by /sup 131/I treatment. The histologic examination of the mass was consistent with serous cystadenoma of the ovary. No thyroid tissue or teratoma was identified. The mechanism for the unusual uptake of /sup 131/I in a benign ovarian tumor is not clear, and the differential diagnosis of metastatic thyroid cancer is briefly reviewed.

  8. I-131-Metaiodobenzylguanidine therapy with allogeneic cord blood stem cell transplantation for recurrent neuroblastoma

    Directory of Open Access Journals (Sweden)

    Sato Yuya

    2012-10-01

    Full Text Available Abstract Iodine-131-metaiodiobenzylguanidine (131I-MIBG therapy combined with allogeneic cord blood stem cell transplantation (SCT was used to treat a 4-year-old girl with recurrent neuroblastoma. The patient experienced relapse 2 years after receiving first-line therapies, which included chemotherapy, surgical resection, irradiation, and autologous peripheral SCT. Although 131I-MIBG treatment did not achieve complete remission, the size of the tumor was reduced after treatment. Based on our findings, we suggest that 131I-MIBG treatment with myeloablative allogeneic SCT should be considered as first-line therapy for high-risk neuroblastoma patients when possible.

  9. Liquid discharges from patients undergoing {sup 131}I treatments

    Energy Technology Data Exchange (ETDEWEB)

    Barquero, R. [Servicio de Radiofisica y Proteccion Radiologica, Hospital Universitario Rio Hortega, E-47010 Valladolid (Spain)], E-mail: rbarquero@hurh.sacyl.es; Basurto, F. [Departamento de Fisica Teorica, Atomica y Optica, Universidad de Valladolid, E-47010 Valladolid (Spain); Nunez, C. [Servicio de Radiofisica y Proteccion Radiologica, Fundacion Jimenez Diaz, FJD, E-82001 Madrid (Spain); Esteban, R. [Servicio de Radiologia, Hospital Clinico Universitario, E-47005 Valladolid (Spain)

    2008-10-15

    This work discusses the production and management of liquid radioactive wastes as excretas from patients undergoing therapy procedures with {sup 131}I radiopharmaceuticals in Spain. The activity in the sewage has been estimated with and without waste radioactive decay tanks. Two common therapy procedures have been considered, the thyroid cancer (4.14 GBq administered per treatment), and the hyperthyroidism (414 MBq administered per treatment). The calculations were based on measurements of external exposure around the 244 hyperthyroidism patients and 23 thyroid cancer patients. The estimated direct activity discharged to the sewage for two thyroid carcinomas and three hyperthyroidisms was 14.57 GBq and 1.27 GBq, respectively, per week; the annual doses received by the most exposed individual (sewage worker) were 164 {mu}Sv and 13 {mu}Sv, respectively. General equations to calculate the activity as a function of the number of patient treated each week were also obtained.

  10. Mechanisms of cadmium carcinogenicity in the gastrointestinal tract.

    Science.gov (United States)

    Bishak, Yaser Khaje; Payahoo, Laleh; Osatdrahimi, Alireza; Nourazarian, Alireza

    2015-01-01

    Cancer, a serious public health problem in worldwide, results from an excessive and uncontrolled proliferation of the body cells without obvious physiological demands of organs. The gastrointestinal tract, including the esophagus, stomach and intestine, is a unique organ system. It has the highest cancer incidence and cancer- related mortality in the body and is influenceed by both genetic and environmental factors. Among the various chemical elements recognized in the nature, some of them including zinc, iron, cobalt, and copper have essential roles in the various biochemical and physiological processes, but only at low levels and others such as cadmium, lead, mercury, arsenic, and nickel are considered as threats for human health especially with chronic exposure at high levels. Cadmium, an environment contaminant, cannot be destroyed in nature. Through impairment of vitamin D metabolism in the kidney it causes nephrotoxicity and subsequently bone metabolism impairment and fragility. The major mechanisms involved in cadmium carcinogenesis could be related to the suppression of gene expression, inhibition of DNA damage repair, inhibition of apoptosis, and induction of oxidative stress. In addition, cadmium may act through aberrant DNA methylation. Cadmium affects multiple cellular processes, including signal transduction pathways, cell proliferation, differentiation, and apoptosis. Down-regulation of methyltransferases enzymes and reduction of DNA methylation have been stated as epigenetic effects of cadmium. Furthermore, increasing intracellular free calcium ion levels induces neuronal apoptosis in addition to other deleterious influence on the stability of the genome.

  11. Human seminal plasma cadmium: comparison with fertility and smoking habits.

    Science.gov (United States)

    Saaranen, M; Kantola, M; Saarikoski, S; Vanha-Perttula, T

    1989-01-01

    Cadmium, selenium and zinc were determined in seminal plasma and serum of 64 men by atomic absorption spectrometry (AAS). The mean (+/- SD) cadmium concentrations in seminal plasma and serum were 0.22 +/- 0.22 micrograms and 0.28 +/- 0.10 micrograms, respectively, but they did not correlate with each other. Smokers (n = 31) had significantly (p less than 0.01) higher serum cadmium concentrations than non-smokers (n = 31). Also seminal plasma cadmium in smokers was elevated, but a significant difference to non-smokers was only found if more than 20 cigarettes were consumed daily. No differences were found in semen quality and fertility between smokers and non-smokers. The seminal plasma cadmium had no correlation to selenium or zinc which, however, displayed a positive correlation (r = 0.852, p less than 0.001) to each other. It is concluded that smoking increases the exposure to cadmium. Although no obvious reproductive suppression was observed, heavy smoking may possibly enhance toxic effects in men under other detrimental exposures.

  12. Influence of combined antioxidants against cadmium induced testicular damage.

    Science.gov (United States)

    Koyuturk, Meral; Yanardag, Refiye; Bolkent, Sehnaz; Tunali, Sevim

    2006-05-01

    Acute effects of cadmium (Cd) and combined antioxidants were evaluated in Sprague-Dawley rat testes. The rats were subdivided into four groups. Cadmium chloride (2mg/kgday) injected intraperitoneally during 8 days. Vitamin C (250mg/kgday), vitamin E (250mg/kgday) and sodium selenate (0.25mg/kgday) were pretreated by gavage in both of control and cadmium injected rats. Testis lipid peroxidation and glutathione levels were determined by spectrophotometrically. In Cd treated rats, lipid peroxidation levels were increased and glutathione levels were decreased and combined antioxidants treatment was effective in preventing of lipid peroxidation and normalizing glutathione. In Cd treated animals, the degenerative changes were observed, but not observed in the administrated rats with Cd and antioxidants under the light microscope. Proliferating cell nuclear antigen, metallothionein and caspase-3 activities were evaluated by immunohistochemically. Proliferation activity was not seen in the spermatogonial cells of cadmium treated testis. Treatment with antioxidants in cadmium administrated testis leads to pronounced increase in proliferation activity. Cytoplasmic caspase-3 activity was determined in the spermatogenic cells but not spermatogonia in treatment of antioxidants with Cd. In control and treated with antioxidants animals, metallothionein expressions were localized in the cells of seminiferous tubules, although the expression only was observed in the interstitial cells of cadmium treated rats. Results demonstrated beneficial effects of combined vitamin C, vitamin E and selenium treatment in Cd toxicity.

  13. Trichosporon jirovecii-mediated synthesis of cadmium sulfide nanoparticles.

    Science.gov (United States)

    El-Baz, Ashraf Farag; Sorour, Noha Mohamed; Shetaia, Youssria Mohamed

    2016-05-01

    Cadmium sulphide is one of the most promising materials for solar cells and of great interest due to its useful applications in photonics and electronics, thus the development of bio-mediated synthesis of cadmium sulphide nanoparticles (CdS NPs) is one of the essential areas in nanoparticles. The present study demonstrates for the first time the eco-friendly biosynthesis of CdS NPs using the yeast Trichosporon jirovecii. The biosynthesis of CdS NPs were confirmed by UV-Vis spectrum and characterized by X-ray diffraction assay and electron microscopy. Scanning and transmission electron microscope analyses shows the formation of spherical CdS NPs with a size range of about 6-15 nm with a mean Cd:S molar ratio of 1.0:0.98. T. jirovecii produced hydrogen sulfide on cysteine containing medium confirmed by positive cysteine-desulfhydrase activity and the colony color turned yellow on 0.1 mM cadmium containing medium. T. jirovecii tolerance to cadmium was increased by the UV treatment and three 0.6 mM cadmium tolerant mutants were generated upon the UV radiation treatment. The overall results indicated that T. jirovecii could tolerate cadmium toxicity by its conversion into CdS NPs on cysteine containing medium using cysteine-desulfhydrase as a defense response mechanism. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Aerobic sulfide production and cadmium precipitation by Escherichia coli expressing the Treponema denticola cysteine desulfhydrase gene.

    Science.gov (United States)

    Wang, C L; Lum, A M; Ozuna, S C; Clark, D S; Keasling, J D

    2001-08-01

    The cysteine desulfhydrase gene of Treponema denticola was over-expressed in Escherichia coli to produce sulfide under aerobic conditions and to precipitate metal sulfide complexes on the cell wall. When grown in a defined salts medium supplemented with cadmium and cysteine, E. coli producing cysteine desulfhydrase secreted sulfide and removed nearly all of the cadmium from solution after 48 h. A control strain produced significantly less sulfide and removed significantly less cadmium. Measurement of acid-labile sulfide and energy dispersive X-ray spectroscopy indicated that cadmium was precipitated as cadmium sulfide. Without supplemental cysteine, both the E. coli producing cysteine desulfhydrase and the control E. coli demonstrated minimal cadmium removal.

  15. Gene expression analysis in cadmium-stressed roots of a low cadmium-accumulating solanaceous plant, Solanum torvum

    National Research Council Canada - National Science Library

    Hirotaka Yamaguchi; Hiroyuki Fukuoka; Tomohito Arao; Akio Ohyama; Tsukasa Nunome; Koji Miyatake; Satomi Negoro

    2010-01-01

    Solanum torvum Sw. cv. Torubamubiga (TB) is a low cadmium (Cd)-accumulating plant. To elucidate the molecular mechanisms of the Cd acclimation process in TB roots, transcriptional regulation was analysed in response to mild Cd treatment...

  16. The Protective Roles of Zinc and Magnesium in Cadmium-Induced Renal Toxicity in Male Wistar Rats

    National Research Council Canada - National Science Library

    Nasim Babaknejad; Ali Asghar Moshtaghie; Kahin Shahanipour; Somaye Bahrami

    2014-01-01

    .... Cadmium can cause dysfunction of different body organs. Zinc (Zn) and magnesium (Mg) supplementation can have protective effects against cadmium toxicity due to their antagonistic and antioxidants properties...

  17. Environmental exposure to cadmium and renal function of elderly women living in cadmium-polluted areas of West-Germany

    Energy Technology Data Exchange (ETDEWEB)

    Ewers, U.; Brockhaus, A.; Dolgner, R.; Freier, I.; Jermann, E.; Hahn, R.; Schlipkoeter, H.W.; Bernard, A.

    1985-12-01

    An epidemiological study was carried out to assess whether or not environmental pollution by cadmium as found in cadmium-polluted areas of the Federal Republic auf Germany is associated with an increased prevalence of biological signs of kidney dysfunction in population groups non-occupationally exposed to heavy metals. The study was run in two industrial areas known to be highly polluted by cadmium and other toxic heavy metals, viz. Stolberg and Duisburg. Duesseldorf was selected as a reference area. As a study population we selected 65- and 66-year-old women who had spent the major part of their lives in one of these areas. The average levels of cadmium in blood and urine showed significant differences in exposure to cadmium in the order Stolberg > Duisburg > Duesseldorf. Serum creatinine levels were, on average, significantly higher in the Stolberg group than in the Duisburg and Duesseldorf groups. With respect to other biological findings (total proteinuria, tubular proteinuria, albuminuria, aminoaciduria, phosphaturia, serum complement) no significant differences between the study populations were noted. It cannot be excluded, however, that in the Stolberg group there is a synergism of ageing and cadmium with respect to the age related decline of the glomerular filtration rate.

  18. Oxidative stress and DNA damage induced by cadmium in the human keratinocyte HaCaT cell line: role of glutathione in the resistance to cadmium.

    Science.gov (United States)

    Nzengue, Yves; Steiman, Régine; Garrel, Catherine; Lefèbvre, Emmanuel; Guiraud, Pascale

    2008-01-14

    Cadmium affects the cellular homeostasis and generates damage via complex mechanisms involving interactions with other metals and oxidative stress induction. In this work we used a human keratinocyte cell line (HaCaT) as a model to study the oxidative damage induced by cadmium to cellular macromolecules, its effect on the antioxidant systems and the role of glutathione in cell protection toward cadmium toxicity. The cells were incubated for 24 and 48 h with cadmium (3, 15, 50 and 100 microM). High doses of cadmium were required to induce a cytotoxicity: 100 microM lead to 30% mortality after 24h and 50% after 48 h. The oxidation of lipids and proteins and the DNA damage, respectively, assessed by thiobarbituric acid reactants determination, thiol group measurement and comet assay, were observed for 50-100 microM cadmium. The cytotoxic effects were strongly correlated to the cellular cadmium content. The glutathione peroxidase and the catalase activities were decreased, while the glutathione reductase activity and the glutathione concentration were increased after cadmium treatment. The superoxide dismutases activities were unchanged. A depletion in glutathione prior to cadmium exposure increased the cytotoxic effects and provoked DNA damage. Our results suggested that the hydroxyl radical could be the major compound involved in the oxidative stress generated by cadmium and that glutathione could play a major role in the protection of HaCaT cells from cytotoxicity but mostly from DNA damage induced by cadmium.

  19. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Limpatanachote, Pisit; Krintratun, Somyot [Department of Internal Medicine, Mae Sot General Hospital, Tak (Thailand)

    2010-08-15

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4{+-}2.3 {mu}g/g creatinine) was significantly greater than that for men (2.0{+-}2.2 {mu}g/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  20. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, Helena A.; Maher, William A., E-mail: bill.maher@canberra.edu.au; Taylor, Anne M.; Krikowa, Frank

    2015-03-15

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata.

  1. Synthesis and Characterization of Mercaptoacetic Acid Capped Cadmium Sulphide Quantum Dots.

    Science.gov (United States)

    Wageh, S; Maize, Mai; Donia, A M; Al-Ghamdi, Ahmed A; Umar, Ahmad

    2015-12-01

    This paper reports the facile synthesis and detailed characterization of mercaptoacetic acid capped cadmium sulphide (CdS) quantum dots using various cadmium precursors. The mercaptoacetic acid capped CdS quantum dots were prepared by facile and simple wet chemical method and characterized by several techniques such as energy dispersive spectroscopy (EDS), X-ray diffraction, Fourier transform infrared (FTIR) spectroscopy, UV-vis. spectroscopy, photoluminescence spectroscopy, high-resolution transmission microscopy (HRTEM) and thremogravimetric analysis. The EDS studies revealed that the prepared quantum dots possess higher atomic percentage of sulfur compared to cadmium due to the coordination of thiolate to the quantum dots surfaces. The X-ray and absorption analyses exhibited that the size of quantum dots prepared by cadmium acetate is larger than the quantum dots prepared by cadmium chloride and cadmium nitrate. The increase in size can be attributed to the low stability constant of cadmium acetate in comparison with cadmium chloride and cadmium nitrate. The FTIR and thermogravimetric analysis showed that the nature of capping molecule on the surface of quantum dots are different depending on the cadmium precursors which affect the emission from CdS quantum dots. Photoemission spectroscopy revealed that the emission of quantum dots prepared by cadmium acetate has high intensity band edge emission along with low intensity trapping state emission. However the CdS quantum dots prepared by cadmium chloride and cadmium nitrate produced only trapping state emissions.

  2. 19p13.1 Is a triple-negative-specific breast cancer susceptibility locus

    NARCIS (Netherlands)

    K. Stevens (Kristen); Z. Fredericksen (Zachary); C. Vachon (Celine); X. Wang (Xing); S. Margolin (Sara); A. Lindblom (Annika); H. Nevanlinna (Heli); D. Greco (Dario); K. Aittomäki (Kristiina); C. Blomqvist (Carl); J. Chang-Claude (Jenny); A. Vrieling (Alina); D. Flesch-Janys (Dieter); H.-P. Sinn (Hans-Peter); S. Wang-Gohrke (Shan); S. Nickels (Stefan); H. Brauch (Hiltrud); Y-D. Ko (Yon-Dschun); H.-P. Fischer; R.K. Schmutzler (Rita); A. Meindl (Alfons); C.R. Bartram (Claus); S. Schott (Sarah); C. Engel (Christoph); A.K. Godwin (Andrew); J. Weaver (JoEllen); S.S. Pathak; P. Sharma (Pankaj); H. Brenner (Hermann); H. Mul̈ler (Heiko); V. Arndt (Volker); C. Stegmaier (Christa); P. Miron (Penelope); D. Yannoukakos (Drakoulis); A. Stavropoulou (Alexandra); G. Fountzilas (George); H. Gogas (Helen); R. Swann (Ruth); M. Dwek (Miriam); A. Perkins (Annie); R.L. Milne (Roger); J. Benítez (Javier); M.P. Zamora (Pilar); J.I.A. Perez (Jose Ignacio Arias); S.E. Bojesen (Stig); S.F. Nielsen (Sune); B.G. Nordestgaard (Børge); H. Flyger (Henrik); P. Guénel (Pascal); T. Truong (Thérèse); F. Menegaux (Florence); E. Cordina-Duverger (Emilie); B. Burwinkel (Barbara); F. Marme (Federick); A. Schneeweiss (Andreas); C. Sohn (Christof); E.J. Sawyer (Elinor); I.P. Tomlinson (Ian); M. Kerin (Michael); J. Peto (Julian); N. Johnson (Nichola); O. Fletcher (Olivia); I. dos Santos Silva (Isabel); P.A. Fasching (Peter); M.W. Beckmann (Matthias); A. Hartmann; A.B. Ekici (Arif); A. Lophatananon (Artitaya); K.R. Muir (Kenneth); P. Puttawibul (Puttisak); S. Wiangnon (Surapon); M.K. Schmidt (Marjanka); A. Broeks (Annegien); L.M. Braaf (Linde); E.H. Rosenberg (Efraim); J.L. Hopper (John); C. Apicella (Carmel); D.J. Park (Daniel); M.C. Southey (Melissa); A.J. Swerdlow (Anthony ); A. Ashworth (Alan); O. Nicholas (Orr); M. Schoemaker (Minouk); H. Anton-Culver (Hoda); A. Ziogas (Argyrios); L. Bernstein (Leslie); C.C. Dur (Christina Clarke); C-Y. Shen (Chen-Yang); J-C. Yu (Jyh-Cherng); H.-M. Hsu (Huan-Ming); C.-N. Hsiung (Chia-Ni); U. Hamann (Ute); T. Dun̈nebier (Thomas); T. Rud̈iger (Thomas); H.U. Ulmer (Hans); P.D.P. Pharoah (Paul); A.M. Dunning (Alison); M.K. Humphreys (Manjeet); Q. Wang (Qing); A. Cox (Angela); S.S. Cross (Simon); M.W.R. Reed (Malcolm); P. Hall (Per); K. Czene (Kamila); C.B. Ambrosone (Christine); F. Ademuyiwa (Foluso); H. Hwang (Helena); D. Eccles (Diana); M. García-Closas (Montserrat); J.D. Figueroa (Jonine); M.E. Sherman (Mark); J. Lissowska (Jolanta); P. Devilee (Peter); C.M. Seynaeve (Caroline); R.A.E.M. Tollenaar (Rob); M.J. Hooning (Maartje); I.L. Andrulis (Irene); J.A. Knight (Julia); G. Glendon (Gord); A.M. Mulligan (Anna Marie); R. Winqvist (Robert); K. Pykäs (Katri); A. Jukkola-Vuorinen (Arja); M. Grip (Mervi); E.M. John (Esther); A. Miron (Alexander); G.G. Alnæs (Grethe); V. Kristensen (Vessela); A.-L. Brøresen-Dale (Anne-Lise); G.G. Giles (Graham); L. Baglietto (Laura); C.A. McLean (Catriona Ann); G. Severi (Gianluca); M. Kosel (Matthew); V.S. Pankratz (Shane); S. Slager (Susan); J.E. Olson (Janet); P. Radice (Paolo); P. Peterlongo (Paolo); S. Manoukian (Siranoush); M. Barile (Monica); D. Lambrechts (Diether); S. Hatse (Sigrid); A.-S. Dieudonné (Anne-Sophie); M.R. Christiaens (Marie Rose); G. Chenevix-Trench (Georgia); J. Beesley (Jonathan); X. Chen (Xiaoqing); A. Mannermaa (Arto); V-M. Kosma (Veli-Matti); J. Hartikainen (Jaana); Y. Soini (Ylermi); D.F. Easton (Douglas); F.J. Couch (Fergus)

    2012-01-01

    textabstractThe 19p13.1 breast cancer susceptibility locus is a modifier of breast cancer risk in BRCA1 mutation carriers and is also associated with the risk of ovarian cancer. Here, we investigated 19p13.1 variation and risk of breast cancer subtypes, defined by estrogen receptor (ER),

  3. 26 CFR 1.501(c)(13)-1 - Cemetery companies and crematoria.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 7 2010-04-01 2010-04-01 true Cemetery companies and crematoria. 1.501(c)(13)-1...) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Exempt Organizations § 1.501(c)(13)-1 Cemetery companies and crematoria. (a) Nonprofit mutual cemetery companies. A nonprofit cemetery company may be entitled...

  4. 46 CFR 131.310 - List of crew members and offshore workers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false List of crew members and offshore workers. 131.310... OPERATIONS Preparations for Emergencies § 131.310 List of crew members and offshore workers. (a) The master... members and offshore workers embarked; (2) In a well-marked place at the vessel's normal berth; or (3...

  5. 29 CFR 794.131 - “Customer * * * engaged in bulk distribution”.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false âCustomer * * * engaged in bulk distributionâ. 794.131... Sales Made to Other Bulk Distributors § 794.131 “Customer * * * engaged in bulk distribution”. A sale to a customer of an enterprise engaged in the wholesale or bulk distribution of petroleum products will...

  6. 46 CFR 131.915 - Persons allowed in pilothouse and on navigational bridge.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Persons allowed in pilothouse and on navigational bridge. 131.915 Section 131.915 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE... bridge. No person may be in the pilothouse while the vessel is under way, unless connected with the...

  7. 131I-MIBG as a first-line treatment in high-risk neuroblastoma patients

    NARCIS (Netherlands)

    Hoefnagel, C. A.; de Kraker, J.; Valdés Olmos, R. A.; Voûte, P. A.

    1994-01-01

    The observed response to 131I-metaiodobenzylguanidine (MIBG) therapy in advanced neuroblastoma after conventional therapy, the non-invasiveness of the procedure, and the high metabolic activity which is frequently observed in untreated tumours led to the concept of substituting 131I-MIBG therapy for

  8. Clinical significance of /sup 131/I meta-iodobenzylguanidine scintigraphy in neuroblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Odano, Ikuo; Takeda, Masayuki; Kimura, Motomasa; Sakai, Kunio

    1988-05-01

    /sup 131/I meta-iodobenzylguanidine (/sup 131/I-MIBG) scintigraphy was performed in sixteen children of neuroblastoma with ages ranging 1 - 9 years old. Eleven were male and 5 female. Scintigrams were obtained 24 hours and 48 hours after injection of /sup 131/I-MIBG (0.3 approx. 0.5 mCi/0.5 ml). In 5 patients being free from tumor recurrence with negative urinary VMA, positive accumulation of /sup 131/I-MIBG was not observed. In 8 cases with positive urinary VMA, abnormal accumulation was noted in all cases. It was supposed close relationship to be present between urinary VMA and abnormal accumulation of /sup 131/I-MIBG. In 8 preoperative cases, 7 primary lesions were clearly demonstrated (sensitivity 88 %); 5 were in adrenal gland and one was in mediastinal and hilar lesion. The smallest size of the visualized tumor was about 1.0 cm in diameter. In 8 metastatic bone lesions detected by radiography and X-ray CT, 7 (88 %) were demonstrated on /sup 131/I-MIBG scintigram. In 2 liver metastases, 1 (50 %) was demonstrated. In 4 distant lymphnode metastases, 3 (75 %) were imaged. In 8 cases with bone marrow involvement proved by bone marrow biopsy, 3 (38 %) were clearly demonstrated by /sup 131/I-MIBG scintigraphy. It was supposed that /sup 131/I-MIBG scintigraphy was useful in demonstrating not only primary lesions but also bone and bone marrow involvement of neuroblastoma.

  9. 27 CFR 478.131 - Firearms transactions not subject to a NICS check.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 3 2010-04-01 2010-04-01 false Firearms transactions not subject to a NICS check. 478.131 Section 478.131 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL... prescribed for the retention of Form 5300.35 in § 478.129(c). (b) The requirements of this section shall be...

  10. 46 CFR 131.825 - Controls of fire-extinguishing system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Controls of fire-extinguishing system. 131.825 Section... OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.825 Controls of fire-extinguishing system. Each control cabinet or space containing a valve or manifold for a fire extinguishing system must...

  11. 27 CFR 28.131 - Application for return of wines withdrawn without payment of tax.

    Science.gov (United States)

    2010-04-01

    ... numbers of the containers to be returned. In the case of bottled wines, the number and size of the bottles... wines withdrawn without payment of tax. 28.131 Section 28.131 Alcohol, Tobacco Products and Firearms... Withdrawal of Wine Without Payment of Tax for Exportation, Use on Vessels and Aircraft, Transfer to a Foreign...

  12. Accumulation and effects of cadmium on guppy (Poecilia reticulata) fed cadmium-dosed cladocera (Moina macrocopa)

    Energy Technology Data Exchange (ETDEWEB)

    Hatakeyama, S.; Yasuno, M.

    1982-08-01

    The study examines the rate of cadmium uptake and body burdens which cause adverse effects on the survival and growth of guppies when they are exposed to Cd dosed in zooplankton (Moina macrocopa) and Cd dissolved in water. Eight guppies fed Moina dosed at 20 ..mu..g Cd/L water died before 10 days. Growth of the remainder of the guppies exposed at this rate was impaired initially but was returned to control level around the 10th day of the study. (JMT)

  13. Virulence potential and genomic mapping of the worldwide clone Escherichia coli ST131.

    Directory of Open Access Journals (Sweden)

    Jean-Philippe Lavigne

    Full Text Available Recently, the worldwide propagation of clonal CTX-M-15-producing Escherichia coli isolates, namely ST131 and O25b:H4, has been reported. Like the majority of extra-intestinal pathogenic E. coli isolates, the pandemic clone ST131 belongs to phylogenetic group B2, and has recently been shown to be highly virulent in a mouse model, even though it lacks several genes encoding key virulence factors (Pap, Cnf1 and HlyA. Using two animal models, Caenorhabditis elegans and zebrafish embryos, we assessed the virulence of three E. coli ST131 strains (2 CTX-M-15- producing urine and 1 non-ESBL-producing faecal isolate, comparing them with five non-ST131 B2 and a group A uropathogenic E. coli (UPEC. In C. elegans, the three ST131 strains showed intermediate virulence between the non virulent group A isolate and the virulent non-ST131 B2 strains. In zebrafish, the CTX-M-15-producing ST131 UPEC isolates were also less virulent than the non-ST131 B2 strains, suggesting that the production of CTX-M-15 is not correlated with enhanced virulence. Amongst the non-ST131 B2 group isolates, variation in pathogenic potential in zebrafish embryos was observed ranging from intermediate to highly virulent. Interestingly, the ST131 strains were equally persistent in surviving embryos as the non-ST131-group B2 strains, suggesting similar mechanisms may account for development of persistent infection. Optical maps of the genome of the ST131 strains were compared with those of 24 reference E. coli strains. Although small differences were seen within the ST131 strains, the tree built on the optical maps showed that these strains belonged to a specific cluster (86% similarity with only 45% similarity with the other group B2 strains and 25% with strains of group A and D. Thus, the ST131 clone has a genetic composition that differs from other group B2 strains, and appears to be less virulent than previously suspected.

  14. 77 FR 36295 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Cadmium in...

    Science.gov (United States)

    2012-06-18

    ... cadmium, to provide medical surveillance, to train workers about the hazards of cadmium in the workplace... appropriate automated, electronic, mechanical, or other technological collection techniques or other forms of...

  15. 131I activity quantification of gamma camera planar images

    Science.gov (United States)

    Barquero, Raquel; Garcia, Hugo P.; Incio, Monica G.; Minguez, Pablo; Cardenas, Alexander; Martínez, Daniel; Lassmann, Michael

    2017-02-01

    A procedure to estimate the activity in target tissues in patients during the therapeutic administration of 131I radiopharmaceutical treatment for thyroid conditions (hyperthyroidism and differentiated thyroid cancer) using a gamma camera (GC) with a high energy (HE) collimator, is proposed. Planar images are acquired for lesions of different sizes r, and at different distances d, in two HE GC systems. Defining a region of interest (ROI) on the image of size r, total counts n g are measured. Sensitivity S (cps MBq-1) in each acquisition is estimated as the product of the geometric G and the intrinsic efficiency η 0. The mean fluence of 364 keV photons arriving at the ROI per disintegration G, is calculated with the MCNPX code, simulating the entire GC and the HE collimator. Intrinsic efficiency η 0 is estimated from a calibration measurement of a plane reference source of 131I in air. Values of G and S for two GC systems—Philips Skylight and Siemens e-cam—are calculated. The total range of possible sensitivity values in thyroidal imaging in the e-cam and skylight GC measure from 7 cps MBq-1 to 35 cps MBq-1, and from 6 cps MBq-1 to 29 cps MBq-1, respectively. These sensitivity values have been verified with the SIMIND code, with good agreement between them. The results have been validated with experimental measurements in air, and in a medium with scatter and attenuation. The counts in the ROI can be produced by direct, scatter and penetration photons. The fluence value for direct photons is constant for any r and d values, but scatter and penetration photons show different values related to specific r and d values, resulting in the large sensitivity differences found. The sensitivity in thyroidal GC planar imaging is strongly dependent on uptake size, and distance from the GC. An individual value for the acquisition sensitivity of each lesion can significantly alleviate the level of uncertainty in the measurement of thyroid uptake activity for each patient.

  16. Iodine-131 uptake in a patient with thyroid cancer and rheumatoid arthritis during acupuncture treatment

    Energy Technology Data Exchange (ETDEWEB)

    Otsuka, N.; Fukunaga, M.; Morita, K.; Ono, S.; Nagai, K.; Katagiri, M.; Harada, T.; Morita, R. (Kawasaki Medical School, Okayama (Japan))

    1990-01-01

    A patient with thyroid carcinoma had abnormal accumulation of I-131 in the areas of both feet and hands on whole body scan. The sites of abnormal accumulation of I-131 were similar to those on bone scintigraphy. The radiographic examination of the lesions showed characteristic findings of rheumatoid arthritis, and the presence of small gold needles for acupuncture treatment was demonstrated. There were no findings of bone metastases. Although the mechanism of accumulation of I-131 in this patient is unknown, interpreters of I-131 whole body scintigraphs should keep this case in mind when acupuncture treatment has been done. The authors can only speculate on a common blood flow mechanism for enhanced HMDP and I-131 uptake in this arthritic patient who had been treated by acupuncture.

  17. Relative Biological Effectiveness (RBE) of (131)I Radiation Relative to (60)Co Gamma Rays.

    Science.gov (United States)

    Neshasteh-Riz, Ali; Mahmoud Pashazadeh, Ali; Mahdavi, Seyed Rabie

    2013-01-01

    To assess relative biological effectiveness (RBE) of (131)I radiation relative to (60)Co gamma rays in glioblastoma spheroid cells. : In this experimental study, glioblastoma spheroid cells were exposed to (131)I radiation and (60)Co gamma rays. Radiation induced DNA damage was evaluated by alkaline comet assay. Samples of spheroid cells were treated by radiation from (131)I for four different periods of time to find the dose-response equation. Spheroid cells were also exposed by 200 cGy of (60)Co gamma rays as reference radiation to induce DNA damage as endpoint. Resulted RBE of (131)I radiation relative to (60)Co gamma rays in 100 µm giloblastoma spheroid cells was equal to 1.16. The finding of this study suggests that (131)I photons and electrons can be more effective than (60)Co gamma rays to produce DNA damage in glioblastoma spheroid cells.

  18. Beta-endorphin 1-31 biotransformation and cAMP modulation in inflammation.

    Directory of Open Access Journals (Sweden)

    Naghmeh Hajarol Asvadi

    Full Text Available A large body of evidence now exists for the immune cell expression, production, and the release of beta-endorphin (BE 1-31 within inflamed tissue. The inflammatory milieu is characterised by increased acidity, temperature and metabolic activity. Within these harsh conditions BE 1-31 is even more susceptible to increased enzymatic degradation over that of plasma or other non-injured tissue. To elucidate the biotransformation pathways of BE 1-31 and provide an insight to the impact of inflamed tissue environments, BE 1-31 and three of its major N-terminal fragments (BE 1-11, BE 1-13 and BE 1-17 were incubated in inflamed tissue homogenates at pH 5.5 for 2 hrs. In addition, the potency of BE 1-31 and five main N--terminal fragments (BE 1-9, BE 1-11, BE 1-13, BE 1-17, BE 1-20 was assessed at mu-opioid receptors (MOR, delta-opioid receptors (DOR, and kappa-opioid receptors (KOR. Opioid receptor potency was investigated by examining the modulation of forskolin induced cAMP accumulation. The majority of the N-terminal fragment of BE 1-31 had similar efficacy to BE 1-31 at MOR. The shortest of the major N-terminal fragments (BE 1-9, had partial agonist activity at MOR but possessed the highest potency of all tested peptides at DOR. There was limited effect for BE 1-31 and the biotransformed peptides at KOR. Major N-terminal fragments produced within inflamed tissue have increased presence within inflamed tissue over that of the parent molecule BE 1-31 and may therefore contribute to BE 1-31 efficacy within disease states that involve inflammation.

  19. Excretion and toxicity evaluation of (131)I-Sennoside A as a necrosis-avid agent.

    Science.gov (United States)

    Yin, Zhiqi; Sun, Lidan; Jin, Qiaomei; Song, Shaoli; Feng, Yuanbo; Liao, Hong; Ni, Yicheng; Zhang, Jian; Liu, Wei

    2017-11-01

    1. Sennoside A (SA) is a newly identified necrosis-avid agent that shows capability for imaging diagnosis and tumor necrosis targeted radiotherapy. As a water-soluble compound, (131)I-Sennoside A ((131)I-SA) might be excreted predominately through the kidneys with the possibility of nephrotoxicity. 2. To further verify excretion pathway and examine nephrotoxicity of (131)I-SA, excretion and nephrotoxicity were appraised. The pharmacokinetics, hepatotoxicity and hematotoxicity of (131)I-SA were also evaluated to accelerate its possible clinical translation. All these studies were conducted in mice with ethanol-induced muscular necrosis following a single intravenous administration of 131I-SA at 18.5 MBq/kg or 370 MBq/kg. 3. Excretion data revealed that (131)I-SA was predominately (73.5% of the injected dose (% ID)) excreted via the kidneys with 69.5% ID detected in urine within 72 h post injection. Biodistribution study indicated that (131)I-SA exhibited initial high distribution in the kidneys but subsequently a fast renal clearance, which was further confirmed by the results of autoradiography and single-photon emission computed tomography-computed tomography (SPECT-CT) imaging. The maximum necrotic to normal muscle ratio reached to 7.9-fold at 48 h post injection, which further verified the necrosis avidity of (131)I-SA. Pharmacokinetic parameters showed that (131)I-SA had fast blood clearance with an elimination half-life of 6.7 h. Various functional indexes were no significant difference (p > 0.05) between before administration and 1 d, 8 d, 16 d after administration. Histopathology showed no signs of tissue damage. 4. These data suggest (131)I-SA is a safe and promising necrosis-avid agent applicable in imaging diagnosis and tumor necrosis targeted radiotherapy.

  20. Effect of selenium on cadmium-induced oxidative stress and esterase activity in rat organs

    OpenAIRE

    Kevin Dzobo; Yogeshkumar S. Naik

    2013-01-01

    Metal toxicity is a threat mainly in the industrialised world where industry discharges many toxic metals into the environment. We investigated the effects of two metals cadmium and selenium on the cytosolic antioxidant enzymes and esterases in the liver, kidneys and testes of rats. Male Sprague-Dawley rats (n=28) were divided equally into four groups: control, cadmium, selenium and cadmium/selenium. Salts of the metals were administered intraperitoneally for 15 days. In the liver, cadmium tr...

  1. RNA-Seq Identifies Key Reproductive Gene Expression Alterations in Response to Cadmium Exposure

    OpenAIRE

    Hanyang Hu; Xing Lu; Xiang Cen; Xiaohua Chen; Feng Li; Shan Zhong

    2014-01-01

    Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively in...

  2. The effect of betaine administration on rat sperm quality following cadmium toxicity

    OpenAIRE

    arash Kheradmand; masoud Alirezaei; omid Dezfoulian

    2014-01-01

    Background: The aim of this study is to survey the protective effects of betaine against cadmium and on sperm quality including progressive motility, sperm membrane integrity, concentration as well as testicular weight. Materials and Methods: Thirty adult male rats were allocated to the following three groups (n=10 in each group): control-saline, cadmium-saline and cadmium-betaine. Induction of testicular injury was achieved by a single injection of cadmium chloride intraperotoneally, and bet...

  3. Cadmium sorption characteristics of phosphorylated sago starch-extraction residue

    Energy Technology Data Exchange (ETDEWEB)

    Igura, Masato, E-mail: mst_igr@yahoo.co.jp [Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, 2-24-16 Nakacho, Koganei, Tokyo 184-8588 (Japan); Okazaki, Masanori [Institute of Symbiotic Science and Technology, Tokyo University of Agriculture and Technology, 2-24-16, Koganei, Tokyo 184-8588 (Japan)

    2010-06-15

    The residue produced by the extraction of sago starch is usually discarded as a waste material. In this study, we phosphorylated the sago starch-extraction residue with phosphoryl chloride and used the phosphorylated residue to remove cadmium from wastewater. The phosphoric ester functionality in the phosphorylated residue was evaluated by means of infrared microspectrometry and solid-state NMR. The dependence of the cadmium sorption behavior on pH, contact time, and electrolyte concentration and the maximum sorption capacity of the phosphorylated residue were also studied. The cadmium sorption varied with pH and electrolyte concentration, and the maximum sorption capacity was 25.2 mg g{sup -1}, which is almost half the capacity of commercially available weakly acidic cation exchange resins. The phosphorylated residue could be reused several times, although cadmium sorption gradually decreased as the number of sorption-desorption cycles increased. The phosphorylated residue sorbed cadmium rapidly, which is expected to be favorable for the continuous operation in a column.

  4. Systematic network assessment of the carcinogenic activities of cadmium.

    Science.gov (United States)

    Chen, Peizhan; Duan, Xiaohua; Li, Mian; Huang, Chao; Li, Jingquan; Chu, Ruiai; Ying, Hao; Song, Haiyun; Jia, Xudong; Ba, Qian; Wang, Hui

    2016-11-01

    Cadmium has been defined as type I carcinogen for humans, but the underlying mechanisms of its carcinogenic activity and its influence on protein-protein interactions in cells are not fully elucidated. The aim of the current study was to evaluate, systematically, the carcinogenic activity of cadmium with systems biology approaches. From a literature search of 209 studies that performed with cellular models, 208 proteins influenced by cadmium exposure were identified. All of these were assessed by Western blotting and were recognized as key nodes in network analyses. The protein-protein functional interaction networks were constructed with NetBox software and visualized with Cytoscape software. These cadmium-rewired genes were used to construct a scale-free, highly connected biological protein interaction network with 850 nodes and 8770 edges. Of the network, nine key modules were identified and 60 key signaling pathways, including the estrogen, RAS, PI3K-Akt, NF-κB, HIF-1α, Jak-STAT, and TGF-β signaling pathways, were significantly enriched. With breast cancer, colorectal and prostate cancer cellular models, we validated the key node genes in the network that had been previously reported or inferred form the network by Western blotting methods, including STAT3, JNK, p38, SMAD2/3, P65, AKT1, and HIF-1α. These results suggested the established network was robust and provided a systematic view of the carcinogenic activities of cadmium in human. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Isotope fractionation of cadmium in lunar material

    Science.gov (United States)

    Schediwy, S.; Rosman, K. J. R.; de Laeter, J. R.

    2006-03-01

    The double spike technique has been used to measure the isotope fractionation and elemental abundance of Cd in nine lunar samples, the Brownfield meteorite and the Columbia River Basalt BCR-1, by thermal ionisation mass spectrometry. Lunar soil samples give a tightly grouped set of positive isotope fractionation values of between + 0.42% and + 0.50% per mass unit. Positive isotope fractionation implies that the heavy isotopes are enhanced with respect to those of the Laboratory Standard. A vesicular mare basalt gave zero isotope fractionation, indicating that the Cd isotopic composition of the Moon is identical to that of the Earth. A sample of orange glass from the Taurus-Littrow region gave a negative isotope fractionation of - 0.23 ± 0.06% per mass unit, presumably as a result of redeposition of Cd from the Cd-rich vapour cloud associated with volcanism. Cadmium is by far the heaviest element to show isotope fractionation effects in lunar samples. The volatile nature of Cd is of importance in explaining these isotope fractionation results. Although a number of mechanisms have been postulated to be the cause of isotope fractionation of certain elements in lunar soils, we believe that the most likely mechanisms are ion and particle bombardment of the lunar surface.

  6. Biosynthesis of cadmium sulphide quantum semiconductor crystallites

    Science.gov (United States)

    Dameron, C. T.; Reese, R. N.; Mehra, R. K.; Kortan, A. R.; Carroll, P. J.; Steigerwald, M. L.; Brus, L. E.; Winge, D. R.

    1989-04-01

    NANOMETRE-SCALE semiconductor quantum crystallites exhibit size-dependent and discrete excited electronic states which occur at energies higher than the band gap of the corresponding bulk solid1-4. These crystallites are too small to have continuous energy bands, even though a bulk crystal structure is present. The onset of such quantum properties sets a fundamental limit to device miniaturization in microelectronics5. Structures with either one, two or all three dimensions on the nanometer scale are of particular interest in solid state physics6. We report here our discovery of the biosynthesis of quantum crystallites in yeasts Candida glabrata and Schizosaccharomyces pombe, cultured in the presence of cad-mium salts. Short chelating peptides of general structure (γ-Glu-Cys)n-Gly control the nucleation and growth of CdS crystallites to peptide-capped intracellular particles of diameter 20 Å. These quantum CdS crystallites are more monodisperse than CdS par-ticles synthesized chemically. X-ray data indicate that, at this small size, the CdS structure differs from that of bulk CdS and tends towards a six-coordinate rock-salt structure.

  7. Collinear laser spectroscopy of atomic cadmium

    CERN Document Server

    Frömmgen, Nadja; Bissell, Mark L.; Bieroń, Jacek; Blaum, Klaus; Cheal, Bradley; Flanagan, Kieran; Fritzsche, Stephan; Geppert, Christopher; Hammen, Michael; Kowalska, Magdalena; Kreim, Kim; Krieger, Andreas; Neugart, Rainer; Neyens, Gerda; Rajabali, Mustafa M.; Nörtershäuser, Wilfried; Papuga, Jasna; Yordanov, Deyan T.

    2015-01-01

    Hyperfine structure $A$ and $B$ factors of the atomic $5s\\,5p\\,\\; ^3\\rm{P}_2 \\rightarrow 5s\\,6s\\,\\; ^3\\rm{S}_1$ transition are determined from collinear laser spectroscopy data of $^{107-123}$Cd and $^{111m-123m}$Cd. Nuclear magnetic moments and electric quadrupole moments are extracted using reference dipole moments and calculated electric field gradients, respectively. The hyperfine structure anomaly for isotopes with $s_{1/2}$ and $d_{5/2}$ nuclear ground states and isomeric $h_{11/2}$ states is evaluated and a linear relationship is observed for all nuclear states except $s_{1/2}$. This corresponds to the Moskowitz-Lombardi rule that was established in the mercury region of the nuclear chart but in the case of cadmium the slope is distinctively smaller than for mercury. In total four atomic and ionic levels were analyzed and all of them exhibit a similar behaviour. The electric field gradient for the atomic $5s\\,5p\\,\\; ^3\\mathrm{P}_2$ level is derived from multi-configuration Dirac-Hartree-Fock calculatio...

  8. Cadmium neurotoxicity to a freshwater planarian.

    Science.gov (United States)

    Wu, Jui-Pin; Lee, Hui-Ling; Li, Mei-Hui

    2014-11-01

    Although freshwater planarians are evolutionarily primitive, they are some of the simplest bilateral animals possessing integrated neural networks similar to those in vertebrates. We attempted to develop planarian Dugesia japonica as a model for investigating the neurotoxicity of environmental pollutants such as cadmium (Cd). This study was therefore designed to study the effects of Cd on the locomotor activity, neurobehavior, and neurological enzymes of D. japonica. After planarians were exposed to Cd at high concentrations, altered neurobehavior was observed that exhibited concentration-dependent patterns. Morphological alterations in Cd-treated planarians included irregular shape, body elongation, screw-like hyperkinesia, and bridge-like position. To study the direct effects of Cd on neurological enzymes, tissue homogenates of planarians were incubated in vitro with Cd before their activity was measured. Results showed that acetylcholinesterase (AChE), adenosine triphosphatase (ATPase), and monoamine oxidase A (MAO-A) activities were inhibited in a concentration-dependent manner. MAO-B activity was significantly induced by Cd at low concentrations and inhibited at high concentrations. Changes in the in vivo activity of AChE and ATPase were also found after planarians were treated with Cd at a sublethal concentration (5.56 μM). These observations indicate that neurotransmission systems in planarians are disturbed after Cd exposure.

  9. Teratogenic effect of cadmium on the foetal development of albino rats

    African Journals Online (AJOL)

    Foetus of pregnant rats exposed to single intraperitoneal injection of 2 mg/kg body weight cadmium sulphate on eighth gestational days; were compared with control (saline injected) fetuses to assess the effects of cadmium sulphate on foetal growth and ossification. Cadmium sulphate caused significant reduction in body ...

  10. Various cadmium compounds in the feed for broilers and laying hens

    Energy Technology Data Exchange (ETDEWEB)

    Nezel, K.; Matthes, S.; Vogt, H.

    1981-06-01

    The influence of various cadmium compounds on the performance and health of broilers and laying hens and on the residues in tissues and eggs has been investigated. The easily soluble cadmium acetate, cystein cadmium and the low-soluble cadmium sulfide in the doses of 0-20-40 ppm cadmium were compared. Eight x 12 male Lohmann broiler chickens in cages for every ration in the 42-/49-days broiler test and 32 LSL-hens (Leghorn type) in single cages for every ration in the 336-days laying test have been used. Parameters tested in both tests were: mortality, feed intake, weight gain, feed efficiency, pathological-anatomical changes as well as cadmium contents in the test rations and in the pectoral muscle, the thigh muscle, the liver, the kidneys and the bones. In the laying test, also the laying rate, egg weight, daily egg output, egg shell stability and cadmium contents in egg white, yolk and in the tissues were tested. In both age groups the negative effect of cadmium acetate and cystein-cadmium employment on performance and health of the birds were similar; comparable concentrations were found in the tissues. Cadmium sulfide had no effect on the performance of the birds and cadmium contents in the tissues were only slightly raised. In the eggs, no cadmium enhancement was noticed.

  11. Effect of lead and cadmium on germination and seedling growth of ...

    African Journals Online (AJOL)

    A study was conducted to determine the effect of different concentrations of lead and cadmium on seed germination and seedling growth of Leucaena leucocephala. Seed were grown under laboratory conditions at 25, 50, 75 and 100 ppm of metal ions of lead and cadmium. Both lead and cadmium treatments showed toxic ...

  12. Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

    Directory of Open Access Journals (Sweden)

    P.B. Lintongan

    2004-06-01

    Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.

  13. Effects of chronic alternating cadmium exposure on the episodic secretion of prolactin in male rats

    Energy Technology Data Exchange (ETDEWEB)

    Esquifino, A.I. [Madrid Univ. (Spain). Facultad de Medicina Complutense; Marquez, N.; Alvarez-Demanuel, E.; Lafuente, A. [Vigo Univ., Orense (Spain). Lab. de Toxicologia

    1998-07-01

    Cadmium increases or decreases prolactin secretion depending on the dose and duration of the exposure to the metal. However, whether there are cadmium effects on the episodic prolactin secretion is less well known. This study was undertaken to address whether chronic alternating exposure to two different doses of cadmium affects the episodic pattern of prolactin and to what extent the effects of cadmium are age-dependent. Male rats were treated s.c. with cadmium chloride (0.5 or 1.0 mg/kg) from day 30 to 60, or from day 60 to 90 of age, with alteration of the doses every 4 days, starting with the smaller dose. Controls received vehicle every 4 days. The last dose of cadmium was given 48 h prior to the pulsatility study. Prolactin secretion in the 4 experimental groups studied was episodic and changed significantly after cadmium exposure. Cadmium administration from day 30 to 60 of life significantly decreased the mean half-life of prolactin. On the other hand, when administered from day 60 to 90 cadmium significantly decreased the mean as well as serum prolactin levels and the absolute amplitude of the prolactin pulses, their duration, the relative amplitude or the mean half-life of the hormone. The frequency of prolactin peaks was not changed by cadmium administration. The results indicate that low intermittent doses of cadmium chronically administered change the episodic secretion pattern of prolactin in rats. The effects of cadmium on prolactin secretion were age dependent. (orig.)

  14. Can calcification predict {sup 131}I accumulation on metastatic lymph nodes in papillary thyroid carcinoma patients receiving {sup 131}I therapy? Comparison of CT, {sup 131}I WBS and {sup 18}F-FDG PET/CT

    Energy Technology Data Exchange (ETDEWEB)

    Kaneko, Koichiro; Abe, Koichiro; Baba, Shingo; Tanabe, Yoshitaka; Yabuuchi, Hidetake; Hatakenaka, Masamitsu; Honda, Hiroshi [Kyushu University, Department of Clinical Radiology, Graduate School of Medical Sciences, Fukuoka (Japan); Sasaki, Masayuki [Kyushu University, Department of Health Sciences, School of Medicine, 3-1-1 Maidashi, Higashi-ku, Fukuoka (Japan)

    2010-02-15

    The aim of this study was to clarify the predictive significance of nodal calcification in terms of the therapeutic option of {sup 131}I therapy in papillary thyroid carcinoma (PTC) patients. We reviewed 19 computed tomography (CT) examinations of PTC patients on receiving {sup 131}I therapy for the presence of nodal calcification, and compared the {sup 131}I whole-body scintigraphy and {sup 18}F-2-fluoro-2-deoxy-D-glucose (FDG) positron emission tomography (PET)/CT findings. The metastatic lymph nodes (mLNs) were divided into three groups: A, those with calcification; B, those without calcification but belonging to patients who had calcified mLNs; C, those without calcification and belonging to patients who had no calcified mLNs. The incidences of {sup 131}I accumulation and maximum standardised uptake values (SUV max) in the three groups were compared. A total of 70 mLNs were evaluated. Twelve mLNs belonged to group A, 13 to group B and 45 to group C. The incidences of {sup 131}I accumulation were significantly higher in groups A (100%) and B (100%) than in group C (11.1%) (p < 0.0001 for both). The SUVmax was significantly lower in groups A (4.1 {+-} 1.9) and B (3.9 {+-} 1.4) than in group C (7.1 {+-} 4.4) (p = 0.01, p = 0.002, respectively). Our results indicated that calcification in mLNs related to the ability of {sup 131}I accumulation and less dedifferentiation. (orig.)

  15. One-Dimensional Fast Transient Simulator for Modeling Cadmium Sulfide/Cadmium Telluride Solar Cells

    Science.gov (United States)

    Guo, Da

    Solar energy, including solar heating, solar architecture, solar thermal electricity and solar photovoltaics, is one of the primary alternative energy sources to fossil fuel. Being one of the most important techniques, significant research has been conducted in solar cell efficiency improvement. Simulation of various structures and materials of solar cells provides a deeper understanding of device operation and ways to improve their efficiency. Over the last two decades, polycrystalline thin-film Cadmium-Sulfide and Cadmium-Telluride (CdS/CdTe) solar cells fabricated on glass substrates have been considered as one of the most promising candidate in the photovoltaic technologies, for their similar efficiency and low costs when compared to traditional silicon-based solar cells. In this work a fast one dimensional time-dependent/steady-state drift-diffusion simulator, accelerated by adaptive non-uniform mesh and automatic time-step control, for modeling solar cells has been developed and has been used to simulate a CdS/CdTe solar cell. These models are used to reproduce transients of carrier transport in response to step-function signals of different bias and varied light intensity. The time-step control models are also used to help convergence in steady-state simulations where constrained material constants, such as carrier lifetimes in the order of nanosecond and carrier mobility in the order of 100 cm2/Vs, must be applied.

  16. Tropospheric Aerosol Radiative Forcing Observational eXperiment - University of Washington instrumented C-131A aircraft Data Set

    Data.gov (United States)

    National Aeronautics and Space Administration — TARFOX_UWC131A is the Tropospheric Aerosol Radiative Forcing Observational eXperiment (TARFOX) - University of Washington instrumented C-131A aircraft data set. The...

  17. Tropospheric Aerosol Radiative Forcing Observational eXperiment - Ames Sun Photometer - University of Washington C-131A aircraft

    Data.gov (United States)

    National Aeronautics and Space Administration — TARFOX_UWC131A_SUNP Data Set was collected from the 6-channel Sun Photometer flown on the University of Washington C-131A aircraft during the Tropospheric Aerosol...

  18. Cytogenetic in thyroid carcinoma and therapy with 131{sup I}; Citogenetica en cancer de tiroides y terapia con 131''I

    Energy Technology Data Exchange (ETDEWEB)

    Popova, L.; Hadjidekova, V.; Christova, R.; Agova, S.; Grudeva, V.; Hadjieva, T.; Dominguez, I.

    2007-07-01

    In order to assess the genotoxic risk of the therapy with radioiodine-131(''131I), the production of micronuclei (MN) and chromosome aberrations (CA) were analyzed in the peripheral blood lymphocytes of group of 26 patients undergoing therapy with this radionuclide for differentiated thyroid carcinoma (DTC). Blood samples were taken immediately before ''131 I administration and 1 month later. The patients underwent radioiodine ablation (RIA) or radioiodine therapy (RIT) after radical thyroidectomy. The amount of orally administered ''131I activity varied from 3330 to 4030 MBq according to the king of therapy (RIA or RIT). results show that after radioiodine therapy there is a significant increase in the frequency of MN and CA. The mean frequencies of MN {+-} Sd before and after the therapy were 10.72 % {+-} 5.84 % and 25.28 %{+-} 12.6% respectively. For CA, the mean frequencies obtained were 1.16% {+-} 0.36% before and 2.3% {+-} 0.87% after the therapy. These findings indicate a genotoxic activity of ''131I therapy estimated after a period of one month. (Author) 38 refs.

  19. Blood Cadmium Concentrations in Women with Ectopic Pregnancy.

    Science.gov (United States)

    Karaer, Abdullah; Tuncay, Gorkem; Tanrikut, Emrullah; Ozgul, Onur

    2017-10-08

    The purpose of this study is to investigate the relationship between the blood level of cadmium and the occurrence of ectopic pregnancy. Forty-one (41) case patients with ectopic pregnancy and 41 uncomplicated intrauterine pregnant patients as controls were recruited. The concentrations of cadmium (Cd) were measured from blood samples using atomic absorption spectrometry. The cases and controls were similar in age, body mass index, and smoking habits. The median blood level of Cd was 0.32 μg/l (interquartile range [IQR] 0.00-0.71) in the women with ectopic pregnancies and 0.34 μg/l (IQR 0.09-0.59) in the controls. There was no significant association between blood cadmium levels and ectopic pregnancy.

  20. Study on removal of cadmium by hybrid liquid membrane process.

    Science.gov (United States)

    Mortaheb, Hamid R; Zolfaghari, Alireza; Mokhtarani, Babak; Amini, Mohammad H; Mandanipour, Valiollah

    2010-05-15

    Removal of cadmium as a hazardous heavy metal is studied by applying a new design of hybrid cell for liquid membrane process. Tri-iso-octyl amine (TIOA) is used as the carrier in the organic phase. The concentration of cadmium in the samples is measured by atomic absorption spectroscopy. The effect of various parameters including type of supporting membrane, pH of feed and stripping phases, initial concentration of cadmium, carrier concentration, solvent nature, and also organic film resistance on mass transfer rate and removal efficiency are studied. The effect of temperature on mass transfer flux is studied by proposing a prediction model. The optimum carrier concentration is found to be about 0.05 M. The appropriate values of pH for feed and stripping phases are about 3 and 13, respectively. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  1. Cadmium toxicity: a possible cause of male infertility in Nigeria.

    Science.gov (United States)

    Akinloye, Oluyemi; Arowojolu, Ayodele O; Shittu, Olayiwola B; Anetor, John I

    2006-03-01

    Serum and seminal plasma cadmium (Cd) concentrations were estimated by atomic absorption spectrophotometry in 60 infertile adult male Nigerians (40 oligozoospermics and 20 azoospermics). The results were compared with Cd level in 40 normozoospermic subjects (matched age, with proven evidence of fertility). The relationship between Cd levels and spermatograms or the hypothalamic-pituitary-gonadal (HPG) -axis was investigated by correlating serum and seminal plasma Cd levels with semen characteristics and hormone levels. The seminal plasma Cd level was significantly higher than those of serum in all studied groups (pcadmium as a cause of infertility in male Nigerians as well as extend and support previous findings concerning cadmium toxicity and male infertility. The strong deleterious effect of cadmium on spermatogenesis may be due to the systemic and cellular toxicity. A possible relationship between this element and the HPG axis is also suggested.

  2. Cadmium-induced oxidative stress in potato tuber

    Directory of Open Access Journals (Sweden)

    Andrzej Stroiński

    2014-01-01

    Full Text Available Short-term treatment of tuber discs of potato (Solanum tuberosum L. with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202 and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP and catalase (CAT was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dismutase (SOD, CAT and AAP was observed and it comes from inactivation of enzymes by cadmium ions. A subsequent activity increase of the enzymes aroused earlier in tolerant tissues. It seems therefore, that tolerant tissues possess a more efficient antioxidative system.

  3. Removal of cadmium by pleurotus sajor-caju basidiomycetes

    Energy Technology Data Exchange (ETDEWEB)

    Cihangir, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Science; Saglam, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Education

    1999-11-01

    The bioaccumulation of cadmium by the white rot fungus Pleurotus sajor-caju onto dry biomass was investigated using aqueous media with concentrations in the range of 0.125 mM-1.0 mM. The highest cadmium uptake (between 88.9 and 91.8%) was observed with aerobic fungal biomass from the exponential growth phase. Up to 1.0 mM cadmium gradually inhibited mycelium development, but never blocked it completely. Freeze-dried, oven-dried and non-metabolizing live Pleurotus sajor-caju biomass types were tested for their capacity to adsorb the test ion Cd{sup 2+} within the pH range of 4.5 to 6.0. Freeze-dried biomass proved to be the most efficient biomass type for Cd{sup 2+} metal adsorption. Therefore, Pleurotus sajor-caju may be used for heavy metal removal and bioremediation. (orig.)

  4. Analysis Of The Underpotential Deposition Of Cadmium On Copper

    Directory of Open Access Journals (Sweden)

    Kowalik R.

    2015-09-01

    Full Text Available In this study the process of deposition of cadmium on polycrystalline copper electrode in sulfate solution was investigated. The process of underpotential and bulk deposition was analyzed by classical electrochemical method: cyclic voltammetry(CV, anodic stripping voltammetry(ASV and electrochemical quartz crystal microbalance(EQCM. The obtained results were compared with electrochemical impedance spectroscopy(EIS measurements. CV, EQCM and EIS results suggest that the UPD of cadmium starts below potential −0.4 V vs Ag/AgCl. Additionally the stripping analysis indicates the formation of cadmium monolayer with different density of deposited atoms depending on the applied potential. The transition from UPD to bulk deposition occurs below potential −0,7 V.

  5. Protection against {sup 131}I-induced Double Strand DNA Breaks in Thyroid Cells

    Energy Technology Data Exchange (ETDEWEB)

    Hershman, J.M.; Okunyan, A.; Cannon, S.; Hogen, V. [Endocrinology, UCLA-VA, Los Angeles (United States); Rivina, Y. [Radiation Biology, UCLA, Los Angeles (United States)

    2012-07-01

    Radioiodine-131 (I{sup 131}) released from nuclear reactor accidents has dramatically increased the incidence of papillary thyroid cancer in exposed individuals, especially young children. The accepted measure for prevention of radiation-induced thyroid cancer is potassium iodide tablets that contain 100 mg iodide taken daily to block thyroid uptake of I{sup 131}. The deposition of ionizing radiation in cells results in double-strand DNA breaks (DSB) at fragile sites, and this early event can generate oncogenic rearrangements that eventually cause the cancer. We have developed a thyroid cell model to quantify the mitogenic effect of I{sup 131}. I{sup 131} causes double strand DNA breaks in FRTL-5 cells detected by 53BP1 or gamma H2AX and had no effect on cells that do not transport iodide. Perchlorate, iodide, and thiocyanate protect against DSB induced by I{sup 131}. Preincubation with the anion or radioprotective compounds prevents DSB; delayed addition of the anion is much less effective. These data provide a basis for studies of radioprotection against DSB induced by I{sup 131} in animals in order to refine the prevention of thyroid cancer resulting from nuclear fallout

  6. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Jeekeeree, Wanpen [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Funkhiew, Thippawan [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Sanjum, Rungaroon; Apiwatpaiboon, Thitikarn [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Phopueng, Ittipol [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)

    2015-01-15

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β{sub 2}-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β{sub 2}-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β{sub 2}-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β{sub 2}-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children.

  7. 131I-Traced PLGA-Lipid Nanoparticles as Drug Delivery Carriers for the Targeted Chemotherapeutic Treatment of Melanoma

    Science.gov (United States)

    Wang, Haiyan; Sheng, Weizhong

    2017-05-01

    Herein, folic acid (FA) conjugated Poly(d,l-lactide-co-glycolide) (PLGA)-lipid composites (FA-PL) were developed as nanocarriers for the targeted delivery of insoluble anti-cancer drug paclitaxel (PTX), resulting FA-PLP nanoparticles. Furthermore, 131I, as a radioactive tracer, was used to label FA-PLP nanoparticles (FA-PLP-131I) to evaluate their cell uptake activity, in vivo blood circulation, and biodistribution. The FA-PLP-131I nanoparticles had a spherical morphology with great stability, a narrow size distribution (165.6 and 181.2 nm), and -22.1 mV in average zeta potential. Confocal laser scanning microscopy indicated that the targeting molecule FA promotes PLP-131I uptake by melanoma B16F10 cells, which was further confirmed by the cell incorporation rate via 131I activity detection as measured by a gamma counter. FA-PLP-131I without PTX (FA-PL-131I) shows minor cytotoxicity, good biocompatibility, while FA-PLP-131I was demonstrated to have efficient cell viability suppression compared to free PTX and PLP-131I. Following intravenous injection, the blood circulation half-life of free PTX ( t 1/2 = 5.4 ± 0.23 h) was prolonged to 18.5 ± 0.5 h by FA-PLP-131I. Through FA targeting, the tumor uptake of FA-PLP-131I was approximately 4.41- and 12.8-fold higher compared to that of PLP-131I and free PTX-131I, respectively. Moreover, following 40 days of treatment, FA-PLP-131I showed an improved tumor inhibition effect compared to free PTX and PLP-131I, with no relapse and no remarkable systemic in vivo toxicity. The results demonstrate that the 131I-labeled PLGA-lipid nanoparticle can be simultaneously applied for targeted drug delivery and reliable tracking of drugs in vivo.

  8. {sup 131}I treatment for thyroid cancer and risk of developing primary hyperparathyroidism: a cohort study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chien-Mu [Taipei Medical University - Shuang Ho Hospital, Department of Nuclear Medicine, Taipei (China); Taipei Medical University, Department of Radiology, College of Medicine, Taipei (China); Doyle, Pat [London School of Hygiene and Tropical Medicine, Faculty of Epidemiology and Population Health, London (United Kingdom); Tsan, Yu-Tse [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); Taichung Veterans General Hospital, Department of Emergency Medicine, Taichung (China); Chung Shan Medical University, School of Medicine, Taichung (China); Lee, Chang-Hsing [Ton Yen General Hospital, Department of Occupational Medicine, Hsinchu County (China); Wang, Jung-Der [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); National Cheng Kung University College of Medicine, Department of Public Health, Tainan (China); Chen, Pau-Chung [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); National Taiwan University College of Public Health, Department of Public Health, Taipei (China); National Taiwan University College of Medicine and Hospital, Department of Environmental and Occupational Medicine, Taipei (China); Collaboration: Health Data Analysis in Taiwan (hDATa) Research Group

    2014-02-15

    To evaluate the association between {sup 131}I therapy for thyroid cancer and risk of developing primary hyperparathyroidism. This was a nationwide population-based cohort study of patients with thyroid cancer diagnosed during the period 1997-2008. The data were obtained from the Taiwan National Health Insurance Research dataset. The cumulative {sup 131}I dose in each patient was calculated. Hazard ratios (HRs) were calculated using a proportional hazards model to estimate the effect of {sup 131}I therapy on the risk of developing primary hyperparathyroidism in the cohort. A total of 8,946 patients with thyroid cancer were eligible for the final analysis. Among these patients, 8 developed primary hyperparathyroidism during the follow-up period that represented 38,248 person-years giving an incidence rate of 20.9 per 10{sup 5} person-years. {sup 131}I was used in the treatment of 6,153 patients (68.8 %) with a median cumulative dose of 3.7 GBq. The adjusted HRs were 0.21 (95% CI 0.02-1.86) and 0.46 (95% CI 0.10-2.10) for those receiving a cumulative {sup 131}I dose of 0.1-3.6 GBq and ≥3.7 GBq, respectively, compared to no therapy. The risk of developing primary hyperparathyroidism did not increase with increasing {sup 131}I dose (test for trend p = 0.51). No interaction was found between {sup 131}I dose and age (p = 0.94) or {sup 131}I dose and sex (p = 0.99). {sup 131}I treatment for thyroid cancer did not increase risk of primary hyperparathyroidism during a 10-year follow-up in this study population. Further research with a longer follow-up period is needed to assess late adverse effects beyond 10 years. (orig.)

  9. 131I treatment for thyroid cancer and risk of developing primary hyperparathyroidism: a cohort study.

    Science.gov (United States)

    Lin, Chien-Mu; Doyle, Pat; Tsan, Yu-Tse; Lee, Chang-Hsing; Wang, Jung-Der; Chen, Pau-Chung

    2014-02-01

    To evaluate the association between (131)I therapy for thyroid cancer and risk of developing primary hyperparathyroidism. This was a nationwide population-based cohort study of patients with thyroid cancer diagnosed during the period 1997-2008. The data were obtained from the Taiwan National Health Insurance Research dataset. The cumulative (131)I dose in each patient was calculated. Hazard ratios (HRs) were calculated using a proportional hazards model to estimate the effect of (131)I therapy on the risk of developing primary hyperparathyroidism in the cohort. A total of 8,946 patients with thyroid cancer were eligible for the final analysis. Among these patients, 8 developed primary hyperparathyroidism during the follow-up period that represented 38,248 person-years giving an incidence rate of 20.9 per 10(5) person-years. (131)I was used in the treatment of 6,153 patients (68.8%) with a median cumulative dose of 3.7 GBq. The adjusted HRs were 0.21 (95% CI 0.02-1.86) and 0.46 (95% CI 0.10-2.10) for those receiving a cumulative (131)I dose of 0.1-3.6 GBq and ≥3.7 GBq, respectively, compared to no therapy. The risk of developing primary hyperparathyroidism did not increase with increasing (131)I dose (test for trend p = 0.51). No interaction was found between (131)I dose and age (p = 0.94) or (131)I dose and sex (p = 0.99). (131)I treatment for thyroid cancer did not increase risk of primary hyperparathyroidism during a 10-year follow-up in this study population. Further research with a longer follow-up period is needed to assess late adverse effects beyond 10 years.

  10. THERAPY OF GRAVES’ DISEASE WITH SODIUM IODIDE-131

    Directory of Open Access Journals (Sweden)

    I Wayan Hartadi Noor

    2013-11-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Graves’ disease is the most common form of thyrotoxicosis, with a peak incidence in the 20-40 year of age group. Females are involved about five times more commonly than male. The easiest sign to recognize patients with Graves’ disease is the present of Graves’ ophthalmopathy. The diagnosis of Graves’ disease may sometimes base only on a physical examination and a medical history. Diffuse thyroid enlargement and sign of thyrotoxicosis, mainly ophthalmopathy and to lesser extent dermopathy, usually adequate for diagnosis. TSH test combined with FT4 test is usually the first laboratory test performs in these patients. The patients suffered Graves’ disease can be treated with antithyroid drug therapy or undergo subtotal Thyroidectomy. Another therapy is by using sodium iodide-131, where this therapy has advantages including easy administration, effectiveness, low expense, and absence of pain. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  11. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S

    2002-01-01

    The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose of the st......The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose....... Experience from cadmium-poisoned humans and laboratory mammals indicates that concentrations above 50-200 microg/g wet wt. may induce histopathological changes. Overall, 31 of the ringed seals had cadmium concentrations in the kidney cortex above 50 microg/g wet wt., 11 had concentrations above 100 and one...

  12. A Model of Cadmium Uptake and Transport in Caco-2 Cells.

    Science.gov (United States)

    Gerasimenko, T N; Senyavina, N V; Anisimov, N U; Tonevitskaya, S A

    2016-05-01

    We created a physiologically substantiated kinetic model of cadmium transport and toxicity in intestinal cell model (Caco-2 cells). Transcriptome profiling of Caco-2 cells revealed high content of transporter DMT1 and ZIP14 and intensive expression of some calcium channels of the CACN family. The mathematical model describing three types of transporters, as well as intracellular cadmium binding with metallothionein and excretion through the basolateral membrane allowed us to construct cadmium uptake and transport curves that approximated the previously obtained experimental data. Using the proposed model, we determined toxic intracellular cadmium concentration leading to cell death and impairing the integrity of cell monolayer and described cadmium transport in this case.

  13. Zinc-Nickel Codeposition in Sulfate Solution Combined Effect of Cadmium and Boric Acid

    Directory of Open Access Journals (Sweden)

    Y. Addi

    2011-01-01

    Full Text Available The combined effect of cadmium and boric acid on the electrodeposition of zinc-nickel from a sulfate has been investigated. The presence of cadmium ion decreases zinc in the deposit. In solution, cadmium inhibits the zinc ion deposition and suppresses it when deposition potential value is more negative than −1.2 V. Low concentration of CdSO4 reduces the anomalous nature of Zn-Ni deposit. Boric acid decreases current density and shifts potential discharge of nickel and hydrogen to more negative potential. The combination of boric acid and cadmium increases the percentage of nickel in the deposit. Boric acid and cadmium.

  14. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador.

    Science.gov (United States)

    Chavez, E; He, Z L; Stoffella, P J; Mylavarapu, R S; Li, Y C; Moyano, B; Baligar, V C

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg(-1)) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0-5, 5-15, 15-30, and 30-50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg(-1), respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg(-1). Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg(-1)), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans>shell>leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg(-1), and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0-5 and 5-15 cm depths (r=0.80 and 0.82 for M3, and r=0.78 and 0.82 for HCl; P<0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: zhe@ufl.edu [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  16. Potentiation of cadmium nephrotoxicity by acetaminophen

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, A.M.; Russis, R. de; Ouled Amor, A.; Lauwerys, R.R.

    1988-10-01

    The possible interactions between acetaminophen and cadmium (Cd) on the kidney were investigated in female Sprague-Dawley rats. Acetaminophen was administered in the food at an average dose of 900 mg/kg and Cd in drinking water at the concentration of 200 ppm. The treatment with acetaminophen and Cd lasted 2 and 10 months, respectively. No interaction between Cd and acetaminophen was observed during the period of their concomitant administration: the increase in albuminuria caused by Cd and acetaminophen was additive, while the tubular impairment caused by acetaminophen (increased ..beta../sub 2/-microglobulinuria and decreased kidney concentrating ability) was not exacerbated by Cd. None of these treatments affected the glomerular filtration rate. Four months after the end of acetaminophen treatment, the renal changes had almost completely disappeared in the rats which had received the analgesic alone. Those continously exposed to Cd had developed slight tubular damage, as evidenced by an increased urinary excretion of ..beta../sub 2/-microglobulin and ..beta..-N-acetylglucosaminidase. By contrast, rats pretreated with acetaminophen for 2 months and exposed to Cd showed a marked increase in urinary excretion of albumin and ..beta../sub 2/-microglobulin, suggesting an interaction between both treatments. At the end of the study, only the interaction with ..beta../sub 2/-microglobulin excretion was still evident; that with the urinary excretion of ..beta..-N-acetylglucosaminidase and albumin having been masked by the chronic progessive nephrosis affecting most animals at that stage. As acetaminophen had no effect on the renal accumulation of Cd, it may be concluded that pretreatment with this analygesic at a dose causing slight tubular dysfunction renders rat kidney more sensitive to the nephrotoxic action of Cd. This observation may be of clinical relevance for population groups occupationally or environmentally exposed to Cd.

  17. Cadmium Concentration in Human Autopsy Tissues.

    Science.gov (United States)

    Lech, Teresa; Sadlik, Józefa K

    2017-10-01

    The concentration of cadmium in human tissues obtained on the basis of autopsies of non-poisoned Polish people (n = 150), aged from 1 to 80 years, examined between 1990 and 2010, is presented. The following values were found in wet digested samples by flame atomic absorption spectrometry (FAAS) (mean ± SD, median, and range, μg/g of wet weight): brain 0.020 ± 0.031, 0.084, 0-0.120 (n = 41); stomach 0.148 ± 0.195, 0.084, 0-1.25 (n = 89); small intestine 0.227 ± 0.231, 0.130, 0-0.830 (n = 39); liver 1.54 ± 1.55, 1.01, 0.015-9.65 (n = 99); kidney 16.0 ± 13.2, 14.0, 0.62-61.3 (n = 91); lung 0.304 ± 0.414, 0.130, 0-1.90 (n = 25); and heart 0.137 ± 0.107, 0.140, 0.017-0.250 (n = 4). Additionally, results (n = 13 people, aged from 2 to 83 years, 63 samples) obtained by inductively coupled plasma optical emission spectrometry (ICP OES) between 2010 and 2015 are given. The obtained data on Cd concentration in the human body can be used to estimate the amounts occurring in "healthy" people and those occurring in cases of chronic or acute poisonings with Cd compounds, which are examined for forensic purposes or to assess environmental exposure levels.

  18. Determination of mercury, cadmium, lead, zinc, selenium and iron by ICP-OES in mushroom samples from around thermal power plant in Muğla, Turkey.

    Science.gov (United States)

    Kula, Ibrahim; Solak, M Halil; Uğurlu, Mehmet; Işıloğlu, Mustafa; Arslan, Yasin

    2011-09-01

    Scleroderma verrucosum, Stropharia coronilla, Lactarius deterrimus, Chroogomphus rutilus, Russula delica, Laccaria laccata, Clitocybe odora var. alba, Lyophyllum decastes, Coprinus comatus, Helvella leucomelaena, Melanoleuca cognata, Melanoleuca cognata, Paxina acetabulum, Clitocybe vermicularis, Sarcosphaera crassa, Rhizopogon roseolu and Thelephora caryophyllea were collected from different localities in Muğla-Yatağan region of Turkey. Their trace metals concentrations were determined by ICPOES after microwave digestion. The results were 0.37 ± 0.01-5.28 ± 0.21 for cadmium, 467 ± 19-3,280 ± 131 for iron, 0.69 ± 0.03-9.15 ± 0.37 for lead, 18.70 ± 0.75-67.10 ± 2.68 for selenium, 75 ± 3-213 ± 8 for zinc and 0.15 ± 0.01-0.55 ± 0.01 for mercury (as μg/g). The detection limits for ICPOES were found as 0.25 for Cadmium, 0.2 for iron, 0.1 for lead, 0.5 for selenium, 0.2 for zinc and 0.03 for mercury (as mg L(-1)). The Relatively Standard Deviations (R.S.D.) were found below 4.0%. The accuracy of procedure was confirmed by certified reference material.

  19. Precision mass measurements for studies of nucleosynthesis via the rapid neutron-capture process. Penning-trap mass measurements of neutron-rich cadmium and caesium isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Atanasov, Dinko

    2016-07-06

    Although the theory for the rapid neutron-capture process (r-process) was developed more than 55 years ago, the astrophysical site is still under a debate. Theoretical studies predict that the r-process path proceeds through very neutron-rich nuclei with very asymmetric proton-to-neutron ratios. Knowledge about the properties of neutron-rich isotopes found in similar regions of the nuclear chart and furthermore suitable for r-process studies is still little or even not existing. The basic nuclear properties such as binding energies, half-lives, neutron-induced or neutron-capture reaction cross-sections, play an important role in theoretical simulations and can vary or even drastically alternate results of these studies. Therefore, a considerable effort was put forward to access neutron-rich isotopes at radioactive ion-beam facilities like ISOLDE at CERN. The goal of this PhD thesis is to describe the experimental work done for the precision mass measurements of neutron-rich cadmium ({sup 129-131}Cd) and caesium ({sup 132,146-148}Cs) isotopes. Measurements were done at the on-line radioactive ion-beam facility ISOLDE by using the four-trap mass spectrometer ISOLTRAP. The cadmium isotopes are key nuclides for the synthesis of stable isotopes around the mass peak A = 130 in the Solar System abundance.

  20. [Physiological response and bioaccumulation of Panax notoginseng to cadmium under hydroponic].

    Science.gov (United States)

    Li, Zi-wei; Yang, Ye; Cui, Xiu-ming; Liao, Pei-ran; Ge, Jin; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui

    2015-08-01

    The physiological response and bioaccumulation of 2-year-old Panax notoginseng to cadmium stress was investigated under a hydroponic experiment with different cadmium concentrations (0, 2.5, 5, 10 μmol · L(-1)). Result showed that low concentration (2.5 μmol · L(-1)) of cadmium could stimulate the activities of SOD, POD, APX in P. notoginseng, while high concentration (10 μmol · L(-1)) treatment made activities of antioxidant enzyme descended obviously. But, no matter how high the concentration of cadmium was, the activities of CAT were inhibited. The Pn, Tr, Gs in P. notoginseng decreased gradually with the increase of cadmium concentration, however Ci showed a trend from rise to decline. The enrichment coefficients of different parts in P. notoginseng ranked in the order of hair root > root > rhizome > leaf > stem, and all enrichment coefficients decreased with the increase of concentration of cadmium treatments; while the cadmium content in different parts of P. notoginseng and the transport coefficients rose. To sum up, cadmium could affect antioxidant enzyme system and photosynthetic system of P. notoginseng; P. notoginseng had the ability of cadmium enrichment, so we should plant it in suitable place reduce for reducing the absorption of cadmium; and choose medicinal parts properly to lessen cadmium intake.

  1. Sexual dimorphism of cadmium-induced toxicity in rats: involvement of sex hormones.

    Science.gov (United States)

    Shimada, Hideaki; Hashiguchi, Takashi; Yasutake, Akira; Waalkes, Michael P; Imamura, Yorishige

    2012-09-01

    The toxic effect of cadmium varies with sex in experimental animals. Previous studies have demonstrated that pretreatment of male Fischer 344 (F344) rats with the female sex hormone progesterone markedly enhances the susceptibility to cadmium, suggesting a role for progesterone in the sexual dimorphism of cadmium toxicity. In the present study, we attempted to further elucidate the mechanism for sex differences in cadmium-induced toxicity in F344 rats. A single exposure to cadmium (5.0 mg Cd/kg, sc) was lethal in 10/10 (100 %) female compared with 6/10 (60 %) male rats. Using a lower dose of cadmium (3.0 mg Cd/kg), circulating alanine aminotransferase activity, indicative of hepatotoxicity, was highly elevated in the cadmium treated females but not in males. However, no gender-based differences occurred in the hepatic cadmium accumulation, metallothionein or glutathione levels. When cadmium (5.0 mg Cd/kg) was administered to young rats at 5 weeks of age, the sex-related difference in lethality was minimal. Furthermore, although ovariectomy blocked cadmium-induced lethality, the lethal effects of the metal were restored by pretreatment with progesterone (40 mg/kg, sc, 7 consecutive days) or β-estradiol (200 μg/kg, sc, 7 consecutive days) to ovariectomized rats. These results provide further evidence that female sex hormones such as progesterone and β-estradiol are involved in the sexual dimorphism of cadmium toxicity in rats.

  2. Cadmium determination in urine by atomic absorption spectrometry as a screening test in industrial medicine

    Science.gov (United States)

    Lehnert, G.; Klavis, G.; Schaller, K. H.; Haas, T.

    1969-01-01

    Lehnert, G., Klavis, G., Schaller, K. H., and Haas, T. (1969).Brit. J. industr. Med.,26, 156-158. Cadmium determination in urine by atomic absorption spectrometry as a screening test in industrial medicine. Cadmium was determined by atomic absorption spectrometry in the urine and serum of 18 workers exposed to cadmium dust and fume in a zinc smelting plant. In all cases the concentrations of cadmium in the serum were within the normal range, but those in the urine were elevated. The elevated urine concentrations showed that the exposed group had taken up more cadmium than normal, although they showed no clinical symptoms of cadmium poisoning. Analysis of urine for cadmium is therefore of value in preventive medicine, and should be used for periodic check-ups on those occupationally exposed. PMID:5780108

  3. Antagonism between cadmium and magnesium: a possible role of magnesium in therapy of cadmium intoxication.

    Science.gov (United States)

    Matović, Vesna; Plamenac Bulat, Zorica; Djukić-Cosić, Danijela; Soldatović, Danilo

    2010-03-01

    One of the important mechanisms of cadmium (Cd) toxicity is its interactions with bioelements, including magnesium (Mg). Exposure to Cd leads to disturbances in Mg metabolism in the organism, while Mg supplementation has an adverse effect on Cd absorption, accumulation and toxicity. According to the available results, which indicate a protective role of Mg against Cd toxicity, it remains to be seen whether magnesium may influence the important unsolved problem of Cd intoxication therapy. In this review, the interactions between the toxic metal Cd and the bioelement Mg are discussed on the basis of the available literature and our own results. We discuss these interactions mainly based on experimental data because data from human studies are scarce.

  4. Cadmium and cadmium-tolerant soil bacteria in cacao crops from northeastern Colombia.

    Science.gov (United States)

    Bravo, D; Pardo-Díaz, S; Benavides-Erazo, J; Rengifo-Estrada, G; Braissant, O; Leon-Moreno, C

    2018-01-18

    This research aims to assess total-cadmium soil content and microbiological aspects to understand the dynamics of culturable cadmium-tolerant bacteria (CdtB) in cacao soils from northeastern Colombia. An integration of inverted dish plating, Cd determination and a microcalorimetry assay (IMC) was carried out. A farm in Boyacá showed the highest level of total soil Cd (3·74 mg kg -1 ) followed by farms in Santander and Arauca (2·76 and 1·16 mg kg -1 , respectively). Coefficient of determination between total soil Cd and CFU of CdtB was high (R 2  = 0·83) for the farm in Boyacá. Moreover, a pool of 129 CdtB was isolated, and phylogeny of 21 CdtB was discussed. Among CdtB strains isolated, Enterobacter sp. CdDB41 showed major Cd immobilization capacity (Q max of 2·21 and 2·32 J at 6 and 24 mg l -1 of CdCl 2 ), with an immobilization rate of 0·220 mg kg -1  h -1 . Among CdtB strains isolated, Enterobacter sp. CdDB41 showed major Cd immobilization capacity (Q max of 2·21 and 2·32 J at 6 and 24 mg l -1 of CdCl 2 ), with an immobilization rate of 0·220 mg kg -1  h -1 . Nothing is known about soil CdtB in cacao. Our data showed that CdtB such as Enterobacter sp. has high immobilization capacity. Furthermore, the otavite found in situ might be mineralized due to the bacterial metabolic activity of CdtB. © 2018 The Society for Applied Microbiology.

  5. Future trends in soil cadmium concentration under current cadmium fluxes to European agricultural soils.

    Science.gov (United States)

    Six, L; Smolders, E

    2014-07-01

    The gradual increase of soil cadmium concentrations in European soils during the 20th century has prompted environmental legislation to limit soil cadmium (Cd) accumulation. Mass balances (input-output) reflecting the period 1980-1995 predicted larger Cd inputs via phosphate (P) fertilizers and atmospheric deposition than outputs via crop uptake and leaching. This study updates the Cd mass balance for the agricultural top soils of EU-27+Norway (EU-27+1). Over the past 15 years, the use of P fertilizers in the EU-27+1 has decreased by 40%. The current mean atmospheric deposition of Cd in EU is 0.35 g Cd ha(-1) yr(-1), this is strikingly smaller than values used in the previous EU mass balances (~3 g Cd ha(-1) yr(-1)). Leaching of Cd was estimated with most recent data of soil solution Cd concentrations in 151 soils, which cover the range of European soil properties. No significant time trends were found in the data of net applications of Cd via manure, compost, sludge and lime, all being small sources of Cd at a large scale. Modelling of the future long-term changes in soil Cd concentrations in agricultural top soils under cereal or potato culture predicts soil Cd concentrations to decrease by 15% over the next 100 years in an average scenario, with decreasing trends in some scenarios being more prevalent than increasing trends in other scenarios. These Cd balances have reverted from the general positive balances estimated 10 or more years ago. Uncertainty analysis suggests that leaching is the most uncertain relative to other fluxes. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Radiosensitive effect of curcumin on thyroid cancer cell death induced by radioiodine-131

    Directory of Open Access Journals (Sweden)

    Hosseinimehr Seyed Jalal

    2014-06-01

    Full Text Available Curcumin is a natural product widely consumed by humans. It has many biological properties. In this study, we investigated the radiosensitive effect of curcumin on thyroid cancer cells against cellular toxicity induced by 131-I. Human thyroid cancer and human non-malignant fibroblast cells (HFFF2 were treated with 131-I and/or curcumin at different concentrations (5, 10 and 25 μg/ml for 48 h. The cell proliferation was measured by determination of the surviving cells by using MTT assay. Our results showed that curcumin increased the killing effect of 131-I on thyroid cancer cells, while it exerted no toxicity on HFFF2 cells. This result shows a promising effect of curcumin on the enhancement of therapeutic effects of 131-I in patients

  7. Cystic thyroid mass following I-131 treatment of papillary thyroid carcinoma: An unusual complication

    Energy Technology Data Exchange (ETDEWEB)

    Morrish, D.W.; Jackson, F.I.; Lalani, Z.H.; Catz, Z.; Sloboda, R. (Univ. of Alberta, Edmonton (Canada))

    1989-12-01

    Several unusual complications of I-131 therapy for thyroid carcinoma are known. Two patients who developed a further unusual event that consisted of a palpable mass and cystic degeneration are described.

  8. Cadmium and zinc accumulation in soybean: A threat to food safety?

    Energy Technology Data Exchange (ETDEWEB)

    Shute, Tracy [Department of Biology, University of Western Ontario, London, ON N6A 5B7 (Canada); Macfie, Sheila M. [Department of Biology, University of Western Ontario, London, ON N6A 5B7 (Canada)]. E-mail: smacfie@uwo.ca

    2006-12-01

    A greenhouse study was conducted to quantify cadmium and zinc accumulated by soybean (Glycine max (L.) Merr.) when the metals were supplied separately and together. The highest dose of cadmium (100 mg/kg) reduced plant height and dry weight (down to 40% and 34% of control, respectively); the highest dose of zinc (2000 mg/kg) reduced plant height to 55% of control and dry weight to 70% of control. With both metals present, the plants were approximately the same size as those treated with cadmium only. The concentration of cadmium in the roots was unaffected by zinc. In other tissues, the effect of zinc on the accumulation of cadmium depended on the doses provided. At low doses, the addition of zinc reduced the concentration of cadmium in aboveground tissues to 40-50% of that found in plants exposed to cadmium only. However, when applied in high doses, the presence of zinc in cadmium-contaminated soils increased the uptake and accumulation of cadmium in aboveground tissues by up to 42%. In contrast, at high doses, the presence of cadmium in zinc-contaminated soil resulted in approximately 35% lower concentrations of zinc in all tissues. At a lower dose, cadmium had no effect on concentration of zinc in the plant tissues. The effects of high doses of one metal on the uptake of the other metal can be partially explained by the effects of one metal on the bioavailability of the other metal. In soils to which only one metal was added, bioavailable cadmium was 70-80% of the total cadmium, and bioavailable zinc was 50-70% of the total zinc. When both metals were added to the soil, 80-100% of the cadmium and 46-60% of the zinc were bioavailable. Concentrations of both metals were highest in root tissues (10-fold higher for cadmium, and up to 2-fold higher for zinc). Although relatively little cadmium was translocated to pods and seeds, the seeds of all plants (including those from control and zinc-treated plants) had concentrations of cadmium 3-4 times above the limit of 0

  9. The presynaptic Munc13-1 binds alcohol and modulates alcohol self-administration in Drosophila

    Science.gov (United States)

    Das, Joydip; Xu, Shiyu; Pany, Satyabrata; Guillory, Ashley; Shah, Vrutant; Roman, Gregg W.

    2013-01-01

    Munc13-1 is a presynaptic active-zone protein essential for neurotransmitter release and involved in presynaptic plasticity in brain. Ethanol, butanol and octanol quenched the intrinsic fluorescence of the C1 domain of Munc13-1 with EC50s of 52 mM, 26 mM and 0.7 mM, respectively. Photoactive azialcohols photolabeled Munc13-1 C1 exclusively at Glu-582, which was identified by mass spectrometry. Mutation of Glu-582 to alanine, leucine and histidine reduced the alcohol binding two- to five-fold. Circular dichroism studies suggested that binding of alcohol increased the stability of the wild type Munc13-1 compared with the mutants. If Munc13-1 plays some role in the neural effects of alcohol in vivo, changes in the activity of this protein should produce differences in the behavioral responses to ethanol. We tested this prediction with a loss-of-function mutation in the conserved Dunc-13 in Drosophila melanogaster. The Dunc-13P84200/+ heterozygotes have 50% wild type levels of Dunc-13 mRNA and display a very robust increase in ethanol self-administration. This phenotype is reversed by the expression of the rat Munc13-1 protein within the Drosophila nervous system. The present studies indicate that Munc13-1 C1 has binding site(s) for alcohols and Munc13-1 activity is sufficient to restore normal self-administration to Drosophila mutants deficient in Dunc-13 activity. PMID:23692447

  10. Comparative Analysis of Direct and Indirect 131I Measurement Methods from the Stack to Outdoor

    Directory of Open Access Journals (Sweden)

    G. Suhariyono

    2017-11-01

    Full Text Available The radioisotope production facility at PUSPIPTEK Serpong produces and processes 131I that can disperse to the settlements (community and the environment around the Serpong Nuclear Area (SNA. 131I is produced routinely for medical uses in hospitals and pharmacies, for both domestic uses and export. 131I is a beta and gamma emitting radioactive material and can cause thyroid cancer. The problem was that there was so far no research and in-depth assessment of the aerial dispersion of 131I radioactivity emitted from the radioisotope production stack to the environment at actual conditions. The research was conducted through simultaneous measurement of 131I radioactivity in the stack of the 131I radioisotope production facility, Serpong, and outdoor in house courtyards around SNA in normal condition (no accident based on the variations of the distance and wind direction. Direct measurements were carried out with a portable in-situ NaI(Tl detector at outdoor, and with a LaBr3 detector in the stack. Indirect measurements were carried out by using charcoal filter and vacuum pump in the stack and outdoor. The direct measurement method has many advantages over the indirect measurement. The direct measurement method was found to be more accurate, less expensive, easier to operate, needing just one operator in its implementation, portable, and can be operated continuously and for long durations. The overall activity concentrations of 131I on average obtained by either direct or indirect method were still below the upper limit of 131I activity concentration in the air (530 Bq/m3 stipulated by the Regulation of the Chairman of BAPETEN (Perka BAPETEN No. 7/2013. 

  11. Uso do TSH recombinante humano no tratamento do bócio multinodular com iodo 131

    OpenAIRE

    Mesa Júnior, Cléo Otaviano; Graf, Hans

    2003-01-01

    Orientador : Hans Graf Dissertaçao (mestrado) - Universidade Federal do Paraná, Setor de Ciencias da Saúde Resumo: O uso do iodo 131 (131l) no tratamento de pacientes com bocio multinodular (BMN) ja esta bem estabelecido, porem devido as baixas captacoes de 1311 destes bocios, geralmente sao necessarias altas doses terapeuticas de iodo radioativo. Este estudo tem como objetivos verificar em pacientes com BMN, apos uso de TSH recombinante humano (rhTSH - recombinant human TSH), o aumento...

  12. Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131

    Science.gov (United States)

    2014-05-01

    solution, and a pit is subsequently formed. Dislocation of the particle may have been facilitated by the AFM tip, formation of corrosion products, or...Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131 by Joseph P. Labukas and Kenneth E. Strawhecker ARL-TR-6925 May...Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131 Joseph P. Labukas and Kenneth E. Strawhecker Weapons and Materials

  13. 32 CFR 935.131 - Right-hand side of the road.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Right-hand side of the road. 935.131 Section 935... INSULAR REGULATIONS WAKE ISLAND CODE Motor Vehicle Code § 935.131 Right-hand side of the road. Each person driving a motor vehicle on Wake Island shall drive on the right-hand side of the road, except where...

  14. Purification of cadmium up to 5N+ by vacuum distillation

    Indian Academy of Sciences (India)

    Cadmium was refined by vacuum distillation, a technique suitable for low boiling and melting point materials, to remove the heavy and low vapour pressure impurities at ppm level. The detailed analysis of the purified Cd as well as raw Cd was done by ICP–OES techniques for 27 impurity elements. Purification was carried ...

  15. Cadmium induced oxidative stress in Dunaliella salina | Moradshahi ...

    African Journals Online (AJOL)

    The unicellular green algae Dunaliella salina contains various antioxidants which protect the cell from oxidative damage due to environmental stresses such as heavy metal stress. In the present study, the response of D. salina at the stationary growth phase to oxidative stress generated by cadmium chloride was ...

  16. Mechanism of cadmium ion removal by base treated juniper fiber

    Science.gov (United States)

    Soo-Hong Min; J.K. Park; James S. Han; Eun Woo Shin

    2003-01-01

    Pinyon juniper, Juniperus Monosperma, is a small-diameter and underutilized (SDU) lignocellulosic material. Evaluated were efficacy of base-treated juniper fiber (BTJF) sample for cadmium (Cd 2+ ) sorption and the viability of juniper fiber as a sorbent for the removal of Cd 2+ from water. Fourier Transform Infrared Spectroscopy (FTIR) analysis indicated that...

  17. Optical characterisation of thin film cadmium oxide prepared by a ...

    African Journals Online (AJOL)

    The optical transmission spectra of transparent conducting cadmium oxide (CdO) thin films deposited by a modified reactive evaporation process onto glass substrates have been measured. The interference fringes were used to calculate the refractive index, thickness variation, average thickness and absorption coefficient ...

  18. Homogeneity and Magnetic Susceptibility in Some Substituted Cadmium Spinels,

    Science.gov (United States)

    1983-11-25

    the excess cadmium was removed. Analysis of the rhodium complex precursor was performed by reduction under flowing 85% argon/1S% hydrogen at 500C...Acta Cryst. B25, 925 (1969). 11. P.W. Selwood, " Magnetochemistry " 2nd ed., Interscience: New York, 1956, p. 78. *l m .. .. ...- 5 -10- TABLE I

  19. Cadmium translocation and accumulation in developing barley grains

    DEFF Research Database (Denmark)

    Chen, Fei; Wu, Feibo; Dong, Jing

    2007-01-01

     Soil cadmium (Cd) contamination has posed a serious problem for safe food production and become a potential agricultural and environmental hazard worldwide. In order to study the transport of Cd into the developing grains, detached ears of two-rowed barley cv. ZAU 3 were cultured in Cd stressed ...

  20. Effects of cadmium on the growth and physiological characteristics ...

    African Journals Online (AJOL)

    The effects of cadmium (Cd) stress on the growth and physiological characteristics were studied in 3 sorghum species viz., sweet sorghum [Sorghum bicolor (L.) Moench. cv. Hunnigreen], sorghum hybrid sudangrass (Sorghum bicolor × Sorghum sudanense, cv. Everlush) and sudangrass [Sorghum sudanense (Piper) Stapf ...

  1. Monitoring the distribution of cadmium in sediment samples from ...

    African Journals Online (AJOL)

    The distribution of cadmium species in sediments of different depths from Obajana stream was investigated by sequential extraction procedure and flame atomic absorption spectrometric detection. Index of geoaccumulation was used to assess the level of sediment pollution and it was found not to be polluted. However, the ...

  2. Copper, nickel, zinc, cadmium and lead contamination of soil at ...

    African Journals Online (AJOL)

    This paper discussed heavy metals such as coppper (Cu), nickel (Ni), zinc (Zn), cadmium (Cd) and lead (Pb) in the soil collected from three sites from the solid waste dumping ground at Kureepuzha, very close to Ashtamudi Lake. Also, control samples were collected and analyzed for the said heavy metals. The levels of all ...

  3. Two new hexacoordinated coordination polymers of cadmium(II ...

    Indian Academy of Sciences (India)

    Two new hexacoordinated coordination polymers of cadmium(II) containing bridging units only: Syntheses, structures and molecular properties. DIPU SUTRADHARa, HABIBAR CHOWDHURYb,∗, SUSHOVAN KONERa, SUBHASIS ROYa and BARINDRA KUMAR GHOSHa,∗. aDepartment of Chemistry, The University of ...

  4. Effect of exposure to cadmium on the tropical freshwater prawn ...

    African Journals Online (AJOL)

    The effect of cadmium (Cd) on mortality, resistance and bioaccumulation in the tropical freshwater prawn Macrobrachium rosenbergii from Egypt were studied. Survival of prawns exposed to Cd doses over 60 μg l-1 were sig nificantly lower than that of prawns exposed to lower doses. After 96 h prawns ex posed to >40 μg ...

  5. Histopathological changes in the head kidney induced by cadmium ...

    African Journals Online (AJOL)

    We evaluated the effect of cadmium (Cd) on the structure and function of the head kidney in the freshwater fish Colossoma macropomum (C. macropomum). Juveniles were exposed to 0.1 mg/L CdCl2 for 31 days. Blood samples were examined using hematological tests and head kidney histology was determined by light ...

  6. Spatial and temporal variation in cadmium body loads of four ...

    African Journals Online (AJOL)

    Increasing urbanization and industrialization along the coastal areas of False Bay in South Africa can endanger coastal ecosystems because of increasing metal pollution. To obtain baseline data on contamination levels in the intertidal zone, cadmium (Cd) body loads of four invertebrate species were measured seasonally ...

  7. Biosorption of Cadmium from Aqueous Solutions Using A local ...

    African Journals Online (AJOL)

    Cadmium (Cd) (II) resistant strain of a marine fungus, named Aspergillus cristatus was isolated from heavy metals polluted area in the Mediterranean Sea, Alexandria, Egypt during autumn, 2009. It could tolerate up to 100 mg l–1. Optimization of culture conditions for production of fungal biomass fortifying maximum Cd (II) ...

  8. The Determination of Lead, Arsenic, Mercury, Cadmium Contents in ...

    African Journals Online (AJOL)

    A total of sixty samples per variety of fish used in this study was prepared for analysis by processes of homogenization and digestion of the whole fish (after their intestines have been removed); after which their individual lead, cadmium, arsenic and chromium contents were estimated by atomic absorption spectrophotometry ...

  9. Cadmium accumulation and antioxidative defenses in leaves of ...

    African Journals Online (AJOL)

    Corn (Zea Mays L.) and wheat (Triticum aestivum L. ) seedlings were grown in four cadmium (Cd) concentration levels (0 - 1 mg/l) in a hydroponic system to analyze the antioxidant enzyme system, Cd concentration in the shoots and roots of plants, proline contents, growth responses and chlorophyll contents in the leaves of ...

  10. Fertility of male workers exposed to cadmium, lead, or manganese.

    Science.gov (United States)

    Gennart, J P; Buchet, J P; Roels, H; Ghyselen, P; Ceulemans, E; Lauwerys, R

    1992-06-01

    The effect of exposure to cadmium, lead, or manganese on male reproductive function was examined in 1988-1989 in Belgian blue-collar workers. The workers were exposed to cadmium in two smelters (n = 83; geometric mean urinary cadmium level = 6.94 micrograms/g of creatinine; mean duration of exposure = 24 years), to lead in a battery factory (n = 74; mean blood lead level = 46.3 micrograms/dl; mean duration of exposure = 10.7 years), or to manganese (manganese dioxide) in a dry alkaline battery plant (n = 70; median atmospheric concentration of total manganese dust = 0.71 mg/m3; mean duration of exposure = 6.2 years). Fertility in these workers and in an unexposed population (n = 138) was assessed by examining the birth experiences of their wives through a logistic regression model. The probability of a live birth was not different between the unexposed workers and the cadmium- or manganese-exposed workers before or after the onset of exposure. While the fertility of the lead-exposed workers was somewhat greater than that of the unexposed before the onset of exposure, a significant decrease in fertility was observed during the period of exposure to the metal (odds ratio = 0.65, 95% confidence interval 0.43-0.98).

  11. Phytoextraction potential of cadmium and lead contamination using ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-12-31

    Dec 31, 2014 ... Lead accumulation in plant tissue impairs various morphological, physiological, and biochemical functions .... chlorophyll meter (based on light transmittance through leaves) was used as a non-destructive tool for .... of cadmium on the photosynthetic system cause several structural and functional disorders.

  12. Biosorption of cadmium (ii) ion from aqueous solution by Afzelia ...

    African Journals Online (AJOL)

    The batch adsorption of cadmium (II) ion from aqueous solution using low-cost adsorbent of biological origin, Afzelia africana shell under different experimental conditions was investigated in this study. The influences of initial Cd (II) ion concentration, initial pH, contact times and temperature were reported. Adsorption of Cd ...

  13. Cadmium sulphide thin film for application in gamma radiation ...

    African Journals Online (AJOL)

    Cadmium Sulphide (CdS) thin film was prepared using pyrolytic spraying technique and then irradiated at varied gamma dosage. The CdS thin film absorption before gamma irradiation was 0.6497. Absorbed doses were computed using standard equation established for an integrating dosimeter. The plot of absorbed dose ...

  14. Production of high purity granular metals: cadmium, zinc, lead

    Directory of Open Access Journals (Sweden)

    Shcherban A. P.

    2017-04-01

    Full Text Available Cadmium, zinc and lead are constituent components of many semiconductor compounds. The obtained high purity distillates and ingots are large-size elements, which is not always convenient to use, and thus require additional grinding, which does not always allow maintaining the purity of the original materials. For the growth of semiconductor and scintillation single crystals it is advisable to use "friable" granular high-purity distillates, which can be processed without the risk of contamination. For example, the European low-background experiment LUCIFER required more than 20 kg of high-purity granulated zinc, which was agreed to be supplied by NSC KIPT. This task was then extended to cadmium and lead. Motivated by these tasks, the authors of this paper propose complex processes of deep refining of cadmium, zinc and lead by vacuum distillation. A device producing granules has been developed. The process of granulation of high-purity metals is explored. The purity of produced granules for cadmium and zinc is >99,9999, and >99,9995% for lead granules. To prevent oxidation of metal granules during exposition to air, chemical methods of surface passivation were used. Organic solvent based on dimethylformamide used as a coolant improves the resistance of granules to atmospheric corrosion during the granulation of high purity Cd, Zn and Pb.

  15. Operational speciation of lead, cadmium, and zinc in farmlands ...

    African Journals Online (AJOL)

    This study was undertaken to evaluate the geochemical fractions and risk potential of lead (Pb), cadmium (Cd) and zinc (Zn) in farmlands around a polluted goldmine in Dareta, northern Nigeria. The total heavy metal concentrations were obtained through a mixed acid digestion. A modified sequential extraction procedure ...

  16. Thermoelectric material comprising scandium doped zinc cadmium oxide

    DEFF Research Database (Denmark)

    2016-01-01

    There is presented a composition of scandium doped Zinc Cadmium Oxide with the general formula ZnzCdxScyO which the inventors have prepared, and for which material the inventors have made the insight that it is particularly advantageous as an n-type oxide material, such as particularly advantageous...

  17. Effect of Pyrolysis Temperature on Cadmium and Lead ...

    African Journals Online (AJOL)

    Consumption of tobacco as cigarette or otherwise has been demonstrated to contribute to air pollution via smoke generation resulting in adverse health effect. Therefore, this study investigates the effect of pyrolysis temperature on the concentration, distribution of cadmium and lead between ash residue and smoke in some ...

  18. High cadmium / zinc ratio in cigarette smokers: potential implications ...

    African Journals Online (AJOL)

    Tobacco smoke may be one of the most common sources of cadmium (Cd) in the general population, particularly in the rising population of smokers in developing countries. Although a relationship between both cigarette smoking and environmental Cd contamination with prostate cancer exist, the mechanisms are unclear.

  19. The biosorption of cadmium and lead ions from aqueous Solution ...

    African Journals Online (AJOL)

    The biosorption potentiality of Musa paradisiaca stalk at removing cadmium and lead ions from aqueous solution was investigated. The biosorption experiment was carried out as a function of contact time, initial pH, initial metal ion concentration and biosorbent dose. Adsorption equilibria were obtained from batch ...

  20. Evaluation of some trace elements (zinc, chromium, cadmium and ...

    African Journals Online (AJOL)

    Throughout the world, tuberculosis (TB) infection is on the increase and it has remained one of the most important causes of death among adults in developing countries. This study evaluated the serum concentrations of some trace elements -Zinc (Zn), Manganese (Mn), Chromium (Cr) and Cadmium (Cd), in 100 blood ...

  1. Cadmium distribution in coastal sediments and mollusks of the US.

    Science.gov (United States)

    Apeti, Dennis A; Lauenstein, Gunnar G; Riedel, Gerhardt F

    2009-07-01

    Cadmium (Cd) concentrations in the coastal United States were assessed using the National Status and Trends (NS&T) Mussel Watch dataset, which is based on the analysis of sediments and bivalves collected from 280 sites since 1986. Using the 1997 sediment data, Pearson correlation (r=0.44, pmollusk Cd content were not well correlated.

  2. Adsorption kinetics of cadmium and lead by chitosan | Bamgbose ...

    African Journals Online (AJOL)

    An evaluation of the kinetics and capacity of chitosan to trap lead and cadmium ions in aqueous solution was carried out at 25oC using concentration and contact time as parameters. The experiments were done as batch process. Our results show that the adsorption process is concentration-driven with high capacity of ...

  3. Phytoextraction potential of cadmium and lead contamination using ...

    African Journals Online (AJOL)

    Vegetative growth, biomass, chemical content and uptake of cadmium (Cd) and lead (Pb) in Melia azedarach L. (chinaberry) and Populus alba L. (white poplar) seedlings were investigated using a 2-year pot experiment. The results indicated that P. alba and M. azedarach are tolerant to contaminated soil by Cd or Pb ...

  4. Hydrogen bonding in thiobenzamide synthon and its Cadmium ...

    Indian Academy of Sciences (India)

    1403. 3.4 Thermal behavior of [Cd(TBA)Cl2]. Several complexes of Cadmium with sulfur- contain- ing ligands have been used as precursors to synthesize. CdS nanoparticules.37,38 Accordingly, thermal stability of [Cd(TBA)Cl2] complex (Figure S9) was carried out in the temperature range 0–900. ◦. C under nitrogen atmo-.

  5. Evaluation of cadmium bioaccumulation and translocation by Hopea ...

    African Journals Online (AJOL)

    parisa

    2012-04-10

    Apr 10, 2012 ... the metal concentration ratio of plant roots to soil), translocation factor (TF, the metal concentration ratio of plant shoots to .... pH (1:2.5 soil to water). 4.62 ..... with high levels of CdSo4 (50 µM) in hydroponic culture. Cadmium ...

  6. Propagation of a cadmium spill through an impounded river system

    NARCIS (Netherlands)

    Klaver, G.T.; Joziasse, J.; Bakker, I.

    2009-01-01

    In this paper, the influence of impoundments (sluices, weirs, etc.) and stream components (tributaries, river branches, associated canals) on the metal content in water and suspended particulate matter (SPM) in the Dutch part of the River Meuse is assessed using the decrease in the cadmium content

  7. Cadmium, copper and nickel levels in vegetables from industrial and ...

    African Journals Online (AJOL)

    The levels of cadmium, copper and nickel in five different edible vegetables viz Talinum triangulare, Celosia trigyna, Corchorus olitorus, Venomia amygydalina and Telfaria accidentalis, and the soils on which they were grown from three industrial and three residential areas of Lagos City, in Nigeria, were determined using ...

  8. Impact of cadmium on the ecdysteroids production in Gammarus fossarum.

    Science.gov (United States)

    Abidi, Sondes; Abbaci, Khedidja Tair; Geffard, Olivier; Boumaiza, Moncef; Dumet, Adeline; Garric, Jeanne; Mondy, Nathalie

    2016-07-01

    Gammarus fossarum is an important test organism which is currently used as a bio-indicator as well as in ecotoxicological tests. Nevertheless, data on ecdysteroids in endocrine toxicity test are not yet available for these species, despite its crucial role in molting and reproduction. In the present paper, ecdysteroids concentrations were studied during the molt cycle (in females) and embryonic development in G. fossarum (Crustacea, Amphipoda) in order to propose an ecdysteroids toxicity test. Ecdysteroids levels in G. fossarum showed a single peak during premolt at stage Dl-D2. In embryos, ecdysteroids levels progressively increased over stages 3 and 4, with peak levels at stage 4. A Cadmium toxicity test was proposed to examine if the molting and embryogenesis disturbances previously observed after cadmium exposure (Geffard et al. 2010) could be attributed to changes in ecdysteroids titers. Exposure to the different cadmium concentrations (3; 9; 300; 900 µg/l) increased ecdysteroids secretion by Y-organs in vitro, but it had no significant effect on exposed embryos (in vivo). Based on previous findings, we are led to conclude that the molting impairments in cadmium-exposed females of G. fossarum is connected to the changes in ecdysteroids concentrations.

  9. Lead and cadmium in wild birds in southeastern Spain

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Fernandez, A.J.; Sanchez-Garcia, J.A.; Luna, A. [Univ. of Murcia (Spain); Jimenez-Montalban, P. [Regional Environmental Agency, Murcia (Spain). Centro de Recuperacion de Fauna Silvestre El Valle

    1995-12-01

    The main purpose of this study was to monitor exposure to lead and cadmium in wild birds in Murcia, a southeastern region of Spain on the Mediterranean coast. This region lies on one of the African-European flyways. Samples of liver, kidney, brain, bone, and whole blood from several species of wild birds were obtained during 1993. The authors found a clear relationship between cadmium and lead concentrations in birds and their feedings habits. Vultures (Gyps fulvus) had the highest concentrations of lead (mean 40 {micro}g/dl in blood), and seagulls (Larus argentatus and Larus ridibundus) the highest concentrations of cadmium (mean 4.43 {micro}g/g in kidney). Insectivores had high concentrations of both metals, and diurnal and nocturnal raptors showed the lowest tissue concentrations. The findings that tissue and blood concentrations were generally not elevated suggests environmental (rather than acute) exposure. Birds from more industrialized areas of the region studied here had higher concentrations of both lead and cadmium.

  10. Evaluation of cadmium bioaccumulation and translocation by Hopea ...

    African Journals Online (AJOL)

    parisa

    2012-04-10

    Apr 10, 2012 ... species such as lettuce (Lactuca sativa L.), cabbage. (Brassica oleracea L.) and tobacco (Nicotiana tabacum. L.) with ability to accumulate high concentrations of Cd in leaves rather than roots (Jadia and Fulekar, 2008a). Total cadmium concentration in the plant. Total plant Cd concentration varied under ...

  11. Influence of diethyldithiocarbamate on cadmium and copper toxicity ...

    African Journals Online (AJOL)

    drinie

    phenomena linked to the natural medium complexity and to evaluate the interactions between two heavy metals cadmium, (Cd) and copper (Cd), and a fungicide, diethyldithiocarbamate (DDTC). The choice of these three chemicals was based on the fact that Cd and Cu are common and worrying environmental pollutants ...

  12. Effects of cadmium stress on growth, metal accumulation and ...

    African Journals Online (AJOL)

    A study quantifying the effects of exogenous cadmium (Cd) on growth, Cd bioaccumulation and organic acids of Spartina alterniflora was conducted. The experiment consisted of three levels of exogenous Cd2+ concentrations: 0, 50, and 200 mg/kg. Total Cd and water-soluble Cd were determined. Plant height, tiller number ...

  13. Concentration and bioavailability of cadmium by some plants ...

    African Journals Online (AJOL)

    A survey was carried out to evaluate the existing level of cadmium in three plant species within and around a refuse site at Ojota, Lagos State, Nigeria. Concentration ranged from background levels to levels well in excess of the maximum tolerable limit in agricultural soils. In the leaves, the least (highest in bracket) of ...

  14. Extraction of cadmium(II) from acidic medium with macroporous ...

    African Journals Online (AJOL)

    Extraction of cadmium(II) from acidic medium with macroporous resin impregnated with bis(2-ethylhexyl) ammonium bis(2-ethylhexyl)dithiocarbamate. I Fall, M Diaw, S A Ndiaye, R N Mendoza, M A Rodriguez, T I Saucedo Medina ...

  15. Rapid biosynthesis of cadmium sulfide (CdS) nanoparticles using ...

    African Journals Online (AJOL)

    Cell-associated biosynthesis of cadmium sulfide (CdS) nanoparticles has been reported to be rather slow and costly. In this study, we report on a rapid and low cost biosynthesis of CdS using culture supernatants of Escherichia coli ATCC 8739, Bacillus subtilis ATCC 6633 and Lactobacillus acidophilus DSMZ 20079T.

  16. Lead and Cadmium Levels of Five Commonly and Widely ...

    African Journals Online (AJOL)

    ... Corchorus olitorius, and Corchorus tridens) consumed by Kano inhabitants were investigated and found to be at concentration below the environmental lead action level set by US EPA/WHO. Cadmium was not detected in the samples. Low concentration of Pb and absence of Cd in all the plant samples analyzed are clear ...

  17. Effects of Cadmium on the Growth and Physiological Characteristics ...

    African Journals Online (AJOL)

    Administrator

    2011-11-09

    Nov 9, 2011 ... The effects of cadmium (Cd) stress on the growth and physiological characteristics were studied in 3 sorghum species viz., sweet sorghum [Sorghum bicolor (L.) Moench. cv. Hunnigreen], sorghum hybrid sudangrass (Sorghum bicolor × Sorghum sudanense, cv. Everlush) and sudangrass [Sorghum.

  18. Purification of cadmium by selective volatilization in vacuum in ...

    Indian Academy of Sciences (India)

    experiments were conducted at the level of nearly 1·5 kg a batch to study the impurities behaviour due to upscaling. The detailed chemical analysis of 58 impurity elements in Cd in presence and absence of oxide layer was carried out by glow discharge mass spectrometry (GDMS). Keywords. High purity; cadmium; selective ...

  19. Effect of Low Level Cadmium Exposure on Superoxide Dismutase ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of low level cadmium (Cd) exposure on the activity of superoxide dismutase (SOD) in rat. Methods: Thirty-two male albino rats were divided into four groups of eight animals each. Group one received distilled water and served as control. The other three groups were exposed to 100, 200 ...

  20. Antioxidants, cadmium-induced toxicity, serum biochemical and the ...

    African Journals Online (AJOL)

    While the ACP and ACPT changed from 32.6±0.72 and 7 ±Units in the control to 54 and 17 units respectively at 40mg/kg of CD. Furthermore Cadmium also caused positively correlated dose- and time-dependent destruction of the histology of the liver, kidney and testes. These were characterized by vascular congestion, ...

  1. Adsorption mechanism of cadmium on juniper bark and wood

    Science.gov (United States)

    Eun Woo Shin; K. G. Karthikeyan; Mandla A. Tshabalala

    2007-01-01

    In this study the capacity of sorbents prepared from juniper wood (JW) and bark (JB) to adsorb cadmium (Cd) from aqueous solutions at different pH values was compared. Adsorption behavior was characterized through adsorption kinetics, adsorption isotherms, and adsorption edge experiments. Results from kinetics and isotherm experiments showed that JB (76.3–91.6 lmol Cd...

  2. Lead and Cadmium in Vinyl Children's Products. A Greenpeace Expose.

    Science.gov (United States)

    Di Gangi, Joseph

    Polyvinyl chloride (vinyl or PVC) is a substance widely used in children's products. Because children in contact with these products may ingest substantial quantities of potentially harmful chemicals during normal play, especially when they chew on the product, this Greenpeace study examined the levels of lead and cadmium in a variety of consumer…

  3. Adsorption of Acetic Acid, Cadmium ions, Lead ions and Iodine ...

    African Journals Online (AJOL)

    Michael Horsfall

    pesticides, as plant nutrients and as a constituent of waste products. These heavy metals may include cadmium, zinc ... effluent might contain non-biodegradable matter, toxic heavy metals, organic matter and also might ..... (2003) Wastewater Engineering Treatment and. Reuse, 4th Edition, Tata McGraw-Hill Publishing.

  4. Effects of Cadmium Exposure on Bone and Kidney Alkaline ...

    African Journals Online (AJOL)

    were given chow (('lu.inca Feed, Nig. Plc) and water ad Iibitum and left to acclimatisc for at period of two weeks before the experiment was commenced. Clremicals and Reagents: Cadmium sulphate. (3CdS().,.8ll2()), chloroform, sodium chloride (E. Merck, Darmstadt, W. Germany). Acid and alkaline phosphatase assay kits ...

  5. Carryover of cadmium from feed in growing pigs

    NARCIS (Netherlands)

    Hoogenboom, L.A.P.; Hattink, J.; Polanen, van A.; Oostrom, van J.J.; Verbunt, J.T.; Traag, W.A.; Kan, K.A.; Eijkeren, J.C.H.; Boeck, de G.; Zeilmaker, M.J.

    2015-01-01

    Growing male pigs were exposed to cadmium (Cd) at levels around 1 and 10 mg kg–1 feed for up to 12 weeks, administered as CdCl2 or Cd-cysteine (CdCys). Pigs exposed to 10 mg kg–1 showed decreased growth during the last 3 weeks. Liver and kidney concentrations of Cd continuously increased over the

  6. Cadmium uptake by Telfaria Occidentalis Hook F.(cucurbitaceae ...

    African Journals Online (AJOL)

    Anova tests showed that the differences between cadmium levels accumulated for control and treatment plants were significant (no overlap in standard error) at 5% level of probability. There were no such significant differences (P 0.05) for the amount of crude protein yields when the control was compared to the treatments.

  7. Physiological and molecular characterisation of cadmium stress in Schmidtea mediterranea.

    Science.gov (United States)

    Plusquin, Michelle; Stevens, An-Sofie; Van Belleghem, Frank; Degheselle, Olivier; Van Roten, Andromeda; Vroonen, Jessica; Blust, Ronny; Cuypers, Ann; Artois, Tom; Smeets, Karen

    2012-01-01

    The planarian Schmidtea mediterranea is a well-studied model organism for developmental research, because of its stem cell system. This characteristic also provides a unique opportunity to study stress management and the effect of stress on stem cells. In this study, we characterised the stress signature at different levels of biological organization. The carcinogenic metal cadmium was used as a model chemical stressor. We focused on stem cell activity and its interaction with other known stress parameters. Here, we have found that S. mediterranea is able to cope with high internal levels of cadmium. At endpoints such as size and mobility, cadmium-related stress effects were detected but all of these responses were transient. Correspondingly, cadmium exposure led to an elevated mitotic activity of the neoblasts, at the same time points when the other responses disappeared. At the molecular level, we observed redox-related responses that can be linked with both repair as well as proliferation mechanisms. Together, our results suggest that these animals have a high plasticity. The induction of stem cell activity may underlie this 'restoring' effect, although a carcinogenic outcome after longer exposure times cannot be excluded.

  8. Cadmium, lead and zinc contents of sporocarps of some ...

    African Journals Online (AJOL)

    Zinc, cadmium and lead concentrations were determined in sporocarps of Ganoderma applanatum (Pers.ex Wallr.), Ganoderma lucidum (Leys.) Fr., Heteroporus biennis (Bull.exFr.), Lycoperdon molle (Pers.: Pers), Lycoperdon pyriforme (Schaeff.ex Pers.), Peniophora incarnata (Fr.) Karst.syn, Pisolithus tinctorius (Mich.ex ...

  9. Phosphate-induced cadmium adsorption in a tropical savannah soil ...

    African Journals Online (AJOL)

    The influence of phosphate (P) on cadmium (Cd) adsorption was examined in a savanna soil with long history of different fertilizer amendment. The soil was incubated with P at 0, 250 and 500 mg P kg-1 soil and left to equilibrate for 2 weeks. Cd was added to the P-incubated soil at concentrations ranging from 27, 49 and ...

  10. Phytoextraction trials of cadmium and lead contaminated soil using ...

    African Journals Online (AJOL)

    Study on the phytoextraction of cadmium (Cd) and lead (Pb) artificially contaminated soil using 3 weed species (Ageratum conyzoides, Syndrella nodiflora and Cleome rutidosperma) was carried out at the Centre for Ecological Studies, University of Port Harcourt. A Randomized Complete Block Design consisting of 2 sets of ...

  11. Reproductive toxicity of lead, cadmium, and phthalate exposure in men.

    Science.gov (United States)

    Pant, Niraj; Kumar, G; Upadhyay, A D; Patel, D K; Gupta, Y K; Chaturvedi, P K

    2014-09-01

    Environmental toxicants viz lead or cadmium and phthalate esters (di(2-ethylhexyl) phthalate [DEHP], dibutyl phthalate [DBP], and diethyl phthalate [DEP]) widely found in different environmental strata are linked to deteriorating male reproductive health. The objective was to assess the relationships between the seminal lead, cadmium, and phthalate (DEHP, DBP, DEP) concentrations at environmental level and serum hormone levels and semen quality in non-occupationally exposed men and specify the effect of individual and combined exposure of toxicants on semen quality. A study of 60 male partners of couples attending the Andrology Laboratory of the Reproductive Biology Department, All India Institute of Medical Sciences (AIIMS), New Delhi, India for semen analysis to assess their inability to achieve a pregnancy was selected for the study. The results of univariate and stepwise multiple regression analysis in the unadjusted model showed a significant correlation between lead or cadmium and phthalates DEHP/DBP/DEP and sperm motility, sperm concentration, and DNA damage. After adjusting for potential confounders, an association with lead or DEHP was only observed. The present data shows that lead (Pb) or cadmium (Cd) or phthalates might independently contribute to decline in semen quality and induce DNA damage. Phthalates might influence reproductive hormone testosterone. These findings are significant in light of the fact that men are exposed to a volley of chemicals; however, due to the small sample size, our finding needs to be confirmed in a larger population.

  12. Detection and tracing of the medical radioisotope 131I in the Canberra environment

    Science.gov (United States)

    Gilfillan, Nathan R.; Timmers, Heiko

    2012-10-01

    The transport and radioecology of the therapeutical radioisotope 131I has been studied in Canberra, Australia. The isotope has been detected in water samples and its activity quantified via characteristic J-ray photo peaks. A comparison of measurements on samples from upstream and downstream of the Canberra waste water treatment plant shows that 131I is discharged from the plant outflow into the local Molonglo river. This is consistent with observations in other urban environments. A time-correlation between the measured activities in the outflow and the therapeutical treatment cycle at the hospital identifies the medical treatment as the source of the isotope. Enhanced activity levels of 131I have been measured for fish samples. This may permit conclusions on 131I uptake by the biosphere. Due to the well-defined and intermittent input of 131I into the sewage, the Canberra situation is ideally suited for radioecological studies. Furthermore, the 131I activity may be applied in tracer studies of sewage transport to and through the treatment plant and as an indicator of outflow dilution following discharge to the environment.

  13. Iodine-131 Metaiodobenzylguanidine Therapy for Neuroblastoma: Reports So Far and Future Perspective

    Directory of Open Access Journals (Sweden)

    Daiki Kayano

    2015-01-01

    Full Text Available Neuroblastoma, which derives from neural crest, is the most common extracranial solid cancer in childhood. The tumors express the norepinephrine (NE transporters on their cell membrane and take in metaiodobenzylguanidine (MIBG via a NE transporter. Since iodine-131 (I-131 MIBG therapy was firstly reported, many trails of MIBG therapy in patients with neuroblastoma were performed. Though monotherapy with a low dose of I-131 MIBG could achieve high-probability pain reduction, the objective response was poor. In contrast, more than 12 mCi/kg I-131 MIBG administrations with or without hematopoietic cell transplantation (HCT obtain relatively good responses in patients with refractory or relapsed neuroblastoma. The combination therapy with I-131 MIBG and other modalities such as nonmyeloablative chemotherapy and myeloablative chemotherapy with HCT improved the therapeutic response in patients with refractory or relapsed neuroblastoma. In addition, I-131 MIBG therapy incorporated in the induction therapy was proved to be feasible in patients with newly diagnosed neuroblastoma. To expand more the use of MIBG therapy for neuroblastoma, further studies will be needed especially in the use at an earlier stage from diagnosis, in the use with other radionuclide formations of MIBG, and in combined use with other therapeutic agents.

  14. Observation of radioactive iodine ({sup 131}I, {sup 129}I) in cropland soil after the Fukushima nuclear accident

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Hideshi, E-mail: hfuji@affrc.go.jp

    2016-10-01

    During the early stages of the Fukushima nuclear accident, the temporal variations of {sup 131}I deposited on the ground and of {sup 131}I accumulated in cropland soil were monitored at a fixed location in Japan. Moreover, concentrations of long-lived radioactive iodine ({sup 129}I) in atmospheric deposits and soil were measured to examine the feasibility of retrospectively reconstructing {sup 131}I levels from the levels of accident-derived {sup 129}I. The exceptionally high levels of {sup 131}I in deposits and soil were attributed to rainfall-related deposition of radionuclides. In the crop field studied, the losses of deposited {sup 131}I and {sup 129}I due to volatilization were small. The atomic ratio {sup 129}I/{sup 131}I in the topsoil corresponded to the same ratio in deposits. The {sup 131}I concentrations measured in the topsoil were very consistent with the {sup 131}I concentrations reconstructed from the {sup 129}I concentrations in the soil. - Highlights: • A high level of {sup 131}I contamination occurs through rainfall-related deposition. • Only a small loss of deposited radioactive iodine occurs via volatilization. • The {sup 129}I/{sup 131}I ratio in soil corresponds to the ratio in atmospheric deposit. • The feasibility of retrospectively reconstructing {sup 131}I is confirmed.

  15. Recent developments in cadmium mercury telluride infrared detectors

    Science.gov (United States)

    Charlton, D. E.

    1982-09-01

    A II-VI compound, cadmium mercury telluride, has dominated recent advances in the detection of infrared radiation. Although the main application is in thermal imaging, other applications include instrumentation and guidance. In this paper we describe the history of the development of cadmium mercury telluride as a detector material, with emphasis on the importance of material parameters and the role of the material scientist. High purity material, free from defects and of good crystal quality, is needed in order to ensure good minority carrier lifetime. Because of the segregation of impurities during solidification, material produced by the Bridgman technique offers considerable advantages over material produced by cast recrystallize techniques. Detectors based on a principle established by C.T. Elliott of the RSRE, Malvern, have led to families of thermal imagers that produce near perfect imagery. These detectors incorporate signal processing in the element by providing the time delay and integration functions that are normally performed off the focal plane in conventional serial scanned systems. A particular requirement of these SPRITE detectors is for long minority carrier lifetime. This has called for improvements in both material and fabrication technology which have led to an advanced technology that has benefited all aspects of the manufacture of cadmium mercury telluride detectors. Near background limited performance will be described in both the 8-14 and the 3-5 μm atmospheric transmission bands. There is, however, more image blurring in the 3-5 μm band than occurs in the 8-14 μm band. The direction of present work is towards detectors combining cadmium mercury telluride elements with advanced integrated circuits to provide more complex signal processing in the focal plane. This has been driven by the need to improve the sensitivity of thermal imaging systems where the scan rates are too low to allow useful time delay and integration in SPRITE detectors

  16. Is rhamnolipid biosurfactant useful in cadmium phytoextraction?

    Energy Technology Data Exchange (ETDEWEB)

    Wen, Jia; Stacey, Samuel P. [Adelaide Univ., Glen Osmond, SA (Australia). Soil and Land Systems; McLaughlin, Mike J. [Adelaide Univ., Glen Osmond, SA (Australia). Soil and Land Systems; CSIRO Land and Water, Agricultural Sustainable Flagship, Environmental Biogeochemistry Program, Waite Campus, Urrbrae, SA (Australia); Kirby, Jason K. [CSIRO Land and Water, Agricultural Sustainable Flagship, Environmental Biogeochemistry Program, Waite Campus, Urrbrae, SA (Australia)

    2010-10-15

    Successful chelant-assisted phytoextraction requires application of an eco-friendly metal-complexing agent which enhances metal uptake but does not pose a significant risk of off-site movement of metals. Rhamnolipid biosurfactant has been used to enhance cadmium (Cd) removal from contaminated soil by washing. It has a strong affinity for Cd compared to some other hazardous metals, suggesting that rhamnolipid could be useful in Cd phytoextraction. This study investigated the potential use of rhamnolipid to enhance Cd phytoextraction. Adsorption patterns of rhamnolipid in soils were investigated by batch adsorption experiments. Hydrophobicity of rhamnolipid-metal complexes were determined by assessing partitioning in an octanol/water system. Phytotoxicity of rhamnolipid to maize (Zea mays) and chelant-assisted phytoextraction efficiency of maize and sunflower (Helianthus annuus) were determined in pot experiments. The results showed that rhamnolipid was prone to adsorb strongly to soil at low application rates (0.1-1.7 mM) possibly due to its hydrophobic interactions with soil organic matter, hence reducing its capacity to complex and transport metals to plant roots. Rhamnolipid mobility increased (i.e. decreased soil phase partitioning) at elevated concentrations ({proportional_to}4.4 mM), which increased soil solution Cd concentrations possibly due to its reduced hydrophobic nature. The use of rhamnolipid at concentrations >4.4 mM severely reduced maize biomass yield, reducing the potential for chelant-assisted phytoextraction. At lower concentrations of rhamnolipid (0.02-1.4 mmol/kg), there was insignificant enhancement of Cd accumulation by plant (Z. mays and H. annuus) shoots, likely through strong retention of the chelant (or Cd-associated rhamnolipid) on soil surfaces. High rates of rhamnolipid addition to soils in this study caused severe phytotoxicity to maize and sunflower. Lower rates of rhamnolipid addition to soils in this study did not improve Cd

  17. Uptake of cadmium by Pseudokirchneriella supcapitata

    Directory of Open Access Journals (Sweden)

    Magela Paula Casiraghi

    2005-11-01

    Full Text Available In this work the microalgae Pseudokirchneriella supcapitata was used for the removal of the cadmium in liquids. The accumulations of metal ions by the alga occur in two stages: a very fast absorption (passive adsorption proceeded by a slower absorption (activate absorption. A mathematical model based on the surface absorption and on the transport into the interior of the cellular membrane was developed. The simulation model kinetic parameters were experimentally obtained. Through the results observed, the mathematical model was shown to be suitable when compared to the experimental results, confirming the validation of the mathematical model.Neste trabalho utilizou-se a microalga Pseudokirchneriella supcapitata para a remoção do cádmio em líquidos. A metodologia consistiu de três conjuntos de experimentos: o primeiro conjunto teve como objetivo a avaliação do crescimento da alga, o segundo foi à avaliação da remoção de cádmio e o terceiro a avaliação do crescimento da alga sendo adicionado o cádmio junto com o inóculo no tempo igual a zero, também foi avaliada a remoção de cádmio neste terceiro experimento. O acúmulo de íons metálicos pela alga ocorre em duas etapas: uma absorção muito rápida (adsorção passiva seguida por uma absorção mais lenta (absorção ativa Desenvolveu-se um modelo matemático baseado na absorção da superfície e no transporte para o interior da membrana celular. A obtenção dos parâmetros cinéticos do modelo de simulação foi obtida experimentalmente. Pelos resultados observados o modelo matemático proposto mostrou-se adequado quando comparado aos resultados experimentais, confirmando a validação do modelo matemático proposto.

  18. Lead, mercury, and cadmium in breast milk

    Directory of Open Access Journals (Sweden)

    Kadriye Yurdakök

    2015-10-01

    Full Text Available Toxic heavy metals are the major source of environmental pollution in this new millennium. Lead, mercury, and cadmium are the most common toxic heavy metals in the environment. There is no known function of these toxic heavy metals in the human body. In females, toxic heavy metals can be accumulated in maternal body before pregnancy and may be transferred to fetus through placenta and later, via breast milk. Lead previously accumulated in maternal bones can be mobilized along with calcium in order to meet increased calcium needs of the fetus in pregnant women and for the calcium needs in human milk during lactation. Human fetus and infants are susceptible to heavy metal toxicity passing through placenta and breastmilk due to rapid growth and development of organs and tissues, especially central nervous system. However most of the damage is already done by the time the infant is born. Intrauterine lead exposure can cause growth retardation, cognitive dysfunction, low IQ scores on ability tests, and low performance in school. Biological samples, such as umbilical cord blood and breast milk, and less commonly infant hair, are used for biomonitoring of intra-uterine exposure to these toxic chemicals. Although toxic metals and other pollutants may be excreted into breast milk, their effects are unknown and this topic is subject of a growing body of research. Despite the possibility of harm from environmental contaminants in breast milk, breastfeeding is still recommended as the best infant feeding method. In fact, the species-specific components present in breast milk protect infants against infections; promote immune and neurologic system development; and may decrease the risk of disease, including allergies, obesity, insulin-dependent diabetes mellitus, inflammatory bowel disease, and sudden infant death syndrome. Breastfeeding also facilitates maternal-infant attachment. The potential risk of environmental contaminants that can be transferred from

  19. Production of fusion radionuclides: Molybdenum-99/ Iodine - 131 and Xenon-133; Produccion de los radionucleidos de fision: Molibdeno-99, Yodo-131 y Xenon-133

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Carrillo, D.

    1982-07-01

    This report presents a new radiochemical method for industrial production of the radionuclides: molybdenum-99, iodine-131 and xenon-133. The above mentioned method based on the alkaline metathesis reaction of irradiated uranium (IV) fluoride, presents the best characteristics for the proposed objective. The study deals with the analysis of that reaction and the separation and purification processes. (Author) 71 refs.

  20. Radioactive Body Burden Measurements in 131Iodine Therapy for Differentiated Thyroid Cancer: Effect of Recombinant Thyroid Stimulating Hormone in Whole Body 131Iodine Clearance

    OpenAIRE

    Ravichandran, Ramamoorthy; Al Saadi, Amal; Al Balushi, Naima

    2014-01-01

    Protocols in the management of differentiated thyroid cancer, recommend adequate thyroid stimulating hormone (TSH) stimulation for radioactive 131I administrations, both for imaging and subsequent ablations. Commonly followed method is to achieve this by endogenous TSH stimulation by withdrawal of thyroxine. Numerous studies worldwide have reported comparable results with recombinant human thyroid stimulating hormone (rhTSH) intervention as conventional thyroxine hormone withdrawal. Radiation...

  1. Toxic effects of nanomaterial-adsorbed cadmium on Daphnia magna.

    Science.gov (United States)

    Gao, Minling; Zhang, Ze; Lv, Mengting; Song, Wenhua; Lv, Yuhua

    2018-02-01

    Chemical immobilization technologies involving the use of chemical absorbents such as nanomaterials have been recommended for the remediation of Cd-contaminated water and soil. The impact of nanomaterials or nanomaterials coexisting with other contaminants on aquatic organisms has been reported, but information on the toxic effects of nanomaterial-adsorbed cadmium (Nano-Cd) on aquatic organisms is lacking. This study aimed to investigate the acute and sub-acute toxicity of Nano-Cd on Daphnia magna by using a method developed based on the standard Organisation for Economic Co-operation and Development (OECD) 202 guidelines. The toxicity of cadmium chloride (Cd 2+ ), nano-manganese dioxide-cadmium (nMnO 2 -Cd), 20nm nano-hydroxyapatite-cadmium (nHAP 20 -Cd), and 40nm nano-hydroxyapatite-cadmium (nHAP 40 -Cd) to D. magna was in the following order: Cd 2+ > nMnO 2 -Cd > nHAP 20 -Cd > nHAP 40 -Cd. Further, nMnO 2 -Cd, nHAP 20 -Cd, and nHAP 40 -Cd showed acute toxicity to D. magna of level II grade according to the Commission of the European Communities and OECD standards. Exposure to low and medium, but not high, Nano-Cd concentrations increased the activities of peroxidase, superoxide dismutase, catalase, and anti-superoxide anion. Thus, Nano-Cd, particularly at high concentrations, could exert oxidative damage in D. magna. An increase in Cd 2+ and Nano-Cd concentrations gradually increased the malondialdehyde content, indicating cell membrane damage caused by the production of excessive O 2 - . Thus, the use of nanomaterials after adsorption of Cd is associated with a potential risk to aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Health effects of cadmium exposure--a review of the literature and a risk estimate.

    Science.gov (United States)

    Järup, L; Berglund, M; Elinder, C G; Nordberg, G; Vahter, M

    1998-01-01

    This report provides a review of the cadmium exposure situation in Sweden and updates the information on health risk assessment according to recent studies on the health effects of cadmium. The report focuses on the health effects of low cadmium doses and the identification of high-risk groups. The diet is the main source of cadmium exposure in the Swedish nonsmoking general population. The average daily dietary intake is about 15 micrograms/day, but there are great individual variations due to differences in energy intake and dietary habits. It has been shown that a high fiber diet and a diet rich in shellfish increase the dietary cadmium intake substantially. Cadmium concentrations in agricultural soil and wheat have increased continuously during the last century. At present, soil cadmium concentrations increase by about 0.2% per year. Cadmium accumulates in the kidneys. Human kidney concentrations of cadmium have increased several fold during the last century. Cadmium in pig kidney has been shown to have increased by about 2% per year from 1984-1992. There is no tendency towards decreasing cadmium exposure among the general nonsmoking population. The absorption of cadmium in the lungs is 10-50%, while the absorption in the gastrointestinal tract is only a few percent. Smokers have about 4-5 times higher blood cadmium concentrations (about 1.5 micrograms/l), and twice as high kidney cortex cadmium concentrations (about 20-30 micrograms/g wet weight) as nonsmokers. Similarly, the blood cadmium concentrations are substantially elevated in persons with low body iron stores, indicating increased gastrointestinal absorption. About 10-40% of Swedish women of child-bearing age are reported to have empty iron stores (S-ferritin body iron stores, and people habitually eating a diet rich in cadmium. According to current knowledge, renal tubular damage is probably the critical health effect of cadmium exposure, both in the general population and in occupationally exposed

  3. Nuclear toxicology file: the cadmium: mechanisms to elucidate; Dossier toxicologie nucleaire: le cadmium: des mecanismes a elucider

    Energy Technology Data Exchange (ETDEWEB)

    Labarre, J. [CEA Saclay, IbiTec-S, Lab. de Biologie Integrative, 91 - Gif sur Yvette (France); Forestier, C. [CEA Cadarache, IBEB, Lab. des Echanges Membranaires et Signalisation, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    Spread in the environment by the human activities, the cadmium is a toxic and mutagen metal and its mechanisms of toxicity are still badly understood. We review here the molecular mechanisms of the transport, the toxicity and the detoxication of this metal by relying us on the cellular model of baker's yeast. (N.C.)

  4. Analysis of aerospace nickel-cadmium battery cells. [cadmium migration as seen by scanning electron microscopy and metallographic analysis

    Science.gov (United States)

    Eliason, R. R.

    1977-01-01

    Various steps followed in analyzing the electrolyte, separator, and electrodes are reviewed. Specific emphasis is given to scanning electron microscopic and metallographic analysis of the plates. Cadmium migration is defined, its effects and causes are examined, and methods for its reduction in cells are suggested.

  5. Radioimmunotherapy in refractory b-cell nonhodgkins lymphoma with I-131-labeled chimeric anti cd-20 c2b8 (I-131 rituximab): preliminary result

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Hye Jin; Park, Yeon Hee; Kim, Sung Eun and others [Korea University Medical School, Seoul (Korea, Republic of)

    2005-07-01

    Recently, the native chimeric human-mouse anti CD-20 antibody IDEC-C2B8 (Rituximab) has been widely applied in NHL. This ongoing phase study was to evaluate whether radioimmunotherapy (RIT) with I-131 rituximab is effective in refractory B-cell NHL. Inclusion criteria were as follows: B-cell NHL with relapsed or refractory to primary standard therapy, measurable disease, adequate hematologic, renal, and hepatic function, informed consent. The rituximab (Mabthera, Roach) was radiolabeled with iodine-131(I-131) using a modified chloramine T method with high radiochemical purity (95%) and preservation of immuno-reactivity. All patients received loading doses of unlabeled rituximab (median, 40 mg: range, 20{approx}70 mg) immediately prior to administration of therapeutic dose (51.4{approx}152.2 MBq/kg), and then underwent gamma camera scan. 11 patients were enrolled (4 low-grade B-cell NHL, 7 DLBCL, median age 63 years). Patients had received a median of three prior chemotherapy regimens. The objective response rate was 36.4% (1 CR, 3 PRs). These all responses were observed in low-grade B-cell NHL, except one with DLBCL. Adverse events were primarily hematologic toxicities; the incidence of grade 3/4 neutropenia, thrombocytopenia, and anemia was 27.3%, 45.5%, and 18.2%, respectively. The treatment-related mortality was observed in one patient, who had been previously treated with high-dose chemotherapy plus TBI with autologous stem cell transplantation. RIT with I-131 rituximab seems to be effective tolerable in refractory low-grade B-cell NHL, although modest activity in refractory DLBCL. Further studies to define the efficacy of I-131 rituximab in DLBCL are warranted.

  6. Pulmonary scintiscanning using /sup 131/iodine-labeled Aprindin in experimental pneumonia and pulmonary embolism. Lungenszintigraphie mit /sup 131/Jod-Aprindin bei experimenteller Pneumonie und Lungenembolie

    Energy Technology Data Exchange (ETDEWEB)

    Doll, M.

    1983-10-25

    An antiarrhythmic agent generally known as Aprindin showed to be accumulated in a highly selective way in the lungs (labeled with iodine-125) and its pharmacokinetic properties were observed to remain largely unchanged following iodination. Unlike human albumin particles labeled with iodine-131 or 99mTc, which are used for conventional 'perfusion' scans, this substance is assumed to enable 'parenchymal' scintiscanning. The study described here was performed to find out whether the distribution pattern of iodine-131-labeled Aprindin is altered due to pathological changes in the parenchymal structure of the lungs. For this purpose, pulmonary embolism and pneumonia were chosen, which are often difficult to differentiate from each other, and studied in animal experiments. Moreover, a relatively simple method of iodination is described. Following administration of 131-I-Aprindin and 99mTc-MAA two successive scintigrams were obtained from rabbits previously assigned to three different study groups. The first group included healthy control animals, while pulmonary embolism was provoked in the second group prior to the examinations. The scintigrams recorded after administration of 131-I-Aprindin gave no evidence of changes in the animals showing embolism as compared to healthy rabbits, whereas the 'perfusion' scintiscans showed the anticipated regions of reduced activity. In the third group, where pneumonia had been induced, the scintigrams obtained following injection of 131-I-Aprindin were marked by considerably reduced levels of activity in the diseased areas. It was concluded that the combined use of the methods tested here enables diagnostic differentiation between pulmonary embolism and pneumonia, the two pathological conditions chosen for this study. It still remains to be investigated in further studies, in which way this combination method can be used in clinical practice. (TRV).

  7. Isolation, Identification, and Characterization of Cadmium Resistant Pseudomonas sp. M3 from Industrial Wastewater

    Directory of Open Access Journals (Sweden)

    Syed Zaghum Abbas

    2014-01-01

    Full Text Available The present study deals with the isolation, identification, and characterization of the cadmium resistant bacteria from wastewater collected from industrial area of Penang, Malaysia. The isolate was selected based on high level of the cadmium and antibiotic resistances. On the basis of morphological, biochemical characteristics, 16S rDNA gene sequencing and phylogeny analysis revealed that the strain RZCd1 was authentically identified as Pseudomonas sp. M3. The industrial isolate showed more than 70% of the cadmium removal in log phase. The cadmium removal capacity of strain RZCd1 was affected by temperature and pH. At pH 7.0 and 35°C, strain RZCd1 showed maximum cadmium removal capacity. The minimal inhibitory concentration of strain RZCd1 against the cadmium was 550 µg/mL. The resistance against the cadmium was associated with resistance to multiple antibiotics: amoxicillin, penicillin, cephalexin, erythromycin, and streptomycin. The strain RZCd1 also gave thick bands of proteins in front of 25 kDa in cadmium stress condition after 3 h of incubation. So the identified cadmium resistant bacteria may be useful for the bioremediation of cadmium contaminated industrial wastewater.

  8. Effects of Humic Acid on the Germination Traits of Pumpkin Seeds under Cadmium Stress

    Directory of Open Access Journals (Sweden)

    Maasoumeh ASADI

    2013-12-01

    Full Text Available The study tackled the effect of humic acid and cadmium concentrations on the pumpkin seed germination characteristics throughout were studied. Treatments were cadmium concentrations on three levels: 0, 100 and 200 ppm and humic acid concentration of 0, 100, 200, 300 and 400 mg lit-1. Results showed that interaction of humic acid and cadmium was not significant on germination traits, but there was a significant effect on seedling growth indexes. Radicle and plumule length increased by 86 and 192% in comparison with control, of the mixture of 200 ppm cadmium and 300 mg lit-1 of humic acid. Cadmium had stimulatory effect on radicle and cotyledon dry weight and the highest values obtained with 200 ppm in mixture with 200 mg lit-1 of humic acid. Also, maximum plumule dry weight was recorded in 200 ppm cadmium and 300 mg lit-1 of humic acid. The highest of indexes were observed of 200 ppm cadmium and 400 mg lit-1 humic acid. In conclusion, the humic acid had detoxifying effect on cadmium stress in the culture and responded antagonistically against cadmium, but it seems that these concentrations of cadmium are low for the pumpkin seed and can be increased in order to reach the toxicity level.

  9. Chronic cadmium exposure stimulates SDF-1 expression in an ERα dependent manner.

    Directory of Open Access Journals (Sweden)

    Esmeralda Ponce

    Full Text Available Cadmium is an omnipotent environmental contaminant associated with the development of breast cancer. Studies suggest that cadmium functions as an endocrine disruptor, mimicking the actions of estrogen in breast cancer cells and activating the receptor to promote cell growth. Although acute cadmium exposure is known to promote estrogen receptor-mediated gene expression associated with growth, the consequence of chronic cadmium exposure is unclear. Since heavy metals are known to bioaccumulate, it is necessary to understand the effects of prolonged cadmium exposure. This study aims to investigate the effects of chronic cadmium exposure on breast cancer progression. A MCF7 breast cancer cell line chronically exposed to 10(-7 M CdCl2 serves as our model system. Data suggest that prolonged cadmium exposures result in the development of more aggressive cancer phenotypes - increased cell growth, migration and invasion. The results from this study show for the first time that chronic cadmium exposure stimulates the expression of SDF-1 by altering the molecular interactions between ERα, c-jun and c-fos. This study provides a mechanistic link between chronic cadmium exposure and ERα and demonstrates that prolonged, low-level cadmium exposure contributes to breast cancer progression.

  10. 131I-MIBG myocardial scintigraphy in patients with Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Tuan-feng YANG

    2016-06-01

    Full Text Available Background 131I-metaiodobenzylguanidine (131I-MIBG, which can be taken by cardiac sympathetic postganglionic fibers, is an imaging agent to assess the cardiac sympathetic nerve function. The present study is to assess the cardiac sympathetic nerve function of patients with Parkinson's disease (PD by 131I-MIBG myocardial scintigraphy and preliminarily explore its applications in the early diagnosis of PD.  Methods Twenty-one eligible PD patients (16 early PD and 5 late PD and 9 normal controls were enrolled in the study. Unified Parkinson's Disease Rating Scale (UPDRS and Hoehn-Yahr stage were used to evaluate the severity of PD. Planar images of chest were obtained at different time points (15 min, 4 h and 24 h after injection of 3 mCi 131I-MIBG, and then the 131I-MIBG myocardial uptake ratios were calculated.  Results 1 The 131I-MIBG myocardial uptake ratios in PD group at 15 min (1.67 ± 0.38, 4 h (1.53 ± 0.47 and 24 h (1.35 ± 0.42 after injection were lower than those in the normal control group respectively (P = 0.000, 0.000, 0.000, and the 131I-MIBG myocardial uptake ratios in the PD group reduced over time (P = 0.002, 0.000, 0.000. 2 The 131I-MIBG myocardial uptake ratios in the early and late PD groups at 15 min [(1.73 ± 0.40 and (1.50 ± 0.30], 4 h [(1.58 ± 0.51 and (1.37 ± 0.31], 24 h [(1.39 ± 0.46 and (1.24 ± 0.29] after injection were lower than those in the normal control group respectively (early PD: P = 0.000, 0.000, 0.000; late PD: P = 0.000, 0.000, 0.000, and the 131I-MIBG myocardial uptake ratios in the early and late PD groups reduced over time (early PD: P = 0.012, 0.000, 0.000; late PD: P = 0.039, 0.001, 0.024.  Conclusions Cardiac sympathetic nerve damage could occur in PD patients, even at an early stage of PD. 131I-MIBG myocardial scintigraphy may help in the early diagnosis of PD. DOI: 10.3969/j.issn.1672-6731.2016.06.008

  11. Evolutionary History of the Global Emergence of the Escherichia coli Epidemic Clone ST131.

    Science.gov (United States)

    Stoesser, Nicole; Sheppard, Anna E; Pankhurst, Louise; De Maio, Nicola; Moore, Catrin E; Sebra, Robert; Turner, Paul; Anson, Luke W; Kasarskis, Andrew; Batty, Elizabeth M; Kos, Veronica; Wilson, Daniel J; Phetsouvanh, Rattanaphone; Wyllie, David; Sokurenko, Evgeni; Manges, Amee R; Johnson, Timothy J; Price, Lance B; Peto, Timothy E A; Johnson, James R; Didelot, Xavier; Walker, A Sarah; Crook, Derrick W

    2016-03-22

    Escherichia colisequence type 131 (ST131) has emerged globally as the most predominant extraintestinal pathogenic lineage within this clinically important species, and its association with fluoroquinolone and extended-spectrum cephalosporin resistance impacts significantly on treatment. The evolutionary histories of this lineage, and of important antimicrobial resistance elements within it, remain unclearly defined. This study of the largest worldwide collection (n= 215) of sequenced ST131E. coliisolates to date demonstrates that the clonal expansion of two previously recognized antimicrobial-resistant clades, C1/H30R and C2/H30Rx, started around 25 years ago, consistent with the widespread introduction of fluoroquinolones and extended-spectrum cephalosporins in clinical medicine. These two clades appear to have emerged in the United States, with the expansion of the C2/H30Rx clade driven by the acquisition of ablaCTX-M-15-containing IncFII-like plasmid that has subsequently undergone extensive rearrangement. Several other evolutionary processes influencing the trajectory of this drug-resistant lineage are described, including sporadic acquisitions of CTX-M resistance plasmids and chromosomal integration ofblaCTX-Mwithin subclusters followed by vertical evolution. These processes are also occurring for another family of CTX-M gene variants more recently observed among ST131, theblaCTX-M-14/14-likegroup. The complexity of the evolutionary history of ST131 has important implications for antimicrobial resistance surveillance, epidemiological analysis, and control of emerging clinical lineages ofE. coli These data also highlight the global imperative to reduce specific antibiotic selection pressures and demonstrate the important and varied roles played by plasmids and other mobile genetic elements in the perpetuation of antimicrobial resistance within lineages. Escherichia coli, perennially a major bacterial pathogen, is becoming increasingly difficult to manage due to

  12. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chantarawong, Wipa [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Inter Departmental Multidisciplinary Graduate Program in Bioscience, Faculty of Science, Kasetsart University, Bangkok (Thailand); Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Pradermwong, Kantimanee [Department of Zoology, Faculty of Science, Kasetsart University, Bangkok (Thailand); Shibahara, Shigeki, E-mail: shibahar@med.tohoku.ac.jp [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan)

    2014-11-28

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  13. The association between urinary kidney injury molecule 1 and urinary cadmium in elderly during long-term, low-dose cadmium exposure: a pilot study

    Directory of Open Access Journals (Sweden)

    Dewitte Harrie

    2011-09-01

    Full Text Available Abstract Background Urinary kidney injury molecule 1 is a recently discovered early biomarker for renal damage that has been proven to be correlated to urinary cadmium in rats. However, so far the association between urinary cadmium and kidney injury molecule 1 in humans after long-term, low-dose cadmium exposure has not been studied. Methods We collected urine and blood samples from 153 non-smoking men and women aged 60+, living in an area with moderate cadmium pollution from a non-ferrous metal plant for a significant period. Urinary cadmium and urinary kidney injury molecule 1 as well as other renal biomarkers (alpha1-microglobulin, beta2-microglobulin, blood urea nitrogen, urinary proteins and microalbumin were assessed. Results Both before (r = 0.20; p = 0.01 and after (partial r = 0.32; p Conclusions We showed that urinary kidney injury molecule 1 levels are positively correlated with urinary cadmium concentration in an elderly population after long-term, low-dose exposure to cadmium, while other classical markers do not show an association. Therefore, urinary kidney injury molecule 1 might be considered as a biomarker for early-stage metal-induced kidney injury by cadmium.

  14. Single or combined cadmium and aluminum intoxication of mice liver and kidney with possible effect of zinc

    Directory of Open Access Journals (Sweden)

    Ahmed S. Ibraheem

    2016-10-01

    Full Text Available In this study, we planned to test toxic effects of cadmium, aluminum either alone or combined with each other on sensitive organs as kidney and liver. The cadmium alone decreased the animal’s body weight. Meanwhile, aluminum did not affect the changes in body weight of cadmium treated animals; adding the zinc significantly reduced the loss of body weight. Serum creatinine and urea were significantly lower in treated group than in control group. Cadmium aluminum or combination of them resulted in a significant increase in serum GPT and GOT activity. Zinc did not prevent the changes caused by aluminum, however, the changes resulted by cadmium intoxication were almost healed or ameliorated by zinc. Treating with Zn alone resulted in drastic effects on kidney tissues more than either cadmium or aluminum. Treating with cadmium or aluminum resulted in infiltration of the liver parenchyma with lymphocytes, fibrosis, micro vesicular steatosis of the hepatocytes for both and appearance of many phagocytic cells, pyknotic cells and vacuolation for cadmium. Combined cadmium and aluminum treatment resulted in less damage than cadmium alone with exception of fatty degeneration. Unexpectedly, zinc induced acute cell vacuolation and steatosis. Cadmium and aluminum combined together did not worsen the situation as expected but was less damaging than cadmium alone, which suggests a possible synergistic effect of combination. Meanwhile, zinc failed to protect kidney from aluminum intoxication, which strengthens the suggestion of two different pathways of cadmium and aluminum intoxication. This finding meant that cadmium is more hepatotoxic than aluminum.

  15. Cadmium and lead residues in field-collected red swamp crayfish (Procambarus clarkii) and uptake by alligator weed, Alternanthera philoxiroides

    Energy Technology Data Exchange (ETDEWEB)

    Naqvi, S.M.; Howell, R.D.; Sholas, M. (Southern Univ., Baton Rouge, LA (United States). Dept. of Biological Sciences and Health Research Center)

    1993-01-01

    The whole-body residues of Cd and Pb in the tissues of Louisiana swamp crayfish (Procambarus clarkii) were determined by flame AAS technique. Test animals were collected from roadside ditches alongside major highways. The water and soil samples were also collected from the same sites. The mean Cd and Pb concentrations in crayfish tissues were 0.46 and 0.07, respectively. The levels of Cd and Pb in the water were 0.09 and 0.04; and in soil were 2.85 and 0.87 mg/1, respectively. The concentration of cadmium was 32 and Pb 12 times more than in the water. The bioaccumulation factors (BF) for Cd and Pb in crayfish tissues were 5.1 and 1.7, respectively. Alligator weed (Alternanthera philoxiroides) plants were exposed to 0.5 mg/1 Cd-chloride or Pb-nitrate solutions for 3 wk period, thrice. The mean Pb accumulation in roots was 1.31 mg/1, followed by stem (0.078 mg/1), but Cd only accumulated in root (0.83 mg/1). The BF for Pb and Cd in plant tissues were 14.8 and 16.6, respectively. The uptake of metals was time-dependent. These data suggest that although there is no biomagnification of Cd and Pb from alligator weed to crayfish, both metals readily accumulate in field-collected crayfish and laboratory-exposed alligator weed.

  16. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S

    2002-01-01

    of the study was to determine whether cadmium-induced damage in the kidneys and the skeletal system could be detected among 100 ringed seals from Northwest Greenland. The cadmium concentrations in the kidney cortex ranged from 0 to 248 microg/g wet weight (mean=44.5, N=100) in the 99 kidneys examined...... or osteodystrophy. This might be explained by the composition of the ringed seals diet, which contains high levels of vitamin D, calcium, phosphorus, zinc, selenium and protein. These elements are all likely to counteract cadmium-induced damage. It is speculated that ringed seal are not particularly vulnerable......The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose...

  17. Radioactive body burden measurements in (131)iodine therapy for differentiated thyroid cancer: effect of recombinant thyroid stimulating hormone in whole body (131)iodine clearance.

    Science.gov (United States)

    Ravichandran, Ramamoorthy; Al Saadi, Amal; Al Balushi, Naima

    2014-01-01

    Protocols in the management of differentiated thyroid cancer, recommend adequate thyroid stimulating hormone (TSH) stimulation for radioactive (131)I administrations, both for imaging and subsequent ablations. Commonly followed method is to achieve this by endogenous TSH stimulation by withdrawal of thyroxine. Numerous studies worldwide have reported comparable results with recombinant human thyroid stimulating hormone (rhTSH) intervention as conventional thyroxine hormone withdrawal. Radiation safety applications call for the need to understand radioactive (131)I (RA(131)I) clearance pattern to estimate whole body doses when this new methodology is used in our institution. A study of radiation body burden estimation was undertaken in two groups of patients treated with RA(131)I; (a) one group of patients having thyroxine medication suspended for 5 weeks prior to therapy and (b) in the other group retaining thyroxine support with two rhTSH injections prior to therapy with RA(131)I. Sequential exposure rates at 1 m in the air were measured in these patients using a digital auto-ranging beta gamma survey instrument calibrated for measurement of exposure rates. The mean measured exposure rates at 1 m in μSv/h immediately after administration and at 24 h intervals until 3 days are used for calculating of effective ½ time of clearance of administered activity in both groups of patients, 81 patients in conventionally treated group (stop thyroxine) and 22 patients with rhTSH administration. The (131)I activities ranged from 2.6 to 7.9 GBq. The mean administered (131)I activities were 4.24 ± 0.95 GBq (n = 81) in "stop hormone" group and 5.11 ± 1.40 GBq (n = 22) in rhTSH group. The fall of radioactive body burden showed two clearance patterns within observed 72 h. Calculated T½eff values were 16.45 h (stop hormone group) 12.35 h (rhTSH group) for elapsed period of 48 h. Beyond 48 h post administration, clearance of RA(131)I takes place with T½eff> 20 h in both groups

  18. Radiochemical purity, at expiry, and radiochemical stability of iodine-131 labelled meta-iodobenzylguanidine concentrates for intravenous infusion.

    Science.gov (United States)

    Wafelman, A R; Hoefnagel, C A; Maes, R A; Beijnen, J H

    1996-08-01

    The determination of the amount of free [131I]iodide in [131I]metaiodobenzylguanidine ([131I]MIBG) concentrates for intravenous infusion under different storage conditions derived from daily practice. The percentage of free [131I]iodide was determined in [131I]MIBG concentrates (1.6-3.9 GBq in 7.5 ml), kept on dry ice (up to expiry, 3 days after production) or, after thawing, at room temperature (up to 24 h). A validated solid phase extraction (SPE) assay was used. Free [131I]iodide increased from 1.9% +/- 0.34% at production to 4.4% +/- 0.67% (mean +/- SD; n = 5) at expiry in 3.7 GBq per 7.5 ml [131I]MIBG infusion concentrates stored on dry ice (-78 degrees C). At room temperature, formation of free [131I]iodide was found to be dependent on the radioactive concentration of the fluid. [131I]iodide levels increased from 3.1%, immediately after thawing, to 6.6% and 16.6% at t = 5 and 24 h, respectively, for a 3.9 GBq per 7.5 ml concentrate. The investigated formulation of [131I]MIBG concentrates, stored in its original packing containing dry ice, can generally be used up to expiry. After thawing, the undiluted concentrates should be administered to a patient within 3.5 h.

  19. Vaccinium corymbosum L. (blueberry) extracts exhibit protective action against cadmium toxicity in Saccharomyces cerevisiae cells.

    Science.gov (United States)

    Oprea, Eliza; Ruta, Lavinia L; Nicolau, Ioana; Popa, Claudia V; Neagoe, Aurora D; Farcasanu, Ileana C

    2014-01-01

    Blueberries (Vaccinium corymbosum L.) are a rich source of antioxidants and their consumption is believed to contribute to food-related protection against oxidative stress. In the present study, the chemoprotective action of blueberry extracts against cadmium toxicity was investigated using a cadmium-hypersensitive strain of Saccharomyces cerevisiae. Four varieties of blueberries were used in the study, and it was found that the extracts with high content of total anthocyanidins exhibited significant protective effect against the toxicity of cadmium and H2O2. Both the blueberry extracts and pure cyanidin exhibited protective effects against cadmium in a dose-dependent manner, but without significantly interfering with the cadmium accumulation by the yeast cells. The results imply that the blueberry extracts might be a potentially valuable food supplement for individuals exposed to high cadmium. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Dunaliella salina as marine microalga highly tolerant to but a poor remover of cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Folgar, S. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Torres, E., E-mail: torres@udc.es [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Perez-Rama, M.; Cid, A.; Herrero, C.; Abalde, J. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain)

    2009-06-15

    Cadmium tolerance and removal in the marine microalga Dunaliella salina were studied in cultures exposed to different metal concentrations (5-120 mg Cd l{sup -1}) for 96 h. This microalga can be included in the group of microalgal species most tolerant to cadmium due to the high value of EC50 that it possesses (48.9 mg Cd l{sup -1} at 96 h of culture). The greater percentage of cadmium removed was obtained in cultures exposed to 5 mg Cd l{sup -1} at 96 h, but removing only 11.3% of the added cadmium. In all cultures, the quantity of cadmium removed intracellularly was much lower than the bioadsorbed quantity and it was proportional to the sulfhydryl group levels. Both the Freundlich and Langmuir adsorption models were suitable for describing the short-term biosorption of cadmium by living cells of D. salina.

  1. Pubertal dependent effects of cadmium on episodic prolactin secretion in male rats

    Energy Technology Data Exchange (ETDEWEB)

    Lafuente, A.; Alvarez-Demanuel, E.; Marquez, N. [Fac. de Cienicas, Orense (Spain). Lab. de Toxicologia; Esquifino, A.I. [Dept. Bioquimica, Facultad de Medicina, Universidad Complutense, 28040-Madrid (Spain)

    1999-02-01

    This work was undertaken to assess if exposure to cadmium related to puberty may affect the episodic pattern of prolactin. Male rats were submitted to cadmium exposure, from day 30 to 60 or from day 60 to 90 of life respectively, at a dose of 50 ppm in the drinking water. Control age-matched rats received cadmium-free water. Prepubertal cadmium administration decreased mean serum prolactin levels and the absolute amplitude of the prolactin pulses. Subchronic exposure to cadmium of adult rats decreased mean serum prolactin levels, the absolute amplitude of the prolactin pulses and their duration, and the mean half-life of the hormone. These results suggest that subchronic cadmium exposure changes the secretory pattern of prolactin in adult male rats in a puberty-dependent way. (orig.) With 1 fig., 1 tab., 37 refs.

  2. Radioiodine (1-131) Dose for the Treatment of Hyperthyroidism in Rajavithi Hospital.

    Science.gov (United States)

    Kuanrakcharoen, Pichit

    2016-02-01

    The main cause of hyperthyroidism is diffuse toxic goiter (Graves' disease), and the treatment of choice after medical therapy failure is radioiodine (I-131). There are two common methods of determining the optimal I-131 dose: calculated dose or fixed dose. The calculated dose method is based on the following formula: 75-200 microcuri/gram of thyroid gland divided by the percentage of radioiodine uptake at 24 hours (24-hour RAIU). As this is quite complex, some centers use fixed doses, such as 5, 10 or 15 mCi because it is simpler. At Rajavithi Hospital, the applied dose of I-131 is determined based on the thyroid gland weight assessed by palpation and other clinical factors. To study the mean I-131 dose for the initial treatment of hyperthyroidism in Rajavithi Hospital, to find the clinical factors that correlate with I-131 treatment dose, and to devise a formula to predict the optimal I-131 treatment dose. This was a retrospective study of 510 patients with a diagnosis of hyperthyroidism who received initial I-131 treatment at the Department of Nuclear Medicine in Rajavithi Hospital between January 2014 and June 2015. Baseline characteristics including age, sex, age at diagnosis, duration of antithyroid drug (ATD) therapy, gland weight (g), 3-hour RAIU and I-131 treatment dose were reviewed from medical records. The mean age ± SD was 41.93 ± 14.11 years (range 14-81 years), and the male to female ratio was 4.1:1. The mean duration of ATD therapy was 3.54 ± 4.02 years (min-max, 0.8-40.6 years). The mean gland weight was 54.35 ± 32.95 grams, and the mean 3-hour RAIU was 55.5 ± 23.69%. The mean I-131 treatment dose was 14.84 ± 5.71 mCi (min-max, 7-30 mCi). There was no significant correlation between dose and age, age at diagnosis, duration of A TD therapy or 3-hour RAIU. The study showed a significant correlation between I-131 dose and gland size, r = 0.938 (p hyperthyroidism after medical therapy failure, and there are various techniques for determining the

  3. Low cadmium (LCD), a novel gene related to cadmium tolerance and accumulation in rice.

    Science.gov (United States)

    Shimo, Hugo; Ishimaru, Yasuhiro; An, Gynheung; Yamakawa, Takashi; Nakanishi, Hiromi; Nishizawa, Naoko K

    2011-11-01

    The contamination of food crops by cadmium (Cd) is a major concern in food production because it can reduce crop yields and threaten human health. In this study, knockout rice plants (Oryza sativa) tagged with the gene trap vector pGA2707 were screened for Cd tolerance, and the tolerant line lcd was obtained. The lcd mutant showed tolerance to Cd on agar plates and in hydroponic culture during early plant development. Metal concentration measurements in hydroponically grown plants revealed significantly less Cd in the shoots of lcd plants compared with wild-type (WT) shoots. When cultured in the field in soil artificially contaminated with low levels of Cd, lcd showed no significant difference in the Cd content of its leaf blades; however, the Cd concentration in the grains was 55% lower in 2009 and 43% lower in 2010. There were no significant differences in plant dry weight or seed yield between lcd and wild-type plants. LCD, a novel gene, is not homologous to any other known gene. LCD localized to the cytoplasm and nucleus, and was expressed mainly in the vascular tissues in the roots and phloem companion cells in the leaves. These data indicate that lcd may be useful for understanding Cd transport mechanisms and is a promising candidate rice line for use in combating the threat of Cd to human health.

  4. Cadmium accumulation and metallothionein biosynthesis in cadmium-treated freshwater mussel Anodonta woodiana.

    Directory of Open Access Journals (Sweden)

    Yongquan Li

    Full Text Available This study investigated the distribution of cadmium (Cd and the protein level of metallothionein (MT and examined the relationship of Cd accumulation and the MT concentration in different tissues of freshwater mussel Anodonta woodiana following Cd treatment. The mussels were exposed to Cd (4.21, 8.43, 16.86, 33.72 and 67.45 mg L-1 for 24, 48, 72 and 96 h, respectively. After Cd treatment, the gills, mantle, foot, visceral mass and digestive gland tissues were collected for analysis. We found that, in the controls, Cd distributed in all tissues in the concentration order of gills>mantle>foot>visceral mass>digestive gland. Upon Cd treatment, Cd concentration significantly increased in all tissues. The highest Cd accumulation was found in the digestive gland, which was 0.142 mg g-1 (P<0.05. MT levels in the gills and mantle of the mussels increased significantly (P<0.05, which were in positive correlation with Cd accumulation in the tissues (P<0.05. In conclusion, our results demonstrated a correlation between Cd accumulation and MT up-regulation in gills and mantle of the mussels after Cd treatment. It is suggested that the protein level of MT in gills and mantle of Anodonta woodiana is a good biomarker for Cd contamination.

  5. Cadmium Uptake by Cuttings of Impatiens walleriana in Response to Different Cadmium Concentrations and Growth Periods.

    Science.gov (United States)

    Lai, Hung-Yu; Lam, Chun-Ming; Wang, Wei-Zhe; Ji, Ya-Jhu

    2017-03-01

    Impatiens walleriana (I. walleriana), a potential cadmium (Cd) hyperaccumulator, can propagate by cuttings, which are less expensive to grow than seedlings. Different growth periods for cuttings, however, may lead to different physiological characteristics. In this study, I. walleriana cuttings were hydroponically grown in Cd-containing solutions (1.0-10.0 μM) for various growth periods (10-60 days). Experimental results showed that the Cd treatments had negative effects on growth compared to the controls that were not spiked with Cd. The extension of the growth period promoted most of the growth exhibitions of I. walleriana, except for SPAD readings for cuttings grown in the 5.0 and 10.0 μM solutions. The accumulation of Cd also increased over time, except in the roots of the cuttings grown in the 5.0 and 10.0 μM solutions. The subcellular distribution and chemical forms of Cd showed that I. walleriana developed better tolerance and detoxification capacities in the cuttings grown in the 5.0 and 10.0 μM solutions than in the cuttings grown in the other two Cd treatments.

  6. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    Science.gov (United States)

    Wei, Rongfei; Guo, Qingjun; Wen, Hanjie; Liu, Congqiang; Yang, Junxing; Peters, Marc; Hu, Jian; Zhu, Guangxu; Zhang, Hanzhi; Tian, Liyan; Han, Xiaokun; Ma, Jie; Zhu, Chuanwei; Wan, Yingxin

    2016-01-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively coupled plasma mass spectrometry (MC-ICPMS). The mass balance of Cd isotope yields isotope fractionations between plant and Cd source (δ114/110Cdorgans-solution) of −0.70‰ to −0.22‰ in Ricinus communis and −0.51‰ to −0.33‰ in Solanum nigrum. Moreover, Cd isotope fractionation during Cd transport from stem to leaf differs between the Cd-tolerant and -hyperaccumulator species. Based on these results, the processes (diffusion, adsorption, uptake or complexation), which may induce Cd isotope fractionation in plants, have been discussed. Overall, the present study indicates potential applications of Cd isotopes for investigating plant physiology. PMID:27076359

  7. Use of /sup 131/I-MIBG scintigraphy in the evaluation of suspected pheochromocytoma

    Energy Technology Data Exchange (ETDEWEB)

    Swensen, S.J.; Brown, M.L.; Sheps, S.G.; Sizemore, G.W.; Gharib, H.; Grant, C.S.; van Heerden, J.A.

    1985-05-01

    Studies at the University of Michigan have shown that /sup 131/I-metaiodobenzylguanidine (/sup 131/I-MIBG) is an effective agent for the diagnosis and localization of pheochromocytomas and paragangliomas. The authors conducted a study that confirmed and expanded that finding. From January 1983 to March 1984, 48 patients at our institution had 51 /sup 131/I-MIBG scans during the workup of suspected sporadic or metastatic pheochromocytoma. Scintigrams were obtained after 500 microCI of /sup 131/I-MIBG had been administered intravenously. The final diagnosis (true-positive, false-negative, or false-positive result) was made at operation and pathologic examination. A true-negative diagnosis was confirmed by normal plasma and fractionated urinary levels of catecholamines and metabolites and, in most patients, computed tomography (CT). The overall sensitivity of /sup 131/I-MIBG scanning was 77%, specificity was 96%, and accuracy was 86%. This test is fairly sensitive in the workup of patients with known or suspected recurrent or metastatic pheochromocytoma. It may also be helpful in the evaluation of suspected sporadic pheochromocytoma when CT findings are normal.

  8. Subchronic toxicity and mutagenicity/genotoxicity studies of Irvingia gabonensis extract (IGOB131).

    Science.gov (United States)

    Kothari, Shil C; Shivarudraiah, Prasad; Venkataramaiah, Suresh Babu; Gavara, Swapna; Soni, Madhu G

    2012-05-01

    African Bush Mango from Irvingia gabonensis is a West African culinary fruit and the mucilage from this fruit seed is used to make traditional soups and sauces. Extract from the kernel (IGOB131) has been claimed for its health benefits. In the present investigations, potential adverse effects, if any, of IGOB131 were investigated in dose-response 90-day study and genotoxicity studies. In the subchronic study, Sprague Dawley rats (20/sex/group) were gavaged with I. gabonensis extract (IGOB131) at dose levels of 0, 100, 1000 and 2500 mg/kg body weight (bw)/day for 90-days. No treatment-related changes in clinical signs, functional observations, mortality, ophthalmologic observations, body weights, body weight gain or feed consumption were noted. Similarly, hematological, clinical chemistry, urine analysis parameters, and organ weights did not reveal any toxicologically significant treatment-related changes. No treatment-related macroscopic and microscopic abnormalities were noted at the end of treatment period. The mutagenicity as evaluated by Ames assay, in vitro and in vivo chromosomal aberration test and in vivo micronucleus assay did not reveal any genotoxicity of IGOB131. The results of subchronic toxicity study suggest the no-observed-adverse-effect level (NOAEL) for I. gabonensis extract (IGOB131) as ≥ 2500 mg/kg bw/day, the highest dose tested. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Detection of multiple endocrine tumours using {sup 131}I-MIBG

    Energy Technology Data Exchange (ETDEWEB)

    Reinhardt, C.A. [Royal Brisbane Hospital, Herston, QLD (Australia). Department of Nuclear Medicine

    1998-03-01

    Full text: An {sup 131}l-MIBG scan was requested in an effort to locate an endocrine tumour after the patient presented with a history of funny turns, intermittent hypertension and elevated urinary catecholamines. The patient was injected with {sup 131}l-MIBG, and scanned 48 and 72 hours post-injection. Anterior and posterior static images of the torso identified several abnormal accumulations of {sup 131}l-MIBG. To help with the diagnosis a {sup 99}mTc-MPP scan followed. Blood pool images showed areas of intense activity matching some of the abnormalities on the {sup 131}l-MIBG scan. The delayed images were unremarkable. Some of these abnormalities were palpable on physical examination and the patient was aware of these lesions since childhood. Surgical excision of five tumours was performed. Histology of {sup 131}l tumours confirmed the diagnosis of ganglioneuroma. The nuclear medicine scans successfully identified the location and type of tumour responsible for the patient``s hormonal problems.

  10. False-positive I-131 scan by contaminated muffler in a patient with thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Han Kyung; Kim, Min Woo; Jeong, Hwan Jeong; Sohn, Myung Hee [Chonbuk National University Hospital, Chonju (Korea, Republic of)

    2006-02-15

    A 39-year-old female patient who had undergone a total thyroidectomy for a papillary thyroid carcinoma underwent a whole body scan with I-131. The I-131 scan was performed 72 hours after administering 185 MBq (5 mGi) of an I-131 solution. The anterior image of head, neck, and upper chest showed multiple areas of increased uptake in the mediastinal area considering of functional metastasis. However, radioactivity was not evident in the image taken after removing her clothes and muffler. The image obtained after placing the muffler on the pallet showed that the radioactivity was still present. It is well known that artifacts on an I-131 scan can be produced by styling hair sputum, drooling during sleep, chewing gum, and paper or a cloth handkerchief that is contaminated with the radioactive iodine from either perspiration or saliva. This activity might be mistaken for a functional metastasis. Therefore, it is essential that an image be obtained after removing the patient's clothes. In this study, artifacts due to a contaminated muffler on the I-131 scan were found. These mimicked a functional metastasis of the mediastinal area in a patient with a papillary thyroid carcinoma.

  11. Bioaccumulation and retention kinetics of cadmium in the freshwater decapod Macrobrachium australiense

    Energy Technology Data Exchange (ETDEWEB)

    Cresswell, Tom, E-mail: tom.cresswell@ansto.gov.au [Centre for Environmental Contaminants Research, CSIRO Land and Water, Locked Bag 2007, Kirrawee, NSW 2232 (Australia); School of Applied Sciences, RMIT University, Plenty Road, Bundoora, VIC 3083 (Australia); Simpson, Stuart L. [School of Applied Sciences, RMIT University, Plenty Road, Bundoora, VIC 3083 (Australia); Smith, Ross E.W. [Hydrobiology, Lang Parade, Auchenflower, QLD 4066 (Australia); Nugegoda, Dayanthi [School of Applied Sciences, RMIT University, Plenty Road, Bundoora, VIC 3083 (Australia); Mazumder, Debashish [Institute for Environmental Research, ANSTO, Locked Bag 2001, Kirrawee, NSW 2232 (Australia); Twining, John [Austral Radioecology, Oyster Bay, NSW, 2225 (Australia)

    2014-03-01

    Highlights: • Sources and mechanisms of Cd bioaccumulation were examined using radiotracers. • Macrobrachium australiense readily accumulated cadmium from the dissolved phase. • Assimilation efficiencies were comparable for sediment and algae. • A biokinetic model predicted ingestion accounted for majority of bioaccumulated Cd. - Abstract: The potential sources and mechanisms of cadmium bioaccumulation by the native freshwater decapods Macrobrachium species in the waters of the highly turbid Strickland River in Papua New Guinea were examined using {sup 109}Cd-labelled water and food sources and the Australian species Macrobrachium australiense as a surrogate. Synthetic river water was spiked with environmentally relevant concentrations of cadmium and animals were exposed for 7 days with daily renewal of test solutions. Dietary assimilation of cadmium was assessed through pulse-chase experiments where prawns were fed separately {sup 109}Cd-labelled fine sediment, filamentous algae and carrion (represented by cephalothorax tissue of water-exposed prawns). M. australiense readily accumulated cadmium from the dissolved phase and the uptake rate increased linearly with increasing exposure concentration. A cadmium uptake rate constant of 0.10 ± 0.05 L/g/d was determined in synthetic river water. During depuration following exposure to dissolved cadmium, efflux rates were low (0.9 ± 5%/d) and were not dependent on exposure concentration. Assimilation efficiencies of dietary sources were comparable for sediment and algae (48–51%), but lower for carrion (28 ± 5%) and efflux rates were low (0.2–2.6%/d) demonstrating that cadmium was well retained by M. australiense. A biokinetic model of cadmium accumulation by M. australiense predicted that for exposures to environmentally relevant cadmium concentrations in the Strickland River, uptake from ingestion of fine sediment and carrion would be the predominant sources of cadmium to the organism. The model predicted

  12. Dietary exposure to cadmium and health effects: impact of environmental changes.

    OpenAIRE

    Piscator, M

    1985-01-01

    Cadmium exposure, metabolism, and effects are described especially in relation to dietary intakes. Data on dietary intakes in several countries have been complied from studies using the duplicate diet method or fecal analysis. These two methods seem to give more accurate data than estimates based on cadmium concentrations in food classes and food consumption (composite method). The present data on absorption and retention of ingested cadmium indicate that normally less than 5% is ingested, bu...

  13. Cadmium Tolerance and Removal from Cunninghamella elegans Related to the Polyphosphate Metabolism

    OpenAIRE

    Hercília M. L. Rolim; Rita C.C. Maia; da Silva, Carlos A. A.; do Nascimento, Aline E.; de Souza, Patrícia M.; Franco, Luciana O.; Marcos A. B. de Lima; Takaki, Galba M. C.

    2013-01-01

    The aim of the present work was to study the cadmium effects on growth, ultrastructure and polyphosphate metabolism, as well as to evaluate the metal removal and accumulation by Cunninghamella elegans (IFM 46109) growing in culture medium. The presence of cadmium reduced growth, and a longer lag phase was observed. However, the phosphate uptake from the culture medium increased 15% when compared to the control. Moreover, C. elegans removed 70%–81% of the cadmium added to the culture medium du...

  14. Sexual dimorphism of cadmium-induced toxicity in rats: involvement of sex hormones

    OpenAIRE

    Shimada, Hideaki; Hashiguchi, Takashi; Yasutake, Akira; Waalkes, Michael P.; Imamura, Yorishige; シマダ, ヒデアキ; ハシグチ, タカシ; ヤスタケ, アキラ; イマムラ, ヨリシゲ; 島田, 秀昭; 橋口, 敬志; 安武 章; 今村, 順茂

    2012-01-01

    The toxic effect of cadmium varies with sex in experimental animals.Previous studies have demonstrated that pretreatment of male Fischer 344 (F344) ratswith the female sex hormone progesterone markedly enhances the susceptibility tocadmium, suggesting a role for progesterone in the sexual dimorphism of cadmiumtoxicity. In the present study, weattempted to furtherelucidate the mechanism for sexdifferencesin cadmium-induced toxicity in F344 rats. A single exposure to cadmium(5.0 mg Cd/kg, s.c.)...

  15. Remote sensing applications in evaluation of cadmium pollution effects

    Science.gov (United States)

    Kozma-Bognar, Veronika; Martin, Gizella; Berke, Jozsef

    2013-04-01

    According to the 21st century developments in information technology the remote sensing applications open new perspectives to the data collection of our environment. Using the images in different spectral bands we get more reliable and accurate information about the condition, process and phenomena of the earth surface compared to the traditional aircraft image technologies (RGB images). The effects of particulate pollution originated from road traffic were analysed by the research team of Department of Meteorology and Water Management (University of Pannonia, Georgikon Faculty) with the application of visible, near infrared and thermal infrared remote sensing aircraft images. In the scope of our research was to detect and monitor the effects of heavy metal contamination in plant-atmosphere system under field experiments. The testing area was situated at Agro-meteorological Research Station in Keszthely (Hungary), where maize crops were polluted once a week (0,5 M concentration) by cadmium. In our study we simulated the effects of cadmium pollution because this element is one of the most common toxic heavy metals in our environment. During two growing seasons (2011, 2012) time-series analyses were carried out based on the remote sensing data and parallel collected variables of field measurement. In each phenological phases of plant we took aerial images, in order to follow the changes of the structure and intensity values of plots images. The spatial resolution of these images were under 10x10 cm, which allowed to use a plot-level evaluation. The structural and intensity based measurement evaluation methods were applied to examine cadmium polluted and control maize canopy after data pre-processing. Research activities also focused on the examination of the influence of the irrigation and the comparison of aerial and terrain parameters. As conclusion, it could be determined the quantification of cadmium pollution effects is possible on maize plants by using remote

  16. Cadmium phytoextraction potential of poplar clones (Populus spp.)

    Energy Technology Data Exchange (ETDEWEB)

    Pilipovic, A.; Orlovic, S.; Petrovic, N. [Faculty of Agriculture, Inst. of Lowland Forestry and Environment, Novi Sad (Czechoslovakia); Nikolic, N.; Krstic, B. [Faculty of Natural Sciences, Dept. of Biology and Ecology, Novi Sad (Czechoslovakia)

    2005-04-01

    Biomass production, leaf number and area, photosynthetic and dark respiration rates, leaf concentration of photosynthetic pigments, nitrate reductase activity, as well as cadmium concentrations in leaves, stem, and roots were measured in poplar clones PE 4/68, B-229, 665, and 45/51. Plants were grown hydroponically under controlled conditions and treated with two different cadmium (Cd) concentrations (10{sup -5} and 10{sup -7} M) in the same background solution (Hoagland's solution). The presence of Cd did not cause serious disturbance of growth and physiological parameters in the studied poplar clones. Cd concentrations in plant tissues reflected external concentrations. In treated plants, root contents increased from 38.57 to 511.51 ppm, leaf contents from 0.91 to 7.50, while stem contents ranged from 1.37 to 9.50 ppm. (orig.)

  17. Highly Sensitive Cadmium Concentration Sensor Using Long Period Grating

    Directory of Open Access Journals (Sweden)

    A. S. Lalasangi

    2011-08-01

    Full Text Available In this paper we have proposed a simple and effective Long Period Grating chemical sensor for detecting the traces of Cadmium (Cd++ in drinking water at ppm level. Long Period gratings (LPG were fabricated by point-by-point technique with CO2 laser. We have characterized the LPG concentration sensor sensitivity for different solutions of Cd concentrations varying from 0.01 ppm to 0.04 ppm by injecting white Light source and observed transmitted spectra using Optical Spectrum Analyzer (OSA. Proper reagents have been used in the solutions for detection of the Cd species. The overall shift in wavelength is 10 nm when surrounding medium gradually changed from water to 0.04 ppm of cadmium concentrations. A comparative study has been done using sophisticated spectroscopic atomic absorption spectrometer (AAS and Inductively Coupled Plasma (ICP instruments. The spectral sensitivity enhancement was done by modifying grating surface with gold nanoparticles.

  18. Differences in cadmium transfer from tobacco to cigarette smoke, compared to arsenic or lead

    Directory of Open Access Journals (Sweden)

    J.-J. Piadé

    2015-01-01

    Full Text Available Arsenic, cadmium and lead levels in tobacco filler and cigarette smoke were determined in a 568-sample worldwide survey. Median tobacco levels for arsenic, cadmium and lead were 237, 769 and 397 ng/g respectively, comparable to those previously reported albeit somewhat lower for lead and cadmium. Median mainstream smoke yields for arsenic, cadmium and lead were <3.75, 18.2, and <12.8 ng/cig. under ISO, and <8.71, 75.1 and <45.7 ng/cig. under Health Canada Intense (HCI smoking regime respectively. In the case of cigarettes with activated carbon, a selective retention of cadmium but not lead or arsenic was observed. This effect was more pronounced under ISO than under HCI smoking regimes. Cadmium selective retention by activated carbon was confirmed by testing specially designed prototype cigarettes and the causes for this selective filtration were investigated. The differences between cadmium, arsenic and lead in terms of their speciation in tobaccos and in cigarette smoke could be related to their distribution in the ash, butt, mainstream (in gas-phase and particulate-phase and sidestream smoke of a smoked cigarette. The possible formation of organometallic cadmium derivatives in the smoke gas-phase is discussed, the presence of which could adequately explain the observed cadmium selective filtration.

  19. Functional characterization of Gram-negative bacteria from different genera as multiplex cadmium biosensors.

    Science.gov (United States)

    Bereza-Malcolm, Lara; Aracic, Sanja; Kannan, Ruban; Mann, Gülay; Franks, Ashley E

    2017-08-15

    Widespread presence of cadmium in soil and water systems is a consequence of industrial and agricultural processes. Subsequent accumulation of cadmium in food and drinking water can result in accidental consumption of dangerous concentrations. As such, cadmium environmental contamination poses a significant threat to human health. Development of microbial biosensors, as a novel alternative method for in situ cadmium detection, may reduce human exposure by complementing traditional analytical methods. In this study, a multiplex cadmium biosensing construct was assembled by cloning a single-output cadmium biosensor element, cadRgfp, and a constitutively expressed mrfp1 onto a broad-host range vector. Incorporation of the duplex fluorescent output [green and red fluorescence proteins] allowed measurement of biosensor functionality and viability. The biosensor construct was tested in several Gram-negative bacteria including Pseudomonas, Shewanella and Enterobacter. The multiplex cadmium biosensors were responsive to cadmium concentrations ranging from 0.01 to 10µgml -1 , as well as several other heavy metals, including arsenic, mercury and lead at similar concentrations. The biosensors were also responsive within 20-40min following exposure to 3µgml -1 cadmium. This study highlights the importance of testing biosensor constructs, developed using synthetic biology principles, in different bacterial genera. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Different effects of sodium chloride preincubation on cadmium tolerance of Pichia kudriavzevii and Saccharomyces cerevisiae.

    Science.gov (United States)

    Ma, Ning; Li, Chunsheng; Dong, Xiaoyan; Wang, Dongfeng; Xu, Ying

    2015-08-01

    Application of growing microorganisms for cadmium removal is restricted by high cadmium toxicity. The effects of sodium chloride (NaCl) preincubation on the cadmium tolerance and removal ability of Pichia kudriavzevii and Saccharomyces cerevisiae were investigated in this study. NaCl preincubation improved the biomass of P. kudriavzevii under cadmium stress, while no obvious effect was observed in S. cerevisiae. The improved activities of peroxidase (POD) and catalase (CAT) after NaCl preincubation might be an important reason for the decrease of the reactive oxygen species (ROS) accumulation, cell death, and oxidative damage of proteins and lipids induced by cadmium, contributing to the improvement of the yeast growth. The cadmium bioaccumulation capacity of P. kudriavzevii decreased significantly after NaCl preincubation, which played an important role in mitigating the cadmium toxicity to the yeast. The cadmium removal rate of P. kudriavzevii was obviously higher than S. cerevisiae and was significantly enhanced after NaCl preincubation. The results suggested that NaCl preincubation improved the cadmium tolerance and removal ability of P. kudriavzevii. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Effects of cadmium on aneuploidy and hemocyte parameters in the Pacific oyster, Crassostrea gigas

    Energy Technology Data Exchange (ETDEWEB)

    Bouilly, Karine [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Gagnaire, Beatrice [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Bonnard, Marc [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Thomas-Guyon, Helene [Laboratoire de Biologie et Environnement Marins, FRE-CNRS, 2727, Universite de La Rochelle, 22 Avenue Michel Crepeau, La Rochelle 17042 (France); Renault, Tristan [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Miramand, Pierre [Laboratoire de Biologie et Environnement Marins, FRE-CNRS, 2727, Universite de La Rochelle, 22 Avenue Michel Crepeau, La Rochelle 17042 (France); Lapegue, Sylvie [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France)]. E-mail: slapegue@ifremer.fr

    2006-06-15

    Pacific oysters, Crassostrea gigas, are commonly reared in estuaries where they are exposed to anthropogenic pollution. Much research has been made on the toxicity of cadmium to aquatic organisms because the compound recurrently contaminates their environment. Our study examined the influence of cadmium on aneuploidy level (lowered chromosome number in a percentage of somatic cells) and hemocyte parameters in C. gigas at different stages of life. Adults and juveniles were exposed to two different concentrations of cadmium. The first concentration applied was equivalent to a peak value found in Marennes-Oleron bay (Charente-Maritime, France; 50 ng L{sup -1}) and the second was 10 times higher (500 ng L{sup -1}). Exposure to 50 ng L{sup -1} cadmium caused a significant decrease in the survival time of C. gigas, but exposure to 500 ng L{sup -1} surprisingly affected the survival time positively. Significant differences in aneuploidy level were observed between the cadmium treatments and the control in adults but not in juveniles or the offspring of the adult groups. The effects of cadmium on hemocyte parameters were analyzed by flow cytometry. Several hemocyte parameters increased significantly after 21 days of cadmium exposure and subsequently decreased. Phenoloxidase-like activity, evaluated by spectrophotometry, varied over the time of the experiment and increased after 66 days of contact with 500 ng L{sup -1} cadmium. Taken together, cadmium at environmentally relevant concentrations seems to have only moderate effects on aneuploidy and hemocyte parameters.

  2. Curcumin regulates airway epithelial cell cytokine responses to the pollutant cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Rennolds, Jessica; Malireddy, Smitha; Hassan, Fatemat; Tridandapani, Susheela; Parinandi, Narasimham [Division of Pulmonary, Allergy, Critical Care and Sleep Medicine, The Ohio State University, Columbus, OH 43210 (United States); Boyaka, Prosper N. [Department of Veterinary Biosciences, The Ohio State University, Columbus, OH 43210 (United States); Cormet-Boyaka, Estelle, E-mail: Estelle.boyaka@osumc.edu [Division of Pulmonary, Allergy, Critical Care and Sleep Medicine, The Ohio State University, Columbus, OH 43210 (United States)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Cadmium induces secretion of IL-6 and IL-8 by two distinct pathways. Black-Right-Pointing-Pointer Cadmium increases NAPDH oxidase activity leading to Erk activation and IL-8 secretion. Black-Right-Pointing-Pointer Curcumin prevents cadmium-induced secretion of both IL-6 and IL-8 by airway cells. Black-Right-Pointing-Pointer Curcumin could be use to suppress lung inflammation due to cadmium inhalation. -- Abstract: Cadmium is a toxic metal present in the environment and its inhalation can lead to pulmonary disease such as lung cancer and chronic obstructive pulmonary disease. These lung diseases are characterized by chronic inflammation. Here we show that exposure of human airway epithelial cells to cadmium promotes a polarized apical secretion of IL-6 and IL-8, two pivotal pro-inflammatory cytokines known to play an important role in pulmonary inflammation. We also determined that two distinct pathways controlled secretion of these proinflammatory cytokines by human airway epithelial cells as cadmium-induced IL-6 secretion occurs via an NF-{kappa}B dependent pathway, whereas IL-8 secretion involves the Erk1/2 signaling pathway. Interestingly, the natural antioxidant curcumin could prevent both cadmium-induced IL-6 and IL-8 secretion by human airway epithelial cells. In conclusion, curcumin could be used to prevent airway inflammation due to cadmium inhalation.

  3. Link between low-dose environmentally relevant cadmium exposures and asthenozoospermia in a rat model.

    Science.gov (United States)

    Benoff, Susan; Auborn, Karen; Marmar, Joel L; Hurley, Ian R

    2008-02-01

    To define the mechanism(s) underlying an association between asthenozoospermia and elevated blood, seminal plasma, and testicular cadmium levels in infertile human males using a rat model of environmentally relevant cadmium exposures. University medical center andrology research laboratory. Male Wistar rats (n = 60), documented to be sensitive to the testicular effects of cadmium. Rats were given ad libitum access to water supplemented with 14% sucrose and 0 mg/L, 5 mg/L, 50 mg/L, or 100 mg/L cadmium for 1, 4, or 8 weeks beginning at puberty. Testicular cadmium levels were determined by atomic absorption, cauda epididymal sperm motility by visual inspection, and testicular gene expression by DNA microarray hybridization. Chronic, low-dose cadmium exposures produced a time- and dose-dependent reduction in sperm motility. Transcription of genes regulated by calcium and expression of L-type voltage-dependent calcium channel mRNA splicing variants were altered by cadmium exposure. Expression of calcium binding proteins involved in modulation of sperm motility was unaffected. A causal relationship between elevated testicular cadmium and asthenozoospermia was identified. Aberrrant sperm motility was correlated with altered expression of L-type voltage-dependent calcium channel isoforms found on the sperm tail, which regulate calcium and cadmium influx.

  4. [The genetic action of ammonium molybdate and cadmium chloride and iodide].

    Science.gov (United States)

    Chopikashvili, L V; Bobyleva, L A; Shapiro, A N

    1991-01-01

    Ammonium molybdate cadmium iodide and cadmium chloride have been studied in test for their genotoxic effect on induction of DNA-cellular bonding, extrasynthesis of DNA in spermatozoa of mice as well as in test to estimate a fertility criterion of Drosophila males. Ammonium molybdate, cadmium iodide and cadmium chloride are stated to be able to induce injuries of native DNA in test on induction of DNA-cellular bonding and DNA-sex cells of mice and Drosophila melanogaster in dominant-lethal test and in experiments on estimation of a fertility coefficient of Drosophila males, respectively.

  5. Effect of speciation on uptake and toxicity of cadmium to shrimp Crangon Crangon (L. )

    Energy Technology Data Exchange (ETDEWEB)

    Simoes Goncalves, M.L.S.; Vilhena, M.F.C.; Machado, L.M.V.F.; Pescada, C.M.R.; Legrand de Moura, M. (Technical Univ. of Lisbon (Portugal))

    1989-08-01

    A study is presented on speciation of seawater with shrimps Crangon Crangon (L.) contaminated with cadmium in the presence and absence of pyridine-2,6-dicarboxylic acid (a rough model of a chelate group of humic acids). Ultrafiltration and ion exchange Chelex columns were associated with atomic absorption (AA) and differential pulse anodic stripping voltammetry (DPASV). The uptake and toxicity of cadmium were studied and the organs where this heavy metal accumulated were examined. It was noticed that the cadmium complex with pyridine-2,6-dicarboxylic was not available to the shrimps and that during the 5 days of the experiment cadmium was preferentially accumulated in the hepatopancreas and carapace.

  6. Interactions between TiO2 nanoparticles and cadmium: consequences for uptake and ecotoxicity

    DEFF Research Database (Denmark)

    Hartmann, B.; Baun, Anders

    2011-01-01

    sedimentation, the sediments are expected to be a sink for nanoparticles. Both in the water phase and in sediments they will mix and interact with other environmental pollutants, including heavy metals. In this study the toxicity of cadmium to three relevant freshwater species, green algae Pseudokirchneriella...... in the absence and presence of 2mg/L TiO2 nanoparticles (P25 Evonic, d: 30 nm). Mass balances for cadmium in the test systems were determined. A high degree of sorption of cadmium onto TiO2 particles was found, which makes TiO2 nanoparticles potential carriers for cadmium. The observed toxicity was higher than...

  7. Cadmium and lead in vegetable and fruit produce selected from specific regional areas of the UK

    Energy Technology Data Exchange (ETDEWEB)

    Norton, Gareth J., E-mail: g.norton@abdn.ac.uk [School of Biological and Environmental Sciences, University of Aberdeen, Cruickshank Building, St Machar Drive, Aberdeen AB24 3UU (United Kingdom); Deacon, Claire M. [School of Biological and Environmental Sciences, University of Aberdeen, Cruickshank Building, St Machar Drive, Aberdeen AB24 3UU (United Kingdom); Mestrot, Adrien [Soil Science Group, Institute of Geography, Universität Bern, Hallerstrasse 12, 3012 Bern (Switzerland); Feldmann, Joerg [Department of Chemistry, School of Physical Sciences, University of Aberdeen, Meston Building, AB24 3UE (United Kingdom); Jenkins, Paul; Baskaran, Christina [Food Standards Agency, Aviation House, Kingsway, London WC2B 6NH (United Kingdom); Meharg, Andrew A. [Institute for Global Food Security, Queen' s University Belfast, David Keir Building, Malone Road, Belfast BT9 5BN (United Kingdom)

    2015-11-15

    Cadmium and lead were determined in fruit and vegetable produce (~ 1300 samples) collected from a field and market basket study of locally grown produce from the South-West of Britain (Devon and Cornwall). These were compared with similarly locally grown produce from the North-East of Britain (Aberdeenshire). The concentrations of cadmium and lead in the market basket produce were compared to the maximum levels (ML) set by the European Union (EU). For cadmium 0.2% of the samples exceeded the ML, and 0.6% of the samples exceeded the ML for lead. The location of cadmium and lead in potatoes was performed using laser ablation ICP-MS. All tested samples exhibited higher lead concentrations, and most exhibited increased concentrations of cadmium in the potato skin compared to the flesh. The concentrations of cadmium and lead found in fruits and vegetables sampled during this study do not increase concern about risk to human health. - Highlights: • Cadmium and lead concentrations determined in fruit and vegetable produce • 0.2% of the samples exceeded guideline values for cadmium. • 0.6% of the samples exceeded guideline values for lead. • Higher concentrations of cadmium and lead were found in the skins of potatoes.

  8. Simple method to reduce interference from excess magnesium in cadmium immunoassays.

    Science.gov (United States)

    Sasaki, Kazuhiro; Oguma, Shinichi; Glass, Thomas; Namiki, Yukie; Sugiyama, Hideo; Ohmura, Naoya; Blake, Diane A

    2008-09-10

    In order to develop a rapid inexpensive test for cadmium in rice, we identified an antibody specific for cadmium-EDTA complexes; this antibody binds to cadmium-EDTA with a Kd of approximately 10(-8) M. Although the antibody's cross reactivity to magnesium was minimal (Kd approximately 10(-5) M), the high toxicity of cadmium coupled with the high natural occurrence of magnesium in rice resulted in a situation where magnesium interfered with cadmium determination and resulted in falsely elevated estimates of cadmium. Fortunately, the formation constant of EDTA for cadmium is approximately 5 x 10(7) times higher (at pH 7) than the formation constant of EDTA for magnesium, and we were able to eliminate the magnesium interference by judicious selection of the EDTA concentration used in the assay. The resulting equilibria are complex, but we show that a relatively simple two-step model in which cadmium and magnesium compete for EDTA followed by cadmium-EDTA and magnesium-EDTA competing for antibody provided a good fit to the measured data. These analyses enabled appropriate selection of the optimum EDTA concentration for an immunoassay with improved selectivity.

  9. Cadmium stress disrupts the endomembrane organelles and endocytosis during Picea wilsonii pollen germination and tube growth.

    Directory of Open Access Journals (Sweden)

    Xiaoxia Wang

    Full Text Available As one of the most severe pollutants, cadmium has been reported to be harmful to plant cells, but the effects of cadmium on gymnosperm pollen germination and tube growth and the mechanism of this involvement are still unclear. Here, we report that cadmium not only strongly inhibited P. wilsonii pollen germination and tube growth, but also significantly altered tube morphology in a dose-dependent manner. Time-lapse images obtained with a laser scanning confocal microscope revealed that endocytosis was dramatically inhibited by cadmium stress. Further investigation with ER-Tracker dye indicated that cadmium stress reduced the number of the Golgi apparatus, and induced dilation of ER. Additionally, Lyso-Tracker staining showed that cadmium distinctly promoted the formation of acidic organelles in pollen tubes, likely derived from the dilated ER. Taken together, our studies indicated that P. wilsonii pollens were highly susceptible to cadmium stress, and that cadmium stress strongly inhibited pollen germination and tube growth by disrupting the endomembrane organelles, inhibiting endo/exocytosis, and forming acidic vacuoles, resulting in swollen tube tips and irregularly broadened tube diameters. These findings provide a new insight into the effects of cadmium toxicity on the tip growth of pollen tubes.

  10. Evaluation of ATC as an Orally Administered Drug in Treatment of Cadmium Toxicity of Rat Organs

    Directory of Open Access Journals (Sweden)

    S. Nabilaldine Fatemi

    2009-01-01

    Full Text Available The effect of N-tetramethylene dithiocarbamate (ATC as a chelating agent on the excretion of cadmium was evaluated in cadmium-poisoned Wistar rats following administration through food and drink. The present research aimed to characterize the potential efficiency of ATC as an orally administered chelator drug after cadmium administration for 60 days. This chelator significantly enhanced the urinary and biliary excretion of cadmium and restored the altered levels of iron. Cadmium and iron concentrations in different tissues were determined by graphite furnace and flame atomic absorption spectrometry (GF AAS and F AAS methods, respectively. The chelation therapy results show that ATC is able to remove cadmium ions from different tissues while iron concentration returned to the normal level and the clinical symptoms were also reduced. In summary, we conclude that ATC is able to mobilize and promote the excretion of cadmium in rat organs and reduce the side effects and general symptoms of toxicity caused by cadmium and might be useful for preliminary testing of the efficacy of chelating agents in human body. However, these results should be confirmed in different experimental models before extrapolation to other systems. This testing procedure of course does not provide all the relevant answers for evaluating the efficiency of chelating agents in cadmium toxicity.

  11. Accumulation and Transfer of Cadmium, by Indica Rice Cultivars Fujian Province of China

    Science.gov (United States)

    James, B.; Wang, G.

    2016-12-01

    This study was designed to evaluate the accumulating ability of cadmium (Cd) by different Indica rice varieties and to understand the differences in transfer factor in the soil-to-rice grain. A total of 189 crop samples and 189 corresponding soil samples were collected for treatment and chemical analysis. Sixteen (16) Indica rice varieties were selected for this study. Our preliminary results showed that there exist significant differences (pindica rice cultivars).The TFstem-grain among the variety revealed that significant differences (pindica rice variety and cadmium decreases in the pattern: root>stem>leaf>grain in the four cultivars except Te -you 009 that showed similar cadmium content in root and stem. Among the hybrid cultivars Yi -you 673 accumulated the most Cadmium in root, stem, leaf and grain, while Te- you 009 accumulated the least Cadmium in root, whereas the conventional cultivar Jia-fu-zhan accumulated the lowest Cadmium in leaf and grain. Our findings also revealed that the Cadmium concentrations in rice grains were more significantly correlated with the Cadmium in stem, followed by leaf, which reveals that the transfer from stem and leaf to grain may be the determinant steps for Cadmium accumulation in the grains.

  12. Effects of ?-Tocopherol on Cadmium-Induced Toxicity in Rat Testis and Spermatogenesis

    OpenAIRE

    Yang, Hoe Saeng; Han, Dong Keun; Kim, Jung Ran; Sim, Jae Chul

    2006-01-01

    Cadmium is known to exert toxic effects on multiple organs, including the testes. To determine if ?-Tocopherol, an antioxidant, could protect testicular tissues and spermatogenesis from the toxic effects of cadmium, six-week old male Sprague-Dawley rats were randomized to receive cadmium at doses of 0 (control), 1, 2, 4 or 8 mg/kg by the intraperitoneal route (Group A) or ?-tocopherol for 5 days before being challenged with cadmium (Group B) in an identical dose-dependent manner. When both gr...

  13. Dietary protein effects on cadmium and metallothionein accumulation in the liver and kidney of rats.

    OpenAIRE

    Revis, N W; Osborne, T R

    1984-01-01

    The relationship of dietary protein to cadmium absorption and tissue deposition was studied in male Sprague-Dawley rats exposed to different levels of cadmium in the drinking water. In animals fed a high-protein or low-protein diet and drinking water containing 25 or 50 ppm cadmium, liver and kidney cadmium and metallothionein were both significantly higher in rats fed the high-protein diet for 2 to 4 months. These differences may possibly be explained by the concentration of cysteine observe...

  14. Optimization of the therapeutic dose of {sup 131}I for thyroid differentiated carcinoma; Otimizacao da dose terapeutica com {sup 131}I para carcinoma diferenciado da tiroide

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Fabiana Farias de

    2002-09-01

    I-131 thyroid cancer therapy is based on the strategy of concentrating radioactive iodine in the thyroid tissue, to completetly eliminate thyroid tissue and functioning thyroid cancer metastases remaining after thyroidectomy. In Brazil, fixed activities of {sup 131} I generally are given, sometimes either delivering insufficient activities to ablate all of the remnants, or unnecessarily high activities, with patients remaining in the hospital for some period of time. This investigation proposes a protocol of individualized planning of ablative doses, based on individual patients metabolisms and measured thyroid remnant masses. Simulated thyroid remnants were fabricated in various forms, volumes and activities, and optimum image acquisition parameters were determined using Single-Photon Emission Computed Tomography 9SPECT). Resultant images were evaluated, to determine the apparent volumes and the {sup 131} I concentrations. I-131 metabolism was studied in 9 patients who had undergone thyroidectomies. Their thyroid remnant masses were determined applying the same parameters used in SPECT simulation studies, and the optimum activity for their therapy was calculated and compared to the established fixed activity of 3.7 GBq (100 mCi), which would have normally been assigned. Background subtraction using the method of percent maximum counts, using a value of 67.5%, combined with scatter correction (triple energy window method), was shown to be optimum for SPECT quantification of volumes between 3-10 ml. Errors in the method were below 9% for sources with regular geometries and around 11% for sources with irregular geometries. In the patient studies, it was observed that 78% of patients could have received reduced activities of {sup 131} (from 0.8-3-2. GBq (20-87 nCi). In addition, 33% of these patients could have received low enough activities to have discharged from the hospital, using an individualized administration scheme. This could also have resulted in a dose

  15. Melanoma vectorized radiotherapy: preclinical evaluation of a new marker labelled by iodine 131; Radiotherapie vectorisee du melanome: evaluation preclinique d un nouveau vecteur marque par l iode 131

    Energy Technology Data Exchange (ETDEWEB)

    Bonnet, M.; Papon, J.; Miot-Noirault, E.; Madelmont, J.C.; Chezal, J.M.; Moins, N. [INSERM/UdA, EA4231, UMR 990, 63 - Clermont Ferrand (France); Mishellany, F.; Penault-Llorca, F.; Cayre, A. [laboratoire d anatomopathologie, CJP, 63 - Clermont-Ferrand (France)

    2010-05-15

    A significant anti tumoral effect of the internal vectorized radiotherapy using the compound {sup 131}I-ICF01012 is demonstrated on different models of melanomas, whatever be their aggressive potential, the quantity and localisation of the melanoma target. this effect is associated to an inhibition of the tumors cells dissemination towards lungs. The optimization of the protocol therapy is underway to get a maximum therapy efficiency associated to a toxicity controlled on non target-organs. (N.C.)

  16. Place of synthesis anti thyroids in the hyperthyroidism treatment by iodine 131; Place des antithyroidiens de synthese dans le traitement par iode 131 des hyperthyroidies

    Energy Technology Data Exchange (ETDEWEB)

    Clerc, J. [Hopital Necker, 75 - Paris (France)

    2000-01-01

    The prescription of synthesis anti thyroids allows to get a fast control of hyperthyroidism when the average time of curing after iodine 131 varies from 6 to 12 weeks, according to the level of radiation doses. It allows to treat the patients in euthyroidism and to avoid aggravation of thyrotoxicosis in the following of the iodine and is particularly useful for the old patients with a cardio vascular risk.

  17. Effects of Cadmium Exposure on Bone and Kidney Alkaline ...

    African Journals Online (AJOL)

    Table 3: Effect of Cadmium on Rat Prostate Gland Acid Phosphatase and Scrum Acid and Alkaline Phosphatase Activities. Cd Dose Enzyme Activity (U/l.,, Mean 35 SD; n 2 3). (mg/kg bd wt) x 104. Prostate ACPC Serum ACP Serum AP. Total Nonprostatic Prostatic "l'otal Nonprostatic Prostatic. 0.0 (control) 263.4 :1: 2.0 31.7 ...

  18. Protein synthesis in cadmium- and pentachlorophenol-tolerant Euglena gracilis

    Energy Technology Data Exchange (ETDEWEB)

    Barque, J.P.; Abahamid, A.; Chacun, H. [Laboratoire de Metabolism Cellulaire et Xenobiotiques, Chatenay-Malabry (France)] [and others

    1995-07-01

    This work is a preliminary characterization of two adapted Euglena gracilis cell lines, one to cadmium and the other to pentachlorophenol. Growth curve analysis indicate that tolerance to one pollutant did not protect against the second pollutant. These suggest that metabolic pathways that are induced by one pollutant are specific for this pollutant. This specificity is detectable at the level of gene expression. 16 refs., 6 figs.

  19. HISTOLOGICAL AND HISTOCHEMICAL CHARACTERISTICS OF RAT MYOCARDIUM IN CADMIUM TOXICOSIS

    Directory of Open Access Journals (Sweden)

    Novica Bojanić

    2013-01-01

    Full Text Available Carcinogenic effects of cadmium on lungs, testicles and prostate are well known, so as cumulative and toxic effects on kidney, liver and bones; however, there have not been many published articles about the effects of cadmium on myocardium. The aim of this study was to estimate the morphological changes in rat myocardium chronically treated by cadmium. The study was carried out on male albino Wistar rats (n=30, age=35-37 days, body mass 120g +/- 10g. The animals were raised in controlled laboratory conditions and provided with standard laboratory rat food and tap water ad libitum. The rats were divided into two groups: ten animals composed the control group and did not undergo any treatment. The 20 experimental rats were exposed to 10mg of CdCl2 /L drinking water for 90 days. After 90 days, all animals were victimized and after the macroscopic inspection of the heart, myocardial tissue was routinely processed and embedded in paraffin. Sections 5 micrometers thick were stained by HE method and histochemical PAS-AB (pH 2, 5, Masson trichrome method for demonstrating collagen fibers and Toluidine blue for mast cells identification. Cross-striated banding pattern of cardiac cells was ruined. Noticeable atrophy and hydropic degeneration of subendocardial localized cardiac cells were found, with the focal presence of myocytolysis. Endothelial cell hyperplasia and edema of the intima were present on arteriolar type blood vessels causing the focal subocclusion. Fibrocytes, histiocytes and mast cells were numerous, perivascularly localized. Mast cells were polymorphic, larger than normal, oval and mostly degranulated. Instead of scanty endomysium, there is a noticeable interstitial fibrillar fibrosis with few fields of collagen in all myocardium layers between cardiac cells, which is particularly prominent around the larger blood vessels. Cadmium has pronounced vasculotropic properties causing morphological changes of cardiomyocytes, myocardial

  20. Transient Response of Cadmium Telluride Modules to Light Exposure: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Deline, C.; del Cueto, J.; Albin, D. S.; Petersen, C.; Tyler, L.; TamizhMani, G.

    2011-07-01

    Commercial cadmium telluride (CdTe) photovoltaic (PV) modules from three different manufacturers were monitored for performance changes during indoor and outdoor light-exposure. Short-term transients in Voc were recorded on some modules, with characteristic times of ~1.1 hours. Outdoor performance data shows a similar drop in Voc after early morning light exposure. Preliminary analysis of FF changes show light-induced changes on multiple time scales, including a long time scale.

  1. The protective role of honey against cytotoxicity of cadmium chloride ...

    African Journals Online (AJOL)

    The present study aimed to investigate the honey (HY) protective role in opposition to cadmium (Cd) induced chromosomal aberrations of bone marrow and sperm abnormalities. Forty five (45) adult male albino mice were caged into six groups. Mice were injected, i.p, 300 mg HY/kg and/or 0.67 mg CdCl2/kg b.w for 96 h, ...

  2. Effects of vitamins C and E pretreatments on cadmium- induced ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-27

    Sep 27, 2010 ... Animals were given single doses of vitamins C (1.5 mg/kg) and E (50 mg/kg) per oral and (0 - 8 mg Cd/kg ip) for 24 h. Animals were sacrificed and the serum ... effects of pretreatments with vitamins C and E on Cd-induced serum levels of the parameters were ... Furthermore, cadmium-induced toxicity is.

  3. Effect of Cadmium on the growth of Spirulina maxima (Arthrospira)

    Energy Technology Data Exchange (ETDEWEB)

    Torres-Munoz, J. A.; Aguilar-Lopez, R.; Hernandez-Villagran, D.; Neria-Gonzalez, M. I.; Rios-Leal, E.; Dominguez-Bocanegra, A. R.

    2009-07-01

    The removal of heavy metal by microorganisms can occur through several mechanisms, such as simple adsorption, absorption, enzymatic synthesis or through the production of extracellular polymers. Cadmium (CD), a metal released in most mining and metallurgical processes, is one of the main agents responsible for water pollution. In spite of the increasing amount of research published on the interaction of microorganisms with heavy metals, few work describe this interaction with cyanobacteria. (Author)

  4. Effect of cadmium on the morphology and anatomy of Salvinia ...

    African Journals Online (AJOL)

    This study aimed to evaluate the morphological and anatomical changes of Salvinia auriculata exposed to different concentrations 0, 2.5, 5, 7.5 and 10 μM of cadmium (Cd) and its effect on plant growth. The experiment was conducted in the laboratory of Plant Anatomy of the IF Goiano/Rio Verde Campus, Goiás. Cd free ...

  5. Cadmium in fertilizers, soil, crops and foods - the Swedish situation

    Energy Technology Data Exchange (ETDEWEB)

    Hellstrand, S.; Landner, L. [Swedish Environmental Research Group (MFG)

    1998-03-01

    The aim of this report is to review available information on the fluxes of cadmium (Cd) to agricultural soils and crops in Sweden from phosphorus fertilizers (P-fertilizer) and other sources, and to discuss how the content of Cd in soil, crops and human food may be influenced by the specific environmental conditions in Sweden, as well as by the agricultural practices used in the country 62 refs, 15 figs, 18 tabs. With 5 page summary in Swedish

  6. Micronuclei induction by {sup 131}I exposure. Study in hyperthyroidism patients

    Energy Technology Data Exchange (ETDEWEB)

    Gutierrez, S.; Carbonell, E.; Creus, A.; Marcos, R. [Grup de Mutagenesi, Departament de Genetica i de Microbiologia, Edifici Cn, Universitat Autonoma de Barcelona, Bellaterra (Spain); Galofre, P. [Servei de Medicina Nuclear, Ciutat Sanitaria i Universitaria Vall d`Hebron, Barcelona (Spain)

    1997-01-03

    To evaluate the eventual genetic damage induced by therapeutic exposure to {sup 131}I, we have studied the presence of micronuclei (MN) in binucleated peripheral blood lymphocytes from a group of 28 hyperthyroidism patients who received {sup 131}I sodium iodide, via oral administration. The study was conducted over time and blood samples were obtained before the treatment, and 1 week, 1 month and 3 months after it. The results obtained indicate a positive relationship between dose and BNMN frequency as calculated by the linear regression coefficient, showing significant increases in the frequency of MN and BNMN (binucleated cells with MN) in the subgroup of patients that received more than 500 MBq. Taking into account that the patients studied were treated with relatively low doses of {sup 131}I, our positive results support the view that the MN assay is sensitive enough to monitor the chromosome damage resulting from the exposure.

  7. Breast ultrasound in 22,131 asymptomatic women with negative mammography.

    Science.gov (United States)

    Girardi, Veronica; Tonegutti, Mara; Ciatto, Stefano; Bonetti, Franco

    2013-10-01

    To evaluate increment cancer detection rate generated by ultrasound (US). US only detected cancers were assessed for 22,131 self-referring asymptomatic women with negative mammography and subgroups by age, previous cancer, breast density. Invasive assessment and surgical biopsy rate were evaluated. The overall US detection was 1.85 per thousand (41/22,131). In the subgroups it was: 1.95 per thousand (22/11,274) in women breasts (p = 0.17) vs 1.56 per thousand (19/12,171) in fatty breasts. The US generated invasive assessment was 1.9% (422/22,131). The benign to malignant open surgical biopsy ratio was 0.17 (7/41). Adding US to negative mammography allowed for substantial incremental cancer detection rate (1.85 per thousand), particularly at age breast cancer and in dense breasts. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Transfer of /sup 131/I and /sup 95m/Tc from pasture to goat milk

    Energy Technology Data Exchange (ETDEWEB)

    Bondietti, E.A.; Garten, C.T. Jr.

    1984-01-01

    Field measurements were made in 1983 on the transfer of /sup 131/I and /sup 95m/Tc from spray-contaminated pasture to goat's milk. The transfer of /sup 131/I to milk was similar to that used for mathematical models in US Nuclear Regulatory Commission Regulatory Guide 1.109, which was derived from stall-feeding experiments using capsulized doses. Compared to /sup 131/I, the /sup 95m/Tc transferred to milk was about 5600 times less. The lower transfer resulted from both immobilization of technetium on pasture prior to ingestion as well as reduced gastrointestinal absorption. The results show that the food chain transfer of technetium to milk is much less than that previously expected based on inferences made from metabolism studies. 6 references, 4 figures, 1 table.

  9. Radionuclide 131I-labeled multifunctional dendrimers for targeted SPECT imaging and radiotherapy of tumors

    Science.gov (United States)

    Zhu, Jingyi; Zhao, Lingzhou; Cheng, Yongjun; Xiong, Zhijuan; Tang, Yueqin; Shen, Mingwu; Zhao, Jinhua; Shi, Xiangyang

    2015-10-01

    We report the synthesis, characterization, and utilization of radioactive 131I-labeled multifunctional dendrimers for targeted single-photon emission computed tomography (SPECT) imaging and radiotherapy of tumors. In this study, amine-terminated poly(amidoamine) dendrimers of generation 5 (G5.NH2) were sequentially modified with 3-(4'-hydroxyphenyl)propionic acid-OSu (HPAO) and folic acid (FA) linked with polyethylene glycol (PEG), followed by acetylation modification of the dendrimer remaining surface amines and labeling of radioactive iodine-131 (131I). The generated multifunctional 131I-G5.NHAc-HPAO-PEG-FA dendrimers were characterized via different methods. We show that prior to 131I labeling, the G5.NHAc-HPAO-PEG-FA dendrimers conjugated with approximately 9.4 HPAO moieties per dendrimer are noncytotoxic at a concentration up to 20 μM and are able to target cancer cells overexpressing FA receptors (FAR), thanks to the modified FA ligands. In the presence of a phenol group, radioactive 131I is able to be efficiently labeled onto the dendrimer platform with good stability and high radiochemical purity, and render the platform with an ability for targeted SPECT imaging and radiotherapy of an FAR-overexpressing xenografted tumor model in vivo. The designed strategy to use the facile dendrimer nanotechnology may be extended to develop various radioactive theranostic nanoplatforms for targeted SPECT imaging and radiotherapy of different types of cancer.We report the synthesis, characterization, and utilization of radioactive 131I-labeled multifunctional dendrimers for targeted single-photon emission computed tomography (SPECT) imaging and radiotherapy of tumors. In this study, amine-terminated poly(amidoamine) dendrimers of generation 5 (G5.NH2) were sequentially modified with 3-(4'-hydroxyphenyl)propionic acid-OSu (HPAO) and folic acid (FA) linked with polyethylene glycol (PEG), followed by acetylation modification of the dendrimer remaining surface amines and

  10. Unexpected Uptake by the Gallbladder in Post-Ablative I-131 Scan

    Directory of Open Access Journals (Sweden)

    Kemal Ünal

    2015-06-01

    Full Text Available A 47-year-old woman was diagnosed as papillary thyroid carcinoma. I-131 ablation therapy was applied following total thyroidectomy, and the whole-body scan revealed a focus of increased uptake in the right upper quadrant. Lateral view images of the uptake site showed that the focus was located near the right liver lobe. The patient was referred to radiology department for correlative abdominal Computed Tomography (CT and Ultrasonography (US to rule out a possible liver metastasis. CT images detected a gallstone in the corresponding area, which was verified by US. These methods did not reveal any metastatic disease in the liver or in other abdominal organs. This is the first published case report documents a rare false-positive finding of I-131 scan that was associated with an asymptomatic gallstone, and emphasizes the importance of correlative imaging in gallbladder related I-131 uptake.

  11. Phenotypic Microarrays Suggest Escherichia coli ST131 Is Not a Metabolically Distinct Lineage of Extra-Intestinal Pathogenic E. coli

    OpenAIRE

    Alqasim, Abdulaziz; Emes, Richard; Clark, Gemma; Newcombe, Jane; La Ragione, Roberto; McNally, Alan

    2014-01-01

    Extraintestinal pathogenic E. coli (ExPEC) are the major aetiological agent of urinary tract infections (UTIs) in humans. The emergence of the CTX-M producing clone E. coli ST131 represents a major challenge to public health worldwide. A recent study on the metabolic potential of E. coli isolates demonstrated an association between the E. coli ST131 clone and enhanced utilisation of a panel of metabolic substrates. The studies presented here investigated the metabolic potential of ST131 and o...

  12. Characterization of a cadmium-binding complex of cabbage leaves

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, G.J.

    1984-11-01

    The chemical nature of a principle, inducible cadmium-binding complex which accumulates in cabbage leaves was studied and compared with that of animal metallothionein and copper-binding proteins isolated from various organisms. The apparent molecular weight of native cabbage complex and carboxymethylated ligand of the complex under native conditions as determined by gel filtration was about 10,000 daltons. Under denaturing conditions their apparent molecular weights were about 2000 daltons. Ligand of native complex contained 37, 28, and 9 residue per cent of glutamic acid-glutamine, cysteine, and glycine, respectively, and low aromatic residue, serine and lysine content. The high acidic and low hydrophobic residue content explain the behavior of complex on electrophoresis in the presence and absence of sodium dodecyl sulfate. Its isoelectric point was below 4.0 and it bound 4 to 6 moles cadmium per mole ligand in what appear to be cadmium-mercaptide chromophores. The complex was found to be heat stable, relatively protease insensitive, and lacking in disulfide bonds. Attempts to determine the primary sequence of reduced native complex and carboxymethylated, cleaved ligand using the Edman degradation procedure were unsuccessful. An electrophoretic procedure is described for preparative isolation of purified complex and a method is described for monitoring ligand of complex as its fluorescent dibromobimane adduct. 31 references, 6 figures, 2 tables.

  13. Gender differences in cadmium and cotinine levels in prepubertal children

    DEFF Research Database (Denmark)

    Fucic, A; Plavec, D; Casteleyn, L

    2015-01-01

    ), and girls (6-7 years, 8-9 years, 10-11 years). The number of subjects per group was between 23 and 53. The cut off values were set at 0.1µg/L for Cd, and 0.8µg/L for cotinine defined according to the highest limit of quantification. The levels of Cd and cotinine were adjusted for creatinine level...... between levels of cadmium and creatinine in all children of both genders. This shows that even at such low levels the possible effect of cadmium on kidney function was present and measurable. An increase in Cd levels was evident with age. Cadmium levels were significantly different between 6-7 year old...... girls, 11 year old boys and 10-11 year old girls. As there was a balanced distribution in the number of subjects from countries included in the study, bias due to data clustering was not probable. The impact of low Cd levels on kidney function and gender differences in Cd levels needs further...

  14. Variation in electrical properties of gamma irradiated cadmium selenate nanowires

    Science.gov (United States)

    Chauhan, R. P.; Rana, Pallavi; Narula, Chetna; Panchal, Suresh; Choudhary, Ritika

    2016-07-01

    Preparation of low-dimensional materials attracts more and more interest in the last few years, mainly due to the wide field of potential commercial applications ranging from life sciences, medicine and biotechnology to communication and electronics. One-dimensional systems are the smallest dimension structures that can be used for efficient transport of electrons and thus expected to be critical to the function and integration of nanoscale devices. Nanowires with well controlled morphology and extremely high aspect ratio can be obtained by replicating a nanoporous polymer ion-track membrane with cylindrical pores of controlled dimensions. With this technique, materials can be deposited within the pores of the membrane by electrochemical reduction of the desired ion. In the present study, cadmium selenate nanowires were synthesized potentiostatically via template method. These synthesized nanowires were then exposed to gamma rays by using a 60Co source at the Inter University Accelerator Centre, New Delhi, India. Structural, morphological, electrical and elemental characterizations were made in order to analyze the effect of gamma irradiation on the synthesized nanowires. I-V measurements of cadmium selenate nanowires, before and after irradiation were made with the help of Keithley 2400 source meter and Ecopia probe station. A significant change in the electrical conductivity of cadmium selenate nanowires was found after gamma irradiation. The crystallography of the synthesized nanowires was also studied using a Rigaku X-ray diffractrometer equipped with Cu-Kα radiation. XRD patterns of irradiated samples showed no variation in the peak positions or phase change.

  15. Cytogenetic effects of cadmium accumulation on water hyacinth (Eichhornia crassipes).

    Science.gov (United States)

    Rosas, I; Carbajal, M E; Gómez-Arroyo, S; Belmont, R; Villalobos-Pietrini, R

    1984-04-01

    Cadmium was bioassayed to observe cytogenetic effects in the water hyacinth (Eichhornia crassipes). Plants were exposed for 96 hr to freshwater containing 0.01, 0.05, 0.10, 1.5, and 10 mg/liter of cadmium. Metal concentrations in tissues were determined by atomic absorption spectrophotometry. The highest level was found in roots, thus root-tip cells were used for cytogenetic studies; after 24 hr of exposure, micronuclei, c-mitotic effects, and pycnosis were detected and after 48 hr polyploidy was observed. A linear relationship between frequencies of micronuclei and cadmium concentrations was found: at 1.5, and 10 mg/liter micronuclei numbers were always the lowest. The inhibition of cell proliferation. shown by the low mitotic index, was proportional to the concentration and time of exposure. From the results presented in this paper it may be concluded that water hyacinth is a good sensor, due to its fast rate of metal accumulation, which allows an easy way to determine the presence of potential mutagenic compounds in water.

  16. Therapy of hepatocellular carcinoma with iodine-131-lipiodol. Results in a large German cohort

    Energy Technology Data Exchange (ETDEWEB)

    Risse, J.H. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Univ. Clinic of Nuclear Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Rabe, C. [Univ. Clinic of Internal Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Pauleit, D. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Inst. of Medicine, Research Center Juelich (Germany); Reichmann, K.; Biersack, H.J.; Palmedo, H. [Univ. Clinic of Nuclear Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Menzel, C.; Gruenwald, F. [Univ. Clinic of Nuclear Medicine, Johann-Wolfgang-Goethe-Univ., Frankfurt am Main (Germany); Strunk, H. [Univ. Clinic of Radiology, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany)

    2006-07-01

    Aim: to evaluate the efficacy and tolerance of iodine-131-lipiodol ({sup 131}I-lipiodol) for hepatocellular carcinoma (HCC) in German long term patients and comparison with medically treated controls. Patients, Methods: 38 courses of intra-arterial {sup 131}I-lipiodol therapy with a total activity up to 6.7 GBq were performed in 18 patients with HCC (6 with portal vein thrombosis). Liver and tumour volume and lipiodol deposition were measured by computed tomography and {sup 131}I activity by scintigraphy. Therapeutic efficacy was determined by tumour volume change and matched-pairs analysis in comparison to medically (i.e. tamoxifen or medical support) treated patients. Results: tumour volume decreased in 20/32 index nodules (63%) after the first course. Repeated therapy frequently resulted in further tumour reduction. Overall response to treatment was partial in 11 nodules, minor response in 4 nodules, and disease was stable in 12 and progressive in 5. Significant response was associated with pretherapeutic nodule volume up to 150 ml (diameter of 6.6 cm). Survival rate after 3, 6, 9, 12, 24 and 36 months was 78, 61, 50, 39, 17, and 6%. Matched-pairs analysis of survival revealed {sup 131}I-lipiodol to be superior to medical treatment. The most important side effect was a pancreatitis-like syndrome whereas overall tolerance was good. Conclusions: The long term results confirm that HCC therapy with {sup 131}I-lipiodol is effective and probably superior to medical treatment. Tumour nodules of up to 6 cm diameter are well suited for this therapy even in the presence of portal vein thrombosis. (orig.)

  17. S values for 131I based on the ICRP adult voxel phantoms.

    Science.gov (United States)

    Lamart, Stephanie; Simon, Steven L; Bouville, Andre; Moroz, Brian E; Lee, Choonsik

    2016-01-01

    To improve the estimates of organ doses from nuclear medicine procedures using (131)I, the authors calculated a comprehensive set of (131)I S values, defined as absorbed doses in target tissues per unit of nuclear transition in source regions, for different source and target combinations. The authors used the latest reference adult male and female voxel phantoms published by the International Commission on Radiological Protection (ICRP Publication 110) and the (131)I photon and electron spectra from the ICRP Publication 107 to perform Monte Carlo radiation transport calculations using MCNPX2.7 to compute the S values. For each phantom, the authors simulated 55 source regions with an assumed uniform distribution of (131)I. They computed the S values for 42 target tissues directly, without calculating specific absorbed fractions. From these calculations, the authors derived a comprehensive set of S values for (131)I for 55 source regions and 42 target tissues in the ICRP male and female voxel phantoms. Compared with the stylised phantoms from Oak Ridge National Laboratory (ORNL) that consist of 22 source regions and 24 target regions, the new data set includes 1662 additional S values corresponding to additional combinations of source-target tissues that are not available in the stylised phantoms. In a comparison of S values derived from the ICRP and ORNL phantoms, the authors found that the S values to the radiosensitive tissues in the ICRP phantoms were 1.1 (median, female) and 1.3 (median, male) times greater than the values based on the ORNL phantoms. However, for several source-target pairs, the difference was up to 10-fold. The new set of S values can be applied prospectively or retrospectively to the calculation of radiation doses in adults internally exposed to (131)I, including nuclear medicine patients treated for thyroid cancer or hyperthyroidism. Published by Oxford University Press 2015. This work is written by (a) US Government employee(s) and is in the

  18. Cardiac 131I-MIBG scintigraphy in patients with multiple system atrophy

    Directory of Open Access Journals (Sweden)

    Li WANG

    2014-03-01

    Full Text Available Background 131I-metaiodobenzylguanidine (131I-MIBG can be intaked by cardiac sympathetic postganglionic fibre, thus becomes the imaging agent to evaluate cardiac sympathetic nerve function. The aim of this study is to investigate the autonomic nerve dysfunction of patients with multiple system atrophy (MSA by using cardiac 131I-MIBG scintigraphy.  Methods Clinical data of 12 MSA patients conforming to the "secord consensus statement on the diagnosis of MSA" was analyzed by Unified Multiple System Atrophy Rating Scale (UMSARS. 131I-MIBG scintigraphy was performed in 12 MSA patients and 7 age-matched controls. Planar images of the chest were obtained 15 min, 4 h and 24 h after the intravenous injection of 3 mCi 13131I-MIBG. Cardiac 131I-MIBG uptake was quantified by comparing region of interest (ROI over heart/mediastinum (H/M ratio.  Results Cardiac 131131I-MIBG uptake ratio in MSA group was significantly less than that in control group in 15 min (1.90 ± 0.41 vs 2.38 ± 0.32, P = 0.017 and 4 h (1.96 ± 0.63 vs 2.60 ± 0.55, P = 0.039. There were significant difference (P < 0.05 between MSA group and control group.  Conclusions Cardiac 131I-MIBG uptake ratio in MSA group was less than that in control group. This finding suggests cardiac sympathetic degeneration may occur in MSA patients. doi: 10.3969/j.issn.1672-6731.2014.03.018

  19. {sup 131}I-induced changes in rat thyroid gland function

    Energy Technology Data Exchange (ETDEWEB)

    Torlak, V.; Capkun, V.; Stanicic, A. [Clinical Hospital Split, Split (Croatia). Dept. of Nuclear Medicine; Zemunik, T. [University of Split, Split (Croatia). Dept. of Medical Biology]. E-mail: tzemunik@bsb.mefst.hr; Modun, D. [University of Split, Split (Croatia). Dept. of Pharmacology; Pesutic-Pisac, V. [Clinical Hospital Split, Split (Croatia). Dept. of Pathology; Markotic, A. [University of Split, Split (Croatia). School of Medicine. Dept. of Biochemistry; Pavela-Vrancic, M. [University of Split, Split (Croatia). Faculty of Natural Sciences. Dept. of Chemistry

    2007-08-15

    Therapeutic doses of {sup 131}I administered to thyrotoxic patients may cause thyroid failure. The present study used a rat model to determine thyroid function after the administration of different doses of {sup 131}I (64-277 {mu}Ci). Thirty male Fisher rats in the experimental group and 30 in the control group (untreated) were followed for 6 months. The animals were 4 months old at the beginning of the experiment and were sacrificed at an age of 9 months. Hormone concentration was determined before {sup 131}I administration (4-month-old animals) and three times following {sup 131}I administration, when the animals were 7, 8, and 9 months old. The thyroid glands were removed and weighed, their volume was determined and histopathological examination was performed at the end of the experiment. Significant differences in serum triiodothyronine and thyroid-stimulating hormone concentration, measured at the age of 7, 8, and 9 months, were found in the experimental group. During aging of the animals, the concentration of thyroxin fell from 64.8 {+-} 8.16 to 55.0 {+-} 6.1 nM in the control group and from 69.4 {+-} 6.9 to 25.4 {+-} 3.2 nM in the experimental group. Thyroid gland volume and weight were significantly lower in the experimental than in the control group. Thyroid glands from the experimental group showed hyaline thickness of the blood vessel wall, necrotic follicles, a strong inflammatory reaction, and peeling of necrotic cells in the follicles. In conclusion, significant differences in hormone levels and histopathological findings indicated prolonged hypothyroidism after {sup 131}I administration to rats, which was not {sup 131}I dose dependent. (author)

  20. 131I therapy for 345 patients with refractory severe hyperthyroidism: Without antithyroid drug pretreatment.

    Science.gov (United States)

    Ding, Yong; Xing, Jialiu; Fang, Yi; Wang, Yong; Zhang, Youren; Long, Yahong

    2016-02-01

    The aim of this study is to evaluate the safety and long-term results of (131)I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment. From January 2002 to December 2012, 408 patients with refractory severe hyperthyroidism were treated with (131)I alone. Among them, 345 were followed up for 1 to 10 years for physical examination, thyroid function, and thyroid ultrasound. Complete Blood Count (CBC) liver function, electrocardiogram, echocardiogram, and Emission Computed Tomography (ECT) thyroid imaging were performed as indicated. The 345 patients had concomitant conditions including thyrotoxic heart disease, severe liver dysfunction, enlarged thyroid weighing 80 to 400 g, severe cytopenia, and vasculitis. One to two weeks prior to (131)I therapy, all patients were given low-iodine diet. The dose of (131)I therapy was 2.59 to 6.66 MBq (70 to180 µCi) per gram of thyroid with an average of 3.83 ± 0.6 MBq (103.6 ± 16.4 µCi); and the total (131)I activity administrated for the individuals was 111 to 3507.6 MBq (3.0 to 94.8 mCi, mean 444 ± 336.7 MBq (12.0 ± 9.1 mCi)). Out of the 408 patients, 283 were cured, 15 with complete remission, and 47 with incomplete remission. No treatment failure or significant clinical worsening was noted in these patients. Our data indicated that (131)I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment is safe and effective. © 2015 by the Society for Experimental Biology and Medicine.