
Sample records for cadmium 119

  1. Effects of inoculation of biosurfactant-producing Bacillus sp. J119 on plant growth and cadmium uptake in a cadmium-amended soil

    Energy Technology Data Exchange (ETDEWEB)

    Sheng Xiafang [MOA Key Laboratory of Microbiological Engineering of Agricultural Environment, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China)], E-mail:; He Linyan; Wang Qingya; Ye Hesong; Jiang Chunyu [MOA Key Laboratory of Microbiological Engineering of Agricultural Environment, College of Life Science, Nanjing Agricultural University, Nanjing 210095 (China)


    A biosurfactant-producing Bacillus sp. J119 isolated from heavy metal contaminated soils was investigated for its effects on the plant growth-promoting characteristics and heavy metal and antibiotic resistance. A pot experiment was conducted for investigating the capability of the biosurfactant-producing bacterial strain Bacillus sp. J119 to promote the plant growth and cadmium uptake of rape, maize, sudangrass and tomato in soil artificially contaminated with different levels of cadmium (Cd) (0 and 50 mg kg{sup -1}). The strain was found to exhibit different multiple heavy metal (Pb, Cd, Cu, Ni and Zn) and antibiotic (kanamycin, streptomycin, ampicillin, tetracycline and rifampin) resistance characteristics. The strain had the capacity to produce indole acetic acid (IAA) and siderophores. Cd treatment did not significantly decreased growth of tomato, maize and rape plants, but Cd treatment significantly decreased growth of sudangrass (p < 0.05). In the Cd-added soil, above-ground biomass and root dry weights of tomatoes were increased by 24 and 59%, respectively, in live bacterial inoculation compared to dead bacterial inoculation control. There were no obvious differences in the above-ground tissue and root dry weight of maize and sudangrass between live bacterial inoculation and dead bacterial inoculation. In the soil treated with 50 mg Cd kg{sup -1}, increase in above-ground tissue Cd content varied from 39 to 70% in live bacterium-inoculated plants compared to dead bacterium-inoculated control. In addition, among the inoculated plants, tomato was the greatest Cd accumulator. The bacterial strain was also able to colonize and develop in the rhizosphere soils after root inoculation.

  2. Cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium is a heavy metal of considerable environmental and occupational concern. Cadmium compounds are classified as human carcinogens by several regulatory agencies. The most convincing data that cadmium is carcinogenic in humans comes from studies indicating occupational cadmium exposure is associated with lung cancer. Cadmium exposure has also been linked to human prostate and renal cancer, although this linkage is weaker than for lung cancer. Other target sites of cadmium carcinogenesis in humans, such as liver, pancreas and stomach, are considered equivocal. In animals, cadmium effectively induces cancers at multiple sites and by various routes. Cadmium inhalation in rats induces pulmonary adenocarcinomas, in accord with its role in human lung cancer. Cadmium can induce tumors and/or preneoplastic lesions within the rat prostate after ingestion or injection. At relatively high doses, cadmium induces benign testicular tumors in rats, but these appear to be due to early toxic lesions and loss of testicular function, rather than from a specific carcinogenic effect of cadmium. Like many other metals, cadmium salts will induce mesenchymal tumors at the site of subcutaneous (s.c.) or intramuscular (i.m.) injections, but the human relevance of these is dubious. Other targets of cadmium in rodents include the liver, adrenal, pancreas, pituitary, and hematopoietic system. With the exception of testicular tumors in rodents, the mechanisms of cadmium carcinogenesis are poorly defined. Cadmium can cause any number of molecular lesions that would be relevant to oncogenesis in various cellular model systems. Most studies indicate cadmium is poorly mutagenic and probably acts through indirect or epigenetic mechanisms, potentially including aberrant activation of oncogenes and suppression of apoptosis

  3. 29 CFR 452.119 - Indirect elections. (United States)


    ... 29 Labor 2 2010-07-01 2010-07-01 false Indirect elections. 452.119 Section 452.119 Labor... STANDARDS GENERAL STATEMENT CONCERNING THE ELECTION PROVISIONS OF THE LABOR-MANAGEMENT REPORTING AND DISCLOSURE ACT OF 1959 Election Procedures; Rights of Members § 452.119 Indirect elections. National...

  4. 49 CFR 1522.119 - Training. (United States)


    ... 49 Transportation 9 2010-10-01 2010-10-01 false Training. 1522.119 Section 1522.119 Transportation... § 1522.119 Training. (a) Initial training. The validation firm must ensure that its validators and individuals who will assist in conducting assessments have completed the initial training prescribed by...

  5. 7 CFR 1260.119 - Beef. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Beef. 1260.119 Section 1260.119 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Promotion and Research Order Definitions § 1260.119 Beef. Beef means flesh of cattle....

  6. 40 CFR 89.119 - Emission tests. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Emission tests. 89.119 Section 89.119... EMISSIONS FROM NEW AND IN-USE NONROAD COMPRESSION-IGNITION ENGINES Emission Standards and Certification Provisions § 89.119 Emission tests. (a) Manufacturer testing. (1) Upon completion of service...

  7. 9 CFR 590.119 - Political activity. (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Political activity. 590.119 Section 590.119 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE EGG... Service § 590.119 Political activity. Inspectors are forbidden during the period of their...

  8. 46 CFR 119.330 - Pressure vessels. (United States)


    ... 46 Shipping 4 2010-10-01 2010-10-01 false Pressure vessels. 119.330 Section 119.330 Shipping COAST... Machinery § 119.330 Pressure vessels. All unfired pressure vessels must be installed to the satisfaction of the cognizant OCMI. The design, construction, and original testing of such unfired pressure...

  9. 46 CFR 119.700 - General. (United States)



  10. 28 CFR 0.119 - Organization. (United States)


    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Organization. 0.119 Section 0.119 Judicial Administration DEPARTMENT OF JUSTICE ORGANIZATION OF THE DEPARTMENT OF JUSTICE 1-Office of Community Oriented Policing Services § 0.119 Organization. The Office of Community Oriented...

  11. 24 CFR 27.119 - Redemption rights. (United States)


    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Redemption rights. 27.119 Section 27.119 Housing and Urban Development Office of the Secretary, Department of Housing and Urban... Single Family Mortgages § 27.119 Redemption rights. Only for purposes of redemption rights under...

  12. Predictions of synthesizing element 119 and 120

    Institute of Scientific and Technical Information of China (English)


    The evaporation residue cross sections of synthesizing superheavy nuclei Z=119, 120 are calculated by different sets of master equations with different dynamical variables. Two methods basically predicted similar results that the Ca induced hot fusion can 48 produce element 119 easier than produce 120, and the evaporation residue cross sections for 119 are detectable by current advanced techniques, while the evaporation residue cross sections are below 0.1 pb for producing element 120.

  13. 46 CFR 119.100 - Intent. (United States)


    ... OVERNIGHT ACCOMMODATIONS FOR MORE THAN 49 PASSENGERS MACHINERY INSTALLATION General Provisions § 119.100 Intent. This part contains requirements for the design, construction, installation, and operation...

  14. 13 CFR 119.2 - Definitions. (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Definitions. 119.2 Section 119.2 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION PROGRAM FOR INVESTMENT IN MICROENTREPRENEURS... entrepreneurs, such as, but not limited to, assistance intended to enhance business planning,...

  15. GPR119 as a fat sensor

    DEFF Research Database (Denmark)

    Hansen, Harald S; Rosenkilde, Mette M; Holst, Jens Juul;


    acting through, for example, GPR40, but is also probably mediated in large part through the luminal formation of 2-monoacylglycerol acting on the 'fat sensor' GPR119. In the pancreas GPR119 may also be stimulated by 2-monoacylglycerol generated from local turnover of pancreatic triacylglycerol. Knowledge...

  16. 46 CFR 119.400 - Applicability. (United States)



  17. 46 CFR 119.200 - General. (United States)



  18. 46 CFR 119.320 - Water heaters. (United States)



  19. 46 CFR 119.310 - Installations. (United States)



  20. 46 CFR 119.600 - General. (United States)



  1. 46 CFR 119.405 - Fuel restrictions. (United States)



  2. 46 CFR 119.520 - Bilge pumps. (United States)



  3. 46 CFR 119.420 - Engine cooling. (United States)



  4. 46 CFR 119.540 - Ballast systems. (United States)



  5. 46 CFR 119.500 - General. (United States)



  6. 46 CFR 119.410 - General requirements. (United States)



  7. 40 CFR 65.119 - Recordkeeping provisions. (United States)


    ... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Recordkeeping provisions. 65.119 Section 65.119 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... assessment that identifies the representative composition of the process fluid. The assessment shall be...

  8. Dicty_cDB: SSI119 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSI119 (Link to dictyBase) - G00806 DDB0231432 Contig-U02098-1 SSI...119E (Link to Original site) SSI119F 420 SSI119Z 452 SSI119P 872 SSI119E 727 Show SSI119 Library SS (Lin...Contig Contig-U02098-1 Original site URL Representative seq. ID SSI119E (Link to Original site) Representative DNA sequence >SSI119 (SSI...119Q) /CSM/SS/SSI1-A/SSI119Q.Seq.d/ TAATTAAACAAAACAAACAAACAAAAAACTAAACTAAATATTTAAAATGTCAACATCATC

  9. Dicty_cDB: CHS119 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHS119 (Link to dictyBase) - - - Contig-U11262-1 - (Link to Original site) CHS1...19F 569 - - - - - - Show CHS119 Library CH (Link to library) Clone ID CHS119 (Link to Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHS119 (CHS119Q) /CSM/CH/CHS1-A/CHS119Q.Seq.d/ AATATTATTTATTTATT...e E Sequences producing significant alignments: (bits) Value CHS119 (CHS119Q) /CSM/CH/CHS1-A/CHS119Q.Seq.d/

  10. AcEST: CL119Contig2 [AcEST

    Lifescience Database Archive (English)

    Full Text Available CL119Contig2 1799 9 Adiantum capillus-veneris contig: CL119contig2 sequence. Link to clone list Show CL119C...ontig2 Contig ID CL119Contig2 Length 1799 Number of clones 9 Definition Adiantum cap...illus-veneris contig: CL119contig2 sequence. Link to clone list Link to clone list Clone ID BP916247 BP92045

  11. 46 CFR 119.220 - Installations. (United States)


    ... PASSENGERS OR WITH OVERNIGHT ACCOMMODATIONS FOR MORE THAN 49 PASSENGERS MACHINERY INSTALLATION Propulsion Machinery § 119.220 Installations. (a) The installation requirements for machinery and boilers for steam and... subchapter J (Electrical Engineering) of this chapter. (b) Installation of propulsion machinery of an...

  12. Income inequality and happiness in 119 nations

    NARCIS (Netherlands)

    M.C. Berg (Maarten); R. Veenhoven (Ruut)


    textabstractINCOME INEQUALITY AND HAPPINESS IN 119 NATIONS All modern nations reduce income differences to some extent, and as a result there is an ongoing discussion about what degree of income inequality is acceptable. In this discussion libertarians oppose egalitarians and a principled consensus

  13. 48 CFR 1503.408 - Evaluation of the SF 119. (United States)


    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Evaluation of the SF 119. 1503.408 Section 1503.408 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY... of the SF 119....

  14. Cadmium toxicity and treatment. (United States)

    Bernhoft, Robin A


    Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established protocols.

  15. Cadmium Toxicity and Treatment

    Directory of Open Access Journals (Sweden)

    Robin A. Bernhoft


    Full Text Available Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established protocols.

  16. Cadmium Toxicity and Treatment


    Bernhoft, Robin A.


    Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established proto...

  17. 46 CFR 119.430 - Engine exhaust pipe installation. (United States)


    ... 46 Shipping 4 2010-10-01 2010-10-01 false Engine exhaust pipe installation. 119.430 Section 119... INSTALLATION Specific Machinery Requirements § 119.430 Engine exhaust pipe installation. (a) The design of all... an exhaust pipe. (b) Exhaust gas must not leak from the piping or any connections. The piping must...

  18. 5 CFR 185.119 - Authority of the ALJ. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Authority of the ALJ. 185.119 Section 185.119 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES § 185.119 Authority of the ALJ. (a) The ALJ shall conduct a fair and impartial...

  19. 14 CFR 119.9 - Use of business names. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Use of business names. 119.9 Section 119.9... COMMERCIAL OPERATORS General § 119.9 Use of business names. (a) A certificate holder under this part may not operate an aircraft under part 121 or part 135 of this chapter using a business name other than a...

  20. 46 CFR 13.119 - Expiration of endorsement. (United States)


    ... 46 Shipping 1 2010-10-01 2010-10-01 false Expiration of endorsement. 13.119 Section 13.119 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY MERCHANT MARINE OFFICERS AND SEAMEN CERTIFICATION OF TANKERMEN General § 13.119 Expiration of endorsement. An endorsement as tankerman is valid for the...

  1. Imaging antenna array at 119 µm


    Neikirk, Dean P.; Tong, Peter P.; Rutledge, David B.; Park, Hyeon; Young, Peter E.


    A focal-plane imaging antenna array has been demonstrated at 119 µm. The array is a line of evaporated silver bow-tie antennas with bismuth microbolometer detectors on a silicon substrate. Radiation is coupled into the array by a lens placed on the back of the substrate. The bolometers are thermally isolated from the silicon substrate with a half-micron layer of polyimide. The array performance is demonstrated by coherent imaging of a series of holes at half the diffraction-limited cut-off fr...

  2. Zinc and cadmium monosalicylates

    Energy Technology Data Exchange (ETDEWEB)

    Kharitonov, Yu.Ya.; Tujebakhova, Z.K. (Moskovskij Khimiko-Tekhnologicheskij Inst. (USSR))


    Zinc and cadmium monosalicylates of the composition MSal, where M-Zn or Cd, Sal - twice deprotonated residue of salicylic acid O-HOC/sub 6/H/sub 4/COOH (H/sub 2/Sal), are singled out and characterized. When studying thermograms, thermogravigrams, IR absorption spectra, roentgenograms of cadmium salicylate compounds (Cd(OC/sub 6/H/sub 4/COO) and products of their thermal transformations, the processes of thermal decomposition of the compounds have been characterized. The process of cadmium monosalicylate decomposition takes place in one stage. Complete loss of salicylate acido group occurs in the range of 320-460 deg. At this decomposition stage cadmium oxide is formed. A supposition is made that cadmium complex has tetrahedral configuration, at that, each salicylate group plays the role of tetradentate-bridge ligand. The compound evidently has a polymer structure.

  3. 含镉粉尘治理前后工人尿镉与血镉水平分析%Analysis of urine cadmium and blood cadmium of workers before and after the cadmium dust control

    Institute of Scientific and Technical Information of China (English)

    李继猛; 皮嵩云; 张玉莲; 李娟萍; 朱洁


    Objective To analyze the urinary cadmium, blood cadmium and urinary β2-MG of workers in a zinc powder processing plant before and after the cadmium dust control, and to explore the effects of dust control on the prevention and treatment of cadmium hazards.Methods The on-site occupational hazard survey was used to investigate the changes of urine cadmium, blood cadmium and 32-MG of 84 workers exposed to cadmium before and after the treatment by self-control analysis for evaluating the effects of dust control measures in a zinc powder processing plant.Results After treatment of the cadmium dust, the geometric mean of zinc dust in the workplace significantly decreased from 3.38 mg/m3 to 2.2 2mg/m3 (P<0.01).The geometric mean concentration of blood cadmium [(2.19±1.19) μg/L] and urine cadmium [(1.96±0.74) μg/g Cr] before treatment were significantly higher than those of one year [(1.63±0.83) μg/L] and [(1.25±0.83) μg/g Cr] and two years [( 1.36±0.95) μg/L] and [(0.94±0.72) μg/g Cr] after the cadmium dust control (P<0.01), respectively.The positive correlations analysis between urine cadmium and blood cadmium concentration of one and two years before and afterthe cadmium dust treatment implied that there was significant difference ( r=0.466, P<0.01).Conclusion Dust treatment could reduce the impact of low concentration cadmium on the urine cadmium and blood cadmium concentrations of the workers exposed to cadmium, and effectively prevent the cadmium poisoning.%目的 分析某锌粉加工厂含镉粉尘治理前后作业工人尿镉、血镉和尿β2-微球蛋白的变化.方法 对锌粉加工厂粉尘进行治理,对粉尘治理前后84名镉作业工人尿镉、血镉、β2-微球蛋白水平进行自身对照分析.结果 治理后,作业场所锌尘几何均数由3.38mg/m3降至2.22mg/m3,差异有统计学意义(P<0.01).治理前调查对象的血镉、尿镉几何均数浓度[血镉(2.19±1.19)μg/L,尿镉(1.96±0.74)μg

  4. Dicty_cDB: CFJ119 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available es producing significant alignments: (bits) Value CFJ119 (CFJ119Q) /CSM/CF/CFJ1-A/CFJ119Q.Seq.d/ 151 3e-36 S...wn update 2004.12.25 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value...0 7.1 1 dna update 2003. 2. 7 Homology vs Protein Score E Sequences producing significant alignments: (bits) Value

  5. 9 CFR 113.119 - Erysipelothrix Rhusiopathiae Bacterin. (United States)



  6. GPR119 agonists: a promising approach for T2DM treatment? A SWOT analysis of GPR119. (United States)

    Kang, Sang-Uk


    Ever since its advent as a promising therapeutic target for type 2 diabetes mellitus (T2DM), G-protein-coupled receptor 119 (GPR119) has received much interest from the pharmaceutical industry. This interest peaked in June 2010, when Sanofi-Aventis agreed to pay Metabolex (Cymabay Therapeutics) US$375 million for MBX-2982, which was a representative orally active GPR119 agonist. However, Sanofi-Aventis opted to terminate the deal in May 2011 and another leading GPR119 agonist, GSK1292263, had a loss of efficacy during its clinical trial. In this review, I discuss the pros and cons of GPR119 through a strengths, weaknesses, opportunities, and threats (SWOT) analysis and propose development strategies for the eventual success of a GPR119 agonist development program. PMID:24060477

  7. GPR119 agonists: a promising approach for T2DM treatment? A SWOT analysis of GPR119. (United States)

    Kang, Sang-Uk


    Ever since its advent as a promising therapeutic target for type 2 diabetes mellitus (T2DM), G-protein-coupled receptor 119 (GPR119) has received much interest from the pharmaceutical industry. This interest peaked in June 2010, when Sanofi-Aventis agreed to pay Metabolex (Cymabay Therapeutics) US$375 million for MBX-2982, which was a representative orally active GPR119 agonist. However, Sanofi-Aventis opted to terminate the deal in May 2011 and another leading GPR119 agonist, GSK1292263, had a loss of efficacy during its clinical trial. In this review, I discuss the pros and cons of GPR119 through a strengths, weaknesses, opportunities, and threats (SWOT) analysis and propose development strategies for the eventual success of a GPR119 agonist development program.

  8. Cadmium status in Egypt

    Institute of Scientific and Technical Information of China (English)


    It is inferred from these studies that releases of Cd are still increasing and it is recommended that measures must be taken to reduce emissions of cadmium. Any cadmium discharged into the Egyptian environment may move from one compartment to another at varying rates,resulting in an accumulation in compartments such as soils and biota. Such accumulation can be expected to increase with continued emissions,and attention should be given to all sources of cadmium, natural as well as anthropogenic especially in the industrial cities in Egypt. Cadmium present in sewage, as well as industrial effluent (also, other liquid and solid wastes) and sewage sludge will increase levels in soils and is xpected to contribute to dietary levels and body burdens. The current information indicates that such effects may have to be evaluated over long periods of time, possibly as long as 50 - 100 years.

  9. 37 CFR 11.9 - Limited recognition in patent matters. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Limited recognition in patent matters. 11.9 Section 11.9 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE REPRESENTATION OF OTHERS BEFORE THE UNITED STATES PATENT AND TRADEMARK...

  10. 49 CFR 215.119 - Defective freight car truck. (United States)


    ... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD FREIGHT CAR SAFETY STANDARDS Freight Car Components Suspension System § 215.119 Defective freight car truck. A railroad may not place or continue in service a... 49 Transportation 4 2010-10-01 2010-10-01 false Defective freight car truck. 215.119 Section...

  11. 21 CFR 119.1 - Dietary supplements containing ephedrine alkaloids. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dietary supplements containing ephedrine alkaloids. 119.1 Section 119.1 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION DIETARY SUPPLEMENTS THAT PRESENT A SIGNIFICANT...

  12. 19 CFR 11.9 - Special marking on certain articles. (United States)


    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Special marking on certain articles. 11.9 Section... OF THE TREASURY PACKING AND STAMPING; MARKING Marking § 11.9 Special marking on certain articles. (a... of additional U.S. Note 4, Chapter 91. If any article so required to be marked is found not to...

  13. 46 CFR 119.435 - Integral fuel tanks. (United States)



  14. 46 CFR 119.510 - Bilge piping system. (United States)



  15. 46 CFR 119.458 - Portable fuel systems. (United States)



  16. 21 CFR 133.119 - Colby cheese for manufacturing. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Colby cheese for manufacturing. 133.119 Section... Standardized Cheese and Related Products § 133.119 Colby cheese for manufacturing. Colby cheese for manufacturing conforms to the definition and standard of identity prescribed for colby cheese by §...

  17. Dietary cadmium intake and breast cancer risk in Japanese women: a case-control study. (United States)

    Itoh, Hiroaki; Iwasaki, Motoki; Sawada, Norie; Takachi, Ribeka; Kasuga, Yoshio; Yokoyama, Shiro; Onuma, Hiroshi; Nishimura, Hideki; Kusama, Ritsu; Yokoyama, Kazuhito; Tsugane, Shoichiro


    Cadmium, an environmental pollutant, may act like an estrogen and be a potential risk factor for estrogen-dependent diseases such as breast cancer. We examined the hypothesis that higher dietary cadmium intake is associated with risk of overall and hormone receptor-defined breast cancer in Japanese women, a population with a relatively high cadmium intake. The study was conducted under a case-control design in 405 eligible matched pairs from May 2001 to September 2005 at four hospitals in Nagano Prefecture, Japan. Dietary cadmium intake was estimated using a food frequency questionnaire. Multivariable-adjusted odds ratios (ORs) and 95% confidence intervals (CIs) of breast cancer and its hormone-receptor-defined subtypes were calculated by tertile of dietary cadmium intake. We found no significant association between dietary cadmium and risk of total breast cancer in either crude or multivariable-adjusted analysis. Adjusted ORs for tertiles of cadmium intake were 1.00, 1.19, and 1.23 (95% CI, 0.76-2.00; P for trend=0.39) for whole breast cancer. Further, no significant associations were seen across strata of menopausal status, smoking, and diabetes in multivariable-adjusted models except for adjusted OR for continuous cadmium intake in postmenopausal women. A statistically significant association was found for estrogen receptor-positive (ER+) tumors among postmenopausal women (adjusted OR=1.00, 1.16, and 1.94 [95% CI, 1.04-3.63; P for trend=0.032]). Although the present study found no overall association between dietary cadmium intake and breast cancer risk, higher cadmium intake was associated with increased risk of ER+ breast cancer in postmenopausal women, at least at regular intake levels in Japanese women in the general population. Further studies are needed to confirm this association. PMID:23608001

  18. Plausible Mechanisms of Cadmium Carcinogenesis (United States)

    Cadmium is a transition metal and an ubiquitous environmental and industrial pollutant. Laboratory animal studies and epidemiological studies have shown that exposure to cadmium is associated with various organ toxicities and carcinogenic effects. Several national and internation...

  19. Cadmium absorption inhibitors for soil

    Energy Technology Data Exchange (ETDEWEB)

    Kitamura, S.


    Cadmium absorption by soil is one cause of soil pollution. Cadmium adsorption inhibitors were prepared by mixing alginic acid which contained brown algae (Ascophyllum nodosum) and an inorganic material, shell fossils. This mixture was highly effective in preventing cadmium absorption by the soil.

  20. Dicty_cDB: AHA119 [Dicty_cDB

    Lifescience Database Archive (English)


  1. IMRT Commissioning: application of the AAPM's TG-119; Comissionamento de IMRT: aplicacao do TG-119 da AAPM

    Energy Technology Data Exchange (ETDEWEB)

    Zeppellini, Caroline; Furnari, Laura, E-mail: [Universidade de Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Inst. de Radiologia


    In order to verify the commissioning of the planning of intensity-modulated radiation therapy system (IMRT), the TG-119 of the American Association of Physicists in Medicine (AAPM) was applied. Using pre defined targets and normal structures, plans were realized, absolute and relative dose were measured with an ionizing chamber and films, and the results were compared with planned values. The maximum deviation of the measurements with the ionization chamber was 3,6%, but, in the total eleven measurements, only two were bigger than the tolerance limit of 3%, recommended by TG-119. The number of points which passed criteria gamma 3% to 3 mm ranged between 96.36% and 99.92%, all measurements were within the recommended 95%. The confidence limits found for both film and for chamber were lower than those achieved in the TG-119. Our results showed a good concordance with TG-119, what means that the system is adequate for clinical applications. (author)

  2. Cadmium in Sweden - environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Parkman, H.; Iverfeldt, Aa. [Swedish Environmental Research Inst. (Sweden); Borg, H.; Lithner, G. [Stockholm Univ. (Sweden). Inst. for Applied Environmental Research


    This report aims at assessing possible effects of cadmium in the Swedish environment. Swedish soils and soft freshwater systems are, due to a generally poor buffering capacity, severely affected by acidification. In addition, the low salinity in the Baltic Sea imply a naturally poor organism structure, with some important organisms living close to their limit of physiological tolerance. Cadmium in soils is mobilized at low pH, and the availability and toxicity of cadmium in marine systems are enhanced at low salinity. The Swedish environment is therefore extra vulnerable to cadmium pollution. The average concentrations of cadmium in the forest mor layers, agricultural soils, and fresh-waters in Sweden are enhanced compared to `back-ground concentrations`, with a general increasing trend from the north to the south-west, indicating strong impact of atmospheric deposition of cadmium originating from the central parts of Europe. In Swedish sea water, total cadmium concentrations, and the fraction of bio-available `free` cadmium, generally increases with decreasing salinity. Decreased emissions of cadmium to the environment have led to decreasing atmospheric deposition during the last decade. The net accumulation of cadmium in the forest mor layer has stopped, and even started to decrease. In northern Sweden, this is due to the decreased deposition, but in southern Sweden the main reason is increased leakage of cadmium from the topsoil as a consequence of acidification. As a result, cadmium in the Swedish environments is undergoing an extended redistribution between different soil compartments, and from the soils to the aquatic systems. 90 refs, 23 figs, 2 tabs. With 3 page summary in Swedish

  3. S Tank Farm SL-119 saltwell piping failure analysis report

    Energy Technology Data Exchange (ETDEWEB)

    Carlos, W.C.


    On January 24, 1992, while pressure testing saltwell line SL-119 in the 241-S Tank Farm, water was observed spraying out of heat trace enclosure. The SL-115, SL-116, SN-215, and SN-216 saltwell lines also recently failed pressure testing because of leaks. This study documents the pertinent facts about the SL-119 line and discusses the cause of the failures. The inspection of the SL-119 failure revealed two through-the-wall holes in the top center of the pipeline. The inspection also strongly suggests that the heat tracing system is directly responsible for causing the SL-119 failure. Poor design of the heat tracing system allowed water to enter, condense, and collect in the electric metallic tubing (EMT) carbon steel conduits. Water flowed to the bottom of the elbow of the conduit and corroded out the elbow. The design also allowed drifting desert sand to enter into the conduit and fall to the bottom (elbow) of the conduit. The sand became wet and aided in the corrosion of the elbow of the conduit. After the EMT conduits corroded though, the water dripped from the corroded ends of the EMT conduits onto the top of the saltwell pipe, corroding the two holes into the top of the line. If the heat tracing hot splice box had not allowed moisture to enter the EMT conduits, the saltwell piping would not have corroded and caused SL-119 to fail.

  4. S Tank Farm SL-119 saltwell piping failure analysis report

    International Nuclear Information System (INIS)

    On January 24, 1992, while pressure testing saltwell line SL-119 in the 241-S Tank Farm, water was observed spraying out of heat trace enclosure. The SL-115, SL-116, SN-215, and SN-216 saltwell lines also recently failed pressure testing because of leaks. This study documents the pertinent facts about the SL-119 line and discusses the cause of the failures. The inspection of the SL-119 failure revealed two through-the-wall holes in the top center of the pipeline. The inspection also strongly suggests that the heat tracing system is directly responsible for causing the SL-119 failure. Poor design of the heat tracing system allowed water to enter, condense, and collect in the electric metallic tubing (EMT) carbon steel conduits. Water flowed to the bottom of the elbow of the conduit and corroded out the elbow. The design also allowed drifting desert sand to enter into the conduit and fall to the bottom (elbow) of the conduit. The sand became wet and aided in the corrosion of the elbow of the conduit. After the EMT conduits corroded though, the water dripped from the corroded ends of the EMT conduits onto the top of the saltwell pipe, corroding the two holes into the top of the line. If the heat tracing hot splice box had not allowed moisture to enter the EMT conduits, the saltwell piping would not have corroded and caused SL-119 to fail


    Directory of Open Access Journals (Sweden)

    Henryka Langauer-Lewowicka


    Full Text Available The paper presents some information about current status of cadmium as an environmental health problem. Agricultural uses of phosphate fertilizers, sewage sludge and industrial uses of Cd are the major source of widespread of this metal at trace levels into the general environment and human foodstuffs. It is well known that high cadmium (Cd exposure causes renal damage, anemia, enteropathy, osteoporosis, osteomalacia, whereas the dose-response relationship at low levels exposure is less established. During the last decade an increasing number of studies have found an adverse health effects due to low environmental exposure to Cd. Many authors try to determine the relationship between Cd intake and Cd toxicity indicators, especially dealing renal tubular damage. The level of b2-microglobulin in urine is regarded as the most sensitive biomarker of renal disfunction due to low environmental Cd concentrations.

  6. Cadmium sulfite hexahydrate revisited

    Directory of Open Access Journals (Sweden)

    Sergio Baggio


    Full Text Available The present structural revision of the title compound, tetracadmium tetrasulfite hexahydrate, [Cd4(SO34(H2O5]·H2O, is a low-temperature upgrade (T = 100 K and R = 0.017 of the original room-temperature structure reported by Kiers & Vos [Cryst. Struct. Commun. (1978. 7, 399–403; T = 293 K and R = 0.080. The compound is a three-dimensional polymer with four independent cadmium centres, four sulfite anions and six water molecules, five of them coordinated to two cadmium centres and the remaining one an unbound solvent molecule which completes the asymmetric unit. There are two types of cadmium environment: CdO8 (through four chelating sulfite ligands and CdO6 (by way of six monocoordinated ligands. The former groups form planar arrays [parallel to (001 and separated by half a unit cell translation along c], made up of chains running along [110] and [overline{1}10], respectively. These chains are, in turn, interconnected both in an intraplanar as well as in an interplanar fashion by the latter CdO6 polyhedra into a tight three-dimensional framework. There is, in addition, an extensive network of hydrogen bonds, in which all 12 water H atoms act as donors and eight O atoms from all four sulfite groups and two water molecules act as acceptors.

  7. Magnetic hyperfine fields on 119Sn nuclei in uranium compounds

    International Nuclear Information System (INIS)

    119Sn Moessbauer spectroscopy studies were performed on 12 uranium intermetallic compounds in order to investigate correlations between the formation of the magnetic moment on the U atom and the magnetic hyperfine field transferred to 119Sn nuclei in magnetically ordered materials. The measured hyperfine fields (Hhf) are related to the values of the ordered U magnetic moments (μB) by μoHhf/n=A μU. The parameter A varies between 0.73 (UGa2) and 1.55 (UGe2). It seems to correlate with the extent of the hybridization of the 5f states with the conduction electron states. (orig.)

  8. Cadmium in blood and hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Ki-Do; Lee, Mi-Sun [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of); Paek, Domyung [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of)], E-mail:


    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 {mu}g/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 {mu}g/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population.

  9. Projectbeschrijving Cadmium-informatiepunt (CIP)

    NARCIS (Netherlands)

    Meijer PJ


    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 19

  10. Projectbeschrijving Cadmium-informatiepunt (CIP)


    Meijer PJ


    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 1989, mentioned in this report.

  11. 21 CFR 812.119 - Disqualification of a clinical investigator. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Disqualification of a clinical investigator. 812... SERVICES (CONTINUED) MEDICAL DEVICES INVESTIGATIONAL DEVICE EXEMPTIONS Responsibilities of Investigators § 812.119 Disqualification of a clinical investigator. (a) If FDA has information indicating that...

  12. 14 CFR 135.119 - Prohibition against carriage of weapons. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Prohibition against carriage of weapons... Flight Operations § 135.119 Prohibition against carriage of weapons. No person may, while on board an aircraft being operated by a certificate holder, carry on or about that person a deadly or dangerous...

  13. 37 CFR 1.19 - Document supply fees. (United States)


    ... COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES General Provisions Fees and Payment of Money § 1.19... the Office within one business day of receipt and delivery to an Office Box or by electronic means (e.g., facsimile, electronic mail)—$3.00 (2) Printed copy of a plant patent in color: $15.00. (3)...

  14. 25 CFR 700.119 - Establishment of fair market value. (United States)


    ... 25 Indians 2 2010-04-01 2010-04-01 false Establishment of fair market value. 700.119 Section 700... value. (a) General. The Commission shall establish the amount of fair market value to be offered to the... recommendations as to the fair market value of the habitations and/or improvements; or (2) The fair market...

  15. 49 CFR 383.119 - Requirements for tank vehicle endorsement. (United States)


    ... 49 Transportation 5 2010-10-01 2010-10-01 false Requirements for tank vehicle endorsement. 383.119... Requirements for tank vehicle endorsement. In order to obtain a Tank Vehicle Endorsement, each applicant must... of varying product densities; (f) Effects of road grade and curvature on motor vehicle handling...

  16. 29 CFR 1926.1127 - Cadmium. (United States)


    ... containment of cadmium or materials containing cadmium on the site or location at which construction...) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1127 Cadmium. (a... forms, in all construction work where an employee may potentially be exposed to cadmium....

  17. Cadmium exposure in the Swedish environment

    Energy Technology Data Exchange (ETDEWEB)



    This report gives a thorough description of cadmium in the Swedish environment. It comprises three parts: Cadmium in Sweden - environmental risks;, Cadmium in goods - contribution to environmental exposure;, and Cadmium in fertilizers, soil, crops and foods - the Swedish situation. Separate abstracts have been prepared for all three parts

  18. Cadmium in newborns


    Eklund, Gunilla


    Cadmium (Cd) is a well-known nephrotoxic environmental contaminant but there are indications that the developing nervous system might be even more sensitive to Cd than the kidneys in adults. Infants are exposed to Cd from various formulas and infant diets and the gastrointestinal Cd uptake is believed to be higher in newborns than in adults. Cd levels monitored in infant foods ranged between 0.74 and 27.0 µg/kg. Cow's milk formulas had the lowest levels and cereal-based formulas had up to 21 ...

  19. Cadmium immobilization by hydroxyapatite

    Directory of Open Access Journals (Sweden)

    Smičiklas Ivana D.


    Full Text Available The contamination of air, soil and water by cadmium is a great environmental problem. If cadmium occurs in nature in ionic form, soluble in water, it easily enters into the food chain. Hydroxyapatite (HAP, Ca-o(POAe(OH2 is a sparingly soluble salt and an excellent matrix for the removal of heavy metals from solutions. Considerable research attention has been paid to the bond between Cc/2+ ions and synthetic hydroxyapatite of known composition. The sorption mechanism is complex. The dominant process is ion exchange, but surface adsorption, surface complexation and coprecipitation can also contribute to the overall mechanism. The sorption capacity depends on the characteristics of hydroxyapatite itself and on the experimental conditions. Under optimum conditions a maximum capacity of 0.8 mol Cd2+/mol HAP can be achieved. HAP is a potential sorbent for the remediation of contaminated water and soil, for industrial waste treatment, and it is also referenced as a material that can be used as a barrier around waste depositories.

  20. Nuclear model calculations on the production of {sup 119}Sb via various nuclear reactions

    Energy Technology Data Exchange (ETDEWEB)

    Sadeghi, Mahdi, E-mail: [Agricultural, Medical and Industrial Research School, Nuclear Science and Technology Research Institute, P.O. Box 31485/498, Karaj (Iran, Islamic Republic of); Enferadi, Milad [Research and Science Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of)


    Only very few radionuclides exist that decay exclusively by EC-mode without accompanying radiation, {sup 119}Sb is one of them. Auger emitter {sup 119}Sb (T{sub 1/2} = 38.9 h, I{sub EC} = 100%) is a potent nuclide for targeted radionuclide therapy based on theoretical dosimetry calculations at a subcellular scale. Auger electron emitting radionuclides in cancer therapy offer the opportunity to deliver a high radiation dose to the tumor cells with high radiotoxicity while minimizing toxicity to normal tissue. {sup 119}Sb excitation function via {sup 119}Sn(p,n){sup 119}Sb, {sup 120}Sn(p,2n){sup 119}Sb, {sup 121}Sb(p,3n){sup 119}Te {yields} {sup 119}Sb, {sup 122}Sn(p,4n){sup 119}Sb, {sup 119}Sn(d,2n){sup 119}Sb and {sup 117}Sn({alpha},2n){sup 119}Te {yields} {sup 119}Sb reactions were calculated by ALICE/91, ALICE/ASH (GDH Model and Hybrid Model) and TALYS-1.0 (equilibrium and pre-equilibrium) codes. Requisite thicknesses of targets were obtained by SRIM code for each reaction.

  1. Nuclear model calculations on the production of 119Sb via various nuclear reactions

    International Nuclear Information System (INIS)

    Only very few radionuclides exist that decay exclusively by EC-mode without accompanying radiation, 119Sb is one of them. Auger emitter 119Sb (T1/2 = 38.9 h, IEC = 100%) is a potent nuclide for targeted radionuclide therapy based on theoretical dosimetry calculations at a subcellular scale. Auger electron emitting radionuclides in cancer therapy offer the opportunity to deliver a high radiation dose to the tumor cells with high radiotoxicity while minimizing toxicity to normal tissue. 119Sb excitation function via 119Sn(p,n)119Sb, 120Sn(p,2n)119Sb, 121Sb(p,3n)119Te → 119Sb, 122Sn(p,4n)119Sb, 119Sn(d,2n)119Sb and 117Sn(α,2n)119Te → 119Sb reactions were calculated by ALICE/91, ALICE/ASH (GDH Model and Hybrid Model) and TALYS-1.0 (equilibrium and pre-equilibrium) codes. Requisite thicknesses of targets were obtained by SRIM code for each reaction.

  2. Cadmium(2) complexes of cytosine

    International Nuclear Information System (INIS)

    Complexes of cadmium(2) with cytosine obtained from aqueous or physiological solutions at room temperature are reported. The complexes were characterized by spectroscopic, conductometric, 1H-NMR, and 13C-NMR measurements and also by thermogravimetry. (Authors)

  3. Discovery of the Cadmium Isotopes


    Amos, S.; Thoennessen, M


    Thirty-seven cadmium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  4. Cadmium telluride nuclear radiation detectors

    International Nuclear Information System (INIS)

    The characteristics and performance of undoped high resistivity cadmium telluride detectors are compared to chlorine lifted counters. It is shown, in particular, that Undodep CdTe is in fact aluminium doped and that compensation occurs, as an silicon or germanium, by pair and triplet formation between the group III donor and the doubly charged cadmium vacancy acceptor. Furthermore, in chlorine doped samples, the polarization effect results from the unpaired level at Esub(c)-0,6eV

  5. Speciation of Dissolved Cadmium

    DEFF Research Database (Denmark)

    Holm, Peter Engelund; Andersen, Sjur; Christensen, Thomas Højlund


    ) method separates dissolved Cd into free divalent Cd (Cd 2+) and complexed Cd and furthermore separates the latter into the operationally defined forms: labile, slowly labile and stable complexes. The dialysis (ED) method determines high molecular weight Cd complexes (above 1000mol. wt). For both methods...... the reproducibility was good. By combining the results of the GEOCHEM calculations in terms of the inorganic complexes, and the IE results, the fractions of free and inorganically complexed Cd were estimated. The IE and ED results furthermore provided information about the organic complexes. Selected environmental......Equilibrium dialysis and ion exchange methods, as well as computer calculations (GEOCHEM), were applied for speciation of dissolved cadmium (Cd) in test solutions and leachate samples. The leachate samples originated from soil, compost, landfill waste and industrial waste. The ion exchange (IE...

  6. 14 CFR 119.53 - Wet leasing of aircraft and other arrangements for transportation by air. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Wet leasing of aircraft and other arrangements for transportation by air. 119.53 Section 119.53 Aeronautics and Space FEDERAL AVIATION... Chapter § 119.53 Wet leasing of aircraft and other arrangements for transportation by air. (a)...

  7. 38 CFR 4.119 - Schedule of ratings-endocrine system. (United States)


    ...-endocrine system. 4.119 Section 4.119 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS SCHEDULE FOR RATING DISABILITIES Disability Ratings The Endocrine System § 4.119 Schedule of ratings—endocrine system. Rating 7900Hyperthyroidism Thyroid enlargement, tachycardia (more than 100 beats...

  8. 15 CFR 27.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... intention of involving human subjects. 27.119 Section 27.119 Commerce and Foreign Trade Office of the Secretary of Commerce PROTECTION OF HUMAN SUBJECTS § 27.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving...

  9. 40 CFR 26.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... intention of involving human subjects. 26.119 Section 26.119 Protection of Environment ENVIRONMENTAL... Research Conducted or Supported by EPA § 26.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human...

  10. 7 CFR 917.119 - Procedure for nominating members for various Commodity Committees; meetings. (United States)


    ... Committees; meetings. 917.119 Section 917.119 Agriculture Regulations of the Department of Agriculture... Bodies § 917.119 Procedure for nominating members for various Commodity Committees; meetings. (a) The nomination procedures that appear in paragraphs (b) and (c) of this section apply to both the Peach and...

  11. 14 CFR 65.119 - Master parachute rigger certificate: Experience, knowledge, and skill requirements. (United States)


    ...: Experience, knowledge, and skill requirements. 65.119 Section 65.119 Aeronautics and Space FEDERAL AVIATION... CREWMEMBERS Parachute Riggers § 65.119 Master parachute rigger certificate: Experience, knowledge, and skill... parachute rigger and has satisfactorily packed at least 100 parachutes of each of two types in common...

  12. 48 CFR 18.119 - Use of patented technology under the North American Free Trade Agreement. (United States)


    ... under the North American Free Trade Agreement. 18.119 Section 18.119 Federal Acquisition Regulations... Available Acquisition Flexibilities 18.119 Use of patented technology under the North American Free Trade Agreement. Requirement to obtain authorization prior to use of patented technology may be waived...

  13. Zinc-induced protection against cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Early, J.L.; Schnell, R.C.


    Pretreatment of male rats with cadmium acetate potentiates the duration of hexobarbital hypnosis and inhibits the rate of hepatic microsomal drug metabolism. Pretreatment of rats with zinc acetate protects against these alterations in drug action elicited by cadmium.

  14. Imaging antenna array at 119 microns. [for plasma diagnostics (United States)

    Neikirk, N. P.; Tong, P. P.; Putledge, D. B.; Park, H.; Young, P. E.


    A focal-plane imaging antenna array has been demonstrated at 119 microns. The array is a line of evaporated silver bow-tie antennas with bismuth microbolometer detectors on a silicon substrate. Radiation is coupled into the array by a lens placed on the back of the substrate. The bolometers are thermally isolated from the silicon substrate with a half-micron layer of polyimide. The array performance is demonstrated by coherent imaging of a series of holes at half the diffraction-limited cut-off frequency.

  15. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    In Denmark and EU the exposure of cadmium from food is at a level that is relatively close to the Tolerable Daily Intake (TDI). This report describes an investigation of the bioavailability of cadmium in selected food items known to contain high levels of cadmium. The purpose was to provide data ...... or crushed linseed nor the intake of cocoa and chocolate....

  16. Mechanisms of cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd), a heavy metal of considerable occupational and environmental concern, has been classified as a human carcinogen by the International Agency for Research on Cancer (IARC). The carcinogenic potential of Cd as well as the mechanisms underlying carcinogenesis following exposure to Cd has been studied using in vitro cell culture and in vivo animal models. Exposure of cells to Cd results in their transformation. Administration of Cd in animals results in tumors of multiple organs/tissues. Also, a causal relationship has been noticed between exposure to Cd and the incidence of lung cancer in human. It has been demonstrated that Cd induces cancer by multiple mechanisms and the most important among them are aberrant gene expression, inhibition of DNA damage repair, induction of oxidative stress, and inhibition of apoptosis. The available evidence indicates that, perhaps, oxidative stress plays a central role in Cd carcinogenesis because of its involvement in Cd-induced aberrant gene expression, inhibition of DNA damage repair, and apoptosis.

  17. 49 CFR 571.119 - Standard No. 119; New pneumatic tires for motor vehicles with a GVWR of more than 4,536 kilograms... (United States)


    ... (15 U.S.C. 1392, 1401, 1421, 1423); delegation of authority at 49 CFR 1.50) Editorial Note: For Federal Register citations affecting § 571.119 see the List of CFR Sections Affected which appears in the... vehicles with a GVWR of more than 4,536 kilograms (10,000 pounds) and motorcycles. 571.119 Section...

  18. Oral cadmium chloride intoxication in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B; Svendsen, P


    Diethyldithiocarbamate (DDC) is known to alleviate acute toxicity due to injection of cadmium salts. However, when cadmium chloride was administered by the oral route, DDC enhanced rather than alleviated the acute toxicity; both oral and intraperitoneal (i.p.) administration of DDC had this effect....... Thus, orally administered DDC enhanced cadmium-induced duodenal and ileal tissue damage and inhibition of peristalsis, as indicated by an increased intestinal transit time. At low cadmium doses, the whole-body retention of cadmium was increased by oral DDC administration. Intraperitoneally administered...

  19. Arsenic-cadmium interaction in rats. (United States)

    Díaz-Barriga, F; Llamas, E; Mejía, J J; Carrizales, L; Santoyo, M E; Vega-Vega, L; Yáñez, L


    Simultaneous exposure to cadmium and arsenic is highly probable in the urban area of San Luis Potosi, Mexico due to common localization of copper and zinc smelters. Therefore, in this work, rats were intraperitoneally exposed either to cadmium or arsenic alone, or simultaneously to both metals. The effects of these treatments on three different toxicological parameters were studied. Cadmium modified the LD50 of arsenic and conversely arsenic modified the LD50 for cadmium. At the histopathological level, arsenic appeared to protect against the cadmium effects, especially on testes. This protective effect seemed to be related to the glutathione levels found in this tissue: rats exposed to both arsenic and cadmium, presented glutathione values intermediate to those observed after exposure to either metal alone; arsenic had the highest value and cadmium the lowest. In liver, rats exposed to arsenic, cadmium or arsenic and cadmium, presented glutathione values below those in the saline group, with the lowest value corresponding to the arsenic and cadmium treatment. The results appear to support the proposed interaction between arsenic and cadmium and coexposure to both metals seems to alter certain effects produced by either metal alone. PMID:2219140

  20. Determination of cadmium in biological samples. (United States)

    Klotz, Katrin; Weistenhöfer, Wobbeke; Drexler, Hans


    Analyses of cadmium concentrations in biological material are performed using inductively coupled plasma mass spectrometry (ICP-MS) and atomic absorption spectrometry (AAS), but also electrochemical methods, neutron activation analysis (NAA), and X-ray fluorescence spectrometry (XRF). The predominant sample matrices include blood, plasma, serum, and urine, as well as hair, saliva, and tissue of kidney cortex, lung, and liver. While cadmium in blood reveals rather the recent exposure situation, cadmium in urine reflects the body burden and is an indicator for the cumulative long term exposure.After chronic exposure, cadmium accumulates in the human body and causes kidney diseases, especially lesions of proximal tubular cells. A tubular proteinuria causes an increase in urinary excretion of microproteins. Excretions of retinol binding protein (RBP), β2-microglobulin (β2-M), and α1-microglobulin are validated biomarkers for analyzing cadmium effects. For this purpose, immunological procedures such as ELISA, and radio- and latex-immunoassays are used.However, proteinuria is not specific to cadmium, but can also occur after exposure to other nephrotoxic agents or due to various kidney diseases. In summary, cadmium in urine and blood are the most specific biomarkers of cadmium exposure. A combination of parameters of exposure (cadmium in blood, cadmium in urine) and parameters of effect (e.g., β2-M, RBP) is required to reveal cadmium-induced nephrological effects. PMID:23430771

  1. Insulin Expression in Rats Exposed to Cadmium

    Institute of Scientific and Technical Information of China (English)


    Objectives To investigate the effects of cadmium exposure on insulin expression in rats. Methods Eighteen adult SD assessed. The levels of cadmium and zinc in pancreas, blood and urine glucose, serum insulin and urine NAG (N-acyetyl-β-glucosaminidase) were determined. The gene expressions of metallothionein (MT) and insulin were also measured,and the oral glucose tolerance tests (OGTT) were carried out. Results The contents of cadmium in pancreas in cadmium-treated rats were higher than that in the control group, which was associated with slight increase of zinc in pancreas.not change significantly after cadmium administration, and the UNAG had no change in Cd-treated group. The gene expression the change of the expression of insulin, MT-Ⅰ and MT-Ⅱ genes. Cadmium can influence the biosynthesis of insulin, but does not induce the release of insulin. The dysfunction of pancreas occurs earlier than that of kidney after administration of cadmium.

  2. Indications for nephrectomy in children: A report on 119 cases

    Directory of Open Access Journals (Sweden)

    Ibrahim Daradka


    Full Text Available The objective of the study is to review the indications for nephrectomy in children. This study was conducted in the Division of Pediatric Surgery at the King Hussein Medical Center, Amman, Jordan, between the years 1997 and 2009. The medical records of 119 of 141 patients who underwent nephrectomy were reviewed. The patients included 67 males and 52 females, and their ages ranged from two months to 13 years. The study patients underwent simple or radical nephrectomy or nephron-sparing surgery during the 13-year period. They were studied with regard to gender, age, indication for nephrectomy, morbidity and mortality. The indications for nephrectomy were divided into benign and malignant conditions. Of the 119 nephrectomies performed, 49 patients (41.2% had malignant conditions and 70 (58.8% had a benign etiology. In the benign group, 23.5% of the patients underwent nephrectomy for complicated vesicoureteric reflux, urinary tract stones or infection (1.6%. Other conditions in this group included ureterocele, posterior urethral valve, etc. Benign conditions and ureterocele necessitating nephrectomy were predominant in female patients, while pelvi-ureteric junction obstruction was predominant in males. The malignant lesions necessitating nephrectomy included Wilms tumor and neuroblastoma. The over-all mortality rate was nil in the absence of malignancy. Obstructive nephropathy was the main cause of nephrectomy in this series, followed by malignancy of the kidney. It remains to be seen whether better management will reduce the incidence of nephrectomies in preventable cases. It is also important that children with a solitary functioning kidney have long-term follow-up.

  3. Retrospective Analysis of 119 Osteosarcomas in a Single Centre Experience

    Directory of Open Access Journals (Sweden)

    Meral Gunaldi


    Full Text Available Aim: Osteosarcomas must be managed by a team which includes pathologists, radiologists, surgeons, radiation therapists, and medical oncologists. Treatment modalities and demographic charasteristics of osteosarcomas were analysed in this study. Material and Method: Primary osteosarcomas treated between 1999-2010 in Cukurova University Medical Faculty Department of Medical Oncology were analysed retrospectively. Results: Of the total 119 patients, 74% were male and 26% female. The median age was 19. The median follow up time was 37 months. The most frequently seen sarcomas were osteoblastic at 82.4%. Localization of the disease was found to be 55% in the lower extremity, 14.1% in the upper extremity, 13% in the head-neck, 6.6% in the thoracic area, and 4.1 % in the pelvic region. Some 6.41% were local stage, 25.64% locally advanced, 15.8% metastatic, and 14.10% were diagnosed with nuks disease. Chemotherapy was administered in 77 of 119 patients. Patients received different treatments: 23.1% were treated with preoperative chemotherapy, 16.67% postoperative, 9.52% palliative, 33.33% preoperative postoperative, 2.38% postoperative palliative, 9.52% preoperative postoperative palliative chemotherapy, and 4.76% of the patients did not receive chemotherapy. Both radical and conservative surgery was performed. The most common metastatic site was the lungs. The overall length of survival was 65 months (95%CI 30-59. The survival rates did not vary between the groups of preoperative, postoperative, preoperative postoperative chemotherapy and other groups (respectively 23 versus 36 versus 28 versus 44 months (p=0.8. No differences were evident for radiotherapy (p=0.06. Discussion: Osteosarcomas can be treated successfully with surgery, chemotherapy, and radiotherapy. There was no cumulative survival difference in results based on the types of chemotherapy used in this study. These results show the importance of a multimodality treatment approach including

  4. Lifetime Measurements in XENON(119-123), Cesium -121, CESIUM-123, and IODINE-119 Using the Recoil-Distance - (United States)

    Chaudhury, Arati

    Lifetime measurements were performed for transitions in the decoupled bands based on the h(,11/2) band-head in ('119-123)Xe, ('121,123)Cs and ('119)I using the Recoil Distance Method to study the systematics of reduced transition probabilities (B(E2)'s) as a function of the proton number and the neutron number in the Z > 50 region and to test the validity of various theoretical models. Levels were populated using the ('104,106,108)Pd (('19)F,p3n(gamma)), ('106,108)Pd(('19)F,4n(gamma)); ('104)Pd(('19)F,2p2n(gamma)); ('115)In(('11)B,3n(gamma)); ('115)In(('11)B,4n(gamma)) ('106)Pd(('16)O,3n(gamma)) and ('106)Pd(('16)O,p2n(gamma)) reactions on enriched, thin, self supporting, stretched targets. The stoppers were stretched gold foils of appropriate thickness. The measured mean lifetimes in ('123)Xe are 21.4 ps (15/2('-), 714 kev), 4.5 ps (19/2('-), 1331 kev) and 1.6 ps (23/2('-), 2084 kev) for ('122)Xe 108 ps (2('+), 331.5 kev), 8.7 ps (4('+), 828.8 kev), 3.6 ps (6('+), 1467.3 kev) and 1.4 ps (8('+), 2217.9 kev); for ('121)Xe 20.4 ps (15/2('-), 687 kev) and 4.0 ps (19/2('-), 1274 Kev); for ('120)Xe, 123 ps (2('+), 321.8 kev), 13 ps (4('+), 794.6 kev); 3.6 ps (6('+), 1395.6 kev); for ('119)Xe, 20.4 ps (15/2('-), 649kev), 3.9 ps (19/2('-), 1224 kev) and 1.5 ps (23/2('-), 1932 kev); for ('123)Cs are 66.5 ps (15/2(' -), 480 kev) and 5.2 ps (19/2('-), 1002 kev); for ('121)Cs, 93.2 ps (15/2('-), 286 kev), 7.6 ps (19/2('-), 758 kev) and 2.0 ps (23/2('-), 1373 kev); and for ('119)50.0 ps (15('-)/2, 1024 kev), 8.7 ps (19('-)/2, 1486 kev) and 2.2 ps (23/2('-), 2076 kev). The numbers in parentheses are the spin and energy of the given level. The systematics of the B(E2)'s obtained both as a function of proton number and the neutron number are presented and compared with the prediction of the Interacting Boson Fermion Model (IBFM) and the Particle plus Triaxial Rotor Model (PTRM) to ascertain the comparative suitability of these models in this region. Both models appear to

  5. 13 CFR 119.5 - How are PRIME grant awards allocated? (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false How are PRIME grant awards allocated? 119.5 Section 119.5 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION PROGRAM FOR INVESTMENT IN MICROENTREPRENEURS (âPRIMEâ OR âTHE ACTâ) § 119.5 How are PRIME grant awards allocated? (a) At least 50 percent of the number of...

  6. Cadmium detoxification processes in the digestive gland of cephalopods in relation to accumulated cadmium concentrations


    Bustamante, Paco; Cosson, Richard; Gallien, Isabelle; Caurant, Florence; Miramand, Pierre


    International audience The high concentrations of cadmium recorded in the digestive gland of cephalopods from various temperate and subpolar waters suggest that these molluscs have developed efficient cadmium detoxification mechanisms. The subcellular distribution of cadmium in the digestive gland cells was investigated in seven cephalopod species from the Bay of Biscay (France) and the Faroe Islands. In most species, cadmium was mainly found in the cytosolic fraction of the digestive glan...

  7. Cadmium content of plants as affected by soil cadmium concentration

    Energy Technology Data Exchange (ETDEWEB)

    Lehoczky, E. [Pannon Univ. of Agricultural Sciences, Keszthely (Hungary); Szabados, I.; Marth, P. [Plant Health and Soil Conservation Station, Higany (Hungary)


    Pot experiments were conducted in greenhouse conditions to study the effects of increasing cadmium (Cd) levels on biomass production and Cd contents in corn, (Zea mays L.), garlic (Allium sativum L.), and spinach (Spinacia oleracea L.). Plants were grown in two soil types: Eutric cambisol soil and A gleyic luvisol soil. Spinach proved to be the most sensitive to Cd treatments as its biomass considerably decreased with the increasing Cd levels. Cadmium contents of the three crops increased with increasing levels of Cd applications. Statistical differences were observed in the Cd contents of crops depending on soil type. With the same Cd rates, Cd tissue concentration of test plants grown in the strongly acidic Gleyic luvisol soil were many times higher than that of plants grown in a neutral Eutric cambisol soil. 14 refs., 4 tabs.

  8. Cadmium Exposure and Pancreatic Cancer in South Louisiana


    Luckett, Brian G.; L. Joseph Su; Rood, Jennifer C.; Elizabeth T. H. Fontham


    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney c...

  9. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    N R Munirathnam; D S Prasad; Ch Sudheer; J V Rao; T L Prakash


    We present the zone refining results of cadmium using horizontal resistive zone refiner under constant flow of moisture free hydrogen gas. The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma optical emission spectrometry (ICPOES) show that majority of the impurities are less than the detection limits. Comparatively, zinc is the most difficult impurity element to remove in cadmium matrix by zone refining.

  10. Electrodialytic Removal of Cadmium from Straw Ash

    DEFF Research Database (Denmark)

    Hansen, Henrik; Ottosen, Lisbeth M.; Villumsen, Arne;


    A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days...... of remediation. Further removal of cadmium could be possible with longer remediation time or a higher current density...

  11. 119Sn Moessbauer spectroscopy of tin containing float glass

    International Nuclear Information System (INIS)

    According to the production process of float glasses tin is used as a common refining agent. Since the surface quality of the glass strongly depends on the local distribution of Sn-redox states, the influence of process parameters on Sn2+/Sn4+ ratios and the assignment to their structural role in the glass network is extremely helpful. Therefore, glass compositions based on SiO2-Al2O3-B2O3-CaO-SnO2 were molten with additions of 0,1, 0,3 and 0,5 wt% SnO2. All samples were tempered for 7 days at 1400 C in N2 and N2-air mixtures with controlled pO2-values of 10-2 and 10-5 bar, respectively. Hyperfine parameters for the tin nucleus in different structural units and their oxidation states were calculated from 119Sn Moessbauer spectra, using theoretical simulations of electron densities and electric field gradients with the Wien2k software. Finally, the thermochemical impact of oxygen on the structure of Sn-bearing glasses is discussed

  12. Bioavailability of cadmium from linseed and cocoa


    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen


    The exposure of the European population to cadmium from food is high compared with the tolerable weekly intake of 2.5 μg/kg bodyweight set by EFSA in 2009. Only few studies on the bioavailability of cadmium from different food sources has been performed but this information in very important for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium ...

  13. The Epigenetic Effects of Prenatal Cadmium Exposure. (United States)

    Vilahur, Nadia; Vahter, Marie; Broberg, Karin


    Prenatal exposure to the highly toxic and common pollutant cadmium has been associated with adverse effects on child health and development. However, the underlying biological mechanisms of cadmium toxicity remain partially unsolved. Epigenetic disruption due to early cadmium exposure has gained attention as a plausible mode of action, since epigenetic signatures respond to environmental stimuli and the fetus undergoes drastic epigenomic rearrangements during embryogenesis. In the current review, we provide a critical examination of the literature addressing prenatal cadmium exposure and epigenetic effects in human, animal, and in vitro studies. We conducted a PubMed search and obtained eight recent studies addressing this topic, focusing almost exclusively on DNA methylation. These studies provide evidence that cadmium alters epigenetic signatures in the DNA of the placenta and of the newborns, and some studies indicated marked sexual differences for cadmium-related DNA methylation changes. Associations between early cadmium exposure and DNA methylation might reflect interference with de novo DNA methyltransferases. More studies, especially those including environmentally relevant doses, are needed to confirm the toxicoepigenomic effects of prenatal cadmium exposure and how that relates to the observed health effects of cadmium in childhood and later life.

  14. 17 CFR 1.19 - Prohibited trading in certain “puts” and “calls”. (United States)


    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Prohibited trading in certain âputsâ and âcallsâ. 1.19 Section 1.19 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION GENERAL REGULATIONS UNDER THE COMMODITY EXCHANGE ACT Prohibited Trading in Commodity Options §...

  15. 49 CFR 238.119 - Rim-stamped straight-plate wheels. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Rim-stamped straight-plate wheels. 238.119 Section... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Safety Planning and General Requirements § 238.119 Rim-stamped straight-plate wheels. (a)(1) Except as provided in paragraph (a)(2) of...

  16. 46 CFR 119.445 - Fill and sounding pipes for fuel tanks. (United States)


    ..., may be used. Such hose must overlap metallic pipe ends at least 1.5 times the pipe diameter and must... 46 Shipping 4 2010-10-01 2010-10-01 false Fill and sounding pipes for fuel tanks. 119.445 Section 119.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER...

  17. 13 CFR 119.13 - How will an applicant make a subgrant? (United States)


    ... specialized training, expanded schedules of operation, or other benefits. (b) If an applicant has identified... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false How will an applicant make a subgrant? 119.13 Section 119.13 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION PROGRAM...

  18. The Ras mutant D119N is both dominant negative and activated

    NARCIS (Netherlands)

    Cool, RH; Schmidt, G; Lenzen, CU; Prinz, H; Vogt, D; Wittinghofer, A


    The introduction of mutation D119N (or its homolog) in the NKxD nucleotide binding motif of various Ras-like proteins produces constitutively activated or dominant-negative effects, depending on the system and assay. Here we show that Ras(D119N) has an inhibitory effect at a cell-specific concentrat

  19. 38 CFR 16.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Research undertaken without the intention of involving human subjects. 16.119 Section 16.119 Pensions, Bonuses, and Veterans... the intention of involving human subjects. In the event research is undertaken without the...

  20. 45 CFR 690.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Research undertaken without the intention of involving human subjects. 690.119 Section 690.119 Public Welfare Regulations Relating to Public Welfare... the intention of involving human subjects. In the event research is undertaken without the...

  1. 2-Oleoyl glycerol is a GPR119 agonist and signals GLP-1 release in humans

    DEFF Research Database (Denmark)

    Hansen, Katrine B; Rosenkilde, Mette M; Knop, Filip K;


    Dietary fat is thought to stimulate release of incretin hormones via activation of fatty acid receptors in the intestine. However, dietary fat (triacylglycerol) is digested to 2-monoacylglycerol and fatty acids. Activation of G protein-coupled receptor 119 (GPR119) stimulates glucagon-like peptide...

  2. 33 CFR 100.119 - Newport-Bermuda Regatta, Narragansett Bay, Newport, RI (United States)


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Newport-Bermuda Regatta, Narragansett Bay, Newport, RI 100.119 Section 100.119 Navigation and Navigable Waters COAST GUARD, DEPARTMENT...-Bermuda Regatta, Narragansett Bay, Newport, RI (a) Regulated area. The regulated area includes all...

  3. 46 CFR 119.465 - Ventilation of spaces containing diesel machinery. (United States)


    ... 46 Shipping 4 2010-10-01 2010-10-01 false Ventilation of spaces containing diesel machinery. 119... MACHINERY INSTALLATION Specific Machinery Requirements § 119.465 Ventilation of spaces containing diesel machinery. (a) A space containing diesel machinery must be fitted with adequate means, such as...

  4. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp. (United States)

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn


    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

  5. Cadmium Modulates Biofilm Formation by Staphylococcus epidermidis

    NARCIS (Netherlands)

    Wu, Xueqing; Santos, Regiane R.; Fink-Gremmels, Johanna


    The aim of the study was to evaluate the effect of cadmium exposure on Staphylococcus epidermidis (ATCC 35984) biofilm formation. Bacteria were cultured in the absence or presence of different concentrations (0-50 mu M) of cadmium. Biofilm formation and bacterial viability were assessed. Quantitativ

  6. Cadmium stress in wheat seedlings: growth, cadmium accumulation and photosynthesis

    DEFF Research Database (Denmark)

    Ci, Dunwei; Jiang, Dong; Wollenweber, Bernd;


    Seedlings of wheat (Triticum aestivum L.) cultivars Jing 411, Jinmai 30 and Yangmai 10 were exposed to 0, 10, 20, 30, 40 or 50 μM of CdCl2 in a solution culture experiment. The effects of cadmium (Cd) stress on wheat growth, leaf photon energy conversion, gas exchange, and Cd accumulation in wheat...... parameters were generally depressed by Cd stress, especially under the high Cd concentrations. Cd concentration and accumulation in both shoots and roots increased with increasing external Cd concentrations. Relationships between corrected parameters of growth, photosynthesis and fluorescence and corrected...

  7. Immunoassay for Cadmium Detection and Quantification

    Institute of Scientific and Technical Information of China (English)



    Objective To detect cadmium in environmental and food samples by graphite furnace atomic absorption spectroscopy (GFAAS) and inductively coupled plasma atomic emission spectroscopy (ICPAES). Methods An indirect competitive enzyme-linked immunosorbent assay (IC-ELISA) was developed based on a cadmium-specific monoclonal antibody.IC-ELISA for cadmium in environmental and food samples was evaluated. Results IC-ELISA showed an IC50 of 45.6 μg/L with a detection limit of 1.95 μg/L for cadmium,and showed a mean recovery ranging 97.67%-107.08%.The coefficient of variations for intra- and iuterassay was 3.41%-6.61% and 4.70%-9.21%,respectively.The correlation coefficient between IC-ELISA and GFAAS was 0.998. Conclusion IC-ELISA can detect and quantify cadmium residue in environmental or food samples.

  8. Cadmium mobility and accumulation in soils of the European Communities

    NARCIS (Netherlands)

    Fraters B; van Beurden AUCJ


    In this overview of the effects of cadmium pollution on agricultural soils in the European Community, both the cadmium loads on agricultural land and the soil sensitivity to cadmium accumulation have been estimated. Cadmium loads have been estimated separately for arable land and grassland. The ef

  9. Application of (119)Sn CPMG MAS NMR for Fast Characterization of Sn Sites in Zeolites with Natural (119)Sn Isotope Abundance. (United States)

    Kolyagin, Yury G; Yakimov, Alexander V; Tolborg, Søren; Vennestrøm, Peter N R; Ivanova, Irina I


    (119)Sn CPMG MAS NMR is demonstrated to be a fast and efficient method for characterization of Sn-sites in Sn-containing zeolites. Tuning of the CPMG echo-train sequence decreases the experimental time by a factor of 5-40 in the case of as-synthesized and hydrated Sn-BEA samples and by 3 orders of magnitude in the case of dehydrated Sn-BEA samples as compared to conventional methods. In the latter case, the reconstruction of the quantitative spectrum without the loss of sensitivity is shown to be possible. The method proposed allows obtaining (119)Sn MAS NMR spectra with improved resolution for Sn-BEA zeolites with natural (119)Sn isotope abundance using conventional MAS NMR equipment. PMID:26978430

  10. China's Goal of Olympics Related to World Competing Status for "119" Gold Medals%"119"奥运竞争格局及我国的对策研究

    Institute of Scientific and Technical Information of China (English)

    鲁国斌; 熊焰; 徐佶



  11. Peculiarities of preparation of cadmium isotopes of high enrichment

    International Nuclear Information System (INIS)

    Cascade equipped by gas centrifuges with regard for requirements to structural materials operating with chemically active compounds (dimethylcadmium) was devised for preparation of high-enriched cadmium isotopes. Solutions of such problems as overcoming of isotope memory, compensation of the effect of isotope overlapping, operative analytical accompanying permitted to optimize separation process and to obtain cadmium isotopes of high enrichment degree: cadmium-116 ∼98.9 %, cadmium-114 ∼98.7 %, cadmium-113 ∼93.3 %, cadmium-112 ∼99.1 %, cadmium-110 ∼95.8 %

  12. Evaluation of the effect of divalent metal transporter 1 gene polymorphism on blood iron, lead and cadmium levels

    International Nuclear Information System (INIS)

    Divalent metal transporter 1 (DMT1), a member of the proton-coupled metal ion transporter family, mediates transport of ferrous iron from the lumen of the intestine into the enterocyte and export of iron from endocytic vesicles. It has an affinity not only for iron but also for other divalent cations including manganese, cobalt, nickel, cadmium, lead, copper, and zinc. DMT1 is encoded by the SLC11a2 gene that is located on chromosome 12q13 in humans and express four major mammalian isoforms (1A/+IRE, 1A/-IRE, 2/+IRE and 2/-IRE). Mutations or polymorphisms of DMT1 gene may have an impact on human health by disturbing metal trafficking. To study the possible association of DMT1 gene with the blood levels of some divalent cations such as iron, lead and cadmium, a single nucleotide polymorphism (SNP) (IVS4+44C/A) in DMT1 gene was investigated in 486 unrelated and healthy individuals in a Turkish population by method of polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). The genotype frequencies were found as 49.8% homozygote typical (CC), 38.3% heterozygote (CA) and 11.9% homozygote atypical (AA). Metal levels were analyzed by dual atomic absorption spectrometer system and the average levels of iron, lead and cadmium in the blood samples were 446.01±81.87 ppm, 35.59±17.72 ppb and 1.25±0.87 ppb, respectively. Individuals with the CC genotype had higher blood iron, lead and cadmium levels than those with AA and CA genotypes. Highly statistically significant associations were detected between IVS4+44 C/A polymorphism in the DMT1 gene and iron and lead levels (p=0.001 and p=0.036, respectively), but no association was found with cadmium level (p=0.344). This study suggested that DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, lead and cadmium levels. - Highlights: • DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, cadmium and lead levels.

  13. Evaluation of the effect of divalent metal transporter 1 gene polymorphism on blood iron, lead and cadmium levels

    Energy Technology Data Exchange (ETDEWEB)

    Kayaaltı, Zeliha, E-mail:; Akyüzlü, Dilek Kaya; Söylemezoğlu, Tülin


    Divalent metal transporter 1 (DMT1), a member of the proton-coupled metal ion transporter family, mediates transport of ferrous iron from the lumen of the intestine into the enterocyte and export of iron from endocytic vesicles. It has an affinity not only for iron but also for other divalent cations including manganese, cobalt, nickel, cadmium, lead, copper, and zinc. DMT1 is encoded by the SLC11a2 gene that is located on chromosome 12q13 in humans and express four major mammalian isoforms (1A/+IRE, 1A/-IRE, 2/+IRE and 2/-IRE). Mutations or polymorphisms of DMT1 gene may have an impact on human health by disturbing metal trafficking. To study the possible association of DMT1 gene with the blood levels of some divalent cations such as iron, lead and cadmium, a single nucleotide polymorphism (SNP) (IVS4+44C/A) in DMT1 gene was investigated in 486 unrelated and healthy individuals in a Turkish population by method of polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). The genotype frequencies were found as 49.8% homozygote typical (CC), 38.3% heterozygote (CA) and 11.9% homozygote atypical (AA). Metal levels were analyzed by dual atomic absorption spectrometer system and the average levels of iron, lead and cadmium in the blood samples were 446.01±81.87 ppm, 35.59±17.72 ppb and 1.25±0.87 ppb, respectively. Individuals with the CC genotype had higher blood iron, lead and cadmium levels than those with AA and CA genotypes. Highly statistically significant associations were detected between IVS4+44 C/A polymorphism in the DMT1 gene and iron and lead levels (p=0.001 and p=0.036, respectively), but no association was found with cadmium level (p=0.344). This study suggested that DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, lead and cadmium levels. - Highlights: • DMT1 IVS4+44 C/A polymorphism is associated with inter-individual variations in blood iron, cadmium and lead levels.

  14. 21 CFR 516.119 - Permanent-resident U.S. agent for foreign requestors and holders. (United States)


    ... requestors and holders. 516.119 Section 516.119 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... § 516.119 Permanent-resident U.S. agent for foreign requestors and holders. Every foreign requestor and holder shall name a permanent resident of the United States as their agent upon whom service of...

  15. 14 CFR 119.71 - Management personnel: Qualifications for operations conducted under part 135 of this chapter. (United States)


    ... or Part 135 of This Chapter § 119.71 Management personnel: Qualifications for operations conducted... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Management personnel: Qualifications for operations conducted under part 135 of this chapter. 119.71 Section 119.71 Aeronautics and Space...

  16. 14 CFR 119.67 - Management personnel: Qualifications for operations conducted under part 121 of this chapter. (United States)


    ... or Part 135 of This Chapter § 119.67 Management personnel: Qualifications for operations conducted... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Management personnel: Qualifications for operations conducted under part 121 of this chapter. 119.67 Section 119.67 Aeronautics and Space...

  17. 49 CFR 240.119 - Criteria for consideration of data on substance abuse disorders and alcohol/drug rules compliance. (United States)


    ... abuse disorders and alcohol/drug rules compliance. 240.119 Section 240.119 Transportation Other... Process § 240.119 Criteria for consideration of data on substance abuse disorders and alcohol/drug rules.... (b) Fitness requirement. (1) A person who has an active substance abuse disorder shall not...

  18. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail:; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail:; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg


    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  19. Response of Pleurotus ostreatus to cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    Favero, N.; Bressa, G.; Costa, P. (Univ. of Padua (Italy))


    The possibility of utilizing agroindustrial wastes in the production of edible, high-quality products (e.g., mushrooms) implies the risk of bringing toxic substances, such as heavy metals, into the human food chain. Thus, growth in the presence of cadmium and cadmium accumulation limits have been studied in the industrially cultivated fungus P. ostreatus. Fruit body production is substantially unaffected in the presence of 25, 139, and 285 mg Cd/kg of dried substrate. Cadmium concentration in fruit bodies is related to cadmium substrate level, the metal being present at higher levels in caps (22-56 mg/kg dry wt) than in stems (13-36 mg/kg dry wt). Concentration factor (CF), very low in the controls (about 2), further decreases in treated specimens. The presence of a cadmium control mechanism in this fungi species is suggested. Fruit body cadmium levels could, however, represent a risk for P. ostreatus consumers, according to FAO/WHO limits related to weekly cadmium intake.

  20. Diagnosis of pancreatic carcinoma by ERCP(analysis of 119 cases).

    Institute of Scientific and Technical Information of China (English)


    The ERCP findings of 119 patients with pancreatic carcinoma were analysed in detail. Based on ERCP findings,the authors suggested a new clasification for pancreatic carcinoma including 6 types: (1)main pancreatic duct obstruction; (2)main panreatic duct steno

  1. GPR119 Agonist AS1269574 Activates TRPA1 Cation Channels to Stimulate GLP-1 Secretion. (United States)

    Chepurny, Oleg G; Holz, George G; Roe, Michael W; Leech, Colin A


    GPR119 is a G protein-coupled receptor expressed on intestinal L cells that synthesize and secrete the blood glucose-lowering hormone glucagon-like peptide-1 (GLP-1). GPR119 agonists stimulate the release of GLP-1 from L cells, and for this reason there is interest in their potential use as a new treatment for type 2 diabetes mellitus. AS1269574 is one such GPR119 agonist, and it is the prototype of a series of 2,4,6 trisubstituted pyrimidines that exert positive glucoregulatory actions in mice. Here we report the unexpected finding that AS1269574 stimulates GLP-1 release from the STC-1 intestinal cell line by directly promoting Ca(2+) influx through transient receptor potential ankyrin 1 (TRPA1) cation channels. These GPR119-independent actions of AS1269574 are inhibited by TRPA1 channel blockers (AP-18, A967079, HC030031) and are not secondary to intracellular Ca(2+) release or cAMP production. Patch clamp studies reveal that AS1269574 activates an outwardly rectifying membrane current with properties expected of TRPA1 channels. However, the TRPA1 channel-mediated action of AS1269574 to increase intracellular free calcium concentration is not replicated by GPR119 agonists (AR231453, oleoylethanolamide) unrelated in structure to AS1269574. Using human embryonic kidney-293 cells expressing recombinant rat TRPA1 channels but not GPR119, direct TRPA1 channel activating properties of AS1269574 are validated. Because we find that AS1269574 also acts in a conventional GPR119-mediated manner to stimulate proglucagon gene promoter activity in the GLUTag intestinal L cell line, new findings reported here reveal the surprising capacity of AS1269574 to act as a dual agonist at two molecular targets (GPR119/TRPA1) important to the control of L-cell function and type 2 diabetes mellitus drug discovery research. PMID:27082897

  2. Application of 119Sn CPMG MAS NMR for Fast Characterization of Sn Sites in Zeolites with Natural 119Sn Isotope Abundance

    DEFF Research Database (Denmark)

    G. Kolyagin, Yury; V. Yakimo, Alexander; Tolborg, Søren;


    119Sn CPMG MAS NMR is demonstrated to be a fast and efficient method for characterization of Sn-sites in Sn-containing zeolites. Tuning of the CPMG echo-train sequence decreases the experimental time by a factor of 5–40 in the case of as-synthesized and hydrated Sn-BEA samples and by 3 orders of ...

  3. Cadmium Toxicity to Ringed Seals (Phoca hispida)

    DEFF Research Database (Denmark)

    Sonne, Christian; Dietz, R.; Riget, F. F.;

    as laboratory mammals. We have studied possible cadmium induced histopathological changes in the kidneys as well as a demineralisation of the skeletal system (DXA-scanning of lumbal vertebraes). No obvious cadmium induced toxic changes were found. Food composition and physiological adaptations may explain......Cadmium concentrations in kidneys from ringed seals (Phoca hispida) from North West Greenland (Qaanaaq) are high. Concentrations range at level known to induce renal toxic effects (mainly tubulopathy) and demineralisation (osteopenia) of the skeletal system (Fanconi's Syndrome) in humans as well...

  4. Clinical Anylisis of Placental Abruption in 119 Cases%119例胎盘早剥的临床分析

    Institute of Scientific and Technical Information of China (English)

    余关佳; 李俊男; 王琳; 刘颖蔚; 常青


    目的:分析胎盘早剥漏诊、误诊原因,提高早期确诊率,降低母儿并发症.方法:回顾性分析我院10余年胎盘早剥患者的临床资料.结果:我院胎盘早剥发生率0.52%.急诊入院患者占46.2%,有明确发病诱因51例(42.9%),以妊娠期高血压疾病、胎膜早破、外伤性因素为主.临床表现主要为腰腹胀或腹痛、阴道流血、血性羊水.B超检出率66.4%.轻型胎盘早剥52例(43.7%),重型胎盘早剥67例(56.3%),出现症状到就诊及处理时间重型早剥组均长于轻型早剥组(P<0.01).子宫胎盘卒中6例,弥散性血管内凝血(DIC)1例.剖宫产85例(71.4%),阴道分娩33例(27.7%),子宫次全切除1例.死胎19例,转新生儿重症监护室29例.结论:临床发病到临床处理时间是影响胎盘早剥轻重程度的重要因素;胎盘旱剥临床表现易与先兆临产、临产或胎儿窘迫等混淆;后壁胎盘、发育异常的胎盘等发生胎盘早剥时,超声容易漏诊.%Objective: To explore the causes of missed diagnosis and misdiagnosis in placental abruption,enhance the accuracy of early diagnosis, and decrease the complication of mother and fetus. Methods:The clinical data of 119 cases with placental abruption were retrospectively reviewed from January 1998 to May 2010 in our hospital. Results: The incidence of placental abruption was 0. 52%. Emergency patients accounted for 46. 2%. 51 cases had the main predisposing factors(42.9% ), mainly including hypertensive disorders complicating pregnancy, premature rupture of fetal membranes, and traumatic factors. The main clinical manifestations included lower abdomen pain, vaginal hemorrhage, bloody amniotic fluid. The detection rate of ultrasonography was 66. 4%. 52 cases was the mild of placental abruption (43. 7% ), 67 cases was the severe of placental abruption(56. 3% ). The interval from the onset of the initial clinical sign to treatment in severe placental abruption was longer than that in mild

  5. Market for nickel-cadmium batteries (United States)

    Putois, F.

    Besides the lead/acid battery market, which has seen a tremendous development linked with the car industry, the alkaline rechargeable battery market has also been expanded for more than twenty years, especially in the field of portable applications with nickel-cadmium batteries. Today, nickel-cadmium batteries have to face newcomers on the market, such as nickel-metal hydride, which is another alkaline couple, and rechargeable lithium batteries; these new battery systems have better performances in some areas. This work illustrates the status of the market for nickel-cadmium batteries and their applications. Also, for two major applications—the cordless tool and the electric vehicles—the competitive situation of nickel-cadmium batteries; facing new systems such as nickel-metal hydride and lithium ion cells are discussed.


    Cadmium consumed in foods grown on soils contaminated by industrial Cd+Zn discharge has caused renal tubular dysfunction in exposed humans in discrete situations. However, lack of understanding about environmental Cd has caused wide concern that generalpopulations may...

  7. Some Aspects of Sealed Nickel Cadmium Cells

    Directory of Open Access Journals (Sweden)

    P. K. Saha


    Full Text Available Sealed Nickel Cadmium Cell system is termed till today as the most reliable power pack for electronic apparatus specially in low temperature use. This paper brings out the development and production of sealed nickel cadmium cells of pocket plate construction. The author who has gained experience in production of Ni-Cd cells in East Germany discusses also the major problems faced by the battery manufactures of to-day.

  8. Cadmium zinc telluride spectral modeling

    International Nuclear Information System (INIS)

    Cadmium zinc telluride (CZT) detectors are the highest resolution room temperature gamma-ray detectors available for isotopic analysis. As with germanium detectors, accurate isotopic analysis using spectra requires peak deconvolution. The CZT peak shapes are asymmetric, with a long low energy tail. The asymmetry is a result of the physics of the electron/hole transport in the semiconductor. An accurate model of the physics of the electron/hole transport through an electric field will allow the parameterization of the peak shapes as a function of energy. In turn this leads to the ability to perform accurate spectral deconvolution and therefore accurate isotopic analysis. The model and the peak-shape parameterization as a function of energy will be presented

  9. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Davila-Rangel, J.I. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico); Unidad Academica Centro Regional de Estudios Nucleares, Universidad Autonoma de Zacatecas Cipres 10, Frac. La Penuela, Zacatecas, Zacatecas 98068 (Mexico); Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, Instituto Literario No. 100 Col. Centro C.P. 50000, Toluca, Edo. de Mexico (Mexico); Solache-Rios, M. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico)], E-mail:


    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 {sup o}C), and the materials were then treated with NaCl (1 M and 5 M) and HNO{sub 3} (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 {sup o}C was higher than leaching from non-irradiated samples.

  10. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    International Nuclear Information System (INIS)

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 oC), and the materials were then treated with NaCl (1 M and 5 M) and HNO3 (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 oC was higher than leaching from non-irradiated samples

  11. Reviews of the environmental effects of pollutants: IV. Cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Hammons, A.S.; Huff, J.E.; Braunstein, H.M.; Drury, J.S.; Shriner, C.R.; Lewis, E.B.; Whitfield, B.L.; Towill, L.E.


    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels.

  12. Reviews of the environmental effects of pollutants: IV. Cadmium

    International Nuclear Information System (INIS)

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 μg per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels

  13. Cadmium removal by Lemna minor and Spirodela polyrhiza. (United States)

    Chaudhuri, Devaleena; Majumder, Arunabha; Misra, Amal K; Bandyopadhyay, Kaushik


    The present study investigates the ability of two genus of duckweed (Lemna minor and Spirodela polyrhiza) to phytoremediate cadmium from aqueous solution. Duckweed was exposed to six different cadmium concentrations, such as, 0.5,1.0,1.5, 2.0, 2.5, and 3.0 mg/L and the experiment was continued for 22 days. Water samples were collected periodically for estimation of residual cadmium content in aqueous solution. At the end of treatment period plant samples were collected and accumulated cadmium content was measured. Cadmium toxicity was observed through relative growth factor and changes in chlorophyll content Experimental results showed that Lemna minor and Spirodela polyrhiza were capable of removing 42-78% and 52-75% cadmium from media depending upon initial cadmium concentrations. Cadmium was removed following pseudo second order kinetic model Maximum cadmium accumulation in Lemna minor was 4734.56 mg/kg at 2 mg/L initial cadmium concentration and 7711.00 mg/kg in Spirodela polyrhiza at 3 mg/L initial cadmium concentration at the end of treatment period. Conversely in both cases maximum bioconcentration factor obtained at lowest initial cadmium concentrations, i.e., 0.5 mg/L, were 3295.61 and 4752.00 for Lemna minor and Spirodela polyrhiza respectively. The present study revealed that both Lemna minor and Spirodela polyrhiza was potential cadmium accumulator. PMID:24933906

  14. Cadmium exposure induces hematuria in Korean adults

    International Nuclear Information System (INIS)

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; Ptrend=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk

  15. Cadmium exposure induces hematuria in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seung Seok [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Kim, Myounghee, E-mail: [Department of Dental Hygiene, College of Health Science, Eulji University, Gyeonggi-do 461-713 (Korea, Republic of); Lee, Su Mi [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lee, Jung Pyo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Sejoong [Department of Internal Medicine, Seoul National University Bundang Hospital, Gyeonggi-do 463-707 (Korea, Republic of); Joo, Kwon Wook [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lim, Chun Soo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Yon Su; Kim, Dong Ki [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of)


    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; P{sub trend}=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk.

  16. Hazards to wildlife from soil-borne cadmium reconsidered (United States)

    Beyer, W.N.


    Cadmium is a toxic element that should be included in environmental risk assessments of contaminated soils. This paper argues, however, that hazards to wildlife from cadmium have often been overstated. The literature contains only meager evidence that wild animals have been seriously harmed by cadmium, even at severely contaminated sites. Although some researchers have reported that wildlife have accumulated concentrations of cadmium in their kidneys that were above suggested injury thresholds, the thresholds may be disputed, since they were well below the World Health Organization criterion of 200 mg/kg (wet weight) of cadmium in the renal cortex for protecting human health. Recent risk assessments have concluded that soil cadmium concentrations less than 1 mg/kg are toxic to soil organisms and wildlife, which implies that background concentrations of cadmium naturally found in soils are hazardous. An examination of the databases used to support these assessments suggested that the toxicity of cadmium has been exaggerated.

  17. On the effect of thallium additions on cadmium amalgam potentials

    International Nuclear Information System (INIS)

    A study has been made of the influence of additives of thallium on potentials of cadmium amalgams with thallium contents of 10, 20, 30, and 40 at.% at 20, 40, 60, and 80 deg C. Additives of thallium have been found to shift the potential of cadmium amalgams towards the range of negative values which indicates an increase in the activity of cadmium. A possibility of calculation of the potential shift for heterogeneous cadmium amalgams on introducing thallium has been shown

  18. Recycling of Spent Nickel-Cadmium Batteries

    Institute of Scientific and Technical Information of China (English)


    A technique for recycling spent nickel-cadmium batteries, which makes separation of cadmium and nickel possible, is developed by laboratory-scale experiments. NH3-H2CO3 aqueous solution was used in this leaching technique. Since neutralization and/or solvent extraction were not required in the separation procedure of nickel and cadmium, the closed systemization of the process becomes possible. Experimental results show that, (1) if the NH3 concentration of leaching solution is sufficiently high and the ratio of H2CO3 to NH3 is properly adjusted, both Ni(OH)2 and Cd(OH)2 react with NH3 and quickly dissolve into leaching solution, and (2) Ni(OH)2 can be converted into insoluble NiO by calcination at 500€癈, and CdO from Cd(OH)2 by calcination maintains good solubility in NH3-H2CO3 aqueous solution. As a conclusion, the recycling technique characterized by two step leaching can be developed based on such changes in dissolution behavior by calcination. Meanwhile, the yields of 99.8% for nickel and 97.6% for cadmium are obtained, and the purities of recovered nickel and cadmium are 99.9% and 98.6%, respectively.

  19. Effect of anions on Toxicity of Cadmium Applied to MIcrobial Biomass in Red Soil

    Institute of Scientific and Technical Information of China (English)



    A laboratory incubation experiment was conducted to elucidat the effects of associated anions on toxicity of cadmium applied to microbial biomass in the red soil. Cadmium was applied at six different levels,i.e.,O(background),5,15,30,60 and 100μg g-1 soil in the form of either cadmium acetate or cadmium chloride. Application of cadmium as cadmium acetate markedly reduced the soil microbial biomass carbon compared to cadmium applied as cadmium chlorde at all the tested levels.Similarly,organic carbon to biomass carbon ration in the soil was markedly increased by increasing the level of the cadmium in the soil as cadmium acetate,while the change wa much smaller in the case of cadmium chloride at the same cadmium levels.The results suggested that due consideration should be given to the source of cadmium while deciding the cadmium levles in experiments.

  20. Cadmium induces cadmium-tolerant gene expression in the filamentous fungus Trichoderma harzianum. (United States)

    Cacciola, Santa O; Puglisi, Ivana; Faedda, Roberto; Sanzaro, Vincenzo; Pane, Antonella; Lo Piero, Angela R; Evoli, Maria; Petrone, Goffredo


    The filamentous fungus Trichoderma harzianum, strain IMI 393899, was able to grow in the presence of the heavy metals cadmium and mercury. The main objective of this research was to study the molecular mechanisms underlying the tolerance of the fungus T. harzianum to cadmium. The suppression subtractive hybridization (SSH) method was used for the characterization of the genes of T. harzianum implicated in cadmium tolerance compared with those expressed in the response to the stress induced by mercury. Finally, the effects of cadmium exposure were also validated by measuring the expression levels of the putative genes coding for a glucose transporter, a plasma membrane ATPase, a Cd(2+)/Zn(2+) transporter protein and a two-component system sensor histidine kinase YcbA, by real-time-PCR. By using the aforementioned SSH strategy, it was possible to identify 108 differentially expressed genes of the strain IMI 393899 of T. harzianum grown in a mineral substrate with the addition of cadmium. The expressed sequence tags identified by SSH technique were encoding different genes that may be involved in different biological processes, including those associated to primary and secondary metabolism, intracellular transport, transcription factors, cell defence, signal transduction, DNA metabolism, cell growth and protein synthesis. Finally, the results show that in the mechanism of tolerance to cadmium a possible signal transduction pathway could activate a Cd(2+)/Zn(2+) transporter protein and/or a plasma membrane ATPase that could be involved in the compartmentalization of cadmium inside the cell. PMID:26349455

  1. Cadmium-113m as a biogeochemical tracer for cadmium in Lake Michigan

    International Nuclear Information System (INIS)

    The Lake Michigan watershed has been sampled for 113mCd. This long-lived metastable isotope of cadmium allowed independent evaluation of cadmium distribution in this dynamic ecosystem. 113mCd analysis was not hampered by contamination or loss. These are problems which have plagued stable cadmium measurements. Sensitivity and specificity were necessary concerns. 113mCd has been preconcentrated from large samples in order to obtain sufficient activity for quantification. Specificity for the gross beta activity measured was secured in a rigorous ion exchange decontamination. Confirmation of the suspected 113mCd beta source was checked by reverse tracer analysis and modified Feather analysis range-energy relationships. The 113mCd activities confirm the expected semiconservative behavior for cadmium. This behavior manifests itself in a long residence time for cadmium in Lake Michigan. The inefficiency of outflow removal, the low sedimentation rate and the unquantified sediment resuspension and release of cadmium are factors contributing to this residence time. Steady state concentration of cadmium in Lake Michigan will increase if present input rates persist

  2. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment

    Directory of Open Access Journals (Sweden)

    Dian Siswanto


    Full Text Available The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N, Cd soils (Cds, and Cd soils each amended with 1% w/w of coir pith (CP, coir pith modified with sodium hydroxide (CPm and corncob (CC under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatments under high cadmium contaminated soil followed the order: Cds > CPm ≥ CP ≥ CC. These transpirations directly influenced cadmium accumulation in shoots and husks of rice plants. The CC and CP seemed to work to reduce the cadmium uptake by rice plants indicated by accumulated cadmium in the husk that were 2.47 and 7.38 mg Cd kg-1 dry weight, respectively. Overall, transpiration tended to drive cadmium accumulation in plants for rice grown in high cadmium contaminated soil. The more that plants uptake cadmium, the lower cadmium that remains in the soil.

  3. Bireactor Electronuclear Systems with Liquid Cadmium Valve

    CERN Document Server

    Bznuni, S A; Zhamkochyan, V M; ASosnin, A N; Polanski, A; Khudaverdyan, A H


    Three main types of bireactor electronuclear systems are discussed. From the point of view of assuring high level of functional characteristics and safety bireactor electronuclear systems with booster using enriched uranium (20 %) and with a liquid cadmium valve appears to be the most effective. It is shown by means of Monte-Carlo modeling that such operation conditions can be achieved which lead to the destruction of the intermediate cadmium layer making the systems supercritical (k_{eff}>1). One can avoid the problem by using a special design of the liquid cadmium valve. In comparison with other nuclear systems (critical reactors, one-reactor electronuclear systems) cascade electronuclear systems have essential advantages allowing the decrease of the proton beam current by one order of magnitude and providing at same time the necessary level of power generation and neutron flux. Availability of both the thermal and fast cones allows one to transmute not only transuranics but also the fission products - cesi...


    Directory of Open Access Journals (Sweden)

    P. Bala Ramudu


    Full Text Available This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself was used as the purging solution. Results showed that 49% reduction of cadmium concentration was achieved in the case of soil saturated (washed with ammonium citrate as well as purging solution also was ammonium citrate. The soil pH and washing solutions were the most important factors in controlling the removal of cadmium in electrokinetic remediation process.

  5. 19 CFR 122.119 - Transportation to another U.S. port. (United States)


    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Transportation to another U.S. port. 122.119... Transportation to another U.S. port. (a) Application. Air cargo shipments may be transferred for transportation as transit air cargo from the port of arrival to another port in the U.S. under this section....

  6. 46 CFR 56.35-1 - Pipe stress calculations (replaces 119.7). (United States)


    ... reference; see 46 CFR 56.01-2) and 46 CFR 56.07-10 are performed. The procedures for nondestructive testing... 46 Shipping 2 2010-10-01 2010-10-01 false Pipe stress calculations (replaces 119.7). 56.35-1... PIPING SYSTEMS AND APPURTENANCES Expansion, Flexibility and Supports § 56.35-1 Pipe stress...

  7. 75 FR 34097 - Expansion of Foreign-Trade Zone 119; Minneapolis-St. Paul Area (United States)


    .../21/09); Whereas, notice inviting public comment was given in the Federal Register (74 FR 26652, 6/3... From the Federal Register Online via the Government Publishing Office ] DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Expansion of Foreign-Trade Zone 119; Minneapolis-St. Paul Area Pursuant to...

  8. Pion-Induced Fission of 209Bi and 119Sn:. Measurements, Calculations, Analyses and Comparison (United States)

    Rana, Mukhtar Ahmed; Sher, Gul; Manzoor, Shahid; Shehzad, M. I.

    Cross-sections for the π--induced fission of 209Bi and 119Sn have been measured using the most sensitive CR-39 solid-state nuclear track detector. In experiments, target-detector stacks were exposed to negative pions of energy 500, 672, 1068, and 1665 MeV at the Brookhaven National Laboratory, USA. An important aspect of the present paper is the comparison of pion-induced fission fragment spectra of above mentioned nuclei with the spontaneous fission fragment spectra of 252Cf. This comparison is made in terms of fission fragment track lengths in the CR-39 detectors. Measurement results are compared with calculations of Monte Carlo and statistical weight functions methods using the computer code CEM95. Agreement between measurements and calculations is fairly good for 209Bi target nuclei whereas it is indigent for the case of 119Sn. The possibilities of the trustworthy calculations, using the computer code CEM95, comparable with measurements of pion-induced fission in intermediate and heavy nuclei are explored by employing various systematics available in the code. Energy dependence of pion-induced fission in 119Sn and 209Bi is analyzed employing a newly defined parameter geometric-size-normalized fission cross-section (χfg). It is found that the collective nuclear excitations, which may lead to fission, become more probable for both 209Bi and 119Sn nuclei with increasing energy of negative pions from 500 to 1665 MeV.

  9. 29 CFR 825.119 - Leave for treatment of substance abuse. (United States)


    ... 29 Labor 3 2010-07-01 2010-07-01 false Leave for treatment of substance abuse. 825.119 Section 825... Leave for treatment of substance abuse. (a) Substance abuse may be a serious health condition if the... substance abuse by a health care provider or by a provider of health care services on referral by a...

  10. Optimization of process parameters for enhanced biodegradation of acid red 119 by Bacillus thuringiensis SRDD

    Directory of Open Access Journals (Sweden)

    Riddhi H. Dave


    Full Text Available Developed Bacillus thuringiensis SRDD showed degradation of C.I. Acid red 119 and growth under the extremecondition of temperature 70°C, pH 3-8, heavy metals concentration of 0.8 mM, NaCl up to 900 mM and 1000 ppm dye. Cottonseed, caster cake and corn cake powders were found to be better and cheaper nutrient supplements for the Bacillus thuringiensisSRDD for biodegradation as compared to molasses. After development of the culture and the process, more than99% degradation was achieved in less than 2 hrs of contact time even on 18th cycles of addition of 100 ppm AR-119 dye. Thedeveloped process showed AR-119 biodegradation rate as high as 220 mg L-1 h-1, which is found to be 130 times more ascompared to the reported data. U.V., FTIR, TLC and HPLC analysis data confirmed biodegradation ability of the Bacillusthuringiensis for AR-119.

  11. 7 CFR 1c.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Research undertaken without the intention of involving... HUMAN SUBJECTS § 1c.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human subjects, but it is later...

  12. 10 CFR 745.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 10 Energy 4 2010-01-01 2010-01-01 false Research undertaken without the intention of involving....119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human subjects, but it is later proposed to involve...

  13. 14 CFR 1230.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Research undertaken without the intention... SPACE ADMINISTRATION PROTECTION OF HUMAN SUBJECTS § 1230.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of...

  14. 28 CFR 46.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Research undertaken without the intention... (CONTINUED) PROTECTION OF HUMAN SUBJECTS § 46.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human...

  15. 49 CFR 11.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 49 Transportation 1 2010-10-01 2010-10-01 false Research undertaken without the intention of... PROTECTION OF HUMAN SUBJECTS § 11.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human subjects, but it...

  16. 22 CFR 225.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Research undertaken without the intention of... PROTECTION OF HUMAN SUBJECTS § 225.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human subjects, but it...

  17. 34 CFR 97.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 34 Education 1 2010-07-01 2010-07-01 false Research undertaken without the intention of involving... Protection of Human Research Subjects) § 97.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human subjects, but it...

  18. 45 CFR 46.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Research undertaken without the intention of... Subjects § 46.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human subjects, but it is later proposed...

  19. 16 CFR 1028.119 - Research undertaken without the intention of involving human subjects. (United States)


    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Research undertaken without the intention of... GENERAL PROTECTION OF HUMAN SUBJECTS § 1028.119 Research undertaken without the intention of involving human subjects. In the event research is undertaken without the intention of involving human...

  20. 47 CFR 101.119 - Simultaneous use of common antenna structures. (United States)


    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Simultaneous use of common antenna structures... SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Technical Standards § 101.119 Simultaneous use of common antenna structures. The simultaneous use of common antenna structures by more than one radio station,...

  1. Oral 2-oleyl glyceryl ether improves glucose tolerance in mice through the GPR119 receptor

    DEFF Research Database (Denmark)

    Hassing, H A; Engelstoft, M S; Sichlau, R M;


    abolished the hormone release. Similarly, in isolated primary colonic crypt cultures from WT mice, GPR119 was required for 2-OG-stimulated GLP-1 release while there was no response in crypts from KO mice. In vivo, gavage with 2-oleyl glyceryl ether ((2-OG ether), a stable 2-OG analog with a potency of 5.3 µ...

  2. Increased cadmium and lead uptake of a cadmium hyperaccumulator tomato by cadmium-resistant bacteria. (United States)

    He, Lin-Yan; Chen, Zhao-Jin; Ren, Gai-Di; Zhang, Yan-Feng; Qian, Meng; Sheng, Xia-Fang


    Two cadmium (Cd)-resistant strains Pseudomonas sp. RJ10 and Bacillus sp. RJ16 were investigated for their effects on the soil Cd and lead (Pb) solubilization and promotion of plant growth and Cd and Pb uptakes of a Cd-hyperaccumulator tomato. In the heavy metal-contaminated inoculated soil, the CaCl(2)-extractable Cd and Pb were increased by 58-104% and 67-93%, respectively, compared to the uninoculation control. The bacteria produced indole acetic acid, siderophore and 1-aminocyclopropane-1-carboxylate deaminase. Root elongation assay conducted on tomato under gnotobiotic conditions demonstrated increase in root elongation of inoculated tomato seedlings compared to the control plants. An increase in Cd and Pb contents of above-ground tissues varied from 92% to 113% and from 73% to 79% in inoculated plants growing in heavy metal-contaminated soil compared to the uninoculation control, respectively. These results show that the bacteria could be exploited for bacteria enhanced-phytoextraction of Cd- and Pb-polluted soils. PMID:19368973

  3. Treatment of cadmium dust with two-stage leaching process

    Institute of Scientific and Technical Information of China (English)


    The treatment of cadmium dust with a two-stage leaching process was investigated to replace the existing sulphation roast-leaching processes. The process parameters in the first stage leaching were basically similar to the neutralleaching in zinc hydrometallurgy. The effects of process parameters in the second stage leaching on the extraction of zincand cadmium were mainly studied. The experimental results indicated that zinc and cadmium could be efficiently recoveredfrom the cadmium dust by two-stage leaching process. The extraction percentages of zinc and cadmium in two stage leach-ing reached 95% and 88% respectively under the optimum conditions. The total extraction percentage of Zn and Cdreached 94%.

  4. Cadmium toxicity in the free-living nematode, Caenorhabditis elegans

    Energy Technology Data Exchange (ETDEWEB)

    Popham, J.D.; Webster, J.M.


    The effect of cadmium on the fecundity, growth, and fine structure of the free-living nematode Caenorhabditis elegans was studied. High concentrations of cadmium significantly decreased the fecundity and growth of these organisms. Electron microscopy showed that cadmium modifies the structure of the mitochondria in the esophagus and intestine, causes the formation of inclusion bodies in the nucleus of esophageal cells, and alters the morphology of cytosomes in the intestinal cells. The results suggest that the decreased fecundity and growth of cadmium-exposed C. elegans may be due to cadmium interfering with nutrient uptake or assimilation or both.

  5. Thermodynamic properties of cadmium in lead amalgam dilute solution

    International Nuclear Information System (INIS)

    Investigation of thermodynamic properties of cadmium dilute solutions in lead amalgam is carried out by means of electromotive force technique within 453-523 K temperature range. Cadmium thermodynamic functions are calculated: activity, activity ratio, Libbs partial energy and its excess value and integral characteristics, respectively. When changing cadmium content from 0.01 up to 0.1 χcd at T=473 K, logarithm of activity ratio does not depend on alloy composition, that is, Heury's law is fulfilled. Increase of cadmium content in amalgam results in the essential reduction of mercury and cadmium reaction

  6. Urinary excretion of cadmium and zinc among persons from Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G.; Kjellstrom, T.; Linnman, L.; Pershagen, G.


    Cadmium and zinc concentrations in the urine of 132 Swedes, including 50 pairs of identical twins, were measured. Atomic absorption spectrophotometry procedures were developed for the analysis. Cadmium concentration increased with age and was higher among smokers than among nonsmokers. Estimated 24-hr excretion of cadmium among nonsmokers increased from about 0.25 to 0.40 in persons from 20 to 70 years old. The 24-hr cadmium excretions among nonsmokers in different age-groups fitted better to total kidney burden than to daily cadmium intake from food. Zinc excretion, on the other hand, decreased after the age of 20.

  7. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John


    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  8. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Posteren viser resultater fra elektrokemiske rensningsforsøg på bioasker udført i forbindelse med PSO projekt 5205 "Elektrokemisk fjernelse af cadmium fra bioasker i pilotskala og vurdering af mulighederne for nyttiggørelse af behandlet aske i beton".......Posteren viser resultater fra elektrokemiske rensningsforsøg på bioasker udført i forbindelse med PSO projekt 5205 "Elektrokemisk fjernelse af cadmium fra bioasker i pilotskala og vurdering af mulighederne for nyttiggørelse af behandlet aske i beton"....

  9. Cadmium exposure and pancreatic cancer in south Louisiana. (United States)

    Luckett, Brian G; Su, L Joseph; Rood, Jennifer C; Fontham, Elizabeth T H


    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P ≤ 0.0001). Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88) and high consumption levels of red meat (4th quartile OR = 6.18) and grains (4th quartile OR = 3.38). Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen. PMID:23319964

  10. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    Directory of Open Access Journals (Sweden)

    Brian G. Luckett


    Full Text Available Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana. We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P≤0.0001. Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88 and high consumption levels of red meat (4th quartile OR = 6.18 and grains (4th quartile OR = 3.38. Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen.

  11. Study of cadmium electrochemical deposition in sulfate medium

    Energy Technology Data Exchange (ETDEWEB)

    Montiel, T.; Solorza, O.; Sanchez, H.


    The cadmium electrochemical deposition process from sulfate medium was studied by means of different electrochemical techniques in both stationary and nonstationary diffusion regimes. The kinetics of the electrochemical reduction of cadmium on solid cadmium electrodes was examined and the kinetic parameters are presented, as well as the diffusion coefficient derived from the different techniques. Temperature has an important effect on the cadmium reduction kinetics, and the activation energy of the process was evaluated. The electrochemical deposition of cadmium is a complex process due to the coexistence of adsorption and nucleation processes; the adsorbed electroactive species appears to be Cd{sup +2}, and a mechanism for cadmium electrodeposition on solid cadmium electrodes is proposed.

  12. Murine strain differences and the effects of zinc on cadmium concentrations in tissues after acute cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    King, L.M. [ARS USDA, Germplasm and Gamete Physiology Lab., Beltsville, MD (United States); Anderson, M.B. [Dept. of Anatomy, Tulane Univ. School of Medicine, New Orleans, LA (United States); Sikka, S.C. [Dept. of Urology, Tulane Univ. School of Medicine, New Orleans, LA (United States); George, W.J. [Dept. of Pharmacology, Tulane Univ. School of Medicine, New Orleans, LA (United States)


    The role of strain differences in cadmium tissue distribution was studied using sensitive (129/J) and resistant (A/J) mice. These murine strains have previously been shown to differ in their susceptibility to cadmium-induced testicular toxicity. Cadmium concentration was measured in testis, epididymis, seminal vesicle, liver, and kidney at 24 h after cadmium chloride exposure (4, 10, and 20 {mu}mol/kg CdCl{sub 2}). The 129/J mice exhibited a significant increase in cadmium concentration in testis, epididymis, and seminal vesicle at all cadmium doses used, compared to A/J mice. However, cadmium concentrations in liver and kidney were not different between the strains, at any dose, indicating that cadmium uptake is similar in these organs at 24 h. These murine strains demonstrate similar hepatic and renal cadmium uptake but significantly different cadmium accumulation in the reproductive organs at 24 h. The mechanism of the protective effect of zinc on cadmium toxicity was studied by assessing the impact of zinc acetate (ZnAc) treatment on cadmium concentrations in 129/J mice after 24 h. Zinc pretreatment (250 {mu}mol/kg ZnAc), given 24 h prior to 20 {mu}mol/kg CdCl{sub 2} administration, significantly decreased the amount of cadmium in the testis, epididymis, and seminal vesicle of 129/J mice, and significantly increased the cadmium content of the liver after 24 h. Cadmium levels in the kidney were unaffected at this time. Zinc pretreatment also prevented the cadmium-induced decrease in testicular sperm concentration and epididymal sperm motility seen in 129/J mice. These findings suggest that the differences in the two murine strains may be attributed partly to the differential accumulation of cadmium in murine gonads. This may be caused by strain differences in the specificity of cadmium transport mechanisms. The protective role of zinc in cadmium-induced testicular toxicity in the sensitive strain may be due to an interference in the cadmium uptake by susceptible

  13. Effects of bacteria on cadmium bioaccumulation in the cadmium hyperaccumulator plant Beta vulgaris var. cicla L. (United States)

    Chen, Su; Chao, Lei; Sun, Lina; Sun, Tieheng


    To investigate the effects of two cadmium-tolerant bacteria, Staphylococcus pasteuri (S. pasteuri X1) and Agrobacterium tumefaciens (A. tumefaciens X2), on cadmium uptake by the cadmium hyperaccumulator plant Beta vulgaris var. cicla L., a pot experiment with artificially contaminated soil was conducted. The results demonstrated that both cadmium-tolerant bacteria enhanced the dry weight of Beta vulgaris var. cicla L. The total dry weights of plants in the control CK20, S. pasteuri X1 and A. tumefaciens X2 treatments were 0.85, 1.13, and 1.38 g/pot, respectively. Compared with the control CK20 findings, the total dry weight of plants was increased by 32.8 and 61.1% after inoculation with S. pasteuri X1 and A. tumefaciens X2, respectively, indicating that A. tumefaciens X2 more strongly promoted the growth of Beta vulgaris var. cicla L. than S. pasteuri X1. In addition, inoculation with S. pasteuri X1 and A. tumefaciens X2 significantly (p < 0.05) promoted cadmium uptake by plants and improved the bioaccumulation of cadmium by the plants from the soil. Moreover, the inoculation of S. pasteuri X1 and A. tumefaciens X2 effectively facilitated the transfer of cadmium in the soil from the Fe-Mn oxide and residual fractions to the soluble plus exchangeable and weakly specially adsorbed fractions in the rhizosphere soils of plants. The bacterial enhancement of cadmium phytoavailability might provide a potential and promising method to increase the efficiency of phytoextraction. PMID:23488173

  14. Urinary cadmium and estimated dietary cadmium in the Women's Health Initiative. (United States)

    Quraishi, Sabah M; Adams, Scott V; Shafer, Martin; Meliker, Jaymie R; Li, Wenjun; Luo, Juhua; Neuhouser, Marian L; Newcomb, Polly A


    Cadmium, a heavy metal dispersed in the environment as a result of industrial and agricultural applications, has been implicated in several human diseases including renal disease, cancers, and compromised bone health. In the general population, the predominant sources of cadmium exposure are tobacco and diet. Urinary cadmium (uCd) reflects long-term exposure and has been frequently used to assess cadmium exposure in epidemiological studies; estimated dietary intake of cadmium (dCd) has also been used in several studies. The validity of dCd in comparison with uCd is unclear. This study aimed to compare dCd, estimated from food frequency questionnaires, to uCd measured in spot urine samples from 1,002 participants of the Women's Health Initiative. Using linear regression, we found that dCd was not statistically significantly associated with uCd (β=0.006, P-value=0.14). When stratified by smoking status, dCd was not significantly associated with uCd both in never smokers (β=0.006, P-value=0.09) and in ever smokers (β=0.003, P-value=0.67). Our results suggest that because of the lack of association between estimated dCd and measured uCd, dietary estimation of cadmium exposure should be used with caution in epidemiologic studies.

  15. 7 CFR 1.119 - Disclosure of record to person other than the individual to whom it pertains. (United States)


    ... individual to whom it pertains. 1.119 Section 1.119 Agriculture Office of the Secretary of Agriculture... individual to whom it pertains. No agency shall disclose any record which is contained in a system of records it maintains, by any means of communication to any person, or to another agency outside USDA,...

  16. Karistusseadustiku § 119¹ ehk tõenduslike probleemide ületamine materiaalõiguse abil / Anneli Soo, Birgit Sisask

    Index Scriptorium Estoniae

    Soo, Anneli, 1984-


    1. jaanuaril 2015 jõustus karistusseadustikus rida muudatusi, sh lisandus § 119¹, mis käsitleb kakluses osalemist. Karistusõiguslikest ja põhiseaduslikest põhimõtetest, millega § 119¹ läheb vastuollu

  17. 14 CFR 119.47 - Maintaining a principal base of operations, main operations base, and main maintenance base... (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Maintaining a principal base of operations, main operations base, and main maintenance base; change of address. 119.47 Section 119.47 Aeronautics... operations base, and main maintenance base; change of address. (a) Each certificate holder must maintain...

  18. 13 CFR 119.11 - What information will be requested in an application under the PRIME program? (United States)


    .... (2) A research proposal indicating the thesis, method(s), scope, duration, and implementation plans... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false What information will be requested in an application under the PRIME program? 119.11 Section 119.11 Business Credit and Assistance...

  19. 7 CFR 1955.119 - Sale of SFH inventory property to a public body or nonprofit organization. (United States)


    ... nonprofit organization. 1955.119 Section 1955.119 Agriculture Regulations of the Department of Agriculture... to a public body or nonprofit organization. Notwithstanding the provisions of § 1955.111 through... public body or nonprofit organization to use for transitional housing for the homeless. A public body...

  20. 14 CFR 382.119 - What information must carriers give individuals with vision or hearing impairment on aircraft? (United States)


    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false What information must carriers give individuals with vision or hearing impairment on aircraft? 382.119 Section 382.119 Aeronautics and Space... carriers give individuals with vision or hearing impairment on aircraft? (a) As a carrier, you must...


    Cadmium induced renal tubular dysfunction occurred where subsistence rice farmers produced their lifetime dietary rice on Zn-mine waste contaminated soils in Japan and other Asian countries. Research has shown that polished rice Cd is greatly increased while grain Zn is not incre...

  2. Field scale behaviour of cadmium in soil.

    NARCIS (Netherlands)

    Boekhold, A.E.


    Although total heavy metal contents of soil are often used to express the degree of contamination, they are of little value to judge environmental effects. The main objective of this thesis was to develop and test methodologies with which environmental risks of cadmium pollution of field soils can b

  3. Mobiliteit van cadmium in de bodem

    NARCIS (Netherlands)

    Chardon, W.J.


    The adsorption of cadmium by twelve Dutch soils was investigated under widely varying circumstances. The adsorption can be described with the Freundlich equation; the parameters of this equation can be predicted using the properties of the soil (pH, organic carbon and clay content).The adsorption ap

  4. Cadmium isotope variations in the Southern Ocean

    NARCIS (Netherlands)

    Xue, Z.; Rehkämper, M.; Horner, T.J.; Abouchami, W.; Middag, R.; van de Flierd, T.; de Baar, H.J.W.


    Cadmium concentrations and isotope compositions were determined for 47 seawater samples from the high nutrient low chlorophyll (HNLC) zone of the Atlantic sector of the Southern Ocean. The samples include 13 surface waters from a transect of the Weddell Gyre and 3 depth profiles from the Weddell Sea

  5. Cadmium phytoextraction potential of different Alyssum species

    Energy Technology Data Exchange (ETDEWEB)

    Barzanti, R., E-mail: [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Colzi, I., E-mail: [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Arnetoli, M., E-mail: [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gallo, A., E-mail: [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Pignattelli, S., E-mail: [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gabbrielli, R., E-mail: [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gonnelli, C., E-mail: [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy)


    Highlights: Black-Right-Pointing-Pointer The possibility of using serpentine plants for phytoextraction of Cd was investigated. Black-Right-Pointing-Pointer Variation in Cd tolerance, accumulation and translocation in three Alyssum plants with different phenotypes were found. Black-Right-Pointing-Pointer Alyssum montanum showed higher Cd tolerance and accumulation than the Ni hyperaccumulator Alyssum bertolonii. Black-Right-Pointing-Pointer As for the kinetic parameters of the Cd uptake system, A. montanum presented a low apparent K{sub m} value. Black-Right-Pointing-Pointer The V{sub max} values were not significantly different among the plants. - Abstract: This work was planned for providing useful information about the possibility of using serpentine adapted plants for phytoextraction of cadmium, element scarcely represented in such metalliferous environment. To this aim, we investigated variation in cadmium tolerance, accumulation and translocation in three Alyssum plants with different phenotypes: Alyssum bertolonii, that is a serpentine endemic nickel hyperaccumulator, and two populations of Alyssum montanum, one adapted and one not adapted to serpentine soils. Plants were hydroponically cultivated in presence of increasing concentrations of CdSO{sub 4} for two weeks. For the metal concentration used in the experiments, the three different Alyssum populations showed variation in cadmium tolerance, accumulation and content. The serpentine adapted population of A. montanum showed statistically higher cadmium tolerance and accumulation than A. bertolonii and the population of A. montanum not adapted to serpentine soil thus deserving to be investigated for phytoextraction purposes. Furthermore, as for the kinetic parameters of the cadmium uptake system, A. montanum serpentine population presented a low apparent K{sub m} value, suggesting a high affinity for this metal of its uptake system, whereas the V{sub max} values were not significantly different among the

  6. Cadmium and Chrome Concentrations in Human Milk

    Directory of Open Access Journals (Sweden)

    Sima Nazarpour


    Full Text Available Introduction: Nutrition of children has the highest priority in any program aimed at children's health care. Milk contaminated with various toxic elements can have adverse effects on children's health. This study aimed to determine the concentration of heavy metals including cadmium(Cd and chromium (Cr of breast feeding women’s milk in Varamin. Methods: This is a cross sectional study. In the present study, chromium and cadmium levels in milk of 100 mothers attending clinics in the city of Varamin were measured in four to eight weeks after delivery, using atomic absorption spectrometry. Results: The mean values (±SD of Cd and Cr in human milk were 5±6.9 μg/ml and 3±2.7 μg/ml respectively. Result of Linear regression showed that cadmium levels were higher in breast milk of people living close to the factory or industrial center. Also, the chromium levels were higher in the breast milk of women in cases of: Smoking by spouses, consumption of imported rice, consumption of mineral water, and living close to the factory or an industrial center. Conclusion: This study showed that the relationship of some factors such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water, with the level of cadmium and chromium. Cadmium and chromium levels of breast milk in this study were higher than the levels of these elements mentioned in the reviewed articles and international standard. Because some variables, such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water can affect the amount of entering elements in breast milk. Actions can be taken to reduce or eliminate these variables in order to decrease the mentioned elements in human milk.

  7. Hepatoprotective activity of Moringa oleifera against cadmium toxicity in rats

    Directory of Open Access Journals (Sweden)

    Reetu Toppo


    Full Text Available Aim: The present investigation has been conducted to evaluate the hepatoprotective activity of Moringa oleifera against cadmium-induced toxicity in rats. Materials and Methods: For this study, 18 Wistar albino rats were taken. Control group, Group I rats were given cadmium chloride @ 200 ppm per kg and Group II rats were treated with M. oleifera extract @ 500 mg/kg along with cadmium chloride @ 200 ppm per kg (daily oral for 28 days. On 29th day, animals were slaughtered and various parameters were determined. Serum biomarkers, oxidative stress parameters, histomorphological examination were carried out with estimation of cadmium concentration in liver tissues. Results: Oral administration of cadmium chloride @ 200 ppm/kg for 28 days resulted in a significant increase in aspartate aminotransferase (AST, alanine transaminase (ALT, alkaline phosphatase (ALP, significant (p≤0.01 increase of lipid peroxidation (LPO and decrease in superoxide dismutase (SOD, and increase in cadmium accumulation in liver. Treatment with M. oleifera @ 500 mg/kg significantly (p<0.01 decreased the elevated ALP, AST, ALT, LPO levels and increase in SOD levels, and as compared to cadmium chloride treated group. However, there was no significant difference in cadmium concentration in liver when compared with cadmium chloride treated group. Conclusion: The study conclude that supplementation of M. oleifera (500 mg/kg, daily oral for 28 days has shown protection against cadmium-induced hepatotoxicity.

  8. Modelling of Cadmium Transport in Soil-Crop System

    Institute of Scientific and Technical Information of China (English)


    A model for simulating cadmium transport in a soil-plant system was built using a commercial simu lating program named Powersim on the basis of input-output processes happening in the soil-plant system.Convective and dispersive transport processes of cadmium in soil profile are embedded. Simulations on a daily base have been done up to a total simulating time of 250 years. Results show that applications of sewage sludge and fertilizer at the simulated rates would only cause slight cadmium accumulations in each layer of the soil, and cadmium accumulation would be levelling off, reaching an equilibrium concentrations layer by layer downward after certain time. The time scale to reach an equilibrium concentration varies from 10 years for the top three layers to over 250 years for the bottom layers. Plant cadmium uptake would increase from 52 ug m-2 under initial soil cadmium concentrations to 65 μg m-2 under equilibrium soil cadmium concentrations, which would not exceed the maximum allowable cadmium concentration in wheat grains. Main parameters which influence cadmium accumulation and transport in soil are total cadmium input, rainfall, evaporation, plant uptake and soil properties.

  9. Monoclonal antibodies to Toxoplasma gondii strain 119 identify recently isolated Danish strains as one group

    DEFF Research Database (Denmark)

    Jensen, L.; Petersen, E.; Henriksen, S.A.;


    Four mAb raised against the Danish Toxoplasma gondii strain 119, were selected by screening hybridoma supernatants by indirect immunofluorescence against tachyzoites of the RH strain in order to obtain strain restricted markers. Strain restriction extended beyond discrimination of the 119 and RH...... strains, as demonstrated on a further six T. gondii reference strains [BK and GT1 (group A), NTE and 561 (group B), and NED and C56 (group C)]. The bradyzoite-specific mAb, 4.3, reacted to the GT1, NTE and 561 strains, but not to the BK, NED or C56 strains. The tachyzoite-specific mAb, 4.25, reacted....... gondii strain collection representative for a small geographic area (Denmark) was established within a short time span from a variety of animal species. Using the mAb as typing reagents to this Danish strain collection, all 36 animal and two human strains were identified as having the same reaction...

  10. Interpreting ‘Torah’ in Psalm 1 in the light of Psalm 119

    Directory of Open Access Journals (Sweden)

    Philippus J. Botha


    Full Text Available This article argued that Psalm 37 and Proverbs 1–4 served as sources for the composition of Psalm 1. The emphasis in both donor texts on the righteous people’s inheriting the Promised Land seems to have imprinted also on Psalm 1, a factor that could change our understanding of it. All three contexts in turn played a role in the composition of Psalm 119, but whilst the author of this long psalm also understood the ‘Torah’ of Yahweh as the incarnation of true wisdom, it seems that ‘Torah’ also subsumed the Promised Land for him. The investigation showed that ‘Torah’ in Psalm 1 should be understood as an arch-lexeme for all the religious texts its author used to compose, similar to what was the understanding of the author of Psalm 119 a little later.

  11. Yeast Interacting Proteins Database: YGR119C, YJL041W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGR119C NUP57 Nucleoporin, essential subunit of the nuclear pore complex (NPC), fun...this bait as bait (5) Rows with this bait as prey (0) YJL041W NSP1 Essential component of the nuclear pore c... gene name NUP57 Bait description Nucleoporin, essential subunit of the nuclear pore complex (NPC), function...h this bait as prey (0) Prey ORF YJL041W Prey gene name NSP1 Prey description Essential component of the nuc

  12. Analysis Of Metaphorin In Psalm Section 1 To 119 Of Bible


    Kaban, Desi R. Sari


    This paper is entitled Analysis of Metaphors in Psalm section 1 to 119 of Bible discusses about existing metaphor in Psalm and analyze the meaning of the metaphor. The writer only studies metaphor in Psalm of David. In writing of this paper, writer conduct method research of bibliography for the study of bibliography to collect information and data by using some books and internet that related to problem of analyzes metaphor. Writer collect metaphor data found on verses in Psalm of David, Lis...

  13. Analysis Of Metaphor In Psalm Section 1 To 119 Of Bible


    Kaban, Desi R. Sari


    This paper is entitled Analysis of Metaphors in Psalm section 1 to 119 of Bible discusses about existing metaphor in Psalm and analyze the meaning of the metaphor. The writer only studies metaphor in Psalm of David. In writing of this paper, writer conduct method research of bibliography for the study of bibliography to collect information and data by using some books and internet that related to problem of analyzes metaphor. Writer collect metaphor data found on verses in Psalm of David, Lis...

  14. The generation and evaluation of recombinant human IgA specific for Plasmodium falciparum merozoite surface protein 1-19 (PfMSP119

    Directory of Open Access Journals (Sweden)

    Corran Patrick H


    Full Text Available Abstract Background Human immunoglobulin G (IgG plays an important role in mediating protective immune responses to malaria. Although human serum immunoglobulin A (IgA is the second most abundant class of antibody in the circulation, its contribution, if any, to protective responses against malaria is not clear. Results To explore the mechanism(s by which IgA may mediate a protective effect, we generated fully human IgA specific for the C-terminal 19-kDa region of Plasmodium falciparum merozoite surface protein 1 (PfMSP119, a major target of protective immune responses. This novel human IgA bound antigen with an affinity comparable to that seen for an epitope-matched protective human IgG1. Furthermore, the human IgA induced significantly higher NADPH-mediated oxidative bursts and degranulation from human neutrophils than the epitope-matched human IgG1 from which it was derived. Despite showing efficacy in in vitro functional assays, the human IgA failed to protect against parasite challenge in vivo in mice transgenic for the human Fcα receptor (FcαRI/CD89. A minority of the animals treated with IgA, irrespective of FcαRI expression, showed elevated serum TNF-α levels and concomitant mouse anti-human antibody (MAHA responses. Conclusions The lack of protection afforded by MSP119-specific IgA against parasite challenge in mice transgenic for human FcαRI suggests that this antibody class does not play a major role in control of infection. However, we cannot exclude the possibility that protective capacity may have been compromised in this model due to rapid clearance and inappropriate bio-distribution of IgA, and differences in FcαRI expression profile between humans and transgenic mice.

  15. Assessment and management of risk to wildlife from cadmium

    International Nuclear Information System (INIS)

    Cadmium, a nonessential heavy metal that comes from natural and anthropogenic sources, is a teratogen, carcinogen, and a possible mutagen. Assessment of potential risk from cadmium requires understanding environmental exposure, mainly from ingestion, although there is some local exposure through inhalation. Chronic exposure is more problematic than acute exposure for wildlife. There is evidence for bioaccumulation, particularly in freshwater organisms, but evidence for biomagnification up the food chain is inconsistent; in some bird studies, cadmium levels were higher in species that are higher on the food chain than those that are lower. Some freshwater and marine invertebrates are more adversely affected by cadmium exposure than are birds and mammals. There is very little experimental laboratory research on the effects of cadmium in amphibians, birds and reptiles, and almost no data from studies of wildlife in nature. Managing the risk from cadmium to wildlife involves assessment (including ecological risk assessment), biomonitoring, setting benchmarks of effects, regulations and enforcement, and source reduction

  16. Study on electrokinetic remediation of cadmium contaminated soils

    Institute of Scientific and Technical Information of China (English)

    SHI Wen-xin; CUI Chong-wei; YU Shui-li; FENG Wei-ming


    Kaolinite from a lead-zinc mining district, which was spiked with cadmium, has been treated by electrokinetics to investigate effects of treatment time and applied voltage gradient. The results showed that the increased test duration had induced a higher removal rate of cadmium. Being treated for 7 days, cadmium was removed from kaolinite dramatically. It was also found that higher removal rate happened when a higher voltage gradient was applied and cadmium accumulated near the cathode because pH increased. Increase of pH near the cathode caused accumulation of cadmium. Moreover, it was observed that cation exchange membrane which was placed between kaolinite and cathode could make pH lower than the initial value and avoid the higher pH near the cathode. As a result, the high concentration accumulation of cadmium near the cathode was avoided.

  17. Research and Development of Cadmium Sulphoselenide Red Pigment

    Institute of Scientific and Technical Information of China (English)

    WU Jianfeng; LI Kun; XU Xiaohong; ZHANG Yaxiang; XU Xiaoyang; LAO Xinbin


    Cadmium sulphoselenide was synthesized continuous substitution solid solution and the only known pigment to yield bright red color on ceramic decoration. Encapsulated cadmium sulphoselenide pigments could yield abundant hues from yellow to red with high opacity at high temperature. The color generation has a linear function relation with the substitution rate. The encapsulation formation process of zirconium silicate encapsulated cadmium sulphoselenide was shown. Insufifcient encapsulation efifciency and potential hazard to human and environment had limited the industrial application of cadmium sulphoselenide red pigment. Ink-jet printing decoration required ifne size cadmium sulphoselenide red pigment on ceramic decoration. The review mainly focused on the synthesis techniques and industrial application of cadmium sulphoselenide red pigment.

  18. In search of biomonitors for cadmium: cadmium content of wild Swedish fauna during 1973-1976. (United States)

    Frank, A


    Forty-five species of birds and 22 species of mammals of the terrestrial and aquatic fauna, herbivores as well as carnivores, were investigated during the period 1973-1976 for cadmium-accumulating properties in order to find biomonitors for cadmium in the Swedish environment. The herbivores of the terrestrial fauna, birds as well as mammals, are preferred to carnivores, since they demonstrate generally higher renal Cd levels. The moose (Alces alces), roe deer (Capreolus capreolus) and hare (Lepus europeus and Lepus timidus) were found to be suitable as biomonitors because of their common occurrence and uniform geographical distribution. The eider duck (Somateria mollissima), although a short-distance migrating bird whose diet is composed mainly of mussels and crustaceans, and which lives along a great part of the Swedish coastline, is suggested as a biomonitor of cadmium for the aquatic environment. The accumulation rate of cadmium in the kidneys is rapid. Renal levels of cadmium in the parts per million range are reached 10 weeks after hatching. Juvenile birds should be collected for monitoring purposes before leaving their feeding domains at the end of the summer. PMID:3810147

  19. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    Energy Technology Data Exchange (ETDEWEB)

    Koparanova, N.; Simov, S. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Fizika na Tvyrdoto Tyalo); Genchev, D. (Bylgarska Akademiya na Naukite, Sofia. Inst. za Yadrena Izsledvaniya i Yadrena Energetika); Metchenov, G. (Research Inst. of Criminalistics and Criminology, Sofia (Bulgaria))


    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more.

  20. Oral cadmium exposure of adults in Germany. 1: Cadmium content of foodstuffs and beverages. (United States)

    Müller, M; Anke, M; Hartmann, E; Illing-Günther, H


    The cadmium contents of 94 and 105 foodstuffs bought in six-fold repetition in 1988 and in nine-fold repetition in 1991, respectively were analysed within the framework of a market-basket study. These foodstuffs were typical of German eating habits. Additionally, 170 samples of drinking water were investigated. The cadmium concentrations of the foodstuffs were comparable with results of recent studies carried out in Europe and North America. Fruit, milk and dairy products, sugar and sugar-rich foodstuffs as well as beverages showed mean cadmium contents cakes and pastries as well as farinaceous products were within the range of 20-40 ng/g. The most important bread, cakes and pastries (wheat and rye bread, toasted bread, rolls) contained 25-35 ng/g. A median cadmium concentration of 0.2 micrograms/l was found in the drinking water. As expected, liver and kidneys showed the highest cadmium levels of 73 and 204 ng/g, respectively on average. PMID:8718751

  1. Hepatotoxicity of Cadmium and Roles of Mitigating Agents

    Directory of Open Access Journals (Sweden)

    Elias Adikwu


    Full Text Available There are increasing reports on cadmium associated hepatotoxicity, due to these reports this study reviewed relevant literature on cadmium associated hepatotoxicity with emphasis on doses, route of administration, salt forms (cadmium compounds and the roles of mitigating agents. Reports have shown that continuous exposure of the liver to cadmium has led to hepatotoxicity. Humans are generally exposed to cadmium by two main routes, inhalation and ingestion. In this study, evaluation of relevant literature showed that irrespective of route of administration and salt forms cadmium hepatotoxicity is dose and time dependent. Cadmium associated hepatotoxicity manifested through impaired functions of hepatic biomarkers (transaminases, enzymatic and non enzymatic antioxidants. Histopathological damage to liver architecture manifested as swelling of hepatocytes, focal necrosis, hepatocytes degeneration, dilatation of ribosomes, damage of membrane-bounded lysosomes, nuclear pyknosis and cytoplasm vacuolization. Deterioration of mitochondrial cristae, deposition of collagen fibrils, hypertrophy of kuffer cells, congestion in central veins and sinusoids, infiltration of mixed inflammatory cells and peripheral hemorrhage also occurred. Hepatotoxic effect of cadmium was mitigated by Vitamin C, Vitamin E, Manganese (11 Chloride, N-acetylcysteine and Selenium. Extracts of plant origin including Solanum tuberosum, Calycopteris floribunda Hibiscus sabdariffa mitigated cadmium induced hepatotoxicity. Chemical substances of animal origin including honey and camel milk were reported to have ameliorated cadmium induced hepatotoxicity. One of the mechanisms of cadmium induced hepatotoxicity is reported to be associated with the up regulation of reactive oxygen species (oxidative stress which caused oxidative damage to lipid contents of membranes and direct liver injury. Conclusion cadmium is dose and time dependently hepatotoxic irrespective of route of administration

  2. Extraction-photometric determination of cadmium in meat products

    Energy Technology Data Exchange (ETDEWEB)

    Krylova, A.N.; Malyarova, M.A.; Zhulenko, V.N.


    As a result of industrial discharges, burning of solid and liquid fuels, and recycling of metal scrap, cadmium compounds enter the atmosphere and drop into the water and soil causing contamination. In this paper, a method was developed for determining cadmium in meat products. It involves wet ashing the sample, extractive separation of the cadmium as the diethyldithiocarbamate, reextraction, and determination as cadmium dithizonate or as a complex with 2,2'-dipyridyl. The detection limit with dithizone is 0.005 mg/kg and with 2,2'-dipyridyl 0.05 mg/kg. An analysis is shown to take less than 60 minutes.

  3. Cadmium elemination from phosphoric acid by ionic flotation

    International Nuclear Information System (INIS)

    The ion flotation process for the recovery of cadmium from wet phosphoric acid (30%P2O5) has been studied. This technique combines a chemical recation between the collector and the cadmium to form a precipitate (sublate) which is carried to the surface of the solution by air bubbles. the resulting foam containing the cadmium may then separated from solution. The influence of parameters such as collector and cadmium concentration as well as iron content have been investigated for the case a synthetic acid (30% P2O5). The result have been applied to the industrial phosphoric acid produced from Djebel Onk's phosphates (Algeria)

  4. Bioremoval of cadmium by lemna minor in different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Uysal, Yagmur [Dept. of Environmental Engineering, Kahramanmaras Sutcu Imam University, Kahramanmaras (Turkey); Taner, Fadime [Dept. of Environmental Engineering, Mersin University, Mersin (Turkey)


    This study was undertaken to determine the cadmium removal efficiency of Lemna minor when it was used for treatment of wastewater having different characteristics, i. e., pH, temperature and cadmium concentration. Plants were cultivated in different pH solutions (4.5-8.0) and temperatures (15-35 C) in the presence of cadmium (0.1-10.0 mg/L) for 168 h. The amount of biomass obtained in the study period, the concentrations of cadmium in the tissues and in the media and net uptake of cadmium by Lemna have been determined for each condition. The percentages of cadmium uptake (PMU) and bioconcentration factors (BCF) were also calculated. The highest accumulation was obtained for the highest cadmium concentration of 10.0 mg Cd/L as 11.668 mg Cd/g at pH 6.0, and as 38.650 mg Cd/g at 35 C and pH 5.0. The cadmium accumulation gradually increased with initial concentration of the medium, but the opposite trend was observed for the PMU. However, the maximum PMU was obtained as 52.2% in the solution with the lowest concentration of 0.1 mg Cd/L. A mathematical model was used to describe the cadmium uptake and the equation obtained was seen to fit the experimental data very well. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  5. Effects of Cadmium on BMP Induced Bone Formation

    Institute of Scientific and Technical Information of China (English)

    陈秋生; 徐顺清


    To demonstrate the direct effects of cadmium on activities of bone morphogenetic protein (BMP), a complex containing BMP and cadmium chloride (CdCl2) was implanted beneath the abdominal skin of young male Wistar rats. The activity of BMP was studied by observing the histological changes, and measuring the activity of alkaline phosphatase (ALP) and acid phosphatase (ACP) and calcium content of the implants at different time points. Our results showed that during bone formation induced by BMP, cadmium inhibited the activities of osteoblasts and osteoclasts, and slowed the deposition of calcium. It is concluded that cadmium can directly affect biological activities of BMP directly.

  6. β—Correction Spectrophotometric Determination of Cadmium with Cadion

    Institute of Scientific and Technical Information of China (English)



    Cadmium has been determined by β-correction spectrophotometry with cadion,p-nitrobenzenediazoaminoaz-obenzone,and a non-ionic surfactant,tuiton X-100.The real absorbance of a Cd-cadion chelate in the colored solution can be accurately determined and the complex-ratio of cadion with Cd(II) has been worked out to be 2.Beer's law is obeyed over the concentration range of 0-0.20mg/1 cadmium and the detec-tion limit for cadmium is only 0.003mg/1.Satisfactory experimental results are presented with respect to the determination of trace cadmium in wastewaters.

  7. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Hosliggende rapport formidler resultaterne fra PSO-projektet: ”Elektrokemisk fjernelse af cadmium fra bioasker” (PSO-F&U 3206), finansieret af Elkraft System og Energi E2 A/S. Projektet blev gennemført i perioden 01.05.2003 – 30.06.2004, og partnerne var Energi E2 A/S, BYG-DTU og Krüger A/S, med...... BYG-DTU som den primært udførende part. Projektets formål var at undersøge, om den elektrodialytiske rensningsmetode kunne bruges til at reducere indholdet af cadmium i asker fra biobrændsel (f.eks. træflis og halm) med henblik på nyttiggørelse af askerne. Projektet havde nær sammenhæng med det...

  8. Electron mobility in mercury cadmium telluride (United States)

    Patterson, James D.


    A previously developed program, which includes all electronic interactions thought to be important, does not correctly predict the value of electron mobility in mercury cadmium telluride particularly near room temperature. Part of the reason for this discrepancy is thought to be the way screening is handled. It seems likely that there are a number of contributors to errors in the calculation. The objective is to survey the calculation, locate reasons for differences between experiment and calculation, and suggest improvements.

  9. Prevention of cadmium bioaccumulation by herbal adaptogens


    K Bharavi; A. Gopala Reddy; G S Rao; Ravi Kumar, P.; D Srinivas Kumar; P Prabhu Prasadini


    Objectives : To evaluate the effect of various herbal adaptogens such as shade-dried powders of Withania somnifera, Ocimum sanctum, Asperagus recemosus, Andrographis paniculata, Asphaltum panjabinum (Shilajith), Gymnema sylvestre, Spirulina platensis, and Panex ginseng on cadmium (Cd)-induced oxidative stress and its accumulation in broiler chicken. Materials and Methods : A total of 80 male broiler chicks of day old age were randomly assigned to 10 equal groups. Group 1 birds were fed wi...



    P. Bala Ramudu; R. P. Tiwari; Srivastava, R. K.


    This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself wa...

  11. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen


    for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium chloride in rats. An experiment where 40 rats were divided into 4 groups and a control group and dosed...... with whole linseed, crushed linseed, cocoa and CdCl2 for 3 weeks was performed. Linseed or cocoa made up 10% of the feed (by weight) and was added as a replacement for carbohydrate source. The rats were dosed for 3 weeks and the cadmium content in the rats' kidneys was measured by ICPMS as a biomarker...... be measured in the kidney compared to the calculated total intake was as follows: Control 2.0 %, Crushed linseed 0.9 %, whole linseed, 1.5 %, cocoa 0.7 % and CdCl2 4.6 %. Based on this study it could not be concluded that the bioavailability in rats form whole linseed is lower that for crushed linseed...

  12. Cadmium biosorption rate in protonated Sargassum biomass

    Energy Technology Data Exchange (ETDEWEB)

    Yang, J.; Volesky, B. [McGill Univ., Montreal, Quebec (Canada). Dept. of Chemical Engineering


    Biosorption of the heavy metal ion Cd{sup 2+} by protonated nonliving brown alga Sargassum fluitans biomass was accompanied by the release of hydrogen protons from the biomass. The uptake of cadmium and the release of proton matched each other throughout the biosorption process. The end-point titration methodology was used to maintain the constant pH 4.0 for developing the dynamic sorption rate. The sorption isotherm could be well represented by the Langmuir sorption model. A mass transfer model assuming the intraparticle diffusion in a one-dimensional thin plate as a controlling step was developed to describe the overall biosorption rate of cadmium ions in flat seaweed biomass particles. The overall biosorption mathematical model equations were solved numerically yielding the effective diffusion coefficient D{sub e} about 3.5 {times} 10{sup {minus}6} cm{sup 2}/s. This value matches that obtained for the desorption process and is approximately half of that of the molecular diffusion coefficient for cadmium ions in aqueous solution.

  13. Soil ecotoxicity assessment using cadmium sensitive plants

    International Nuclear Information System (INIS)

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd

  14. Soil ecotoxicity assessment using cadmium sensitive plants

    Energy Technology Data Exchange (ETDEWEB)

    An, Youn-Joo


    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd.

  15. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment


    Dian Siswanto; Parinda Suksabye; Paitip Thiravetyan


    The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N), Cd soils (Cds), and Cd soils each amended with 1% w/w of coir pith (CP), coir pith modified with sodium hydroxide (CPm) and corncob (CC) under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatm...

  16. Influence of a high level of dietary cadmium on cadmium content in milk, excretion, and cow performance

    Energy Technology Data Exchange (ETDEWEB)

    Miller, W.J.; Lampp, B.; Powell, G.W.; Salotti, C.A.; Blackmon, D.M.


    Three Holstein cows were each given 3.0 g of cadmium daily (two equal doses) for two weeks by gelatin capsules. There was a sharp drop in concentrate consumption for the first few days of cadmium administration but, by the second week, consumption returned to normal. Milk production declined sharply for several days and then increased appreciably, but to a level still substantially lower than that of controls during the last five days cadmium was given. When cadmium treatments ceased, milk production increased by 50%. Fat content of milk was elevated considerably during the week when production was most reduced. Cows given cadmium lost considerable weight. There were no other clinical manifestations of toxicity. As determined by the chromic oxide indicator method and twice-daily grab samples, fecal excretion of cadmium for the second week averaged 82% of that given. The cadmium level in the urine was below the limits of detectability of the method (0.5 ppm of urine). The cadmium content of the milk was less than 0.1 ppm of the milk, which was the lower reliability limit of the procedure used. On this basis less than 0.22% of the amount administered appeared in the milk. In vitro studies demonstrated that cadmium combines with the casein and whey protein fractions of the milk readily, with the amount combined being linear when levels from 1.0 to 25.0 ppm are added to milk. Smaller amounts were present in the lactose and mineral fractions.

  17. Cadmium sulfate complexing with thiourea during preparation of cadmium sulfide films

    International Nuclear Information System (INIS)

    Composition of complexes deposited from cadmium sulfate and thiourea(TU) aqueous solution is studied. Its influence on cadmium sulfide film deposition during solution spraying is ascertained. It is shown that with increase of TU concentration in aqueous solution gradual substitution of TU molecules for the first sphere SO42- ions takes place. As a result CdS deposition from these solutions is initiated when the ratio of CdSO4:TU concentrations is 1:2 and for prepartation of uniform films a five-fold TU excess as a minimum is necessary

  18. Correlative characteristic of cadmium in soils of steppe Dnieper region

    Directory of Open Access Journals (Sweden)

    N. M. Tsvetkova


    Full Text Available Much attention is paid to searching for methods of establishing environmental standards for objective assessment of admissibility of anthropogenic load on the biosphere. The main pollutants of the environment are xenobiotics; heavy metals such as cadmium occupy hold a special place among them. Cadmium is one of the most dangerous environmental toxic agents, belonging to the 1stclass of hazard. Due to insufficient and fragmented information available on the distribution of cadmium in the city edaphotopes, it’s necessary to conduct additional research, taking into account the properties of soils and the biological characteristics of every element. The paper shows the ratio of cadmium in soils and soil-forming rocks of steppe Dnieper region. Environmental assessment of cadmium content in Dniprodzerzhinsk city soilsis made, and the problem of topsoil contamination of the city as a territory of high anthropogenic load is considered. It is found that the content of cadmium down the profile in natural soil increases. Enrichment of the topsoil with cadmium occurs due to contamination. The value of movable forms content, expressed as a percentage of the total content, varies from 12% to 70%, providing the evidence of the technogenic origin of cadmium in Dniprodzerzhinsk city topsoil. General and proximate correlation analyses of interrelation of soil cadmium and specifically selected characteristics of soil (pH, humus, sulfate ions, dry solid, chloride ions, total alkalinity, hygroscopic moisture were made. It is established that cadmium concentration in the movable forms of natural soils of the steppe Dnieper region depends primarily on pH value. With the increase in pH value, concentration of movable cadmium in soil increases.

  19. Cadmium induces transcription independently of intracellular calcium mobilization.

    Directory of Open Access Journals (Sweden)

    Brooke E Tvermoes

    Full Text Available BACKGROUND: Exposure to cadmium is associated with human pathologies and altered gene expression. The molecular mechanisms by which cadmium affects transcription remain unclear. It has been proposed that cadmium activates transcription by altering intracellular calcium concentration ([Ca(2+](i and disrupting calcium-mediated intracellular signaling processes. This hypothesis is based on several studies that may be technically problematic; including the use of BAPTA chelators, BAPTA-based fluorescent sensors, and cytotoxic concentrations of metal. METHODOLOGY/PRINCIPAL FINDING: In the present report, the effects of cadmium on [Ca(2+](i under non-cytotoxic and cytotoxic conditions was monitored using the protein-based calcium sensor yellow cameleon (YC3.60, which was stably expressed in HEK293 cells. In HEK293 constitutively expressing YC3.60, this calcium sensor was found to be insensitive to cadmium. Exposing HEK293::YC3.60 cells to non-cytotoxic cadmium concentrations was sufficient to induce transcription of cadmium-responsive genes but did not affect [Ca(2+](i mobilization or increase steady-state mRNA levels of calcium-responsive genes. In contrast, exposure to cytotoxic concentrations of cadmium significantly reduced intracellular calcium stores and altered calcium-responsive gene expression. CONCLUSIONS/SIGNIFICANCE: These data indicate that at low levels, cadmium induces transcription independently of intracellular calcium mobilization. The results also support a model whereby cytotoxic levels of cadmium activate calcium-responsive transcription as a general response to metal-induced intracellular damage and not via a specific mechanism. Thus, the modulation of intracellular calcium may not be a primary mechanism by which cadmium regulates transcription.

  20. Critical review of animal carcinogenesis by cadmium and its inorganic compounds

    International Nuclear Information System (INIS)

    Animal carcinogenic biassays relative to 6 inorganic cadmium substances (cadmium metal, cadmium oxide, cadmium sulfide, cadmium sulfate, cadmium chloride and cadmium acetate) are reviewed (speciation). Critical evaluation of literature data on carcinogenicity has been performed by making reference to E.C. guidelines of good laboratory practice. There are few data on routes relevant for human risk assessment: experiments on inhalation demonstrate lung carcinogenicity of cadmium oxide, cadmium sulfide, cadmium sulfate and cadmium chloride in rats but not in mice nor in hamsters; no carcinogenic effects of cadmium compounds are observed following oral administration. For routes of less or no relevance for human risk assessment, some results are clearly positive: subcutaneous injection induces cancers in situ (various cadmium compounds), testicular tumours (cadmium sulfate and cadmium chloride) and prostatic tumours (cadmium chloride) but such effects are not observed using relevant malignancies in rats. With respect to other no relevant routes (intraperitoneal, intrarenal...) tumours are incidentally produced in situ, but not in remote organs. Numerous studies fail to demonstrate cadmium carcinogenicity, but methodologically acceptable negative ones are very limited in number. Accordingly strain dependent effects and dose effect relationship could not be thoroughly assessed

  1. Study of nuclear structure of odd mass 119-127I nuclei in a phenomenological approach (United States)

    Singh, Dhanvir; Gupta, Anuradha; Kumar, Amit; Sharma, Chetan; Singh, Suram; Bharti, Arun; Khosa, S. K.; Bhat, G. H.; Sheikh, J. A.


    By using the phenomenological approach of Projected Shell Model (PSM), the positive and negative-parity band structures of odd mass neutron-rich 119-127I nuclei have been studied with the deformed single-particle states generated by the standard Nilsson potential. For these isotopes, the band structures have been analyzed in terms of quasi-particles configurations. The phenomenon of backbending in moment of inertia is also studied in the present work. Besides this, the reduced transition probabilities, i.e. B (E 2) and B (M 1), are obtained from the PSM wavefunction for the first time for yrast bands of these isotopes.

  2. NOTCH2 is neither rearranged nor mutated in t(1;19 positive oligodendrogliomas.

    Directory of Open Access Journals (Sweden)

    Magdalena Benetkiewicz

    Full Text Available The combined deletion of 1p and 19q chromosomal arms is frequent in oligodendrogliomas (OD and has recently been shown to be mediated by an unbalanced t(1;19 translocation. Recent studies of 1p/19q co-deleted OD suggest that the NOTCH2 gene is implicated in oligodendrocyte differentiation and may be involved in this rearrangement. The objective of the present study was to analyze the NOTCH2 locus either as a chromosomal translocation locus that may be altered by the 1p/19q recurrent rearrangement or as a gene that may be inactivated by a two hit process. We performed an array-CGH analysis of 15 ODs presenting 1p/19q co-deletion using a high-density oligonucleotide microarray spanning 1p and 19q pericentromeric regions with 377 bp average probe spacing. We showed that the 1p deletion extends to the centromere of chromosome 1 and includes the entire NOTCH2 gene. No internal rearrangement of this gene was observed. This strongly suggests that the t(1;19 translocation does not lead to an abnormal NOTCH2 structure. The analysis of the entire NOTCH2 coding sequence was performed in four cases and did not reveal any mutation therefore indicating that NOTCH2 does not harbor genetic characteristics of a tumor suppressor gene. Finally, the detailed analysis of chromosome 19 pericentromeric region led to the identification of two breakpoint clusters at 19p12 and 19q11-12. Interestingly, these two regions share a large stretch of homology. Together with previous observations of similarities between chromosome 1 and 19 alphoid sequences, this suggests that the t(1;19 translocation arises from complex intra and interchromosomal rearrangements.This is the first comprehensive deletion mapping by high density oligo-array of the 1p/19q co-deletion in oligodendroglioma tumors using a methodological approach superior to others previously applied. As such this paper provides clear evidence that the NOTCH2 gene is not physically rearranged by t(1;19 translocation of

  3. Biased signaling of lipids and allosteric actions of synthetic molecules for GPR119

    DEFF Research Database (Denmark)

    Hassing, Helle A; Fares, Suzan; Larsen, Olav;


    for 2h with the 2-MAG-lipase inhibitor JZL84 doubled the constitutive activity, indicating that endogenous lipids contribute to the apparent constitutive activity. Finally, besides being an agonist, AR231453 acted as a positive allosteric modulator of OEA and increased its potency by 54-fold at 100nM AR......231453. Our studies uncovering broad and biased signaling, masked constitutive activity by endogenous MAGs, and ago-allosteric properties of synthetic ligands may explain why many GPR119 drug-discovery programs have failed so far....

  4. Drikkevands optagelse af cadmium og bly fra armaturer

    DEFF Research Database (Denmark)

    Nielsen, K.

    Notatet omfatter rapporter fra to forsøgsrækker vedr. brugsvands optagelse af bly og cadmium. Den første omhandler brugsvandsarmaturers afgivelse af bly og cadmium til syntetisk brugsvand med en sammensætning svarende til en sur, blød vandtype. Forsøgene omfatter 10 armaturer og armaturdele...

  5. Cadmium-induced ectopic apoptosis in zebrafish embryos

    Energy Technology Data Exchange (ETDEWEB)

    Chan, Po Kwok; Cheng, Shuk Han [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon (Hong Kong)


    In this study, we tested the hypothesis that cadmium-induced developmental toxicity was mediated via ectopic occurrence of apoptosis during embryonic development. We employed confocal microscopy to acquire images of whole-mount staining of apoptotic cells in zebrafish embryo exposed to 100 {mu}M cadmium from 5 hours post fertilisation (hpf) to 28 hpf. Three-dimensional reconstruction of the images was performed and the spatial and temporal distributions of apoptotic cells in the embryos were compared. In cadmium-treated embryos with varying degrees of gross developmental malformations, significantly higher numbers of apoptotic cells were detected with this method. In order to detect the precise locations of apoptotic cells, we performed terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL) assay in sectioned embryos. In the degenerating neural tube of cadmium-treated embryos apoptotic cells were detected, while in the healthy neural tube of the untreated controls no apoptotic cells were found. We then employed flow cytometry to investigate whether cadmium exposure would affect the dynamics of apoptosis or induce any abnormalities in cell-cycle progression. It appeared that cadmium did not induce cell-cycle arrest. The percentages of apoptotic cells did not differ in the two groups at 13, 16 or 19 hpf. At 28 hpf, however, a significantly higher percentage of apoptotic cells were found in the cadmium-treated group. Exposure to cadmium, therefore, induced ectopic apoptosis at 28 hpf without affecting the dynamics of apoptosis at earlier developmental stages. (orig.)

  6. Cadmium inhibits neurogenesis in zebrafish embryonic brain development

    Energy Technology Data Exchange (ETDEWEB)

    Chow, Elly Suk Hen [Division of Biology, California Institute of Technology, 1200 California Boulevard, Pasadena, CA 91125 (United States); Hui, Michelle Nga Yu; Lin Chunchi [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China); Cheng Shukhan [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China)], E-mail:


    Cadmium is a non-essential heavy metal found abundantly in the environment. Children of women exposed to cadmium during pregnancy display lower motor and perceptual abilities. High cadmium body burden in children is also related to impaired intelligence and lowered school achievement. However, little is known about the molecular and cellular basis of developmental neurotoxicity in the sensitive early life stages of animals. In this study, we explore neurological deficits caused by cadmium during early embryonic stages in zebrafish by examining regionalization of the neural tube, pattern formation and cell fate determination, commitment of proneural genes and induction of neurogenesis. We show that cadmium-treated embryos developed a smaller head with unclear boundaries between the brain subdivisions, particularly in the mid-hindbrain region. Embryos display normal anterior to posterior regionalization; however, the commitment of neural progenitor cells was affected by cadmium. We observe prominent reductions in the expression of several proneuronal genes including ngn1 in cell clusters, zash1a in the developing optic tectum, and zash1b in the telencephalon and tectum. Cadmium-treated embryos also have fewer differentiated neurons and glia in the facial sensory ganglia as indicated by decreased zn-12 expression. Also, a lower transcription level of neurogenic genes, ngn1 and neuroD, is observed in neurons. Our data suggest that cadmium-induced neurotoxicity can be caused by impaired neurogenesis, resulting in markedly reduced neuronal differentiation and axonogenesis.

  7. Epigenetic Effects of Cadmium [Abstract and Poster 2014 (United States)

    We have reviewed the literature on in vitro and in vivo experiments as well as human studies on cadmium to understand the epigenetic mechanisms involved in cadmium- induced toxicity and carcinogenicity. This presentation will identify gaps in our current understanding and suggest...

  8. Electrolytic indium refining from cadmium in glycerine electrolyte

    International Nuclear Information System (INIS)

    The results of investigations directed on development of electrochemical indium cleaning from cadmium in glycerine base electrolyte are presented. Optimal operational conditions, specific consumption of reactants and electric power are determined. Relationship between variation of concentration of cadmium impurity in refined metal and duration of electrolysis is revealed. The method for determination of cleaning time is proposed. Developed process was put into commercial operation

  9. Method of making a thin film cadmium telluride solar cell

    International Nuclear Information System (INIS)

    A method for making a photovoltaic cell is described comprising the steps of: (a) depositing a transparent or semi-transparent conductive window layer onto a substrate; (b) depositing a layer of cadmium telluride including phosphorus onto the window layer; (c) depositing a layer of lead telluride onto the layer of cadmium telluride; and (d) depositing a metallic electrode onto the lead telluride layer

  10. Removing cadmium from electroplating wastewater by waste saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    DAI Shu-juan; WEI De-zhou; ZHOU Dong-qin; JIA Chun-yun; WANG Yu-juan; LIU Wen-gang


    The appropriate condition and scheme of removing cadmium from electroplating wastewater were investigated by adsorption-precipitation method using waste saccharomyces cerevisiae(WSC) as sorbent. Effect factors on biosorption of cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae and precipitation process of waste saccharomyces cerevisiae after adsorbing cadmium were studied. The results show that removal rate of cadmium is over 88% after 30 min adsorbing under the condition of cadmium concentration 26 mg/L, the dosage of waste saccharomyces cerevisiae 16.25 g/L, temperature 18 ℃, pH 6.0 and precipitation time 4 h. Biosorption-precipitation method is effective to remove cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae. The SEM, infrared spectroscopy and Zeta-potential of the cells show that chemical chelating is the main adsorption form; electrostatic attraction, hydrogen bonding and van der Waals force all function in adsorption process; and ―NH2―,―C=O―,―C=O―NH―,―CH3, ―OH are the main adsorption groups.

  11. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.


    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  12. Cadmium Removal from Aqueous Solutions by Ground Pine Cone

    Directory of Open Access Journals (Sweden)

    H Izanloo, S Nasseri


    Full Text Available A study on the removal of cadmium ions from aqueous solutions by pine cone was conducted in batch conditions. Kinetic data and equilibrium removal isotherms were obtained. The influence of different experimental parameters such as contact time, initial concentration of cadmium, pine cone mass and particle size, and temperature on the kinetics of cadmium removal was studied. Results showed that the main parameters that played an important role in removal phenomenon were initial cadmium concentration, particle size and pine cone mass. The necessary time to reach equilibrium was between 4 and 7 hours based on the initial concentration of cadmium. The capacity of cadmium adsorption at equilibrium increased with the decrease of pine cone particle size. The capacity of cadmium adsorption at equilibrium by pine cone increased with the quantity of pine cone introduced (1–4 g/L. Temperature in the range of 20-30°C showed a restricted effect on the removal kinetics (13.56 mg/g at 20°C and a low capacity of adsorption about 11.48 mg/g at 30°C. The process followed pseudo second-order kinetics. The cadmium uptake of pine cone was quantitatively evaluated using adsorption isotherms. Results indicated that the Langmuir model gave a better fit to the experimental data in comparison with the Freundlich equation.

  13. Effect of environmental exposure to Cadmium on pregnancy outcome

    Directory of Open Access Journals (Sweden)

    F. Ramezanzadeh


    Full Text Available "n "n "nBackgrounds andObjectives:The objective of the present study was to evaluate the potential effect of environmental exposure to toxic metal (cadmium on pregnancy outcome and fetal growth."nMaterials and Methods: 330 normal pregnant women were randomly selected from vali-e-asr hospital, from July 2003 through Feb. 2005. Cadmium was measured in umbilical cord blood and mother whole blood of postpartum women without occupational exposure to metals in Tehran, Iran, using inductively coupled plasma mass spectrometry"nResult: Whole blood cadmium and cord blood cadmium ranged from 0/00 to 6/30 μg/L ,respectivly. in the group higher level of maternal blood cadmium (> 0.40 μg/L 1cm decrease was seen in neonatal birth height. (p = 0.007 There was a significant association between cadmium exposure and birth weight.Mann-whitney test showed that, maternal blood cadmium level, was significantly negatively associated with neonatal birth weight (z = -1.83, P < 0.06."nConclusion: It was concluded that environmental exposure to cadmium significantly reduces neonatal birth height.

  14. Risk of overestimation of urinary cadmium concentrations: interference from molybdenum

    Directory of Open Access Journals (Sweden)

    Cañas A.I.


    Full Text Available We show here that the selection of analytical method is critical when measuring low levels of cadmium in human urine. Cadmium is today usually analyzed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS, which has a higher sensitivity than Atomic Absorption Spectroscopy (AAS. ICP-MS cadmium measurements show interference from tin (114Sn and molybdenum oxides, which can result in an overestimation of cadmium levels. The 114Sn interference is stable and can be mathematically corrected. Molybdenum concentrations in urine are variable and different from individual to individual. We have estimated the degree of error which molybdenum interference introduces in the measurement of cadmium in urine by conventional ICP-MS. 268 urine samples from mothers and their children were measured. Removal of the molybdenum oxide interference (DRC-ICP-MS method reduced urinary cadmium concentrations significantly (47.8%. The urinary molybdenum concentration in children was higher than in their mothers, resulting in greater overestimation. Our results clearly show that the DRC method is essential for reliable measurements of urinary cadmium concentrations, particularly in children. Furthermore, care should be taken when comparing Human Biomonitoring data for cadmium in urine and attention should be paid to which analytical method has been used (e.g. AAS and ICP-Ms, and especially if the measurements have been corrected for molybdenum interference.

  15. The effect of phosphate fertilizer cadmium on cadmium in soils and crops

    NARCIS (Netherlands)

    Smilde, K.W.; Luit, van B.


    Een van de oorzaken, waardoor bodemvervuiling met cadmium optreedt en dus een bevordering van cadmiumopname door het gewas, is toepassing van fosfaatkunstmest, waarin zich verschillende gehaltes van dit zware metaal bevinden. Dit rapport behandelt het onderzoek naar de stijging van het cadmiumgehalt


    Biosolids and Cd salt-amended soils were collected from a long-term field experiment established in 1976. Cadmium sorption experiments were conducted on different fractions of soils amended with biosolids, Cd salt, and unamended soils (control). The organic carbon (OC) of soils ...

  17. Comparison of toxicity and disposition of cadmium chloride and cadmium metallothionein in rats.

    NARCIS (Netherlands)

    Groten, J.P.


    In Chapter 1 of this thesis a general introduction is presented with a survey of the literature. It gives a brief overview of the factors involved in the absorption, metabolism and toxicity of Cd after oral intake.In short, the main source of environmental exposure to cadmium for no

  18. Cadmium chronic administration to lactating ewes. Reproductive performance, cadmium tissue accumulation and placental transfer

    Energy Technology Data Exchange (ETDEWEB)

    Floris, B.; Bomboi, G.; Sechi, P.; Marongiu, M. L. [Sassari Univ., Sassari (Italy). Dipt. di Biologia Animale; Pirino, S. [Sassari Univ., Sassari (Italy). Ist. di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-chirurgica Veterinaria


    20 lactating ewes were allotted to two groups: 10 subjects received orally 100 mg/day of CdCl{sub 2} for 108 consecutive days, and the remaining 10 acted as control. Reproductive performance in ewes and cadmium tissue accumulation, both in ewes and their lambs, were investigated. The results showed that in ewes: 1) the regular cadmium intestinal intake negatively influences all reproductive parameters; 2) cadmium is particularly accumulated in kidney and liver, bur also in mammary gland, although at distinctly lower level; 3) chronic administration does not increase cadmium placental transfer in lactating pregnant subjects. [Italian] 20 pecore in lattazione sono state suddivise in 2 gruppi: 10 soggetti ricevettero per os 100 mg/giorno di CdCl{sub 2} per 108 giorni consecutivi, e i restanti 10 funsero da controllo. Sono stati studiati i parametri riproduttivi delle pecore e l'accumulo di cadmio nei tessuti, sia delle pecore che dei loro agnelli. I risultati hanno mostrato che negli ovini: 1) il regolare assorbimento intestinale di cadmio influenza negativamente tutti i parametri riproduttivi; 2) il cadmio viene accumulato principalmente nei reni e nel fegato, ma anche dalla ghiandola mammaria, sebbene in misura nettamente inferiore; 3) la somministrazione cronica di cadmio nei soggetti gravidi non incrementa il suo passaggio transplacentare.

  19. Adsorption of cadmium from aqueous solutions by perlite. (United States)

    Mathialagan, T; Viraraghavan, T


    The present study examined the use of perlite for the removal of cadmium from aqueous solutions. The effects of pH and contact time on the adsorption process were examined. The optimum pH for adsorption was found to be 6.0. Residual cadmium concentration reached equilibrium in 6h and the rate of cadmium adsorption by perlite was rapid in the first hour of the reaction time. Ho's pseudo-second-order model best described the kinetics of the reaction. Batch adsorption experiments conducted at room temperature (22+/-1 degrees C) showed that the adsorption pattern followed the Freundlich isotherm model. The maximum removal of cadmium obtained from batch studies was 55%. Thomas model was used to describe the adsorption data from column studies. The results generally showed that perlite could be considered as a potential adsorbent for cadmium removal from aqueous solutions.

  20. Cadmium adsorption in montmorillonite as affected by glyphosate

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-jun; ZHOU Dong-mei; LUO Xiao-san; SUN Rui-juan; CHEN Huai-man


    Behaviors of soil heavy metals are often affected by coexisting herbicides due to their physical and chemical interaction. Effect of glyphosate, an herbicide containing -PO32- and -COOH groups, on cadmium adsorption in montmorillonite was studied in detail. The results showed that cadmium adsorption quantity in montmorillonite increased with increasing soil solution pH and cadmium concentration as usual, but decreased with glyphosate, which is due to the formation of a low affinity complex of Cd and glyphosate and decreasing solution pH induced by glyphosate addition. When the equilibrium solution pH was below 6.7, glyphosate has little effect on cadmium adsorption, but when the equilibrium solution pH was above 6.7, glyphosate significantly decreased cadmium adsorption quantity in montmorillonite. In addition, the adding order of Cd and glyphosate also influenced Cd adsorption quantity in montmorillonite.

  1. Synthesis of cadmium chalcogenide nanotubes at room temperature

    KAUST Repository

    Pan, Jun


    Cadmium chalcogenide (CdE, E=S, Se, Te) polycrystalline nanotubes have been synthesized from precursor of CdS/cadmium thiolate complex at room temperature. The precursor was hydrothermally synthesized at 180 °C using thioglycolic acid (TGA) and cadmium acetate as starting materials. The transformation from the rod-like precursor of CdS/cadmium thiolate complex to CdS, CdSe and CdTe nanotubes were performed under constant stirring at room temperature in aqueous solution containing S 2-, Se 2- and Te 2-, respectively. The nanotube diameter can be controlled from 150 to 400 nm related to the dimension of templates. The XRD patterns show the cadmium chalcogenide nanotubes all corresponding to face-centered cubic structure. © 2012 Elsevier B.V. All rights reserved.

  2. Determination of the cadmium and copper content inherent to metallothionein

    Energy Technology Data Exchange (ETDEWEB)

    Raspor, B.; Kozar, S.; Pavicic, J.; Juric, D. [Ruder Boskovic Institute, Center for Marine Research Zagreb, P.O.B. 1016, HR-10 001 Zagreb (Croatia)


    The reliability of the voltammetric determination of the cadmium and copper content (at pH 1.0), inherent to metallothionein (MT) isolated from the digestive gland of Mytilus galloprovincialis, was investigated. An artifact signal enhancement of copper, caused by the cupric-thionein complex adsorption at the mercury electrode, was established. This artifact was removed by UV-digestion of the sample for 15-20 h prior to analysis. A similar artifact was not detected for cadmium, because at this pH the cadmium-thionein complex has dissociated, and cadmium exists in the ionic form. Therefore, the voltammetric analysis of the cadmium content can be performed directly at pH 1.0, without prior UV-digestion of the sample. (orig.) With 3 figs., 1 tab., 12 refs.

  3. Effect of pregnancy on cadmium-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Takizama, Y. (Akita Univ. School of Medicine, Japan); Nakamura, I.; Kurayama, R.; Hirasawa, F.; Kawai, K.


    It is well known that itai-itai disease with the osteopathy is broken out among multiparas, 40 years of age and up Japanese residents. In this paper we described an experimental study of effect of pregnancy on cadmium treated rats. Female mature rats were administered drinking water containing 50 and 200 ppm cadmium as CdCl/sub 2/. During 180 days of the experiment, three times of pregnancy were succesful, though slight depression of body weight gain was noticed in the 200 ppm group. The cadmium was accumulated in the kidneys, liver and bone proportionally to the amount of cadmium administered. No significant change was recognized in serum calcium, phosphorus and alkaline phosphatase levels after 180 days. Though cadmium 200 ppm treated rats showed slight histological lesions in the proximal convoluted tubules of the kidney, there appeared to be no osteomalacia including excess formation of osteoid tissue.

  4. Galaxy Luminosity Function of Dynamically Young Abell 119 Cluster: Probing the Cluster Assembly

    CERN Document Server

    Lee, Youngdae; Hilker, Michael; Sheen, Yun-Kyeong; Yi, Sukyoung K


    We present the galaxy luminosity function (LF) of the Abell 119 cluster down to $M_r\\sim-14$ mag based on deep images in the $u$-, $g$-, and $r$-bands taken by using MOSAIC II CCD mounted on the Blanco 4m telescope at the CTIO. The cluster membership was accurately determined based on the radial velocity information as well as on the color-magnitude relation for bright galaxies and the scaling relation for faint galaxies. The overall LF exhibits a bimodal behavior with a distinct dip at $r\\sim18.5$ mag ($M_r\\sim-17.8$ mag), which is more appropriately described by a two-component function. The shape of the LF strongly depends on the cluster-centric distance and on the local galaxy density. The LF of galaxies in the outer, low-density region exhibits a steeper slope and more prominent dip compared with that of counterparts in the inner, high-density region. We found evidence for a substructure in the projected galaxy distribution in which several overdense regions in the Abell 119 cluster appear to be closely ...

  5. Updated Drainable Interstitial Liquid Volume Estimates for 119 Single Shell Tanks (SST) Declared Stabilized

    Energy Technology Data Exchange (ETDEWEB)

    FIELD, J.G.


    This document assesses the volume of drainable interstitial liquid (DIL) and pumpable liquid remaining in 119 single-shell tanks (SSTs) that were previously stabilized. Based on the methodology and assumptions presented, the DIL exceeded the stabilization criterion of less than 50,000 gal in two of the 119 SSTs. Tank 241-C-102 had an estimated DIL of 62,000 gal, and the estimated DIL for tank 241-BY-103 was 58,000 gal. In addition, tanks 241-BX-103, 241-T-102, and 241-T-112 appear to exceed the stabilization criterion of 5,000 gal supernatant. An assessment of the source of the supernatant in these tanks is beyond the scope of this document. The actual DIL and pumpable liquid remaining volumes for each tank may vary significantly from estimated volumes as a result of specific tank waste characteristics that are not currently measured or defined. Further refinement to the pumpable liquid and DIL volume estimates may be needed as additional tank waste information is obtained.

  6. Investigating the peculiar emission from the new VHE gamma-ray source H1722+119 (United States)

    Ahnen, M. L.; Ansoldi, S.; Antonelli, L. A.; Antoranz, P.; Babic, A.; Banerjee, B.; Bangale, P.; Barres de Almeida, U.; Barrio, J. A.; Becerra González, J.; Bednarek, W.; Bernardini, E.; Biasuzzi, B.; Biland, A.; Blanch, O.; Bonnefoy, S.; Bonnoli, G.; Borracci, F.; Bretz, T.; Buson, S.; Carosi, A.; Chatterjee, A.; Clavero, R.; Colin, P.; Colombo, E.; Contreras, J. L.; Cortina, J.; Covino, S.; Da Vela, P.; Dazzi, F.; De Angelis, A.; De Lotto, B.; de Oña Wilhelmi, E.; Di Pierro, F.; Doert, M.; Domínguez, A.; Dominis Prester, D.; Dorner, D.; Doro, M.; Einecke, S.; Eisenacher Glawion, D.; Elsaesser, D.; Fallah Ramazani, V.; Fernández-Barral, A.; Fidalgo, D.; Fonseca, M. V.; Font, L.; Frantzen, K.; Fruck, C.; Galindo, D.; García López, R. J.; Garczarczyk, M.; Garrido Terrats, D.; Gaug, M.; Giammaria, P.; Godinović, N.; González Muñoz, A.; Gora, D.; Guberman, D.; Hadasch, D.; Hahn, A.; Hanabata, Y.; Hayashida, M.; Herrera, J.; Hose, J.; Hrupec, D.; Hughes, G.; Idec, W.; Kodani, K.; Konno, Y.; Kubo, H.; Kushida, J.; La Barbera, A.; Lelas, D.; Lindfors, E.; Lombardi, S.; Longo, F.; López, M.; López-Coto, R.; Majumdar, P.; Makariev, M.; Mallot, K.; Maneva, G.; Manganaro, M.; Mannheim, K.; Maraschi, L.; Marcote, B.; Mariotti, M.; Martínez, M.; Mazin, D.; Menzel, U.; Miranda, J. M.; Mirzoyan, R.; Moralejo, A.; Moretti, E.; Nakajima, D.; Neustroev, V.; Niedzwiecki, A.; Nievas Rosillo, M.; Nilsson, K.; Nishijima, K.; Noda, K.; Nogués, L.; Orito, R.; Overkemping, A.; Paiano, S.; Palacio, J.; Palatiello, M.; Paneque, D.; Paoletti, R.; Paredes, J. M.; Paredes-Fortuny, X.; Pedaletti, G.; Perri, L.; Persic, M.; Poutanen, J.; Prada Moroni, P. G.; Prandini, E.; Puljak, I.; Rhode, W.; Ribó, M.; Rico, J.; Rodriguez Garcia, J.; Saito, T.; Satalecka, K.; Schultz, C.; Schweizer, T.; Sillanpää, A.; Sitarek, J.; Snidaric, I.; Sobczynska, D.; Stamerra, A.; Steinbring, T.; Strzys, M.; Takalo, L.; Takami, H.; Tavecchio, F.; Temnikov, P.; Terzić, T.; Tescaro, D.; Teshima, M.; Thaele, J.; Torres, D. F.; Toyama, T.; Treves, A.; Verguilov, V.; Vovk, I.; Ward, J. E.; Will, M.; Wu, M. H.; Zanin, R.; D'Ammando, F.; Berdyugin, A.; Hovatta, T.; Max-Moerbeck, W.; Raiteri, C. M.; Readhead, A. C. S.; Reinthal, R.; Richards, J. L.; Verrecchia, F.; Villata, M.


    The Major Atmospheric Gamma-ray Imaging Cherenkov (MAGIC) telescopes observed the BL Lac object H1722+119 (redshift unknown) for six consecutive nights between 2013 May 17 and 22, for a total of 12.5 h. The observations were triggered by high activity in the optical band measured by the KVA (Kungliga Vetenskapsakademien) telescope. The source was for the first time detected in the very high energy (VHE, E > 100 GeV) γ-ray band with a statistical significance of 5.9σ. The integral flux above 150 GeV is estimated to be (2.0 ± 0.5) per cent of the Crab nebula flux. We used contemporaneous high energy (HE, 100 MeV source. Within the framework of the current extragalactic background light models, we estimate the redshift to be z = 0.34 ± 0.15. Additionally, we used contemporaneous X-ray to radio data collected by the instruments on board the Swift satellite, the KVA, and the Owens Valley Radio Observatory telescope to study multifrequency characteristics of the source. We found no significant temporal variability of the flux in the HE and VHE bands. The flux in the optical and radio wavebands, on the other hand, did vary with different patterns. The spectral energy distribution of H1722+119 shows surprising behaviour in the ˜3 × 1014-1018 Hz frequency range. It can be modelled using an inhomogeneous helical jet synchrotron self-Compton model.

  7. Influence of Aluminum and Cadmium Stresses on Mineral Nutrition and Root Exudates in Two Barley Cultivars

    Institute of Scientific and Technical Information of China (English)

    QUO Tian-Rong; ZHANG Guo-Ping; ZHOU Mei-Xue; WU Fei-Bo; CHEN Jin-Xin


    A hydroponic experiment was carried out to study the effect of aluminum (Al) and cadmium (Cd) on Al and mineral nutrient contents in plants and Al-induced organic acid exudation in two barley varieties with different Al tolerance. Al-sensitive cv. Shang 70-119 had significantly higher Al content and accumulation in plants than Al-tolerant cv. Gebeina, especially in roots, when subjected to low pH (4.0) and Al treatments (100 μmol L-1 Al and 100 μmol L-1 Al +1.0 μmol L-1 Cd). Cd addition increased Al content in plants exposed to Al stress. Both low pH and Al treatments caused marked reduction in Ca and Mg contents in all plant parts, P and K contents in the shoots and leaves, Fe, Zn and Mo contents in the leaves, Zn and B contents in the shoots, and Mn contents both in the roots and leaves. Moreover, changes in nutrient concentrations were greater in the plants exposed to both Al and Cd than in those exposed only to Al treatment. A dramatic enhancement of malate, citrate, and succinate was found in the plants exposed to 100 μmol L-1 Al relative to the control, and the Al-tolerant cultivar had a considerable higher exudation of these organic acids than the Al-sensitive one, indicating that Al-induced enhancement of these organic acids is very likely to be associated with Al tolerance.

  8. Effects of diethyldithiocarbamate on the toxicokinetics of cadmium chloride in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B


    Diethyldithiocarbamate (DDC) efficiently alleviates the acute toxicity of injected cadmium chloride, but enhances the acute toxicity of orally administered cadmium chloride. Further, DDC induces extensive changes in organ distribution of cadmium, and mobilizes aged cadmium depots. The present study...... investigates effects of DDC on the toxicokinetics of cadmium at lower doses of cadmium than those used in previous studies. During single exposure to subtoxic oral doses of cadmium chloride DDC enhanced intestinal cadmium absorption, both after intraperitoneal and oral administration of DDC. In such acute...... exposure experiments orally administered DDC only slightly changed the relative organ distribution of absorbed cadmium, while intraperitoneal administration of DDC induced extensive changes in organ preference of absorbed cadmium. The relative hepatic and testicular deposition was reduced, while...

  9. Fast-neutron scattering from elemental cadmium

    International Nuclear Information System (INIS)

    Neutron differential-elastic-scattering cross sections of elemental cadmium are measured from approx. = 1.5 to 4.0 MeV at incident-neutron energy intervals of 50 to 200 keV and at 10 to 20 scattering angles distributed between approx. = 20 and 160 degrees. Concurrently, lumped-level neutron inelastic-excitation cross sections are measured. The experimental results are used to deduce parameters of an optical-statistical model that is descriptive of the observables and are compared with corresponding quantities given in ENDF/B-V

  10. Chorea: clinical correlates of 119 cases Coréia: análise clínica de 119 casos

    Directory of Open Access Journals (Sweden)

    Maria Fernanda Mendes


    Full Text Available Chorea is a clinical syndrome characterized by abnormal involuntary arrhythmic movements, randomly distributed in time, affecting mainly the distal parts of the limbs. There are many diseases associated with chorea but the distribution of the etiologies vary too much in different parts of the world. We intended to study the etiologies of chorea in a Movement Disorders Unit of a university hospital-based outpatient clinic in Brazil. We studied the records of 119 patients with chorea based in the diagnostic criteria of the World Federation of Neurology. Sydenham's chorea (SC was the most frequent cause of chorea (51.3% of our sample. Other common causes were Huntington's chorea (18.5% and chorea post-stroke (9.2%. SC is not commonly seen in developed countries nowadays but is not rare in Brazil. SC patients generally have the clinical manifestation of it in the first 20 years of age and girls are more affected than boys and this feature was observed in our sample. Based on our own experience and in the review of the literature we propose an etiological classification of chorea.Coréia é uma síndrome caracterizada por movimentos involuntários arrítmicos, rápidos, abruptos, não repetitivos no tempo e com distribuição variável, preferentemente distal. O número de entidades clínicas reconhecidamente associadas a movimentos coréicos tem se tornado cada vez maior com o passar do tempo. Propusemo-nos estudar a frequência e algumas características epidemiológicas das coréias atendidas em um ambulatório especializado em distúrbios do movimento. Foram estudados os prontuários de 119 pacientes com o diagnóstico sindrômico de coréia. O predomínio absoluto foi de coréia de Sydenham (CS com 51,3% do total da amostra. Outras causas frequentes foram doença de Huntington (DH presente em 18,5% e a coréia secundária a doença cerebrovascular em 9,2% dos pacientes. O sexo feminino predominou em todas as faixas etárias, mas principalmente

  11. Modeling cadmium in the feed chain and cattle organs

    Directory of Open Access Journals (Sweden)

    van der Fels-Klerx, I.


    Full Text Available The objectives of this study were to estimate cadmium contamination levels in different scenarios related to soil characteristics and assumptions regarding cadmium accumulation in the animal tissues, using quantitative supply chain modeling. The model takes into account soil cadmium levels, soil pH, soil-to-plant transfer, animal consumption patterns, and transfer into animal organs (liver and kidneys. The model was applied to cattle up to the age of six years which were fed roughage (maize and grass and compound feed. Cadmium content in roughage and cadmium intake by cattle were calculated for six different (soil scenarios varying in soil cadmium levels and soil pH. For each of the six scenarios, the carry-over of cadmium from intake into the cattle organs was estimated applying two model assumptions, i.e., linear accumulation and a steady state situation. The results showed that only in the most extreme soil scenario (cadmium level 2.5, pH 4.5, cadmium exceeded the EC maximum tolerated level in roughage. Assuming linear accumulation, cadmium levels in organs of cattle up to six years of age, ranged from 0.37-4.03 of fresh weight for kidneys and from 0.07 to 0.77 of fresh weight for livers. The maximum tolerated levels in one or both organs were exceeded in several scenarios. When considering organ excretion of cadmium, internal cadmium levels in organs were approximately one order of magnitude lower as compared to the results of the linear accumulation model. In this case only in the most extreme soil scenario, the maximum tolerated level in the kidney was exceeded. It was concluded that the difference between the two assumptions (linear model versus a steady state situation to estimate cadmium carry-over in cattle is negligible in the animal's first five years of life, but will become relevant at higher ages. For the current case, the linear approach is a good descriptor for worst case situations. Furthermore, this

  12. Sources of cadmium exposure among healthy premenopausal women

    International Nuclear Information System (INIS)

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 μg/g (95% confidence interval (CI): 0.38-0.48 μg/g) and 0.30 μg/g (0.27-0.33 μg/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 μg/g (95% CI: 0.06-0.15 μg/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: →Urine cadmium, usual

  13. Sources of cadmium exposure among healthy premenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Scott V., E-mail: [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Newcomb, Polly A. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Shafer, Martin M. [Environmental Chemistry and Technology Program, University of Wisconsin and Wisconsin State Laboratory of Hygiene, Madison, WI (United States); Atkinson, Charlotte [Department of Oral and Dental Science, Bristol Dental School, Bristol (United Kingdom); Bowles, Erin J. Aiello [Group Health Research Institute, Seattle, WA (United States); Newton, Katherine M. [Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Group Health Research Institute, Seattle, WA (United States); Lampe, Johanna W. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States)


    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 {mu}g/g (95% confidence interval (CI): 0.38-0.48 {mu}g/g) and 0.30 {mu}g/g (0.27-0.33 {mu}g/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 {mu}g/g (95% CI: 0.06-0.15 {mu}g/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: {yields

  14. Accumulation and distribution of arsenic and cadmium by tea plants

    Institute of Scientific and Technical Information of China (English)

    Yuan-zhi SHI; Jian-yun RUAN; Lifeng MA; Wen-yan HAN; Fang WANG


    It is important to research the rules about accumulation and distribution of arsenic and cadmium by tea plants, which will give us some scientific ideas about how to control the contents of arsenic and cadmium in tea. In this study, by field inves- tigation and pot trial, we found that mobility of arsenic and cadmium in tea plants was low. Most arsenic and cadmium absorbed were fixed in feeding roots and only small amount was transported to the above-ground parts. Distribution of arsenic and cadmium, based on their concentrations of unit dry matter, in tea plants grown on un-contaminated soil was in the order: feeding roots>stems≈main roots>old leaves>young leaves. When tea plants were grown on polluted soils simulated by adding salts of these two metals, feeding roots possibly acted as a buffer and defense, and arsenic and cadmium were transported less to the above- ground parts. The concentration of cadmium in soil significantly and negatively correlated with chlorophyll content, photosyn- thetic rate, transpiration rate and biomass production of tea plants.

  15. Cadmium Uptake in Synechococcus aquatilis (Reynaud Strain SY01

    Directory of Open Access Journals (Sweden)

    Ruperto Vallarta Jr.


    Full Text Available Cadmium uptake in Synechococcus aquatilis (Reynaud Strain SY01 showed a biphasic behavior, with an initial rapid passive cell wall interaction phase and a later slow intracellular cation uptake process. The cell wall uptake process followed Michaelis-Menten kinetics. The apparent Km of the uptake system was 38.89 µM, a relatively high affinity Km value compared to other metal uptake systems. Fitting of experimental data to the Langmuir and Freundlich adsorption isotherms showed that binding of cadmium to the cell surface was monolayer and/or multilayer, although the monolayer adsorption was more probable, as exemplified by a high correlation coefficient. This could be explained by the presence of a strong primary binding site which was responsible for a monolayer adsorption and a weak secondary binding site which could be responsible for a multilayer adsorption. The uptake process was found to be relatively specific for cadmium. Equimolar amounts (200 µM of cobalt, nickel, magnesium, and copper did not significantly affect cadmium uptake. Synechococcus aquatilis Strain SY01 cells also showed an efflux mechanism for cadmium, although the amount of excluded cadmium was insignificant compared with the amount of adsorbed cadmium in the cell wall.

  16. Bacterial bioremediation of aquatic cadmium 11 of area of Pakistan

    International Nuclear Information System (INIS)

    Cadmium Cd/sup +2/ pollution arises mainly from contamination of minerals used in agriculture and from industrial process. The usual situation is of large volume of soil and H/sub 2/O that are contaminated with low but significant concentration of Cd/sup +2/. Cadmium is one of the most dangerous heavy metal both to human health and aquatic ecosystem. Microorganisms have developed different strategies to regulate uptake and to detoxify heavy metals viz; by different mechanisms i.e. by adsorption to cell surface, by intercellular accumulation, precipitation, biosynthesis of metallothioneins to volatile compounds. Microcosm experiments in chemostat incubated at 20 deg. C showed that Cadmium Contamination does not greatly affect bacterial communities in cultures contaminated with up to 1mg CdI/sup -1/. acterial productivity remains unchanged and Cadmium- resistant strains arise quickly and in great number. The cadmium accumulation by bacteria depend on the bacterial productivity. The free bacteria can accumulate up to 1200 ppm Cadmium Where as the adhering bacteria concentrate up to 6100 ppm. At a steady state, 11-29% Cadmium is removed from the water phase of cultures. This paper includes Cd (II) removal by Bacteria from waste water of Wah Cantonment Pakistan. (author)

  17. Gadolinium chloride pretreatment ameliorates acute cadmium-induced hepatotoxicity. (United States)

    Kyriakou, Loukas G; Tzirogiannis, Konstantinos N; Demonakou, Maria D; Kourentzi, Kalliopi T; Mykoniatis, Michael G; Panoutsopoulos, Georgios I


    Cadmium is a known industrial and environmental pollutant. It causes hepatotoxicity upon acute administration. Features of cadmium-induced acute hepatoxicity encompass necrosis, apoptosis, peliosis and inflammatory infiltration. Gadolinium chloride (GdCl3) may prevent cadmium-induced hepatotoxicity by suppressing Kupffer cells. The effect of GdCl3 pretreatment on a model of acute cadmium-induced liver injury was investigated. Male Wistar rats 4-5 months old were injected intraperitoneally with normal saline followed by cadmium chloride (CdCl2; 6.5 mg/kg) or GdCl3 (10 mg/kg) followed by CdCl2 (6.5 mg/kg; groups I and II, respectively). Rats of both the groups were killed at 9, 12, 16, 24, 48 and 60 h after cadmium intoxication. Liver sections were analyzed for necrosis, apoptosis, peliosis and mitoses. Liver regeneration was also evaluated by tritiated thymidine incorporation into hepatic DNA. Serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were also determined. Hepatic necrosis, hepatocyte and nonparenchymal cell apoptosis and macroscopic and microscopic types of peliosis hepatis were minimized by gadolinium pretreatment. Serum levels of AST and ALT were also greatly diminished in rats of group II. Tritiated thymidine incorporation into hepatic DNA was increased in gadolinium pretreatment rats. Kupffer cell activation was minimal in both the groups of rats. Gadolinium pretreatment attenuates acute cadmium-induced liver injury in young Wistar rats, with mechanisms other than Kupffer cell elimination.

  18. Screening of Amaranth Cultivars (Amaranthus mangostanus L.) for Cadmium Hyperaccumulation

    Institute of Scientific and Technical Information of China (English)

    FAN Hong-li; ZHOU Wei


    The potential harm of soil cadmium pollution to ecological environment and human health has been increasingly widely concerned. Phytoremediation, as a kind of new and effective technology, has become an important method for cleaning up cadmium in contaminated sites. The amaranth (Amaranthus mangostanus L.) is widely distributed and has abundant varieties in China, its rapid growth and large biomass can be served as candidate for cadmium hyperaccumulators for phytoremediation. To obtain cadmium hyper-accumulator, Cd uptake in 23 amaranth euitivars from different ecological region was investigated under hydroponic culture condition. Meanwhile, pot experiment was established to probe phytoremediation potentiality of Cd contaminated soil by amaranth. Three treatment (Cd 5, 10, and 25 mg kg-1) were imposed to red soil, yellow brown soil, and vegetable soil. The results showed that under hydroponic culture with Cd 3 mg L-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 260 mg kg-1, and its total cadmium uptake was the highest among various cultivars. In the treatment Cd 25 mg kg-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 212 mg kg-1, while bioaccumulation factor and shoot purification rate reached 8.50 and 3.8%, respectively. Further, the total biomass and shoot biomass were not decreased significantly under Cd exposure.These results suggested that eultivar Tianxingmi is a typical Cd hyperaccumulator, and can be expected to be used in phytoremediation of Cd contaminated soil.

  19. Blood cadmium concentration and lipid profile in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kisok, E-mail: [Department of Public Health, Keimyung University, 1000 Shindang-dong, Daegu 704-701 (Korea, Republic of)


    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03-1.79 for fourth quintile and OR=1.41; 95% CI, 1.07-1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  20. Cadmium minimization in wheat: A critical review. (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik


    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment.

  1. Selenium protection from cadmium and chromium poisoning

    International Nuclear Information System (INIS)

    The interaction of selenium with cadmium and chromium was studied in 168 chicken-broilers (DWCxWR) divided into four equal groups. Eight-week old control animals received an intravenous dose of /sup 115m/Cd Chloride 370 KBq/Kg (Group I), or 51Cr Chloride 370 KBq/Kg (Group II). The kinetics of these isotopes were studied by scintillation spectrometry (NaI/TI) carried out for whole blood, plasma, plasma proteins, urine, feces and homogenates of all organs at various time intervals. Animals in Groups III and IV received eight subcutaneous doses of sodium selenate (5ug) at 8-week intervals prior to /sup 115m/Cd or 51Cr. The kinetics of these elements were studied as in the previous two groups. It was found that selenium affected those kinetics in two ways: (a) by increasing the excretion of Cd by 11 +/- 3% (P < 0.001) and that of Cr by 7 +/- 1% (P < 0.001); and (b) by favoring redistribution of those elements, with significant (P < 0.001) reductions in liver, endocrine glands and kidney and increases (P < 0.01) in bone. The study suggests that selenium protects the animals' vital organs from environmental pollutants, such as cadmium and chromium

  2. Cadmium minimization in wheat: A critical review. (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik


    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment. PMID:27062345

  3. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara


    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  4. Luminosity segregation in three clusters of galaxies (A119, A2443, A2218) (United States)

    Pracy, Michael B.; Driver, Simon P.; De Propris, Roberto; Couch, Warrick J.; Nulsen, Paul E. J.


    We use deep wide-field V-band imaging obtained with the Wide Field Camera at the prime focus of the Issac Newton Telescope to study the spatial and luminosity distribution of galaxies in three low redshift (0.04 < z < 0.2) clusters: Abell 119, Abell 2443 and Abell 2218. The absolute magnitude limits probed in these clusters are MV- 5 logh0.7=-13.3, -15.4 and -16.7mag, respectively. The galaxy population, at all luminosities, along the line-of-sight to the clusters can be described by the linear combination of a King profile and a constant surface density of field galaxies. We find that, for these three clusters, the core radius is invariant with intrinsic luminosity of the cluster population to the above limits and thus there is no evidence for luminosity segregation in these clusters. The exception is the brightest galaxies in A2218 which exhibit a more compact spatial distribution. We find that the total projected luminosity distribution (within 1h-10.7Mpc of the cluster centre) can be well represented by a single Schechter function with moderately flat faint-end slopes: α=-1.22+0.07-0.06 (A119), α=-1.11+0.10-0.09 (A2443) and α=-1.14+0.08-0.07 (A2218). We perform a geometric deprojection of the cluster galaxy population and confirm that no `statistically significant' evidence of a change in the shape of the luminosity distribution with cluster-centric radius exists. Again, the exception being A2218 which exhibits a core region with a flatter faint-end slope.

  5. Exposure dose response relationships of the freshwater bivalve Hyridella australis to cadmium spiked sediments

    Energy Technology Data Exchange (ETDEWEB)

    Marasinghe Wadige, Chamani P.M., E-mail:; Maher, William A.; Taylor, Anne M.; Krikowa, Frank


    Highlights: • The exposure–dose–response approach was used to assess cadmium exposure and toxicity. • Accumulated cadmium in H. australis reflected the sediment cadmium exposure. • Spill over of cadmium into the biologically active pool was observed. • Increased cadmium resulted in measurable biological effects. • H. australis has the potential to be a cadmium biomonitor in freshwater environments. - Abstract: To understand how benthic biota may respond to the additive or antagonistic effects of metal mixtures in the environment it is first necessary to examine their responses to the individual metals. In this context, laboratory controlled single metal-spiked sediment toxicity tests are useful to assess this. The exposure–dose–response relationships of Hyridella australis to cadmium-spiked sediments were, therefore, investigated in laboratory microcosms. H. australis was exposed to individual cadmium spiked sediments (<0.05 (control), 4 ± 0.3 (low) and 15 ± 1 (high) μg/g dry mass) for 28 days. Dose was measured as cadmium accumulation in whole soft body and individual tissues at weekly intervals over the exposure period. Dose was further examined as sub-cellular localisation of cadmium in hepatopancreas tissues. The biological responses in terms of enzymatic and cellular biomarkers were measured in hepatopancreas tissues at day 28. H. australis accumulated cadmium from spiked sediments with an 8-fold (low exposure organisms) and 16-fold (high exposure organisms) increase at day 28 compared to control organisms. The accumulated tissue cadmium concentrations reflected the sediment cadmium exposure at day 28. Cadmium accumulation in high exposure organisms was inversely related to the tissue calcium concentrations. Gills of H. australis showed significantly higher cadmium accumulation than the other tissues. Accumulated cadmium in biologically active and biologically detoxified metal pools was not significantly different in cadmium exposed

  6. Cadmium biosorption by baker’s yeast in aqueous suspension


    Tálos Katalin; Pernyeszi Tímea; Majdik Cornelia; Hegedűsova Alzbeta; Páger Csilla


    The biosorption of cadmium from artificial aqueous solutions using native baker’s yeast was investigated. The highest metal uptake value was 110 mg g-1 in a suspension of 0.3 g L-1. The effect of pH, initial cadmium concentration, adsorption time and biosorbent dosage on biosorption by baker’s yeast was studied. The maximum biosorption capacity of cadmium by yeast was observed at pH 6.0. The adsorption equilibrium was reached within sixty minutes and the sorption process followed pseudo...

  7. Chromosomal Locus for Cadmium Resistance in Pseudomonas putida Consisting of a Cadmium-Transporting ATPase and a MerR Family Response Regulator


    Lee, Seon-Woo; Glickmann, Eric; Cooksey, Donald A.


    Pseudomonads from environmental sources vary widely in their sensitivity to cadmium, but the basis for this resistance is largely uncharactarized. A chromosomal fragment encoding cadmium resistance was cloned from Pseudomonas putida 06909, a rhizosphere bacterium, and sequence analysis revealed two divergently transcribed genes, cadA and cadR. CadA was similar to cadmium-transporting ATPases known mostly from gram-positive bacteria, and to ZntA, a lead-, zinc-, and cadmium-transporting ATPase...

  8. Inclusion free cadmium zinc tellurium and cadmium tellurium crystals and associated growth method (United States)

    Bolotnikov, Aleskey E.; James, Ralph B.


    The present disclosure provides systems and methods for crystal growth of cadmium zinc tellurium (CZT) and cadmium tellurium (CdTe) crystals with an inverted growth reactor chamber. The inverted growth reactor chamber enables growth of single, large, high purity CZT and CdTe crystals that can be used, for example, in X-ray and gamma detection, substrates for infrared detectors, or the like. The inverted growth reactor chamber enables reductions in the presence of Te inclusions, which are recognized as an important limiting factor in using CZT or CdTe as radiation detectors. The inverted growth reactor chamber can be utilized with existing crystal growth techniques such as the Bridgman crystal growth mechanism and the like. In an exemplary embodiment, the inverted growth reactor chamber is a U-shaped ampoule.

  9. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum


    Rongfei Wei; Qingjun Guo; Hanjie Wen; Congqiang Liu; Junxing Yang; Marc Peters; Jian Hu; Guangxu Zhu; Hanzhi Zhang; Liyan Tian; Xiaokun Han; Jie Ma; Chuanwei Zhu; Yingxin Wan


    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively cou...

  10. Electrochemical removal of cadmium from bio-ash; Elektrokemisk fjernelse af cadmium fra bioasker

    Energy Technology Data Exchange (ETDEWEB)

    Juul Pedersen, Anne; Ottosen, Lisbeth M.; Simonsen, Peter; Christensen, Terkel C.


    The potential of using the method electrodialytic remediation for removal of cadmium from bioashes has been investigated. Five different types of fly ash from biomass combustion were included in the study: 1) A straw combustion fly ash from grate-firing at Avedoere power plant. 2) A fly ash from co-firing of wood and fuel oil at Avedoere power plant. 3) A suspended, grain size fractionated straw fly ash, obtained from PSO project FU 2201, fine and coarse size fraction. The ash was originally produced at Avedoere power plant. 4) A straw pellet fly ash from dust-firing at Amager power plant. Thr five ashes were characterised, and a series of preliminary elekctrodialytic remediation experiments were conducted on each ash. In spite a significant differences between the five ashes with respect to parameters such as pH and content of cadmium, all ashes showed promising remediation potential. For all ashes cadmium concentrations below the regulatory limits for recycling were reached in one or more of the preliminary remediation experiements. The best results were obtained with the suspended straw ash from PSO FU 2201, whereas the results with the wood chips ash, due to a high initial pH value, were less sucessful, meaning that the remediation process was progressing more slowly. (BA)

  11. Soil biogeochemistry, plant physiology and phytoremediation of cadmium contaminated soils (United States)

    Cadmium (Cd) loading in soil and the environment has been accelerated worldwide due to enhanced industrialization and intensified agricultural production, particularly in the developing countries. Soil Cd pollution, resulting from both anthropogenic and geogenic sources, has posed an increasing chal...

  12. A Study of Growth of Cadmium Oxide Nano structure

    International Nuclear Information System (INIS)

    Cadmium oxide nano structure were synthesized by solid-vapor deposition without catalyst. Cadmium Oxide powder was heated to 1320 K in a tube furnace, and the resultant vapor was carried to the silicon substrate zone by an argon flow. Field electron scanning electron microscopy revealed that the product was dendrite-like petals of Cadmium Oxide nano structure. The grown nano structure had random orientations and a grain size of 30 nm. Photoluminescence spectroscopy was conducted to investigate the optical properties of the nano structures. The red-shift direct band gap energy of Cadmium Oxide nano structure was at 548 nm (2.26 eV), whereas that of CdO bulk was at 491 nm (2.5 eV). (author)

  13. Polycrystalline Thin-Film Research: Cadmium Telluride (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)


    Capabilities fact sheet that includes scope, core competencies and capabilities, and contact/web information for Polycrystalline Thin-Film Research: Cadmium Telluride at the National Center for Photovoltaics.

  14. Electrodialytic removal of cadmium from straw combustion fly ash

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Ottosen, Lisbeth M.; Villumsen, Arne


    Fly ash from straw combustion contains valuable nutrients when returned to agricultural soils. In many instances, however, this fly ash may contain heavy metals, such as cadmium, at levels which often exceed the limits given by the Danish legislation. Thus before utilizing the nutrients, cadmium...... must be removed from these ashes. The use of an electrodialytic remediation method to remove cadmium from fly ash arising from straw combustion and containing 11.2 mg Cd kg$+-1$/ DM (dry matter) was accessed. After 36 days of remediation at a constant current density of 5.6 mA cm$+-2$/ more than 97......% of the cadmium had been removed from around 150 g ash on a dry basis. $CPY 2004 Society of Chemical Industry....

  15. Literature review on pickling inhibitors and cadmium electroplating processes (United States)

    Elsea, A. R.; Fletcher, E. E.; Groeneveld, T. P.


    Because introduction of hydrogen during bright-cadmium electroplating of high strength steels causes hydrogen-stress cracking, a program was undertaken to evaluate various processes and materials. Report describes effectiveness of inhibitors for reducing hydrogen absorption by steels.


    Cadmium (Cd) is a ubquitous element and a significant inorganic pollutant that has previously been found to bioaccumulate in reproductive organs of fish and disrupt important endocrine processes, especially those involved in synthesis, release and metabolism of hormones. Clearly,...

  17. A Facile Glycosylation of Spirostanol Catalyzed by Cadmium Carbonate

    Institute of Scientific and Technical Information of China (English)


    A facile glycosylation for the synthesis of spirostanol glycosides was reported. Using cadmium carbonate as a catalyst in CH3CN, a series of saponins was synthesized efficiently in a satisfactory yield.

  18. Ion exchange of Cobalt and Cadmium in Zeolite X

    International Nuclear Information System (INIS)

    The growing development in the industry has an important contribution to the environmental damage, where the natural effluents are each day more contaminated by toxic elements, such as: mercury, chromium, lead and cadmium. So as to separate such elements it has sorbent must have enough stability, and have a sharp capacity of sorption. In this work it was studied the sorption behavior of cobalt and on the other hand, cadmium in aqueous solutions, which along with sodic form of the Zeolite X, undergoes a phenomenon of ionic interchange. Such interchange was verify to different concentration of cadmium, cobalt and hydronium ion. The content of cobalt and sodium in the interchanged samples was detected through the neutronic activation analysis. The results disclose a higher selectivity for cadmium than cobalt. (Author)

  19. A lincRNA-DYNLRB2-2/GPR119/GLP-1R/ABCA1-dependent signal transduction pathway is essential for the regulation of cholesterol homeostasis


    Hu, Yan-Wei; Yang, Jun-Yao; Ma, Xin; Chen, Zhi-Ping; Hu, Ya-Rong; Zhao, Jia-Yi; Li, Shu-Fen; Qiu, Yu-Rong; Lu, Jing-Bo; Wang, Yan-Chao; Gao, Ji-Juan; Sha, Yan-Hua; Zheng, Lei; Wang, Qian


    Accumulated evidence shows that G protein-coupled receptor 119 (GPR119) plays a key role in glucose and lipid metabolism. Here, we explored the effect of GPR119 on cholesterol metabolism and inflammation in THP-1 macrophages and atherosclerotic plaque progression in apoE−/− mice. We found that oxidized LDL (Ox-LDL) significantly induced long intervening noncoding RNA (lincRNA)-DYNLRB2-2 expression, resulting in the upregulation of GPR119 and ABCA1 expression through the glucagon-like peptide ...

  20. Prediction of cadmium concentration in selected home-produced vegetables. (United States)

    Bešter, Petra Karo; Lobnik, Franc; Eržen, Ivan; Kastelec, Damijana; Zupan, Marko


    Soil contaminated with cadmium presents a potential hazard for humans, animals and plants. The latter play a major role in the transfer of cadmium to the food chain. The uptake of cadmium and its accumulation by plants is dependent on various soil, plants and environmental factors. In order to identify soil properties with statistically significant influence on cadmium concentration in vegetables and to reduce the collection of data, time and costs, regression models can be applied. The main objective of this research was to develop regression models to predict the concentration of cadmium in 9-vegetable species: zucchini, tomato, cabbage, onion, potato, carrot, red beet, endive and chicory, based on soil properties. Soil samples were collected from 123 home gardens of the Municipality of Celje and 59 of these gardens were also included in vegetable sampling. The concentration of elements (e.g. arsenic, cadmium, copper, lead, and zinc) in the samples was determined by Inductively Coupled Plasma Mass Spectrometry. Single (for cabbage, potato, red beet and chicory) and multiple (for tomato, onion, carrot and endive) linear regression models were developed. There was no statistically significant regression model for zucchini. The most significant parameter for the influencing the cadmium concentration in vegetables was the concentration of cadmium in soil. Other important soil properties were the content of organic matter, pH-value and the concentration of manganese. It was concluded that consuming carrots, red beets, endives, onions, potatoes and chicory which are grown in gardens with Cd concentrations (mgkg(-1) DW) above 2.4, 3.2, 6.3, 7.9, 8.3 and 10.9, respectively, might represent an important contribution to dietary Cd exposure. PMID:23886800

  1. Surfactant Mediated Cadmium Determination with Dithizone in Aqueous Solution


    Ismael, Fouad Jawad


    ABSTRACT: Cadmium is a toxic and hazardous trace metal that has become a serious environmental pollutant since industrialization and intensive farming began in late 19th century. Although there are many established wet-chemical and instrumental methods for qualitative and quantitative determination of cadmium, most involve the formation of the Cd-dithizone complex in the presence of the highly toxic potassium cyanide which is then extracted into carcinogenic chlorinated organic solvents such ...

  2. Ecotoxicity and genotoxicity of cadmium in different marine trophic levels. (United States)

    Pavlaki, Maria D; Araújo, Mário J; Cardoso, Diogo N; Silva, Ana Rita R; Cruz, Andreia; Mendo, Sónia; Soares, Amadeu M V M; Calado, Ricardo; Loureiro, Susana


    Cadmium ecotoxicity and genotoxicity was assessed in three representative species of different trophic levels of marine ecosystems - the calanoid copepod Acartia tonsa, the decapod shrimp, Palaemon varians and the pleuronectiform fish Solea senegalensis. Ecotoxicity endpoints assessed in this study were adult survival, hatching success and larval development ratio (LDR) for A. tonsa, survival of the first larval stage (zoea I) and post-larvae of P. varians, egg and larvae survival, as well as the presence of malformations in the larval stage of S. senegalensis. In vivo genotoxicity was assessed on adult A. tonsa, the larval and postlarval stage of P. varians and newly hatched larvae of S. senegalensis using the comet assay. Results showed that the highest sensitivity to cadmium is displayed by A. tonsa, with the most sensitive endpoint being the LDR of nauplii to copepodites. Sole eggs displayed the highest tolerance to cadmium compared to the other endpoints evaluated for all tested species. Recorded cadmium toxicity was (by increasing order): S. senegalensis eggs < P. varians post-larvae < P. varians zoea I < S. senegalensis larvae < A. tonsa eggs < A. tonsa LDR. DNA damage to all species exposed to cadmium increased with increasing concentrations. Overall, understanding cadmium chemical speciation is paramount to reliably evaluate the effects of this metal in marine ecosystems. Cadmium is genotoxic to all three species tested and therefore may differentially impact individuals and populations of marine taxa. As A. tonsa was the most sensitive species and occupies a lower trophic level, it is likely that cadmium contamination may trigger bottom-up cascading effects in marine trophic interactions. PMID:27203468

  3. Avalanche multiplication of electrons and holes in cadmium telluride

    CERN Document Server

    Demich, N V


    Determination of the ratio of the coefficients of the electrons and holes of the diode structures impact ionization is carried out with the purpose of optimizing the parameters of the avalanche diodes from the cadmium telluride. It is shown experimentally, that the process of the impact ionization in the cadmium telluride is stimulated by holes. The ratio of the coefficients of the holes and electrons impact ionization constitutes approx = 30-40

  4. Association between blood cadmium levels and malnutrition in peritoneal dialysis


    Hsu, Ching-Wei; Lin, Ja-Liang; Lin-Tan, Dan-Tzu; Huang, Wen-Hung; Chen, Kuan-Hsing; Yen, Tzung-Hai


    Background Malnutrition is associated with an increased risk of cardiovascular death and may cause protein-energy wasting in individuals with chronic kidney disease. A previous study demonstrated that blood cadmium levels (BCLs) were associated with malnutrition in maintenance hemodialysis (MHD) patients. However, the correlation between cadmium exposure and malnutrition remains unclear in chronic peritoneal dialysis (CPD) patients. This study examined the possible adverse effects of environm...

  5. Study on Systemic Separation of Palladium, Silver, Cadmium and Tin

    Institute of Scientific and Technical Information of China (English)

    YU; Zhen-hua; HUANG; Kun


    To accurately measure the yields of palladium,silver,cadmium and tin that generated from the fission of plutonium,radiochemical method is needed because there is much interference in using directγ-spectroscopy measurements.Usually,we want to get as much as possible the experiment data from one target,so it is required systemic separation of palladium,silver,cadmium and tin.Considering the

  6. Harmful effects of cadmium on olfactory system in mice. (United States)

    Bondier, Jean-Robert; Michel, Germaine; Propper, Alain; Badot, Pierre-Marie


    The inhalation of certain metals can result in olfactory epithelial injury, an altered sense of smell, and direct delivery of the metal from the olfactory epithelium to the olfactory bulbs and other parts of the central nervous system. The purpose of this study was to examine whether mice given an intranasal instillation of cadmium would develop altered olfactory function and to assess whether cadmium may be transported directly from the olfactory epithelium to the central nervous system. To evaluate cadmium's ability to induce anosmia and on the basis of olfactory epithelium sensitivity to metals, the aim of this study was first to study cadmium effects on the olfactory function and secondly to check whether cadmium may be transported from the nasal area to the central nervous system. After an intranasal instillation of a solution containing CdCl2 at 136 mM, we observed in treated mice: (1) a partial destruction of the olfactory epithelium, which is reduced to three or four basal cell layers followed by a progressive regeneration; (2) a loss of odor discrimination with a subsequent recovery; and (3) a cadmium uptake by olfactory bulbs demonstrated using atomic absorption spectrophotometry, but not by other parts of the central nervous system. Cadmium was delivered to the olfactory bulbs, most likely along the olfactory nerve, thereby bypassing the intact blood-brain barrier. We consider that cadmium can penetrate olfactory epithelium and hence be transported to olfactory bulbs. The olfactory route could therefore be a likely way to reach the brain and should be taken into account for occupational risk assessments for this metal.

  7. Cadmium removal in a biosorption column

    Energy Technology Data Exchange (ETDEWEB)

    Volesky, B.; Prasetyo, I. (McGill Univ., Montreal, Quebec (Canada). Dept. of Chemical Engineering)


    New biosorbent material derived from a ubiquitous brown marine alga Ascophyllum nodosum has been examined in packed-bed flow-through sorption columns. It effectively removed 10 mg/L of cadmium down to 1.5 ppb levels in the effluent, representing 99.985% removal. The experimental methodology used was based on the early Bohart and Adams sorption model, resulting in quantitative determination of the characteristic process parameters which can be used for performance comparison and process design. An average metal loading of the biosorbent (N[sub 0]) determined was 30 mg Cd/g, corresponding closely to that observed for the batch equilibrium metal concentration of 10 mg Cd/L. The critical bed depth (D[sub min]) for the potable water effluent quality standard varied with the column feed flow rate from 20 to 50 cm. The sorption column mass transfer and dispersion coefficients were determined, which are also required for solving the sorption model equations.

  8. Cadmium substituted high permeability lithium ferrite

    Indian Academy of Sciences (India)

    S S Bellad; S C Watawe; A M Shaikh; B K Chougule


    Polycrystalline Li0.5–/2 Cd Fe2.5–/2O4 ferrites where = 0, 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6 were prepared by a double sintering ceramic technique and characterized by X-ray diffraction and scanning electron microscopy (SEM). The lattice parameter is found to increase monotonically with the cadmium content. It is explained in terms of the sizes of component ions. The grain size of the samples increases up to = 0.3 and then it decreases for higher values of . A similar trend is observed in the variation of Ms with Cd2+ content. The initial permeability () is however found to increase continuously with . The increase in is attributed to decrease of anisotropy constant K1 and higher grain size of the samples.

  9. Synthesis and Electroluminescence Characterization of Cadmium Complex

    Directory of Open Access Journals (Sweden)



    Full Text Available We have synthesized and characterized a new electroluminescence material,Cadmium [(2-(2-hydroxyphenylbenzoxazole(8-hydoxyquinoline] Cd(HPBq. The absorption spectra of this material show maxima at 378 nm. It may be attributed due to π° – π* transition. The photoluminescence showed peak at 520 nm. TGA data of the material shows stability up to 370 °C .Organic light emitting diode have been fabricated with this material and the fundamental structures of the device is ITO/α-NPD/ Cd(HPBq/BCP/Alq3/LiF/Al exhibited a luminescence peak at 550 nm. The maximum luminescence of the device was 295 cd/m2 with current density of 6687 A/m2 at 20 V. The maximum current efficiency of OLED was 1.01 cd/A at 17 V and power efficiency was 1.01 lm/w at 17 V.

  10. Soil Cadmium Regulates Antioxidases in Sorghum

    Institute of Scientific and Technical Information of China (English)

    LIU Da-lin; ZHANG Shu-pan; CHEN Zheng; QIU Wei-wei


    The regulatory mechanism of soil cadmium(Cd)on antioxidases in sorghum was studied using 3 sorghum species viz.,sweet sorghum[Sorghum bicolor(L.)],sorghum hybrid sudangrass(Sorghum bicolor × S.sudanense,cv.Everlush)and sudangrass[Sorghum sudanense(Piper)Stapf cv.Xinjiang].The results showed that low concentrations of Cd2+(≤10 mg kg-1)induced the activities of 4 antioxidases in leaves of the 3 species of sorghum,but high Cd2+concentrations(≥50 mg kg-1)significantly reduced the activities of all the four antioxidases.The glutathione(GSH)contents in leaves of the 3 species of sorghum correlated positively with the Cd2+concentrations.The maximum antioxidase activities were observed at the elongation stage of sorghum during the whole growth period.

  11. Flotation of cadmium-loaded biomass. (United States)

    Matis, K A; Zouboulis, A I


    Biosorption of heavy metal ions such as Cd(2+) by dead biomass has been recognized as a potential alternative to existing removal technologies applied to wastewater treatment. Two bacterial strains were studied in the laboratory, streptomyces griseus and S. clavuligerus, an industrial by-product. Both washed and unwashed samples were examined. Foam flotation proposed in this work as the separation state following biosorption. Effective biomass separation was conducted in the presence of a frother, ethanol. The pH of the solution was a crucial parameter for flotation and also for metal binding. Other basic parameters of flotation examined were the initial cadmium concentration in the dilute aqueous solution and the quantity of biomass used. A study of zeta-potential measurements of the actinomycetes was carried out under the conditions used in the separation; surface tension was also measured. These provided useful information on the process. PMID:18618752

  12. Cadmium in goods - contribution to environmental exposure

    Energy Technology Data Exchange (ETDEWEB)

    Bergbaeck, B.; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science


    The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs

  13. Tantalum-cadmium film coatings: Preparation, phase composition, and structure (United States)

    Tuleushev, Yu. Zh.; Volodin, V. N.; Zhakanbaev, E. A.


    Ion-plasma sputtering and codeposition of ultrafine Ta and Cd particles were used for the first time to prepare solid solutions, namely, alloys with up to 66.2 at % Cd in the form of coatings; the fact of such a production confirms the thermal-fluctuation melting and coalescence of small particles. When the coatings are formed by tantalum and cadmium nanolayers, the mutual dissolution of the components takes place, which is accompanied by the formation of solid solutions of one metal in the other. When the cadmium concentration is above 44 at %, the β-Ta tetragonal lattice transforms into the α-Ta body-centered cubic lattice. Beginning from 74.4 at % Cd, a hexagonal structure typical of cadmium is formed, and tantalum is present in the coatings in the form of amorphous phase. The formation of β-Ta- and Cd-based interstitial and α-Ta-based substitute solid solutions is stated. At 700°C, cadmium evaporates from Ta-based solid solutions, and porous tantalum is formed. The evaporation of cadmium from coatings, which consist of the mixture of tantalum solid solution in cadmium and amorphous tantalum, leads to the formation of tantalum characterized by a highly developed surface. The prepared Ta-based materials assume the technological application of the results of the investigation.

  14. Trichosporon jirovecii-mediated synthesis of cadmium sulfide nanoparticles. (United States)

    El-Baz, Ashraf Farag; Sorour, Noha Mohamed; Shetaia, Youssria Mohamed


    Cadmium sulphide is one of the most promising materials for solar cells and of great interest due to its useful applications in photonics and electronics, thus the development of bio-mediated synthesis of cadmium sulphide nanoparticles (CdS NPs) is one of the essential areas in nanoparticles. The present study demonstrates for the first time the eco-friendly biosynthesis of CdS NPs using the yeast Trichosporon jirovecii. The biosynthesis of CdS NPs were confirmed by UV-Vis spectrum and characterized by X-ray diffraction assay and electron microscopy. Scanning and transmission electron microscope analyses shows the formation of spherical CdS NPs with a size range of about 6-15 nm with a mean Cd:S molar ratio of 1.0:0.98. T. jirovecii produced hydrogen sulfide on cysteine containing medium confirmed by positive cysteine-desulfhydrase activity and the colony color turned yellow on 0.1 mM cadmium containing medium. T. jirovecii tolerance to cadmium was increased by the UV treatment and three 0.6 mM cadmium tolerant mutants were generated upon the UV radiation treatment. The overall results indicated that T. jirovecii could tolerate cadmium toxicity by its conversion into CdS NPs on cysteine containing medium using cysteine-desulfhydrase as a defense response mechanism. PMID:26467054

  15. 23 CFR 636.119 - How does this part apply to a project developed under a public-private partnership? (United States)


    ... the developer must follow the appropriate Federal-aid procurement requirements (23 CFR part 172 for engineering service contracts, 23 CFR part 635 for construction contracts and the requirements of this part... OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS DESIGN-BUILD CONTRACTING General § 636.119...

  16. Ustekinumab treatment for psoriasis in 119 patients maintained on therapy for a minimum of one year: a review. (United States)

    Wilder, Elizabeth G; Patel, Mahir; Hebeler, Katherine; Menter, Alan


    Ustekinumab is a human IgG1κ monoclonal antibody that binds with high affinity and specificity to the p40 protein subunit shared by both the interleukin-12 and interleukin-23 cytokines. This study reviews clinical response and adverse events in 119 psoriasis patients who have received ustekinumab for a minimum of 1 year. The medical records of 119 psoriasis patients treated with ustekinumab at our referral clinic in Dallas between 2009 and 2013 were reviewed for response rates, side effects, and concomitant therapies. Of 119 patients, 117 (98%) had plaque type psoriasis, with 40 (34%) patients having psoriasis affecting either their palms and/or soles. Forty-four (37%) patients had psoriatic arthritis. The median follow-up period was 31 months. Fifty-six (47%) of the 119 patients obtained near complete clearance (response of more than 90% of initial body surface area involvement) upon the final follow-up visit or at the time of ustekinumab treatment discontinuation. Concomitant systemic treatments, primarily methotrexate, were given to 59 (50%) patients. Twenty-three (19%) patients discontinued treatment, primarily for sub-optimal response or loss of response. Fifty (42%) patients required either an increase in the dose of ustekinumab to 90 mg and/or administration more frequently than every 12 weeks to achieve and maintain psoriasis clearance.

  17. Mutation-Guided Unbiased Modeling of the Fat Sensor GPR119 for High-Yield Agonist Screening

    DEFF Research Database (Denmark)

    Norn, Christoffer; Pedersen, Maria Hauge; Engelstoft, Maja S.;


    multiple X-ray receptor structures in combination with a fully flexible ligand docking protocol to det. the binding conformation of AR231453, a small-mol. agonist, in the GPR119 receptor. Resulting models converge to one conformation that explains the majority of data from mutation studies...

  18. 14 CFR 119.69 - Management personnel required for operations conducted under part 135 of this chapter. (United States)


    ... or Part 135 of This Chapter § 119.69 Management personnel required for operations conducted under... of management personnel due to— (1) The kind of operation involved; (2) The number and type of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Management personnel required...

  19. 14 CFR 119.65 - Management personnel required for operations conducted under part 121 of this chapter. (United States)


    ... or Part 135 of This Chapter § 119.65 Management personnel required for operations conducted under... of management personnel due to— (1) The kind of operation involved; (2) The number and type of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Management personnel required...

  20. 29 CFR 102.119 - Privacy Act Regulations: notification as to whether a system of records contains records... (United States)


    ...) and (d), and from 29 CFR 102.119(a), (b), (c), (d), (e), and (f), insofar as the system contains... Regional Office Files (NLRB-25), Regional Advice and Injunction Litigation System (RAILS) and Associated Headquarters Files (NLRB-28), and Appeals Case Tracking System (ACTS) and Associated Headquarters Files...

  1. Structural basis for constitutive activity and agonist-induced activation of the enteroendocrine fat sensor GPR119

    DEFF Research Database (Denmark)

    Engelstoft, Maja Storm; Norn, C; Pedersen, Maria Hauge;


    activation (AR231453 and OEA). Novel Rosetta-based receptor modelling was applied, using a composite template approach with segments from different X-ray structures and fully flexible ligand docking. KEY RESULTS: The increased signalling induced by increasing the cell surface expression of GPR119...

  2. 重金属铅和镉对溪荪生理特性的影响%Effects of Lead and Cadmium on Physiological Property of Iris sanguinea

    Institute of Scientific and Technical Information of China (English)

    张丽丽; 赵九洲; 赵婷婷; 余诗文; 宋霞; 陈娟娟; 杨晓婷; 韩玉林


    A hydroponics experiment was conducted to examine the effects of lead,cadmium and their combination pollution on the physiological property of Iris sanguinea.The results obtained after lead and cadmium treatments for 8 days showed that the contents of chlorophyll a,chlorophyll b and carotenoid in the leaves of /.Sanguinea were increased and the contents of chlorophyll a were significantly increased (p<0.05) under 500 mg/L lead,and 500 mg/L lead+25 mg/L cadmium pollution.The contents of chlorophyll a,chlorophyll b and carotenoid were decreased under 25 mg/L cadmium pollution and the content of chlorophyll a was significantly dropped (p<0.05).The relative electric conductivity of the cell membrane in the leaves of/,sanguinea un-der the pollution of 25 mg/L cadmium was significantly increased by 27% compared with that of control.Malonaldehyde (MDA) content in the leaves under the stress of 25 mg/L cadmium was significantly increased to 1.19 times of the control.MDA contents in the leaves and rhizomes and roots was not increased insignificantly under 500 mg/L lead stress,indicating that /.Sanguinea has a better resistance to lead than cadmium in the experimental concentrations.MDA content in the leaves and rhizomes and roots under the pollution of 500 mg/L lead+25 mg/L cadmium was significantly increased,which indicated that the cell membrane was dam-aged by combination of lead and cadmium pollution.The pollution of lead and cadmium and their combination had a similar effect on superoxide dismutase and peroxidase activities of/,sanguinea.The activities of su-peroxide dismutase and peroxidase in the rhizomes and roots were enhanced compared with that of control of no pollution and those in the leaves were decreased.The activity of superoxide dismutase in the rhizomes and roots under the pollution of 25 mg/L cadmium was significantly increased.The activity of peroxidase in the rhizomes and roots under all treatments of lead and cadmium were significantly increased.%采

  3. The Role of Exopolymers in Protection of Ralstonia sp., a Cadmium-resistant Bacterium, from Cadmium Toxicity


    Anchulee Watcharamusik; Benjaphorn Prapagdee


    Production of exopolymers is one of heavy metal resistance mechanisms in bacteria. Ralstonia sp. TAK1, a cadmium-resistant bacterium, was isolated from a high cadmium (Cd) contaminated soil at the zinc mine, Tak province, Thailand. The bacterium was cultivated in LB broth and its growth was monitored. The yields of exopolymers were measured by the phenol-sulfuric method at different growth phases. The levels of Cd resistance were quantitatively determined by survival cell assay. The highest a...

  4. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    International Nuclear Information System (INIS)

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4±2.3 μg/g creatinine) was significantly greater than that for men (2.0±2.2 μg/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  5. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Limpatanachote, Pisit; Krintratun, Somyot [Department of Internal Medicine, Mae Sot General Hospital, Tak (Thailand)


    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4{+-}2.3 {mu}g/g creatinine) was significantly greater than that for men (2.0{+-}2.2 {mu}g/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  6. Effects of Soil pH,Texture,Moisture,Organic Matter and Cadmium Content on Cadmium Diffusion Coefficient

    Institute of Scientific and Technical Information of China (English)



    The supply of cadmium from soil to plant roots mainly depends on the diffusion prooess.This work was conducted to study the effects of some soil properties on cadmium diffusion coefficient (D) in soil. Measurements were made using the Shofield and Graham-Bryce's isotopic labelling method.Cadmium diffusion coefficients varied from 10-7to 10-9 cms2-1.Higher values were observed in acid sandy soils and lower values in calcareous clay soils.Liming an acid soil resulted in a substantial decrease of D.Addition of cadmium as nitrate salt generally increased D,while addition of sewage sludge and organic matter resulted in a significant decrease of cadmium diffusion.The rhizospheric activity also induced a moderate reduction in D.The relationships between D(10-9cms2-1)on the on hand and soil pH.moisture(Mc,g kg-1) ,organic matter(OM,g kg-1),clay(Cy,gkg-1)and cadmium content(Cd,mgkg-1) on the other were obtained by the multiple regression:D=182.1-29.91pH+0.210Mc-0.303OM+0.011Cy+1.64Cd(R2=0.859,n=22).

  7. Increased intracellular iron and mineralization of cultured hFOB 1.19 cells following hepcidin activation through ferroportin

    International Nuclear Information System (INIS)

    To address whether hepcidin functions in bone metabolism. This study was carried out in the Laboratory of Radiation Medicine and Public Health of Soochow University, and the Laboratory of the Second Affiliated Hospital of Soochow University, Suzhou, China, from September 2009 to July 2010. The positive expression of ferroportin-1 (Fpn-1) was detected by reverse transcriptase-polymerase chain reaction. After the treatment with distilled water (control group) and hepcidin (25noml/L, 50noml/L, 100noml/L), the fluorescence intensity related to intracellular iron concentration of a human fetal osteoblast cell line (hFOB 1.19) was measured by a confocal laser scanning microscope. A 3-(4,5- dimethylthiazol-2-yl) -2-5-diphenyltetrazolium bromide assay, and Von Kossa staining was performed to evaluate cell proliferation and mineralization in cultured hFOB 1.19 cells. This study revealed a high level expression of Fpn-1 in hFOB 1.19. On the basis of which, it was found that 25noml/L, 50noml/L, 100noml/L hepcidin could promote the fluorescence intensity related to intracellular iron concentration and mineralization in hFOB 1.19 in a dose-dependent manner (p0.05). The hepcidin-ferroportin signal pathway may function in the osteoblast cell line of hFOB 1.19 cells. It is also suggested that cross-talk between iron and calcium homeostasis may play a role in bone metabolism in responding to hepcidin activation (Author).

  8. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    International Nuclear Information System (INIS)

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata

  9. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, Helena A.; Maher, William A., E-mail:; Taylor, Anne M.; Krikowa, Frank


    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata.

  10. Cadmium: A toxin and a nutrient for marine phytoplankton. Doctoral thesis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.G.


    Although cadmium is known to be very toxic, it exhibits nutrient-like vertical concentration profiles in the open ocean. Cadmium enhances the growth of the marine diatom Thalassiosira weissflogii, a chlorophyte and some prymnesiophytes at inorganic zinc and cadmium concentrations typical of surface seawater. Detailed studies of T. weissflogii show that cadmium is also regulated like a nutrient over a wide range of external inorganic cadmium (5-500pM) and inorganic zinc (2-16pM) concentrations. The cellular cadmium concentration is maintained at relatively constant levels both through uptake and, at high inorganic cadmium concentrations (5nM), export of cadmium, most likely complexed to the metal-binding polypeptide phytochelatin. Cadmium may play an essential role in carbon uptake under conditions of zinc limitation. The same low level of inorganic cadmium that enhances the growth of T. weissflogii restores the activity of carbonic anhydrase, thought to be the key enzyme limiting growth at low zinc. Cadmium coelutes with a least one of the multiple isoforms of carbonic anhydrase produced by T. weissfiogii and covaries with activity of this isoform. The substitution of cadmium for zinc in carbonic anhydrase links the geochemical cycle of cadmium to those of zinc and carbon.

  11. Neurocysticercosis in Ceará State, northeastern Brazil: a review of 119 cases. (United States)

    Sousa, A Q; Sa, H L; Queiroz, T R; Horta, W G; Pearson, R D


    Relatively little is known about the occurrence of neurocysticercosis in northeastern Brazil. There have been no published reports from the state of Ceará, but a review of the records at the Hospital São José in Fortaleza, Brazil identified 119 patients with neurocysticercosis diagnosed between January 1988 and April 1994. Patients came from 43 municipalities in Ceará. Their ages ranged from five to 74 years; the greatest number of cases were in persons 10-40 years of age; 63% were males. Seizures were the presenting complaint in 64% of the patients and headache in 22%. Two patients, each with several hundred intracranial lesions, presented with mental status changes; one was initially given the clinical diagnosis of viral meningoencephalitis. Computed tomography scans showed that 44% of the patients had five or more lesions. Cysts were found throughout the brain. The parietal lobe was the most frequent site of involvement; 85% of patients had one or more lesions there. The brain stem was involved in 8%. There was no consistent association between the severity of the clinical abnormalities and the radiologic findings. Computed tomography of the thighs was done in 10 persons; cysts were identified in nine.

  12. Oral vaccination of mice against rodent malaria with recombinant expressing MSP-119

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hong Zhang; Pei-Hong Jiang; Ning-Jun Li; Mi Shi; Weida Huang


    AIM: To construct the recombinant Lactococcus lactis as oral delivery vaccination against malaria.METHODS: The C-terminal 19-ku fragments of MSP1(MSP-119) of Plasmodium yoelii265-BY was expressed in L. lactis and the recombinant L. lactis was administered orally to BALB/c and C57BL/6 mice. After seven interval vaccinations within 4 wk, the mice were challenged with P.yoelii 265-BY parasites of erythrocytic stage. The protective efficacy of recombinant L.lactiswas evaluated.RESULTS: The peak parasitemias in average for the experiment groups of BALB/c and C57BL/6 mice were 0.8±0.4% and 20.8±26.5%, respectively, and those of their control groups were 12.0±0.8% and 60.8±9.6%, respectively. None of the BALB/c mice in both experimental group and control group died during the experiment.However, all the C57BL/6 mice in the control group died within 23 d and all the vaccinated mice survived well.CONCLUSION: The results imply the potential of recombinant L.lactis as oral delivery vaccination against malaria.

  13. Enhanced 119Sn Moessbauer quadrupole interactions below the magnetic phase transition of UPt2Sn

    International Nuclear Information System (INIS)

    119Sn Moessbauer effect measurements (4.2 K 2Sn and UCu2Sn. For temperatures above TN we find that the quadrupole splitting (ΔEQ) in UPt2Sn is about 3 times larger than in UCu2Sn. This difference in ΔEQ is suggested to be due to a large electronic contribution from the Pt-ligands in UPt2Sn. Upon decreasing temperature below TN, we find only in UPt2Sn an anomalous increase of ΔEQ relative to the extrapolated ΔEQ values in the paramagnetic phase (4% increase at 4.2 K). In addition, we have measured the thermal expansion coefficient (α) of a polycrystalline UPt2Snsample (4.2 K N of Δα ∼ 1.1 x 10-6 K-1. It is shown that the enhancement of ΔEQ is of electronic origin and related to the onset of AF order in UPt2Sn. (orig.)

  14. Whole-exome sequencing in undiagnosed genetic diseases: interpreting 119 trios (United States)

    Zhu, Xiaolin; Petrovski, Slavé; Xie, Pingxing; Ruzzo, Elizabeth K.; Lu, Yi-Fan; McSweeney, K. Melodi; Ben-Zeev, Bruria; Nissenkorn, Andreea; Anikster, Yair; Oz-Levi, Danit; Dhindsa, Ryan S.; Hitomi, Yuki; Schoch, Kelly; Spillmann, Rebecca C.; Heimer, Gali; Marek-Yagel, Dina; Tzadok, Michal; Han, Yujun; Worley, Gordon; Goldstein, Jennifer; Jiang, Yong-Hui; Lancet, Doron; Pras, Elon; Shashi, Vandana; McHale, Duncan; Need, Anna C.; Goldstein, David B.


    Purpose: Despite the recognized clinical value of exome-based diagnostics, methods for comprehensive genomic interpretation remain immature. Diagnoses are based on known or presumed pathogenic variants in genes already associated with a similar phenotype. Here, we extend this paradigm by evaluating novel bioinformatics approaches to aid identification of new gene–disease associations. Genet Med 17 10, 774–781. Methods: We analyzed 119 trios to identify both diagnostic genotypes in known genes and candidate genotypes in novel genes. We considered qualifying genotypes based on their population frequency and in silico predicted effects we also characterized the patterns of genotypes enriched among this collection of patients. Genet Med 17 10, 774–781. Results: We obtained a genetic diagnosis for 29 (24%) of our patients. We showed that patients carried an excess of damaging de novo mutations in intolerant genes, particularly those shown to be essential in mice (P = 3.4 × 10−8). This enrichment is only partially explained by mutations found in known disease-causing genes. Genet Med 17 10, 774–781. Conclusion: This work indicates that the application of appropriate bioinformatics analyses to clinical sequence data can also help implicate novel disease genes and suggest expanded phenotypes for known disease genes. These analyses further suggest that some cases resolved by whole-exome sequencing will have direct therapeutic implications. Genet Med 17 10, 774–781. PMID:25590979

  15. Magnetic Ordering in BaFe_{11.9} In_{0.1} O_{19} Hexaferrite (United States)

    Trukhanov, S. V.; Trukhanov, A. V.; Turchenko, V. O.; Kostishin, V. G.; Panina, L. V.; Kazakevich, I. S.; Balagurov, A. M.


    The crystal and magnetic structure by powder neutron diffractometry as well as the magnetic properties by vibration sample magnetometry for the BaFe_{11.9} In_{0.1} O_{19} polycrystalline sample have been performed in a wide temperature range from 10 up to 730 K and in magnetic field up to 14 T. The atomic coordinates and lattice parameters have been Rietveld refined. The Invar effect has been observed in the low-temperature range below 150 K. It was explained by the thermal oscillation anharmonicity of atoms. The increase of the microstress value with decreasing temperature has been defined from Rietveld refinement. It is established that the ferrimagnet-paramagnet phase transition is a standard second-order one. From the macroscopic magnetization measurement, the Curie temperature and ordered magnetic moment per nominal iron ion are obtained. From the microscopic diffraction measurement, the magnetic moments at different atomic position and total magnetic moment per iron ion have been defined at different temperatures. The most likely reasons and the mechanism of magnetic ordering are discussed.

  16. Multiepoch Radio Observations of the Exciting Sources of HH 212 and HH 119

    Directory of Open Access Journals (Sweden)

    R. Galván Madrid


    Full Text Available Presentamos observaciones de alta resolución angular (- 0.``3 hechas con el Very Large Array a 3.5 cm hacia las regiones de las fuentes excitadoras de dos sistemas Herbig-Haro: HH 212 en Orión y HH 119 en B335. Las observaciones fueron hechas durante tres épocas diferentes con el objetivo de medir posibles variaciones temporales rápidas (en la escala de una semana a un mes en las fuentes. En HH 212 detectamos, promediando las observaciones de las tres épocas, una fuente muy débil justo en la posición esperada para la fuente excitadora del sistema HH. La comparación con otras observaciones de radio de esta fuente indica variación temporal considerable en escala de años. En B335 detectamos en cada época al objeto previamente reportado por otros autores y nuestros resultados sugieren que esta fuente, un chorro térmico de radio, es variable en escalas de tiempo de un mes. Discutimos posibles explicaciones para esta rápida variabilidad.


    Energy Technology Data Exchange (ETDEWEB)

    Upadhyaya, B.R.


    This report describes the detailed results for task 2 of DOE-NERI project number 99-119 entitled ''Automatic Development of Highly Reliable Control Architecture for Future Nuclear Power Plants''. This project is a collaboration effort between the Oak Ridge National Laboratory (ORNL,) The University of Tennessee, Knoxville (UTK) and the North Carolina State University (NCSU). UTK is the lead organization for Task 2 under contract number DE-FG03-99SF21906. Under task 2 we completed the development of data-driven models for the characterization of sub-system dynamics for predicting state variables, control functions, and expected control actions. We have also developed the ''Principal Component Analysis (PCA)'' approach for mapping system measurements, and a nonlinear system modeling approach called the ''Group Method of Data Handling (GMDH)'' with rational functions, and includes temporal data information for transient characterization. The majority of the results are presented in detailed reports for Phases 1 through 3 of our research, which are attached to this report.

  18. The SAMI galaxy survey: Galaxy Interactions and Kinematic Anomalies in Abell 119

    CERN Document Server

    Oh, Sree; Cortese, Luca; van de Sande, Jesse; Mahajan, Smriti; Jeong, Hyunjin; Sheen, Yun-Kyeong; Allen, James T; Bekki, Kenji; Bland-Hawthorn, Joss; Bloom, Jessica V; Brough, Sarah; Bryant, Julia J; Colless, Matthew; Croom, Scott M; Fogarty, L M R; Goodwin, Michael; Green, Andy; Konstantopoulos, Iraklis S; Lawrence, Jon; López-Sánchez, Á R; Lorente, Nuria P F; Medling, Anne M; Owers, Matt S; Richards, Samuel; Scott, Nicholas; Sharp, Rob; Sweet, Sarah M


    Galaxy mergers are important events that can determine the fate of a galaxy by changing its morphology, star-formation activity and mass growth. Merger systems have commonly been identified from their disturbed morphologies, and we now can employ Integral Field Spectroscopy to detect and analyze the impact of mergers on stellar kinematics as well. We visually classified galaxy morphology using deep images ($\\mu_{\\rm r} = 28\\,\\rm mag\\,\\, arcsec^{-2}$) taken by the Blanco 4-m telescope at the Cerro Tololo Inter-American Observatory. In this paper we investigate 63 bright ($M_{\\rm r}<-19.3$) spectroscopically-selected galaxies in Abell 119; of which 53 are early type and 20 galaxies show a disturbed morphology by visual inspection. A misalignment between the major axes in the photometric image and the kinematic map is conspicuous in morphologically-disturbed galaxies. Our sample is dominated by early-type galaxies, yet it shows a surprisingly tight Tully-Fisher relation except for the morphologically-disturbe...

  19. Luminosity segregation in three clusters of galaxies (A119, 2443, 2218)

    CERN Document Server

    Pracy, M B; De Propris, R; Couch, W J; Nulsen, P E J


    We use deep wide-field V-band imaging obtained with the Wide Field Camera at the prime focus of the Issac Newton Telescope to study the spatial and luminosity distribution of galaxies in three low redshift (0.04119, Abell 2443 and Abell 2218. The absolute magnitude limits probed in these clusters are M_{V} - 5logh_{0.7} = -13.3, -15.4 and -16.7mag respectively. The galaxy population, at all luminosities, along the line-of-sight to the clusters can be described by the linear combination of a King profile and a constant surface density of field galaxies. We find that, for these three clusters, the core radius is invariant with intrinsic luminosity of the cluster population to the above limits and thus there is no evidence for luminosity segregation in these clusters. The exception is the brightest galaxies in A2218 which exhibit a more compact spatial distribution. We find the total projected luminosity distribution (within 1Mpc of the cluster centre) can be well represented by a s...

  20. Investigating the peculiar emission from the new VHE gamma-ray source H1722+119

    CERN Document Server

    Ahnen, M L; Antonelli, L A; Antoranz, P; Babic, A; Banerjee, B; Bangale, P; de Almeida, U Barres; Barrio, J A; González, J Becerra; Bednarek, W; Bernardini, E; Biasuzzi, B; Biland, A; Blanch, O; Bonnefoy, S; Bonnoli, G; Borracci, F; Bretz, T; Buson, S; Carosi, A; Chatterjee, A; Clavero, R; Colin, P; Colombo, E; Contreras, J L; Cortina, J; Covino, S; Da Vela, P; Dazzi, F; De Angelis, A; De Lotto, B; Wilhelmi, E de Ona; Di Pierro, F; Doert, M; Domínguez, A; Prester, D Dominis; Dorner, D; Doro, M; Einecke, S; Glawion, D Eisenacher; Elsaesser, D; Ramazani, V Fallah; Fernández-Barral, A; Fidalgo, D; Fonseca, M V; Font, L; Frantzen, K; Fruck, C; Galindo, D; López, R J García; Garczarczyk, M; Terrats, D Garrido; Gaug, M; Giammaria, P; Godinović, N; Munoz, A González; Gora, D; Guberman, D; Hadasch, D; Hahn, A; Hanabata, Y; Hayashida, M; Herrera, J; Hose, J; Hrupec, D; Hughes, G; Idec, W; Kodani, K; Konno, Y; Kubo, H; Kushida, J; La Barbera, A; Lelas, D; Lindfors, E; Lombardi, S; Longo, F; López, M; López-Coto, R; Majumdar, P; Makariev, M; Mallot, K; Maneva, G; Manganaro, M; Mannheim, K; Maraschi, L; Marcote, B; Mariotti, M; Martínez, M; Mazin, D; Menzel, U; Miranda, J M; Mirzoyan, R; Moralejo, A; Moretti, E; Nakajima, D; Neustroev, V; Niedzwiecki, A; Rosillo, M Nievas; Nilsson, K; Nishijima, K; Noda, K; Nogués, L; Orito, R; Overkemping, A; Paiano, S; Palacio, J; Palatiello, M; Paneque, D; Paoletti, R; Paredes, J M; Paredes-Fortuny, X; Pedaletti, G; Perri, L; Persic, M; Poutanen, J; Moroni, P G Prada; Prandini, E; Puljak, I; Rhode, W; Ribó, M; Rico, J; Garcia, J Rodriguez; Saito, T; Satalecka, K; Schultz, C; Schweizer, T; Sillanpää, A; Sitarek, J; Snidaric, I; Sobczynska, D; Stamerra, A; Steinbring, T; Strzys, M; Takalo, L; Takami, H; Tavecchio, F; Temnikov, P; Terzić, T; Tescaro, D; Teshima, M; Thaele, J; Torres, D F; Toyama, T; Treves, A; Verguilov, V; Vovk, I; Ward, J E; Will, M; Wu, M H; Zanin, R; D'Ammando, F; Hovatta, T; Max-Moerbeck, W; Raiteri, C M; Readhead, A C S; Reinthal, R; Richards, J L; Verrecchia, F; Villata, M


    The MAGIC (Major Atmospheric Gamma-ray Imaging Cherenkov) telescopes observed the BL Lac object H1722+119 (redshift unknown) for six consecutive nights between 2013 May 17 and 22, for a total of 12.5 h. The observations were triggered by high activity in the optical band measured by the KVA (Kungliga Vetenskapsakademien) telescope. The source was for the first time detected in the very high energy (VHE, $E > 100$ GeV) $\\gamma$-ray band with a statistical significance of 5.9 $\\sigma$. The integral flux above 150 GeV is estimated to be $(2.0\\pm 0.5)$ per cent of the Crab Nebula flux. We used contemporaneous high energy (HE, 100 MeV $ < E < 100$ GeV) $\\gamma$-ray observations from Fermi-LAT (Large Area Telescope) to estimate the redshift of the source. Within the framework of the current extragalactic background light models, we estimate the redshift to be $z = 0.34 \\pm 0.15$. Additionally, we used contemporaneous X-ray to radio data collected by the instruments on board the Swift satellite, the KVA, and t...


    Directory of Open Access Journals (Sweden)

    Anetta Lukáčová


    Full Text Available The cadmium concentrations depend on the environmental conditions and food production methods. The monitoring of cadmium concentration in meat is important for human health. The concentrations of cadmium in meat and meat products collected from central Slovakia, in the central Europe region and from different countries of West Europe were assessed using by AA spectrometer with graphite furnace (PerkinElmer AAnalyst 80, MA, USA. Within starting materials we detected the highest values of cadmium in beef from foreign production (0.1101 ppm, followed by pork from foreign production (0.0901 ppm in Lovecka salama and pork thigh (0.0523 ppm in selected ham. In Lovecka salami we were found the highest concentration of cadmium in final samples from foreign starting materials, followed by homogenized samples from foreign starting materials, final samples from domestic starting materials and homogenized samples from domestic starting materials (0.3728, 0.3549, 0.2387, 0.2112 ppm, respectively. The highest concentration of cadmium in selected ham were found in final products from foreign starting materials, homogenized samples from foreign starting materials, final products from domestic starting materials and homogenized samples from domestic starting materials (0.1453, 0.1382,0.0810, 0.0734 ppm, respectively. The obtained results suggested that the concentrations of cadmium are higher in homogenized samples and final products in Lovecka salami and selected ham in comparison with to starting materials. Technological process of meat processing can create a potential source of heavy metals in final products.

  2. Predictors of urinary cadmium levels in adult females

    Energy Technology Data Exchange (ETDEWEB)

    McElroy, Jane A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States)]. E-mail:; Shafer, Martin M. [University of Wisconsin, Environmental Chemistry and Technology Program, 600 N Park Street, Madison, WI 53706 (United States); Hampton, John M. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Newcomb, Polly A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Fred Hutchinson Cancer Research Center, Cancer Prevention Program, 1100 Fairview Ave N, M4-B402 PO Box 19024, Seattle, WA 98109 (United States)


    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration.

  3. Cadmium, ATPase-P, yeast. From transport to toxicity

    International Nuclear Information System (INIS)

    Two projects has been developed during my PhD. One consisting in the functional study of CadA, the Cd2+-ATPase from Listeria monocytogenes, the other one was focused on the toxicity of cadmium and the associated response of the yeast Saccharomyces cerevisiae. This two studies used a a phenotype of sensitivity to cadmium induced by CadA expression in yeast. This phenotype was used as a screening tool to identify essential amino acids of Cd transport by CadA and to study cadmium toxicity and the corresponding yeast cellular response. CadA actively transports Cd using ATP hydrolysis as energy source. Directed mutagenesis of the membranous polar, sulphur and charged amino-acids revealed that Cd transport pathway implied four transmembrane segments (Tm) and more precisely the cysteine C354, C356 and proline P355 of the CPC motif located in Tm6, aspartate D692 in Tm8, glutamate E164 in Tm4 and methionine M149 in Tm5. From our studies, 2 Cd ions would be translocated for each hydrolysis ATP. Expression of CadA in the yeast Saccharomyces cerevisiae induces an hypersensitivity to Cd. A wild type cell can grow up to 100 μm cadmium whereas CadA expressing yeast cannot grow with 1 μm cadmium in the culture medium. This cadmium sensitivity was due to the localisation of CadA in the endoplasmic reticulum membrane. Transport of cadmium in this compartment produces an accumulation of mis-folded proteins that induces the Unfolded Protein Response (UPR). As UPR also occurs in a wild type yeast exposed to low Cd concentration, one can point out endoplasmic reticulum as a extremely sensitive cellular compartment. UPR also appears as an early response to Cd as it happens far before any visible signs of toxicity. (author)

  4. Effect of Biochar on Relieving Cadmium Stress and Reducing Accumulation in Super japonica Rice

    Institute of Scientific and Technical Information of China (English)

    ZHANG Zhen-yu; MENG Jun; DANG Shu; CHEN Wen-fu


    It is of great importance to solve the threats induced by cadmium pollution on crops. This paper examined the effect of biochar on cadmium accumulation in japonica rice and revealed the mechanism underlying the response of protective enzyme system to cadmium stress. Biochar derived from rice straw was applied at two application rates under three cadmium concentrations. Shennong 265, super japonica rice variety, was selected as the test crop. The results indicated that cadmium content in above-ground biomass of rice increased with increasing soil cadmium concentrations, but the biochar application could suppress the accumulation of cadmium to some extent. Under high concentrations of cadmium, content of free proline and MDA (malondialdehyde) were high, so did the SOD (superoxide dismutase), POD (peroxidase) and CAT (catalase) activity in the lfag leaf of rice. However, the protective enzyme activities remained at low level when biochar was added.

  5. Accumulation and effects of cadmium on guppy (Poecilia reticulata) fed cadmium-dosed cladocera (Moina macrocopa)

    Energy Technology Data Exchange (ETDEWEB)

    Hatakeyama, S.; Yasuno, M.


    The study examines the rate of cadmium uptake and body burdens which cause adverse effects on the survival and growth of guppies when they are exposed to Cd dosed in zooplankton (Moina macrocopa) and Cd dissolved in water. Eight guppies fed Moina dosed at 20 Cd/L water died before 10 days. Growth of the remainder of the guppies exposed at this rate was impaired initially but was returned to control level around the 10th day of the study. (JMT)

  6. Cadmium Impairs p53 Activity in HepG2 Cells


    Urani, C.; Melchioretto, P.; M. Fabbri; Bowe, G.; Maserati, E.; Gribaldo, L.


    Cadmium and cadmium compounds are contaminants of the environment, food, and drinking water and are important constituents of cigarette smoke. Cd exposure has also been associated with airborne particulate CdO and with Cd-containing quantum dots in medical therapy. Adverse cadmium effects reported in the literature have stimulated during recent years an ongoing discussion to better elucidate cadmium outcomes at cell and molecular level. The present work is designed to gain an insight into the...

  7. Cadmium Stress Induced Changes in Antioxidant Enzymes, Lipid Peroxidation and Hydrogen Peroxide Contents in Barley Seedlings


    Amel Alayat; Lynda Souiki; Mohammed Reda Djebar; Zine Eddine Boumedris; Ouissem Moumeni; Houria Berrebbah


    Cadmium pollution is a problem of increasing significance for ecological, nutritional and environmental reasons. Different plant species and varieties show a wide range of plasticity in Cadmium tolerance, from a high degree of sensitivity to the hyper-accumulating phenotype of some tolerant plants. To avoid Cadmium toxicity, plants adopt various defense strategies. The present study was undertaken to assess and investigate the antioxidant responses of barley (Hordeum vulgare) L.) to cadmium t...

  8. A method for making a cadmium anode for a hermetically sealed alkaline storage battery

    Energy Technology Data Exchange (ETDEWEB)

    Morioka, Y.; Yosikhira, Y.


    Metallic cadmium powder and a glue solution are added to CdO powder. The compound is applied to a current tap and dried. The powder form metallic cadmium is prepared from a mixture of zinc and nickel powder which is dispersed in a solution of cadmium salts. As a result of the replacement reaction, a spongy metallic cadmium is produced which contains nickel. The sponge is ground. The obtained powder is used as an additive for the CdO.

  9. An explorative analysis of ERCC1-19q13 copy number aberrations in a chemonaive stage III colorectal cancer cohort

    DEFF Research Database (Denmark)

    Smith, David Hersi; Christensen, Ib Jarle; Jensen, Niels Frank;


    investigation is to determine the presence, frequency and prognostic impact of ERCC1 or ERCC4 gene copy number alterations in colorectal cancer (CRC). Methods: Fluorescent in situ hybridization probes directed at ERCC1 and ERCC4 with relevant reference probes were constructed. Probes were tested in a CRC cell...... line panel and in tumor sections from 152 stage III CRC chemonaive patients. Relationships between biomarker status and clinical endpoints (overall survival, time to recurrence, and local recurrence in rectal cancer) were analyzed by survival statistics. Results: ERCC1-19q13 copy number alterations...... were observed in a single cell line metaphase (HT29). In patient material, ERCC1-19q13 copy number gains (ERCC1-19q13/CEN-2 ≥ 1.5) were detected in 27.0% of specimens, whereas ERCC1-19q13 deletions (ERCC1-19q13/CEN-2

  10. Single and joint effects of petroleum hydrocarbons and cadmium on the polychaete Perinereis aibuhitensis Grube

    Institute of Scientific and Technical Information of China (English)


    Using the concentration gradient and combined pollutant exposure method, the single and joint effects of petroleum hydrocarbons (PHCs) and cadmium (Cd) on polychaete Perinereis aibuhitensis Grube, an ecologically keystone species in estuarine and coastal environment, have been investigated. The results indicate that the toxicity of PHCs to P. aibuhitensis is stronger than that of Cd to the organism. There are positive correlations between the mortality of worms and the exposed concentration of single Cd or PHCs in solution. Similarly, the accumulation of Cd or PHCs in worms increases with increasing Cd- or PHC-exposed concentrations. All the correlation relationships can be described using unitary quadratic equations (Y or Z = aX2 + bX + c). It is calculated, on the basis of these expressions, that the median lethal dose (LC50) of P. aibuhitensis exposed to a single Cd or PHC is 793.4-13567.3 and 28.0-119.9 μg/L, respectively. The exposed time has some stimulative effect on the two pollutants and on the mortality of the worms. Thus, even a low concentration of a single Cd or PHC may have strong toxic effects on the worms when the exposed time becomes longer. The accumulation of Cd or PHCs in worms differs with an increase in exposure time at the given exposed concentration of a single Cd or PHC. Noticeably, the accumulation of PHCs in worms decreases with an increase in exposure time at the given high concentration of PHCs in solution. The joint effect of PHCs and Cd on P. aibuhitensis is very complicated and changes with the exposed concentrations of the two pollutants. At the given concentration of PHCs, the joint toxicity of the two pollutants on the worms changes from synergism to antagonism with an increase in Cd concentration. The accumulation of Cd in the worms significantly decreases with the addition of PHCs to exposure solution.

  11. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)


    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  12. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H2DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were


    It has been postulated that nonvegetarians may be exposed to less cadmium than vegetarians because of the cadmium-poor meat in their diet. This study attempts to test this possibility by measuring the cadmium exposure and accumulation in a population subgroup that includes many v...

  14. 76 FR 57682 - Petition Requesting Regulations Restricting Cadmium in Children's Products (United States)


    ... cadmium in children's products, especially toy metal jewelry. On September 6, 2011, the Commission granted... cadmium in children's jewelry is published by ASTM International, Inc. (``ASTM'') within three months after September 16, 2011. If a voluntary standard for cadmium in children's jewelry is published by...

  15. 40 CFR 415.640 - Applicability; description of the cadmium pigments and salts production subcategory. (United States)


    ... cadmium pigments and salts production subcategory. 415.640 Section 415.640 Protection of Environment... POINT SOURCE CATEGORY Cadmium Pigments and Salts Production Subcategory § 415.640 Applicability; description of the cadmium pigments and salts production subcategory. The provisions of this subpart...

  16. Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

    Directory of Open Access Journals (Sweden)

    P.B. Lintongan


    Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.

  17. SNF1-related protein kinases type 2 are involved in plant responses to cadmium stress.

    NARCIS (Netherlands)

    A. Kulik; A. Anielska-Mazur; M. Bucholc; E. Koen; E. Szymańska; A. Żmieńko; E. Krzywińska; I. Wawer; F. McLoughlin; D. Ruszkowski; M. Figlerowicz; C. Testerink; A. Sklodowska; D. Wendehenne; G. Dobrowolska


    Cadmium ions are notorious environmental pollutants. To adapt to cadmium-induced deleterious effects plants have developed sophisticated defense mechanisms. However, the signaling pathways underlying the plant response to cadmium are still elusive. Our data demonstrate that SnRK2s (for SNF1-related

  18. Kinetic parameters and TL mechanism in cadmium tetra borate phosphor

    Energy Technology Data Exchange (ETDEWEB)

    Annalakshmi, O. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Jose, M.T., E-mail: [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Sridevi, J. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India); Venkatraman, B. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Amarendra, G. [Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Mandal, A.B. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India)


    Polycrystalline powder samples of cadmium tetra borate were synthesized by a simple solid state sintering technique and gamma irradiated sample showed a simple Thermoluminescence (TL) glow peak around 460 K. The TL kinetic parameters of gamma irradiated phosphor were determined by initial rise (IR), isothermal decay (ID), peak shape (PS), variable heating rate (VHR) and glow curve de-convolution method. The kinetic parameters such as activation energy (E), frequency factor (s) and order of kinetics (b) were calculated by IR, ID, PS and VHR methods are in the order of ∼1.05 eV, 10{sup 9}–10{sup 12} s{sup −1} and 1.58, respectively. From the results of TL and PL emission studies carried out on the phosphor revealed that the defect centers related to TL is different from that for PL. EPR measurements were carried out to identify the defect centers formed in cadmium tetra borate phosphor on gamma irradiation. Based on EPR studies the mechanism for TL process in cadmium tetra borate is proposed in this paper -- Highlights: • Polycrystalline powder samples of undoped cadmium tetra borate synthesized. • Cadmium tetra borate phosphor exhibits a dosimetric peak at 458 K. • Kinetic parameters of the trap responsible for TL evaluated. • TL mechanism is proposed from TL to EPR correlation studies.

  19. Cadmium sorption characteristics of phosphorylated sago starch-extraction residue

    International Nuclear Information System (INIS)

    The residue produced by the extraction of sago starch is usually discarded as a waste material. In this study, we phosphorylated the sago starch-extraction residue with phosphoryl chloride and used the phosphorylated residue to remove cadmium from wastewater. The phosphoric ester functionality in the phosphorylated residue was evaluated by means of infrared microspectrometry and solid-state NMR. The dependence of the cadmium sorption behavior on pH, contact time, and electrolyte concentration and the maximum sorption capacity of the phosphorylated residue were also studied. The cadmium sorption varied with pH and electrolyte concentration, and the maximum sorption capacity was 25.2 mg g-1, which is almost half the capacity of commercially available weakly acidic cation exchange resins. The phosphorylated residue could be reused several times, although cadmium sorption gradually decreased as the number of sorption-desorption cycles increased. The phosphorylated residue sorbed cadmium rapidly, which is expected to be favorable for the continuous operation in a column.

  20. Lead and cadmium in indoor air and the urban environment

    International Nuclear Information System (INIS)

    The present study was conducted to find potential terrestrial biomonitors for heavy metals in indoor air in an urban environment. TSP, PM10, and PM2.5 were collected in three retirement facilities in the urban area of Vienna. In addition, particulate matter and soil, vegetation, and isopods (Porcellio scaber L.) were collected in the adjacent garden areas. Aerosols were sampled with a low-volume air sampler. The sampled materials were wet ashed and total lead and cadmium contents were determined. Water-soluble heavy metal concentrations were measured in aqueous extracts from air exposed filters, soil, and vegetation. Lead and cadmium were analyzed by graphite furnace AAS. Lead contents in the vegetation were inferred from water-soluble lead in soils. Lead in isopods generally reflected the contents in vegetation. Cadmium in plants probably derived from soil solutions as well as from atmospheric input. Isopods reflected the total cadmium contents in soils. Particulate matter was dominated by PM2.5, both with respect to mass concentrations and to heavy metal contents. The indoor aerosol was found to be influenced by human activity, indoor sources, and outdoor particles. Relationships between indoor airborne heavy metals and the contents in vegetation (lead and cadmium: positive) and isopods (lead: negative) were identified to have the potential for biomonitoring indoor air quality. - Urban vegetation and isopods are potential indicators for indoor aerial heavy metals

  1. Lead and cadmium in indoor air and the urban environment. (United States)

    Komarnicki, Günter J K


    The present study was conducted to find potential terrestrial biomonitors for heavy metals in indoor air in an urban environment. TSP, PM(10), and PM(2.5) were collected in three retirement facilities in the urban area of Vienna. In addition, particulate matter and soil, vegetation, and isopods (Porcellio scaber L.) were collected in the adjacent garden areas. Aerosols were sampled with a low-volume air sampler. The sampled materials were wet ashed and total lead and cadmium contents were determined. Water-soluble heavy metal concentrations were measured in aqueous extracts from air exposed filters, soil, and vegetation. Lead and cadmium were analyzed by graphite furnace AAS. Lead contents in the vegetation were inferred from water-soluble lead in soils. Lead in isopods generally reflected the contents in vegetation. Cadmium in plants probably derived from soil solutions as well as from atmospheric input. Isopods reflected the total cadmium contents in soils. Particulate matter was dominated by PM(2.5), both with respect to mass concentrations and to heavy metal contents. The indoor aerosol was found to be influenced by human activity, indoor sources, and outdoor particles. Relationships between indoor airborne heavy metals and the contents in vegetation (lead and cadmium: positive) and isopods (lead: negative) were identified to have the potential for biomonitoring indoor air quality.

  2. Collinear laser spectroscopy of atomic cadmium

    CERN Document Server

    Frömmgen, Nadja; Bissell, Mark L; Bieroń, Jacek; Blaum, Klaus; Cheal, Bradley; Flanagan, Kieran; Fritzsche, Stephan; Geppert, Christopher; Hammen, Michael; Kowalska, Magdalena; Kreim, Kim; Krieger, Andreas; Neugart, Rainer; Neyens, Gerda; Rajabali, Mustafa M; Nörtershäuser, Wilfried; Papuga, Jasna; Yordanov, Deyan T


    Hyperfine structure $A$ and $B$ factors of the atomic $5s\\,5p\\,\\; ^3\\rm{P}_2 \\rightarrow 5s\\,6s\\,\\; ^3\\rm{S}_1$ transition are determined from collinear laser spectroscopy data of $^{107-123}$Cd and $^{111m-123m}$Cd. Nuclear magnetic moments and electric quadrupole moments are extracted using reference dipole moments and calculated electric field gradients, respectively. The hyperfine structure anomaly for isotopes with $s_{1/2}$ and $d_{5/2}$ nuclear ground states and isomeric $h_{11/2}$ states is evaluated and a linear relationship is observed for all nuclear states except $s_{1/2}$. This corresponds to the Moskowitz-Lombardi rule that was established in the mercury region of the nuclear chart but in the case of cadmium the slope is distinctively smaller than for mercury. In total four atomic and ionic levels were analyzed and all of them exhibit a similar behaviour. The electric field gradient for the atomic $5s\\,5p\\,\\; ^3\\mathrm{P}_2$ level is derived from multi-configuration Dirac-Hartree-Fock calculatio...

  3. Cadmium in insects after ash fertilization

    Institute of Scientific and Technical Information of China (English)

    Martin Lodenius; Jussi Josefsson; Kari Heli(o)vaara; Esa Tulisalo; Matti Nummelin


    Ash fertilization of forests returns nutrients to forest ecosystems and has a positive effect on soil pH.but it also may elevate Cd concentrations of forest biota.Cadmium concentrations of some forest insects(Formica ants.carabids and Coleopteran larvac from decaying wood)were investigated in southern Finland where two plots were fertilized with wood ash,while two other plots represented anfertilized control plots.In ants,mean Cd concentration was 3.6±1.4 mg/kg.with nest workers having significantly higher concen-trations than workers trapped in pitfall traps.Concentrations at fertilized and unfertilized plots were similar.In carabid beetles,the average Cd concentration of Carabus glabratus was 0.44±0.36 mg/kg.with no significant difference between control plots and fertilized plots.In another carabid beetle,Pterostichus niger,mean Cd concentration was higher at fertilized plots compared to control plots.We conclude that the variation of Cd concentra-tions in the insects studied is more efficiently controlled by species-specific differences than fertilization history of the forest floor.

  4. Thin-film cadmium telluride solar cells (United States)

    Chu, T. L.


    Cadmium telluride, with a room-temperature band-gap energy of 1.5 eV, is a promising thin-film photovoltaic material. The major objective of this research has been to demonstrate thin-film CdTe heterojunction solar cells with a total area greater than 1 sq cm and photovoltaic efficiencies of 13 percent or more. Thin-film p-CdTe/CdS/SnO2:F/glass solar cells with an AM1.5 efficiency of 10.5 percent have been reported previously. This report contains results of work done on: (1) the deposition, resistivity control, and characterization of p-CdTe films by the close-spaced sublimation process; (2) the deposition of large-band-gap window materials; (3) the electrical properties of CdS/CdTe heterojunctions; (4) the formation of stable, reproducible, ohmic contacts (such as p-HgTe) to p-CdTe; and (5) the preparation and evaluation of heterojunction solar cells.

  5. Cadmium uptake by rat red blood cells

    International Nuclear Information System (INIS)

    Rat red blood cells were employed to study the uptake of cadmium (109Cd). Suspensions of red blood cells were exposed to Cd concentrations (both bound and free) observed following in vivo Cd administration. Cd uptake was biphasic with an initial rapid phase (0C was one-fourth of that at 370C. The metabolic inhibitors: sodium fluoride (1mM), potassium cyanide (1mM) and carbonyl cyanide-m-chlorophenyl hydrazone (2μM) and the Na+-K+-ATPase inhibitor, ouabain (1mM) did not reduce Cd (50μM) uptake into red blood cells. This suggests that the uptake of Cd into red blood cells was not an active process. Incubation of Cd (10μM) with an equimolar concentration of Zn did not alter uptake of Cd into red blood cells, but at 5 and 10 times higher concentrations of Zn, Cd uptake was enhanced 5-fold. Mercury at one-tenth and equimolar concentrations of Cd increased Cd uptake by red blood cells 2-fold. N-Ethylmaleimide (0.5-5mM), which irreversibly inactivates membrane sulfhydryl groups, decreased Cd uptake. The data indicate that Cd uptake into rat red blood cells occurs by passive transport and that alterations of sulfhydryls of red blood cell membrane may modulate the process. (author)

  6. Cadmium accumulation and subcellular distribution in relation to cadmium chloride induced cytotoxicity in vitro

    International Nuclear Information System (INIS)

    A bovine kidney cell culture system was used to assess what relationship cadmium (Cd) uptake and subcellular distribution had to cadmium chloride induced cytotoxicity. Twenty-four hour incubation with 0.1-10 μM Cd elicited 0-90% cytotoxicity. Fifty percent cytotoxicity was estimated to result from 0.8 μM Cd. A concentration-related Cd accumulation paralleled the cytotoxicity profile. The time-course for Cd accumulation was linear for the first 6 h of exposure and plateaued by 18 h post-exposure. When the degree of cytotoxicity was compared with the cellular Cd burden at 24 h post-treatment a least-squares linear regression analysis (r=0.93) indicated a direct relationship. Subcellular distribution studies indicated greater than 90% Cd recovery from the soluble supernatant (105,000 g) at all levels of cytotoxicity studied. Metallothionein sequestered less than 25% of the cellular Cd. As a result of the correlation of the degree of cytotoxicity with the cellular Cd burden and the independence of subcellular distribution from cytotoxicity, a cumulative mechanism of toxicity for Cd in MDBK cells was suggested. (author)

  7. In vitro activity against Staphylococcus aureus of a novel antimicrobial agent, PRF-119, a recombinant chimeric bacteriophage endolysin. (United States)

    Idelevich, Evgeny A; von Eiff, Christof; Friedrich, Alexander W; Iannelli, Domenico; Xia, Guoqing; Peters, Georg; Peschel, Andreas; Wanninger, Ingrid; Becker, Karsten


    Antistaphylococcal activity of the novel chimeric endolysin PRF-119 was evaluated with the microdilution method. The MIC(50) and MIC(90) of 398 methicillin-susceptible Staphylococcus aureus isolates were 0.098 μg/ml and 0.391 μg/ml, respectively (range, 0.024 to 0.780 μg/ml). Both the MIC(50) and MIC(90) values of 776 methicillin-resistant S. aureus isolates were 0.391 μg/ml (range, 0.024 to 1.563 μg/ml). All 192 clinical isolates of coagulase-negative staphylococci exhibited MIC values of >50 μg/ml. In conclusion, PRF-119 exhibited very good activity specifically against S. aureus.

  8. Dynamic Nuclear Polarization NMR Enables the Analysis of Sn-Beta Zeolite Prepared with Natural Abundance 119Sn Precursors


    Gunther, William R.; Michaelis, Vladimir K.; Caporini, Marc A.; Griffin, Robert G.; Román-Leshkov, Yuriy


    The catalytic activity of tin-containing zeolites, such as Sn-Beta, is critically dependent on the successful incorporation of the tin metal center into the zeolite framework. However, synchrotron-based techniques or solid-state nuclear magnetic resonance (ssNMR) of samples enriched with 119Sn isotopes are the only reliable methods to verify framework incorporation. This work demonstrates, for the first time, the use of dynamic nuclear polarization (DNP) NMR for characterizing zeolites contai...


    NARCIS (Netherlands)



    Single-crystal X-ray diffraction has shown that (SmS)1.19 TaS2 is a misfit layer compound built alternately of double layers of SmS, an approximately {100} slice of NaCl-type SmS and sandwiches of TaS2 with tantalum in slightly distorted trigonal prisms of sulfur. The two structural units are both d

  10. Cadmium Accumulation Characteristics of Winter Weed Lapsana apogonoides in Paddy Field%稻田冬季杂草稻槎菜的镉积累特性研究

    Institute of Scientific and Technical Information of China (English)

    林立金; 石军; 刘春阳; 马倩倩; 何静; 钟程操; 黄佳璟; 温铿; 廖明安


    In order to screen more cadmium hyperaccumulators for cadmium contaminated paddy field remedia-tion,the pot and plot experiments were conducted to study the cadmium accumulation characteristics and ecophysio-logical characteristics of winter weed Lapsana apogonoides in paddy field.The preliminary and further experiments showed that the root biomass,shoot biomass,whole plant biomass and resistance coefficient of L.apogonoides de-creased first and increased later and decreased again with the increase of cadmium concentration in soil,and there was no significant toxic characteristic in any treatment.With the increase of soil cadmium concentration,the cadmi-um contents in root and shoot of L.apogonoides increased.When the soil cadmium concentration was 75 mg /kg,the cadmium contents in shoots of preliminary and further experiments were 1 19.50,1 10.1 1 mg /kg,respectively,which reached the critical value of cadmium hyperaccumulator(100 mg /kg).The root bioconcentration factor(BCF)and shoot BCF were greater than 1 ,and translocation factor(TF)exceeded 1 when the soil cadmium treatment was grea-ter than 0 mg /kg.The cadmium accumulation amounts in root,shoot and whole plant of L.apogonoides increased with the increase of soil cadmium concentration,and had highly significant linear regression relationship with soil cadmium concentration.The further experiment showed the chlorophyll content decreased first and increased later and decreased again with the increase of cadmium concentration in soil,SOD activity increased first and decreased later,and POD activity decreased first and increased later,which were related to the special physiological mechanism of L.apogonoides.In plot experiment,the cadmium accumulation amount in shoot of L.apogonoides was 1.10 -1.13 mg /m2 at soil cadmium level of 2.04 -2.89 mg /kg.Therefore,L.apogonoides was a cadmium hyperaccumulator which could be used to remedy the cadmium contaminated paddy field in winter.%为进一步筛选出更多的

  11. Cadmium accumulation characteristics and removal potentials of high cadmium accumulating rice line grown in cadmium-contaminated soils. (United States)

    Tang, Hao; Li, Tingxuan; Yu, Haiying; Zhang, Xizhou


    Phytoextraction is a promising technique to remove cadmium (Cd) from contaminated soils. In this research, the two different Cd accumulation rice lines of Lu527-8 (the high Cd accumulating rice line) and Lu527-4 (the normal rice line) were grown in soils with different Cd treatments (0, 5, 10, and 20 mg kg(-1) soil) to evaluate Cd accumulation characteristics and Cd removal potentials. When the concentration of Cd in soil increased, Lu527-8 showed less symptoms of phytotoxicity when compared to Lu527-4. Furthermore, Lu527-8 demonstrated greater shoot Cd accumulation (321.17-964.95 mg plant(-1)) than Lu527-4 (50.37-201.66 μg plant(-1)) at the jointing and filling stages. The soil available Cd content of Lu527-8 significantly decreased by 26.92-38.97 and 27.77-63.44 % at the jointing and filling stages, respectively. Meanwhile, the total Cd content in soil also reduced by 11.64-46.75 and 21.41-54.11 % at jointing and filling stages, respectively. When the Cd concentration in soil was 20 mg kg(-1), the Cd extraction rate in shoots of Lu527-8 reached 2.12 and 2.85 % which increased 10.60 and 6.48 times compared with that of Lu527-4 at the jointing and filling stages, respectively. In conclusion, this study demonstrates that Lu527-8 shows great abilities of Cd accumulation and Cd removal potential from contaminated soils with different Cd treatments and it is a promising species for phytoextraction of Cd-contaminated soils.

  12. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Jeekeeree, Wanpen [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Funkhiew, Thippawan [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Sanjum, Rungaroon; Apiwatpaiboon, Thitikarn [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Phopueng, Ittipol [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)


    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β{sub 2}-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β{sub 2}-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β{sub 2}-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β{sub 2}-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children.

  13. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    International Nuclear Information System (INIS)

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β2-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β2-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β2-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β2-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children

  14. Analysis Of The Underpotential Deposition Of Cadmium On Copper

    Directory of Open Access Journals (Sweden)

    Kowalik R.


    Full Text Available In this study the process of deposition of cadmium on polycrystalline copper electrode in sulfate solution was investigated. The process of underpotential and bulk deposition was analyzed by classical electrochemical method: cyclic voltammetry(CV, anodic stripping voltammetry(ASV and electrochemical quartz crystal microbalance(EQCM. The obtained results were compared with electrochemical impedance spectroscopy(EIS measurements. CV, EQCM and EIS results suggest that the UPD of cadmium starts below potential −0.4 V vs Ag/AgCl. Additionally the stripping analysis indicates the formation of cadmium monolayer with different density of deposited atoms depending on the applied potential. The transition from UPD to bulk deposition occurs below potential −0,7 V.

  15. Effects of macromolecular chelators on intestinal cadmium absorption in mice

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, O.; Nielsen, J.B.; Bulman, R.A.


    Suppression of absorption by macromolecular chelators have been sucessful with several metals. In this paper a series of immobilized chelators ranging from DTPA to S-containing soft bases have been synthetized and investigated for ability to suppress intestinal uptake of /sup 109/Cd/sup 2+/ in mice. Dextran-O-ethyl-mercaptan, xanthates derived from polysaccharides and polyvinyl alcohol, dithiocarbamates of polyethylene imine and aminoethyl cellulose, and DTPA immobilized on aminopropyl silica were all ineffective. DTPA immobilized on aminoethyl cellulose even enhanced the intestinal uptake. The macromolecular chelators were without extensive effect on organ distribution of absorbed cadmium, except for dithiocarbamate immobilized on polyethylene imine, which enhanced the deposition of cadmium in several organs including the brain. Although the results are discouragign, they indicate that desing and synthesis of immobilized vicinal dithio compounds may represent an avenue for development of non-absorbable chelators with high affinity for cadmium.

  16. Biosorption of Cadmium by Fungal Biomass of Aspergillus niger

    Institute of Scientific and Technical Information of China (English)



    Objective To investigate the removal of cadmium from aqueous solution by waste fungal biomass of Aspergillus niger, originated from citric acid fermentation industry. Methods Batch adsorption test was used to study the biosorption equilibrium and isotherm. The Cd2+ concentration was measured with atomic adsorption spectrophotometer (AAS) HITACHI 180-80. Results The biosorption achieved equilibrium within 30 min. The adsorption isotherm could be described by Freundlich adsorption model, and the constants KF and 1/n were determined to be 2.07 and 0.18, respectively, and the correlation efficiency was 0.97. The optimal pH for Cd adsorption was 6.0. The cadmium-laden biomass could be effectively regenerated using 0.1 N HCl. Conclusion The waste biomass of Aspergillus niger, a by-product of fermentation industry, is a potential biosorbent for the removal of cadmium from aqueous solution.

  17. Cadmium-induced oxidative stress in potato tuber

    Directory of Open Access Journals (Sweden)

    Andrzej Stroiński


    Full Text Available Short-term treatment of tuber discs of potato (Solanum tuberosum L. with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202 and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP and catalase (CAT was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dismutase (SOD, CAT and AAP was observed and it comes from inactivation of enzymes by cadmium ions. A subsequent activity increase of the enzymes aroused earlier in tolerant tissues. It seems therefore, that tolerant tissues possess a more efficient antioxidative system.

  18. Antifungal activity of nicotine and its cadmium complex

    International Nuclear Information System (INIS)

    Nicotine and its metal complex; Cd(II)-nicotine were isolated from leaves of Nicotiana tabacum using various metal ions by the reported techniques and studied for their antifungal activities against fourteen different species of fungi. For comparative study, pure sample of nicotine and metal salt used for complexation; cadmium(II) iodide was also subjected to antifungal tests with the same species of fungus under similar conditions. Results indicated that nicotine is quite effective against the rare pathogenic and Non pathogenic fungi but comparatively less effective against Pathogenic fungi. Nicotine was found to be completely ineffective against the selected species of Occasional pathogenic fungi. Cadmium(II) iodide effectively inhibited Pathogenic and Non pathogenic fungi whereas relatively ineffective against the Occasional pathogenic and Rare pathogenic fungi. On the other hand, Cadmium(II) nicotine complex inhibited all the selected species of fungi except Fusarium solani. (author)

  19. Synthesis and decay process of superheavy nuclei with Z=119-122 via hot-fusion reactions (United States)

    Ghahramany, N.; Ansari, A.


    In this research article attempts have been made to calculate the superheavy-nuclei synthesis characteristics including, the potential energy parameters, fusion probability, fusion and evaporation residue (ER) cross sections as well as, decay properties of compound nucleus and the residue nuclei formation probability for elements with Z=119-122 by using the hot-fusion reactions. It is concluded that, although a selection of double magic projectiles such as 48Ca with high binding energy, simplifies the calculations significantly due to spherical symmetric shape of the projectile, resulting in high evaporation residue cross section, unfortunately, nuclei with Z > 98 do not exist in quantities sufficient for constructing targets for the hot-fusion reactions. Therefore, practically our selection is fusion reactions with titanium projectile because the mass production of target nuclei for experimental purposes is more feasible. Based upon our findings, it is necessary, for new superheavy-nuclei production with Z > 119, to use neutron-rich projectiles and target nuclei. Finally, the maximal evaporation residue cross sections for the synthesis of superheavy elements with Z=119-122 have been calculated and compared with the previously founded ones in the literature.

  20. Substitute potting compound for Sylgard 93-119 based on Sylgard 184 and Q3-6527 dielectric gel

    Energy Technology Data Exchange (ETDEWEB)

    Flowers, G.L.; Switzer, S.T.


    Development of a substitute potting compound developed by Pantex to replace the no longer available Dow Corning 93-119 is described. The specific approach taken in this development utilized Dow Corning Sylgard 184 as the basic starting material, altering its viscosity with Dow Corning Dielectric Gel Q3-6527 and then modifying the cure rate with Dow Corning Accelerator Q3-6559. Various tests were run to characterize both chemical and physical properties of the substitutes as well as the initial 93-119 and the starting raw materials. Summaries of the data peculiar to this substitute are presented here whereas a more detailed examination of the test methods and results for the overall project are presented in another report. The properties of two substitutes developed from the two extremes of viscosity to be expected for Sylgard 184 during production are presented. These substitutes are easily quick-frozen in the catalyzed state for production use upon thawing. They are however somewhat more difficult to deaerate and eventually cure to a harder state than the original DC 93-119.


    Directory of Open Access Journals (Sweden)

    Pavol Trebichalský


    Full Text Available The work is to evaluate the extent of risk transfer of heavy metals from soil burdensome to their different levels of consumption of selected parts of the crop. The goal to be achieved in conditions of simulated vegetation pot experiments. To implement the experiment, we used the agricultural soil of land site Výčapy - Opatovce. The experiments use two types of leguminous plants: Faba beans (Faba vulgaris M., a variety MERLIN lentil dishes (Lens esculentum variety NELKA. In one experimental tank was weighed 5 kg of soil mixed with 1 kg of silica sand, and the bottom of the container we put a small drainage layer of gravel. Within each container, we applied the calculated dose of the basic fertilizer, as well as various amounts of soluble salts of cadmium observed. Crops are harvested when fully ripe and the  wet mineralization of plant samples was determined by heavy metals AAS method for device VARIAN 240FS. Significant ratio of cadmium is in the aboveground biomass of the legumes. Lentils take into aboveground biomass much more cadmium than  faba beans. The cadmium content in the first two variants is significantly lower than in the next two in both crops. We may conclude that the faba beans, and lentils to accumulate an increased amount of cadmium in soil in a relatively large amount of seeds. Although it is clear that Faba bean received cadmium content was compared with more lentils. Due to the significant accumulation of Cd by plants lentils and excessive production of the aboveground biomass is potentially usable lens as fytoremediation crop recovery for metalic polluted soils.doi:10.5219/221

  2. Cadmium effects and accumulation in cultures of Prorocentrum micans (dinophyta) (United States)

    Kayser, H.; Sperling, K.-R.


    Effects and accumulation of cadmium were studied in unialgal 10-1 batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 µg l-1. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 µg Cd l-1 reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 µg Cd-1 does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and in the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 µg g-1 (dry weight) in controls to 500 µg g-1 (dry weight) in media containing 100 µg Cd l-1. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant (Series 1) or decreased only slowly during experimental time (Series 2). The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  3. Cadmium effects and accumulation in cultures of Prorocentrum micans (Dinophyta)

    Energy Technology Data Exchange (ETDEWEB)

    Kayser, H.; Sperling, K.R.


    Effects and accumulation of cadmium were studied in 10-l batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 l/sup -1/. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 Cd l/sup -1/ reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 Cd l/sup -1/ does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 g/sup -1/ (dry weight) in controls to 500 g/sup -1/ (dry weight) in media containing 100 Cd l/sup -1/. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant or decreased only slowly during experimental time. The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  4. Lead and Cadmium Content of Korbal Rice in Northern Iran

    Directory of Open Access Journals (Sweden)

    A Bakhtiarian


    Full Text Available Every year the entrance of factory wastes such as Shiraz Petrochemical Complex, Marvdasht sugar cube factory, and Charmineh factory, and other industrial units into the Kor and Sivand rivers and also the entrance of the Marvdasht and Zarghan city sewer system wastes into the Kor river and the use of their water in the cultivation of the rice has caused a significant increase in the lead and cadmium content of the grains of rice. To study the effect of the Kor river's pollution on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the grains of rice, 57 samples of 6 different types of rice were prepared in 19 different stations in Korbal region and also 18 samples of 6 different types of rice, cultivated with unpolluted water, were prepared in the National Institute of Rice Research (Gilan. A comparison of the pollution level of the Korbal and Gilan rice samples shows a significant difference and indicates the significant effect of the pollution of the river on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the hybrid, prolific, and late rice sample types were greater than that of unprolific and early types, such that the amount of these two elements were highest in the Hassani type (the lead content was 0.9625 ppm and the cadmium content was 0.0793 ppm, whereas the Gasroddashti type which blooms earlier and is long seeded has the lowest amount of these two elements.

  5. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S;


    . Experience from cadmium-poisoned humans and laboratory mammals indicates that concentrations above 50-200 microg/g wet wt. may induce histopathological changes. Overall, 31 of the ringed seals had cadmium concentrations in the kidney cortex above 50 microg/g wet wt., 11 had concentrations above 100 and one......The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose...... of the study was to determine whether cadmium-induced damage in the kidneys and the skeletal system could be detected among 100 ringed seals from Northwest Greenland. The cadmium concentrations in the kidney cortex ranged from 0 to 248 microg/g wet weight (mean=44.5, N=100) in the 99 kidneys examined...

  6. Effect of pH on cadmium biosorption by coconut copra meal

    International Nuclear Information System (INIS)

    Biosorption of cadmium ion by coconut copra meal, an agricultural waste product was investigated as a function of initial solution pH and initial cadmium concentration. Pseudo-second-order kinetic analyses were performed to determine the rate constant of biosorption, the equilibrium capacity, and initial biosorption rate. Cadmium biosorption by copra meal was found to be dependent on the initial solution pH and initial cadmium concentration. Ion exchange occurred in the initial biosorption period. In addition, mathematical relationships were drawn to relate the change in the solution hydrogen ion concentration with equilibrium biosorption capacity, initial cadmium concentration, and equilibrium biosorption capacity

  7. Contribution of an Auxin to the Uptake of Nickel and Cadmium in Maize Seedlings

    Institute of Scientific and Technical Information of China (English)



    Maize seedlings were cultured in nickel or cadmium contaminated sand treated with α-naphthylacetic acid (NAA). The effects of NAA on nickel and cadmium uptake in roots, shoots, and subcellular fractions (cell wall, nuclei and remained parts of seedling cells) were determined. The data showed growth promotion when NAA was applied at low concentrations and inhibition at high concentrations. Uptake of nickel and cadmium content increased concurrently in roots and shoots. In the subcellular fraction, nickel and cadmium was greatest in the cell wall. The changes in growth had greatest correlation with nickel and cadmium content in the subcellular fraction.

  8. Purification and characterization of a cadmium-induced metallothionein from the shore crab Carcinus maenas (L.)

    DEFF Research Database (Denmark)

    Pedersen, K L; Pedersen, S N; Højrup, P;


    Two metallothionein variants were purified from the midgut gland of crabs (Carcinus maenas) exposed to a high cadmium concentration (2 p.p.m.). One of the variants was purified from crabs exposed to a low cadmium concentration (0.5 p.p.m.). The purification method involved acetone precipitation...... from crabs exposed to the high cadmium concentration differed only by a single residue of methionine at the N-terminus. The single variant isolated from crabs exposed to the low cadmium concentration was the one without the N-terminal methionine, indicating that high cadmium concentrations either...

  9. Zinc-Nickel Codeposition in Sulfate Solution Combined Effect of Cadmium and Boric Acid

    Directory of Open Access Journals (Sweden)

    Y. Addi


    Full Text Available The combined effect of cadmium and boric acid on the electrodeposition of zinc-nickel from a sulfate has been investigated. The presence of cadmium ion decreases zinc in the deposit. In solution, cadmium inhibits the zinc ion deposition and suppresses it when deposition potential value is more negative than −1.2 V. Low concentration of CdSO4 reduces the anomalous nature of Zn-Ni deposit. Boric acid decreases current density and shifts potential discharge of nickel and hydrogen to more negative potential. The combination of boric acid and cadmium increases the percentage of nickel in the deposit. Boric acid and cadmium.

  10. SU-E-T-159: Evaluation of a Patient Specific QA Tool Based On TG119

    Energy Technology Data Exchange (ETDEWEB)

    Ashmeg, S; Zhang, Y; O' Daniel, J; Yin, F; Ren, L [Duke University Medical Center, Durham, NC (United States)


    Purpose: To evaluate the accuracy of a 3D patient specific QA tool by analysis of the results produced from associated software in homogenous phantom and heterogonous patient CT. Methods: IMRT and VMAT plans of five test suites introduced by TG119 were created in ECLIPSE on a solid water phantom. The ten plans -of increasing complexity- were delivered to Delta4 to give a 3D measurement. The Delta4's “Anatomy” software uses the measured dose to back-calculate the energy fluence of the delivered beams, which is used for dose calculation in a patient CT using a pencilbeam algorithm. The effect of the modulated beams' complexity on the accuracy of the “Anatomy” calculation was evaluated. Both measured and Anatomy doses were compared to ECLIPSE calculation using 3% - 3mm gamma criteria.We also tested the effect of heterogeneity by analyzing the results of “Anatomy” calculation on a Brain VMAT and a 3D conformal lung cases. Results: In homogenous phantom, the gamma passing rates were found to be as low as 74.75% for a complex plan with high modulation. The mean passing rates were 91.47% ± 6.35% for “Anatomy” calculation and 99.46% ± 0.62% for Delta4 measurements.As for the heterogeneous cases, the rates were 96.54%±3.67% and 83.87%±9.42% for Brain VMAT and 3D lung respectively. This increased error in the lung case could be due to the use of the pencil beam algorithm as opposed to the AAA used by ECLIPSE.Also, gamma analysis showed high discrepancy along the beam edge in the “Anatomy” calculated results. This suggests a poor beam modeling in the penumbra region. Conclusion: The results show various sources of errors in “Anatomy” calculations. These include beam modeling in the penumbra region, complexity of a modulated beam (shown in homogenous phantom and brain cases) and dose calculation algorithms (3D conformal lung case)

  11. Vertebral and Intraspinal Anomalies in Indian Population with Congenital Scoliosis: A Study of 119 Consecutive Patients (United States)

    S, Rajasekaran; G, Balamurali; Shetty, Ajoy


    Study Design Retrospective case study by clinical and radiological data analysis. Purpose To analyze different types of vertebral anomalies and the incidence of associated intraspinal anomalies in the Indian population. Overview of Literature This is the largest study of congenital scoliosis and associated intraspinal anomalies in Indian population. Incidence of intraspinal anomaly in this series is 47% which is higher than previous literature. Hemivertebra was the most common anomaly as seen in previous studies. Methods A total of 119 patients with congenital scoliosis who underwent surgery between December 2006 and December 2012 were studied. Data was reviewed with medical records, plain radiographs, and magnetic resonance imaging (MRI) scans. Results Thoracolumbar curve was most common, seen in 43.6% of patients. In addition to scoliotic deformity, kyphosis was seen in 26% of patients. Failure of formation, the most common vertebral anomaly, was seen in 51.2% of patients, failure of segmentation was seen in 19.3% of patients, and there were 29.4% patients having both formation and segmentation anomalies. Hemivertebra was the most common vertebral anomaly seen in 66.3% of patients and for whom 63.2% were in thoracic spine. Intraspinal anomalies were associated with 47% of patients with congenital scoliosis. Tethered cord was the most common intraspinal abnormality and was found in 48.2% patients with intraspinal anomalies. The patients with failure of segmentation and mixed deformities were found to have a significantly higher incidence of intraspinal anomalies (65% and 57%, respectively) than those with failure of formation (34%). Out of 31 patients with kyphotic deformity 29% had intraspinal anomalies, and amongst them tethered cord was the most common anomaly seen in 66% patients. Out of 12 patients with neurocutaneous markers, 83% patients had intraspinal anomaly. Conclusions Intraspinal anomalies were seen in 47% of patients with congenital scoliosis in the

  12. SU-E-T-159: Evaluation of a Patient Specific QA Tool Based On TG119

    International Nuclear Information System (INIS)

    Purpose: To evaluate the accuracy of a 3D patient specific QA tool by analysis of the results produced from associated software in homogenous phantom and heterogonous patient CT. Methods: IMRT and VMAT plans of five test suites introduced by TG119 were created in ECLIPSE on a solid water phantom. The ten plans -of increasing complexity- were delivered to Delta4 to give a 3D measurement. The Delta4's “Anatomy” software uses the measured dose to back-calculate the energy fluence of the delivered beams, which is used for dose calculation in a patient CT using a pencilbeam algorithm. The effect of the modulated beams' complexity on the accuracy of the “Anatomy” calculation was evaluated. Both measured and Anatomy doses were compared to ECLIPSE calculation using 3% - 3mm gamma criteria.We also tested the effect of heterogeneity by analyzing the results of “Anatomy” calculation on a Brain VMAT and a 3D conformal lung cases. Results: In homogenous phantom, the gamma passing rates were found to be as low as 74.75% for a complex plan with high modulation. The mean passing rates were 91.47% ± 6.35% for “Anatomy” calculation and 99.46% ± 0.62% for Delta4 measurements.As for the heterogeneous cases, the rates were 96.54%±3.67% and 83.87%±9.42% for Brain VMAT and 3D lung respectively. This increased error in the lung case could be due to the use of the pencil beam algorithm as opposed to the AAA used by ECLIPSE.Also, gamma analysis showed high discrepancy along the beam edge in the “Anatomy” calculated results. This suggests a poor beam modeling in the penumbra region. Conclusion: The results show various sources of errors in “Anatomy” calculations. These include beam modeling in the penumbra region, complexity of a modulated beam (shown in homogenous phantom and brain cases) and dose calculation algorithms (3D conformal lung case)

  13. Spectroscopic study of cadmium (II) complexes with heterocyclic dithiocarbamate ligands

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Fontan, S. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Rodriguez-Seoane, P. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Casas, J.S. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Sordo, J. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Jones, M.M. (Department of Chemistry and Center in Molecular Toxicology, Vanderbilt University, Nashville, TN (United States))


    Cadmium(II) dithiocarbamates Cd(dtc)[sub 2] (dtc=4-carboxamidopiperidine-1-carbodithioate, morpholine-1-carbodithioate or 4-(2-hydroxyethyl)piperazine-1-carbodithioate) and Cd(dtc)[sub 2].H[sub 2]O (dtc=4-hydroxypiperidine-1-carbodithioate)[r brace] have been prepared and characterized by thermal analysis and IR and NMR ([sup 13]C, [sup 113]Cd) spectrometry. Two of these ligands have previously been shown capable of removing cadmium from its aged in vivo storage sites. The use of solid state [sup 13]C NMR measurements to establish the coordination mode of the dithiocarbomate ligands is also examined and the difficulties which arise are discussed. (orig.)

  14. Synthesis and characterization of cadmium doped lead–borate glasses

    Indian Academy of Sciences (India)

    A A Alemi; H Sedghi; A R Mirmohseni; V Golsanamlu


    Cadmium doped lead–borate glasses were prepared from the melts in appropriate proportions of PbO2, H3BO3 and (15–40 mol%) CdO mixture in the temperature range 700–950°C. The infrared spectra of the glasses in the range 400–4000 cm-1 show their structures. No boroxol ring formation was observed in the structure of these glasses. Furthermore, doped cadmium atoms were not seen in tetrahedral coordination. But the conversion of three-fold to four-fold coordination of boron atoms in the structure of glasses was observed.

  15. Cadmium resistance from Staphylococcus aureus plasmid pI258 cadA gene results from a cadmium-efflux ATPase.


    Nucifora, G; Chu, L; Misra, T K; Silver, S


    Cadmium resistance specified by the cadA determinant of Staphylococcus aureus plasmid pI258 results from the functioning of a cadmium-efflux system. In the nucleotide sequence of the DNA fragment containing the cadA determinant, two open reading frames were identified. The larger one, corresponding to a predicted polypeptide of 727 amino acid residues, is necessary and sufficient for expression of cadmium resistance. Comparison of the CadA amino acid sequence with known protein sequences sugg...

  16. Biosorption of cadmium by endophytic fungus (EF) Microsphaeropsis sp. LSE10 isolated from cadmium hyperaccumulator Solanum nigrum L. (United States)

    Xiao, Xiao; Luo, Shenglian; Zeng, Guangming; Wei, Wanzhi; Wan, Yong; Chen, Liang; Guo, Hanjun; Cao, Zhe; Yang, Lixia; Chen, Jueliang; Xi, Qiang


    A novel technology to obtain highly efficient biosorbent from the endophytes of a hyperaccumulator is reported. This technology is more convenient than the traditional method of obtaining biosorbents by experimentally screening many types of biomass by trial and error. Using this technology, endophytic fungus (EF) LSE10 was isolated from the cadmium hyperaccumulator Solanum nigrum L. It was identified as Microsphaeropsis sp. When cultured in vitro, the biomass yield of this EF was more than twice that of none-endophytic fungus (NEF) Rhizopus cohnii. Subsequently, it was used as a biosorbent for biosorption of cadmium from the aqueous solution. The results showed that the maximum biosorption capacity was 247.5mg/g (2.2 mmol/g) which was much higher than those of other adsorbents, including biosorbents and activated carbon. Carboxyl, amino, sulphonate and hydroxyl groups on EF LSE10 surface were responsible for the biosorption of cadmium. PMID:19854641

  17. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)


    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  18. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    International Nuclear Information System (INIS)

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg−1) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg−1, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg−1. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg−1), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg−1, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil Cd contamination is likely

  19. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador. (United States)

    Chavez, E; He, Z L; Stoffella, P J; Mylavarapu, R S; Li, Y C; Moyano, B; Baligar, V C


    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg(-1)) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0-5, 5-15, 15-30, and 30-50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg(-1), respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg(-1). Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg(-1)), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans>shell>leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg(-1), and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0-5 and 5-15 cm depths (r=0.80 and 0.82 for M3, and r=0.78 and 0.82 for HCl; Pbeans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils.

  20. Cadmium potentiates toxicity of cypermethrin in zebrafish. (United States)

    Yang, Ye; Ye, Xiaoqing; He, Buyuan; Liu, Jing


    Co-occurrence of pesticides such as synthetic pyrethroids and metals in aquatic ecosystems raises concerns over their combined ecological effects. Cypermethrin, 1 of the top 5 synthetic pyrethroids in use, has been extensively detected in surface water. Cadmium (Cd) has been recognized as 1 of the most toxic metals and is a common contaminant in the aquatic system. However, little information is available regarding their joint toxicity. In the present study, combined toxicity of cypermethrin and Cd and the underlying mechanisms were investigated. Zebrafish embryos and adults were exposed to the individual contaminant or binary mixtures. Co-exposure to cypermethrin and Cd produced synergistic effects on the occurrence of crooked body, pericardial edema, and noninflation of swim bladder. The addition of Cd significantly potentiated cypermethrin-induced spasms and caused more oxidative stress in zebrafish larvae. Cypermethrin-mediated induction of transcription levels and catalytic activities of cytochrome P450 (CYP) enzyme were significantly down-regulated by Cd in both zebrafish larvae and adults. Chemical analytical data showed that in vitro elimination of cypermethrin by CYP1A1 was inhibited by Cd. The addition of Cd caused an elevation of in vivo cypermethrin residue levels in the mixture-exposed adult zebrafish. These results suggest that the enhanced toxicity of cypermethrin in the presence of Cd results from the inhibitory effects of Cd on CYP-mediated biotransformation of this pesticide. The authors' findings provide a deeper understanding of the mechanistic basis accounting for the joint toxicity of cypermethrin and Cd. PMID:26267556

  1. Potentiation of cadmium nephrotoxicity by acetaminophen

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, A.M.; Russis, R. de; Ouled Amor, A.; Lauwerys, R.R.


    The possible interactions between acetaminophen and cadmium (Cd) on the kidney were investigated in female Sprague-Dawley rats. Acetaminophen was administered in the food at an average dose of 900 mg/kg and Cd in drinking water at the concentration of 200 ppm. The treatment with acetaminophen and Cd lasted 2 and 10 months, respectively. No interaction between Cd and acetaminophen was observed during the period of their concomitant administration: the increase in albuminuria caused by Cd and acetaminophen was additive, while the tubular impairment caused by acetaminophen (increased ..beta../sub 2/-microglobulinuria and decreased kidney concentrating ability) was not exacerbated by Cd. None of these treatments affected the glomerular filtration rate. Four months after the end of acetaminophen treatment, the renal changes had almost completely disappeared in the rats which had received the analgesic alone. Those continously exposed to Cd had developed slight tubular damage, as evidenced by an increased urinary excretion of ..beta../sub 2/-microglobulin and ..beta..-N-acetylglucosaminidase. By contrast, rats pretreated with acetaminophen for 2 months and exposed to Cd showed a marked increase in urinary excretion of albumin and ..beta../sub 2/-microglobulin, suggesting an interaction between both treatments. At the end of the study, only the interaction with ..beta../sub 2/-microglobulin excretion was still evident; that with the urinary excretion of ..beta..-N-acetylglucosaminidase and albumin having been masked by the chronic progessive nephrosis affecting most animals at that stage. As acetaminophen had no effect on the renal accumulation of Cd, it may be concluded that pretreatment with this analygesic at a dose causing slight tubular dysfunction renders rat kidney more sensitive to the nephrotoxic action of Cd. This observation may be of clinical relevance for population groups occupationally or environmentally exposed to Cd.

  2. [Physiological response and bioaccumulation of Panax notoginseng to cadmium under hydroponic]. (United States)

    Li, Zi-wei; Yang, Ye; Cui, Xiu-ming; Liao, Pei-ran; Ge, Jin; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui


    The physiological response and bioaccumulation of 2-year-old Panax notoginseng to cadmium stress was investigated under a hydroponic experiment with different cadmium concentrations (0, 2.5, 5, 10 μmol · L(-1)). Result showed that low concentration (2.5 μmol · L(-1)) of cadmium could stimulate the activities of SOD, POD, APX in P. notoginseng, while high concentration (10 μmol · L(-1)) treatment made activities of antioxidant enzyme descended obviously. But, no matter how high the concentration of cadmium was, the activities of CAT were inhibited. The Pn, Tr, Gs in P. notoginseng decreased gradually with the increase of cadmium concentration, however Ci showed a trend from rise to decline. The enrichment coefficients of different parts in P. notoginseng ranked in the order of hair root > root > rhizome > leaf > stem, and all enrichment coefficients decreased with the increase of concentration of cadmium treatments; while the cadmium content in different parts of P. notoginseng and the transport coefficients rose. To sum up, cadmium could affect antioxidant enzyme system and photosynthetic system of P. notoginseng; P. notoginseng had the ability of cadmium enrichment, so we should plant it in suitable place reduce for reducing the absorption of cadmium; and choose medicinal parts properly to lessen cadmium intake. PMID:26677685

  3. Thin-film cadmium telluride photovoltaics: ES and H issues, solutions, and perspectives

    International Nuclear Information System (INIS)

    Photovoltaics (PV) is a growing business worldwide, with new technologies evolving towards potentially large-volume production. PV use produces no emissions, thus offsetting many potential environmental problems. However, the new PV technologies also bring unfamiliar environment, safety, and health (ES and H) challenges that require innovative solutions. This is a summary of the issues, solutions, and perspectives associated with the use of cadmium in one of the new and important PV technologies: thin-film, cadmium telluride (CdTe) PV, which is being developed and commercialized by several companies including Solar Cells Inc. (Toledo, Ohio), BP Solar (Fairfield, California), and Matsushita (Japan). The principal ES and H issue for thin-film cadmium telluride PV is the potential introduction of cadmium--a toxic heavy metal--into the air or water. The amount of cadmium in thin-film PV, however, is quite small--one nickel cadmium flashlight battery has about as much cadmium (7 g) as a square meter of PV module using current technology--and a typical cordless power tool will have 5--10 batteries. CdTe modules are also very well sealed, limiting the chance of release. Nonetheless, minimizing the amount of cadmium in cadmium telluride modules and preventing the introduction of that cadmium into the environment is a top priority for National Renewable Energy Laboratory researchers and cadmium telluride PV manufacturers

  4. Reduced cadmium-induced cytotoxicity in cultured liver cells following 5-azacytidine pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, M.P.; Wilson, M.J.; Poirier, L.A.


    Recent work indicated that administration of the pyrimidine analog 5-azacytidine (AZA), either to cells in culture or to rats, results in an enhancement of expression of the metallothionein (MT) gene. Since MT is thought to play a central role in the detoxification of cadmium, the present study was designed to assess the effect of AZA pretreatment on cadmium cytotoxicity. Cultured rat liver cells in log phase of growth were first exposed to AZA (8 microM). Forty-eight hours later, cadmium was added. A modest increase in MT amounts over control was detected after AZA treatment alone. Cadmium alone resulted in a 10-fold increase in MT concentrations. The combination of AZA pretreatment followed by cadmium exposure caused a 23-fold increase in MT concentrations over control. Treatment with the DNA synthesis inhibitor hydroxyurea (HU) eliminated the enhancing effect of AZA pretreatment on cadmium induction of MT, indicating that cell division is required. AZA-pretreated cells were also harvested and incubated in suspension with cadmium for 0 to 90 min. AZA-pretreated cells showed marked reductions in cadmium-induced cytotoxicity as reflected by reduced intracellular potassium loss, glutamic-oxaloacetic transaminase loss, and lipid peroxidation following cadmium exposure. Results suggest that AZA pretreatment induces tolerance to cadmium cytotoxicity which appears to be due to an increased capacity to synthesize MT rather than high quantities of preexisting MT at the time of cadmium exposure.

  5. Reduced cadmium-induced cytotoxicity in cultured liver cells following 5-azacytidine pretreatment

    International Nuclear Information System (INIS)

    Recent work indicated that administration of the pyrimidine analog 5-azacytidine (AZA), either to cells in culture or to rats, results in an enhancement of expression of the metallothionein (MT) gene. Since MT is thought to play a central role in the detoxification of cadmium, the present study was designed to assess the effect of AZA pretreatment on cadmium cytotoxicity. Cultured rat liver cells in log phase of growth were first exposed to AZA (8 microM). Forty-eight hours later, cadmium was added. A modest increase in MT amounts over control was detected after AZA treatment alone. Cadmium alone resulted in a 10-fold increase in MT concentrations. The combination of AZA pretreatment followed by cadmium exposure caused a 23-fold increase in MT concentrations over control. Treatment with the DNA synthesis inhibitor hydroxyurea (HU) eliminated the enhancing effect of AZA pretreatment on cadmium induction of MT, indicating that cell division is required. AZA-pretreated cells were also harvested and incubated in suspension with cadmium for 0 to 90 min. AZA-pretreated cells showed marked reductions in cadmium-induced cytotoxicity as reflected by reduced intracellular potassium loss, glutamic-oxaloacetic transaminase loss, and lipid peroxidation following cadmium exposure. Results suggest that AZA pretreatment induces tolerance to cadmium cytotoxicity which appears to be due to an increased capacity to synthesize MT rather than high quantities of preexisting MT at the time of cadmium exposure

  6. Dietary intake and urinary level of cadmium and breast cancer risk: A meta-analysis. (United States)

    Lin, Jinbo; Zhang, Fang; Lei, Yixiong


    Cadmium, a human carcinogenic heavy metal, has been reported to be associated with breast cancer risk; however, the results from the epidemiological studies are not always consistent. The objective of this study was to quantitatively summarize the current evidence for the relationship between cadmium exposure and breast cancer risk using meta-analysis methods. Six studies determining the dietary cadmium intake level and five studies evaluating the urinary cadmium level were identified in a systematic search of MEDLINE and PubMed databases, and the associations between these levels and breast cancer risk were analysed. The pooled estimates under the random-effects model suggested that higher urinary cadmium levels were associated with an increased risk for breast cancer (highest versus lowest quantile, pooled odds ratio [OR]=2.24, 95% confidence interval [95%CI]=1.49-3.35) and a 1μg/g creatinine increase in urinary cadmium led to a 1.02-fold increment of breast cancer (pooled OR=2.02, 95%CI=1.34-3.03); however, pooled estimates for dietary cadmium intake found no significant association between cadmium exposure and breast cancer risk (highest versus lowest quantile, pooled relative risk [RR]=1.01, 95%CI=0.89-1.15). These results suggest that cadmium exposure may lead to an increased risk of breast cancer, and urinary cadmium levels can serve as a reliable biomarker for long-term cadmium exposure and may predict the breast cancer risk.

  7. [Physiological response and bioaccumulation of Panax notoginseng to cadmium under hydroponic]. (United States)

    Li, Zi-wei; Yang, Ye; Cui, Xiu-ming; Liao, Pei-ran; Ge, Jin; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui


    The physiological response and bioaccumulation of 2-year-old Panax notoginseng to cadmium stress was investigated under a hydroponic experiment with different cadmium concentrations (0, 2.5, 5, 10 μmol · L(-1)). Result showed that low concentration (2.5 μmol · L(-1)) of cadmium could stimulate the activities of SOD, POD, APX in P. notoginseng, while high concentration (10 μmol · L(-1)) treatment made activities of antioxidant enzyme descended obviously. But, no matter how high the concentration of cadmium was, the activities of CAT were inhibited. The Pn, Tr, Gs in P. notoginseng decreased gradually with the increase of cadmium concentration, however Ci showed a trend from rise to decline. The enrichment coefficients of different parts in P. notoginseng ranked in the order of hair root > root > rhizome > leaf > stem, and all enrichment coefficients decreased with the increase of concentration of cadmium treatments; while the cadmium content in different parts of P. notoginseng and the transport coefficients rose. To sum up, cadmium could affect antioxidant enzyme system and photosynthetic system of P. notoginseng; P. notoginseng had the ability of cadmium enrichment, so we should plant it in suitable place reduce for reducing the absorption of cadmium; and choose medicinal parts properly to lessen cadmium intake.

  8. Ecological toxicity of reactive X-3B red dye and cadmium acting on wheat (Triticum aestivum)

    Institute of Scientific and Technical Information of China (English)


    Ecological toxicity of reactive X-3B red dye and cadmium in both their single form and their combined form on wheat was studied using the experimental method of seed and root exposure. The single-factor exposure indicated that the inhibitory rate of wheat root elongation was significantly increased with the increase in the concentration of the dye in the cultural solution, although seed germination of wheat was not sensitive to the dye. The toxicity of cadmium was greatly higher than that of the dye, but low concentration cadmium (< 40 mg/L) could promote the germination of wheat seed. Interactive effects of the dye and cadmium on wheat were complicated. There was no significant correlation between the inhibitory rate of seed germination and the concentrations of the dye and cadmium. Low concentration cadmium could strengthen the toxicity of the dye acting on root elongation. On the contrary, high concentration cadmium could weaken the toxicity of the dye acting on root elongation.

  9. Dissolution ad uptake of cadmium from dental gold solder alloy implants

    International Nuclear Information System (INIS)

    Pure metallic cadmium was irradiated by means of thermal neutrons. The irradiated cadmium (115Cd) was placed in bags of gold foil and the bags were implanted subcutaneously in the neck region of mice. Two and 3 d respectively after implantation the mice were killed, the bags removed and the animals subjected to whole-body autoradiography. The autoradiograms revealed an uptake of 115Cd in liver and kidney. In another experiment specimens of a cadmium-containing dental gold solder alloy, a cadmium-free dental casting gold alloy and soldered assemblies made of these two alloys were implanted subcutaneously in the neck region of mice. The animals were killed after 6 months; cadmium analysis showed significant increases in the cadmium concentration in liver and kidney of those mice which had been given implants of gold solder alloy. The study clearly shows that due to electrochemical corrosion cadmium can be released from implants and accumulated in the kidneys and the liver. (author)

  10. A New Klebsiella planticola Strain (Cd-1) Grows Anaerobically at High Cadmium Concentrations and Precipitates Cadmium Sulfide


    Sharma, Pramod K.; Balkwill, David L.; Frenkel, Anatoly; Vairavamurthy, Murthy A.


    Heavy metal resistance by bacteria is a topic of much importance to the bioremediation of contaminated soils and sediments. We report here the isolation of a highly cadmium-resistant Klebsiella planticola strain, Cd-1, from reducing salt marsh sediments. The strain grows in up to 15 mM CdCl2 under a wide range of NaCl concentrations and at acidic or neutral pH. In growth medium amended with thiosulfate, it precipitated significant amounts of cadmium sulfide (CdS), as confirmed by x-absorption...

  11. Changes in Tissue Metals After Cadmium Intoxication and Intervention With Chlorpromazine in Male Rats 

    Institute of Scientific and Technical Information of China (English)



    Cadmium(Cd),one of the most dangerous heavy metals,has a very similar ionic radius to calcium(Ca),The interference of cadmium in calcium homeostasis may play an important role in cadmium toxicity.Recent reports indicate that calmodulin(CaM) inhibitors such as trifluoperazine and chlorpromazine(CPZ) could protect rodents against cadmium toxicity,It was also reported that pretreatment of mice with zine(Zn)could reduce the adverse effects induced by cadmium.The aim of this study is to determine whether Cd changes the balance of other essential metals such as Zn and copper(Cu) in rat tissues,and whether CPZ can reverse these changes which are induced by cadmium intoxication.Adult male Sprague-Dawley(SD) rats were injected intraperitoneally(ip) with cadmium chloride(CdCl2)(0.2,0.4,0.8mg Cd/kg body wight) alone and 0.4mg Cd/kg in association with CPZ(5mg/kg) daily for a week.The control animals were injected with normal saline only.The results showed that the cadmium content in the liver,kidney,and testis increased significantly with a dose-response relationship.Cadmium treatment markedly increased the Zn and Ca content in some of the tissues,Hepatic and renal metallothionein(MT) increased significantly after cadmium intoxication,CPZ treatment,howerver,reduced cadmium content in liver,but not blood and kidney.CPZ seemed to decrease the content of MT in liver and significantly increase the amounts of MT in kidney.These data suggest that the intervention of cadmium with tissue essential metals may play a role in cadium toxicity in rats,and calmodulin inhibitors to some extent can reduce the adverse effect of cadmium by decreasing the cadmium load in tissues and reversing the unbalance of essetial metals.

  12. Thin films and solar cells of cadmium telluride and cadmium zinc telluride

    Energy Technology Data Exchange (ETDEWEB)

    Ferekides, C.S.


    The objectives of this dissertation are to investigate (1) the metalorganic chemical vapor deposition (MOCVD) and properties of cadmium telluride (CdTe) and cadmium zinc telluride (Cd(1-x)Zn(z)Te) films and junctions, and their potential application to solar cells, and (2) the fabrication and characterization of CdTe solar cells by the close spaced sublimation (CSS) technique. CdTe and Cd(1-x)Zn(x)Te films have been deposited by MOCVD on a variety of substrates at 300-400 C.The effect of the deposition parameters and post deposition heat treatments on the electrical, optical, and structural properties have been investigated. Heterojunctions of the configuration CdTe/transparent conducting semiconductor (TCS) and Cd(1-x)Zn(x)Te/TCS have been prepared and characterized. CdTe(MOCVD)/CdS and Cd(1-x)Zn(x)Te(E sub g = 1.65eV)/Cd(1-x)Zn(x)S solar cells with efficiencies of 9.9 percent and 2.4 percent, respectively have been fabricated. The as-deposited CdTe(MOCVD)/CdS junctions exhibited high dark current densities due to deflects at the interface associated with small grain size. No effective post-deposition heat treatment has been developed. CdTe/CdS solar cells have also been fabricated by the close spaced sublimation (CSS). Significant improvements in material and processing have been made, and in collaboration with fellow researchers an AM1.5 conversion efficiency of 13.4 percent has been demonstrated, the highest efficiency ever measured for such devices. The highest conversion efficiency for the CdTe(CSS)/CdS solar cell was achieved by reaching high open-circuit voltages and fill factors, while the short-circuit current densities were moderate. These results indicate that further improvements to increase the short-circuit current densities can result in conversion efficiencies over 15 percent.

  13. Future trends in soil cadmium concentration under current cadmium fluxes to European agricultural soils. (United States)

    Six, L; Smolders, E


    The gradual increase of soil cadmium concentrations in European soils during the 20th century has prompted environmental legislation to limit soil cadmium (Cd) accumulation. Mass balances (input-output) reflecting the period 1980-1995 predicted larger Cd inputs via phosphate (P) fertilizers and atmospheric deposition than outputs via crop uptake and leaching. This study updates the Cd mass balance for the agricultural top soils of EU-27+Norway (EU-27+1). Over the past 15 years, the use of P fertilizers in the EU-27+1 has decreased by 40%. The current mean atmospheric deposition of Cd in EU is 0.35 g Cd ha(-1) yr(-1), this is strikingly smaller than values used in the previous EU mass balances (~3 g Cd ha(-1) yr(-1)). Leaching of Cd was estimated with most recent data of soil solution Cd concentrations in 151 soils, which cover the range of European soil properties. No significant time trends were found in the data of net applications of Cd via manure, compost, sludge and lime, all being small sources of Cd at a large scale. Modelling of the future long-term changes in soil Cd concentrations in agricultural top soils under cereal or potato culture predicts soil Cd concentrations to decrease by 15% over the next 100 years in an average scenario, with decreasing trends in some scenarios being more prevalent than increasing trends in other scenarios. These Cd balances have reverted from the general positive balances estimated 10 or more years ago. Uncertainty analysis suggests that leaching is the most uncertain relative to other fluxes.

  14. Analysis of Utilization of Cefazolin in 119 Hospitals of Shanghai During 2011-2013%2011-2013年上海119家医院头孢唑林应用分析

    Institute of Scientific and Technical Information of China (English)

    陈坚; 黄堃


    目的:评价头孢唑林在上海地区医院的应用现状和趋势。方法:对2011—2013年上海市119家医院头孢唑林的销售金额、用药频度( defined daily dose system,DDDs)、日均费用( daily drug cost,DDC)等进行统计和分析。结果:3年间,头孢唑林的份额在头孢菌素类药物中约占0.13%,销售金额呈逐年下降的趋势,DDDs略有上升,DDC略有下降,DDDs的复合年均增长率为2.31%。结论:应进一步规范头孢唑林的临床应用,以确保临床用药的安全和有效。%OBJECTIVE:To evaluate the utilization and tendency of cefazolin in 119 hospitals of Shanghai. METHODS:The utilization of cefazolin in 119 hospitals of Shanghai during 2011-2013 was statistically analyzed in respect of consumption sum, defined daily dose system( DDDs) and daily defined cost( DDC) , etc.RESULTS:During the three years, the market share of cefazolin took up about 0.13% of cephalosporins, but the consumption sum decreased yearly; DDDs had a slight increase while DDC had a slight decrease, CAGA of DDDs was 2.31%. CONCLUSIONS:The clinical application of cefazolin should be further regulated, so as to ensure the effective, safe and economical medication in clinic.

  15. Lead and cadmium in wild birds in southeastern Spain

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Fernandez, A.J.; Sanchez-Garcia, J.A.; Luna, A. [Univ. of Murcia (Spain); Jimenez-Montalban, P. [Regional Environmental Agency, Murcia (Spain). Centro de Recuperacion de Fauna Silvestre El Valle


    The main purpose of this study was to monitor exposure to lead and cadmium in wild birds in Murcia, a southeastern region of Spain on the Mediterranean coast. This region lies on one of the African-European flyways. Samples of liver, kidney, brain, bone, and whole blood from several species of wild birds were obtained during 1993. The authors found a clear relationship between cadmium and lead concentrations in birds and their feedings habits. Vultures (Gyps fulvus) had the highest concentrations of lead (mean 40 {micro}g/dl in blood), and seagulls (Larus argentatus and Larus ridibundus) the highest concentrations of cadmium (mean 4.43 {micro}g/g in kidney). Insectivores had high concentrations of both metals, and diurnal and nocturnal raptors showed the lowest tissue concentrations. The findings that tissue and blood concentrations were generally not elevated suggests environmental (rather than acute) exposure. Birds from more industrialized areas of the region studied here had higher concentrations of both lead and cadmium.

  16. Nickel cadmium batteries. Citations from the NTIS data base (United States)

    Cavagnaro, D. M.


    The design, fabrication, components, testing, and assembly of nickel cadmium batteries are covered in the bibliography. The majority of these citations deal with the development of power supplies for aircraft and spacecraft. This updated bibliography contains 135 abstracts, 19 of which are new entries to the previous edition.

  17. A method for partitioning cadmium bioaccumulated in small aquatic organisms

    Energy Technology Data Exchange (ETDEWEB)

    Siriwardena, S.N.; Rana, K.J.; Baird, D.J. [Univ. of Stirling (United Kingdom). Institute of Aquaculture


    A series of laboratory experiments was conducted to evaluate bioaccumulation and surface adsorption of aqueous cadmium (Cd) by sac-fry of the African tilapia Oreochromis niloticus. In the first experiment, the design consisted of two cadmium treatments: 15 {micro}g Cd{center_dot}L{sup {minus}1} in dilution water and a Cd-ethylenediaminetetraacetic acid (Cd-EDTA) complex at 15 {micro}m{center_dot}L{sup {minus}1}, and a water-only control. There were five replicates per treatment and 40 fish per replicate. It was found that EDTA significantly reduced the bioaccumulation of cadmium by tilapia sac-fry by 34%. Based on the results, a second experiment was conducted to evaluate four procedures: a no-rinse control; rinsing in EDTA; rinsing in distilled water; and rinsing in 5% nitric acid, for removing surface-bound Cd from exposed sac-fry. In this experiment, 30 fish in each of five replicates were exposed to 15 {micro}g Cd{center_dot}L{sup {minus}1} for 72 h, processed through the rinse procedures, and analyzed for total Cd. The EDTA rinse treatment significantly reduced (p<0.05) Cd concentrations of the exposed fish relative to those receiving no rinse. It was concluded that the EDTA rinse technique may be useful in studies evaluating the partitioning of surface-bound and accumulated cadmium in small aquatic organisms.

  18. Exposure determinants of cadmium in European mothers and their children

    DEFF Research Database (Denmark)

    Berglund, Marika; Larsson, Kristin; Grandér, Margaretha;


    The metal cadmium (Cd) is a widespread environmental pollutant with documented adverse effects on the kidneys and bones from long-term environmental exposure, but with insufficiently elucidated public health consequences such as risk of cardiovascular disease, hormone-related cancer in adults and...

  19. GEMAS: Geochemical Distribution of Cadmium in European Soil (United States)

    Birke, Manfred; Reimann, Clemens; Demetriades, Alecos; Dinelli, Enrico; Halamić, Josip; Rauch, Uwe; Gosar, Mateja; Ladenberger, Anna; Klos, Volodymyr; De Vivo, Benedetto


    Cadmium concentrations are reported for the urbanisation and use of fertilisers. The median value of Cd in the mobile metal ion (MMI®) extraction of Ap soil samples is 0.054 mg/kg. The Cd distribution pattern of MMI® extracts shows a zone of relatively high values throughout central Europe, which can be linked to agricultural land use (input of Cd via fertlisers).

  20. Plant science: the key to preventing slow cadmium poisoning

    NARCIS (Netherlands)

    Clemens, S.; Aarts, M.G.M.; Thomine, S.; Verbruggen, N.


    Practically all human populations are environmentally exposed to cadmium (Cd), mostly through plant-derived food. A growing body of epidemiological evidence suggests that there is no margin of safety between current Cd exposure levels and the threshold for adverse health effects and, hence, there is

  1. The cadmium content in bone of osteoporotic patients

    International Nuclear Information System (INIS)

    There are about 50 elements in the human body. A half of them is the essential elements in the organism. The residual elements except main constituents are called the essential trace elements for the organism. Trace elements in human body are very important for physical reactions of life. There is an osteoporosis that is one of the old person's disease. The osteoporosis happened by changing some physical nature of bone with aging. Or hormone imbalance and deficiency of calcium intake degenerated the bone in quality, too. The trace elements in human organ tissues and human bone tissues were determined to make clear distribution of trace elements in the human body by neutron activation analysis. Very much cadmium was found in human bones of osteoporotic patients. Why the high concentration of cadmium present in the bone tissues? Cadmium accumulates in it for long term of years. The Cd rich bone easily damaged by very weak impact. The normal bone mainly formed by Ca-hydroxyapatite with some connective protein tissues. Cadmium containing one formed by the hydroxyapatite, too. There is no apparent change in the nature and crystalline change. (author)

  2. Separator Qualification for Aerospace Nickel-cadmium Cells (United States)

    Milden, M. J.


    The development plans for a new separator for nickel cadmium (NiCd) cells is described. Research includes acceptance testing, operation in a charge/discharge characterization matrix, and life testing in low earth orbit (LEO) and geosynchronous (GEO) orbit under real time and accelerated conditions.

  3. Cadmium and zinc relationships in kidney cortex, liver, and pancreas

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G.; Piscator, M.; Linnman, L.


    Zinc and cadmium have been determined in kidney cortex, liver, and pancreas from 292 subjects autopsied in Stockholm, Sweden. In the liver and pancreas zinc was found to have a normal frequency distribution, average 45.3 and 26.9 wet wt, respectively. The concentrations of zinc in these two organs were constant regardless of age at death. Zinc was shown to accumulate with age in the kidney cortex in a way similar to cadmium, and had a log-normal distribution. The calculation of the regression line between individual cadmium concentrations below 60 and zinc concentrations gave a slope constant of 0.61 (Y/sub Zn/ = 0.61 X/sub Cd/ + 24.4), which corresponds to a nearly equimolar increase of zinc. The concentrations of ''physiological zinc,'' i.e., total zinc minus the zinc related to cadmium, were normally distributed (anti x = 24.6 Zn/g) and did not change with age. Furthermore, data on dry weight/wet weight ratios and ash weight/dry weight ratios in relation to age are presented.

  4. Tribological performance of organic cadmium compound as lubricant additive

    Institute of Scientific and Technical Information of China (English)

    HU Jian-qiang; XIE Feng; ZHU Huan-qin; ZHEN Fa-zheng; YAO Jun-bing


    The oil-soluble cadmium dipropyldithiophosphate additive was synthesized. A four-ball tester was used to evaluate the tribological performance of the additive in a mineral oil under different loads and lubricant grease synthesized compared with some commercial additives. The results show that it exhibits excellent antiwear and load-carrying capacities and is better than other additives. The surface analytical tools such as scanning electron microscope (SEM) with energy dispersive X-ray (EDX), X-ray photoelectron spectrometer (XPS) were used to investigate the topography, the compositions, and chemical states of some typical elements on the rubbing surface of worn scar.Smooth and light topography of worn scar further confirms that the additive shows good antiwear capacities. The results of EDX and XPS analyses indicate that tribochemical mixed protective films consisting of atomic cadmium, sulphides, sulphates and phosphates are formed on the rubbing surface, which contribute to improving the tribological properties of lubricant and grease. Particularly, the soft cadmium film formed plays an important role in improving antiwear properties of oils. Finally, antiwear mechanism of the additive and formation scheme of atomic cadmium was proposed.

  5. in situ immobilization of Cadmium and zinc in contaminated soils

    NARCIS (Netherlands)

    Osté, L.A.


    Keywords: beringite, cadmium, DOC, DOM, earthworms, immobilization, leaching, lime, manganese oxides, metal binding, metal uptake, organic matter partitioning, pH, soil contamination, remediation, sorption, Swiss chard, zeolites, zinc.It is generally assumed that a decrease in metal c

  6. Nuclear toxicology file: the cadmium: mechanisms to elucidate

    International Nuclear Information System (INIS)

    Spread in the environment by the human activities, the cadmium is a toxic and mutagen metal and its mechanisms of toxicity are still badly understood. We review here the molecular mechanisms of the transport, the toxicity and the detoxication of this metal by relying us on the cellular model of baker's yeast. (N.C.)

  7. Differents remediation methodos for lead, chromium and cadmium contaminated soils

    International Nuclear Information System (INIS)

    The usage of phosphates in the remediation of plots contaminated with heavy metals appears to be a good strategy to lessen the danger of these metals. This study analyses the effect of the mobilization of: Lead, chromium and cadmium by utilizing diverse forms of phosphates in contaminated soils of three different origins with ph modification and without it

  8. Cadmium translocation and accumulation in developing barley grains

    DEFF Research Database (Denmark)

    Chen, Fei; Wu, Feibo; Dong, Jing;


     Soil cadmium (Cd) contamination has posed a serious problem for safe food production and become a potential agricultural and environmental hazard worldwide. In order to study the transport of Cd into the developing grains, detached ears of two-rowed barley cv. ZAU 3 were cultured in Cd stressed...

  9. Determination of lead and cadmium in biological materials

    International Nuclear Information System (INIS)

    Sampling techniques and experience, and decomposition methods are presented. The processes used in flameless atomic absorption spectrometry (including the method using automatic insertion of samples), pulse polarography and isotope dilution mass spectrometry are described. Finally, the results of lead and cadmium measurements in bovine liver, blood, urine and hair samples are reported and discussed with a comparison of methods in some cases

  10. A major gene for grain cadmium accumulation in oat


    Tanhuanpää, Pirjo; Kalendar, Ruslan; Schulman, Alan; Kiviharju, Elina


    A population of 150 F2 plants was derived from a cross between two spring oat individuals, one from cv. Aslak (Boreal Plant Breeding LTd., Finland) and the other from cv. Salo (Svalöf-Weibull AB, Sweden). Cadmium was tested by inductively coupled plasma mass spectrometry (ICP-MS) method.

  11. Quercus infectoria Gall Extract Enhanced the Proliferation and Activity of Human Fetal Osteoblast Cell Line (hFOB 1.19)


    Hapidin, Hermizi; ROZELAN, Dalila; ABDULLAH, Hasmah; WAN HANAFFI, Wan Nurhidayah; Soelaiman, Ima Nirwana


    Background: The present study investigated the effects of Quercus infectoria (QI) gall extract on the proliferation, alkaline phosphatase (ALP), osteocalcin, and the morphology of a human fetal osteoblast cell line (hFOB 1.19).

  12. Characterization of Ag-Ge-Se bulk glasses by means of Moessbauer effect on {sup 57}Fe and {sup 119}Sn atomic nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Arcondo, B; Urena, M A; Garrido, J M Conde; Rocca, J A; Fontana, M, E-mail: barcond@fi.uba.a [Laboratorio de Solidos Amorfos, INTECIN, Facultad de IngenierIa, Universidad de Buenos Aires-CONICET (Argentina)


    In this work, the structure of Fe and Sn doped Ag{sub x}(Ge{sub 0.25}Se{sub 0.75}){sub 100-x} (x=0 to 25 at.%) intrinsically inhomogeneous glasses is analyzed employing {sup 119m}Sn and {sup 57}Fe Moessbauer spectroscopy, X-ray diffractometry and scanning electron microscopy. {sup 119m}Sn enters in the glass as a substitutional impurity for Ge whereas {sup 57}Fe enters as an interstitial impurity. Moessbauer spectra obtained with {sup 119m}SnO{sub 3}Ca source, from samples containing about 1% {sup 119}Sn for Ge, reveal that the local order of Ge in both amorphous phases is basically the same whereas Moessbauer spectra obtained with {sup 57}Fe(Rh) source, from samples containing about 0.5% {sup 57}Fe, evidence the differences between both phases.

  13. Aisopose lood / Aisopos ; tõlkinud ja kommenteerinud Kaarina Rein (96, 27, 119, 126, 143, 303) ja Janika Päll (72)

    Index Scriptorium Estoniae

    Aisopos, 6.saj. e.Kr.


    Sissejuhatus lk. 395, kommentaarid lk. 587-588. - Sisu: 96: Reetor Demades ; 27: Kalur, kes vett peksis ; 72: Härjakarjus ja Herakles : [luuletus] ; 119: Zeus ja rebane ; 126: Kohtumõistja Zeus ; 143: Pilliroog ja õlipuu ; 303: Kaks nahkpauna

  14. Quantifying the importance of MSP1-19 as a target of growth-inhibitory and protective antibodies against Plasmodium falciparum in humans.

    Directory of Open Access Journals (Sweden)

    Danny W Wilson

    Full Text Available BACKGROUND: Antibodies targeting blood stage antigens are important in protection against malaria, but the key targets and mechanisms of immunity are not well understood. Merozoite surface protein 1 (MSP1 is an abundant and essential protein. The C-terminal 19 kDa region (MSP1-19 is regarded as a promising vaccine candidate and may also be an important target of immunity. METHODOLOGY/FINDINGS: Growth inhibitory antibodies against asexual-stage parasites and IgG to recombinant MSP1-19 were measured in plasma samples from a longitudinal cohort of 206 children in Papua New Guinea. Differential inhibition by samples of mutant P. falciparum lines that expressed either the P. falciparum or P. chabaudi form of MSP1-19 were used to quantify MSP1-19 specific growth-inhibitory antibodies. The great majority of children had detectable IgG to MSP1-19, and high levels of IgG were significantly associated with a reduced risk of symptomatic P. falciparum malaria during the 6-month follow-up period. However, there was little evidence of PfMSP1-19 specific growth inhibition by plasma samples from children. Similar results were found when testing non-dialysed or dialysed plasma, or purified antibodies, or when measuring growth inhibition in flow cytometry or microscopy-based assays. Rabbit antisera generated by immunization with recombinant MSP1-19 demonstrated strong MSP1-19 specific growth-inhibitory activity, which appeared to be due to much higher antibody levels than human samples; antibody avidity was similar between rabbit antisera and human plasma. CONCLUSIONS/SIGNIFICANCE: These data suggest that MSP1-19 is not a major target of growth inhibitory antibodies and that the protective effects of antibodies to MSP1-19 are not due to growth inhibitory activity, but may instead be mediated by other mechanisms. Alternatively, antibodies to MSP1-19 may act as a marker of protective immunity.

  15. Lead, mercury, and cadmium in breast milk

    Directory of Open Access Journals (Sweden)

    Kadriye Yurdakök


    Full Text Available Toxic heavy metals are the major source of environmental pollution in this new millennium. Lead, mercury, and cadmium are the most common toxic heavy metals in the environment. There is no known function of these toxic heavy metals in the human body. In females, toxic heavy metals can be accumulated in maternal body before pregnancy and may be transferred to fetus through placenta and later, via breast milk. Lead previously accumulated in maternal bones can be mobilized along with calcium in order to meet increased calcium needs of the fetus in pregnant women and for the calcium needs in human milk during lactation. Human fetus and infants are susceptible to heavy metal toxicity passing through placenta and breastmilk due to rapid growth and development of organs and tissues, especially central nervous system. However most of the damage is already done by the time the infant is born. Intrauterine lead exposure can cause growth retardation, cognitive dysfunction, low IQ scores on ability tests, and low performance in school. Biological samples, such as umbilical cord blood and breast milk, and less commonly infant hair, are used for biomonitoring of intra-uterine exposure to these toxic chemicals. Although toxic metals and other pollutants may be excreted into breast milk, their effects are unknown and this topic is subject of a growing body of research. Despite the possibility of harm from environmental contaminants in breast milk, breastfeeding is still recommended as the best infant feeding method. In fact, the species-specific components present in breast milk protect infants against infections; promote immune and neurologic system development; and may decrease the risk of disease, including allergies, obesity, insulin-dependent diabetes mellitus, inflammatory bowel disease, and sudden infant death syndrome. Breastfeeding also facilitates maternal-infant attachment. The potential risk of environmental contaminants that can be transferred from

  16. Uptake of cadmium by Pseudokirchneriella supcapitata

    Directory of Open Access Journals (Sweden)

    Magela Paula Casiraghi


    Full Text Available In this work the microalgae Pseudokirchneriella supcapitata was used for the removal of the cadmium in liquids. The accumulations of metal ions by the alga occur in two stages: a very fast absorption (passive adsorption proceeded by a slower absorption (activate absorption. A mathematical model based on the surface absorption and on the transport into the interior of the cellular membrane was developed. The simulation model kinetic parameters were experimentally obtained. Through the results observed, the mathematical model was shown to be suitable when compared to the experimental results, confirming the validation of the mathematical model.Neste trabalho utilizou-se a microalga Pseudokirchneriella supcapitata para a remoção do cádmio em líquidos. A metodologia consistiu de três conjuntos de experimentos: o primeiro conjunto teve como objetivo a avaliação do crescimento da alga, o segundo foi à avaliação da remoção de cádmio e o terceiro a avaliação do crescimento da alga sendo adicionado o cádmio junto com o inóculo no tempo igual a zero, também foi avaliada a remoção de cádmio neste terceiro experimento. O acúmulo de íons metálicos pela alga ocorre em duas etapas: uma absorção muito rápida (adsorção passiva seguida por uma absorção mais lenta (absorção ativa Desenvolveu-se um modelo matemático baseado na absorção da superfície e no transporte para o interior da membrana celular. A obtenção dos parâmetros cinéticos do modelo de simulação foi obtida experimentalmente. Pelos resultados observados o modelo matemático proposto mostrou-se adequado quando comparado aos resultados experimentais, confirmando a validação do modelo matemático proposto.

  17. Is rhamnolipid biosurfactant useful in cadmium phytoextraction?

    Energy Technology Data Exchange (ETDEWEB)

    Wen, Jia; Stacey, Samuel P. [Adelaide Univ., Glen Osmond, SA (Australia). Soil and Land Systems; McLaughlin, Mike J. [Adelaide Univ., Glen Osmond, SA (Australia). Soil and Land Systems; CSIRO Land and Water, Agricultural Sustainable Flagship, Environmental Biogeochemistry Program, Waite Campus, Urrbrae, SA (Australia); Kirby, Jason K. [CSIRO Land and Water, Agricultural Sustainable Flagship, Environmental Biogeochemistry Program, Waite Campus, Urrbrae, SA (Australia)


    Successful chelant-assisted phytoextraction requires application of an eco-friendly metal-complexing agent which enhances metal uptake but does not pose a significant risk of off-site movement of metals. Rhamnolipid biosurfactant has been used to enhance cadmium (Cd) removal from contaminated soil by washing. It has a strong affinity for Cd compared to some other hazardous metals, suggesting that rhamnolipid could be useful in Cd phytoextraction. This study investigated the potential use of rhamnolipid to enhance Cd phytoextraction. Adsorption patterns of rhamnolipid in soils were investigated by batch adsorption experiments. Hydrophobicity of rhamnolipid-metal complexes were determined by assessing partitioning in an octanol/water system. Phytotoxicity of rhamnolipid to maize (Zea mays) and chelant-assisted phytoextraction efficiency of maize and sunflower (Helianthus annuus) were determined in pot experiments. The results showed that rhamnolipid was prone to adsorb strongly to soil at low application rates (0.1-1.7 mM) possibly due to its hydrophobic interactions with soil organic matter, hence reducing its capacity to complex and transport metals to plant roots. Rhamnolipid mobility increased (i.e. decreased soil phase partitioning) at elevated concentrations ({proportional_to}4.4 mM), which increased soil solution Cd concentrations possibly due to its reduced hydrophobic nature. The use of rhamnolipid at concentrations >4.4 mM severely reduced maize biomass yield, reducing the potential for chelant-assisted phytoextraction. At lower concentrations of rhamnolipid (0.02-1.4 mmol/kg), there was insignificant enhancement of Cd accumulation by plant (Z. mays and H. annuus) shoots, likely through strong retention of the chelant (or Cd-associated rhamnolipid) on soil surfaces. High rates of rhamnolipid addition to soils in this study caused severe phytotoxicity to maize and sunflower. Lower rates of rhamnolipid addition to soils in this study did not improve Cd

  18. A t(1;19)(q10;p10) mediates the combined deletions of 1p and 19q and predicts a better prognosis of patients with oligodendroglioma. (United States)

    Jenkins, Robert B; Blair, Hilary; Ballman, Karla V; Giannini, Caterina; Arusell, Robert M; Law, Mark; Flynn, Heather; Passe, Sandra; Felten, Sara; Brown, Paul D; Shaw, Edward G; Buckner, Jan C


    Combined deletion of chromosomes 1p and 19q is associated with improved prognosis and responsiveness to therapy in patients with anaplastic oligodendroglioma. The deletions usually involve whole chromosome arms, suggesting a t(1;19)(q10;p10). Using stem cell medium, we cultured a few tumors. Paraffin-embedded tissue was obtained from 21 Mayo Clinic patients and 98 patients enrolled in 2 North Central Cancer Treatment Group (NCCTG) low-grade glioma trials. Interphase fusion of CEP1 and 19p12 probes detected the t(1;19). 1p/19q deletions were evaluated by fluorescence in situ hybridization. Upon culture, one oligodendroglioma contained an unbalanced 45,XX,t(1;19)(q10;p10). CEP1/19p12 fusion was observed in all metaphases and 74% of interphase nuclei. Among Mayo Clinic oligodendrogliomas, the prevalence of fusion was 81%. Among NCCTG patients, CEP1/19p12 fusion prevalence was 55%, 47%, and 0% among the oligodendrogliomas, mixed oligoastrocytomas, and astrocytomas, respectively. Ninety-one percent of NCCTG gliomas with 1p/19q deletion and 12% without 1p/19q deletion had CEP1/19p12 fusion (P low-grade oligodendroglioma was 9.1 years without fusion and 13.0 years with fusion (P = 0.01). Similar significant median OS differences were observed for patients with combined 1p/19q deletions. The absence of alterations was associated with a significantly shorter OS for patients who received higher doses of radiotherapy. Our results strongly suggest that a t(1;19)(q10;p10) mediates the combined 1p/19q deletion in human gliomas. Like combined 1p/19q deletion, the 1;19 translocation is associated with superior OS and progression-free survival in low-grade glioma patients.

  19. Cadmium burden and the risk and phenotype of prostate cancer

    Directory of Open Access Journals (Sweden)

    Wu Tony T


    Full Text Available Abstract Background Studies on the association between prostate cancer and cadmium exposure have yielded conflicting results. This study explored cadmium burden on the risk and phenotype of prostate cancer in men with no evident environmental exposure. Methods Hospital-based 261 prostate cancer cases and 267 controls with benign diseases were recruited from four hospitals in Taiwan. Demographic, dietary and lifestyle data were collected by standardized questionnaires. Blood cadmium (BCd and creatinine-adjusted urine cadmium (CAUCd levels were measured for each participant. Statistical analyses measured the prostate cancer risk associated with BCd and CAUCd separately, controlling for age, smoking and institution. BCd and CAUCd levels within cases were compared in relation to the disease stage and the Gleason score. Results High family income, low beef intake, low dairy product consumption and positive family history were independently associated with the prostate carcinogenesis. There was no difference in BCd levels between cases and controls (median, 0.88 versus 0.87 μg/l, p = 0.45. Cases had lower CAUCd levels than controls (median, 0.94 versus 1.40 μg/g creatinine, p = 0.001. However, cases with higher BCd and CAUCd levels tended to be at more advanced stages and to have higher Gleason scores. The prostate cancer cases with Gleason scores of ≥ 8 had an odds ratio of 2.89 (95% confidence interval 1.25-6.70, compared with patients with scores of 2-6. Conclusion Higher CAUCd and BCd levels may be associated with advanced cancer phenotypes, but there was only a tenuous association between cadmium and prostate cancer.

  20. Induction of cytoprotective autophagy in PC-12 cells by cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qiwen [College of Veterinary Medicine, Yangzhou University, Yangzhou 225009 (China); Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009 (China); Bijie Pilot Area Research Institute of Bijie University, Bijie 551700 (China); Zhu, Jiaqiao; Zhang, Kangbao; Jiang, Chenyang; Wang, Yi; Yuan, Yan; Bian, Jianchun; Liu, Xuezhong; Gu, Jianhong [College of Veterinary Medicine, Yangzhou University, Yangzhou 225009 (China); Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009 (China); Liu, Zongping, E-mail: [College of Veterinary Medicine, Yangzhou University, Yangzhou 225009 (China); Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009 (China)


    Highlights: •Cadmium can promote early upregulation of autophagy in PC-12 cells. •Autophagy precedes apoptosis in cadmium-treated PC-12 cells. •Cadmium-induced autophagy is cytoprotective in PC-12 cells. •Class III PI3K/beclin-1/Bcl-2 signaling pathway plays a positive role in cadmium-triggered autophagy. -- Abstract: Laboratory data have demonstrated that cadmium (Cd) may induce neuronal apoptosis. However, little is known about the role of autophagy in neurons. In this study, cell viability decreased in a dose- and time-dependent manner after treatment with Cd in PC-12 cells. As cells were exposed to Cd, the levels of LC3-II proteins became elevated, specific punctate distribution of endogenous LC3-II increased, and numerous autophagosomes appeared, which suggest that Cd induced a high level of autophagy. In the late stages of autophagy, an increase in the apoptosis ratio was observed. Likewise, pre-treatment with chloroquine (an autophagic inhibitor) and rapamycin (an autophagic inducer) resulted in an increased and decreased percentage of apoptosis in contrast to other Cd-treated groups, respectively. The results indicate that autophagy delayed apoptosis in Cd-treated PC-12 cells. Furthermore, co-treatment of cells with chloroquine reduced autophagy and cell activity. However, rapamycin had an opposite effect on autophagy and cell activity. Moreover, class III PI3 K/beclin-1/Bcl-2 signaling pathways served a function in Cd-induced autophagy. The findings suggest that Cd can induce cytoprotective autophagy by activating class III PI3 K/beclin-1/Bcl-2 signaling pathways. In sum, this study strongly suggests that autophagy may serve a positive function in the reduction of Cd-induced cytotoxicity.

  1. Physiological characterization of cadmium-exposed Chlamydomonas reinhardtii. (United States)

    Bräutigam, Anja; Schaumlöffel, Dirk; Preud'homme, Hugues; Thondorf, Iris; Wesenberg, Dirk


    Chlamydomonas reinhardtii is a common model organism for investigation of metal stress. This green alga produces phytochelatins in the presence of metal ions. The influence of cadmium is of main interest, because it is a strong activator of phytochelatin synthase. Cell wall bound and intracellular cadmium content was determined after exposition to 70 µm CdCl(2), showing the main portion of the metal outside the cell. Nevertheless, imported cadmium was sufficient to cause significant changes in thiolpeptide metabolism and its transcriptional regulation. Modern analytical approaches enable new insights into phytochelatin (PC) distribution. A new rapid and precise UPLC-MS method allowed high-throughput PC quantification in algal samples after 1, 4, 24 and 48 h cadmium stress. Initially, canonic PCs were synthesized in C. reinhardtii during cadmium exposition, but afterwards CysPCs became the major thiolpeptides. Thus, after 48 h the concentration of the PC-isoforms CysPC(2-3) and CysGSH attained between 105 and 199 nmol g(-1) fresh weight (FW), whereas the PC(2-3) concentrations were only 15 nmol g(-1) FW. The relative quantification of γ-glutamyl transpeptidase (γ-GT) mRNA suggests the generation of CysPCs by glutamate cleavage from canonic PCs by γ-GT. Furthermore, a homology model of C. reinhardtii phytochelatin synthase was constructed to verify the use of crystal structures from Anabaena sp. phytochelatin synthase (PCS) for docking studies with canonical PCs and CysPCs. From the difference in energy scores, we hypothesize that CysPC may prevent the synthesis of canonical PCs by blocking the binding pocket. Finally, possible physiological reasons for the high abundance of CysPC compared with their canonic precursors are discussed.

  2. Effects of Humic Acid on the Germination Traits of Pumpkin Seeds under Cadmium Stress

    Directory of Open Access Journals (Sweden)

    Maasoumeh ASADI


    Full Text Available The study tackled the effect of humic acid and cadmium concentrations on the pumpkin seed germination characteristics throughout were studied. Treatments were cadmium concentrations on three levels: 0, 100 and 200 ppm and humic acid concentration of 0, 100, 200, 300 and 400 mg lit-1. Results showed that interaction of humic acid and cadmium was not significant on germination traits, but there was a significant effect on seedling growth indexes. Radicle and plumule length increased by 86 and 192% in comparison with control, of the mixture of 200 ppm cadmium and 300 mg lit-1 of humic acid. Cadmium had stimulatory effect on radicle and cotyledon dry weight and the highest values obtained with 200 ppm in mixture with 200 mg lit-1 of humic acid. Also, maximum plumule dry weight was recorded in 200 ppm cadmium and 300 mg lit-1 of humic acid. The highest of indexes were observed of 200 ppm cadmium and 400 mg lit-1 humic acid. In conclusion, the humic acid had detoxifying effect on cadmium stress in the culture and responded antagonistically against cadmium, but it seems that these concentrations of cadmium are low for the pumpkin seed and can be increased in order to reach the toxicity level.

  3. Flow of Cadmium from Rechargeable Batteries in the United States, 1996-2007 (United States)

    Wilburn, David R.


    Cadmium metal has been found to be toxic to humans and the environment under certain conditions; therefore, a thorough understanding of the use and disposal of the metal is warranted. Most of the cadmium used in the United States comes from imported products. In 2007, more than 83 percent of the cadmium used in the United States was contained in batteries, mostly in rechargeable nickel-cadmium batteries used in popular consumer products such as cordless phones and power tools. The flow of cadmium contained in rechageable nickel-cadmium batteries used in the United States was tracked for the years 1996 to 2007. The amount of cadmium metal contained in imported products in 2007 was estimated to be about 1,900 metric tons, or about 160 percent higher than the reported cadmium production in the United States from all primary and secondary sources. Although more than 40,000 metric tons of cadmium was estimated to be contained in nickel-cadmium rechargeable batteries that became obsolete during the 12-year study period, not all of this material was sent to municipal solid waste landfills. About 27 percent of the material available for recovery in the United States was recycled domestically in 2007; the balance was discarded in municipal solid waste landfills, exported for recycling, retained in temporary storage, or thrown away.

  4. Chronic cadmium exposure stimulates SDF-1 expression in an ERα dependent manner.

    Directory of Open Access Journals (Sweden)

    Esmeralda Ponce

    Full Text Available Cadmium is an omnipotent environmental contaminant associated with the development of breast cancer. Studies suggest that cadmium functions as an endocrine disruptor, mimicking the actions of estrogen in breast cancer cells and activating the receptor to promote cell growth. Although acute cadmium exposure is known to promote estrogen receptor-mediated gene expression associated with growth, the consequence of chronic cadmium exposure is unclear. Since heavy metals are known to bioaccumulate, it is necessary to understand the effects of prolonged cadmium exposure. This study aims to investigate the effects of chronic cadmium exposure on breast cancer progression. A MCF7 breast cancer cell line chronically exposed to 10(-7 M CdCl2 serves as our model system. Data suggest that prolonged cadmium exposures result in the development of more aggressive cancer phenotypes - increased cell growth, migration and invasion. The results from this study show for the first time that chronic cadmium exposure stimulates the expression of SDF-1 by altering the molecular interactions between ERα, c-jun and c-fos. This study provides a mechanistic link between chronic cadmium exposure and ERα and demonstrates that prolonged, low-level cadmium exposure contributes to breast cancer progression.

  5. Isolation, Identification, and Characterization of Cadmium Resistant Pseudomonas sp. M3 from Industrial Wastewater

    Directory of Open Access Journals (Sweden)

    Syed Zaghum Abbas


    Full Text Available The present study deals with the isolation, identification, and characterization of the cadmium resistant bacteria from wastewater collected from industrial area of Penang, Malaysia. The isolate was selected based on high level of the cadmium and antibiotic resistances. On the basis of morphological, biochemical characteristics, 16S rDNA gene sequencing and phylogeny analysis revealed that the strain RZCd1 was authentically identified as Pseudomonas sp. M3. The industrial isolate showed more than 70% of the cadmium removal in log phase. The cadmium removal capacity of strain RZCd1 was affected by temperature and pH. At pH 7.0 and 35°C, strain RZCd1 showed maximum cadmium removal capacity. The minimal inhibitory concentration of strain RZCd1 against the cadmium was 550 µg/mL. The resistance against the cadmium was associated with resistance to multiple antibiotics: amoxicillin, penicillin, cephalexin, erythromycin, and streptomycin. The strain RZCd1 also gave thick bands of proteins in front of 25 kDa in cadmium stress condition after 3 h of incubation. So the identified cadmium resistant bacteria may be useful for the bioremediation of cadmium contaminated industrial wastewater.

  6. Formation of the food vacuole in Plasmodium falciparum: a potential role for the 19 kDa fragment of merozoite surface protein 1 (MSP1(19.

    Directory of Open Access Journals (Sweden)

    Anton R Dluzewski

    Full Text Available Plasmodium falciparum Merozoite Surface Protein 1 (MSP1 is synthesized during schizogony as a 195-kDa precursor that is processed into four fragments on the parasite surface. Following a second proteolytic cleavage during merozoite invasion of the red blood cell, most of the protein is shed from the surface except for the C-terminal 19-kDa fragment (MSP1(19, which is still attached to the merozoite via its GPI-anchor. We have examined the fate of MSP1(19 during the parasite's subsequent intracellular development using immunochemical analysis of metabolically labeled MSP1(19, fluorescence imaging, and immuno-electronmicroscopy. Our data show that MSP1(19 remains intact and persists to the end of the intracellular cycle. This protein is the first marker for the biogenesis of the food vacuole; it is rapidly endocytosed into small vacuoles in the ring stage, which coalesce to form the single food vacuole containing hemozoin, and persists into the discarded residual body. The food vacuole is marked by the presence of both MSP1(19 and the chloroquine resistance transporter (CRT as components of the vacuolar membrane. Newly synthesized MSP1 is excluded from the vacuole. This behavior indicates that MSP1(19 does not simply follow a classical lysosome-like clearance pathway, instead, it may play a significant role in the biogenesis and function of the food vacuole throughout the intra-erythrocytic phase.

  7. BeppoSAX spectroscopy of the NGC7078 (M15) globular cluster X-ray source X2127+119


    Sidoli, L.; Parmar, A. N.; Oosterbroek, T.


    Results of a 1999 November 16--17 BeppoSAX observation of the low-mass X-ray binary X2127+119 located in the globular cluster NGC7078 are presented. The system is believed to be one where the central neutron star is normally obscured by the accretion disk, and only X-rays scattered into our line of sight by an extended accretion disk corona (ADC) are observed. The 0.1--10 keV lightcurve is energy dependent and shows two partial eclipses separated by the 17.1 hr orbital period. The 0.1--100 ke...

  8. Role of neutron transfer processes on the 6Li+120Sn and 7Li+119Sn fusion reactions

    Directory of Open Access Journals (Sweden)

    Fisichella M.


    Full Text Available The results concerning the study of 6Li+120Sn and 7Li+119Sn systems are presented. These two sistems are characterised by very similar structures of the interacting nuclei and by different Q-value for one-and two- neutron transfer. Our aim is to disentangle the possible effects due to the different n-transfer Q-values, at sub-barriers energies, by comparing the two fusion excitation function. In these experiments the fusion cross section has been measured by using a stack activation technique. No particular differences in the two fusion excitation functions have been observed.

  9. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    International Nuclear Information System (INIS)

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure

  10. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chantarawong, Wipa [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Inter Departmental Multidisciplinary Graduate Program in Bioscience, Faculty of Science, Kasetsart University, Bangkok (Thailand); Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Pradermwong, Kantimanee [Department of Zoology, Faculty of Science, Kasetsart University, Bangkok (Thailand); Shibahara, Shigeki, E-mail: [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan)


    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  11. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S;


    . Experience from cadmium-poisoned humans and laboratory mammals indicates that concentrations above 50-200 microg/g wet wt. may induce histopathological changes. Overall, 31 of the ringed seals had cadmium concentrations in the kidney cortex above 50 microg/g wet wt., 11 had concentrations above 100 and one...

  12. The prediction of the nuclear quadrupole splitting of 119Sn Mössbauer spectroscopy data by scalar relativistic DFT calculations. (United States)

    Krogh, Jesper W; Barone, Giampaolo; Lindh, Roland


    The electric field gradient components for the tin nucleus of 34 tin compounds of experimentally known structures and (119)Sn Mössbauer spectroscopy parameters were computed at the scalar relativistic density functional theory level of approximation. The theoretical values of the electric field gradient components were used to determine a quantity, V, which is proportional to the nuclear quadrupole splitting parameter (DeltaE). In a subsequent linear regression analysis the effective nuclear quadrupole moment, Q, was evaluated. The value of (11.9+/-0.1) fm(2) is a significant improvement over the non-relativistic result of (15.2+/-4.4) fm(2) and is in agreement with the experimental value of (10.9+/-0.8) fm(2). The average mean square error DeltaE(calcd)-DeltaE(exptl)=+/-0.3 mm s(-1) is a factor of two smaller than in the non-relativistic case. Thus, the approach has a quality which provides accurate support for the structure interpretation by (119)Sn spectroscopy. It was noted that geometry optimization at the relativistic level does not significantly increase the quality of the results compared with non-relativistic optimized structures. The accuracy in the approach called on us to consider the singlet-triplet state nature of the electronic structure of one of the investigated compounds. PMID:16671047

  13. Dunaliella salina as marine microalga highly tolerant to but a poor remover of cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Folgar, S. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Torres, E., E-mail: [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain); Perez-Rama, M.; Cid, A.; Herrero, C.; Abalde, J. [Departamento de Biologia Celular y Molecular, Laboratorio de Microbiologia, Facultad de Ciencias, Universidade da Coruna, Alejandro de la Sota no 1, 15008 La Coruna (Spain)


    Cadmium tolerance and removal in the marine microalga Dunaliella salina were studied in cultures exposed to different metal concentrations (5-120 mg Cd l{sup -1}) for 96 h. This microalga can be included in the group of microalgal species most tolerant to cadmium due to the high value of EC50 that it possesses (48.9 mg Cd l{sup -1} at 96 h of culture). The greater percentage of cadmium removed was obtained in cultures exposed to 5 mg Cd l{sup -1} at 96 h, but removing only 11.3% of the added cadmium. In all cultures, the quantity of cadmium removed intracellularly was much lower than the bioadsorbed quantity and it was proportional to the sulfhydryl group levels. Both the Freundlich and Langmuir adsorption models were suitable for describing the short-term biosorption of cadmium by living cells of D. salina.

  14. Cadmium exposure from smoking cigarettes: variations with time and country where purchased. (United States)

    Elinder, C G; Kjellström, T; Lind, B; Linnman, L; Piscator, M; Sundstedt, K


    Cadmium has been determined in 26 brands of cigarettes purchased in eight different countries throughout the world and in 16 different samples of cigarettes produced in Sweden between 1918 and 1968. In addition the amount of cadmium released from smoking one cigarette to the particulate phase collected from a smoking simulation machine, corresponding to the amount actually inhaled by a smoker, has been determined. The cadmium concentration in different brands of cigarettes ranged from 0.19 to 3.0 micrograms Cd/g dry wt, with a general tendency toward lower values in cigarettes from developing countries. No systematic change in the cadmium concentration of cigarettes with time could be revealed. The amount of cadmium inhaled from smoking one cigarette containing about 1.7 microgram Cd was estimated to be 0.14 to 0.19 microgram, corresponding to about 10% of the total cadmium content in the cigarette. PMID:6617614

  15. Soluble Moringa oleifera leaf extract reduces intracellular cadmium accumulation and oxidative stress in Saccharomyces cerevisiae. (United States)

    Kerdsomboon, Kittikhun; Tatip, Supinda; Kosasih, Sattawat; Auesukaree, Choowong


    Moringa oleifera leaves are a well-known source of antioxidants and traditionally used for medicinal applications. In the present study, the protective action of soluble M. oleifera leaf extract (MOLE) against cadmium toxicity was investigated in the model eukaryote Saccharomyces cerevisiae. The results showed that this extract exhibited a protective effect against oxidative stress induced by cadmium and H2O2 through the reduction of intracellular reactive oxygen species. Interestingly, not only the co-exposure of soluble MOLE with cadmium but also pretreatment of this extract prior to cadmium exposure significantly reduced the cadmium uptake through an inhibition of Fet4p, a low-affinity iron(II) transporter. In addition, the supplementation of soluble MOLE significantly reduced intracellular iron accumulation in a Fet4p-independent manner. Our findings suggest the potential use of soluble extract from M. oleifera leaves as a dietary supplement for protection against cadmium accumulation and oxidative stress. PMID:26675819

  16. Assessment of Cadmium Contamination of Soils in Sewage Disposal Areasof Coimbatore District, Tamil Nadu, India

    Directory of Open Access Journals (Sweden)

    R. Vinu Radha


    Full Text Available Cadmium is a naturally occurring minor element, one of the metallic components in the earth’s crust and oceans and present everywhere. Agricultural soils may also be enriched by cadmium which causes it’s accumulation in plants and pose a potential threat to human health. Also high concentrations of cadmium in soil have detrimental effects on ecosystem as it enters the food chain. Soil samples were collected from different places near sewage disposal areas in Coimbatore where the source of cadmium is likely to be threatening the public. Twenty six samples were collected, their physiochemical properties and total cadmium content were determined. Five soil samples that showed high levels of more than 3 mg kg-1of cadmium were identified as hotspots and their Arbuscularmycorrhizal spore count were assessed.

  17. Soluble Moringa oleifera leaf extract reduces intracellular cadmium accumulation and oxidative stress in Saccharomyces cerevisiae. (United States)

    Kerdsomboon, Kittikhun; Tatip, Supinda; Kosasih, Sattawat; Auesukaree, Choowong


    Moringa oleifera leaves are a well-known source of antioxidants and traditionally used for medicinal applications. In the present study, the protective action of soluble M. oleifera leaf extract (MOLE) against cadmium toxicity was investigated in the model eukaryote Saccharomyces cerevisiae. The results showed that this extract exhibited a protective effect against oxidative stress induced by cadmium and H2O2 through the reduction of intracellular reactive oxygen species. Interestingly, not only the co-exposure of soluble MOLE with cadmium but also pretreatment of this extract prior to cadmium exposure significantly reduced the cadmium uptake through an inhibition of Fet4p, a low-affinity iron(II) transporter. In addition, the supplementation of soluble MOLE significantly reduced intracellular iron accumulation in a Fet4p-independent manner. Our findings suggest the potential use of soluble extract from M. oleifera leaves as a dietary supplement for protection against cadmium accumulation and oxidative stress.

  18. Pubertal dependent effects of cadmium on episodic prolactin secretion in male rats

    Energy Technology Data Exchange (ETDEWEB)

    Lafuente, A.; Alvarez-Demanuel, E.; Marquez, N. [Fac. de Cienicas, Orense (Spain). Lab. de Toxicologia; Esquifino, A.I. [Dept. Bioquimica, Facultad de Medicina, Universidad Complutense, 28040-Madrid (Spain)


    This work was undertaken to assess if exposure to cadmium related to puberty may affect the episodic pattern of prolactin. Male rats were submitted to cadmium exposure, from day 30 to 60 or from day 60 to 90 of life respectively, at a dose of 50 ppm in the drinking water. Control age-matched rats received cadmium-free water. Prepubertal cadmium administration decreased mean serum prolactin levels and the absolute amplitude of the prolactin pulses. Subchronic exposure to cadmium of adult rats decreased mean serum prolactin levels, the absolute amplitude of the prolactin pulses and their duration, and the mean half-life of the hormone. These results suggest that subchronic cadmium exposure changes the secretory pattern of prolactin in adult male rats in a puberty-dependent way. (orig.) With 1 fig., 1 tab., 37 refs.

  19. Dunaliella salina as marine microalga highly tolerant to but a poor remover of cadmium

    International Nuclear Information System (INIS)

    Cadmium tolerance and removal in the marine microalga Dunaliella salina were studied in cultures exposed to different metal concentrations (5-120 mg Cd l-1) for 96 h. This microalga can be included in the group of microalgal species most tolerant to cadmium due to the high value of EC50 that it possesses (48.9 mg Cd l-1 at 96 h of culture). The greater percentage of cadmium removed was obtained in cultures exposed to 5 mg Cd l-1 at 96 h, but removing only 11.3% of the added cadmium. In all cultures, the quantity of cadmium removed intracellularly was much lower than the bioadsorbed quantity and it was proportional to the sulfhydryl group levels. Both the Freundlich and Langmuir adsorption models were suitable for describing the short-term biosorption of cadmium by living cells of D. salina.

  20. Lead, Cadmium and Nickel Contents of Some Medicinal Agents (United States)

    Nessa, Fazilatun; Khan, S. A.; Abu Shawish, K.Y.I.


    Thirty nine brands of pharmaceutical dosage forms (28 tablets, 4 syrups, 6 suspensions and one chewing gum) that are available in United Arab Emirates pharmaceutical markets were investigated for the presence of three heavy metals; lead, cadmium and nickel. Amongst the samples, 13 products were manufactured locally in United Arab Emirates and 26 products were imported from around the world. The samples were prepared by acid digestion procedure and the resultant solutions were analyzed for heavy metals by using a validated graphite furnace atomic absorption spectrometric method. Calibration curves were achieved using different concentration of lead, nickel and cadmium ranged from 0.001 to 0.05 μg/ml. The mean recoveries of metals from the samples were 86.4 to 97%. The %relative standard deviation for the intraassay and interday precision for the metals were <5%. Amongst the 39 samples of pharmaceutical dosage form all exhibited a positive response for lead, cadmium and nickel except three products whose Ni levels were below quantification level. The products contained variable amounts of heavy metals as of 0.0017 to 11.88 μg lead; 0.0011 to 0.5559 μg cadmium and 0.0011 to 2.6428 μg nickel, respectively. Based on maximum recommended daily dose (g) of these products, maximum daily ingested mass of lead was 0.0034 to 11.88 μg/d, 0.0013 to 0.56 μg/d for cadmium and 0.0011 to 2.64 μg/d for nickel, respectively. The results were compared with those of oral permitted daily exposure levels of United State Pharmacopeial National Formulary 2013. All the products were safe to consume and contained lower level of lead, cadmium and nickel than Oral Permitted Daily Exposure levels, except three products which showed higher level of lead than oral permitted daily exposure levels. Hence the raw materials used in manufacturing of these medicinal agents might be responsible for the presence of higher level of lead. PMID:27168689

  1. Lead, cadmium and nickel contents of some medicinal agents

    Directory of Open Access Journals (Sweden)

    Fazilatun Nessa


    Full Text Available Thirty nine brands of pharmaceutical dosage forms (28 tablets, 4 syrups, 6 suspensions and one chewing gum that are available in United Arab Emirates pharmaceutical markets were investigated for the presence of three heavy metals; lead, cadmium and nickel. Amongst the samples, 13 products were manufactured locally in United Arab Emirates and 26 products were imported from around the world. The samples were prepared by acid digestion procedure and the resultant solutions were analyzed for heavy metals by using a validated graphite furnace atomic absorption spectrometric method. Calibration curves were achieved using different concentration of lead, nickel and cadmium ranged from 0.001 to 0.05 μg/ml. The mean recoveries of metals from the samples were 86.4 to 97%. The %relative standard deviation for the intraassay and interday precision for the metals were <5%. Amongst the 39 samples of pharmaceutical dosage form all exhibited a positive response for lead, cadmium and nickel except three products whose Ni levels were below quantification level. The products contained variable amounts of heavy metals as of 0.0017 to 11.88 μg lead; 0.0011 to 0.5559 μg cadmium and 0.0011 to 2.6428 μg nickel, respectively. Based on maximum recommended daily dose (g of these products, maximum daily ingested mass of lead was 0.0034 to 11.88 μg/d, 0.0013 to 0.56 μg/d for cadmium and 0.0011 to 2.64 μg/d for nickel, respectively. The results were compared with those of oral permitted daily exposure levels of United State Pharmacopeial National Formulary 2013. All the products were safe to consume and contained lower level of lead, cadmium and nickel than Oral Permitted Daily Exposure levels, except three products which showed higher level of lead than oral permitted daily exposure levels. Hence the raw materials used in manufacturing of these medicinal agents might be responsible for the presence of higher level of lead.

  2. Radiation and cadmium induced histological alteration in the mice liver

    International Nuclear Information System (INIS)

    Healthy male Swiss albino mice (6-8 weeks old) were procured from CCS Agricultural University, Hissar and maintained at 20-25 degree celcius. The animals were housed in polypropylene cages and maintained on balanced mice feed and tap water ad libitum. Cobalt gamma radiotherapy source (Thearton, Canada) was used to irradiate the animals.The animals were irradiated at the dose rate of 0.97 Gy/Min. The aqueous solution of cadmium chloride (20 ppm) was administered orally in drinking water. For the purpose the animals were divided into the following groups. Group-I included sham irradiated animals and served as normal.The animal of Group-II were treated with cadmium chloride through out the experiment. The mice of group-Ill were irradiated with 1.25, 2.5 and 5.0 Gy of gamma rays. The animals of group-IV were treated with cadmium chloride and also exposed to 1.25, 2.5 and 5.0 Gy of gamma rays. Five animals were autopsied by cervical dislocation from every set of experiment and each post treatment interval of 1, 2, 4, 7, 14 and 28 days. The weight of animals was recorded. For histopathological studies pieces of liver were fixed in Bouins fixative for 24 hrs. The tissues were washed in water to remove excess of the fixative, dehydrated in graded series of alcohol, cleared in xylene and embedded in paraffin wax. Section were cut at 5 micrometer and stained in Harris heametoxylene and alcoholic eosin. The histopathological changes included cytoplasmic degranulation, vaculation, pycnotic nuclei, giant cells, binucleated cells and enucleation. Hyperaemia and leucocytic infilteration were also noticed. The changes were more marked on day 7 but on day 14 the sign of recovery were observed and on day 28 comparatively better hepatic architecture were observed. The synergistic additive changes were seen in the liver after the combined treatment of gamma radiation and cadmium chloride. From present finding it could de deduced that the liver of Swiss albino mice suffered with

  3. Cadmium- and mercury-resistant Bacillus strains from a salt marsh and from Boston Harbor.


    Mahler, I; Levinson, H. S.; Wang, Y.; Halvorson, H O


    Bacteria resistant to cadmium or mercury or both were isolated from the Great Sippewissett Marsh (Cape Cod, Mass.) and from Boston Harbor. Many of these metal-resistant isolates were gram-positive aerobic sporeformers, although not necessarily isolated as spores. Although several of the isolated strains bore plasmids, cadmium and mercury resistances appeared to be, for the most part, chromosomally encoded. DNA sequence homology of the gram-positive cadmium- and mercury-resistant isolates was ...

  4. Spectrophotometric determination of trace amount of cadmium with iodide and methyl violet

    International Nuclear Information System (INIS)

    A selective spectrophotometric method based on the interaction of an anionic iodo complex of cadmium with methyl violet has been described for the determination of trace amounts of cadmium. The developed method is precise, accurate and has been applied to determination of cadmium at trace levels (25 ppb) in sea water and high purity sample of indium and zinc materials. (author). 10 refs., 2 tabs

  5. Chronic cadmium treatment promotes oxidative stress and endothelial damage in isolated rat aorta.

    Directory of Open Access Journals (Sweden)

    Camila C P Almenara

    Full Text Available Cadmium is a highly toxic metal that is present in phosphate fertilizers, and the incidence of cadmium poisoning in the general population has increased, mainly due to cigarette smoking. Once absorbed, cadmium accumulates in the tissues, causing harmful effects including high blood pressure, endothelial damage and oxidative stress. Oxidative stress is known to efficiently produce oxidized low-density lipoprotein and consequently atherosclerosis, mainly in the aorta. However, the mechanisms through which endothelial damage is induced by cadmium have not been elucidated. Thus, the aim of this study was to investigate the effects of this metal in the isolated aorta and the possible role of oxidative stress. Rats received 100 mg.L(-1 cadmium chloride (CdCl2 in the drinking water or distilled water alone for four weeks. The pressor effect of cadmium was followed throughout the exposure period by tail plethysmography. At the end of the fourth week, the blood cadmium content was established, and the vascular reactivity of the isolated aorta to phenylephrine, acetylcholine and sodium nitroprusside was analyzed in the context of endothelium denudation and incubation with L-NAME, apocynin, losartan, enalapril, superoxide dismutase (SOD or catalase. We observed an increased response to phenylephrine in cadmium-treated rats. This increase was abolished by catalase and SOD incubation. Apocynin treatment reduced the phenylephrine response in both treatment groups, but its effect was greater in cadmium-treated rats, and NOX2 expression was greater in the cadmium group. These results suggested that cadmium in blood concentrations similar to those found in occupationally exposed populations is able to stimulate NOX2 expression, contributing to oxidative stress and reducing NO bioavailability, despite enhanced eNOS expression. These findings suggest that cadmium exposure promotes endothelial damage that might contribute to inflammation, vascular injury and the

  6. Determination of cadmium in water samples by co-precipitation and neutron activation analysis

    International Nuclear Information System (INIS)

    For the determination of cadmium in sea water, a neutron activation analysis method involving a preconcentration step has been developed. Preconcentration is achieved by co-precipitation of cadmium dibenzyldithiocarbamate with phenolphthalein. The precipitate is collected on 0.45 μm membrane filters and cadmium is determined by instrumental neutron activation analysis. A 115mCd radio tracer was used to establish optimum conditions and to evaluate the chemical yield. (author) 14 refs.; 1 fig. ; 2 tabs



    Ceci, E.; G. de Candia; E. Bonerba


    Cadmium concentrations has been evaluated in Octopus vulgaris sampled from two sites of Apulian coast (South Italy) and compared with import cephalopods to estimate if maximum levels of cadmium established for these organisms by the European Commission were exceed. In all local samples mean cadmium concentrations were higher in hepatopancreas than in flesh, this is an important evaluation if consider the traditional and unusual consumption in certain population of Mediterranean region of raw ...

  8. Cephalopods as a key of the transfer of cadmium to top marine predators


    Bustamante, Paco; Caurant, Florence; Fowler, Scott; Miramand, Pierre


    International audience Cephalopods of 11 species differing in their geographic distribution (French , Irish and faroese waters) and feeding habitats, were analysed for their cadmium contents. When comparing the cadmium levels of these cephalopods, it show that the squid Todarodes sagittatus and the octopus Eledone cirrhosa coming from the Faroe Islands contain respectively 17 and 18 times more than the animals from the French Atlantic coast. High cadmium levels in cephalopods from sub-pola...

  9. Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression*


    Cui, Yuxia; Freedman, Jonathan H.


    The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, β,β-carotene 15,15′-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1–6 cells. In C. eleg...

  10. Dietary Cadmium Intake and the Risk of Cancer: A Meta-Analysis


    Young Ae Cho; Jeongseon Kim; Hae Dong Woo; Moonsu Kang


    BACKGROUND: Diet is a major source of cadmium intake among the non-smoking general population. Recent studies have determined that cadmium exposure may produce adverse health effects at lower exposure levels than previously predicted. We conducted a meta-analysis to combine and analyze the results of previous studies that have investigated the association of dietary cadmium intake and cancer risk. METHODS: We searched PubMed, EMBASE, and MEDLINE database for case-control and cohort studies th...



    Hussien Ali NAJI; Mohammad Mushgil ZENAD


    Cadmium (Cd) is a heavy toxic metal, with harmful effects on animals and public health. Recently the risk of cadmium toxicity is substantially regarded; the environmental pollution is increased due to multi- uses of this element in various industries. This study was performed to clarify the effects of acute cadmium toxicity in sheep with trail of using alpha lipoic acid as an antioxidant therapeutic substance. Fifteen male lambs aged from 5-to-7 months were divided equally in to three groups,...

  12. Activation of Methanogenesis by Cadmium in the Marine Archaeon Methanosarcina acetivorans


    Elizabeth Lira-Silva; M Geovanni Santiago-Martínez; Viridiana Hernández-Juárez; Rodolfo García-Contreras; Rafael Moreno-Sánchez; Ricardo Jasso-Chávez


    Methanosarcina acetivorans was cultured in the presence of CdCl(2) to determine the metal effect on cell growth and biogas production. With methanol as substrate, cell growth and methane synthesis were not altered by cadmium, whereas with acetate, cadmium slightly increased both, growth and methane rate synthesis. In cultures metabolically active, incubations for short-term (minutes) with 10 µM total cadmium increased the methanogenesis rate by 6 and 9 folds in methanol- and acetate-grown cel...

  13. Low cadmium (LCD), a novel gene related to cadmium tolerance and accumulation in rice. (United States)

    Shimo, Hugo; Ishimaru, Yasuhiro; An, Gynheung; Yamakawa, Takashi; Nakanishi, Hiromi; Nishizawa, Naoko K


    The contamination of food crops by cadmium (Cd) is a major concern in food production because it can reduce crop yields and threaten human health. In this study, knockout rice plants (Oryza sativa) tagged with the gene trap vector pGA2707 were screened for Cd tolerance, and the tolerant line lcd was obtained. The lcd mutant showed tolerance to Cd on agar plates and in hydroponic culture during early plant development. Metal concentration measurements in hydroponically grown plants revealed significantly less Cd in the shoots of lcd plants compared with wild-type (WT) shoots. When cultured in the field in soil artificially contaminated with low levels of Cd, lcd showed no significant difference in the Cd content of its leaf blades; however, the Cd concentration in the grains was 55% lower in 2009 and 43% lower in 2010. There were no significant differences in plant dry weight or seed yield between lcd and wild-type plants. LCD, a novel gene, is not homologous to any other known gene. LCD localized to the cytoplasm and nucleus, and was expressed mainly in the vascular tissues in the roots and phloem companion cells in the leaves. These data indicate that lcd may be useful for understanding Cd transport mechanisms and is a promising candidate rice line for use in combating the threat of Cd to human health.

  14. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum (United States)

    Wei, Rongfei; Guo, Qingjun; Wen, Hanjie; Liu, Congqiang; Yang, Junxing; Peters, Marc; Hu, Jian; Zhu, Guangxu; Zhang, Hanzhi; Tian, Liyan; Han, Xiaokun; Ma, Jie; Zhu, Chuanwei; Wan, Yingxin


    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively coupled plasma mass spectrometry (MC-ICPMS). The mass balance of Cd isotope yields isotope fractionations between plant and Cd source (δ114/110Cdorgans-solution) of −0.70‰ to −0.22‰ in Ricinus communis and −0.51‰ to −0.33‰ in Solanum nigrum. Moreover, Cd isotope fractionation during Cd transport from stem to leaf differs between the Cd-tolerant and -hyperaccumulator species. Based on these results, the processes (diffusion, adsorption, uptake or complexation), which may induce Cd isotope fractionation in plants, have been discussed. Overall, the present study indicates potential applications of Cd isotopes for investigating plant physiology. PMID:27076359

  15. Role of dissolved and particulate cadmium in the accumulation of cadmium in cultured oysters (Crassostrea gigas)

    Energy Technology Data Exchange (ETDEWEB)

    Lekhi, Priyanka [Department of Chemistry, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)], E-mail:; Cassis, D. [Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Pearce, C.M. [Pacific Biological Station, Fisheries and Oceans Canada, Nanaimo, BC V9T 6N7 (Canada); Ebell, N. [Odyssey Shellfish Ltd., Nanoose Bay, BC V0R 9G0 (Canada); Maldonado, M.T. [Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Orians, K.J. [Department of Chemistry, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)


    Pacific oysters (Crassostrea gigas) collected on the coast of British Columbia, Canada have occasionally shown cadmium (Cd) concentrations at or above 2 {mu}g g{sup -1} (wet weight), which has resulted in the loss of some international markets. This study investigated the source and transfer of Cd to oysters by focusing on the role of dissolved and particulate Cd in seawater. Parameters monitored for 1 year at two oyster farm sites on Vancouver Island included: oyster tissue mass and shell length, Cd in oysters, dissolved Cd, particulate Cd, temperature and salinity. Results show that dissolved Cd was the main source of Cd to the oysters and that Cd was mainly concentrated in the gut tissues. A seasonal trend was observed in Cd in oysters, in which levels were lowest during periods of higher temperatures. Results also indicate that the local oceanographic inputs and sediment diagenesis directly affect dissolved Cd and thereby influence the Cd levels in oysters. Particulate matter was not found to be a source of Cd in oysters, and was actually negatively correlated. This was likely due to the uptake of dissolved Cd by phytoplankton and the effect of phytoplankton on oyster tissue mass.

  16. Curcumin Protects against Cadmium-Induced Vascular Dysfunction, Hypertension and Tissue Cadmium Accumulation in Mice

    Directory of Open Access Journals (Sweden)

    Upa Kukongviriyapan


    Full Text Available Curcumin from turmeric is commonly used worldwide as a spice and has been demonstrated to possess various biological activities. This study investigated the protective effect of curcumin on a mouse model of cadmium (Cd—induced hypertension, vascular dysfunction and oxidative stress. Male ICR mice were exposed to Cd (100 mg/L in drinking water for eight weeks. Curcumin (50 or 100 mg/kg was intragastrically administered in mice every other day concurrently with Cd. Cd induced hypertension and impaired vascular responses to phenylephrine, acetylcholine and sodium nitroprusside. Curcumin reduced the toxic effects of Cd and protected vascular dysfunction by increasing vascular responsiveness and normalizing the blood pressure levels. The vascular protective effect of curcumin in Cd exposed mice is associated with up-regulation of endothelial nitric oxide synthase (eNOS protein, restoration of glutathione redox ratio and alleviation of oxidative stress as indicated by decreasing superoxide production in the aortic tissues and reducing plasma malondialdehyde, plasma protein carbonyls, and urinary nitrate/nitrite levels. Curcumin also decreased Cd accumulation in the blood and various organs of Cd-intoxicated mice. These findings suggest that curcumin, due to its antioxidant and chelating properties, is a promising protective agent against hypertension and vascular dysfunction induced by Cd.

  17. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum (United States)

    Wei, Rongfei; Guo, Qingjun; Wen, Hanjie; Liu, Congqiang; Yang, Junxing; Peters, Marc; Hu, Jian; Zhu, Guangxu; Zhang, Hanzhi; Tian, Liyan; Han, Xiaokun; Ma, Jie; Zhu, Chuanwei; Wan, Yingxin


    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively coupled plasma mass spectrometry (MC-ICPMS). The mass balance of Cd isotope yields isotope fractionations between plant and Cd source (δ114/110Cdorgans-solution) of ‑0.70‰ to ‑0.22‰ in Ricinus communis and ‑0.51‰ to ‑0.33‰ in Solanum nigrum. Moreover, Cd isotope fractionation during Cd transport from stem to leaf differs between the Cd-tolerant and -hyperaccumulator species. Based on these results, the processes (diffusion, adsorption, uptake or complexation), which may induce Cd isotope fractionation in plants, have been discussed. Overall, the present study indicates potential applications of Cd isotopes for investigating plant physiology.

  18. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum (United States)

    Wei, Rongfei; Guo, Qingjun; Wen, Hanjie; Liu, Congqiang; Yang, Junxing; Peters, Marc; Hu, Jian; Zhu, Guangxu; Zhang, Hanzhi; Tian, Liyan; Han, Xiaokun; Ma, Jie; Zhu, Chuanwei; Wan, Yingxin


    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively coupled plasma mass spectrometry (MC-ICPMS). The mass balance of Cd isotope yields isotope fractionations between plant and Cd source (δ114/110Cdorgans-solution) of -0.70‰ to -0.22‰ in Ricinus communis and -0.51‰ to -0.33‰ in Solanum nigrum. Moreover, Cd isotope fractionation during Cd transport from stem to leaf differs between the Cd-tolerant and -hyperaccumulator species. Based on these results, the processes (diffusion, adsorption, uptake or complexation), which may induce Cd isotope fractionation in plants, have been discussed. Overall, the present study indicates potential applications of Cd isotopes for investigating plant physiology.

  19. Phytoremediation of cadmium by the facultative halophyte plant Bolboschoenus maritimus (L.) Palla, at different salinities. (United States)

    Santos, Márcia S S; Pedro, Carmen A; Gonçalves, Sílvia C; Ferreira, Susana M F


    The cadmium phytoremediation capacity of the halophyte plant Bolboschoenus maritimus (L.) Palla and the influence of water salinity were assessed in a greenhouse experiment, in order to better understand the bioremediation capacity of this plant. Three concentrations of cadmium (0, 50 and 100 μg l(-1)) and four salinity conditions (0, 5, 10 and 20) were chosen to evaluate the cadmium accumulation, in order to test these plants as a potential phytoremediation tool in brackish environments. The cadmium content in water and plants (underground organs, stems and leaves) was analysed with graphite furnace atomic absorption spectrometry. All the plants submitted to salinity 20 and in the three cadmium treatments died. The plants' survival was highest in the lowest salinities, where highest growth and biomasses were also obtained. The plants presented more cadmium content in the rhizomes, followed by stems and even less in leaves. The salt stress of the plants interfered with their cadmium accumulation capacity. The highest cadmium accumulation in the rhizomes occurred at salinity 0, while the salinities 0 and 5 were the most adequate for stems and leaves. The experiment pointed out that B. maritimus represents a good possible intervenient for cadmium bioremediation in freshwater and low salinity brackish water environments, but its use is limited in the habitats of higher salinity.

  20. Cadmium Increases the Sensitivity of Adolescent Female Mice to Nicotine-Related Behavioral Deficits

    Directory of Open Access Journals (Sweden)

    Philip Adeyemi Adeniyi


    Full Text Available This study investigates spatial and nonspatial working memory, anxiety related behavior, and motor activities in cadmium and/or nicotine exposed female adolescent mice. P28 female adolescent mice (albino strain were divided into four groups of five (n=5 mice each. A set of mice (Nic received subcutaneous nicotine (2.0 mg/kg while a separate set (Cd was treated with 2.0 mg/kg cadmium (subcutaneous. For the combined treatments of cadmium and nicotine, we administered 2.0 mg/kg Nicotine and 2.0 mg/kg of Cd. Subsequently, a separate group of animals (n=5; control received normal saline. The total duration of treatment for all groups was 28 days (P28–P56. At P56, the treatment was discontinued, after which the animals were examined in behavioural tests. Nicotine and cadmium increased the metabolism and food intake in the female adolescent mice. This also corresponded to an increase in weight when compared with the control. However, a combined nicotine-cadmium treatment induced a decline in weight of the animals versus the control. Also, nicotine administration increased the motor function, while cadmium and nicotine-cadmium treatment caused a decline in motor activity. Both nicotine and cadmium induced a reduction in memory index; however, nicotine-cadmium treatment induced the most significant decrease in nonspatial working memory.

  1. Cadmium and lead in vegetable and fruit produce selected from specific regional areas of the UK

    Energy Technology Data Exchange (ETDEWEB)

    Norton, Gareth J., E-mail: [School of Biological and Environmental Sciences, University of Aberdeen, Cruickshank Building, St Machar Drive, Aberdeen AB24 3UU (United Kingdom); Deacon, Claire M. [School of Biological and Environmental Sciences, University of Aberdeen, Cruickshank Building, St Machar Drive, Aberdeen AB24 3UU (United Kingdom); Mestrot, Adrien [Soil Science Group, Institute of Geography, Universität Bern, Hallerstrasse 12, 3012 Bern (Switzerland); Feldmann, Joerg [Department of Chemistry, School of Physical Sciences, University of Aberdeen, Meston Building, AB24 3UE (United Kingdom); Jenkins, Paul; Baskaran, Christina [Food Standards Agency, Aviation House, Kingsway, London WC2B 6NH (United Kingdom); Meharg, Andrew A. [Institute for Global Food Security, Queen' s University Belfast, David Keir Building, Malone Road, Belfast BT9 5BN (United Kingdom)


    Cadmium and lead were determined in fruit and vegetable produce (~ 1300 samples) collected from a field and market basket study of locally grown produce from the South-West of Britain (Devon and Cornwall). These were compared with similarly locally grown produce from the North-East of Britain (Aberdeenshire). The concentrations of cadmium and lead in the market basket produce were compared to the maximum levels (ML) set by the European Union (EU). For cadmium 0.2% of the samples exceeded the ML, and 0.6% of the samples exceeded the ML for lead. The location of cadmium and lead in potatoes was performed using laser ablation ICP-MS. All tested samples exhibited higher lead concentrations, and most exhibited increased concentrations of cadmium in the potato skin compared to the flesh. The concentrations of cadmium and lead found in fruits and vegetables sampled during this study do not increase concern about risk to human health. - Highlights: • Cadmium and lead concentrations determined in fruit and vegetable produce • 0.2% of the samples exceeded guideline values for cadmium. • 0.6% of the samples exceeded guideline values for lead. • Higher concentrations of cadmium and lead were found in the skins of potatoes.

  2. Health, safety and environmental issues relating to cadmium usage in photovoltaic energy systems

    Energy Technology Data Exchange (ETDEWEB)

    Moskowitz, P.D.; Fthenakis, V.M. (Brookhaven National Lab., Upton, NY (USA)); Zweibel, K. (Solar Energy Research Inst., Golden, CO (USA))


    This paper discusses the current technology base and hazards associated with two promising thin-film photovoltaic cells that contain cadmium compounds -- cadmium telluride (CdTe) and copper indium diselenide (CuInSe{sub 2}). More specifically, this paper summarizes the toxicological information on cadmium (Cd) compounds; evaluates potential health, safety and environmental hazards associated with cadmium usage in the photovoltaics industry; describes regulatory requirements associated with the use, handling and disposal of cadmium compounds; and lists management options to permit the safe and continued use of these materials. Handling of cadmium in photovoltaic production can present hazards to health, safety and the environment. Prior recognition of these hazards can allow device manufacturers and regulators to implement appropriate and readily available hazard management strategies. Hazards associated with product use (i.e., array fires) and disposal remain controversial and partially unresolved. The most likely effects that could be expected would be those associated with chronic low-level exposures to cadmium wastes. Because of the general immobility of the cadmium present in these devices and availability of environmental and biomonitoring protocols, chronic hazards can be monitored, and remediated if necessary. Nevertheless, concern about cadmium hazards should continue to be emphasized to ensure that health, safety and environmental issues are properly managed. At the same time, the potential role that these systems can play in ameliorating some important health and environmental hazards related to other energy systems should not be ignored. 27 refs., 5 figs., 2 tabs.

  3. Prostatic cellular changes after injection of cadmium and lead into rat prostate

    Energy Technology Data Exchange (ETDEWEB)

    Khare, N.; Der, R.; Ross, G.; Fahim, M.


    Forty male rats were divided into four groups. Group I served as control. Group II received 1 mg lead injected into the prostate; Group III received 1 mg cadmium chloride; and Group IV received 0.5 mg lead acetate and 0.5 mg cadmium chloride. The lead caused stone formation in the bladder and calcification of both bladder and prostate; cadmium caused reduction in size and weight of prostate, and histological observation showed marked atrophy of the gland, cuboidal epithelium, and squamous metaplasia in the acini of the prostate; there was no synergistic effect of lead acetate and cadmium chloride when combined at the level administered to Group IV.

  4. Prostatic cellular changes after injection of cadmium and lead into rat prostate. (United States)

    Khare, N; Der, R; Ross, G; Fahim, M


    Forty male rats were divided into four groups. Group I served as control. Group II received 1 mg. lead injected into the prostate; Group III received 1 mg. cadmium chloride; and Group IV received 0.5 mg. lead acetate and 0.5 mg. cadmium chloride. Results indicated that lead caused stone formation in the bladder and calcification of both bladder and prostate; cadmium caused reduction in size and weight of prostate, and histological observation showed marked atrophy of the gland, cuboidal epithelium, and squamous metaplasia in the acini of the prostate; there was no synergistic effect of lead acetate and cadmium chloride when combined at the level administered to Group IV.

  5. Protective role of carnosine in mice with cadmium-induced acute hepatotoxicity. (United States)

    Fouad, Amr A; Qureshi, Habib A; Yacoubi, Mohamed T; Al-Melhim, Walid N


    The hepatoprotective effect of carnosine was investigated against cadmium-induced acute liver injury in mice. Hepatotoxicity was induced by a single i.p. injection of cadmium chloride (6.5mg/kg). Carnosine treatment (10mg/kg/day, i.p.) was applied for three consecutive days, starting one day before cadmium administration. Carnosine significantly decreased the cadmium-induced elevations in serum aminotransferases. Carnosine suppressed lipid peroxidation and restored the deficits in the antioxidant defense mechanisms (reduced glutathione level, and catalase and superoxide dismutase activities) in liver tissue resulted from cadmium administration. Also, the reductions in hepatic nitric oxide and zinc ion levels, and the increases in hepatic cadmium ion concentration, and myeloperoxidase and caspase-3 activities following cadmium exposure were significantly attenuated by carnosine treatment. In addition, carnosine markedly ameliorated cadmium-induced liver tissue damage as evidenced by light and electron microscopic examinations. It was concluded that carnosine can be considered a potential candidate to protect the liver against the deleterious effect of acute cadmium intoxication. PMID:19748544

  6. Cadmium and lead in vegetable and fruit produce selected from specific regional areas of the UK

    International Nuclear Information System (INIS)

    Cadmium and lead were determined in fruit and vegetable produce (~ 1300 samples) collected from a field and market basket study of locally grown produce from the South-West of Britain (Devon and Cornwall). These were compared with similarly locally grown produce from the North-East of Britain (Aberdeenshire). The concentrations of cadmium and lead in the market basket produce were compared to the maximum levels (ML) set by the European Union (EU). For cadmium 0.2% of the samples exceeded the ML, and 0.6% of the samples exceeded the ML for lead. The location of cadmium and lead in potatoes was performed using laser ablation ICP-MS. All tested samples exhibited higher lead concentrations, and most exhibited increased concentrations of cadmium in the potato skin compared to the flesh. The concentrations of cadmium and lead found in fruits and vegetables sampled during this study do not increase concern about risk to human health. - Highlights: • Cadmium and lead concentrations determined in fruit and vegetable produce • 0.2% of the samples exceeded guideline values for cadmium. • 0.6% of the samples exceeded guideline values for lead. • Higher concentrations of cadmium and lead were found in the skins of potatoes

  7. Curcumin regulates airway epithelial cell cytokine responses to the pollutant cadmium

    International Nuclear Information System (INIS)

    Highlights: ► Cadmium induces secretion of IL-6 and IL-8 by two distinct pathways. ► Cadmium increases NAPDH oxidase activity leading to Erk activation and IL-8 secretion. ► Curcumin prevents cadmium-induced secretion of both IL-6 and IL-8 by airway cells. ► Curcumin could be use to suppress lung inflammation due to cadmium inhalation. -- Abstract: Cadmium is a toxic metal present in the environment and its inhalation can lead to pulmonary disease such as lung cancer and chronic obstructive pulmonary disease. These lung diseases are characterized by chronic inflammation. Here we show that exposure of human airway epithelial cells to cadmium promotes a polarized apical secretion of IL-6 and IL-8, two pivotal pro-inflammatory cytokines known to play an important role in pulmonary inflammation. We also determined that two distinct pathways controlled secretion of these proinflammatory cytokines by human airway epithelial cells as cadmium-induced IL-6 secretion occurs via an NF-κB dependent pathway, whereas IL-8 secretion involves the Erk1/2 signaling pathway. Interestingly, the natural antioxidant curcumin could prevent both cadmium-induced IL-6 and IL-8 secretion by human airway epithelial cells. In conclusion, curcumin could be used to prevent airway inflammation due to cadmium inhalation.

  8. Effects of cadmium on aneuploidy and hemocyte parameters in the Pacific oyster, Crassostrea gigas

    International Nuclear Information System (INIS)

    Pacific oysters, Crassostrea gigas, are commonly reared in estuaries where they are exposed to anthropogenic pollution. Much research has been made on the toxicity of cadmium to aquatic organisms because the compound recurrently contaminates their environment. Our study examined the influence of cadmium on aneuploidy level (lowered chromosome number in a percentage of somatic cells) and hemocyte parameters in C. gigas at different stages of life. Adults and juveniles were exposed to two different concentrations of cadmium. The first concentration applied was equivalent to a peak value found in Marennes-Oleron bay (Charente-Maritime, France; 50 ng L-1) and the second was 10 times higher (500 ng L-1). Exposure to 50 ng L-1 cadmium caused a significant decrease in the survival time of C. gigas, but exposure to 500 ng L-1 surprisingly affected the survival time positively. Significant differences in aneuploidy level were observed between the cadmium treatments and the control in adults but not in juveniles or the offspring of the adult groups. The effects of cadmium on hemocyte parameters were analyzed by flow cytometry. Several hemocyte parameters increased significantly after 21 days of cadmium exposure and subsequently decreased. Phenoloxidase-like activity, evaluated by spectrophotometry, varied over the time of the experiment and increased after 66 days of contact with 500 ng L-1 cadmium. Taken together, cadmium at environmentally relevant concentrations seems to have only moderate effects on aneuploidy and hemocyte parameters

  9. Effects of cadmium on aneuploidy and hemocyte parameters in the Pacific oyster, Crassostrea gigas

    Energy Technology Data Exchange (ETDEWEB)

    Bouilly, Karine [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Gagnaire, Beatrice [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Bonnard, Marc [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Thomas-Guyon, Helene [Laboratoire de Biologie et Environnement Marins, FRE-CNRS, 2727, Universite de La Rochelle, 22 Avenue Michel Crepeau, La Rochelle 17042 (France); Renault, Tristan [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France); Miramand, Pierre [Laboratoire de Biologie et Environnement Marins, FRE-CNRS, 2727, Universite de La Rochelle, 22 Avenue Michel Crepeau, La Rochelle 17042 (France); Lapegue, Sylvie [IFREMER, Laboratoire de Genetique et Pathologie, La Tremblade 17390 (France)]. E-mail:


    Pacific oysters, Crassostrea gigas, are commonly reared in estuaries where they are exposed to anthropogenic pollution. Much research has been made on the toxicity of cadmium to aquatic organisms because the compound recurrently contaminates their environment. Our study examined the influence of cadmium on aneuploidy level (lowered chromosome number in a percentage of somatic cells) and hemocyte parameters in C. gigas at different stages of life. Adults and juveniles were exposed to two different concentrations of cadmium. The first concentration applied was equivalent to a peak value found in Marennes-Oleron bay (Charente-Maritime, France; 50 ng L{sup -1}) and the second was 10 times higher (500 ng L{sup -1}). Exposure to 50 ng L{sup -1} cadmium caused a significant decrease in the survival time of C. gigas, but exposure to 500 ng L{sup -1} surprisingly affected the survival time positively. Significant differences in aneuploidy level were observed between the cadmium treatments and the control in adults but not in juveniles or the offspring of the adult groups. The effects of cadmium on hemocyte parameters were analyzed by flow cytometry. Several hemocyte parameters increased significantly after 21 days of cadmium exposure and subsequently decreased. Phenoloxidase-like activity, evaluated by spectrophotometry, varied over the time of the experiment and increased after 66 days of contact with 500 ng L{sup -1} cadmium. Taken together, cadmium at environmentally relevant concentrations seems to have only moderate effects on aneuploidy and hemocyte parameters.

  10. Heterologously expressed bacterial and human multidrug resistance proteins confer cadmium resistance to Escherichia coli


    Achard-Joris, M; van Saparoea, HBV; Driessen, AJM; Bourdineaud, JP; Bourdineaud, Jean-Paul


    The human MDR1 gene is induced by cadmium exposure although no resistance to this metal is observed in human cells overexpressing hMDR1. To access the role of MDR proteins in cadmium resistance, human MDR1, Lactococcus lactis lmrA, and Oenococcus oeni omrA were expressed in an Escherichia coli tolC mutant strain which proved to be hypersensitive to cadmium. Both the human and bacterial MDR genes conferred cadmium resistance to E. coli up to 0.4 mM concentration. Protection was abolished by 10...

  11. Curcumin regulates airway epithelial cell cytokine responses to the pollutant cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Rennolds, Jessica; Malireddy, Smitha; Hassan, Fatemat; Tridandapani, Susheela; Parinandi, Narasimham [Division of Pulmonary, Allergy, Critical Care and Sleep Medicine, The Ohio State University, Columbus, OH 43210 (United States); Boyaka, Prosper N. [Department of Veterinary Biosciences, The Ohio State University, Columbus, OH 43210 (United States); Cormet-Boyaka, Estelle, E-mail: [Division of Pulmonary, Allergy, Critical Care and Sleep Medicine, The Ohio State University, Columbus, OH 43210 (United States)


    Highlights: Black-Right-Pointing-Pointer Cadmium induces secretion of IL-6 and IL-8 by two distinct pathways. Black-Right-Pointing-Pointer Cadmium increases NAPDH oxidase activity leading to Erk activation and IL-8 secretion. Black-Right-Pointing-Pointer Curcumin prevents cadmium-induced secretion of both IL-6 and IL-8 by airway cells. Black-Right-Pointing-Pointer Curcumin could be use to suppress lung inflammation due to cadmium inhalation. -- Abstract: Cadmium is a toxic metal present in the environment and its inhalation can lead to pulmonary disease such as lung cancer and chronic obstructive pulmonary disease. These lung diseases are characterized by chronic inflammation. Here we show that exposure of human airway epithelial cells to cadmium promotes a polarized apical secretion of IL-6 and IL-8, two pivotal pro-inflammatory cytokines known to play an important role in pulmonary inflammation. We also determined that two distinct pathways controlled secretion of these proinflammatory cytokines by human airway epithelial cells as cadmium-induced IL-6 secretion occurs via an NF-{kappa}B dependent pathway, whereas IL-8 secretion involves the Erk1/2 signaling pathway. Interestingly, the natural antioxidant curcumin could prevent both cadmium-induced IL-6 and IL-8 secretion by human airway epithelial cells. In conclusion, curcumin could be used to prevent airway inflammation due to cadmium inhalation.

  12. Different effects of sodium chloride preincubation on cadmium tolerance of Pichia kudriavzevii and Saccharomyces cerevisiae. (United States)

    Ma, Ning; Li, Chunsheng; Dong, Xiaoyan; Wang, Dongfeng; Xu, Ying


    Application of growing microorganisms for cadmium removal is restricted by high cadmium toxicity. The effects of sodium chloride (NaCl) preincubation on the cadmium tolerance and removal ability of Pichia kudriavzevii and Saccharomyces cerevisiae were investigated in this study. NaCl preincubation improved the biomass of P. kudriavzevii under cadmium stress, while no obvious effect was observed in S. cerevisiae. The improved activities of peroxidase (POD) and catalase (CAT) after NaCl preincubation might be an important reason for the decrease of the reactive oxygen species (ROS) accumulation, cell death, and oxidative damage of proteins and lipids induced by cadmium, contributing to the improvement of the yeast growth. The cadmium bioaccumulation capacity of P. kudriavzevii decreased significantly after NaCl preincubation, which played an important role in mitigating the cadmium toxicity to the yeast. The cadmium removal rate of P. kudriavzevii was obviously higher than S. cerevisiae and was significantly enhanced after NaCl preincubation. The results suggested that NaCl preincubation improved the cadmium tolerance and removal ability of P. kudriavzevii. PMID:25721585


    Directory of Open Access Journals (Sweden)

    Z. O. Lipatova


    Full Text Available Cadmium sulfide quantum dots are perspective materials in optics, medicine, biology and optoelectronics. Fluorophosphate glasses, doped with cadmium sulfide quantum dots, were examined in the paper. Heat treatment led to the formation of quantum dots with diameters equal to 2.8 nm, 3.0 nm and 3.8 nm. In view of such changes in the quantum dots size the fundamental absorption edge shift and the luminescence band are being displaced to the long wavelengths. Luminescence lifetime has been found to be dependent on the registration wavelength in the range from 450 to 700 nm. Obtained fluorophosphate glasses with CdS quantum dots can find their application as fluorescent materials with intensive luminescence band and long excited-state natural lifetime.

  14. Remote sensing applications in evaluation of cadmium pollution effects (United States)

    Kozma-Bognar, Veronika; Martin, Gizella; Berke, Jozsef


    According to the 21st century developments in information technology the remote sensing applications open new perspectives to the data collection of our environment. Using the images in different spectral bands we get more reliable and accurate information about the condition, process and phenomena of the earth surface compared to the traditional aircraft image technologies (RGB images). The effects of particulate pollution originated from road traffic were analysed by the research team of Department of Meteorology and Water Management (University of Pannonia, Georgikon Faculty) with the application of visible, near infrared and thermal infrared remote sensing aircraft images. In the scope of our research was to detect and monitor the effects of heavy metal contamination in plant-atmosphere system under field experiments. The testing area was situated at Agro-meteorological Research Station in Keszthely (Hungary), where maize crops were polluted once a week (0,5 M concentration) by cadmium. In our study we simulated the effects of cadmium pollution because this element is one of the most common toxic heavy metals in our environment. During two growing seasons (2011, 2012) time-series analyses were carried out based on the remote sensing data and parallel collected variables of field measurement. In each phenological phases of plant we took aerial images, in order to follow the changes of the structure and intensity values of plots images. The spatial resolution of these images were under 10x10 cm, which allowed to use a plot-level evaluation. The structural and intensity based measurement evaluation methods were applied to examine cadmium polluted and control maize canopy after data pre-processing. Research activities also focused on the examination of the influence of the irrigation and the comparison of aerial and terrain parameters. As conclusion, it could be determined the quantification of cadmium pollution effects is possible on maize plants by using remote

  15. Persistent neurotoxicity from a battery fire: is cadmium the culprit? (United States)

    Kilburn, K H; McKinley, K L


    Two train conductors had chest tightness, painful breathing, muscle cramps, and nausea after fighting a fire in a battery box under a passenger coach. Shortly thereafter, they became anosmic and had excessive fatigue, persistent headaches, sleep disturbances, irritability, unstable moods, and hypertension. Urinary cadmium and nickel levels were elevated. Neurobehavioral testing showed, in comparison to referents, prolonged reaction times, abnormal balance, prolonged blink reflex latency, severely constricted visual fields, and decreased vibration sense. Test scores showed that immediate verbal and visual recall were normal but delayed recall was reduced. Scores on overlearned information were normal. Tests measuring dexterity, coordination, decision making, and peripheral sensation and discrimination revealed abnormalities. Repeat testing 6 and 12 months after exposure showed persistent abnormalities. Cadmium and vinyl chloride are the most plausible causes of the neurotoxicity, but fumes from the fire may have contained other neurotoxic chemicals.

  16. Purification of cadmium up to 5N+ by vacuum distillation

    Indian Academy of Sciences (India)

    S T Ali; J V Rao; K S Varma; T L Prakash


    Cadmium was refined by vacuum distillation, a technique suitable for low boiling and melting point materials, to remove the heavy and low vapour pressure impurities at ppm level. The detailed analysis of the purified Cd as well as raw Cd was done by ICP–OES techniques for 27 impurity elements. Purification was carried out in an efficient high-yield vacuum distillation system designed and fabricated for purifying 3N+ purity indigenous cadmium to 5N+ (99.999%). Analysis confirmed the reduction of total impurity content from 134 ppm (3N7) for raw Cd to 3 ppm (5N7) upon vacuum distilled Cd. The present study shows that the analysis of impurities such as Fe, Mg and Ca are contributed from environmental effect, whereas impurities such as Pb, Bi, Ag, Ni, Cu, Zn and Tl require adaptation of elemental analysing technique to counter dilution effect. The Hg trace analysis can however be carried out by hydride generation techniques.

  17. Synthesis and Structure of Bis(4-nitrobenzaldehyde thiosemicarbazone) Cadmium Iodide

    Institute of Scientific and Technical Information of China (English)


    The title complex, bis(4-nitrobenzaldehyde thiosemicarbazone) cadmium iodide (C16H16CdI2N8O4S2) crystallizes in the triclinic system, space group P1 with a=9.632(2), b=11.227(2), c=14.031(3), α= 67.50(3), β= 86.99(3), γ= 66.64(3)°, V=1278.13, Z = 2, Dc = 2.117gcm-3, F(000) = 772, μ =3.472mm-1 MoKα radiation (λ=0.71073), R = 0.0443, wR= 0.1425 for 4529 observed reflections [I>2σ(I)] of 4731 independent reflections. The result shows that the structure contains CdL2I2 (where L = 4-nitrobenzaldehyde thiosemicarbazone) distorted tetrahedral units in which the two ligands are S-bonded as monodentate to cadmium ion; the two iodide ions are also coordinated to Cd(II).

  18. Microbially Mediated-Precipitation of Cadmium Carbonate Nanoparticles. (United States)

    Kang, Serku; Kim, Yumi; Lee, Youngjae; Rohl, Yul


    The objectives of this study were to investigate the microbially mediated precipitation of cadmium using microorganisms enriched from rhodoliths and to characterize the mineralogical properties of the precipitates. A 16S rRNA sequence analysis showed the enriched microorganisms contained carbonate forming microorganisms such as Proteus mirabilis. The microorganisms mediated Cd-precipitation with Cd-acetate, but no precipitates were formed without the microbes in D-1 medium. XRD analysis showed the precipitates were poorly crystalline Cd-carbonates (CdCO3). SEM and TEM-EDS analyses showed that the Cd-carbonate minerals were irregular in shape, 20-30 nm in size, and composed of C, O, and Cd. Therefore, microbially mediated precipitation of cadmium carbonates could be used as a precursor of CdO nanoparticles and could play an important role in Cd immobilization in Cd-contaminated water as well as CO2 fixation in natural environments.

  19. The Cadmium Zinc Telluride Imager on AstroSat

    CERN Document Server

    Bhalerao, V; Vibhute, A; Pawar, P; Rao, A R; Hingar, M K; Khanna, Rakesh; Kutty, A P K; Malkar, J P; Patil, M H; Arora, Y K; Sinha, S; Priya, P; Samuel, Essy; Sreekumar, S; Vinod, P; Mithun, N P S; Vadawale, S V; Vagshette, N; Navalgund, K H; Sarma, K S; Pandiyan, R; Seetha, S; Subbarao, K


    The Cadmium Zinc Telluride Imager (CZTI) is a high energy, wide-field imaging instrument on AstroSat. CZT's namesake Cadmium Zinc Telluride detectors cover an energy range from 20 keV to > 200 keV, with 11% energy resolution at 60 keV. The coded aperture mask attains an angular resolution of 17' over a 4.6 deg x 4.6 deg (FWHM) field of view. CZTI functions as an open detector above 100 keV, continuously sensitive to GRBs and other transients in about 30% of the sky. The pixellated detectors are sensitive to polarisation above ~100 keV, with exciting possibilities for polarisation studies of transients and bright persistent sources. In this paper, we provide details of the complete CZTI instrument, detectors, coded aperture mask, mechanical and electronic configuration, as well as data and products.

  20. Cisto linfoepitelial oral: relato de quatro casos e revisão de 119 casos apresentados na literatura Oral lymphoepithelial cyst: report of 4 cases and review of 119 cases reported in the literature

    Directory of Open Access Journals (Sweden)

    Luiz Eduardo Rodrigues Juliasse


    Full Text Available INTRODUÇÃO: O cisto linfoepitelial oral é uma lesão incomum, assintomática e de pequenas dimensões, geralmente descoberto durante exames de rotina da cavidade bucal. OBJETIVO: Relatar quatro casos de cisto linfoepitelial oral, confrontando seus aspectos com aqueles reportados em outros 119 casos publicados na literatura. RELATO DOS CASOS: Três casos em mulheres, com idade entre 16 e 23 anos, e um caso em homem, com 45 anos, caracterizados por nódulos assintomáticos, de pequenas dimensões e coloração variando do branco ao amarelado. Dois casos estavam localizados na superfície ventral da língua, um em assoalho bucal e outro em orofaringe. Histologicamente, as lesões revelaram cavidade cística contendo quantidade variável de células epiteliais descamadas, revestida por epitélio pavimentoso estratificado, predominantemente paraceratinizado, de interface plana com o tecido conjuntivo. A cápsula fibrosa exibiu um denso infiltrado linfocítico, com identificação de centros germinativos em apenas dois casos. CONCLUSÃO: A análise conjunta dos casos apresentados neste trabalho e de outros 119 casos relatados na literatura revela que os cistos linfoepiteliais orais exibem predileção pelo gênero masculino, com ápice de incidência na terceira década de vida. Em geral, essas lesões se apresentam como pequenos nódulos assintomáticos localizados no assoalho bucal. Histologicamente, a maioria dos casos revela epitélio cístico com padrão de maturação paraceratinizado e exibe centros germinativos na cápsula fibrosa.INTRODUCTION: The oral lymphoepithelial cyst is a rare, asymptomatic lesion with small dimensions, commonly discovered during routine examination of the oral cavity. OBJECTIVE: To report four cases of oral lymphoepithelial cyst and compare their aspects with other 119 cases reported in the literature. CASE REPORT: Three cases in women, age range 16 to 23, and one case in a 45-year-old man, all of them presenting