WorldWideScience

Sample records for cadmium 101

  1. Cadmium

    NARCIS (Netherlands)

    Meulenbelt, Jan

    2017-01-01

    Together with zinc and mercury, cadmium belongs to group IIb of the periodic table. It can be found in rocks, soil, water, coal, zinc ore, lead ore, and copper ore. In the environment, cadmium is present predominantly as the oxide or as the chloride, sulfide, or sulfate salt. It has no recognizable

  2. Cadmium Alternatives

    Science.gov (United States)

    2012-08-01

    using for commercial applications Other zinc alloys Zinc cobalt , tin zinc, zinc iron Passivation Cadmium, ZnNi, SnZn, ZnCo, ZnFe, and...for Change Cadmium passivated with hexavalent chromium has been in use for many decades Cadmium is toxic, and is classified as a priority...Executive Orders 13514 & 13423 DoD initiatives – Young memo (April 2009) DFAR restricting use of hexavalent chromium Allows the use of hexavalent

  3. Study on workers exposed to cadmium in alkaline storage battery manufacturing and PVC compounding

    Energy Technology Data Exchange (ETDEWEB)

    Chan, O.Y.; Tan, K.T.; Kwok, S.F.; Chio, L.F.

    1982-01-01

    The extent of cadmium exposure was studied in a cadmium-nickel battery factory and 8 PVC factories using cadmium stabilisers in the compounding of PVC. A total of 101 cadmium-exposed workers and 21 control subjects matched by sex, age, ethnic group and smoking history was investigated. Blood and urine cadmium levels were considerably elevated in the battery workers but were not raised in the PVC workers. These findings were consistent with the results of cadmium-in-air assessments. Among the female battery workers, urine cadmium excretion increased significantly with employment time. There was good correlation between blood and urine cadmium levels among the female subjects. A significant association between blood cadmium levels and prevalence of chest pain was also noted among the females. No low molecular weight proteinuria was detected, but two female battery workers had slight albuminuria and one male PVC worker had glucosuria but had abnormal GTT results.

  4. Cadmium sulfide membranes

    Science.gov (United States)

    Spanhel, Lubomir; Anderson, Marc A.

    1991-10-22

    A method is described for the creation of novel q-effect cadmium sulfide membranes. The membranes are made by first creating a dilute cadmium sulfide colloid in aqueous suspension and then removing the water and excess salts therefrom. The cadmium sulfide membrane thus produced is luminescent at room temperature and may have application in laser fabrication.

  5. Leadership 101

    Science.gov (United States)

    2015-12-01

    none of them aligned with each other. It seems leadership 101 is easy to identify but hard to implement. Defense AT&L: November–December 2015 18...question leadership must be able to answer and articulate is why we need those features—the benefits, if you will. Or said another way, what defense...Defense AT&L: November–December 2015 16 Leadership 101 Scott Reynolds 17 Defense AT&L: November–December 2015 Reynolds is a faculty member at the

  6. Calcium enhances cadmium tolerance and decreases cadmium ...

    African Journals Online (AJOL)

    These results suggest that cadmium uptake in lettuce plants is negatively associated with the presence of calcium in the culture medium, maybe due to a competition between these two cations for binding and absorption sites in roots. In conclusion, the results suggest that fertilization with Ca2+ appears to be a promising ...

  7. Toxicity of cadmium to grapevine

    Energy Technology Data Exchange (ETDEWEB)

    Rupp, D.; Ruehl, E.; Alleweldt, G.

    1985-01-01

    Cuttings of the cv. Riesling were cultivated in nutrient solutions with different amounts of cadmium. Cadmium inhibited the growth of shoot and of leaf area and produced chlorosis, necroses and leaf deformations. Old leaves showed no symptoms at all, but with high cadmium levels leaf fall occurred. The threshold of cadmium damage was beneath a level of 0.1 ppm Cd of the nutrient solution. The dry matter production of the plants was reduced by cadmium: 0.66 mg Cd/l of nutrient solution caused an inhibition of 50%. Cadmium reduced the chlorophyll content of the leaves. The transport of iron from roots to leaves was inhibited nearly completely by medium to high levels of cadmium (1.0, 3.0, 10.0 ppm). Iron was accumulated in the roots. Thus cadmium may have caused an iron deficiency chlorosis in grapevines. The uptake of cadmium showed a clear dependence on the amount of cadmium in the nutrient solution. Within the plants, decreasing amounts of cadmium were found following the pattern roots - stem - leaves.

  8. 29 CFR 1910.1027 - Cadmium.

    Science.gov (United States)

    2010-07-01

    ... battery Plate making, plate preparation 50 All other processes 15 Zinc/Cadmium refining* Cadmium refining... as an airborne concentration of cadmium of 2.5 micrograms per cubic meter of air (2.5 µg/m3... air cadmium level to which an employee is exposed means the exposure to airborne cadmium that would...

  9. 75 FR 74608 - Airworthiness Directives; CENTRAIR Models 101, 101A, 101P, and 101AP Gliders

    Science.gov (United States)

    2010-12-01

    ..., 101A, 101P, and 101AP Gliders AGENCY: Federal Aviation Administration (FAA), Department of... reinforced in 1984 with a modification. Gliders produced before the introduction of this modification have... modification. Gliders produced before the introduction of this modification have not been systematically...

  10. 41 CFR 101-30.101-17 - Supply support.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Supply support. 101-30.101-17 Section 101-30.101-17 Public Contracts and Property Management Federal Property Management....1-General § 101-30.101-17 Supply support. Supply support means the functions performed by the supply...

  11. Sex differences in shotgun proteome analyses for chronic oral intake of cadmium in mice.

    Directory of Open Access Journals (Sweden)

    Yoshiharu Yamanobe

    Full Text Available Environmental diseases related to cadmium exposure primarily develop owing to industrial wastewater pollution and/or contaminated food. In regions with high cadmium exposure in Japan, cadmium accumulation occurs primarily in the kidneys of individuals who are exposed to the metal. In contrast, in the itai-itai disease outbreak that occurred in the Jinzu River basin in Toyama Prefecture in Japan, cadmium primarily accumulated in the liver. On the other hand, high concentration of cadmium caused renal tubular disorder and osteomalacia (multiple bone fracture, probably resulting from the renal tubular dysfunction and additional pathology. In this study, we aimed to establish a mouse model of chronic cadmium intake. We administered cadmium-containing drinking water (32 mg/l to female and male mice ad libitum for 11 weeks. Metal analysis using inductively coupled plasma mass spectrometry revealed that cadmium accumulated in the kidneys (927 x 10 + 185 ng/g in females and 661 x 10 + 101 ng/g in males, liver (397 x 10 + 199 ng/g in females and 238 x 10 + 652 ng/g in males, and thyroid gland (293 + 93.7 ng/g in females and 129 + 72.7 ng/g in males of mice. Female mice showed higher cadmium accumulation in the kidney, liver, and thyroid gland than males did (p = 0.00345, p = 0.00213, and p = 0.0331, respectively. Shotgun proteome analyses after chronic oral administration of cadmium revealed that protein levels of glutathione S-transferase Mu2, Mu4, and Mu7 decreased in the liver, and those of A1 and A2 decreased in the kidneys in both female and male mice.

  12. Cadmium hazard in silver brazing.

    Science.gov (United States)

    Gan, S L; Tan, S H; Pinnagoda, J; Tan, K T

    1995-03-01

    This study evaluates the usage of cadmium-containing silver brazing alloys in Singapore and the potential cadmium hazard from its use. Of the 137 factories which responded to the survey questionnaire, only 28 (20.4%) carried out brazing. Of these, only 7 factories used cadmium-containing filler alloys. One hundred and six out of 123 workers from one of these factories had cadmium-in-blood concentrations exceeding 10 mcg/l. Thirty-one (29.2%) of the workers with excessive cadmium absorption had urinary beta-2 microglobulin levels exceeding 28 mcg/g creat. Workers in the other factories who were intermittently exposed had cadmium-in-blood concentrations of 10 mcg/l and below.

  13. Cadmium in Sweden - environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Parkman, H.; Iverfeldt, Aa. [Swedish Environmental Research Inst. (Sweden); Borg, H.; Lithner, G. [Stockholm Univ. (Sweden). Inst. for Applied Environmental Research

    1998-03-01

    This report aims at assessing possible effects of cadmium in the Swedish environment. Swedish soils and soft freshwater systems are, due to a generally poor buffering capacity, severely affected by acidification. In addition, the low salinity in the Baltic Sea imply a naturally poor organism structure, with some important organisms living close to their limit of physiological tolerance. Cadmium in soils is mobilized at low pH, and the availability and toxicity of cadmium in marine systems are enhanced at low salinity. The Swedish environment is therefore extra vulnerable to cadmium pollution. The average concentrations of cadmium in the forest mor layers, agricultural soils, and fresh-waters in Sweden are enhanced compared to `back-ground concentrations`, with a general increasing trend from the north to the south-west, indicating strong impact of atmospheric deposition of cadmium originating from the central parts of Europe. In Swedish sea water, total cadmium concentrations, and the fraction of bio-available `free` cadmium, generally increases with decreasing salinity. Decreased emissions of cadmium to the environment have led to decreasing atmospheric deposition during the last decade. The net accumulation of cadmium in the forest mor layer has stopped, and even started to decrease. In northern Sweden, this is due to the decreased deposition, but in southern Sweden the main reason is increased leakage of cadmium from the topsoil as a consequence of acidification. As a result, cadmium in the Swedish environments is undergoing an extended redistribution between different soil compartments, and from the soils to the aquatic systems. 90 refs, 23 figs, 2 tabs. With 3 page summary in Swedish

  14. Speciation of Dissolved Cadmium

    DEFF Research Database (Denmark)

    Holm, Peter Engelund; Andersen, Sjur; Christensen, Thomas Højlund

    1995-01-01

    Equilibrium dialysis and ion exchange methods, as well as computer calculations (GEOCHEM), were applied for speciation of dissolved cadmium (Cd) in test solutions and leachate samples. The leachate samples originated from soil, compost, landfill waste and industrial waste. The ion exchange (IE...... leachates showed different Cd speciation patterns as expected. Some leachates were dominated by free divalent Cd (1-70%), some by inorganic complexes (1-87%), and some by organic complexes (7-98%)....

  15. Cadmium in blood and hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Ki-Do; Lee, Mi-Sun [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of); Paek, Domyung [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of)], E-mail: paekdm@snu.ac.kr

    2008-12-15

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 {mu}g/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 {mu}g/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population.

  16. Cadmium exposure in the Swedish environment

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This report gives a thorough description of cadmium in the Swedish environment. It comprises three parts: Cadmium in Sweden - environmental risks;, Cadmium in goods - contribution to environmental exposure;, and Cadmium in fertilizers, soil, crops and foods - the Swedish situation. Separate abstracts have been prepared for all three parts

  17. Oral cadmium chloride intoxication in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B; Svendsen, P

    1988-01-01

    Diethyldithiocarbamate (DDC) is known to alleviate acute toxicity due to injection of cadmium salts. However, when cadmium chloride was administered by the oral route, DDC enhanced rather than alleviated the acute toxicity; both oral and intraperitoneal (i.p.) administration of DDC had this effect....... Thus, orally administered DDC enhanced cadmium-induced duodenal and ileal tissue damage and inhibition of peristalsis, as indicated by an increased intestinal transit time. At low cadmium doses, the whole-body retention of cadmium was increased by oral DDC administration. Intraperitoneally administered...... DDC increased cadmium-induced acute mortality and testicular necrosis, and it enhanced cadmium-induced reduction of intestinal motility and increased the whole-body retention of cadmium, indicating increased intestinal cadmium absorption. Also, DDC changed the organ distribution of absorbed cadmium...

  18. Cadmium immobilization by hydroxyapatite

    Directory of Open Access Journals (Sweden)

    Smičiklas Ivana D.

    2003-01-01

    Full Text Available The contamination of air, soil and water by cadmium is a great environmental problem. If cadmium occurs in nature in ionic form, soluble in water, it easily enters into the food chain. Hydroxyapatite (HAP, Ca-o(POAe(OH2 is a sparingly soluble salt and an excellent matrix for the removal of heavy metals from solutions. Considerable research attention has been paid to the bond between Cc/2+ ions and synthetic hydroxyapatite of known composition. The sorption mechanism is complex. The dominant process is ion exchange, but surface adsorption, surface complexation and coprecipitation can also contribute to the overall mechanism. The sorption capacity depends on the characteristics of hydroxyapatite itself and on the experimental conditions. Under optimum conditions a maximum capacity of 0.8 mol Cd2+/mol HAP can be achieved. HAP is a potential sorbent for the remediation of contaminated water and soil, for industrial waste treatment, and it is also referenced as a material that can be used as a barrier around waste depositories.

  19. Cadmium colours: composition and properties

    Science.gov (United States)

    Paulus, J.; Knuutinen, U.

    The composition and the properties of cadmium aquarelle colours are discussed. The examined colours were 24 different aquarelle cadmium colours from six different manufacturers. The colours ranged from light, bright yellows to dark, deep-red tones. The aim of this research was to find out if the pigments contain cadmium salts: sulphides and/or selenides. This information will help in choosing watercolours in conservation processes. Today, aquarelle colours not containing cadmium pigments are being sold as cadmium colours; thus their properties might be different from actual cadmium colours. The aim of the research was to verify that the colour samples contained cadmium pigments and to estimate their compositions and ageing properties. Element analyses were performed from colour samples using micro-chemical tests and X-ray fluorescence measurements. Thin-layer chromatography was used for analysing gum Arabic as a possible binding medium in the chosen colour samples. Through ageing tests, the resistance of the colour samples to the exposure to light, heat and humidity was studied. Visible-light spectroscopy was used in determining the hues and hue changes of the aquarelle colour samples. The spectrophotometer used the CIE L*a*b* tone colour measuring system. From the colour measurements the changes in the lightness/darkness, the redness, the yellowness and the saturation of the samples were examined.

  20. 41 CFR 101-30.101-7 - Federal Catalog System.

    Science.gov (United States)

    2010-07-01

    ... property used by the Federal Government by providing only one classification, one name, one description... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Federal Catalog System. 101-30.101-7 Section 101-30.101-7 Public Contracts and Property Management Federal Property Management...

  1. 41 CFR 101-39.101-1 - Agency cooperation.

    Science.gov (United States)

    2010-07-01

    ...-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.1-Establishment, Modification, and Discontinuance of Interagency Fleet... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Agency cooperation. 101-39.101-1 Section 101-39.101-1 Public Contracts and Property Management Federal Property Management...

  2. 41 CFR 101-30.101-13 - Management data.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Management data. 101-30.101-13 Section 101-30.101-13 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30...

  3. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  4. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... How Peer Counseling Works Julie Gassaway, MS, RN Pediatric Injuries Pediatric Spinal Cord Injury 101 Lawrence Vogel, MD The Basics of Pediatric SCI Rehabilitation Sara Klaas, MSW Transitions for Children ...

  5. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Spinal Cord Injury 101 Adult ... LLC Understanding Spinal Cord Injury About Us Expert Videos Contact Us Personal Experience Videos Blog Videos By ...

  6. Zinc-induced protection against cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Early, J.L.; Schnell, R.C.

    1978-02-01

    Pretreatment of male rats with cadmium acetate potentiates the duration of hexobarbital hypnosis and inhibits the rate of hepatic microsomal drug metabolism. Pretreatment of rats with zinc acetate protects against these alterations in drug action elicited by cadmium.

  7. Cadmium uptake by plants

    Energy Technology Data Exchange (ETDEWEB)

    Haghiri, F.

    1973-01-01

    Absorption of /sup 115m/Cd by soybean (Gylcine max l.) plants via foliar and root systems and translocation into the seed was determined. The uptake of /sup 115m/Cd by soybeans via the root system was more efficient than that of the foliar placement. Growth and Cd concentrations of soybean and wheat (Triticum aestivum l.) tops were influenced by soil-applied Cd. In both crops, the Cd concentration of plant tops increased while yield decreased with increasing levels of applied Cd. Cadmium toxicitiy began to occur in both crops at the lowest level of soil applied Cd (2.5 ppM). With soybean plants, Cd toxicity symptoms resembled fe chlorosis. For wheat plants there were no visual symptoms other than the studied growth. The relative concentration of Cd found in several vegetable crops varied depending on the plant species. The relative Cd concentration in descending order for various vegetables was lettuce (Lactuca sativa l.) > radish top (Raphanus sativus l.) > celery stalk (Apium graveolens l.) > celery leaves greater than or equal to green pepper (Capsicum frutescens l.) > radish roots.

  8. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    In Denmark and EU the exposure of cadmium from food is at a level that is relatively close to the Tolerable Daily Intake (TDI). This report describes an investigation of the bioavailability of cadmium in selected food items known to contain high levels of cadmium. The purpose was to provide data ...... or crushed linseed nor the intake of cocoa and chocolate....

  9. Removal of cadmium from acidic phosphatic solutions

    Energy Technology Data Exchange (ETDEWEB)

    Frankenfeld, K.; Brodt, P.; Eich, G.; Ruschke, P.

    1985-01-08

    The invention is concerned with a process of removing cadmium from acid, especially P/sub 2/O/sub 5/-containing solutions by liquid/liquid extraction with the aid of alkyl amine salts that are dissolved in an inert, organic solvent. The cadmium ions are removed from the acid, aqueous phase and are enriched in the organic phase. The cadmium-containing organic phase, subsequently, is re-extracted with an aqueous salt solution, with the cadmium ions migrating from the organic phase into the aqueous phase. The process is particularly suitable for extracting cadmium from concentrated, highly acid aqueous solutions.

  10. Magnesium supplements affect selected cadmium toxic actions and uptake of repeated doses of cadmium

    Directory of Open Access Journals (Sweden)

    Grosicki Andrzej

    2015-12-01

    Full Text Available The importance of magnesium supplements on organ retention of cadmium and allometric parameters after repeated exposure to cadmium chloride were studied in male Wistar rats. Magnesium chloride was given via drinking water (500 mg Mg/L to rats exposed intragastrically to cadmium chloride (labelled with cadmium 109 at a daily dose corresponding to 25 mg/kg diet for 7, 14, 21, and 28 d. Supplements of magnesium temporarily decreased cadmium retention in the duodenum and liver. No significant differences in cadmium retention were evidenced in the kidneys and testicles. The supplements of magnesium also retain more of the body weight gains and restore the relative liver and testicle weight in rats intoxicated with cadmium. Comparison of the present results with earlier reports suggests a relationship between doses of magnesium and cadmium; higher doses of cadmium need more magnesium to overcome toxic action of the heavy metal.

  11. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Spinal Cord Injury 101 Lawrence Vogel, MD The Basics of Pediatric SCI Rehabilitation Sara Klaas, MSW Transitions ... PhD Michelle Meade, PhD Jonathon Rose, PhD The Basics of Spinal Cord Injury Rehabilitation Kristine Cichowski, MS ...

  12. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Cord Injury Allen Heinemann, PhD How Peer Counseling Works Julie Gassaway, MS, RN Pediatric Injuries Pediatric Spinal Cord Injury 101 Lawrence Vogel, MD The Basics of Pediatric SCI Rehabilitation Sara Klaas, MSW Transitions for Children with Spinal Cord Injury Patricia Mucia, RN Family ...

  13. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Lokomat T. George Hornby, PhD, PT Empowering the Patient After Spinal Cord Injury Guy W. Fried, MD Substance Abuse and Spinal Cord Injury Allen Heinemann, PhD How Peer Counseling Works Julie Gassaway, MS, RN Pediatric Injuries Pediatric Spinal Cord Injury 101 Lawrence Vogel, ...

  14. J. Genet. classic 101

    Indian Academy of Sciences (India)

    Journal of Genetics, Vol. 85, No. 2, August 2006. 101. Page 2. J. Genet. classic. 102. Journal of Genetics, Vol. 85, No. 2, August 2006. Page 3. J. Genet. classic. Journal of Genetics, Vol. 85, No. 2, August 2006. 103. Page 4. J. Genet. classic. 104. Journal of Genetics, Vol. 85, No. 2, August 2006. Page 5. J. Genet. classic.

  15. Isolation, identification and cadmium adsorption of a high cadmium ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-27

    Sep 27, 2010 ... P. chrysosporium was used to biosorp cadmium (II), lead (II), copper (II) and the adsorption capacities reached 23.04, 69.77 and 20.33mg/g dry biomass, respectively (Say et al. 2001). The maximum experimental biosorption capacities for entrapped live and dead fungal mycelia of L. sajur-caju were found ...

  16. 41 CFR 101-30.101-16 - Data transmission.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Data transmission. 101-30....1-General § 101-30.101-16 Data transmission. Data transmission means the operation of telecommunication equipment for the receipt and transmission of item identification and management data. ...

  17. Main: CRC101 [AT Atlas

    Lifescience Database Archive (English)

    Full Text Available CRC101 CRC1 Establishment of Chemical Library and Development of Protein Regulation... Technology Chemical library Tetsuo Nagano Graduate School of Pharmaceutical Sciences, The University CRC101.csml ...

  18. Mechanisms of cadmium induced genomic instability

    Energy Technology Data Exchange (ETDEWEB)

    Filipic, Metka, E-mail: metka.filipic@nib.si [National Institute of Biology, Department for Genetic Toxicology and Cancer Biology, Ljubljana (Slovenia)

    2012-05-01

    Cadmium is an ubiquitous environmental contaminant that represents hazard to humans and wildlife. It is found in the air, soil and water and, due to its extremely long half-life, accumulates in plants and animals. The main source of cadmium exposure for non-smoking human population is food. Cadmium is primarily toxic to the kidney, but has been also classified as carcinogenic to humans by several regulatory agencies. Current evidence suggests that exposure to cadmium induces genomic instability through complex and multifactorial mechanisms. Cadmium dose not induce direct DNA damage, however it induces increase in reactive oxygen species (ROS) formation, which in turn induce DNA damage and can also interfere with cell signalling. More important seems to be cadmium interaction with DNA repair mechanisms, cell cycle checkpoints and apoptosis as well as with epigenetic mechanisms of gene expression control. Cadmium mediated inhibition of DNA repair mechanisms and apoptosis leads to accumulation of cells with unrepaired DNA damage, which in turn increases the mutation rate and thus genomic instability. This increases the probability of developing not only cancer but also other diseases associated with genomic instability. In the in vitro experiments cadmium induced effects leading to genomic instability have been observed at low concentrations that were comparable to those observed in target organs and tissues of humans that were non-occupationally exposed to cadmium. Therefore, further studies aiming to clarify the relevance of these observations for human health risks due to cadmium exposure are needed.

  19. Bioaccumulation of cadmium by growing Zygosaccharomyces rouxii and Saccharomyces cerevisiae.

    Science.gov (United States)

    Li, Chunsheng; Jiang, Wei; Ma, Ning; Zhu, Yinglian; Dong, Xiaoyan; Wang, Dongfeng; Meng, Xianghong; Xu, Ying

    2014-03-01

    Bioaccumulation via growing cells is a potential technique for heavy metal removal from food materials. The cadmium bioaccumulation characteristics by growing Zygosaccharomyces rouxii and Saccharomyces cerevisiae were investigated. Z. rouxii displayed powerful cadmium removal ability at low cadmium concentrations, which mainly depended on the intracellular cadmium bioaccumulation. The percentage of intracellular cadmium bioaccumulation of both yeasts obviously decreased with the increase of initial biomass and cadmium concentrations. Low pH and elevated concentrations of zinc and copper significantly decreased the intracellular cadmium bioaccumulation of both yeasts but improved the cadmium tolerance and the cell-surface cadmium bioaccumulation of Z. rouxii. Cadmium removal of Z. rouxii was improved by zinc and copper conditionally. Z. rouxii that possessed more powerful cadmium tolerance and removal ability at low pH and high concentration of competing ions can be developed into a potential cadmium removal agent using in complex food environment in future. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Cadmium content of plants as affected by soil cadmium concentration

    Energy Technology Data Exchange (ETDEWEB)

    Lehoczky, E. [Pannon Univ. of Agricultural Sciences, Keszthely (Hungary); Szabados, I.; Marth, P. [Plant Health and Soil Conservation Station, Higany (Hungary)

    1996-12-31

    Pot experiments were conducted in greenhouse conditions to study the effects of increasing cadmium (Cd) levels on biomass production and Cd contents in corn, (Zea mays L.), garlic (Allium sativum L.), and spinach (Spinacia oleracea L.). Plants were grown in two soil types: Eutric cambisol soil and A gleyic luvisol soil. Spinach proved to be the most sensitive to Cd treatments as its biomass considerably decreased with the increasing Cd levels. Cadmium contents of the three crops increased with increasing levels of Cd applications. Statistical differences were observed in the Cd contents of crops depending on soil type. With the same Cd rates, Cd tissue concentration of test plants grown in the strongly acidic Gleyic luvisol soil were many times higher than that of plants grown in a neutral Eutric cambisol soil. 14 refs., 4 tabs.

  1. Cadmium and Cadmium/Zinc Ratios and Tobacco-Related Morbidities

    Science.gov (United States)

    Richter, Patricia; Faroon, Obaid; Pappas, R. Steven

    2017-01-01

    Metals are one of five major categories of carcinogenic or toxic constituents in tobacco and tobacco smoke. Cadmium is highly volatile and a higher percentage of the total tobacco cadmium content is efficiently transferred to mainstream tobacco smoke than many other toxic metals in tobacco. Inhaled cadmium bioaccumulates in the lungs and is distributed beyond the lungs to other tissues, with a total body biological half-life of one to two decades. Chronic cadmium exposure through tobacco use elevates blood and urine cadmium concentrations. Cadmium is a carcinogen, and an inducer of proinflammatory immune responses. Elevated exposure to cadmium is associated with reduced pulmonary function, obstructive lung disease, bronchogenic carcinoma, cardiovascular diseases including myocardial infarction, peripheral arterial disease, prostate cancer, cervical cancer, pancreatic cancer, and various oral pathologies. Cadmium and zinc have a toxicologically inverse relationship. Zinc is an essential element and is reportedly antagonistic to some manifestations of cadmium toxicity. This review summarizes associations between blood, urine, and tissue cadmium concentrations with emphasis on cadmium exposure due to tobacco use and several disease states. Available data about zinc and cadmium/zinc ratios and tobacco-related diseases is summarized from studies reporting smoking status. Collectively, data suggest that blood, urine, and tissue cadmium and cadmium/zinc ratios are often significantly different between smokers and nonsmokers and they are also different in smokers for several diseases and cancers. Additional biomonitoring data such as blood or serum and urine zinc and cadmium levels and cadmium/zinc ratios in smokers may provide further insight into the development and progression of diseases of the lung, cardiovascular system, and possibly other organs. PMID:28961214

  2. Cadmium and Cadmium/Zinc Ratios and Tobacco-Related Morbidities.

    Science.gov (United States)

    Richter, Patricia; Faroon, Obaid; Pappas, R Steven

    2017-09-29

    Metals are one of five major categories of carcinogenic or toxic constituents in tobacco and tobacco smoke. Cadmium is highly volatile and a higher percentage of the total tobacco cadmium content is efficiently transferred to mainstream tobacco smoke than many other toxic metals in tobacco. Inhaled cadmium bioaccumulates in the lungs and is distributed beyond the lungs to other tissues, with a total body biological half-life of one to two decades. Chronic cadmium exposure through tobacco use elevates blood and urine cadmium concentrations. Cadmium is a carcinogen, and an inducer of proinflammatory immune responses. Elevated exposure to cadmium is associated with reduced pulmonary function, obstructive lung disease, bronchogenic carcinoma, cardiovascular diseases including myocardial infarction, peripheral arterial disease, prostate cancer, cervical cancer, pancreatic cancer, and various oral pathologies. Cadmium and zinc have a toxicologically inverse relationship. Zinc is an essential element and is reportedly antagonistic to some manifestations of cadmium toxicity. This review summarizes associations between blood, urine, and tissue cadmium concentrations with emphasis on cadmium exposure due to tobacco use and several disease states. Available data about zinc and cadmium/zinc ratios and tobacco-related diseases is summarized from studies reporting smoking status. Collectively, data suggest that blood, urine, and tissue cadmium and cadmium/zinc ratios are often significantly different between smokers and nonsmokers and they are also different in smokers for several diseases and cancers. Additional biomonitoring data such as blood or serum and urine zinc and cadmium levels and cadmium/zinc ratios in smokers may provide further insight into the development and progression of diseases of the lung, cardiovascular system, and possibly other organs.

  3. Cadmium and Cadmium/Zinc Ratios and Tobacco-Related Morbidities

    Directory of Open Access Journals (Sweden)

    Patricia Richter

    2017-09-01

    Full Text Available Metals are one of five major categories of carcinogenic or toxic constituents in tobacco and tobacco smoke. Cadmium is highly volatile and a higher percentage of the total tobacco cadmium content is efficiently transferred to mainstream tobacco smoke than many other toxic metals in tobacco. Inhaled cadmium bioaccumulates in the lungs and is distributed beyond the lungs to other tissues, with a total body biological half-life of one to two decades. Chronic cadmium exposure through tobacco use elevates blood and urine cadmium concentrations. Cadmium is a carcinogen, and an inducer of proinflammatory immune responses. Elevated exposure to cadmium is associated with reduced pulmonary function, obstructive lung disease, bronchogenic carcinoma, cardiovascular diseases including myocardial infarction, peripheral arterial disease, prostate cancer, cervical cancer, pancreatic cancer, and various oral pathologies. Cadmium and zinc have a toxicologically inverse relationship. Zinc is an essential element and is reportedly antagonistic to some manifestations of cadmium toxicity. This review summarizes associations between blood, urine, and tissue cadmium concentrations with emphasis on cadmium exposure due to tobacco use and several disease states. Available data about zinc and cadmium/zinc ratios and tobacco-related diseases is summarized from studies reporting smoking status. Collectively, data suggest that blood, urine, and tissue cadmium and cadmium/zinc ratios are often significantly different between smokers and nonsmokers and they are also different in smokers for several diseases and cancers. Additional biomonitoring data such as blood or serum and urine zinc and cadmium levels and cadmium/zinc ratios in smokers may provide further insight into the development and progression of diseases of the lung, cardiovascular system, and possibly other organs.

  4. Relations between liver cadmium, cumulative exposure, and renal function in cadmium alloy workers.

    OpenAIRE

    Mason, H. J.; Davison, A G; Wright, A. L.; Guthrie, C J; Fayers, P M; Venables, K M; Smith, N J; Chettle, D R; Franklin, D M; Scott, M. C.

    1988-01-01

    Detailed biochemical investigations of renal function were made on 75 male workers exposed to cadmium and an equal number of referents matched for age, sex, and employment status. The exposed group consisted of current and retired workers who had been employed in the manufacture of copper-cadmium alloy at a single factory in the United Kingdom for periods of up to 39 years and for whom cumulative cadmium exposure indices could be calculated. In vivo measurements of liver and kidney cadmium bu...

  5. Cadmium resistance in Drosophila: a small cadmium binding substance

    Energy Technology Data Exchange (ETDEWEB)

    Jacobson, K.B.; Williams, M.W.; Richter, L.J.; Holt, S.E.; Hook, G.J.; Knoop, S.M.; Sloop, F.V.; Faust, J.B.

    1985-01-01

    A small cadmium-binding substance (CdBS) has been observed in adult Drosophila melanogaster that were raised for their entire growth cycle on a diet that contained 0.15 mM CdCl/sub 2/. Induction of CdBS was observed in strains that differed widely in their sensitivity of CdCl/sub 2/. This report describes the induction of CdBS and some of its characteristics. 17 refs., 4 figs., 1 tab.

  6. [Effects of cadmium on testis function].

    Science.gov (United States)

    Martynowicz, Helena; Skoczyńska, Anna; Karczmarek-Wdowiak, Beata; Andrzejak, Ryszard

    2005-01-01

    The deterioration of male fertility, reported in numerous epidemiological studies over past decades, can be connected with growing exposure to environmental toxins. Heavy metals, especially cadmium, is widely spread and extremely toxic. The mechanisms of cadmium toxic effects vary and involve the damage of vascular endothelium, intracellular junctions, germ cells, Leydig and Sertoli cells. Cadmium can increase activity of reactive oxygen species and induce changes in activity of enzymatic systems and inflammatory reactions. The morphological changes caused by cadmium included the necrosis of seminiferous tubiles and interstitial edema. This metal can reduce testosterone synthesis at various levels and deteriorate spermatogenesis. Cadmium is also acknowledged carcinogen with confirmed mutagenic and genotoxic activity. Increasing environmental exposure to cadmium, currently existing occupational exposure and the prevalence of tobacco smoking results in constant increase in the number of diagnosed fertility impairments.

  7. Cadmium Concentration in Human Autopsy Tissues.

    Science.gov (United States)

    Lech, Teresa; Sadlik, Józefa K

    2017-10-01

    The concentration of cadmium in human tissues obtained on the basis of autopsies of non-poisoned Polish people (n = 150), aged from 1 to 80 years, examined between 1990 and 2010, is presented. The following values were found in wet digested samples by flame atomic absorption spectrometry (FAAS) (mean ± SD, median, and range, μg/g of wet weight): brain 0.020 ± 0.031, 0.084, 0-0.120 (n = 41); stomach 0.148 ± 0.195, 0.084, 0-1.25 (n = 89); small intestine 0.227 ± 0.231, 0.130, 0-0.830 (n = 39); liver 1.54 ± 1.55, 1.01, 0.015-9.65 (n = 99); kidney 16.0 ± 13.2, 14.0, 0.62-61.3 (n = 91); lung 0.304 ± 0.414, 0.130, 0-1.90 (n = 25); and heart 0.137 ± 0.107, 0.140, 0.017-0.250 (n = 4). Additionally, results (n = 13 people, aged from 2 to 83 years, 63 samples) obtained by inductively coupled plasma optical emission spectrometry (ICP OES) between 2010 and 2015 are given. The obtained data on Cd concentration in the human body can be used to estimate the amounts occurring in "healthy" people and those occurring in cases of chronic or acute poisonings with Cd compounds, which are examined for forensic purposes or to assess environmental exposure levels.

  8. Electrodialytic Removal of Cadmium from Straw Ash

    DEFF Research Database (Denmark)

    Hansen, Henrik; Ottosen, Lisbeth M.; Villumsen, Arne

    1999-01-01

    A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days of remed......A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days...

  9. Interplay of calcium and cadmium in mediating cadmium toxicity.

    Science.gov (United States)

    Choong, Grace; Liu, Ying; Templeton, Douglas M

    2014-03-25

    The environmentally important toxic metal, cadmium, exists as the Cd(2+) ion in biological systems, and in this state structurally resembles Ca(2+). Thus, although cadmium exerts a broad range of adverse actions on cells by virtue of its propensity to bind to protein thiol groups, it is now well appreciated that Cd(2+) participates in a number of Ca(2+)-dependent pathways, attributable to its actions as a Ca(2+) mimetic, with a central role for calmodulin, and the Ca(2+)/calmodlin-dependent protein kinase II (CaMK-II) that mediates effects on cytoskeletal dynamics and apoptotic cell death. Cadmium interacts with receptors and ion channels on the cell surface, and with the intracellular estrogen receptor where it binds competitively to residues shared by Ca(2+). It increases cytosolic [Ca(2+)] through several mechanisms, but also decreases transcript levels of some Ca(2+)-transporter genes. It initiates mitochondrial apoptotic pathways, and activates calpains, contributing to mitochondria-independent apoptosis. However, the recent discovery of the role CaMK-II plays in Cd(2+)-induced cell death, and subsequent implication of CaMK-II in Cd(2+)-dependent alterations of cytoskeletal dynamics, has opened a new area of mechanistic cadmium toxicology that is a focus of this review. Calmodulin is necessary for induction of apoptosis by several agents, yet induction of apoptosis by Cd(2+) is prevented by CaMK-II block, and Ca(2+)-dependent phosphorylation of CaMK-II has been linked to increased Cd(2+)-dependent apoptosis. Calmodulin antagonism suppresses Cd(2+)-induced phosphorylation of Erk1/2 and the Akt survival pathway. The involvement of CaMK-II in the effects of Cd(2+) on cell morphology, and particularly the actin cytoskeleton, is profound, favouring actin depolymerization, disrupting focal adhesions, and directing phosphorylated FAK into a cellular membrane. CaMK-II is also implicated in effects of Cd(2+) on microtubules and cadherin junctions. A key question for

  10. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 28; Issue 3. Zone refining of cadmium and related characterization. N R Munirathnam ... The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma optical ...

  11. Cadmium Toxicity to Ringed Seals (Phoca hispida)

    DEFF Research Database (Denmark)

    Sonne, Christian; Dietz, R.; Riget, F. F.

    Cadmium concentrations in kidneys from ringed seals (Phoca hispida) from North West Greenland (Qaanaaq) are high. Concentrations range at level known to induce renal toxic effects (mainly tubulopathy) and demineralisation (osteopenia) of the skeletal system (Fanconi's Syndrome) in humans as well...... the absence of toxic effects of cadmium in ringed seal...

  12. Subcellular localization of cadmium in hyperaccumulator Populus ...

    African Journals Online (AJOL)

    ... of damage to organs of grey poplar was as follows: root > stem> leaves. It was suggested that the Populus × canescens as a renewable resource has the potential to decontaminate cadmium stress development, accumulation and distribution. Key words: Cadmium, phytoremediation, hyperaccumulator, grey poplar, organ.

  13. REMOVAL OF CADMIUM FROM AQUEOUS SOLUTION USING ...

    African Journals Online (AJOL)

    The uptake of cadmium from aqueous solution appeared to follow adsorption mechanism and not ion exchange as characteristic of many other divalent hexacyanoferrates. The sorption data were fitted with Langmuir adsorption isotherm. KEY WORDS: Cadmium removal, Potassium manganese hexacynoferrates(II)/(III) Bull.

  14. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    Unknown

    Abstract. We present the zone refining results of cadmium using horizontal resistive zone refiner under constant flow of moisture free hydrogen gas. The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma ...

  15. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene (cadA4) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette (cadA4C), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation.IMPORTANCEListeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and tolerate

  16. Cadmium mobility and accumulation in soils of the European Communities

    NARCIS (Netherlands)

    Fraters B; van Beurden AUCJ

    1993-01-01

    In this overview of the effects of cadmium pollution on agricultural soils in the European Community, both the cadmium loads on agricultural land and the soil sensitivity to cadmium accumulation have been estimated. Cadmium loads have been estimated separately for arable land and grassland. The

  17. Main: SAD101 [AT Atlas

    Lifescience Database Archive (English)

    Full Text Available SAD101 SAD1 Structural Analysis of Membrane Protein Complexes by Solid-State NMR St...ructural Analysis of Membrane Protein Complexes by Solid-State NMR Toshimichi Fujiwara Institute for Protein Research, Osaka University SAD101.csml ...

  18. 41 CFR 101-39.101 - Notice of intention to begin a study.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Notice of intention to begin a study. 101-39.101 Section 101-39.101 Public Contracts and Property Management Federal Property... Interagency Fleet Management Systems § 101-39.101 Notice of intention to begin a study. The Administrator, GSA...

  19. Cadmium action in synapses in the brain

    Energy Technology Data Exchange (ETDEWEB)

    Minami, Akira; Takeda, Atsushi; Nishibaba, Daisuke; Tekefuta, Sachiyo; Oku, Naoto [Department of Radiobiochemistry, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka (Japan)

    2001-05-01

    Chronic exposure to cadmium causes central nervous system disorders, e.g., olfactory dysfunction. To clarify cadmium toxicity in synaptic neurotransmission in the brain, the movement and action of cadmium in the synapses was examined using in vivo microdialysis. One and 24 h after injection of {sup 109}CdCl{sub 2} into the amygdala of rats, {sup 109}Cd release into the extracellular space was facilitated by stimulation with high K{sup +}, suggesting that cadmium taken up in amygdalar neurons is released into the synaptic clefts in a calcium- and impulse-dependent manner. To examine the action of cadmium in the synapses, the amygdala was perfused with artificial cerebrospinal fluid containing 10-30 {mu}M CdCl{sub 2}. The release of excitatory neurotransmitters, i.e., glutamate and aspartate, into the extracellular space was decreased during perfusion with cadmium, while the release of inhibitory neurotransmitters, i.e., glycine and {gamma}-amino butyric acid (GABA), into the extracellular space was increased during the period. These results suggest that cadmium released from the amygdalar neuron terminals affects the degree and balance of excitation-inhibition in synaptic neurotransmission. (author)

  20. Response of Pleurotus ostreatus to cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    Favero, N.; Bressa, G.; Costa, P. (Univ. of Padua (Italy))

    1990-08-01

    The possibility of utilizing agroindustrial wastes in the production of edible, high-quality products (e.g., mushrooms) implies the risk of bringing toxic substances, such as heavy metals, into the human food chain. Thus, growth in the presence of cadmium and cadmium accumulation limits have been studied in the industrially cultivated fungus P. ostreatus. Fruit body production is substantially unaffected in the presence of 25, 139, and 285 mg Cd/kg of dried substrate. Cadmium concentration in fruit bodies is related to cadmium substrate level, the metal being present at higher levels in caps (22-56 mg/kg dry wt) than in stems (13-36 mg/kg dry wt). Concentration factor (CF), very low in the controls (about 2), further decreases in treated specimens. The presence of a cadmium control mechanism in this fungi species is suggested. Fruit body cadmium levels could, however, represent a risk for P. ostreatus consumers, according to FAO/WHO limits related to weekly cadmium intake.

  1. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail: luamatu@uol.com.br; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail: menezes@cdtn.br; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg

    2009-07-01

    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  2. [Cadmium and selenium interaction in mammals].

    Science.gov (United States)

    Lazarus, Maja

    2010-09-01

    Cadmium occurs in the environment naturally and as a pollutant. Its exposure is inevitable and may produce toxic effects in many organs and organ systems through binding to biological structures, accumulation in internal organs or induction of free radical production. Another important aspect of Cd toxicity is its interaction, often anthagonistic, with essential elements. Vice versa, additional intake of the essential elements may have beneficial influence on distribution and toxic effects of cadmium. Selenium is an essential microelement and a constituent of many selenoproteins with antioxidant properties that bind cadmium (and other toxic elements such as mercury or arsenic). This review summarizes results, to date, of cadmium toxicokinetics and toxicodinamics, selenium biokinetics and biodinamics, as well as mechanisms of cadmium-selenium interaction and their impact on the oxidative status derived from the studies based upon mainly on animal experiments and on limited number of human studies. The wide variety of different doses, dose ratios, element administration modes and exposure lenghts of cadmium and selenium often yielded contradictory results. Future studies should be focused on assessment of effects of cadmium and selenium interaction in sensitive population groups and mechanisms of that interaction. Regarding animal studies, doses and exposure should be adjusted to long-term low exposure levels that are usually found in human population.

  3. Main: SAC101 [AT Atlas

    Lifescience Database Archive (English)

    Full Text Available SAC101 SAC1 Development of the synchrotron beamlines dedicated to the measurement o...f micron-size protein crystals Development of the synchrotron beamlines dedicated to the measurement of micr

  4. FDA 101: Regulating Biological Products

    Science.gov (United States)

    ... Products For Consumers Home For Consumers Consumer Updates FDA 101: Regulating Biological Products Share Tweet Linkedin Pin ... and highly important field. What biological products does FDA regulate? The Center for Biologics Evaluation and Research ( ...

  5. Low level determinations of environmental cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Rosman, K.J.R.; De Laeter, J.R.

    1976-06-24

    An isotope dilution technique has been developed to measure the concentration of cadmium in aqueous solutions with a sensitivity of 0.003 micrograms per liter. The concentrations of cadmium in two river systems in Western Australia has been measured to establish an accurate set of low level reference determinations in a region which is relatively free of sources of industrial pollution. The results of the study demonstrate that the cadmium content in the two major river systems in western Australia is about 100 times lower than the World Health Organization limits. The data indicate that the cadmium content tends to decrease upstream from the mouth of the river, and that in the reservoir areas the content is as low as 0.02 micrograms per liter. These values are substantially lower than waterways in other parts of the world. 13 references, 1 figure, 1 table.

  6. Cadmium substituted high permeability lithium ferrite

    Indian Academy of Sciences (India)

    , 0.5 and 0.6 were prepared by a double sintering ceramic technique and characterized by X-ray diffraction and scanning electron microscopy (SEM). The lattice parameter is found to increase monotonically with the cadmium content.

  7. Market for nickel-cadmium batteries

    Science.gov (United States)

    Putois, F.

    Besides the lead/acid battery market, which has seen a tremendous development linked with the car industry, the alkaline rechargeable battery market has also been expanded for more than twenty years, especially in the field of portable applications with nickel-cadmium batteries. Today, nickel-cadmium batteries have to face newcomers on the market, such as nickel-metal hydride, which is another alkaline couple, and rechargeable lithium batteries; these new battery systems have better performances in some areas. This work illustrates the status of the market for nickel-cadmium batteries and their applications. Also, for two major applications—the cordless tool and the electric vehicles—the competitive situation of nickel-cadmium batteries; facing new systems such as nickel-metal hydride and lithium ion cells are discussed.

  8. 47 CFR 101.513 - Transmitter power.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Transmitter power. 101.513 Section 101.513... SERVICES 24 GHz Service and Digital Electronic Message Service § 101.513 Transmitter power. The transmitter power will be governed by § 101.113. Further, each application must contain an analysis demonstrating...

  9. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Davila-Rangel, J.I. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico); Unidad Academica Centro Regional de Estudios Nucleares, Universidad Autonoma de Zacatecas Cipres 10, Frac. La Penuela, Zacatecas, Zacatecas 98068 (Mexico); Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, Instituto Literario No. 100 Col. Centro C.P. 50000, Toluca, Edo. de Mexico (Mexico); Solache-Rios, M. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico)], E-mail: msr@nuclear.inin.mx

    2008-10-15

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 {sup o}C), and the materials were then treated with NaCl (1 M and 5 M) and HNO{sub 3} (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 {sup o}C was higher than leaching from non-irradiated samples.

  10. Reviews of the environmental effects of pollutants: IV. Cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Hammons, A.S.; Huff, J.E.; Braunstein, H.M.; Drury, J.S.; Shriner, C.R.; Lewis, E.B.; Whitfield, B.L.; Towill, L.E.

    1978-06-01

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 ..mu..g per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels.

  11. Cadmium removal by Lemna minor and Spirodela polyrhiza.

    Science.gov (United States)

    Chaudhuri, Devaleena; Majumder, Arunabha; Misra, Amal K; Bandyopadhyay, Kaushik

    2014-01-01

    The present study investigates the ability of two genus of duckweed (Lemna minor and Spirodela polyrhiza) to phytoremediate cadmium from aqueous solution. Duckweed was exposed to six different cadmium concentrations, such as, 0.5,1.0,1.5, 2.0, 2.5, and 3.0 mg/L and the experiment was continued for 22 days. Water samples were collected periodically for estimation of residual cadmium content in aqueous solution. At the end of treatment period plant samples were collected and accumulated cadmium content was measured. Cadmium toxicity was observed through relative growth factor and changes in chlorophyll content Experimental results showed that Lemna minor and Spirodela polyrhiza were capable of removing 42-78% and 52-75% cadmium from media depending upon initial cadmium concentrations. Cadmium was removed following pseudo second order kinetic model Maximum cadmium accumulation in Lemna minor was 4734.56 mg/kg at 2 mg/L initial cadmium concentration and 7711.00 mg/kg in Spirodela polyrhiza at 3 mg/L initial cadmium concentration at the end of treatment period. Conversely in both cases maximum bioconcentration factor obtained at lowest initial cadmium concentrations, i.e., 0.5 mg/L, were 3295.61 and 4752.00 for Lemna minor and Spirodela polyrhiza respectively. The present study revealed that both Lemna minor and Spirodela polyrhiza was potential cadmium accumulator.

  12. Cigarette Smoke Cadmium Breakthrough from Traditional Filters: Implications for Exposure

    Science.gov (United States)

    Pappas, R. Steven; Fresquez, Mark R.; Watson, Clifford H.

    2015-01-01

    Cadmium, a carcinogenic metal, is highly toxic to renal, skeletal, nervous, respiratory, and cardiovascular systems. Accurate and precise quantification of mainstream smoke cadmium levels in cigarette smoke is important because of exposure concerns. The two most common trapping techniques for collecting mainstream tobacco smoke particulate for analysis are glass fiber filters and electrostatic precipitators. We observed that a significant portion of total cadmium passed through standard glass fiber filters that are used to trap particulate matter. We therefore developed platinum traps to collect the cadmium that passed through the filters and tested a variety of cigarettes with different physical parameters for quantities of cadmium that passed though the filters. We found less than 1% cadmium passed through electrostatic precipitators. In contrast, cadmium that passed through 92 mm glass fiber filters on a rotary smoking machine was significantly higher, ranging from 3.5% to 22.9% of total smoke cadmium deliveries. Cadmium passed through 44 mm filters typically used on linear smoking machines to an even greater degree, ranging from 13.6% to 30.4% of the total smoke cadmium deliveries. Differences in the cadmium that passed through from the glass fiber filters and electrostatic precipitator could be explained in part if cadmium resides in the smaller mainstream smoke aerosol particle sizes. Differences in particle size distribution could have toxicological implications and could help explain the pulmonary and cardiovascular cadmium uptake in smokers. PMID:25313385

  13. Dynamic of cadmium accumulation in the internal organs of rats after exposure to cadmium chloride and cadmium sulphide nanoparticules of various sizes

    Directory of Open Access Journals (Sweden)

    Apykhtina O.L.

    2017-06-01

    Full Text Available The article presents the results of study of cadmium accumulation in the internal organs of Wistar rats after prolonged intraperitoneal administration of cadmium chloride and cadmium sulphide nanoparticles of 4-6 nm and 9-11 nm in size in a dose of 0.08 mg /kg/day calculated as cadmium. Toxic effects were evaluated after 30 injections (1.5 months, 60 injections (3 months, and 1.5 months after the exposure has been ceased. The results of the study showed that the most intensive accumulation of cadmium was observed in the kidneys and liver of experimental animals, which is due to the peculiarities of the toxicokinetics and the route of administration of cadmium compounds. In the kidneys, spleen and thymus of animals exposed to cadmium sulphide nanoparticles, a greater concentration of cadmium than in the organs of animals exposed to cadmium chloride was found. Cadmium accumulated more intensively in the spleen after exposure to larger nanoparticles, than in the kidneys and thymus. In the liver, heart, aorta and brain significant accumulation was observed after cadmium chloride exposure.

  14. Cadmium exposure induces hematuria in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seung Seok [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Kim, Myounghee, E-mail: dkkim73@gmail.com [Department of Dental Hygiene, College of Health Science, Eulji University, Gyeonggi-do 461-713 (Korea, Republic of); Lee, Su Mi [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lee, Jung Pyo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Sejoong [Department of Internal Medicine, Seoul National University Bundang Hospital, Gyeonggi-do 463-707 (Korea, Republic of); Joo, Kwon Wook [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lim, Chun Soo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Yon Su; Kim, Dong Ki [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of)

    2013-07-15

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; P{sub trend}=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk.

  15. Toxicity of cadmium to the developing lung

    Energy Technology Data Exchange (ETDEWEB)

    Daston, G.P.

    1981-01-01

    The effects of cadmium on the developing lung and pulmonary surfactant were studied. Pregnant rats received subcutaneous injections of cadmium chloride on days 12 to 15 of gestation and were sacrificed throughout late gestation. The treatment resulted in high embryonic mortality and growth regardation. Fetal lung weight was reduced 20 to 30% due to hypoplasia, as the number of lung cells (DNA/lung) but not cell size (protein/cell) was lowered. The ultrastructural development of alveolar epithelium was altered; cytodifferentiation was delayed; and the cytoplasmic inclusions which contain pulmonary surfactant, were reduced in the term fetus. Accumulation of phosphatidylcholine (PC), the major component of pulmonary surfactant, was diminished in the lungs of treated fetuses. The immediate cause of this lowered accumulation was a decreased rate of synthesis of PC from choline. Carbohydrates probably represent a major source of PC precursors and are present in large quantities in the fetal lung as glycogen. The pulmonary glycogen content of cadmium-exposed fetuses was diminished. It is postulated that this is a reason for the lowered rate of PC synthesis. Maternally administered cadmium did not pass through the placenta; thus, the mechanism of fetotoxicity was indirect. Maternal cadmium exposure did result in lowered fetal zinc levels. Coadministration of zinc with cadmium raised fetal zinc concentration to control values and alleviated all fetotoxicity. Fetal zinc deficiency is a possible mechanism for the toxic effects on the developing lung. Several dams were allowed to give birth and their offspring were observed for respiratory problems. Cadmium treatment delayed parturition by about a day. Symptoms of respiratory distress syndrome (RDS) were observed in 11% of the treated neonates. All but one of these individuals died and had lungs with hyaline membranes. This is the only known case of an environmental agent causing neonatal RDS.

  16. Uptake of cadmium from hydroponic solutions by willows ( Salix spp ...

    African Journals Online (AJOL)

    Salix integra 'Weishanhu') and Yizhibi (S. integra 'Yizhibi') were chosen as model plants to evaluate their potential for uptake of cadmium from hydroponic culture and relative uptake mechanism. Cadmium uptake showed a linear increase in the ...

  17. SUBSTITUTION OF CADMIUM CYANIDE ELECTROPLATING WITH ZINC CHLORIDE ELECTROPLATING

    Science.gov (United States)

    The study evaluated the zinc chloride electroplating process as a substitute for cadmium cyanide electroplating in the manufacture of industrial connectors and fittings at Aeroquip Corporation. The process substitution eliminates certain wastes, specifically cadmium and cyanide, ...

  18. Genotoxic Effect of Atrazine, Arsenic, Cadmium and Nitrate ...

    African Journals Online (AJOL)

    ATZ), Cadmium (Cd), Arsenic (As) and Nitrate (NO3) have both estrogenic activity and carcinogenic potential. Atrazine has clastogenic effects and may also act as tumor promoter as it induces the aromatase enzyme. Arsenic and Cadmium ...

  19. Cadmium exposure and health risks: Recent findings

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G. [Huddinge Hospital (Sweden). Dept. of Renal Medicine; Jaerup, L. [Stockholm City Council (Sweden). Dept. of Environmental Health

    1996-08-01

    Environmental and/or occupational exposure to cadmium give rise to a tubular kidney dysfunction which may proceed to more generalized renal damage and bone disease if exposure has been high and prolonged. Recent scientific work shows that early renal effects develop at lower levels of exposure than previously anticipated. Previous risk assessments for cadmium were mainly based on studies on healthy male workers. The general population, however, also include particularly susceptible groups such as elderly and individuals with illnesses (e.g. diabetes) that may predispose to cadmium-induced health effects. A significant proportion of the general population displays early signs of toxicity already at urinary cadmium concentrations around 3 nmol mmol{sup -1} creatinine. In addition to early tubular effects, cadmium may exert direct or indirect effects on mineral metabolism and the mineralization of the skeleton at relatively low levels of exposure. This may have important health implications, as poor and easily fractured bone is a major problem among the elderly in all industrialized countries. 41 refs, 4 figs

  20. Cadmium recycling in the United States in 2000

    Science.gov (United States)

    Plachy, Jozef

    2003-01-01

    Recycling of cadmium is a young and growing industry that has been influenced by environmental concerns and regulatory constraints. Domestic recycling of cadmium began in 1989 as a byproduct of processing of spent nickel-cadmium batteries. In 1995, International Metals Reclamation Co. Inc. expanded its operations by building a dedicated cadmium recycling plant. In 2000, an estimated 13 percent of cadmium consumption in the United States was sourced from recycled cadmium, which is derived mainly from old scrap or, to lesser degree, new scrap. The easiest forms of old scrap to recycle are small spent nickel-cadmium batteries followed by flue dust generated during recycling of galvanized steel and small amounts of alloys that contain cadmium. Most of new scrap is generated during manufacturing processes, such as nickel-cadmium battery production. All other uses of cadmium are in low concentrations and, therefore, difficult to recycle. Consequently, much of this cadmium is dissipated and lost. The amount of cadmium in scrap that was unrecovered in 2000 was estimated to be 2,030 metric tons, and an estimated 285 tons was recovered. Recycling efficiency was estimated to be about 15 percent.

  1. Cadmium uptake by the green alga Chlorella emersonii | Arikpo ...

    African Journals Online (AJOL)

    Investigations were carried out on the uptake of the heavy metal cadmium (Cd) by the green alga Chlorella emersonii with the aid of an ion selective electrode. Cadmium uptake by Chlorella was very rapid with 70% of total uptake occurring during the first 10 seconds. Uptake of cadmium by Chlorella showed a direct ...

  2. Cadmium affects the social behaviour of rainbow trout, Oncorhynchus mykiss

    Energy Technology Data Exchange (ETDEWEB)

    Sloman, Katherine A.; Scott, Graham R.; Diao Zhongyu; Rouleau, Claude; Wood, Chris M.; McDonald, D. Gord

    2003-10-29

    The present study investigated both the effects of cadmium on the social interactions of rainbow trout and the differential accumulation of waterborne cadmium among social ranks of fish. Fish exposed to waterborne cadmium concentrations of 2 {mu}g l{sup -1} for 24 h, followed by a 1, 2 or 3 day depuration period in clean water, had a decreased ability to compete with non-exposed fish. However, the competitive ability of exposed fish given a 5 day depuration period was not significantly impaired. Cadmium accumulated in the olfactory apparatus of fish exposed to waterborne cadmium for 24 h and decreased significantly only after 5 days depuration in clean water. Among groups of ten fish held in stream tanks, where all fish were exposed to cadmium, there were significant effects on social behaviour and growth rate. Dominance hierarchies formed faster among fish exposed to cadmium than among control fish, and overall growth rates were higher in the cadmium treatment. In groups of ten fish, social status also affected tissue accumulation of cadmium during waterborne exposure, with dominant fish accumulating more cadmium at the gill. In conclusion, exposure to low levels of cadmium, affects the social behaviour of fish, in part due to accumulation in the olfactory apparatus, and dominant fish accumulate more gill cadmium than subordinates during chronic waterborne exposure.

  3. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    Directory of Open Access Journals (Sweden)

    P. Bala Ramudu

    2007-09-01

    Full Text Available This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself was used as the purging solution. Results showed that 49% reduction of cadmium concentration was achieved in the case of soil saturated (washed with ammonium citrate as well as purging solution also was ammonium citrate. The soil pH and washing solutions were the most important factors in controlling the removal of cadmium in electrokinetic remediation process.

  4. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John

    2013-01-01

    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  5. Toxic effects of Cadmium on the garden snail (Helix aspersa)

    Energy Technology Data Exchange (ETDEWEB)

    Russell, L.K. (Northrop Services Inc., Corvallis, OR); DeHaven, J.I.; Botts, R.P.

    1981-05-01

    Spreading treated municipal wastes on agricultural and forest lands is becoming an established method of disposal. However, there is concern about the deleterious effects of toxicants, particularly cadmium, in the sludges. Cadmium concentrations in sewage sludge have been reported as high as 1500 ppM. The work reported here is a part of a larger project to investigate the ecological effects of municipal wastes on forest lands. Snails, Helix aspersa, were chosen to examine the entrance of cadmium into terrestrial food chains. This experiment was designed to determine cadmium accumulation, acute toxicity, and behavioral, reproductive and growth responses with increasing levels of cadmium.

  6. 48 CFR 2942.101 - Policy.

    Science.gov (United States)

    2010-10-01

    ... 2942.101 Federal Acquisition Regulations System DEPARTMENT OF LABOR CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES Contract Audit Services 2942.101 Policy. The OASAM Division of Cost... for the Department of Labor. ...

  7. Genetics 101 --The Hereditary Material of Life

    Science.gov (United States)

    ... of this page please turn Javascript on. Feature: Genetics 101 Genetics 101 — The Hereditary Material of Life Past Issues / Summer 2013 Table of Contents Genetics is the study of heredity, the process in ...

  8. Cadmium-induced testicular injury.

    Science.gov (United States)

    Siu, Erica R; Mruk, Dolores D; Porto, Catarina S; Cheng, C Yan

    2009-08-01

    Cadmium (Cd) is an environmental toxicant and an endocrine disruptor in humans and rodents. Several organs (e.g., kidney, liver) are affected by Cd and recent studies have illustrated that the testis is exceedingly sensitive to Cd toxicity. More important, Cd and other toxicants, such as heavy metals (e.g., lead, mercury) and estrogenic-based compounds (e.g., bisphenols) may account for the recent declining fertility in men among developed countries by reducing sperm count and testis function. In this review, we critically discuss recent data in the field that have demonstrated the Cd-induced toxicity to the testis is probably the result of interactions of a complex network of causes. This is likely to involve the disruption of the blood-testis barrier (BTB) via specific signal transduction pathways and signaling molecules, such as p38 mitogen-activated protein kinase (MAPK). We also summarize current studies on factors that confer and/or regulate the testis sensitivity to Cd, such as Cd transporters and metallothioneins, the impact of Cd on the testis as an endocrine disruptor and oxidative stress inducer, and how it may disrupt the Zn(2+) and/or Ca(2+) mediated cellular events. While much work is needed before a unified mechanistic pathway of Cd-induced testicular toxicity emerges, recent studies have helped to identify some of the likely mechanisms and/or events that take place during Cd-induced testis injury. Furthermore, some of the recent studies have shed lights on potential therapeutic or preventive approaches that can be developed in future studies by blocking or minimizing the destructive effects of Cd to testicular function in men.

  9. 7 CFR 1160.101 - Act.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Act. 1160.101 Section 1160.101 Agriculture Regulations... Definitions § 1160.101 Act. Act means the Fluid Milk Promotion Act of 1990, Subtitle H of Title XIX of the Food, Agriculture, Conservation, and Trade Act of 1990, Public Law 101-624, 7 U.S.C. 6401-6417, and any...

  10. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    Directory of Open Access Journals (Sweden)

    Brian G. Luckett

    2012-01-01

    Full Text Available Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana. We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P≤0.0001. Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88 and high consumption levels of red meat (4th quartile OR = 6.18 and grains (4th quartile OR = 3.38. Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen.

  11. 34 CFR 101.41 - Computation.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Computation. 101.41 Section 101.41 Education... PRACTICE AND PROCEDURE FOR HEARINGS UNDER PART 100 OF THIS TITLE Time § 101.41 Computation. In computing..., intermediate Saturdays, Sundays, and legal holidays shall be excluded from the computation. ...

  12. 9 CFR 101.6 - Cell cultures.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Cell cultures. 101.6 Section 101.6..., SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.6 Cell cultures. When used in conjunction with or in reference to cell cultures, which may be referred to as tissue cultures...

  13. 12 CFR 545.101 - Fiscal agency.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Fiscal agency. 545.101 Section 545.101 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY FEDERAL SAVINGS ASSOCIATIONS-OPERATIONS § 545.101 Fiscal agency. A Federal savings association designated fiscal agent by the Secretary of...

  14. 19 CFR 357.101 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Definitions. 357.101 Section 357.101 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE SHORT SUPPLY PROCEDURES § 357.101... pricing trends. (c) Interested party means (1) A U.S. producer or consumer of the product; (2) a U.S...

  15. 34 CFR 101.21 - Parties.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Parties. 101.21 Section 101.21 Education Regulations of... AND PROCEDURE FOR HEARINGS UNDER PART 100 OF THIS TITLE Parties § 101.21 Parties. (a) The term party... Department of Education, shall be deemed a party to all proceedings. ...

  16. 47 CFR 101.1109 - Records maintenance.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Records maintenance. 101.1109 Section 101.1109 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Competitive Bidding Procedures for LMDS § 101.1109 Records maintenance. All winning bidders...

  17. 45 CFR 303.101 - Expedited processes.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 2 2010-10-01 2010-10-01 false Expedited processes. 303.101 Section 303.101... STANDARDS FOR PROGRAM OPERATIONS § 303.101 Expedited processes. (a) Definition. Expedited processes means... intrastate cases, expedited processes as specified under this section to establish paternity and to establish...

  18. 7 CFR 1400.101 - Minor children.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Minor children. 1400.101 Section 1400.101 Agriculture... SUBSEQUENT CROP, PROGRAM, OR FISCAL YEARS Payment Limitation § 1400.101 Minor children. (a) Except as provided in paragraph (b) of this section, payments received by a child under 18 years of age as of April 1...

  19. 5 CFR 7101.101 - General.

    Science.gov (United States)

    2010-01-01

    ... OF THE NATIONAL LABOR RELATIONS BOARD § 7101.101 General. (a) Purpose. In accordance with 5 CFR 2635... responsible for reviewing the Confidential Financial Disclosure Reports filed by designated NLRB employees... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false General. 7101.101 Section 7101.101...

  20. 36 CFR 10.1 - Animals available.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Animals available. 10.1 Section 10.1 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR DISPOSAL OF CERTAIN WILD ANIMALS § 10.1 Animals available. From time to time there are surplus live elk...

  1. 39 CFR 601.101 - Effective date.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Effective date. 601.101 Section 601.101 Postal... RIGHTS OTHER THAN PATENTS PURCHASING OF PROPERTY AND SERVICES § 601.101 Effective date. These regulations... that date will be governed by the regulations in effect at the time the solicitation was issued. ...

  2. 34 CFR 101.11 - Appearance.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Appearance. 101.11 Section 101.11 Education Regulations... PRACTICE AND PROCEDURE FOR HEARINGS UNDER PART 100 OF THIS TITLE Appearance and Practice § 101.11 Appearance. A party may appear in person or by counsel and participate fully in any proceeding. A State...

  3. 47 CFR 101.141 - Microwave modulation.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Microwave modulation. 101.141 Section 101.141... SERVICES Technical Standards § 101.141 Microwave modulation. (a) Microwave transmitters employing digital modulation techniques and operating below 25.25 GHz (except for MVDDS stations in the 12,200-12,700 MHz band...

  4. 47 CFR 101.1315 - Service areas.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Service areas. 101.1315 Section 101.1315... SERVICES Multiple Address Systems System License Requirements § 101.1315 Service areas. In the frequency bands not licensed on a site-by-site basis, the geographic service areas for MAS are Economic Areas (EAs...

  5. 47 CFR 101.1501 - Service areas.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Service areas. 101.1501 Section 101.1501 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Service and Technical Rules for the 70/80/90 GHz Bands § 101.1501 Service areas. The 70/80/90 GHz...

  6. 47 CFR 101.523 - Service areas.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Service areas. 101.523 Section 101.523... SERVICES 24 GHz Service and Digital Electronic Message Service § 101.523 Service areas. (a) The service areas for 24 GHz are Economic Areas (EAs) as defined in this paragraph (a). The Bureau of Economic...

  7. 7 CFR 1220.101 - Act.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1220.101 Section 1220.101 Agriculture... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.101 Act. The term Act means the Soybean Promotion, Research, and Consumer Information Act, subtitle E of title XIX, of the Food...

  8. 7 CFR 1280.101 - Act.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Act. 1280.101 Section 1280.101 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.101 Act. Act means the Commodity Promotion, Research, and Information Act of 1996 (7 U.S.C. 7411-7425; Pub. L. 104-127; 110 Stat...

  9. 7 CFR 1150.101 - Act.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Act. 1150.101 Section 1150.101 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Definitions § 1150.101 Act. Act means Title I, Subtitle B, of the Dairy and Tobacco Adjustment Act of 1983...

  10. 5 CFR 4501.101 - General.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false General. 4501.101 Section 4501.101 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE OFFICE OF PERSONNEL MANAGEMENT § 4501.101 General. In accordance with 5 CFR 2635.105, the regulations in this part apply to employees of...

  11. 5 CFR 10.1 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Definitions. 10.1 Section 10.1 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE RULES AGENCY ACCOUNTABILITY SYSTEMS; OPM AUTHORITY TO REVIEW PERSONNEL MANAGEMENT PROGRAMS (RULE X) § 10.1 Definitions. For purposes of this rule— (a) 'Agency' means an Executive agency as...

  12. 5 CFR 470.101 - Statutory authority.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Statutory authority. 470.101 Section 470.101 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PERSONNEL MANAGEMENT RESEARCH PROGRAMS AND DEMONSTRATIONS PROJECTS General Provisions § 470.101 Statutory authority. (a) Section 4702, title 5, United States Code,...

  13. 5 CFR 5301.101 - General.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false General. 5301.101 Section 5301.101 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.101 General. (a) Purpose. In accordance with 5 CFR 2635.105...

  14. 47 CFR 101.1505 - Segmentation plan.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Segmentation plan. 101.1505 Section 101.1505 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Service and Technical Rules for the 70/80/90 GHz Bands § 101.1505 Segmentation plan. (a) An entity...

  15. 45 CFR 73.735-101 - Purpose.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Purpose. 73.735-101 Section 73.735-101 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION STANDARDS OF CONDUCT General Provisions § 73.735-101 Purpose. To assure that the business of the Department of Health and Human Services...

  16. 34 CFR 101.114 - Expeditious treatment.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Expeditious treatment. 101.114 Section 101.114 Education Regulations of the Offices of the Department of Education OFFICE FOR CIVIL RIGHTS, DEPARTMENT OF... § 101.114 Expeditious treatment. Requests for expeditious treatment of matters pending before the...

  17. 47 CFR 101.1525 - RF safety.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false RF safety. 101.1525 Section 101.1525 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Service and Technical Rules for the 70/80/90 GHz Bands § 101.1525 RF safety. Licensees in the 70...

  18. 41 CFR 101-39.205 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 39-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.2-GSA Interagency Fleet Management System Services § 101-39.205 ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true 101-39.205 Section 101-39...

  19. 47 CFR 101.807 - Transmitter power.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Transmitter power. 101.807 Section 101.807... SERVICES Local Television Transmission Service § 101.807 Transmitter power. Stations in this service will not be authorized to use transmitters having a rated power output in excess of the limits set forth in...

  20. 7 CFR 1463.101 - Administration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Administration. 1463.101 Section 1463.101 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF... Payment Program § 1463.101 Administration. (a) The program will be administered under the general...

  1. 5 CFR 831.101 - Administration.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Administration. 831.101 Section 831.101 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE REGULATIONS (CONTINUED) RETIREMENT Administration and General Provisions § 831.101 Administration. (a) OPM has charge of the...

  2. 49 CFR 1503.101 - TSA requirements.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false TSA requirements. 1503.101 Section 1503.101... Scope of Investigative and Enforcement Procedures § 1503.101 TSA requirements. (a) The investigative and enforcement procedures in this part apply to TSA's investigation and enforcement of violations of TSA...

  3. 25 CFR 101.13 - Security.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Security. 101.13 Section 101.13 Indians BUREAU OF INDIAN... § 101.13 Security. (a) United States direct loans shall be secured by such security as the Commissioner may require. A lack of security will not preclude the making of a loan if the proposed use of the...

  4. 41 CFR 101-1.110 - Deviation.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Deviation. 101-1.110 Section 101-1.110 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101-1.110 Deviation...

  5. 40 CFR 133.101 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Definitions. 133.101 Section 133.101... REGULATION § 133.101 Definitions. Terms used in this part are defined as follows: (a) 7-day average. The... pond is used as the principal process, and (3) The treatment works provide significant biological...

  6. 40 CFR 61.101 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Definitions. 61.101 Section 61.101....101 Definitions. As used in this subpart, all terms not defined here have the meaning given them in... factors to account for differences in biological effectiveness due to the quality of radiation and its...

  7. 49 CFR 38.101 - Lighting.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Lighting. 38.101 Section 38.101 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Commuter Rail Cars and Systems § 38.101 Lighting. (a) Any stepwell or...

  8. 29 CFR 541.101 - Business owner.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Business owner. 541.101 Section 541.101 Labor Regulations... Executive Employees § 541.101 Business owner. The term “employee employed in a bona fide executive capacity... equity interest in the enterprise in which the employee is employed, regardless of whether the business...

  9. 19 CFR 101.7 - Customs seal.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Customs seal. 101.7 Section 101.7 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY GENERAL PROVISIONS § 101.7 Customs seal. (a) Design. According to the design furnished by the Department...

  10. 32 CFR 101.5 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Requirements. 101.5 Section 101.5 National... PARTICIPATION IN RESERVE TRAINING PROGRAMS § 101.5 Requirements. (a) Reserve participation—(1) Training requirements under 10 U.S.C. 270(a). (i) Each individual inducted, enlisted, or appointed in the U.S. Armed...

  11. 12 CFR 708b.101 - Mergers generally.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Mergers generally. 708b.101 Section 708b.101 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS AFFECTING CREDIT UNIONS MERGERS OF FEDERALLY-INSURED CREDIT UNIONS; VOLUNTARY TERMINATION OR CONVERSION OF INSURED STATUS Mergers § 708b.101...

  12. 7 CFR 4287.101 - Introduction.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Introduction. 4287.101 Section 4287.101 Agriculture Regulations of the Department of Agriculture (Continued) RURAL BUSINESS-COOPERATIVE SERVICE AND RURAL... § 4287.101 Introduction. (a) This subpart supplements part 4279, subparts A and B, by providing...

  13. 24 CFR 904.101 - Introduction.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Introduction. 904.101 Section 904.101 Housing and Urban Development Regulations Relating to Housing and Urban Development (Continued... LOW RENT HOUSING HOMEOWNERSHIP OPPORTUNITIES Turnkey III Program Description § 904.101 Introduction...

  14. 19 CFR 191.101 - Drawback allowance.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Drawback allowance. 191.101 Section 191.101... Preparations (Including Perfumery) Manufactured From Domestic Tax-Paid Alcohol § 191.101 Drawback allowance. (a....C. 7653(c)). However, there is no authority of law for the allowance of drawback of internal-revenue...

  15. 7 CFR 987.101 - Lot.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Lot. 987.101 Section 987.101 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... RIVERSIDE COUNTY, CALIFORNIA Administrative Rules Definitions § 987.101 Lot. Lot means the aggregate...

  16. 5 CFR 338.101 - Citizenship.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Citizenship. 338.101 Section 338.101 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS QUALIFICATION REQUIREMENTS (GENERAL) Citizenship Requirements § 338.101 Citizenship. (a) A person may be admitted to competitive...

  17. 19 CFR 101.8 - Identification cards.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Identification cards. 101.8 Section 101.8 Customs... GENERAL PROVISIONS § 101.8 Identification cards. Each Customs employee shall be issued an appropriate identification card with that employee's photograph and signature, signed by the appropriate issuing officer. ...

  18. 47 CFR 101.213 - Station identification.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Station identification. 101.213 Section 101.213 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Operational Requirements § 101.213 Station identification. Stations in these services are exempt...

  19. Murine strain differences and the effects of zinc on cadmium concentrations in tissues after acute cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    King, L.M. [ARS USDA, Germplasm and Gamete Physiology Lab., Beltsville, MD (United States); Anderson, M.B. [Dept. of Anatomy, Tulane Univ. School of Medicine, New Orleans, LA (United States); Sikka, S.C. [Dept. of Urology, Tulane Univ. School of Medicine, New Orleans, LA (United States); George, W.J. [Dept. of Pharmacology, Tulane Univ. School of Medicine, New Orleans, LA (United States)

    1998-10-01

    The role of strain differences in cadmium tissue distribution was studied using sensitive (129/J) and resistant (A/J) mice. These murine strains have previously been shown to differ in their susceptibility to cadmium-induced testicular toxicity. Cadmium concentration was measured in testis, epididymis, seminal vesicle, liver, and kidney at 24 h after cadmium chloride exposure (4, 10, and 20 {mu}mol/kg CdCl{sub 2}). The 129/J mice exhibited a significant increase in cadmium concentration in testis, epididymis, and seminal vesicle at all cadmium doses used, compared to A/J mice. However, cadmium concentrations in liver and kidney were not different between the strains, at any dose, indicating that cadmium uptake is similar in these organs at 24 h. These murine strains demonstrate similar hepatic and renal cadmium uptake but significantly different cadmium accumulation in the reproductive organs at 24 h. The mechanism of the protective effect of zinc on cadmium toxicity was studied by assessing the impact of zinc acetate (ZnAc) treatment on cadmium concentrations in 129/J mice after 24 h. Zinc pretreatment (250 {mu}mol/kg ZnAc), given 24 h prior to 20 {mu}mol/kg CdCl{sub 2} administration, significantly decreased the amount of cadmium in the testis, epididymis, and seminal vesicle of 129/J mice, and significantly increased the cadmium content of the liver after 24 h. Cadmium levels in the kidney were unaffected at this time. Zinc pretreatment also prevented the cadmium-induced decrease in testicular sperm concentration and epididymal sperm motility seen in 129/J mice. These findings suggest that the differences in the two murine strains may be attributed partly to the differential accumulation of cadmium in murine gonads. This may be caused by strain differences in the specificity of cadmium transport mechanisms. The protective role of zinc in cadmium-induced testicular toxicity in the sensitive strain may be due to an interference in the cadmium uptake by susceptible

  20. 41 CFR 101-26.505-4-101-26.505-6 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true 101-26.505-4-101-26.505-6 Section 101-26.505-4-101-26.505-6 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 26-PROCUREMENT SOURCES AND...

  1. 41 CFR 101-1.101 - Federal Property Management Regulations System.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Federal Property Management Regulations System. 101-1.101 Section 101-1.101 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1...

  2. 49 CFR 571.101 - Standard No. 101; Controls and displays.

    Science.gov (United States)

    2010-10-01

    ....2.8Each control for an automatic vehicle speed system (cruise control) and each control for heating... 49 Transportation 6 2010-10-01 2010-10-01 false Standard No. 101; Controls and displays. 571.101... Motor Vehicle Safety Standards § 571.101 Standard No. 101; Controls and displays. S1. Scope. This...

  3. Remediation of cadmium by Indian mustard (Brassica juncea L. from cadmium contaminated soil: a phytoextraction study

    Directory of Open Access Journals (Sweden)

    Rajeev Kumar Bhadkariya

    2014-05-01

    Full Text Available Cadmium is a toxic metal for living organisms and an environmental contaminant. Soils in many parts of the world are slightly too moderately contaminated by Cd due to long term use and disposal of Cd-contaminated wastes. Cost effective technologies are needed to remove cadmium from the contaminated sites. Soil phytoextraction is engineering based, low cost and socially accepted developing technology that uses plants to clean up contaminants in soils. This technology can be adopted as a remediation of cadmium from Cd-contaminated soils with the help of Brassica juncea plant. The objective of this work was to evaluate the cadmium (Cd accumulate and the tolerance of Brassica juncea. The Cd accumulates in all parts of plants (roots, stems and leaves. It was found that accumulating efficiency increased with the increase in the concentration of applied cadmium metal solution. Maximum accumulation of cadmium was found in roots than stem and leaves. Phytoextraction coefficient and translocation factor were highest to show the validity of the Brassica juncea species for hyperaccumulation of the Cd metal. These results suggested that Brassica juncea has a high ability to tolerate and accumulate Cd, so it might be a promising plant to be used for phytoextraction of Cd contaminated soil. DOI: http://dx.doi.org/10.3126/ije.v3i2.10533 International Journal of the Environment Vol.3(2 2014: 229-237

  4. Phytotoxicity of cadmium on peroxidation, superoxide dismutase ...

    African Journals Online (AJOL)

    The results indicated that Cd destroyed the balance of free radical metabolisms, which resulted in increasing malondialdehyde (MDA) content and the relative cell membrane permeability (RMP). The kernel yield and kernel rate per pot showed significant decrease under cadmium stress (P < 0.05). The varieties FengHua3 ...

  5. Combustion synthesis of cadmium sulphide nanomaterials for ...

    Indian Academy of Sciences (India)

    Anion-doped cadmium sulphide nanomaterials have been synthesized by using combustionmethod at normal atmospheric conditions. Oxidant/fuel ratios have been optimized in order to obtain CdS with best characteristics. Formation of CdS and size of crystallite were identified by X-ray diffraction and confirmed by ...

  6. Mobiliteit van cadmium in de bodem

    NARCIS (Netherlands)

    Chardon, W.J.

    1984-01-01

    The adsorption of cadmium by twelve Dutch soils was investigated under widely varying circumstances. The adsorption can be described with the Freundlich equation; the parameters of this equation can be predicted using the properties of the soil (pH, organic carbon and clay

  7. Cadmium versus phosphate in the world ocean

    NARCIS (Netherlands)

    Baar, Hein J.W. de; Saager, Paul M.; Nolting, Rob F.; Meer, Jaap van der

    1994-01-01

    Cadmium (Cd) is one of the best studied trace metals in seawater and at individual stations exhibits a more or less linear relation with phosphate. The compilation of all data from all oceans taken from over 30 different published sources into one global dataset yields only a broad scatterplot of Cd

  8. Enhanced Electrokinetic Remediation of Cadmium Contaminated Soil

    African Journals Online (AJOL)

    In an attempt to remediate contaminated soil, a new technique of purging cadmium from soil is examined by enhanced electrokinetic method. It involves the passage of low level direct current between two electrodes in the soil to remove contaminant. An apparatus consisting of four principal parts; soil cell, electrode ...

  9. ( Rattus norvegicus ) Fed with Dietary Cadmium

    African Journals Online (AJOL)

    Histological changes in the kidney tissues of albino rats (Rattus norvegicus) fed 100mg/kg body weight of cadmium sulphate incorporated as food material has been studied in vivo in an acute toxicological experiment. The behavioural pattern and physical changes in the rats were also investigated. Loss of weight and ...

  10. Combustion synthesis of cadmium sulphide nanomaterials for ...

    Indian Academy of Sciences (India)

    The observed enhanced photocatalytic activity of the CdS nanomaterials for the hydrogen production from water (2120 μmol/h) can be attributed to high crystallinity, low band gap and less exciton recombination due to the C and N doping. Keywords. Cadmium sulphide; combustion synthesis; anion doping; water splitting; ...

  11. REPRODUCTIVE EFFECTS OF TRANSGENERATIONAL CADMIUM EXPOSURE

    Science.gov (United States)

    Japanese medaka (Oryzias latipes) were used to compare the effects of environmentally relevant cadmium (Cd) exposure on reproduction in adult animals previously exposed in ovo or as hatchlings. Adults were raised either from eggs produced during a two week exposure to 0, 1, 5, o...

  12. PHYSIOLOGICAL EFFECTS OF TRANSGENERATIONAL CADMIUM EXPOSURE.

    Science.gov (United States)

    A series of assays were modified or developed to use with small fish species, specifically Japanese medaka (Oryzias latipes). These assays were used to compare the effects of environmentally relevant cadmium (Cd) exposure on indicators of endocrine function in adult animals previ...

  13. Characterization of nanocrystalline cadmium telluride thin films ...

    Indian Academy of Sciences (India)

    Unknown

    tion method, successive ionic layer adsorption and reaction (SILAR), are described. For deposition of CdTe thin films, cadmium ... By conducting several trials optimization of the adsorption, reaction and rinsing time duration for CdTe thin film deposition was ... 3.1 Reaction mechanism. CdTe thin films were grown on micro ...

  14. antioxidants, cadmium-induced toxicity, serum biochemical

    African Journals Online (AJOL)

    Daniel Owu

    (1.51/gm) and selenium (0.25mg) which on their own had little or no effects on the serum basal phosphatases, hormonal and histological stability caused a reversal of the cadmium-induced biochemical, hormonal and histological toxicities of the ..... accessory sex tissues atrophy such as the prostate. (Waalkes et al 1997a).

  15. Rising environmental cadmium levels in developing countries ...

    African Journals Online (AJOL)

    Summary: Cadmium (Cd) is a ubiquitous environmental pollutant of increasing worldwide concern. It is thought to be of greater concern to rapidly industrializing developing countries because of the increasing pace of industrial activities in these countries with increasing consumption and release into the environment.

  16. Hepatoprotective activity of Moringa oleifera against cadmium toxicity in rats

    Directory of Open Access Journals (Sweden)

    Reetu Toppo

    2015-04-01

    Full Text Available Aim: The present investigation has been conducted to evaluate the hepatoprotective activity of Moringa oleifera against cadmium-induced toxicity in rats. Materials and Methods: For this study, 18 Wistar albino rats were taken. Control group, Group I rats were given cadmium chloride @ 200 ppm per kg and Group II rats were treated with M. oleifera extract @ 500 mg/kg along with cadmium chloride @ 200 ppm per kg (daily oral for 28 days. On 29th day, animals were slaughtered and various parameters were determined. Serum biomarkers, oxidative stress parameters, histomorphological examination were carried out with estimation of cadmium concentration in liver tissues. Results: Oral administration of cadmium chloride @ 200 ppm/kg for 28 days resulted in a significant increase in aspartate aminotransferase (AST, alanine transaminase (ALT, alkaline phosphatase (ALP, significant (p≤0.01 increase of lipid peroxidation (LPO and decrease in superoxide dismutase (SOD, and increase in cadmium accumulation in liver. Treatment with M. oleifera @ 500 mg/kg significantly (p<0.01 decreased the elevated ALP, AST, ALT, LPO levels and increase in SOD levels, and as compared to cadmium chloride treated group. However, there was no significant difference in cadmium concentration in liver when compared with cadmium chloride treated group. Conclusion: The study conclude that supplementation of M. oleifera (500 mg/kg, daily oral for 28 days has shown protection against cadmium-induced hepatotoxicity.

  17. Enhanced cadmium phytoremediation of Glycine max L. through bioaugmentation of cadmium-resistant bacteria assisted by biostimulation.

    Science.gov (United States)

    Rojjanateeranaj, Pongsarun; Sangthong, Chirawee; Prapagdee, Benjaphorn

    2017-10-01

    This study examined the potential of three strains of cadmium-resistant bacteria, including Micrococcus sp., Pseudomonas sp. and Arthrobacter sp., to promote root elongation of Glycine max L. seedlings, soil cadmium solubility and cadmium phytoremediation in G. max L. planted in soil highly polluted with cadmium with and without nutrient biostimulation. Micrococcus sp. promoted root length in G. max L. seedlings under toxic cadmium conditions. Soil inoculation with Arthrobacter sp. increased the bioavailable fraction of soil cadmium, particularly in soil amended with a C:N ratio of 20:1. Pot culture experiments observed that the highest plant growth was in Micrococcus sp.-inoculated plants with nutrient biostimulation. Cadmium accumulation in the roots, stems and leaves of G. max L. was significantly enhanced by Arthrobacter sp. with nutrient biostimulation. A combined use of G. max L. and Arthrobacter sp. with nutrient biostimulation accelerated cadmium phytoremediation. In addition, cadmium was retained in roots more than in stems and leaves and G. max L. had the lowest translocation factor at all growth stages, suggesting that G. max L. is a phytostabilizing plant. We concluded that biostimulation-assisted bioaugmentation is an important strategy for improving cadmium phytoremediation efficiency. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Assessment and management of risk to wildlife from cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Burger, Joanna [Division of Life Sciences, Environmental and Occupational Health Sciences Institute, Consortium for Risk Evaluation with Stakeholder Participation, Rutgers University, Piscataway, New Jersey, 08854-8082 (United States)], E-mail: burger@biology.rutgers.edu

    2008-01-15

    Cadmium, a nonessential heavy metal that comes from natural and anthropogenic sources, is a teratogen, carcinogen, and a possible mutagen. Assessment of potential risk from cadmium requires understanding environmental exposure, mainly from ingestion, although there is some local exposure through inhalation. Chronic exposure is more problematic than acute exposure for wildlife. There is evidence for bioaccumulation, particularly in freshwater organisms, but evidence for biomagnification up the food chain is inconsistent; in some bird studies, cadmium levels were higher in species that are higher on the food chain than those that are lower. Some freshwater and marine invertebrates are more adversely affected by cadmium exposure than are birds and mammals. There is very little experimental laboratory research on the effects of cadmium in amphibians, birds and reptiles, and almost no data from studies of wildlife in nature. Managing the risk from cadmium to wildlife involves assessment (including ecological risk assessment), biomonitoring, setting benchmarks of effects, regulations and enforcement, and source reduction.

  19. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    Energy Technology Data Exchange (ETDEWEB)

    Koparanova, N.; Simov, S. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Fizika na Tvyrdoto Tyalo); Genchev, D. (Bylgarska Akademiya na Naukite, Sofia. Inst. za Yadrena Izsledvaniya i Yadrena Energetika); Metchenov, G. (Research Inst. of Criminalistics and Criminology, Sofia (Bulgaria))

    1985-02-01

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more.

  20. Schiff bases as cadmium(II) selective ionophores in polymeric membrane electrodes.

    Science.gov (United States)

    Gupta, V K; Singh, A K; Gupta, Barkha

    2007-02-05

    The construction and performance characteristics of polymeric membrane electrodes based on two neutral ionophores, N,N'-[bis(pyridin-2-yl)formylidene]butane-1,4-diamine (S1) and N-(2-pyridinylmethylene)-1,2-benzenediamine (S2) for quantification of cadmium ions, are described. The influences of membrane compositions on the potentiometric response of the electrodes have been found to substantially improve the performance characteristics. The best performance was obtained with the electrode having a membrane composition (w/w) of (S1) (2.15%):PVC (32.2%):o-NPOE (64.5%):KTpClPB (1.07%). The proposed electrode exhibits Nernstian response in the concentration range of 7.9x10(-8) to 1.0x10(-1) M Cd2+ with limit of detection 5.0x10(-8) M, performs satisfactorily over wide pH range (2.0-8.0) with a fast response time (10 s). The sensor has been found to work satisfactorily in partially non-aqueous media up to 30% (v/v) content of methanol, ethanol and acetonitrile and could be used for a period of 2 months. The analytical usefulness of the proposed electrode has been evaluated by its application in the determination of cadmium in real samples. The practical utility of the membrane electrode has also been observed in the presence of surfactants.

  1. Association of Environmental Cadmium Exposure with Pediatric Dental Caries

    OpenAIRE

    Arora, Manish; Weuve, Jennifer Lynn; Schwartz, Joel David; Robert O Wright

    2008-01-01

    Background: Although animal experiments have shown that cadmium exposure results in severe dental caries, limited epidemiologic data are available on this issue. Objectives: We aimed to examine the relationship between environmental cadmium exposure and dental caries in children 6–12 years of age. Methods: We analyzed cross-sectional data, including urine cadmium concentrations and counts of decayed or filled tooth surfaces, from the Third National Health and Nutrition Examination Survey. We ...

  2. Bioremoval of cadmium by lemna minor in different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Uysal, Yagmur [Dept. of Environmental Engineering, Kahramanmaras Sutcu Imam University, Kahramanmaras (Turkey); Taner, Fadime [Dept. of Environmental Engineering, Mersin University, Mersin (Turkey)

    2010-04-15

    This study was undertaken to determine the cadmium removal efficiency of Lemna minor when it was used for treatment of wastewater having different characteristics, i. e., pH, temperature and cadmium concentration. Plants were cultivated in different pH solutions (4.5-8.0) and temperatures (15-35 C) in the presence of cadmium (0.1-10.0 mg/L) for 168 h. The amount of biomass obtained in the study period, the concentrations of cadmium in the tissues and in the media and net uptake of cadmium by Lemna have been determined for each condition. The percentages of cadmium uptake (PMU) and bioconcentration factors (BCF) were also calculated. The highest accumulation was obtained for the highest cadmium concentration of 10.0 mg Cd/L as 11.668 mg Cd/g at pH 6.0, and as 38.650 mg Cd/g at 35 C and pH 5.0. The cadmium accumulation gradually increased with initial concentration of the medium, but the opposite trend was observed for the PMU. However, the maximum PMU was obtained as 52.2% in the solution with the lowest concentration of 0.1 mg Cd/L. A mathematical model was used to describe the cadmium uptake and the equation obtained was seen to fit the experimental data very well. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  3. Short Communication Acute toxicity of cadmium against catfish ...

    African Journals Online (AJOL)

    Short Communication Acute toxicity of cadmium against catfish Heteropneustes Fossilis (Siluriformes: Heteropneustidae) in static renewal bioassays. Rubi Rai, Diwakar Mishra, Sunil Kumar Srivastav, Ajai Kumar Srivastav ...

  4. Inactivation of cadmium in contaminated soils using synthetic zeolites.

    Science.gov (United States)

    Gworek, B

    1992-01-01

    The addition of synthetic zeolite pellets to soils contaminated with cadmium significantly reduced the concentrations of cadmium in the roots and shoots of a range of crop plants. Use of synthetic foyazite group zeolites types 4A and 13X, at application rates of 1% by soil weight, caused reductions in cadmium concentrations of up to 86% in leaves of lettuce grown in pots, compared to controls with no added zeolites. The potential of these substances to reduce cadmium entry into the food chain, and as a clean up method, is noted.

  5. Balance ability in 7- and 10-year-old children: associations with prenatal lead and cadmium exposure and with blood lead levels in childhood in a prospective birth cohort study.

    Science.gov (United States)

    Taylor, Caroline M; Humphriss, Rachel; Hall, Amanda; Golding, Jean; Emond, Alan M

    2015-12-30

    Most studies reporting evidence of adverse effects of lead and cadmium on the ability to balance have been conducted in high-exposure groups or have included adults. The effects of prenatal exposure have not been well studied, nor have the effects in children been directly studied. The aim of the study was to identify the associations of lead (in utero and in childhood) and cadmium (in utero) exposure with the ability to balance in children aged 7 and 10 years. Prospective birth cohort study. Maternal blood lead (n=4285) and cadmium (n=4286) levels were measured by inductively coupled plasma mass spectrometry in women enrolled in the Avon Longitudinal Study of Parents and Children (ALSPAC) during pregnancy. Child lead levels were measured in a subsample of 582 of ALSPAC children at age 30 months. Children completed a heel-to-toe walking test at 7 years. At 10 years, the children underwent clinical tests of static and dynamic balance. Statistical analysis using SPSS V.19 included logistic regression modelling, comparing categories of ≥ 5 vs lead, and ≥ 1 vs lead or cadmium exposure (adjusted OR for balance dysfunction: Pb 1.01 (95% CI 0.95 to 1.01), n=1732; Cd 0.95 (0.77 to 1.20), n=1734), or with elevated child blood lead level at age 30 months (adjusted OR 0.98 (0.92 to 1.05), n=354). Similarly, neither measures of static nor dynamic balance at age 10 years were associated with in utero lead or cadmium exposure, or child lead level. These findings do not provide any evidence of an association of prenatal exposure to lead or cadmium, or lead levels in childhood, on balance ability in children. Confirmation in other cohorts is needed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  6. Mercury Cadmium Selenide for Infrared Detection

    Science.gov (United States)

    2013-06-01

    were grown using elemental mercury (Hg), cadmium (Cd), and selenium (Se) sources. The beam equiva- lent pressure ( BEP ) emanating from all sources was...flux), the BEP measured for the cracker source was found to vary with the cracking zone temperature, tracking with the data found in Ref. 7. This sug...The Se BEP measured for the typical cracking zone temperature of 800 C was found to be close to a factor of two lower than at the typical effusion cell

  7. Cadmium-binding proteins from blue crabs (Callinectes sapidus) environmentally exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Wiedow, M.A.; Kneip, T.J.; Garte, S.J.

    1982-06-01

    Two heat-stable (90/sup 0/C) cadmium-binding proteins were isolated from the hepatopancreas of Hudson River blue crabs (Callinectes sapidus) by Sephadex G-75 gel filtration chromatography. These proteins have molecular weights of 10,600 and 9,400, and ultraviolet absorbance ratios at 250/280 nm of 12.4 and 5.4, respectively. Repeated freezing and thawing and prolonged (3-6 weeks) storage resulted in protein degradation or loss of Cd-binding activity. These proteins were induced by laboratory injection of CdCl/sub 2/ in blue crabs from pristine (Chesapeake Bay) areas; however, injection of CdCl/sub 2/ into Hudson River animals yielded anomalous chromatography profiles. Cadmium-binding proteins were also identified in blue crab thoracic muscle and gill. The possibility is discussed that these proteins are a type of metallothionein and could contribute to the human toxicity of this cadmium-contaminated edible crustacean.

  8. Cadmium concentrations in the testes, sperm, and spermatids of mice subjected to long-term cadmium chloride exposure.

    Science.gov (United States)

    Bench, G; Corzett, M H; Martinelli, R; Balhorn, R

    1999-01-01

    Exposures to cadmium have been reported to reduce male fertility and there are several hypotheses that suggest how reduced male fertility may result from incorporation of cadmium into sperm chromatin. The purpose of this study was to determine whether mice subjected to long-term intraperitoneal cadmium exposure incorporated cadmium into their sperm chromatin. Male mice were exposed to 0.1 mg/kg body weight cadmium in the form of CdCl2 via intraperitoneal injection once per week for 4, 10, 26, and 52 weeks and then sacrificed. The cadmium contents of the liver, testes, pooled sperm, and pooled spermatids from dosed and control animals were determined by atomic absorption spectroscopy. Cadmium and zinc contents in individual sperm and spermatid heads were determined by particle-induced x-ray emission. Atomic absorption spectroscopy revealed that although cadmium accumulated in the liver and testes, cadmium was not detected in pooled sperm or spermatid samples down to minimum detectable limits of 0.02 microg/g dry weight. Particle-induced x-ray emission analyses did not show the presence of cadmium in any sperm or spermatid head down to minimum detectable limits of 15 microg/g dry weight. Particle-induced x-ray emission analyses also demonstrated that phosphorus, sulfur, and zinc concentrations in individual sperm and spermatid heads were not altered by exposure to CdCl2. Because cadmium was not incorporated into sperm chromatin at levels above 0.02 microg/g dry weight, the data cast doubt on hypotheses that suggest that reduced male fertility may result from incorporation of cadmium into sperm chromatin.

  9. Bioaugmentation with cadmium-resistant plant growth-promoting rhizobacteria to assist cadmium phytoextraction by Helianthus annuus.

    Science.gov (United States)

    Prapagdee, Benjaphorn; Chanprasert, Maesinee; Mongkolsuk, Skorn

    2013-07-01

    Micrococcus sp. MU1 and Klebsiella sp. BAM1, the cadmium-resistant plant growth-promoting rhizobacteria (PGPR), produce high levels of indole-3-acetic acid (IAA) during the late stationary phase of their growth. The ability of PGPR to promote root elongation, plant growth and cadmium uptake in sunflowers (Helianthus annuus) was evaluated. Both species of bacteria were able to remove cadmium ions from an aqueous solution and enhanced cadmium mobilization in contaminated soil. Micrococcus sp. and Klebsiella sp. use aminocyclopropane carboxylic acid as a nitrogen source to support their growth, and the minimum inhibitory concentrations of cadmium for Micrococcus sp. and Klebsiella sp. were 1000 and 800mM, respectively. These bacteria promoted root elongation in H. annuus seedlings in both the absence and presence of cadmium compared to uninoculated seedlings. Inoculation with these bacteria was found to increase the root lengths of H. annuus that had been planted in cadmium-contaminated soil. An increase in dry weight was observed for H. annuus inoculated with Micrococcus sp. Moreover, Micrococcus sp. enhanced the accumulation of cadmium in the root and leaf of H. annuus compared to untreated plants. The highest cadmium accumulation in the whole plant was observed when the plants were treated with EDTA following the treatment with Micrococcus sp. In addition, the highest translocation of cadmium from root to the above-ground tissues of H. annuus was found after treatment with Klebsiella sp. in the fourth week after planting. Our results show that plant growth and cadmium accumulation in H. annuus was significantly enhanced by cadmium-resistant PGPRs, and these bacterial inoculants are excellent promoters of phytoextraction for the rehabilitation of heavy metal-polluted environments. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium chloride in rats. An experiment where 40 rats were divided into 4 groups and a control group and dosed...... with whole linseed, crushed linseed, cocoa and CdCl2 for 3 weeks was performed. Linseed or cocoa made up 10% of the feed (by weight) and was added as a replacement for carbohydrate source. The rats were dosed for 3 weeks and the cadmium content in the rats' kidneys was measured by ICPMS as a biomarker...... be measured in the kidney compared to the calculated total intake was as follows: Control 2.0 %, Crushed linseed 0.9 %, whole linseed, 1.5 %, cocoa 0.7 % and CdCl2 4.6 %. Based on this study it could not be concluded that the bioavailability in rats form whole linseed is lower that for crushed linseed...

  11. Acute fatal occupational cadmium poisoning by inhalation

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, K.; Ueda, M.; Kikuchi, H.; Hattori, H.; Hiraoka, Y.

    1983-01-01

    A 43-year-old male smelter was admitted to a hospital on account of severe dyspnea about 2 days after exposure to brownish-yellow smoke produced by melting of ''copper'' scrap. On admission pronounced hypoxemia was revealed, and an oxygen-enriched gas was administered after intubation. Although inspired oxygen concentration was gradually increased, hypoxemia progressed and he died on day 11 in hospital. The principal autopsy finding was chiefly confined to the lungs. Both lungs were heavy (the left weighing 1,470 g; the right 1,710 g) and firm to the touch. Histologically, no normal alveoli were found throughout the entire lung. Some alveolar spaces were occupied by pneumocytes, others by organized exudate with fibrosis. Interstitial fibrosis was present. Patchy areas of inflammatory cell infiltrations as well as intra-alveolar hemorrhages were observed. On the basis of the above findings a diagnosis of diffuse alveolar damage was made. Based on the available evidence (presence of cadmium in the ''copper'' scrap, feature of the smoke, clinical signs with latent time, and high cadmium concentration of the lung), the diffuse alveolar damage was considered to have been caused by inhaled cadmium. The pulmonary change of the present case was more advanced in pathologic stage in comparison with those reported in the literature.

  12. Active sulforhodamine 101 uptake into hippocampal astrocytes.

    Directory of Open Access Journals (Sweden)

    Christian Schnell

    Full Text Available Sulforhodamine 101 (SR101 is widely used as a marker of astrocytes. In this study we investigated labeling of astrocytes by SR101 in acute slices from the ventrolateral medulla and the hippocampus of transgenic mice expressing EGFP under the control of the astrocyte-specific human GFAP promoter. While SR101 efficiently and specifically labeled EGFP-expressing astrocytes in hippocampus, we found that the same staining procedure failed to label astrocytes efficiently in the ventrolateral medulla. Although carbenoxolone is able to decrease the SR101-labeling of astrocytes in the hippocampus, it is unlikely that SR101 is taken up via gap-junction hemichannels because mefloquine, a blocker for pannexin and connexin hemichannels, was unable to prevent SR101-labeling of hippocampal astrocytes. However, SR101-labeling of the hippocampal astrocytes was significantly reduced by substrates of organic anion transport polypeptides, including estron-3-sulfate and dehydroepiandrosterone sulfate, suggesting that SR101 is actively transported into hippocampal astrocytes.

  13. Do cadmium, lead, and aluminum in drinking water increase the risk of hip fractures? A NOREPOS study.

    Science.gov (United States)

    Dahl, Cecilie; Søgaard, Anne Johanne; Tell, Grethe S; Flaten, Trond Peder; Hongve, Dag; Omsland, Tone Kristin; Holvik, Kristin; Meyer, Haakon E; Aamodt, Geir

    2014-01-01

    The aim of this study was to investigate relations between cadmium, lead, and aluminum in municipality drinking water and the incidence of hip fractures in the Norwegian population. A trace metals survey in 566 waterworks was linked geographically to hip fractures from hospitals throughout the country (1994-2000). In all those supplied from these waterworks, 5,438 men and 13,629 women aged 50-85 years suffered a hip fracture. Poisson regression models were fitted, adjusting for age, region of residence, urbanization, and type of water source as well as other possibly bone-related water quality factors. Effect modification by background variables and interactions between water quality factors were examined (correcting for false discovery rate). Men exposed to a relatively high concentration of cadmium (IRR = 1.10; 95 % CI 1.01, 1.20) had an increased risk of fracture. The association between relatively high lead and hip fracture risk was significant in the oldest age group (66-85 years) for both men (IRR = 1.11; 95 % CI 1.02, 1.21) and women (IRR = 1.10; 95 % CI 1.04, 1.16). Effect modification by degree of urbanization on hip fracture risk in men was also found for all three metals: cadmium, lead, and aluminum. In summary, a relatively high concentration of cadmium, lead, and aluminum measured in drinking water increased the risk of hip fractures, but the associations depended on gender, age, and urbanization degree. This study could help in elucidating the complex effects on bone health by risk factors found in the environment.

  14. Correlative characteristic of cadmium in soils of steppe Dnieper region

    Directory of Open Access Journals (Sweden)

    N. M. Tsvetkova

    2015-09-01

    Full Text Available Much attention is paid to searching for methods of establishing environmental standards for objective assessment of admissibility of anthropogenic load on the biosphere. The main pollutants of the environment are xenobiotics; heavy metals such as cadmium occupy hold a special place among them. Cadmium is one of the most dangerous environmental toxic agents, belonging to the 1stclass of hazard. Due to insufficient and fragmented information available on the distribution of cadmium in the city edaphotopes, it’s necessary to conduct additional research, taking into account the properties of soils and the biological characteristics of every element. The paper shows the ratio of cadmium in soils and soil-forming rocks of steppe Dnieper region. Environmental assessment of cadmium content in Dniprodzerzhinsk city soilsis made, and the problem of topsoil contamination of the city as a territory of high anthropogenic load is considered. It is found that the content of cadmium down the profile in natural soil increases. Enrichment of the topsoil with cadmium occurs due to contamination. The value of movable forms content, expressed as a percentage of the total content, varies from 12% to 70%, providing the evidence of the technogenic origin of cadmium in Dniprodzerzhinsk city topsoil. General and proximate correlation analyses of interrelation of soil cadmium and specifically selected characteristics of soil (pH, humus, sulfate ions, dry solid, chloride ions, total alkalinity, hygroscopic moisture were made. It is established that cadmium concentration in the movable forms of natural soils of the steppe Dnieper region depends primarily on pH value. With the increase in pH value, concentration of movable cadmium in soil increases.

  15. Mutagenic effect of cadmium on tetranucleotide repeats in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Slebos, Robbert J.C. [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States) and Department of Otolaryngology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States)]. E-mail: r.slebos@vanderbilt.edu; Li Ming [Department of Biostatistics, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Evjen, Amy N. [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Coffa, Jordy [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Shyr, Yu [Department of Biostatistics, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Yarbrough, Wendell G. [Department of Cancer Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States); Department of Otolaryngology, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN 37232 (United States)

    2006-12-01

    Cadmium is a human carcinogen that affects cell proliferation, apoptosis and DNA repair processes that are all important to carcinogenesis. We previously demonstrated that cadmium inhibits DNA mismatch repair (MMR) in yeast cells and in human cell-free extracts (H.W. Jin, A.B. Clark, R.J.C. Slebos, H. Al-Refai, J.A. Taylor, T.A. Kunkel, M.A. Resnick, D.A. Gordenin, Cadmium is a mutagen that acts by inhibiting mismatch repair, Nat. Genet. 34 (3) (2003) 326-329), but cadmium also inhibits DNA excision repair. For this study, we selected a panel of three hypermutable tetranucleotide markers (MycL1, D7S1482 and DXS981) and studied their suitability as readout for the mutagenic effects of cadmium. We used a clonal derivative of the human fibrosarcoma cell line HT1080 to assess mutation levels in microsatellites after cadmium and/or N-methyl-N-nitro-N-nitrosoguanidine (MNNG) exposure to study effects of cadmium in the presence or absence of base damage. Mutations were measured in clonally expanded cells obtained by limiting dilution after exposure to zero dose, 0.5 {mu}M cadmium, 5 nM MNNG or a combination of 0.5 {mu}M cadmium and 5 nM MNNG. Exposure of HT1080-C1 to cadmium led to statistically significant increases in microsatellite mutations, either with or without concurrent exposure to MNNG. A majority of the observed mutant molecules involved 4-nucleotide shifts consistent with DNA slippage mutations that are normally repaired by MMR. These results provide evidence for the mutagenic effects of low, environmentally relevant levels of cadmium in intact human cells and suggest that inhibition of DNA repair is involved.

  16. Cadmium induces transcription independently of intracellular calcium mobilization.

    Directory of Open Access Journals (Sweden)

    Brooke E Tvermoes

    Full Text Available BACKGROUND: Exposure to cadmium is associated with human pathologies and altered gene expression. The molecular mechanisms by which cadmium affects transcription remain unclear. It has been proposed that cadmium activates transcription by altering intracellular calcium concentration ([Ca(2+](i and disrupting calcium-mediated intracellular signaling processes. This hypothesis is based on several studies that may be technically problematic; including the use of BAPTA chelators, BAPTA-based fluorescent sensors, and cytotoxic concentrations of metal. METHODOLOGY/PRINCIPAL FINDING: In the present report, the effects of cadmium on [Ca(2+](i under non-cytotoxic and cytotoxic conditions was monitored using the protein-based calcium sensor yellow cameleon (YC3.60, which was stably expressed in HEK293 cells. In HEK293 constitutively expressing YC3.60, this calcium sensor was found to be insensitive to cadmium. Exposing HEK293::YC3.60 cells to non-cytotoxic cadmium concentrations was sufficient to induce transcription of cadmium-responsive genes but did not affect [Ca(2+](i mobilization or increase steady-state mRNA levels of calcium-responsive genes. In contrast, exposure to cytotoxic concentrations of cadmium significantly reduced intracellular calcium stores and altered calcium-responsive gene expression. CONCLUSIONS/SIGNIFICANCE: These data indicate that at low levels, cadmium induces transcription independently of intracellular calcium mobilization. The results also support a model whereby cytotoxic levels of cadmium activate calcium-responsive transcription as a general response to metal-induced intracellular damage and not via a specific mechanism. Thus, the modulation of intracellular calcium may not be a primary mechanism by which cadmium regulates transcription.

  17. 46 CFR 502.101 - Computation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 9 2010-10-01 2010-10-01 false Computation. 502.101 Section 502.101 Shipping FEDERAL... Computation. In computing any period of time under the rules in this part, the time begins with the day... from the computation. ...

  18. Library 101: Why, How, and Lessons Learned

    Science.gov (United States)

    Porter, Michael; King, David Lee

    2010-01-01

    This article describes how and why the Library 101 Project was created and the lessons that the developers learned out of this project. The Library 101 is a project that challenges librarians to revise the paradigm of "basic" library services in order to remain relevant in this technology-driven world. It was developed by Michael Porter,…

  19. 41 CFR 101-30.501 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... classification of personal property under the control of Federal agencies and to maintain uniform item management... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Applicability. 101-30.501 Section 101-30.501 Public Contracts and Property Management Federal Property Management Regulations System...

  20. 48 CFR 2801.101 - Purpose.

    Science.gov (United States)

    2010-10-01

    ... the contractual relationship between the Department and potential or existing contractors. The JAR... 2801.101 Federal Acquisition Regulations System DEPARTMENT OF JUSTICE General DEPARTMENT OF JUSTICE ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 2801.101 Purpose. (a) The Justice Acquisition...

  1. 5 CFR 2604.101 - Purpose.

    Science.gov (United States)

    2010-01-01

    ... AND SCHEDULE OF FEES FOR THE PRODUCTION OF PUBLIC FINANCIAL DISCLOSURE REPORTS General Provisions... reproduction and mailing of public financial disclosure reports requested by any person. ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Purpose. 2604.101 Section 2604.101...

  2. 7 CFR 1421.101 - Maturity dates.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity dates. 1421.101 Section 1421.101 Agriculture... Maturity dates. (a)(1) All marketing assistance loans shall mature on demand by CCC and no later than the... filed and disbursed except, for transferred marketing assistance loan collateral. The maturity date for...

  3. 41 CFR 101-27.202 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Applicability. 101-27.202 Section 101-27.202 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 27-INVENTORY MANAGEMENT 27.2-Management of...

  4. 41 CFR 101-30.604 - Availability.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Availability. 101-30.604 Section 101-30.604 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.6-GSA Section...

  5. 41 CFR 101-29.202 - Standard.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Standard. 101-29.202 Section 101-29.202 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 29-FEDERAL PRODUCT DESCRIPTIONS 29.2...

  6. 10 CFR 434.101 - Scope.

    Science.gov (United States)

    2010-01-01

    ... occupant comfort and sanitation, and which impose thermal loads in excess of 5% of the loads that would... BUILDINGS Administration and Enforcement-General § 434.101 Scope. 101.1 This part provides design requirements for the building envelope, electrical distribution systems and equipment for electric power...

  7. 47 CFR 101.64 - Service areas.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Service areas. 101.64 Section 101.64... Service areas. Service areas for 38.6-40.0 GHz service are Economic Areas (EAs) as defined below. EAs are.... Additionally, there are four EA-like areas: Guam and Northern Mariana Islands; Puerto Rico and the U.S. Virgin...

  8. 47 CFR 101.1401 - Service areas.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Service areas. 101.1401 Section 101.1401... Service areas. Multichannel Video Distribution and Data Service (MVDDS) is licensed on the basis of Designated Market Areas (DMAs). The 214 DMA service areas are based on the 210 Designated Market Areas...

  9. 5 CFR 792.101 - Statutory requirements.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Statutory requirements. 792.101 Section 792.101 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE REGULATIONS (CONTINUED) FEDERAL EMPLOYEES' HEALTH AND COUNSELING PROGRAMS Regulatory Requirements for Alcoholism and Drug...

  10. 41 CFR 101-26.301 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Applicability. 101-26.301 Section 101-26.301 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 26-PROCUREMENT SOURCES AND PROGRAM 26.3...

  11. 41 CFR 101-26.607 - Billings.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Billings. 101-26.607 Section 101-26.607 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 26-PROCUREMENT SOURCES AND PROGRAM 26.6...

  12. 41 CFR 101-26.601 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true 101-26.601 Section 101-26.601 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 26-PROCUREMENT SOURCES AND PROGRAM 26.6-Procurement...

  13. 41 CFR 101-26.504 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true 101-26.504 Section 101-26.504 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 26-PROCUREMENT SOURCES AND PROGRAM 26.5-GSA...

  14. 10 CFR 34.101 - Notifications.

    Science.gov (United States)

    2010-01-01

    ... manufacturer and model number of equipment involved in the incident; (4) Place, date, and time of the incident... 10 Energy 1 2010-01-01 2010-01-01 false Notifications. 34.101 Section 34.101 Energy NUCLEAR REGULATORY COMMISSION LICENSES FOR INDUSTRIAL RADIOGRAPHY AND RADIATION SAFETY REQUIREMENTS FOR INDUSTRIAL...

  15. 7 CFR 1900.101 - General.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false General. 1900.101 Section 1900.101 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS-COOPERATIVE SERVICE, RURAL UTILITIES SERVICE, AND FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE PROGRAM REGULATIONS...

  16. 48 CFR 3001.101 - Purpose.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Purpose. 3001.101 Section... ACQUISITION REGULATION (HSAR) GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 3001.101 Purpose. The Department of Homeland Security Acquisition Regulation (HSAR) establishes uniform...

  17. 48 CFR 2901.101 - Purpose.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Purpose. 2901.101 Section... ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2901.101 Purpose. (a) Chapter 29, Department of... System of the Code of Federal Regulations. (b) The purpose of the DOLAR is to implement the FAR, and to...

  18. 41 CFR 101-28.301 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Applicability. 101-28.301 Section 101-28.301 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 28-STORAGE AND DISTRIBUTION 28.3-Customer...

  19. 23 CFR 660.101 - Purpose.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Purpose. 660.101 Section 660.101 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS SPECIAL PROGRAMS... assist rural and community economic development and promote tourism and travel. ...

  20. 47 CFR 101.1425 - RF safety.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false RF safety. 101.1425 Section 101.1425 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE... safety. MVDDS stations in the 12.2-12.7 GHz frequency band do not operate with output powers that equal...

  1. 49 CFR 229.101 - Engines.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Engines. 229.101 Section 229.101 Transportation... Engines. (a) The temperature and pressure alarms, controls and related switches of internal combustion engines shall function properly. (b) Whenever an engine has been shut down due to mechanical or other...

  2. 12 CFR 303.101 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Definitions. 303.101 Section 303.101 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION PROCEDURE AND RULES OF PRACTICE FILING PROCEDURES Change of... person who holds the title of president, chief executive officer, chief operating officer, chief managing...

  3. 40 CFR 430.101 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Specialized definitions. 430.101 Section 430.101 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES....01 of this part shall apply to this subpart. (b) Noncorrugating medium furnish subdivision mills are...

  4. 41 CFR 101-45.002 - Gold.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed bid...

  5. 41 CFR 101-4.310 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Recruitment. 101-4.310... Admission and Recruitment Prohibited § 101-4.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient... recruitment and admission of students. A recipient may be required to undertake additional recruitment efforts...

  6. 41 CFR 101-4.510 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Recruitment. 101-4.510... Employment in Education Programs or Activities Prohibited § 101-4.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring...

  7. 5 CFR 410.101 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... organizational needs in response to human resource plans and re-engineering, downsizing, restructuring, and/or... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Definitions. 410.101 Section 410.101 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS TRAINING General Provisions...

  8. 41 CFR 101-39.002 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Applicability. 101-39.002 Section 101-39.002 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 39-INTERAGENCY FLEET...

  9. 41 CFR 101-5.102 - Definitions.

    Science.gov (United States)

    2010-07-01

    ..., incinerators, or similar facilities. Excluded are interagency fleet management centers established pursuant to... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Definitions. 101-5.102 Section 101-5.102 Public Contracts and Property Management Federal Property Management Regulations System...

  10. 41 CFR 101-39.200 - Scope.

    Science.gov (United States)

    2010-07-01

    ... participating agencies. These services may be furnished through commercial rental companies, private sector... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Scope. 101-39.200 Section 101-39.200 Public Contracts and Property Management Federal Property Management Regulations System...

  11. 31 CFR 101.7 - Exceptions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Exceptions. 101.7 Section 101.7 Money and Finance: Treasury Regulations Relating to Money and Finance MITIGATION OF FORFEITURE OF... smelting the gold coins exceeds the value of the gold bullion to be returned. ...

  12. 41 CFR 101-29.210 - Product.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Product. 101-29.210... FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 29-FEDERAL PRODUCT DESCRIPTIONS 29.2-Definitions § 101-29.210 Product. The term product is any end item, either manufactured or produced, and also...

  13. 7 CFR 4279.101 - Introduction.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Introduction. 4279.101 Section 4279.101 Agriculture Regulations of the Department of Agriculture (Continued) RURAL BUSINESS-COOPERATIVE SERVICE AND RURAL... Introduction. (a) Content. This subpart contains loan processing regulations for the Business and Industry (B&I...

  14. 48 CFR 39.101 - Policy.

    Science.gov (United States)

    2010-10-01

    ... OMB Circular A-127, Financial Management Systems, when acquiring financial management systems. Agencies may acquire only core financial management software certified by the Joint Financial Management... CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY General 39.101 Policy. (a) Division A, Section 101(h), Title...

  15. 41 CFR 101-4.540 - Advertising.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Advertising. 101-4.540... Employment in Education Programs or Activities Prohibited § 101-4.540 Advertising. A recipient shall not in any advertising related to employment indicate preference, limitation, specification, or...

  16. 40 CFR 417.101 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 417.101 Section 417.101 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Air-SO3 Sulfation and Sulfonation...

  17. 5 CFR 185.101 - Purpose.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Purpose. 185.101 Section 185.101 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES.... The subpart establishes administrative procedures for imposing civil penalties and assessments against...

  18. 41 CFR 101-4.500 - Employment.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Employment. 101-4.500... Employment in Education Programs or Activities Prohibited § 101-4.500 Employment. (a) General. (1) No person... subjected to discrimination in employment, or recruitment, consideration, or selection therefor, whether...

  19. 31 CFR 800.101 - Scope.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Scope. 800.101 Section 800.101 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF INVESTMENT SECURITY, DEPARTMENT OF THE TREASURY REGULATIONS PERTAINING TO MERGERS, ACQUISITIONS, AND TAKEOVERS BY...

  20. Determination of cadmium, lead and mercury residual levels in meat ...

    African Journals Online (AJOL)

    Determination of cadmium, lead and mercury residual levels in meat of canned light tuna ( Katsuwonus pelamis and Thunnus albacares ) and fresh little tunny ( Euthynnus alletteratus ) in Libya. ... Surveillance for mercury (Hg), lead (Pb) and cadmium (Cd) contamination in tuna products is crucial for consumer food safety.

  1. Biosorption of arsenic and cadmium from aqueous solutions ...

    African Journals Online (AJOL)

    The biosorption of cadmium and arsenic from aqueous solutions onto the unmodified compact biomass of microscopic filamentous fungus Aspergillus clavatus DESM. was studied in the concentration range of 0.25 – 100 mg.l-1. The experimental biosorption results for arsenic and cadmium followed well the Freundlich ...

  2. Synthesis and characterization of cadmium doped lead–borate ...

    Indian Academy of Sciences (India)

    Unknown

    No boroxol ring formation was observed in the structure of these glasses. Furthermore, doped cadmium atoms were not seen in tetrahedral coordination. But the conversion of three-fold to four-fold coordination of boron atoms in the structure of glasses was observed. Keywords. Cadmium; lead borate glasses. 1. Introduction.

  3. Cadmium ion removal using biosorbents derived from fruit peel wastes

    Directory of Open Access Journals (Sweden)

    Wanna Saikaew

    2009-11-01

    Full Text Available The ability of fruit peel wastes, corn, durian, pummelo, and banana, to remove cadmium ions from aqueous solution by biosorption were investigated. The experiments were carried out by batch method at 25oC. The influence of particle sizes, solution pH, and initial cadmium ion concentrations were evaluated on the biosorption studies. The result showed that banana peel had the highest cadmium ions removal followed by durian, pummelo, and corn peels at cadmium ions removal of 73.15, 72.17, 70.56, and 51.22%, respectively. There was a minimal effect when using different particle sizes of corn peel as biosorbent, while the particle size of the others had no influence on the removal of cadmium ions. The cadmium ions removal increased significantly as the pH of the solution increased rapidly from 1 to 5. At pH 5, the cadmium ions removal reached a maximum value. The equilibrium process was best described by the Langmuir isotherms, with maximum biosorption capacities of durian, pummelo, and banana peel of 18.55, 21.83, and 20.88 mg/g respectively. Fourier Transform Infrared Spectroscopy revealed that carboxyl, hydroxyl, and amide groups on the fruit peels’ surface and these groups were involved in the adsorption of the cadmium ions.

  4. Levels of cadmium in cigarette brands found in Zamfara state ...

    African Journals Online (AJOL)

    The levels of cadmium were determined in some cigarette brands found in Zamfara state, North-west Nigeria. The solutions of the samples were prepared using the dry-ash method. The levels of cadmium in the solution were determined using atomic absorption spectrometer. The absorbance readings of the elements were ...

  5. Levels of Lead, Cadmium and Chromium in Oreochromis Niloticus ...

    African Journals Online (AJOL)

    Lead (Pb), Cadmium (Cd) and Chromium (Cr) levels in Oreochromis niloticus, aquatic plants, water and sawdust were collected and analyzed for Lead, Cadmium and Chromium using atomic absorption spectroscopy. Results obtained showed that sawdust had the highest Lead and Chromium contents of 32.0 + 0.99 μg/g ...

  6. Evaluation of serum levels of cadmium and Lead in occupationally ...

    African Journals Online (AJOL)

    Cadmium and Lead are extremely toxic metals found in industrial workplaces. They are also found in some industrial paints and may represent hazards when sprayed.Exposure to Cadmium fumes may cause flu-like symptoms including chills, fever and muscle ache sometimes reffered to as "the cadium blues." Occupational ...

  7. Cadmium verification measurements of HFIR shroud assembly 22

    Energy Technology Data Exchange (ETDEWEB)

    Chapman, J.A.; Schultz, F.J.

    1994-04-01

    This report discusses radiation-based nondestructive examination methods which have been used to successfully verify the presence of cadmium in High Flux Isotope Reactor (HFIR) spent-fuel shroud assembly number 22 (SA22). These measurements show, in part, that SA22 is certified to meet the criticality safety specifications for a proposed reconfiguration of the HFIR spent-fuel storage array. Measurement of the unique 558.6-keV gamma-ray from neutron radiative capture on cadmium provided conclusive evidence for the presence of cadmium in the outer shroud of the assembly. Cadmium verification in the center post and outer shroud was performed by measuring the degree of neutron transmission in SA22 relative to two calibration shroud assemblies. Each measurement was performed at a single location on the center post and outer shroud. These measurements do not provide information on the spatial distribution or uniformity of cadmium within an assembly. Separate measurements using analog and digital radiography were performed to (a) globally map the continuity of cadmium internal mass, and (b) locally determine the thickness of cadmium. Radiography results will be reported elsewhere. The measurements reported here should not be used to infer the thickness of cadmium in either the center post or outer shroud of an assembly.

  8. The relationship between maternal blood cadmium, zinc levels and ...

    African Journals Online (AJOL)

    The delivery of babies with low birth weight is a prognosis of neonatal mortality, morbidity and poor health outcomes later in life. This study evaluates the levels of cadmium, zinc and calculated cadmium/zinc ratio in non-occupationally exposed pregnant women at delivery and their relationship with birth weight of babies.

  9. Elevated cadmium exposure may be associated with periodontal bone loss.

    Science.gov (United States)

    Dye, Bruce A; Dillon, Charles F

    2010-06-01

    Association of environmental cadmium exposure with periodontal disease in US adults. Arora M, Weuve J, Schwartz J, Wright RO. Environ Health Perspect 2009;117:739-44. Bruce A. Dye, DDS, MPH, Charles F. Dillon, MD, PhD. Is environmental cadmium associated with periodontal disease? Information not available. Cross-sectional study. Level 3: Other evidence. Not applicable.

  10. Cadmium, an Environmental Pollutant: A Review | Adedapo | West ...

    African Journals Online (AJOL)

    Cadmium (Cd) is a toxic heavy metal and is considered to be an environmental pollutant. Cadmium levels in the environment vary widely. Several sources of human exposure to Cd, including employment in primary metal industries, production of certain batteries, foods, soil and cigarette smoke, are known. Its inhalation has ...

  11. Comparative Hepatotoxicity Test of Cadmium and Lead in Rats ...

    African Journals Online (AJOL)

    Conclusion: Studies indicate that liver function is impeded particularly with respect to protein synthesis, detoxification processes and the cellular integrity of the organ is damaged in the group that cadmium and lead were added (p<0.05). But the water sample from the mining pond, though containing higher cadmium and ...

  12. Effect of cadmium stress on antioxidative enzymes during the ...

    African Journals Online (AJOL)

    In this work, the influence of high cadmium concentrations on percentage germination, specific activities and isoenzyme patterns of catalase (CAT), superoxide dismutase (SOD), and peroxidase (POD) during the germination of Serbian spruce [Picea omorika (Pan..) Purkynĕ] was studied. Cadmium chloride concentrations ...

  13. Levels of Cadmium and Lead in Water, Sediments and Selected ...

    African Journals Online (AJOL)

    Keywords: heavy metals, cadmium, lead, water, sediment, fish, Kenya coast. Flame absorption spectrophotometry was used to investigate the concentration and distribution of cadmium and lead in water, sediments and selected fish species in Makupa and Tudor creeks in Mombasa, Kenya between May 1997 and March ...

  14. Determination and estimation of Cadmium intake from Tarom rice 1 ...

    African Journals Online (AJOL)

    DR. MIKE HORSFALL

    Malaysia. 27.74. Spain. 0.85. Philippines. 20.14. USA. 7.43. Dietary intake of Cadmium: The intake of Cd was estimated by multiplication of daily consumption ... cereals such as rice. JECFA has set PTWI for the. Cadmium at 7 µg/kg of body weight (WHO., 2004). According to the published papers, daily consumption of rice ...

  15. nitrosoguanidine-induced cadmium resistant mutants of Aspergillus ...

    Indian Academy of Sciences (India)

    Unknown

    of S. cerevisiae (Inouhe et al 1989) were used for under- standing the molecular genetics of cadmium toxicity and ... The pH of the medium was adjusted to 6⋅4 before autoclaving. Cadmium-resistant mutants after isolation ..... Saccharomyces cerevisiae; Biochem. Biophys. Acta 993 51–55. Kimura M, Otaki N and Imano M ...

  16. induced by cadmium using random amplified polymorphic DNA

    African Journals Online (AJOL)

    darya

    2013-04-17

    Apr 17, 2013 ... Jin YH, Clark AB, Slebos, RJC, Al-Refai H, Taylor JA, Kunkel TA,. Resnick MA, Gordenin DA (2003). Cadmium is a mutagen that acts by inhibiting mismatch repair. Nat. Genet. 34(3):326-329. Joseph P (2009). Mechanisms of cadmium carcinogenesis. Toxicol. Appl. Pharmacol. 238:272-279. Azimi et al.

  17. Effects of Cadmium Exposure on Bone and Kidney Alkaline ...

    African Journals Online (AJOL)

    This paper examines the effects of varying doses of cadmium on bone and kidney alkaline phosphatase and on testis and prostate acid phosphatase after 4 weeks of administration to separate groups of rats. Relative to the cadmium-free control rats femur bone alkaline phosphatase activity was significantly (P<0.05) ...

  18. Cadmium Removal from Aqueous Solutions by Ground Pine Cone

    Directory of Open Access Journals (Sweden)

    H Izanloo, S Nasseri

    2005-01-01

    Full Text Available A study on the removal of cadmium ions from aqueous solutions by pine cone was conducted in batch conditions. Kinetic data and equilibrium removal isotherms were obtained. The influence of different experimental parameters such as contact time, initial concentration of cadmium, pine cone mass and particle size, and temperature on the kinetics of cadmium removal was studied. Results showed that the main parameters that played an important role in removal phenomenon were initial cadmium concentration, particle size and pine cone mass. The necessary time to reach equilibrium was between 4 and 7 hours based on the initial concentration of cadmium. The capacity of cadmium adsorption at equilibrium increased with the decrease of pine cone particle size. The capacity of cadmium adsorption at equilibrium by pine cone increased with the quantity of pine cone introduced (1–4 g/L. Temperature in the range of 20-30°C showed a restricted effect on the removal kinetics (13.56 mg/g at 20°C and a low capacity of adsorption about 11.48 mg/g at 30°C. The process followed pseudo second-order kinetics. The cadmium uptake of pine cone was quantitatively evaluated using adsorption isotherms. Results indicated that the Langmuir model gave a better fit to the experimental data in comparison with the Freundlich equation.

  19. Cadmium chronic administration to lactating ewes. Reproductive performance, cadmium tissue accumulation and placental transfer

    Energy Technology Data Exchange (ETDEWEB)

    Floris, B.; Bomboi, G.; Sechi, P.; Marongiu, M. L. [Sassari Univ., Sassari (Italy). Dipt. di Biologia Animale; Pirino, S. [Sassari Univ., Sassari (Italy). Ist. di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-chirurgica Veterinaria

    2000-12-01

    20 lactating ewes were allotted to two groups: 10 subjects received orally 100 mg/day of CdCl{sub 2} for 108 consecutive days, and the remaining 10 acted as control. Reproductive performance in ewes and cadmium tissue accumulation, both in ewes and their lambs, were investigated. The results showed that in ewes: 1) the regular cadmium intestinal intake negatively influences all reproductive parameters; 2) cadmium is particularly accumulated in kidney and liver, bur also in mammary gland, although at distinctly lower level; 3) chronic administration does not increase cadmium placental transfer in lactating pregnant subjects. [Italian] 20 pecore in lattazione sono state suddivise in 2 gruppi: 10 soggetti ricevettero per os 100 mg/giorno di CdCl{sub 2} per 108 giorni consecutivi, e i restanti 10 funsero da controllo. Sono stati studiati i parametri riproduttivi delle pecore e l'accumulo di cadmio nei tessuti, sia delle pecore che dei loro agnelli. I risultati hanno mostrato che negli ovini: 1) il regolare assorbimento intestinale di cadmio influenza negativamente tutti i parametri riproduttivi; 2) il cadmio viene accumulato principalmente nei reni e nel fegato, ma anche dalla ghiandola mammaria, sebbene in misura nettamente inferiore; 3) la somministrazione cronica di cadmio nei soggetti gravidi non incrementa il suo passaggio transplacentare.

  20. The effect of phosphate fertilizer cadmium on cadmium in soils and crops

    NARCIS (Netherlands)

    Smilde, K.W.; Luit, van B.

    1983-01-01

    Een van de oorzaken, waardoor bodemvervuiling met cadmium optreedt en dus een bevordering van cadmiumopname door het gewas, is toepassing van fosfaatkunstmest, waarin zich verschillende gehaltes van dit zware metaal bevinden. Dit rapport behandelt het onderzoek naar de stijging van het

  1. Cadmium content in soil at Heirisson Island, Western Australia

    Energy Technology Data Exchange (ETDEWEB)

    Hosie, D.J.; Bogoiais, A.; De Laeter, J.R.; Rosman, K.J.R.

    1978-01-01

    A study was initiated to determine the cadmium level of soil samples from Heirisson Island, western Australia. Cadmium is a particularly toxic element considered harmful to humans and vegetation. Experimental methods and materials are described. Results indicate that cadmium concentrations decrease markedly with distance from road edges, where the cadmium is thought to originate from automobile tires. Other results are detailed. Despite the fact that the amount of cadmium fallout from vehicular traffic is considerably smaller in Australia than was expected on the basis of overseas studies, it is still apparent that the accession rate in soil adjoining busy highways is sufficiently large to demand that care is taken to avoid growing vegetation for human consumption too close to such roadside locations. (3 graphs, 8 references)

  2. Effect of cadmium chloride on hepatic lipid peroxidation in mice

    DEFF Research Database (Denmark)

    Andersen, H R; Andersen, O

    1988-01-01

    Intraperitoneal administration of cadmium chloride to 8-12 weeks old CBA-mice enhanced hepatic lipid peroxidation. A positive correlation between cadmium chloride dose and level of peroxidation was observed in both male and female mice. A sex-related difference in mortality was not observed...... but at a dose of 25 mumol CdCl2/kg the level of hepatic lipid peroxidation was higher in male mice than in female mice. The hepatic lipid peroxidation was not increased above the control level in 3 weeks old mice, while 6 weeks old mice responded with increased peroxidation as did 8-12 weeks old mice....... The mortality after an acute toxic dose of cadmium chloride was the same in the three age groups. Pretreatment of mice with several low intraperitoneal doses of cadmium chloride alleviated cadmium induced mortality and lipid peroxidation. The results demonstrate both age dependency and a protective effect...

  3. Synthesis of cadmium chalcogenide nanotubes at room temperature

    KAUST Repository

    Pan, Jun

    2012-10-01

    Cadmium chalcogenide (CdE, E=S, Se, Te) polycrystalline nanotubes have been synthesized from precursor of CdS/cadmium thiolate complex at room temperature. The precursor was hydrothermally synthesized at 180 °C using thioglycolic acid (TGA) and cadmium acetate as starting materials. The transformation from the rod-like precursor of CdS/cadmium thiolate complex to CdS, CdSe and CdTe nanotubes were performed under constant stirring at room temperature in aqueous solution containing S 2-, Se 2- and Te 2-, respectively. The nanotube diameter can be controlled from 150 to 400 nm related to the dimension of templates. The XRD patterns show the cadmium chalcogenide nanotubes all corresponding to face-centered cubic structure. © 2012 Elsevier B.V. All rights reserved.

  4. Adsorption of cadmium from aqueous solutions by perlite.

    Science.gov (United States)

    Mathialagan, T; Viraraghavan, T

    2002-10-14

    The present study examined the use of perlite for the removal of cadmium from aqueous solutions. The effects of pH and contact time on the adsorption process were examined. The optimum pH for adsorption was found to be 6.0. Residual cadmium concentration reached equilibrium in 6h and the rate of cadmium adsorption by perlite was rapid in the first hour of the reaction time. Ho's pseudo-second-order model best described the kinetics of the reaction. Batch adsorption experiments conducted at room temperature (22+/-1 degrees C) showed that the adsorption pattern followed the Freundlich isotherm model. The maximum removal of cadmium obtained from batch studies was 55%. Thomas model was used to describe the adsorption data from column studies. The results generally showed that perlite could be considered as a potential adsorbent for cadmium removal from aqueous solutions.

  5. Effect of pregnancy on cadmium-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Takizama, Y. (Akita Univ. School of Medicine, Japan); Nakamura, I.; Kurayama, R.; Hirasawa, F.; Kawai, K.

    1982-01-01

    It is well known that itai-itai disease with the osteopathy is broken out among multiparas, 40 years of age and up Japanese residents. In this paper we described an experimental study of effect of pregnancy on cadmium treated rats. Female mature rats were administered drinking water containing 50 and 200 ppm cadmium as CdCl/sub 2/. During 180 days of the experiment, three times of pregnancy were succesful, though slight depression of body weight gain was noticed in the 200 ppm group. The cadmium was accumulated in the kidneys, liver and bone proportionally to the amount of cadmium administered. No significant change was recognized in serum calcium, phosphorus and alkaline phosphatase levels after 180 days. Though cadmium 200 ppm treated rats showed slight histological lesions in the proximal convoluted tubules of the kidney, there appeared to be no osteomalacia including excess formation of osteoid tissue.

  6. Biochemical responses and accumulation of cadmium in Spirodela polyrhiza.

    Science.gov (United States)

    Rolli, N M; Suvarnakhandi, S S; Mulgund, G S; Ratageri, R H; Taranath, T C

    2010-07-01

    The present study focused on biochemical responses of Spirodela polyrhiza to cadmium stresses and its accumulation. The laboratory experiments were conducted for the assessment of biochemical responses and accumulation of cadmium in plants at its various concentrations (0.1, 0.5, 1.5 and 2.0 ppm) at the regular interval for twelve days exposure. Spirodela showed visible symptoms like withering of roots and chlorosis at higher concentration (2.0 ppm), however the plant showed normal growth at lower concentration (0.1 ppm). The estimation of biochemical parameters (total chlorophyll, protein and carbohydrate) of test plants showed a significant increase at lower concentration (0.1 ppm) of cadmium. The biochemical changes decrease with increase in exposure concentration and duration. The toxic effect of cadmium is directly proportional to its concentration and duration. The accumulation of cadmium by Spirodela polyrhiza was maximum at four days exposure duration and gradually decreases.

  7. Possible mechanism for cadmium-induced hypertension in rats

    Energy Technology Data Exchange (ETDEWEB)

    Revis, N.

    1978-01-01

    The mechanism of cadmium-induced hypertension was explored by measuring noradrenaline metabolism. Cadmium in vitro was shown to inhibit both monoamine oxidase and catechol-O-methyltransferase, the two enzymes which inactivate the neurotransmitters noradrenaline and adrenaline. However, rats which were injected or fed (via the drinking water) with cadmium showed that, among the tissues surveyed, these two enzymes were inhibited significantly only in the aorta. In vitro, cadmium was found to inhibit noradrenaline binding to membranes from the heart, lung, and kidney, while stimulating binding to aortic membranes, which suggests that the effects may be specific. These results suggest that, in the aorta, cadmium may inhibit the two catabolic enzymes of noradrenaline, while at the same time stimulating noradrenaline-binding. Thus the effects of noradrenaline on vascular smooth muscle would be increased as well as prolonged.

  8. Possible mechanism for cadmium-induced hypertension in rats

    Energy Technology Data Exchange (ETDEWEB)

    Revis, N.

    1978-02-13

    The mechanism of cadmium-induced hypertension was explored by measuring noradrenaline metabolism. Cadmium in vitro was shown to inhibit both monoamine oxidase and catechol-O-methyltransferase, the two enzymes which inactivate the neurotransmitters noradrenaline and adrenaline. However, rats which were injected or fed (via the drinking water) with cadmium showed that, among the tissues surveyed, these two enzymes were inhibited significantly only in the aorta. In vitro, cadmium was found to inhibit noradrenaline binding to membranes from the heart, lung, and kidney, while stimulating binding to aortic membranes, which suggests that the effects may be specific. These results suggest that, in the aorta, cadmium may inhibit the two catabolic enzymes of noradrenaline, while at the same time stimulating noradrenaline-binding. Thus the effects of noradrenaline on vascular smooth muscle would be increased as well as prolonged.

  9. Mortality of copper cadmium alloy workers with special reference to lung cancer and non-malignant diseases of the respiratory system, 1946-92.

    Science.gov (United States)

    Sorahan, T; Lister, A; Gilthorpe, M S; Harrington, J M

    1995-01-01

    OBJECTIVES--To identify and quantify any relations between occupational exposure to cadmium oxide fume and mortalities from lung cancer and from chronic non-malignant diseases of the respiratory system. METHODS--The mortality experience of 347 copper cadmium alloy workers, 624 workers employed in the vicinity of copper cadmium alloy work (vicinity workers), and 521 iron and brass foundry workers (all men) was investigated for the period 1946-92. All subjects were first employed in these types of work in the period 1922-78 and for a minimum period of one year at one of two participating factories. Two analytical approaches were used, indirect standardisation and Poisson regression. RESULTS--Compared with the general population of England and Wales, mortality from lung cancer among copper cadmium alloy workers was close to expectation (observed deaths 18, expected deaths 17.8, standardised mortality ratio (SMR) 101, 95% confidence interval (95% CI) 60 to 159). A significant excess was shown for lung cancer among vicinity workers but not among iron and brass foundry workers (vicinity workers: observed 55, expected 34.3, SMR 160, 95% CI 121 to 209, P alloy workers: observed 54, expected 23.5, SMR 230, 95% CI 172 to 300, P copper cadmium alloy workers were combined with independent assessments of cadmium exposures over time to develop individual estimates of cumulative exposure to cadmium; this being a time dependent variable. Poisson regression was used to investigate risks of lung cancer and risks of chronic non-malignant diseases of the respiratory system in relation to three levels of cumulative cadmium exposure ( or = 4800 micrograms.m-3.y). After adjustment for age, year of starting alloy work, factory, and time from starting alloy work, there was a significant positive trend (P < 0.01) between cumulative exposure to cadmium and risks of mortality from chronic non-malignant diseases of the respiratory system. Relative to a risk of unity for the lowest exposure

  10. Dicty_cDB: CFC101 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFC101 (Link to dictyBase) - - - Contig-U16381-1 CFC101F (Link to Original site) CFC...101F 131 - - - - - - Show CFC101 Library CF (Link to library) Clone ID CFC101 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/CF/CFC1-A/CFC101Q.Seq.d/ Representative seq. ID CFC10...1F (Link to Original site) Representative DNA sequence >CFC101 (CFC101Q) /CSM/CF/CFC1-A/CFC101Q.Seq.d/ ATTAA...ein update 2009. 5.12 PSORT - 5' end seq. ID CFC101F 5' end seq. >CFC101F.Seq ATTAAATCATTGTAGTATTTTGTTCATATT

  11. Dislocation Etching Solutions for Mercury Cadmium Selenide

    Science.gov (United States)

    2014-09-01

    mercury cadmium telluride (Hg1–xCdxTe) for infrared (IR) sensor applications, but etch pit density ( EPD ) measurements are required to measure...dislocations that affect device performance. No EPD solutions have been reported for Hg1–xCdxSe, and standard EPD solutions for Hg1–xCdxTe have proved...ineffective. Thus, a new etching solution is required for EPD measurements of Hg1–xCdxSe. Samples were etched in various solutions and the resulting pits

  12. The Effect of Selenium and +(-)Catechin on Lipid Peroxidation and Glutathione in Cadmium Fed Rats

    Science.gov (United States)

    Özdemir, Semra; Dursun, Şefik

    2007-04-01

    Cadmium performs its effect on living organisms by accumulating in various tissues and effects tissue antioxidant enzyme systems. The testes are critical target organ following cadmium exposure. The present study was planned to determine the possible protective roles of selenium and +(-) catechin against the toxic effects of cadmium. The study has been performed in Wistar Albino rats which divided into four groups as control, cadmium, cadmium+selenium and cadmium+ catechin received groups. Each experimental group consisted of ten rats. The experimental group rats have received cadmium sulphate, sodium selenite and +(-) catechin via there drinking water for thirty days. Cadmium concentration, lipid peroxidation and glutathione were measured in the homogenate of testes and blood. As a result of the study it may be said that: The cadmium accumulates in testes and its concentration increases in blood and possibly selenium administration is helpful against cadmium but not +(-)catechin.

  13. Sources of cadmium exposure among healthy premenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Scott V., E-mail: sadams@fhcrc.org [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Newcomb, Polly A. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Shafer, Martin M. [Environmental Chemistry and Technology Program, University of Wisconsin and Wisconsin State Laboratory of Hygiene, Madison, WI (United States); Atkinson, Charlotte [Department of Oral and Dental Science, Bristol Dental School, Bristol (United Kingdom); Bowles, Erin J. Aiello [Group Health Research Institute, Seattle, WA (United States); Newton, Katherine M. [Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Group Health Research Institute, Seattle, WA (United States); Lampe, Johanna W. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States)

    2011-04-01

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 {mu}g/g (95% confidence interval (CI): 0.38-0.48 {mu}g/g) and 0.30 {mu}g/g (0.27-0.33 {mu}g/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 {mu}g/g (95% CI: 0.06-0.15 {mu}g/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: {yields

  14. Examination of SR101 shipping packages

    Energy Technology Data Exchange (ETDEWEB)

    Daugherty, W. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-03-01

    Four SR101 shipping packages were removed from service and provided for disassembly and examination of the internal fiberboard assemblies. These packages were 20 years old, and had experienced varying levels of degradation. Two of the packages were successfully disassembled and fiberboard samples were removed from these packages and tested. Mechanical and thermal property values are generally comparable to or higher than baseline values measured on fiberboard from 9975 packages, which differs primarily in the specified density range. While baseline data for the SR101 material is not available, this comparison with 9975 material suggests that the material properties of the SR101 fiberboard have not significantly degraded.

  15. How Does Oyster Shell Immobilize Cadmium?

    Science.gov (United States)

    Lee, Hyun Ho; Kim, Sang Yoon; Owens, Vance N; Park, Sungkyun; Kim, Jiwoong; Hong, Chang Oh

    2018-01-01

    The exact mechanism of cadmium (Cd) immobilization by oyster shell (OS) has not been reported. The effect of OS on Cd immobilization and the exact mechanism should be known before applying remediation technology using OS to Cd contaminated soils. Therefore, the objective of this study was to elucidate the mechanism of Cd immobilization by OS. Three grams of OS (< 0.84 mm) was reacted with 30 mL of 0-3.56 mg Cd L-1 solution at 25 °C for 48 h. Cadmium adsorption increased with increasing initial concentration of Cd in solution. The X-ray diffraction patterns clearly demonstrated that precipitation of CdCO3 did not take place in suspensions of OS after reacting with up to 3.56 mol Cd L-1. Interestingly, we found formation of Ca0.67Cd0.33CO3 crystalline in suspension of OS after reacting with maximum initial Cd concentrations. Precipitation and chemisorption might contribute to Cd immobilization together. However, we feel confident that chemisorption is the major mechanism by which Cd immobilization occurs with OS. In conclusion, OS could be an effective bioadsorbent to immobilize Cd through formation of geochemically stable Cd mineral.

  16. Cadmium hampers salt tolerance of Sesuvium portulacastrum.

    Science.gov (United States)

    Wali, Mariem; Martos, Soledad; Pérez-Martín, Laura; Abdelly, Chedly; Ghnaya, Tahar; Poschenrieder, Charlotte; Gunsé, Benet

    2017-06-01

    It is well known that salinity reduces cadmium toxicity in halophytes. However, the possible interference of Cd with the mechanisms of salt tolerance is poorly explored. The aim of this study was to see whether Cd affects salt tolerance mechanisms in the halophyte Sesuvium portulacastrum. S. portulacastrum plants obtained from cuttings were grown in hydroponics for 3 weeks and then exposed to low (0.09 mM) or moderate (200 mM) NaCl concentrations, alone or in combination with 25 μM CdCl 2 . Microscopy observation revealed two strategies of salt tolerance: euhalophytism and secretion of salt by bladder cells. Cadmium exposure hardly influenced the total leaf Na + concentrations. However, Cd supply delayed the salt-induced upregulation of AHA1 (plasma membrane H + -ATPase 1) and SOS1 (plasma membrane Na + transporter "Salt Overly Sensitive 1"), genes that are essential for salt tolerance. Moreover, Cd induced the activation of BADH, coding for betaine aldehyde dehydrogenase, indicating enhanced osmotic stress due to Cd. Sodium-green fluorescence in protoplasts from plants grown with low or high NaCl, alone or in combination with Cd, revealed higher Na + concentrations in the cytoplasm of Cd-exposed plants. Taken together the results indicate interference of Cd with salt tolerance mechanisms in S. portulacastrum. This may have consequences for the efficient use of halophytes in phytoremediation of Cd-contaminated saline soils. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Cadmium-Sensitive Mutants of Arabidopsis thaliana.

    Science.gov (United States)

    Howden, R; Cobbett, C S

    1992-09-01

    A screening procedure for identifying Cd-sensitive mutants of Arabidopsis thaliana is described. With this procedure, two Cd-sensitive mutants were isolated. These represent independent mutations in the same locus, referred to as CAD1. Genetic analysis has shown that the sensitive phenotype is recessive to the wild type and segregates as a single Mendelian locus. Crosses of the mutant to marker strains showed that the mutation is closely linked to the tt3 locus on chromosome 5. In addition to Cd, the mutants are also significantly more sensitive to mercuric ions and only slightly more sensitive to Cu and Zn, while being no more sensitive than the wild type to Mn, thus indicating a degree of specificity in the mechanism affected by the mutation. Undifferentiated callus tissue is also Cd sensitive, suggesting that the mutant phenotype is expressed at the cellular level. Both wild-type and mutant plants showed increased sensitivity to Cd in the presence of buthionine sulfoximine, an inhibitor of the biosynthesis of the cadmium-binding (gamma-glutamylcysteine)(n)-glycine peptides, suggesting that the mutant is still able to synthesize these peptides. However, the effects of a cad1 mutation and buthionine sulfoximine together on cadmium sensitivity are essentially nonadditive, indicating that they may affect different aspects of the same detoxification mechanism. Assays of Cd uptake by intact plants indicate that the mutant is deficient in its ability to sequester Cd.

  18. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  20. Protective effect of cannabidiol against cadmium hepatotoxicity in rats.

    Science.gov (United States)

    Fouad, Amr A; Al-Mulhim, Abdulruhman S; Gomaa, Wafaey

    2013-10-01

    The protective effect of cannabidiol, the non-psychoactive component of Cannabis sativa, against liver toxicity induced by a single dose of cadmium chloride (6.5 mgkg(-1) i.p.) was investigated in rats. Cannabidiol treatment (5 mgkg(-1)/day, i.p.) was applied for five days starting three days before cadmium administration. Cannabidiol significantly reduced serum alanine aminotransferase, and suppressed hepatic lipid peroxidation, prevented the depletion of reduced glutathione and nitric oxide, and catalase activity, and attenuated the elevation of cadmium level in the liver tissue resulted from cadmium administration. Histopathological examination showed that cadmium-induced liver tissue injury was ameliorated by cannabidiol treatment. Immunohistochemical analysis revealed that cannabidiol significantly decreased the cadmium-induced expression of tumor necrosis factor-α, cyclooxygenase-2, nuclear factor-κB, caspase-3, and caspase-9, and increased the expression of endothelial nitric oxide synthase in liver tissue. It was concluded that cannabidiol may represent a potential option to protect the liver tissue from the detrimental effects of cadmium toxicity. Copyright © 2013 Elsevier GmbH. All rights reserved.

  1. Blood cadmium concentration and lipid profile in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kisok, E-mail: kimkisok@kmu.ac.kr [Department of Public Health, Keimyung University, 1000 Shindang-dong, Daegu 704-701 (Korea, Republic of)

    2012-01-15

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03-1.79 for fourth quintile and OR=1.41; 95% CI, 1.07-1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  2. Accumulation and distribution of arsenic and cadmium by tea plants*

    Science.gov (United States)

    Shi, Yuan-zhi; Ruan, Jian-yun; Ma, Li-feng; Han, Wen-yan; Wang, Fang

    2008-01-01

    It is important to research the rules about accumulation and distribution of arsenic and cadmium by tea plants, which will give us some scientific ideas about how to control the contents of arsenic and cadmium in tea. In this study, by field investigation and pot trial, we found that mobility of arsenic and cadmium in tea plants was low. Most arsenic and cadmium absorbed were fixed in feeding roots and only small amount was transported to the above-ground parts. Distribution of arsenic and cadmium, based on their concentrations of unit dry matter, in tea plants grown on un-contaminated soil was in the order: feeding roots>stems≈main roots>old leaves>young leaves. When tea plants were grown on polluted soils simulated by adding salts of these two metals, feeding roots possibly acted as a buffer and defense, and arsenic and cadmium were transported less to the above-ground parts. The concentration of cadmium in soil significantly and negatively correlated with chlorophyll content, photosynthetic rate, transpiration rate and biomass production of tea plants. PMID:18357630

  3. Absorption of cadmium in bean cultivars variety black Jamapa

    Science.gov (United States)

    Ibarra, M. C. V.; Gomez, R.; Arriaga, R. M.

    2003-05-01

    (4) The cadmium is highly toxic and for all biota in very small concentrations, these study was to know the limit of phitotoxicity and nutrition of cadmium in bean cultivars variety black Jamapa, and to measure absorption of cadmium in roots, stem, leaves and grain. The experiment was carried out in plots with bean of the black variety Jamapa, in greenhouse, 6 treatments in the water of irrigation with 0, 25, 50, 100 y 200 micromoles of cadmium, to quantification of cadmium in plant, is carried out with ICP previous acid digest(I) method D4638-86 of ASTM 1990. Was carried out analysis of variation and results indicate that, there were been significant for the variables : number of leaves, foliate area, dry weight from root, height of plant; the threshold of toxicity for the plant in the condition that it was carried out the experiment were 100 200micromoles of cadmium applied in water of irrigation weekly, the visual symptom were: yellow of leaves, morphologic changes in leaves showed leaves bi-foliate and tetra-foliate in treatments upper of 100micromoles of cadmium.

  4. Dicty_cDB: VHB101 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available library) VHB101 (Link to dictyBase) - - - Contig-U16299-1 - (Link to Original site) - - VHB101Z 712 -...- - - - Show VHB101 Library VH (Link to library) Clone ID VHB101 (Link to dictyBase) Atlas ID - NBRP ID...URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHB1-A/VHB101Q.Seq.d/ Representative seq. ID - (Link to Original...site) Representative DNA sequence >VHB101 (VHB101Q) /CSM/VH/VHB1-A/VHB101Q.Seq.d/ XXXXXXXXXXTTCTATGAAAG...significant alignments: (bits) Value VHB101 (VHB101Q) /CSM/VH/VHB1-A/VHB101Q.Seq.d/ 1380 0.0 VHP385 (VHP385Q)

  5. Dicty_cDB: VHQ101 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHQ101 (Link to dictyBase) - - - Contig-U16531-1 - (Link to Original site) - - VHQ10...1Z 177 - - - - Show VHQ101 Library VH (Link to library) Clone ID VHQ101 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHQ1-A/VHQ101Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHQ101 (VHQ101Q) /CSM/VH/VHQ1-A/VHQ101Q.Seq.d/ XXXXXXXXXXTCAATTT...VHQ174Q.Seq.d/ 331 2e-90 VHQ101 (VHQ101Q) /CSM/VH/VHQ1-A/VHQ101Q.Seq.d/ 331 2e-90 VHP687 (VHP687Q) /CSM/VH/V

  6. Dicty_cDB: SLF101 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF101 (Link to dictyBase) - G01105 DDB0231239 Contig-U01283-1 SLF...101P (Link to Original site) SLF101F 315 SLF101Z 523 SLF101P 838 - - Show SLF101 Library SL (Link to library) Clone ID SLF...ontig-U01283-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLF1-A/SLF...101Q.Seq.d/ Representative seq. ID SLF101P (Link to Original site) Representative DNA sequence >SLF101 (SLF101Q) /CSM/SL/SLF...1-A/SLF101Q.Seq.d/ ATTCCAAAGTTTACAAAAAAACAAAAAAAAAAAATAAAAAAATAAACCAAAGCAATCATG GACAGTTT

  7. Association of environmental cadmium exposure with pediatric dental caries.

    Science.gov (United States)

    Arora, Manish; Weuve, Jennifer; Schwartz, Joel; Wright, Robert O

    2008-06-01

    Although animal experiments have shown that cadmium exposure results in severe dental caries, limited epidemiologic data are available on this issue. We aimed to examine the relationship between environmental cadmium exposure and dental caries in children 6-12 years of age. We analyzed cross-sectional data, including urine cadmium concentrations and counts of decayed or filled tooth surfaces, from the Third National Health and Nutrition Examination Survey. We used logistic and zero-inflated negative binomial (ZINB) regression to estimate the association between urine cadmium concentrations and caries experience, adjusting these analyses for potential confounders including environmental tobacco smoke (ETS). Urine cadmium concentrations ranged from 0.01 to 3.38 ng/mL. Approximately 56% of children had experienced caries in their deciduous teeth, and almost 30% had been affected by caries in their permanent dentition. An interquartile range (IQR) increase in creatinine-corrected cadmium concentrations (0.21 microg/g creatinine) corresponded to a 16% increase in the odds of having experienced caries in deciduous teeth [prevalence odds ratio (OR)=1.16; 95% confidence interval (CI), 0.96-1.40]. This association was statistically significant in children with low ETS exposure (prevalence OR=1.30; 95% CI, 1.01-1.67). The results from the ZINB regression indicated that, among children with any caries history in their deciduous teeth, an IQR increase in cadmium was associated with 17% increase in the number of decayed or filled surfaces. We observed no association between cadmium and caries experience in permanent teeth. Environmental cadmium exposure may be associated with increased risk of dental caries in deciduous teeth of children.

  8. Removal of cadmium and cyanide from aqueous solutions through electrodialysis

    Directory of Open Access Journals (Sweden)

    Marder Luciano

    2003-01-01

    Full Text Available The discharge of galvanic industry wastewaters containing heavy metals and cyanide is one of the largest sources of water pollution. The use of the electrodialysis technique for the treatment of a synthetic wastewater containing approximately 0.0089 mol L-1 cadmium and 0.081 mol L-1 cyanide was studied using a five-compartment electrodialysis cell. The results demonstrate that the removal of cadmium and cyanide depends on the applied current density and it is limited by the precipitation of cadmium on the cation-exchange membrane in the diluate central cell compartment.

  9. Cadmium free lead alloy for reusable radiotherapy shielding.

    Science.gov (United States)

    Blackwell, C R; Amundson, K D

    1990-01-01

    A low melting point cadmium free fusible lead alloy suitable for custom radiotherapy shielding blocks is described. The alloy, referred to here as Alloy-203, differs in composition from the more common Lipowitz's metal (Cerrobend) by being cadmium free, having a slightly higher lead content and a 203 degrees F melting temperature. Attenuation properties have been studied for 4-18 MV X-rays. Alloy-203 has lower transmission than Lipowitz's metal, primarily due to the higher content of lead and bismuth. Daily use for the past 2 years at Mayo Clinic has not indicated any major problems associated with the use of this cadmium free alloy for custom shield fabrication.

  10. Effect of Chlorella intake on Cadmium metabolism in rats

    OpenAIRE

    Shim, Jee Ae; Son, Young Ae; Park, Ji Min; Kim, Mi Kyung

    2009-01-01

    This study was performed to investigate the effect of chlorella on cadmium (Cd) toxicity in Cd- administered rats. Sixty male Sprague-Dawley rats (14 week-old) were blocked into 6 groups. Cadmium chloride was given at levels of 0 or 325 mg (Cd: 0, 160 ppm), and chlorella powder at levels of 0, 3 and 5%. Cadmium was accumulated in blood and tissues (liver, kidney and small intestine) in the Cd-exposed groups, while the accumulation of Cd was decreased in the Cd-exposed chlorella groups. Fecal ...

  11. 15 CFR 200.101 - Measurement research.

    Science.gov (United States)

    2010-01-01

    ..., PROCEDURES, AND FEES § 200.101 Measurement research. (a) The NIST staff continually reviews the advances in... phenomena, and uses these to devise and improve standards, measuring devices, and measurement techniques. As...

  12. 47 CFR 101.517 - Antennas.

    Science.gov (United States)

    2010-10-01

    ... SERVICES 24 GHz Service and Digital Electronic Message Service § 101.517 Antennas. (a) Transmitting... registered with the Commission. The structure owner is responsible for registering, painting, and lighting...

  13. 101 sõbraga leedi / Jaan Mettik

    Index Scriptorium Estoniae

    Mettik, Jaan

    2007-01-01

    Virve Roosti toalilleraamatutest. Vt. samas: Kuidas sündis Virve Roosti viimane teos "Toalilleraamat. 101 rohelist sõpra?" ; Miks peab lillesõbra raamaturiiulis olema vähemalt üks Virve Roosti toalilleraamat?

  14. 48 CFR 46.101 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... Section 46.101 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACT MANAGEMENT..., including functional operation of supplies or their components, by the application of established scientific principles and procedures. ...

  15. 15 CFR 970.101 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... SERVICE DEEP SEABED MINING REGULATIONS FOR EXPLORATION LICENSES General § 970.101 Definitions. For... independent business behavior of such person; (h) Deep seabed means the seabed, and the subsoil thereof to a...

  16. 15 CFR 971.101 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... SERVICE DEEP SEABED MINING REGULATIONS FOR COMMERCIAL RECOVERY PERMITS General § 971.101 Definitions. For... relations, or other similar means, which substantially affect the independent business behavior of such...

  17. 40 CFR 405.101 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... AND STANDARDS DAIRY PRODUCTS PROCESSING POINT SOURCE CATEGORY Dry Milk Subcategory § 405.101.... Composition of input materials may be based on either direct analysis or generally accepted published values. ...

  18. 40 CFR 420.101 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... tube means those cold forming operations that process unheated pipe and tube products using either... AND STANDARDS IRON AND STEEL MANUFACTURING POINT SOURCE CATEGORY Cold Forming Subcategory § 420.101...

  19. Headaches and Migraines: Migraine 101 Quiz

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues Headaches and Migraines Migraine 101 Quiz Past Issues / Spring 2009 Table of ... the facts when it comes to headaches and migraines? Test your knowledge with this quick quiz. True/ ...

  20. Exposure dose response relationships of the freshwater bivalve Hyridella australis to cadmium spiked sediments

    Energy Technology Data Exchange (ETDEWEB)

    Marasinghe Wadige, Chamani P.M., E-mail: chamani.marasinghe.wadige@canberra.edu.au; Maher, William A.; Taylor, Anne M.; Krikowa, Frank

    2014-07-01

    Highlights: • The exposure–dose–response approach was used to assess cadmium exposure and toxicity. • Accumulated cadmium in H. australis reflected the sediment cadmium exposure. • Spill over of cadmium into the biologically active pool was observed. • Increased cadmium resulted in measurable biological effects. • H. australis has the potential to be a cadmium biomonitor in freshwater environments. - Abstract: To understand how benthic biota may respond to the additive or antagonistic effects of metal mixtures in the environment it is first necessary to examine their responses to the individual metals. In this context, laboratory controlled single metal-spiked sediment toxicity tests are useful to assess this. The exposure–dose–response relationships of Hyridella australis to cadmium-spiked sediments were, therefore, investigated in laboratory microcosms. H. australis was exposed to individual cadmium spiked sediments (<0.05 (control), 4 ± 0.3 (low) and 15 ± 1 (high) μg/g dry mass) for 28 days. Dose was measured as cadmium accumulation in whole soft body and individual tissues at weekly intervals over the exposure period. Dose was further examined as sub-cellular localisation of cadmium in hepatopancreas tissues. The biological responses in terms of enzymatic and cellular biomarkers were measured in hepatopancreas tissues at day 28. H. australis accumulated cadmium from spiked sediments with an 8-fold (low exposure organisms) and 16-fold (high exposure organisms) increase at day 28 compared to control organisms. The accumulated tissue cadmium concentrations reflected the sediment cadmium exposure at day 28. Cadmium accumulation in high exposure organisms was inversely related to the tissue calcium concentrations. Gills of H. australis showed significantly higher cadmium accumulation than the other tissues. Accumulated cadmium in biologically active and biologically detoxified metal pools was not significantly different in cadmium exposed

  1. Inclusion free cadmium zinc tellurium and cadmium tellurium crystals and associated growth method

    Science.gov (United States)

    Bolotnikov, Aleskey E [South Setauket, NY; James, Ralph B [Ridge, NY

    2010-07-20

    The present disclosure provides systems and methods for crystal growth of cadmium zinc tellurium (CZT) and cadmium tellurium (CdTe) crystals with an inverted growth reactor chamber. The inverted growth reactor chamber enables growth of single, large, high purity CZT and CdTe crystals that can be used, for example, in X-ray and gamma detection, substrates for infrared detectors, or the like. The inverted growth reactor chamber enables reductions in the presence of Te inclusions, which are recognized as an important limiting factor in using CZT or CdTe as radiation detectors. The inverted growth reactor chamber can be utilized with existing crystal growth techniques such as the Bridgman crystal growth mechanism and the like. In an exemplary embodiment, the inverted growth reactor chamber is a U-shaped ampoule.

  2. Studies on growth and nucleation kinetics of cadmium thiourea sulphate and magnesium cadmium thiourea sulphate

    Energy Technology Data Exchange (ETDEWEB)

    Daniel, Mekala [Quaid-e-Milleth College, Chennai 600002 (India)], E-mail: mekaladaniel@rediffmail.com; Malliga, M. Jeyarani [Bharathi Women College, Chennai 600108 (India); Sankar, R. [Kings Engineering College, Irungatukottai, Sriperumbudhur, Chennai 602105 (India); Jayaraman, D. [Presidency College, Chennai 600 004 (India)

    2009-03-15

    Semiorganic materials, in general possess high non-linear coefficient and mechanical strength which will be more applicable for device fabrication. Cadmium thiourea sulphate (CTS) and magnesium cadmium thiourea sulphate (MCTS) are better semiorganic materials which find applications in the field of optoelectronics. Single crystals of CTS and MCTS have been successfully grown from aqueous solution by slow evaporation technique using predetermined solubility data. The basic growth parameters of the crystal nuclei of the grown crystals of CTS and MCTS were evaluated based on the classical theory of homogeneous nucleation. The classical nucleation theory makes use of capillarity approximation which has certain limitations. A correction has to be applied for it and the classical nucleation theory has been suitably modified in order to calculate the critical nucleus parameters.

  3. Safety and mutagenicity evaluation of Vigiis 101 powder made from Lactobacillus paracasei subsp. paracasei NTU 101.

    Science.gov (United States)

    Tseng, Wei-Ting; Shih, Tsung-Wei; Liu, Shing-Hwa; Pan, Tzu-Ming

    2015-03-01

    The aim of the present work was to assess the genotoxic activity and the potential for toxicity upon repeated dosing of "Vigiis 101" powder, a probiotic consisting of dried bacteria Lactobacillus paracasei subsp. paracasei NTU 101. Results of the Ames test in Salmonella typhimurium strains TA1537, TA98, TA100, TA102, and TA1535 showed that Vigiis 101 (⩽5 mg per plate) was not mutagenic. We used experiments on ICR mice to evaluate the genotoxicity of Vigiis 101. Compared to the control, high-dose Vigiis 101 administration (16.72 g per kg of body weight) did not cause significant changes either in the number of reticulocytes or in the percentage (occurrence) of micronucleated reticulocytes. A mammalian chromosomal aberration test showed that the number of Chinese hamster ovary cells with abnormal chromosomes was <4% after Vigiis 101 treatment (maximal concentration was 5 mg/ml). A 28-day oral toxicity assay in Wistar rats was performed to assess the no-observed-adverse-effect level of Vigiis 101. Compared to the control, high-dose Vigiis 101 administration (5000 mg/kg/day) had no effects on mortality and body weight and did not cause toxicopathological lesions. Taken together, these results show that Vigiis 101 has no significant mutagenic or toxic effects. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Blood and urine cadmium and bioelements profile in nickel-cadmium battery workers in Serbia.

    Science.gov (United States)

    Bulat, Z Plamenac; Dukic-Cosic, D; Dokic, M; Bulat, P; Matovic, V

    2009-03-01

    Although cadmium (Cd) is extensively used for nickel-cadmium battery production, few recent reports are available on the effect of this toxic metal on the imbalance of biometals in occupational exposure. The current study was carried out to determine the Cd level and its effect on the content of bioelements: zinc, cooper, magnesium, and iron in blood and urine of workers exposed to Cd during nickel-cadmium battery production. beta(2)-microglobulins (beta(2)-MG), as indicators of kidney damage, were determined in urine.The study group comprised 32 male nickel-cadmium battery workers, and the control group had 15 male construction workers with no history of Cd exposure. Levels of Cd and bioelements were determined in blood and urine by atomic absorption spectrophotometry.Cd concentration in blood of exposed workers was around 10 microg/L and in urine ranged from 1.93 to 8.76 microg/g creatinine (cr). Urine Cd concentration was significantly higher in exposed workers than in the controls, although no statistical difference in beta(2)-MG content was observed in urine between the two groups. Blood Zn and Mg level were significantly reduced and urine Zn level was increased in Cd-exposed group when compared with controls.The mean Cd concentrations in blood and urine did not exceed the recommended reference values of 10 microg/L in blood and 10 microg/g cr in urine. Cd exposure resulted in disturbances of Zn in blood and urine and Mg in blood but had no effect on Cu and Fe content in biological fluids.

  5. Interactive effects of cadmium and Microcystis aeruginosa (cyanobacterium) on the growth, antioxidative responses and accumulation of cadmium and microcystins in rice seedlings.

    Science.gov (United States)

    Kuang, Xiaolin; Gu, Ji-Dong; Tie, BaiQing; Yao, Bangsong; Shao, Jihai

    2016-10-01

    Cadmium pollution and harmful cyanobacterial blooms are two prominent environmental problems. The interactive effects of cadmium(II) and harmful cyanobacteria on rice seedlings remain unknown. In order to elucidate this issue, the interactive effects of cadmium(II) and Microcystis aeruginosa FACHB905 on the growth and antioxidant responses of rice seedling were investigated in this study, as well as the accumulation of cadmium(II) and microcystins. The results showed that the growth of rice seedlings was inhibited by cadmium(II) stress but promoted by inoculation of M. aeruginosa FACHB905. cadmium(II) stress induced oxidative damage on rice seedlings. Inoculation of M. aeruginosa FACHB905 alleviated the toxicity of cadmium(II) on rice seedlings. The accumulation of cadmium(II) in rice seedlings was decreased by M. aeruginosa FACHB905, but the translocation of cadmium(II) from root to shoot was increased by this cyanobacterium. The accumulation of microcystins in rice seedlings was decreased by cadmium(II). Results presented in this study indicated that cadmium(II) and M. aeruginosa had antagonistic toxicity on rice seedlings. The findings of this study throw new light on evaluation of ecological- and public health-risks for the co-contamination of cadmium(II) and harmful cyanobacteria.

  6. 33 CFR 101.115 - Incorporation by reference.

    Science.gov (United States)

    2010-07-01

    ... International Convention for the Safety of Life at Sea, 1974, and amendments to Chapter XI of SOLAS 1974, adopted December 12, 2002, (SOLAS Chapter XI-1 or SOLAS Chapter XI-2) 101.120; 101.310; 101.410; 101.505...

  7. Integrated photovoltaics in nickel cadmium battery electric vehicles.

    Science.gov (United States)

    2008-12-01

    This research report presents Connecticut Department of Transportations (ConnDOTs) : evaluation of preproduction prototype nickel-cadmium (NiCd) battery-powered electric : vehicles (BEVs) as an alternative-fuel (alt-fuel) option for local trips...

  8. Low molecular weight organic acids in root exudates and cadmium ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    –234. Cieslinski G, Van Rees KCJ, Szmigielska AM, Krishnamurti GSR,. Huang PM (1998). Lowmolecular-weight organic acids in rhizosphere soils of durum wheat and their effect on cadmium bioaccumulation. Plant Soil, 203: ...

  9. Protective effect of zinc against cadmium toxicity on pregnant rats ...

    African Journals Online (AJOL)

    Protective effect of zinc against cadmium toxicity on pregnant rats and their fetuses at morphological, physiological and molecular level. Ashraf El-Sayed, Salem M Salem, Amany A El-Garhy, Zeinab A Rahman, Asmaa M Kandil ...

  10. Two new hexacoordinated coordination polymers of cadmium (II ...

    Indian Academy of Sciences (India)

    Two new hexacoordinated coordination polymers of cadmium(II) containing bridging units only: Syntheses, structures and molecular properties. DIPU SUTRADHAR HABIBAR CHOWDHURY SUSHOVAN KONER SUBHASIS ROY BARINDRA KUMAR GHOSH. Regular Article Volume 128 Issue 9 September 2016 pp 1377- ...

  11. Transfer and accumulation of lead, zinc, cadmium and copper in ...

    African Journals Online (AJOL)

    Transfer and accumulation of lead, zinc, cadmium and copper in plants growing in abandoned mining-district area. HK Chakroun, F Souissi, JL Bouchardon, R Souissi, J Moutte, O Faure, E Remon, S Abdeljaoued ...

  12. Cadmium affects the mitochondrial viability and the acid soluble ...

    African Journals Online (AJOL)

    Cadmium affects the mitochondrial viability and the acid soluble thiols concentration in liver, kidney, heart and gills of Ancistrus brevifilis (Eigenmann, 1920). P Velasquez-Vottelerd, Y Anton, R Salazar-Lugo ...

  13. Analysis and determination of mercury, cadmium and lead in ...

    African Journals Online (AJOL)

    Analysis and determination of mercury, cadmium and lead in canned tuna fish marketed in Iran. E Rahimi, M Hajisalehi, HR Kazemeini, A Chakeri, A Khodabakhsh, M Derakhshesh, M Mirdamadi, AG Ebadi, A Rezvani, FM Kashkahi ...

  14. EFFECTS OF CADMIUM ON THE REPRODUCTIVE AXIS OF JAPANESE MEDAKA

    Science.gov (United States)

    Cadmium (Cd) is a ubquitous element and a significant inorganic pollutant that has previously been found to bioaccumulate in reproductive organs of fish and disrupt important endocrine processes, especially those involved in synthesis, release and metabolism of hormones. Clearly,...

  15. Cadmium-binding in the pregnant and fetal rat

    Energy Technology Data Exchange (ETDEWEB)

    Kelman, B.J.; Ozga, J.A.; Walter, B.K.; Sasser, L.B.

    1979-01-01

    A cadmium-binding moiety with properties in common with adult cadmium-thionein was identified in the livers of fetal rats at day 18 of gestation. Pregnant rats (approx. 200 g) were subcutaneously injected with 50 ..mu..g of radiolabeled cadmium in the form of /sup 115m/CdCl/sub 2/ daily from days 11 through 15 of gestation. Maternal liver contained 14 to 18 ..mu..g Cd/g tissue; fetal liver contained 44 to 70 ng Cd/g tissue. A soluble (aqueous), heat stable, cadmium-binding molecule(s) was found which had an apparent molecular weight of approx. 10,000 in adult livers and 6000 in fetal livers by gel filtration chromatography. Both fetal and adult proteins absorbed maximally at 254 but not 280 nm.

  16. Polycrystalline Thin-Film Research: Cadmium Telluride (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2011-06-01

    Capabilities fact sheet that includes scope, core competencies and capabilities, and contact/web information for Polycrystalline Thin-Film Research: Cadmium Telluride at the National Center for Photovoltaics.

  17. Polycrystalline Thin-Film Research: Cadmium Telluride (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2013-06-01

    This National Center for Photovoltaics sheet describes the capabilities of its polycrystalline thin-film research in the area of cadmium telluride. The scope and core competencies and capabilities are discussed.

  18. Levels of Cadmium and Lead in Water, Sediments and Selected ...

    African Journals Online (AJOL)

    Daisy Ouya

    Key words: heavy metals, cadmium, lead, water, sediment, fish, Kenya coast. Abstract—Flame absorption ... known essential role in living organisms, and are toxic at even low ... Changes in. pH and electrode potential (Eh) can mobilise heavy.

  19. Electrodialytic removal of cadmium from straw combustion fly ash

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Ottosen, Lisbeth M.; Villumsen, Arne

    2004-01-01

    Fly ash from straw combustion contains valuable nutrients when returned to agricultural soils. In many instances, however, this fly ash may contain heavy metals, such as cadmium, at levels which often exceed the limits given by the Danish legislation. Thus before utilizing the nutrients, cadmium...... must be removed from these ashes. The use of an electrodialytic remediation method to remove cadmium from fly ash arising from straw combustion and containing 11.2 mg Cd kg$+-1$/ DM (dry matter) was accessed. After 36 days of remediation at a constant current density of 5.6 mA cm$+-2$/ more than 97......% of the cadmium had been removed from around 150 g ash on a dry basis. $CPY 2004 Society of Chemical Industry....

  20. Soil biogeochemistry, plant physiology and phytoremediation of cadmium contaminated soils

    Science.gov (United States)

    Cadmium (Cd) loading in soil and the environment has been accelerated worldwide due to enhanced industrialization and intensified agricultural production, particularly in the developing countries. Soil Cd pollution, resulting from both anthropogenic and geogenic sources, has posed an increasing chal...

  1. Dicty_cDB: CHR101 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR101 (Link to dictyBase) - - - Contig-U16471-1 - (Link to Original site) - - CHR...101Z 799 - - - - Show CHR101 Library CH (Link to library) Clone ID CHR101 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHR1-A/CHR101Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHR101 (CHR101Q) /CSM/CH/CHR1-A/CHR101Q.Seq.d/ XXXXXXXXXXCTCCAGA...lxflkn Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CHR101 (CHR101Q) /CSM/CH/CHR1-A/CHR

  2. Cadmium-induced oxidative stress in potato tuber

    OpenAIRE

    Andrzej Stroiński; Monika Kozłowska

    2014-01-01

    Short-term treatment of tuber discs of potato (Solanum tuberosum L.) with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202) and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP) and catalase (CAT) was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dism...

  3. Protective effect of pre-supplementation with selenium on cadmium ...

    African Journals Online (AJOL)

    The effect of the antioxidant nutrient selenium, Se, on biologic response to cadmium-induced oxidative cytotoxicity was investigated in rats pretreated with Se prior to exposure to mild doses of Cd. Male wistar strain rats (200-250 g b.wt) were exposed to a single daily oral dose of cadmium (3 mg CdCl2/kg) in drinking water ...

  4. Diazinon and Cadmium Neurotoxicity in Rats after an Experimental Administration

    OpenAIRE

    Róbert Toman; Svätoslav Hluchý; Jozef Golian; Michal Cabaj; Mária Adamkovičová

    2012-01-01

    The aim of this study was to describe the changes in cholinesterase activity in separate doses and after coadministration of cadmium and diazinon intraperitoneally and to assess toxicity and interactions of diazinon and cadmium on the nervous system in male rats. 40 male rats were randomly divided into three experimental and one control group (10 rats in each group). Blood analyzes were performed 36 hours after an intraperitoneal administration of observed compounds. The statistical evaluatio...

  5. Cadmium, lead and bromine in beached microplastics.

    Science.gov (United States)

    Massos, Angelo; Turner, Andrew

    2017-08-01

    Samples of microplastic (n = 924) from two beaches in south west England have been analysed by field-portable-x-ray fluorescence (FP-XRF) spectrometry, configured in a low-density mode and with a small-spot facility, for the heavy metals, Cd and Pb, and the halogen, Br. Primary plastics in the form of pre-production pellets were the principal type of microplastic (>70%) on both beaches, with secondary, irregularly-shaped fragments representing the remainder of samples. Cadmium and Pb were detected in 6.9% and 7.5% of all microplastics, respectively, with concentrations of either metal that exceeded 103 μg g-1 usually encountered in red and yellow pellets or fragments. Respective correlations of Cd and Pb with Se and Cr were attributed to the presence of the coloured, inorganic pigments, cadmium sulphoselenide and lead chromate. Bromine, detected in 10.4% of microplastics and up to concentrations of about 13,000 μg g-1, was mainly encountered in neutrally-coloured pellets. Its strong correlation with Sb, whose oxides are effective fire suppressant synergists, suggests the presence of a variety of brominated flame retardants arising from the recycling of plastics originally used in casings for heat-generating electrical equipment. The maximum bioaccessible concentrations of Cd and Pb, evaluated using a physiological extraction based on the chemical characteristics of the proventriculus-gizzard of the northern fulmar, were about 50 μg g-1 and 8 μg g-1, respectively. These concentrations exceed those estimated for the diet of local seabirds by factors of about 50 and 4, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Cadmium in goods - contribution to environmental exposure

    Energy Technology Data Exchange (ETDEWEB)

    Bergbaeck, B.; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science

    1998-03-01

    The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs

  7. Crystal structures of dibromido{N-[(pyridin-2-yl-κNmethylidene]picolinohydrazide-κ2N′,O}cadmium methanol monosolvate and diiodido{N-[(pyridin-2-yl-κNmethylidene]picolinohydrazide-κ2N′,O}cadmium

    Directory of Open Access Journals (Sweden)

    Ali Akbar Khandar

    2017-05-01

    Full Text Available The title compounds, [CdBr2(C12H10N4O]·CH3OH, (I, and [CdI2(C12H10N4O], (II, are cadmium bromide and cadmium iodide complexes of the ligand (E-N′-(pyridin-2-ylmethylenepicolinohydrazide. Complex (I crystallizes as the methanol monosolvate. In both compounds, the Cd2+ cation is ligated by one O atom and two N atoms of the tridentate ligand, and by two bromide anions forming a Br2N2O pentacoordination sphere for (I, and by two iodide anions forming an I2N2O pentacoordination sphere for (II, both with a distorted square-pyramidal geometry. In the crystal of complex (I, molecules are linked by pairs of N—H...O and O—H...Br hydrogen bonds, involving the solvent molecule, forming dimeric units, which are linked by C—H...Br hydrogen bonds forming layers parallel to (101. In the crystal of complex (II, molecules are linked by N—H...I hydrogen bonds, forming chains propagating along [010]. In complex (II, measured at room temperature, the two iodide anions are each disordered over two sites; the refined occupancy ratio is 0.75 (2:0.25 (2.

  8. Mechanisms of cadmium carcinogenicity in the gastrointestinal tract.

    Science.gov (United States)

    Bishak, Yaser Khaje; Payahoo, Laleh; Osatdrahimi, Alireza; Nourazarian, Alireza

    2015-01-01

    Cancer, a serious public health problem in worldwide, results from an excessive and uncontrolled proliferation of the body cells without obvious physiological demands of organs. The gastrointestinal tract, including the esophagus, stomach and intestine, is a unique organ system. It has the highest cancer incidence and cancer- related mortality in the body and is influenceed by both genetic and environmental factors. Among the various chemical elements recognized in the nature, some of them including zinc, iron, cobalt, and copper have essential roles in the various biochemical and physiological processes, but only at low levels and others such as cadmium, lead, mercury, arsenic, and nickel are considered as threats for human health especially with chronic exposure at high levels. Cadmium, an environment contaminant, cannot be destroyed in nature. Through impairment of vitamin D metabolism in the kidney it causes nephrotoxicity and subsequently bone metabolism impairment and fragility. The major mechanisms involved in cadmium carcinogenesis could be related to the suppression of gene expression, inhibition of DNA damage repair, inhibition of apoptosis, and induction of oxidative stress. In addition, cadmium may act through aberrant DNA methylation. Cadmium affects multiple cellular processes, including signal transduction pathways, cell proliferation, differentiation, and apoptosis. Down-regulation of methyltransferases enzymes and reduction of DNA methylation have been stated as epigenetic effects of cadmium. Furthermore, increasing intracellular free calcium ion levels induces neuronal apoptosis in addition to other deleterious influence on the stability of the genome.

  9. Human seminal plasma cadmium: comparison with fertility and smoking habits.

    Science.gov (United States)

    Saaranen, M; Kantola, M; Saarikoski, S; Vanha-Perttula, T

    1989-01-01

    Cadmium, selenium and zinc were determined in seminal plasma and serum of 64 men by atomic absorption spectrometry (AAS). The mean (+/- SD) cadmium concentrations in seminal plasma and serum were 0.22 +/- 0.22 micrograms and 0.28 +/- 0.10 micrograms, respectively, but they did not correlate with each other. Smokers (n = 31) had significantly (p less than 0.01) higher serum cadmium concentrations than non-smokers (n = 31). Also seminal plasma cadmium in smokers was elevated, but a significant difference to non-smokers was only found if more than 20 cigarettes were consumed daily. No differences were found in semen quality and fertility between smokers and non-smokers. The seminal plasma cadmium had no correlation to selenium or zinc which, however, displayed a positive correlation (r = 0.852, p less than 0.001) to each other. It is concluded that smoking increases the exposure to cadmium. Although no obvious reproductive suppression was observed, heavy smoking may possibly enhance toxic effects in men under other detrimental exposures.

  10. Influence of combined antioxidants against cadmium induced testicular damage.

    Science.gov (United States)

    Koyuturk, Meral; Yanardag, Refiye; Bolkent, Sehnaz; Tunali, Sevim

    2006-05-01

    Acute effects of cadmium (Cd) and combined antioxidants were evaluated in Sprague-Dawley rat testes. The rats were subdivided into four groups. Cadmium chloride (2mg/kgday) injected intraperitoneally during 8 days. Vitamin C (250mg/kgday), vitamin E (250mg/kgday) and sodium selenate (0.25mg/kgday) were pretreated by gavage in both of control and cadmium injected rats. Testis lipid peroxidation and glutathione levels were determined by spectrophotometrically. In Cd treated rats, lipid peroxidation levels were increased and glutathione levels were decreased and combined antioxidants treatment was effective in preventing of lipid peroxidation and normalizing glutathione. In Cd treated animals, the degenerative changes were observed, but not observed in the administrated rats with Cd and antioxidants under the light microscope. Proliferating cell nuclear antigen, metallothionein and caspase-3 activities were evaluated by immunohistochemically. Proliferation activity was not seen in the spermatogonial cells of cadmium treated testis. Treatment with antioxidants in cadmium administrated testis leads to pronounced increase in proliferation activity. Cytoplasmic caspase-3 activity was determined in the spermatogenic cells but not spermatogonia in treatment of antioxidants with Cd. In control and treated with antioxidants animals, metallothionein expressions were localized in the cells of seminiferous tubules, although the expression only was observed in the interstitial cells of cadmium treated rats. Results demonstrated beneficial effects of combined vitamin C, vitamin E and selenium treatment in Cd toxicity.

  11. Trichosporon jirovecii-mediated synthesis of cadmium sulfide nanoparticles.

    Science.gov (United States)

    El-Baz, Ashraf Farag; Sorour, Noha Mohamed; Shetaia, Youssria Mohamed

    2016-05-01

    Cadmium sulphide is one of the most promising materials for solar cells and of great interest due to its useful applications in photonics and electronics, thus the development of bio-mediated synthesis of cadmium sulphide nanoparticles (CdS NPs) is one of the essential areas in nanoparticles. The present study demonstrates for the first time the eco-friendly biosynthesis of CdS NPs using the yeast Trichosporon jirovecii. The biosynthesis of CdS NPs were confirmed by UV-Vis spectrum and characterized by X-ray diffraction assay and electron microscopy. Scanning and transmission electron microscope analyses shows the formation of spherical CdS NPs with a size range of about 6-15 nm with a mean Cd:S molar ratio of 1.0:0.98. T. jirovecii produced hydrogen sulfide on cysteine containing medium confirmed by positive cysteine-desulfhydrase activity and the colony color turned yellow on 0.1 mM cadmium containing medium. T. jirovecii tolerance to cadmium was increased by the UV treatment and three 0.6 mM cadmium tolerant mutants were generated upon the UV radiation treatment. The overall results indicated that T. jirovecii could tolerate cadmium toxicity by its conversion into CdS NPs on cysteine containing medium using cysteine-desulfhydrase as a defense response mechanism. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Aerobic sulfide production and cadmium precipitation by Escherichia coli expressing the Treponema denticola cysteine desulfhydrase gene.

    Science.gov (United States)

    Wang, C L; Lum, A M; Ozuna, S C; Clark, D S; Keasling, J D

    2001-08-01

    The cysteine desulfhydrase gene of Treponema denticola was over-expressed in Escherichia coli to produce sulfide under aerobic conditions and to precipitate metal sulfide complexes on the cell wall. When grown in a defined salts medium supplemented with cadmium and cysteine, E. coli producing cysteine desulfhydrase secreted sulfide and removed nearly all of the cadmium from solution after 48 h. A control strain produced significantly less sulfide and removed significantly less cadmium. Measurement of acid-labile sulfide and energy dispersive X-ray spectroscopy indicated that cadmium was precipitated as cadmium sulfide. Without supplemental cysteine, both the E. coli producing cysteine desulfhydrase and the control E. coli demonstrated minimal cadmium removal.

  13. Gene expression analysis in cadmium-stressed roots of a low cadmium-accumulating solanaceous plant, Solanum torvum

    National Research Council Canada - National Science Library

    Hirotaka Yamaguchi; Hiroyuki Fukuoka; Tomohito Arao; Akio Ohyama; Tsukasa Nunome; Koji Miyatake; Satomi Negoro

    2010-01-01

    Solanum torvum Sw. cv. Torubamubiga (TB) is a low cadmium (Cd)-accumulating plant. To elucidate the molecular mechanisms of the Cd acclimation process in TB roots, transcriptional regulation was analysed in response to mild Cd treatment...

  14. ATX-101 for reduction of submental fat.

    Science.gov (United States)

    Wollina, Uwe; Goldman, Alberto

    2015-04-01

    Facial esthetics are important for self-esteem. Undesired submental fat (SMF) deposits lead to an unappealing submental profile associated with aging and overweight. Compound ATX-101 is a proprietary formulation of purified synthetic deoxycholic acid for pharmacological submental contouring. Review areas covered: This reviews covers anatomy of SMF, biochemistry of deoxycholic acid related to adipose tissue and tissue response to injection of ATX-101. Data from clinical trials were analyzed for efficacy and safety. Published studies using PubMed(©) database 2000 - 2014 have been analyzed. The terms 'deoxycholate', 'deoxycholic acid', 'ATX-101' and 'injection lipolysis' were used. Deoxycholic acid causes adipocyte breakdown and an inflammatory tissue reaction leading to fat cell reduction and limited fibrosis. Four large clinical Phase III trials demonstrated efficacy of ATX-101 in reduction of SMF measured by validated scales and objective measurements. Patients reported improved psychological features and feeling. Adverse effects were mild and temporary. Adipocytolysis of SMF by ATX-101 is an important step forward to the development of approved drugs for reduction of localized fat pads. This could become a growing market.

  15. The Protective Roles of Zinc and Magnesium in Cadmium-Induced Renal Toxicity in Male Wistar Rats

    National Research Council Canada - National Science Library

    Nasim Babaknejad; Ali Asghar Moshtaghie; Kahin Shahanipour; Somaye Bahrami

    2014-01-01

    .... Cadmium can cause dysfunction of different body organs. Zinc (Zn) and magnesium (Mg) supplementation can have protective effects against cadmium toxicity due to their antagonistic and antioxidants properties...

  16. Environmental exposure to cadmium and renal function of elderly women living in cadmium-polluted areas of West-Germany

    Energy Technology Data Exchange (ETDEWEB)

    Ewers, U.; Brockhaus, A.; Dolgner, R.; Freier, I.; Jermann, E.; Hahn, R.; Schlipkoeter, H.W.; Bernard, A.

    1985-12-01

    An epidemiological study was carried out to assess whether or not environmental pollution by cadmium as found in cadmium-polluted areas of the Federal Republic auf Germany is associated with an increased prevalence of biological signs of kidney dysfunction in population groups non-occupationally exposed to heavy metals. The study was run in two industrial areas known to be highly polluted by cadmium and other toxic heavy metals, viz. Stolberg and Duisburg. Duesseldorf was selected as a reference area. As a study population we selected 65- and 66-year-old women who had spent the major part of their lives in one of these areas. The average levels of cadmium in blood and urine showed significant differences in exposure to cadmium in the order Stolberg > Duisburg > Duesseldorf. Serum creatinine levels were, on average, significantly higher in the Stolberg group than in the Duisburg and Duesseldorf groups. With respect to other biological findings (total proteinuria, tubular proteinuria, albuminuria, aminoaciduria, phosphaturia, serum complement) no significant differences between the study populations were noted. It cannot be excluded, however, that in the Stolberg group there is a synergism of ageing and cadmium with respect to the age related decline of the glomerular filtration rate.

  17. Oxidative stress and DNA damage induced by cadmium in the human keratinocyte HaCaT cell line: role of glutathione in the resistance to cadmium.

    Science.gov (United States)

    Nzengue, Yves; Steiman, Régine; Garrel, Catherine; Lefèbvre, Emmanuel; Guiraud, Pascale

    2008-01-14

    Cadmium affects the cellular homeostasis and generates damage via complex mechanisms involving interactions with other metals and oxidative stress induction. In this work we used a human keratinocyte cell line (HaCaT) as a model to study the oxidative damage induced by cadmium to cellular macromolecules, its effect on the antioxidant systems and the role of glutathione in cell protection toward cadmium toxicity. The cells were incubated for 24 and 48 h with cadmium (3, 15, 50 and 100 microM). High doses of cadmium were required to induce a cytotoxicity: 100 microM lead to 30% mortality after 24h and 50% after 48 h. The oxidation of lipids and proteins and the DNA damage, respectively, assessed by thiobarbituric acid reactants determination, thiol group measurement and comet assay, were observed for 50-100 microM cadmium. The cytotoxic effects were strongly correlated to the cellular cadmium content. The glutathione peroxidase and the catalase activities were decreased, while the glutathione reductase activity and the glutathione concentration were increased after cadmium treatment. The superoxide dismutases activities were unchanged. A depletion in glutathione prior to cadmium exposure increased the cytotoxic effects and provoked DNA damage. Our results suggested that the hydroxyl radical could be the major compound involved in the oxidative stress generated by cadmium and that glutathione could play a major role in the protection of HaCaT cells from cytotoxicity but mostly from DNA damage induced by cadmium.

  18. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Limpatanachote, Pisit; Krintratun, Somyot [Department of Internal Medicine, Mae Sot General Hospital, Tak (Thailand)

    2010-08-15

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4{+-}2.3 {mu}g/g creatinine) was significantly greater than that for men (2.0{+-}2.2 {mu}g/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  19. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, Helena A.; Maher, William A., E-mail: bill.maher@canberra.edu.au; Taylor, Anne M.; Krikowa, Frank

    2015-03-15

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata.

  20. Synthesis and Characterization of Mercaptoacetic Acid Capped Cadmium Sulphide Quantum Dots.

    Science.gov (United States)

    Wageh, S; Maize, Mai; Donia, A M; Al-Ghamdi, Ahmed A; Umar, Ahmad

    2015-12-01

    This paper reports the facile synthesis and detailed characterization of mercaptoacetic acid capped cadmium sulphide (CdS) quantum dots using various cadmium precursors. The mercaptoacetic acid capped CdS quantum dots were prepared by facile and simple wet chemical method and characterized by several techniques such as energy dispersive spectroscopy (EDS), X-ray diffraction, Fourier transform infrared (FTIR) spectroscopy, UV-vis. spectroscopy, photoluminescence spectroscopy, high-resolution transmission microscopy (HRTEM) and thremogravimetric analysis. The EDS studies revealed that the prepared quantum dots possess higher atomic percentage of sulfur compared to cadmium due to the coordination of thiolate to the quantum dots surfaces. The X-ray and absorption analyses exhibited that the size of quantum dots prepared by cadmium acetate is larger than the quantum dots prepared by cadmium chloride and cadmium nitrate. The increase in size can be attributed to the low stability constant of cadmium acetate in comparison with cadmium chloride and cadmium nitrate. The FTIR and thermogravimetric analysis showed that the nature of capping molecule on the surface of quantum dots are different depending on the cadmium precursors which affect the emission from CdS quantum dots. Photoemission spectroscopy revealed that the emission of quantum dots prepared by cadmium acetate has high intensity band edge emission along with low intensity trapping state emission. However the CdS quantum dots prepared by cadmium chloride and cadmium nitrate produced only trapping state emissions.

  1. Accumulation and effects of cadmium on guppy (Poecilia reticulata) fed cadmium-dosed cladocera (Moina macrocopa)

    Energy Technology Data Exchange (ETDEWEB)

    Hatakeyama, S.; Yasuno, M.

    1982-08-01

    The study examines the rate of cadmium uptake and body burdens which cause adverse effects on the survival and growth of guppies when they are exposed to Cd dosed in zooplankton (Moina macrocopa) and Cd dissolved in water. Eight guppies fed Moina dosed at 20 ..mu..g Cd/L water died before 10 days. Growth of the remainder of the guppies exposed at this rate was impaired initially but was returned to control level around the 10th day of the study. (JMT)

  2. 77 FR 36295 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Cadmium in...

    Science.gov (United States)

    2012-06-18

    ... cadmium, to provide medical surveillance, to train workers about the hazards of cadmium in the workplace... appropriate automated, electronic, mechanical, or other technological collection techniques or other forms of...

  3. Effect of selenium on cadmium-induced oxidative stress and esterase activity in rat organs

    OpenAIRE

    Kevin Dzobo; Yogeshkumar S. Naik

    2013-01-01

    Metal toxicity is a threat mainly in the industrialised world where industry discharges many toxic metals into the environment. We investigated the effects of two metals cadmium and selenium on the cytosolic antioxidant enzymes and esterases in the liver, kidneys and testes of rats. Male Sprague-Dawley rats (n=28) were divided equally into four groups: control, cadmium, selenium and cadmium/selenium. Salts of the metals were administered intraperitoneally for 15 days. In the liver, cadmium tr...

  4. RNA-Seq Identifies Key Reproductive Gene Expression Alterations in Response to Cadmium Exposure

    OpenAIRE

    Hanyang Hu; Xing Lu; Xiang Cen; Xiaohua Chen; Feng Li; Shan Zhong

    2014-01-01

    Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively in...

  5. The effect of betaine administration on rat sperm quality following cadmium toxicity

    OpenAIRE

    arash Kheradmand; masoud Alirezaei; omid Dezfoulian

    2014-01-01

    Background: The aim of this study is to survey the protective effects of betaine against cadmium and on sperm quality including progressive motility, sperm membrane integrity, concentration as well as testicular weight. Materials and Methods: Thirty adult male rats were allocated to the following three groups (n=10 in each group): control-saline, cadmium-saline and cadmium-betaine. Induction of testicular injury was achieved by a single injection of cadmium chloride intraperotoneally, and bet...

  6. 21 CFR 101.13 - general principles.

    Science.gov (United States)

    1996-04-01

    ... content claims FOOD AND DRUGS FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES--CONTINUED FOOD FOR HUMAN CONSUMPTION FOOD LABELING General Provisions Sec. 101.13 Nutrient content claims... supplements). (b) A claim that expressly or implicitly characterizes the level of a nutrient (nutrient content...

  7. 41 CFR 101-39.303 - Maintenance.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Maintenance. 101-39.303... Maintenance. In order to ensure uninterrupted operation of GSA Interagency Fleet Management System (IFMS) vehicles, safety and preventive maintenance inspections will be performed at regularly scheduled intervals...

  8. 33 CFR 101.510 - Assessment tools.

    Science.gov (United States)

    2010-07-01

    ... MARITIME SECURITY: GENERAL Other Provisions § 101.510 Assessment tools. Ports, vessels, and facilities required to conduct security assessments by part 103, 104, 105, or 106 of this subchapter may use any... may include: (a) DHS/TSA's vulnerability self-assessment tool located at http://www.tsa.gov/risk; and...

  9. 5 CFR 3201.101 - General.

    Science.gov (United States)

    2010-01-01

    ... Directors. (b) Corporation ethics officials. The Executive Secretary of the Corporation shall act as the... Administrative Personnel FEDERAL DEPOSIT INSURANCE CORPORATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE FEDERAL DEPOSIT INSURANCE CORPORATION § 3201.101 General. (a) Purpose. The regulations in...

  10. 49 CFR 212.101 - Program principles.

    Science.gov (United States)

    2010-10-01

    ... Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION STATE SAFETY PARTICIPATION REGULATIONS State/Federal Roles § 212.101 Program... principal role of the State Safety Participation Program in the national railroad safety effort is to...

  11. 5 CFR 308.101 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS VOLUNTEER SERVICE § 308.101 Definitions. In this part: Student is an individual who is enrolled not less than half-time in a high school, trade school, technical or vocational institute, junior college, college, university or other accredited...

  12. 49 CFR 1542.101 - General requirements.

    Science.gov (United States)

    2010-10-01

    ... Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRPORT SECURITY Airport Security Program § 1542.101... carries out a security program that— (1) Provides for the safety and security of persons and property on...

  13. 5 CFR 537.101 - Purpose.

    Science.gov (United States)

    2010-01-01

    ... employee) all or part of any outstanding qualifying student loan or loans previously taken out by a job... Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS REPAYMENT OF STUDENT LOANS § 537.101 Purpose. This part implements 5 U.S.C. 5379, which authorizes agencies to establish a student...

  14. 41 CFR 101-25.404 - Furniture.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Furniture. 101-25.404...-25.404 Furniture. Furniture (office, household and quarters, and institutional) shall not be replaced... which rehabilitation of the furniture at 75 percent or less of the cost of a new item would not extend...

  15. 47 CFR 10.1 - Basis.

    Science.gov (United States)

    2010-10-01

    ... FEDERAL COMMUNICATIONS COMMISSION GENERAL COMMERCIAL MOBILE ALERT SYSTEM General Information § 10.1 Basis. The rules in this part are issued pursuant to the authority contained in the Warning, Alert, and... of June 26, 2006, Public Alert and Warning System, 71 FR 36975, June 26, 2006. ...

  16. 9 CFR 2.101 - Holding period.

    Science.gov (United States)

    2010-01-01

    ... WELFARE REGULATIONS Compliance With Standards and Holding Period § 2.101 Holding period. (a) Any live dog... considered to have acquired a dog or cat which is sold through the auction sale. (1) That any live dog or cat acquired by a dealer or exhibitor from any private or contract animal pound or shelter shall be held by...

  17. 47 CFR 52.101 - General definitions.

    Science.gov (United States)

    2010-10-01

    ... Free Numbers § 52.101 General definitions. As used in this part: (a) Number Administration and Service Center (“NASC”). The entity that provides user support for the Service Management System database and administers the Service Management System database on a day-to-day basis. (b) Responsible Organization (“Resp...

  18. 7 CFR 900.101 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... Governing Meetings To Arbitrate and Mediate Disputes Relating to Sales of Milk or Its Products § 900.101 Definitions. As used in this subpart, the terms as defined in the act shall apply with equal force and effect..., to arbitrate a bona fide dispute with reference to the terms and conditions of the sale of milk or...

  19. 41 CFR 101-39.400 - General.

    Science.gov (United States)

    2010-07-01

    ... FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 39-INTERAGENCY FLEET... responsible for the operation of General Services Administration (GSA) Interagency Fleet Management System... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true General. 101-39.400...

  20. 41 CFR 101-39.300 - General.

    Science.gov (United States)

    2010-07-01

    ... FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 39-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.3-Use and Care of GSA Interagency Fleet Management System Vehicles § 101-39.300 General. (a) The objective of the General Services Administration (GSA) Interagency Fleet Management System...

  1. 41 CFR 101-39.302 - Rotation.

    Science.gov (United States)

    2010-07-01

    ... FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 39-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.3-Use and Care of GSA Interagency Fleet Management System Vehicles § 101-39.302 Rotation. GSA Interagency Fleet Management System (IFMS) vehicles on high mileage assignments may be...

  2. 41 CFR 101-39.102 - Determinations.

    Science.gov (United States)

    2010-07-01

    ...-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.1-Establishment, Modification, and Discontinuance of Interagency Fleet Management Systems § 101-39.102 Determinations. Each determination to establish a fleet management system... name of the executive agency designated to be responsible for operating the fleet management system and...

  3. 41 CFR 101-39.305 - Storage.

    Science.gov (United States)

    2010-07-01

    ... FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 39-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.3-Use and Care of GSA Interagency Fleet Management System Vehicles § 101-39.305 Storage. (a) GSA Interagency Fleet Management System (IFMS) vehicles shall be stored and parked at locations...

  4. 29 CFR 1603.101 - Coverage.

    Science.gov (United States)

    2010-07-01

    ... STATE AND LOCAL GOVERNMENT EMPLOYEE COMPLAINTS OF EMPLOYMENT DISCRIMINATION UNDER SECTION 304 OF THE GOVERNMENT EMPLOYEE RIGHTS ACT OF 1991 Administrative Process § 1603.101 Coverage. Section 304 of the Government Employee Rights Act of 1991 applies to employment, which includes application for employment, of...

  5. 5 CFR 7701.101 - Purpose.

    Science.gov (United States)

    2010-01-01

    ... Administrative Personnel INSTITUTE OF MUSEUM AND LIBRARY SERVICES SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE INSTITUTE OF MUSEUM AND LIBRARY SERVICES § 7701.101 Purpose. In accordance with 5 CFR 2635.105, the regulations of this part apply to employees of the Institute of Museum and Library Services...

  6. 9 CFR 101.5 - Testing terminology.

    Science.gov (United States)

    2010-01-01

    ... VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.5 Testing terminology. Terms used when evaluating biological products shall mean: (a) Standard Requirement. Test methods, procedures, and criteria established by Animal and Plant Health Inspection Service for evaluating biological...

  7. 9 CFR 101.4 - Labeling terminology.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.4 Labeling terminology. Terms pertaining to identification and packaging of biological products shall mean... biological product; (2) Appearing upon any immediate carton or box used to package such final container; and...

  8. 5 CFR 430.101 - Authority.

    Science.gov (United States)

    2010-01-01

    ... Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PERFORMANCE MANAGEMENT Performance Management § 430.101 Authority. Chapter 43 of title 5, United States Code, provides for the performance appraisal of Federal employees. This subpart supplements and implements this portion of the law. ...

  9. 48 CFR 1402.101 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... WORDS AND TERMS Definitions 1402.101 Definitions. As used in this part: Bureau procurement chief (BPC..., unless specified otherwise, to the CCO. If the BPC is also the CO for an action requiring approval of the BPC, then approval shall be at the HCA level. Chief of the contracting office (CCO) is defined as the...

  10. 36 CFR 1192.101 - Lighting.

    Science.gov (United States)

    2010-07-01

    ... 1192.101 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS COMPLIANCE BOARD AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY GUIDELINES FOR TRANSPORTATION VEHICLES Commuter Rail... platforms shall have outside lights which, when the door is open, provide at least 1 footcandle of...

  11. 46 CFR 169.101 - Purpose.

    Science.gov (United States)

    2010-10-01

    ..., DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS General Provisions § 169.101 Purpose. The regulations in this part set forth uniform requirements which are suited to the particular characteristics and specialized operations of sailing school vessels as defined in Title 46...

  12. 41 CFR 101-30.601 - Objective.

    Science.gov (United States)

    2010-07-01

    ... FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.6-GSA Section of the Federal Supply Catalog § 101-30.601 Objective. GSA supply catalogs are primarily designed to... Service (FSS) stock program as a source of supply. GSA also provides information relative to other FSS...

  13. 5 CFR 2610.101 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... Administrative Personnel OFFICE OF GOVERNMENT ETHICS ORGANIZATION AND PROCEDURES IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT General Provisions § 2610.101 Definitions. (a) Act means the Equal Access to Justice Act, 5 U.S.C. 504, as amended. (b) Adjudicative officer means the official, without regard to...

  14. 14 CFR 13.101 - Applicability.

    Science.gov (United States)

    2010-01-01

    ... Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES INVESTIGATIVE AND ENFORCEMENT PROCEDURES Formal Fact-Finding Investigation Under an Order of Investigation § 13.101 Applicability. (a) This subpart applies to fact-finding investigations in which an order of...

  15. Cadmium sorption characteristics of phosphorylated sago starch-extraction residue

    Energy Technology Data Exchange (ETDEWEB)

    Igura, Masato, E-mail: mst_igr@yahoo.co.jp [Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, 2-24-16 Nakacho, Koganei, Tokyo 184-8588 (Japan); Okazaki, Masanori [Institute of Symbiotic Science and Technology, Tokyo University of Agriculture and Technology, 2-24-16, Koganei, Tokyo 184-8588 (Japan)

    2010-06-15

    The residue produced by the extraction of sago starch is usually discarded as a waste material. In this study, we phosphorylated the sago starch-extraction residue with phosphoryl chloride and used the phosphorylated residue to remove cadmium from wastewater. The phosphoric ester functionality in the phosphorylated residue was evaluated by means of infrared microspectrometry and solid-state NMR. The dependence of the cadmium sorption behavior on pH, contact time, and electrolyte concentration and the maximum sorption capacity of the phosphorylated residue were also studied. The cadmium sorption varied with pH and electrolyte concentration, and the maximum sorption capacity was 25.2 mg g{sup -1}, which is almost half the capacity of commercially available weakly acidic cation exchange resins. The phosphorylated residue could be reused several times, although cadmium sorption gradually decreased as the number of sorption-desorption cycles increased. The phosphorylated residue sorbed cadmium rapidly, which is expected to be favorable for the continuous operation in a column.

  16. Systematic network assessment of the carcinogenic activities of cadmium.

    Science.gov (United States)

    Chen, Peizhan; Duan, Xiaohua; Li, Mian; Huang, Chao; Li, Jingquan; Chu, Ruiai; Ying, Hao; Song, Haiyun; Jia, Xudong; Ba, Qian; Wang, Hui

    2016-11-01

    Cadmium has been defined as type I carcinogen for humans, but the underlying mechanisms of its carcinogenic activity and its influence on protein-protein interactions in cells are not fully elucidated. The aim of the current study was to evaluate, systematically, the carcinogenic activity of cadmium with systems biology approaches. From a literature search of 209 studies that performed with cellular models, 208 proteins influenced by cadmium exposure were identified. All of these were assessed by Western blotting and were recognized as key nodes in network analyses. The protein-protein functional interaction networks were constructed with NetBox software and visualized with Cytoscape software. These cadmium-rewired genes were used to construct a scale-free, highly connected biological protein interaction network with 850 nodes and 8770 edges. Of the network, nine key modules were identified and 60 key signaling pathways, including the estrogen, RAS, PI3K-Akt, NF-κB, HIF-1α, Jak-STAT, and TGF-β signaling pathways, were significantly enriched. With breast cancer, colorectal and prostate cancer cellular models, we validated the key node genes in the network that had been previously reported or inferred form the network by Western blotting methods, including STAT3, JNK, p38, SMAD2/3, P65, AKT1, and HIF-1α. These results suggested the established network was robust and provided a systematic view of the carcinogenic activities of cadmium in human. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Isotope fractionation of cadmium in lunar material

    Science.gov (United States)

    Schediwy, S.; Rosman, K. J. R.; de Laeter, J. R.

    2006-03-01

    The double spike technique has been used to measure the isotope fractionation and elemental abundance of Cd in nine lunar samples, the Brownfield meteorite and the Columbia River Basalt BCR-1, by thermal ionisation mass spectrometry. Lunar soil samples give a tightly grouped set of positive isotope fractionation values of between + 0.42% and + 0.50% per mass unit. Positive isotope fractionation implies that the heavy isotopes are enhanced with respect to those of the Laboratory Standard. A vesicular mare basalt gave zero isotope fractionation, indicating that the Cd isotopic composition of the Moon is identical to that of the Earth. A sample of orange glass from the Taurus-Littrow region gave a negative isotope fractionation of - 0.23 ± 0.06% per mass unit, presumably as a result of redeposition of Cd from the Cd-rich vapour cloud associated with volcanism. Cadmium is by far the heaviest element to show isotope fractionation effects in lunar samples. The volatile nature of Cd is of importance in explaining these isotope fractionation results. Although a number of mechanisms have been postulated to be the cause of isotope fractionation of certain elements in lunar soils, we believe that the most likely mechanisms are ion and particle bombardment of the lunar surface.

  18. Biosynthesis of cadmium sulphide quantum semiconductor crystallites

    Science.gov (United States)

    Dameron, C. T.; Reese, R. N.; Mehra, R. K.; Kortan, A. R.; Carroll, P. J.; Steigerwald, M. L.; Brus, L. E.; Winge, D. R.

    1989-04-01

    NANOMETRE-SCALE semiconductor quantum crystallites exhibit size-dependent and discrete excited electronic states which occur at energies higher than the band gap of the corresponding bulk solid1-4. These crystallites are too small to have continuous energy bands, even though a bulk crystal structure is present. The onset of such quantum properties sets a fundamental limit to device miniaturization in microelectronics5. Structures with either one, two or all three dimensions on the nanometer scale are of particular interest in solid state physics6. We report here our discovery of the biosynthesis of quantum crystallites in yeasts Candida glabrata and Schizosaccharomyces pombe, cultured in the presence of cad-mium salts. Short chelating peptides of general structure (γ-Glu-Cys)n-Gly control the nucleation and growth of CdS crystallites to peptide-capped intracellular particles of diameter 20 Å. These quantum CdS crystallites are more monodisperse than CdS par-ticles synthesized chemically. X-ray data indicate that, at this small size, the CdS structure differs from that of bulk CdS and tends towards a six-coordinate rock-salt structure.

  19. Collinear laser spectroscopy of atomic cadmium

    CERN Document Server

    Frömmgen, Nadja; Bissell, Mark L.; Bieroń, Jacek; Blaum, Klaus; Cheal, Bradley; Flanagan, Kieran; Fritzsche, Stephan; Geppert, Christopher; Hammen, Michael; Kowalska, Magdalena; Kreim, Kim; Krieger, Andreas; Neugart, Rainer; Neyens, Gerda; Rajabali, Mustafa M.; Nörtershäuser, Wilfried; Papuga, Jasna; Yordanov, Deyan T.

    2015-01-01

    Hyperfine structure $A$ and $B$ factors of the atomic $5s\\,5p\\,\\; ^3\\rm{P}_2 \\rightarrow 5s\\,6s\\,\\; ^3\\rm{S}_1$ transition are determined from collinear laser spectroscopy data of $^{107-123}$Cd and $^{111m-123m}$Cd. Nuclear magnetic moments and electric quadrupole moments are extracted using reference dipole moments and calculated electric field gradients, respectively. The hyperfine structure anomaly for isotopes with $s_{1/2}$ and $d_{5/2}$ nuclear ground states and isomeric $h_{11/2}$ states is evaluated and a linear relationship is observed for all nuclear states except $s_{1/2}$. This corresponds to the Moskowitz-Lombardi rule that was established in the mercury region of the nuclear chart but in the case of cadmium the slope is distinctively smaller than for mercury. In total four atomic and ionic levels were analyzed and all of them exhibit a similar behaviour. The electric field gradient for the atomic $5s\\,5p\\,\\; ^3\\mathrm{P}_2$ level is derived from multi-configuration Dirac-Hartree-Fock calculatio...

  20. Cadmium neurotoxicity to a freshwater planarian.

    Science.gov (United States)

    Wu, Jui-Pin; Lee, Hui-Ling; Li, Mei-Hui

    2014-11-01

    Although freshwater planarians are evolutionarily primitive, they are some of the simplest bilateral animals possessing integrated neural networks similar to those in vertebrates. We attempted to develop planarian Dugesia japonica as a model for investigating the neurotoxicity of environmental pollutants such as cadmium (Cd). This study was therefore designed to study the effects of Cd on the locomotor activity, neurobehavior, and neurological enzymes of D. japonica. After planarians were exposed to Cd at high concentrations, altered neurobehavior was observed that exhibited concentration-dependent patterns. Morphological alterations in Cd-treated planarians included irregular shape, body elongation, screw-like hyperkinesia, and bridge-like position. To study the direct effects of Cd on neurological enzymes, tissue homogenates of planarians were incubated in vitro with Cd before their activity was measured. Results showed that acetylcholinesterase (AChE), adenosine triphosphatase (ATPase), and monoamine oxidase A (MAO-A) activities were inhibited in a concentration-dependent manner. MAO-B activity was significantly induced by Cd at low concentrations and inhibited at high concentrations. Changes in the in vivo activity of AChE and ATPase were also found after planarians were treated with Cd at a sublethal concentration (5.56 μM). These observations indicate that neurotransmission systems in planarians are disturbed after Cd exposure.

  1. Teratogenic effect of cadmium on the foetal development of albino rats

    African Journals Online (AJOL)

    Foetus of pregnant rats exposed to single intraperitoneal injection of 2 mg/kg body weight cadmium sulphate on eighth gestational days; were compared with control (saline injected) fetuses to assess the effects of cadmium sulphate on foetal growth and ossification. Cadmium sulphate caused significant reduction in body ...

  2. Various cadmium compounds in the feed for broilers and laying hens

    Energy Technology Data Exchange (ETDEWEB)

    Nezel, K.; Matthes, S.; Vogt, H.

    1981-06-01

    The influence of various cadmium compounds on the performance and health of broilers and laying hens and on the residues in tissues and eggs has been investigated. The easily soluble cadmium acetate, cystein cadmium and the low-soluble cadmium sulfide in the doses of 0-20-40 ppm cadmium were compared. Eight x 12 male Lohmann broiler chickens in cages for every ration in the 42-/49-days broiler test and 32 LSL-hens (Leghorn type) in single cages for every ration in the 336-days laying test have been used. Parameters tested in both tests were: mortality, feed intake, weight gain, feed efficiency, pathological-anatomical changes as well as cadmium contents in the test rations and in the pectoral muscle, the thigh muscle, the liver, the kidneys and the bones. In the laying test, also the laying rate, egg weight, daily egg output, egg shell stability and cadmium contents in egg white, yolk and in the tissues were tested. In both age groups the negative effect of cadmium acetate and cystein-cadmium employment on performance and health of the birds were similar; comparable concentrations were found in the tissues. Cadmium sulfide had no effect on the performance of the birds and cadmium contents in the tissues were only slightly raised. In the eggs, no cadmium enhancement was noticed.

  3. Effect of lead and cadmium on germination and seedling growth of ...

    African Journals Online (AJOL)

    A study was conducted to determine the effect of different concentrations of lead and cadmium on seed germination and seedling growth of Leucaena leucocephala. Seed were grown under laboratory conditions at 25, 50, 75 and 100 ppm of metal ions of lead and cadmium. Both lead and cadmium treatments showed toxic ...

  4. Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

    Directory of Open Access Journals (Sweden)

    P.B. Lintongan

    2004-06-01

    Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.

  5. Effects of chronic alternating cadmium exposure on the episodic secretion of prolactin in male rats

    Energy Technology Data Exchange (ETDEWEB)

    Esquifino, A.I. [Madrid Univ. (Spain). Facultad de Medicina Complutense; Marquez, N.; Alvarez-Demanuel, E.; Lafuente, A. [Vigo Univ., Orense (Spain). Lab. de Toxicologia

    1998-07-01

    Cadmium increases or decreases prolactin secretion depending on the dose and duration of the exposure to the metal. However, whether there are cadmium effects on the episodic prolactin secretion is less well known. This study was undertaken to address whether chronic alternating exposure to two different doses of cadmium affects the episodic pattern of prolactin and to what extent the effects of cadmium are age-dependent. Male rats were treated s.c. with cadmium chloride (0.5 or 1.0 mg/kg) from day 30 to 60, or from day 60 to 90 of age, with alteration of the doses every 4 days, starting with the smaller dose. Controls received vehicle every 4 days. The last dose of cadmium was given 48 h prior to the pulsatility study. Prolactin secretion in the 4 experimental groups studied was episodic and changed significantly after cadmium exposure. Cadmium administration from day 30 to 60 of life significantly decreased the mean half-life of prolactin. On the other hand, when administered from day 60 to 90 cadmium significantly decreased the mean as well as serum prolactin levels and the absolute amplitude of the prolactin pulses, their duration, the relative amplitude or the mean half-life of the hormone. The frequency of prolactin peaks was not changed by cadmium administration. The results indicate that low intermittent doses of cadmium chronically administered change the episodic secretion pattern of prolactin in rats. The effects of cadmium on prolactin secretion were age dependent. (orig.)

  6. One-Dimensional Fast Transient Simulator for Modeling Cadmium Sulfide/Cadmium Telluride Solar Cells

    Science.gov (United States)

    Guo, Da

    Solar energy, including solar heating, solar architecture, solar thermal electricity and solar photovoltaics, is one of the primary alternative energy sources to fossil fuel. Being one of the most important techniques, significant research has been conducted in solar cell efficiency improvement. Simulation of various structures and materials of solar cells provides a deeper understanding of device operation and ways to improve their efficiency. Over the last two decades, polycrystalline thin-film Cadmium-Sulfide and Cadmium-Telluride (CdS/CdTe) solar cells fabricated on glass substrates have been considered as one of the most promising candidate in the photovoltaic technologies, for their similar efficiency and low costs when compared to traditional silicon-based solar cells. In this work a fast one dimensional time-dependent/steady-state drift-diffusion simulator, accelerated by adaptive non-uniform mesh and automatic time-step control, for modeling solar cells has been developed and has been used to simulate a CdS/CdTe solar cell. These models are used to reproduce transients of carrier transport in response to step-function signals of different bias and varied light intensity. The time-step control models are also used to help convergence in steady-state simulations where constrained material constants, such as carrier lifetimes in the order of nanosecond and carrier mobility in the order of 100 cm2/Vs, must be applied.

  7. Tank 241-AZ-101 tank characterization plan

    Energy Technology Data Exchange (ETDEWEB)

    Schreiber, R.D.

    1995-02-06

    The Defense Nuclear Facilities Safety Board has advised the DOE to concentrate the near-term sampling and analysis activities on identification and resolution of safety issues. The Data Quality Objective (DQO) process was chosen as a tool to be used in the resolution of safety issues. As a result, A revision in the Federal Facilities Agreement and Consent Order (Tri-Party Agreement) milestone M-44 has been made, which states that ``A Tank Characterization Plan (TCP) will also be developed for each double-shell tank (DST) and single-shell tank (SST) using the DQO process. Development of TCPs by the DQO process is intended to allow users to ensure their needs will be met and that resources are devoted to gaining only necessary information``. This document satisfies that requirement for Tank 241-AZ-101 (AZ-101) sampling activities. Tank AZ-101 is currently a non-Watch List tank, so the only DQOs applicable to this tank are the safety screening DQO and the compatibility DQO, as described below. The contents of Tank AZ-101, as of October 31, 1994, consisted of 3,630 kL (960 kgal) of dilute non-complexed waste and aging waste from PUREX (NCAW, neutralized current acid waste). Tank AZ-101 is expected to have two primary layers. The bottom layer is composed of 132 kL of sludge, and the top layer is composed of 3,500 kL of supernatant, with a total tank waste depth of approximately 8.87 meters.

  8. 49 CFR 1544.101 - Adoption and implementation.

    Science.gov (United States)

    2010-10-01

    ....101 Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRCRAFT OPERATOR SECURITY: AIR CARRIERS AND COMMERCIAL OPERATORS Security Program § 1544.101 Adoption and implementation. (a) Full program...

  9. Blood Cadmium Concentrations in Women with Ectopic Pregnancy.

    Science.gov (United States)

    Karaer, Abdullah; Tuncay, Gorkem; Tanrikut, Emrullah; Ozgul, Onur

    2017-10-08

    The purpose of this study is to investigate the relationship between the blood level of cadmium and the occurrence of ectopic pregnancy. Forty-one (41) case patients with ectopic pregnancy and 41 uncomplicated intrauterine pregnant patients as controls were recruited. The concentrations of cadmium (Cd) were measured from blood samples using atomic absorption spectrometry. The cases and controls were similar in age, body mass index, and smoking habits. The median blood level of Cd was 0.32 μg/l (interquartile range [IQR] 0.00-0.71) in the women with ectopic pregnancies and 0.34 μg/l (IQR 0.09-0.59) in the controls. There was no significant association between blood cadmium levels and ectopic pregnancy.

  10. Study on removal of cadmium by hybrid liquid membrane process.

    Science.gov (United States)

    Mortaheb, Hamid R; Zolfaghari, Alireza; Mokhtarani, Babak; Amini, Mohammad H; Mandanipour, Valiollah

    2010-05-15

    Removal of cadmium as a hazardous heavy metal is studied by applying a new design of hybrid cell for liquid membrane process. Tri-iso-octyl amine (TIOA) is used as the carrier in the organic phase. The concentration of cadmium in the samples is measured by atomic absorption spectroscopy. The effect of various parameters including type of supporting membrane, pH of feed and stripping phases, initial concentration of cadmium, carrier concentration, solvent nature, and also organic film resistance on mass transfer rate and removal efficiency are studied. The effect of temperature on mass transfer flux is studied by proposing a prediction model. The optimum carrier concentration is found to be about 0.05 M. The appropriate values of pH for feed and stripping phases are about 3 and 13, respectively. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  11. Cadmium toxicity: a possible cause of male infertility in Nigeria.

    Science.gov (United States)

    Akinloye, Oluyemi; Arowojolu, Ayodele O; Shittu, Olayiwola B; Anetor, John I

    2006-03-01

    Serum and seminal plasma cadmium (Cd) concentrations were estimated by atomic absorption spectrophotometry in 60 infertile adult male Nigerians (40 oligozoospermics and 20 azoospermics). The results were compared with Cd level in 40 normozoospermic subjects (matched age, with proven evidence of fertility). The relationship between Cd levels and spermatograms or the hypothalamic-pituitary-gonadal (HPG) -axis was investigated by correlating serum and seminal plasma Cd levels with semen characteristics and hormone levels. The seminal plasma Cd level was significantly higher than those of serum in all studied groups (pcadmium as a cause of infertility in male Nigerians as well as extend and support previous findings concerning cadmium toxicity and male infertility. The strong deleterious effect of cadmium on spermatogenesis may be due to the systemic and cellular toxicity. A possible relationship between this element and the HPG axis is also suggested.

  12. Cadmium-induced oxidative stress in potato tuber

    Directory of Open Access Journals (Sweden)

    Andrzej Stroiński

    2014-01-01

    Full Text Available Short-term treatment of tuber discs of potato (Solanum tuberosum L. with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202 and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP and catalase (CAT was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dismutase (SOD, CAT and AAP was observed and it comes from inactivation of enzymes by cadmium ions. A subsequent activity increase of the enzymes aroused earlier in tolerant tissues. It seems therefore, that tolerant tissues possess a more efficient antioxidative system.

  13. Removal of cadmium by pleurotus sajor-caju basidiomycetes

    Energy Technology Data Exchange (ETDEWEB)

    Cihangir, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Science; Saglam, N. [Hacettepe Univ., Ankara (Turkey). Faculty of Education

    1999-11-01

    The bioaccumulation of cadmium by the white rot fungus Pleurotus sajor-caju onto dry biomass was investigated using aqueous media with concentrations in the range of 0.125 mM-1.0 mM. The highest cadmium uptake (between 88.9 and 91.8%) was observed with aerobic fungal biomass from the exponential growth phase. Up to 1.0 mM cadmium gradually inhibited mycelium development, but never blocked it completely. Freeze-dried, oven-dried and non-metabolizing live Pleurotus sajor-caju biomass types were tested for their capacity to adsorb the test ion Cd{sup 2+} within the pH range of 4.5 to 6.0. Freeze-dried biomass proved to be the most efficient biomass type for Cd{sup 2+} metal adsorption. Therefore, Pleurotus sajor-caju may be used for heavy metal removal and bioremediation. (orig.)

  14. Analysis Of The Underpotential Deposition Of Cadmium On Copper

    Directory of Open Access Journals (Sweden)

    Kowalik R.

    2015-09-01

    Full Text Available In this study the process of deposition of cadmium on polycrystalline copper electrode in sulfate solution was investigated. The process of underpotential and bulk deposition was analyzed by classical electrochemical method: cyclic voltammetry(CV, anodic stripping voltammetry(ASV and electrochemical quartz crystal microbalance(EQCM. The obtained results were compared with electrochemical impedance spectroscopy(EIS measurements. CV, EQCM and EIS results suggest that the UPD of cadmium starts below potential −0.4 V vs Ag/AgCl. Additionally the stripping analysis indicates the formation of cadmium monolayer with different density of deposited atoms depending on the applied potential. The transition from UPD to bulk deposition occurs below potential −0,7 V.

  15. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Jeekeeree, Wanpen [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Funkhiew, Thippawan [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Sanjum, Rungaroon; Apiwatpaiboon, Thitikarn [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Phopueng, Ittipol [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)

    2015-01-15

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β{sub 2}-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β{sub 2}-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β{sub 2}-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β{sub 2}-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children.

  16. 41 CFR 101-5.305 - Agency participation.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Agency participation. 101-5.305 Section 101-5.305 Public Contracts and Property Management Federal Property Management... AND COMPLEXES 5.3-Federal Employee Health Services § 101-5.305 Agency participation. At the time the...

  17. 32 CFR 935.101 - Seizure of property.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Seizure of property. 935.101 Section 935.101 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE TERRITORIAL AND INSULAR REGULATIONS WAKE ISLAND CODE Criminal Actions § 935.101 Seizure of property. Any property seized in connection...

  18. 41 CFR 101-42.1102-10 - Firearms.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Firearms. 101-42.1102-10... Certain Categories of Property § 101-42.1102-10 Firearms. (a) Utilization requirements. (1) In accordance with § 101-43.4801(c) of this chapter, reports of excess reportable firearms and requests for their...

  19. 34 CFR 101.23 - Complainants not parties.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Complainants not parties. 101.23 Section 101.23... EDUCATION PRACTICE AND PROCEDURE FOR HEARINGS UNDER PART 100 OF THIS TITLE Parties § 101.23 Complainants not parties. A person submitting a complaint pursuant to § 100.7(b) of this title is not a party to the...

  20. 21 CFR 895.101 - Prosthetic hair fibers.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Prosthetic hair fibers. 895.101 Section 895.101...) MEDICAL DEVICES BANNED DEVICES Listing of Banned Devices § 895.101 Prosthetic hair fibers. Prosthetic hair fibers are devices intended for implantation into the human scalp to simulate natural hair or conceal...

  1. 48 CFR 928.101-1 - Policy on use.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Policy on use. 928.101-1... REQUIREMENTS BONDS AND INSURANCE Bonds and Other Financial Protections 928.101-1 Policy on use. In addition to the restriction on use of bid guarantees in 48 CFR 28.101-1(a), a bid guarantee may be required only...

  2. 41 CFR 101-30.701-2 - Item standardization code.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Item standardization code. 101-30.701-2 Section 101-30.701-2 Public Contracts and Property Management Federal Property Management....7-Item Reduction Program § 101-30.701-2 Item standardization code. Item standardization code (ISC...

  3. 7 CFR 42.101 - Meaning of words.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Meaning of words. 42.101 Section 42.101 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... CONDITION OF FOOD CONTAINERS Definitions § 42.101 Meaning of words. Words used in this part in the singular...

  4. 7 CFR 43.101 - Meaning of words.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Meaning of words. 43.101 Section 43.101 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... SAMPLING PLANS Definitions § 43.101 Meaning of words. Words used in this subpart in the singular form shall...

  5. 7 CFR 955.101 - Vidalia Onion Handler Report.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Vidalia Onion Handler Report. 955.101 Section 955.101... Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE VIDALIA ONIONS GROWN IN GEORGIA Rules and Regulations § 955.101 Vidalia Onion Handler Report. (a) Each handler shall furnish shipping...

  6. 34 CFR 101.3 - Use of gender and number.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Use of gender and number. 101.3 Section 101.3 Education Regulations of the Offices of the Department of Education OFFICE FOR CIVIL RIGHTS, DEPARTMENT OF EDUCATION PRACTICE AND PROCEDURE FOR HEARINGS UNDER PART 100 OF THIS TITLE General Information § 101.3 Use of gender...

  7. 48 CFR 29.101 - Resolving tax problems.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Resolving tax problems. 29.101 Section 29.101 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL CONTRACTING REQUIREMENTS TAXES General 29.101 Resolving tax problems. (a) Contract tax problems are...

  8. 48 CFR 1329.101 - Resolving tax problems.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Resolving tax problems. 1329.101 Section 1329.101 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE GENERAL CONTRACTING REQUIREMENTS TAXES General 1329.101 Resolving tax problems. Legal questions relating to tax issues...

  9. 48 CFR 629.101 - Resolving tax problems.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Resolving tax problems. 629.101 Section 629.101 Federal Acquisition Regulations System DEPARTMENT OF STATE GENERAL CONTRACTING REQUIREMENTS TAXES General 629.101 Resolving tax problems. In certain instances, acquisitions by posts are...

  10. 48 CFR 2929.101 - Resolving tax problems.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Resolving tax problems. 2929.101 Section 2929.101 Federal Acquisition Regulations System DEPARTMENT OF LABOR GENERAL CONTRACTING REQUIREMENTS TAXES General 2929.101 Resolving tax problems. Contract tax problems or questions...

  11. 48 CFR 229.101 - Resolving tax problems.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Resolving tax problems. 229.101 Section 229.101 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE GENERAL CONTRACTING REQUIREMENTS TAXES General 229.101 Resolving tax problems. (a...

  12. 10 CFR 835.101 - Radiation protection programs.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Radiation protection programs. 835.101 Section 835.101 Energy DEPARTMENT OF ENERGY OCCUPATIONAL RADIATION PROTECTION Management and Administrative Requirements § 835.101 Radiation protection programs. (a) A DOE activity shall be conducted in compliance with a documented radiation protection program (RPP) a...

  13. 3 CFR 101.4 - National Security Council.

    Science.gov (United States)

    2010-01-01

    ... 3 The President 1 2010-01-01 2010-01-01 false National Security Council. 101.4 Section 101.4... PROCEDURES ACT § 101.4 National Security Council. Freedom of Information regulations for the National Security Council appear at 32 CFR Ch. XXI. ...

  14. 3 CFR 101.2 - Office of Management and Budget.

    Science.gov (United States)

    2010-01-01

    ... 3 The President 1 2010-01-01 2010-01-01 false Office of Management and Budget. 101.2 Section 101.2... PROCEDURES ACT § 101.2 Office of Management and Budget. Freedom of Information regulations for the Office of Management and Budget appear at 5 CFR Ch. III. ...

  15. 5 CFR 2600.101 - Mission and history.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Mission and history. 2600.101 Section 2600.101 Administrative Personnel OFFICE OF GOVERNMENT ETHICS ORGANIZATION AND PROCEDURES ORGANIZATION AND FUNCTIONS OF THE OFFICE OF GOVERNMENT ETHICS § 2600.101 Mission and history. (a) The Office of...

  16. 42 CFR 84.101 - Man test 5; requirements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Man test 5; requirements. 84.101 Section 84.101 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Self-Contained Breathing Apparatus § 84.101 Man test 5; requirements....

  17. 41 CFR 101-26.000 - Scope of part.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Scope of part. 101-26.000 Section 101-26.000 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 26-PROCUREMENT SOURCES AND PROGRAM § 101-26...

  18. 29 CFR 101.39 - Initiation of advisory opinion case.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Initiation of advisory opinion case. 101.39 Section 101.39... Opinions and Declaratory Orders Regarding Board Jurisdiction § 101.39 Initiation of advisory opinion case... advisory opinion determining whether it would or would not assert jurisdiction on the basis of the facts...

  19. 41 CFR 101-45.001 - Demilitarization and decontamination.

    Science.gov (United States)

    2010-07-01

    ... decontamination. 101-45.001 Section 101-45.001 Public Contracts and Property Management Federal Property..., ABANDONMENT, OR DESTRUCTION OF PERSONAL PROPERTY § 101-45.001 Demilitarization and decontamination. (a... characteristics, or otherwise making it unfit for further use. (b) Demilitarization or decontamination of property...

  20. 19 CFR 141.101 - Time of deposit.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Time of deposit. 141.101 Section 141.101 Customs... (CONTINUED) ENTRY OF MERCHANDISE Deposit of Estimated Duties § 141.101 Time of deposit. Estimated duties shall either be deposited with the Customs officer designated to receive the duties at the time of the...

  1. 46 CFR 67.101 - Waiver of evidence of build.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Waiver of evidence of build. 67.101 Section 67.101... DOCUMENTATION OF VESSELS Build Requirements for Vessel Documentation § 67.101 Waiver of evidence of build. (a) A vessel owner applying for documentation unable to obtain the evidence of build required by § 67.99 may...

  2. 40 CFR 141.101 - Use of bottled water.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Use of bottled water. 141.101 Section 141.101 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Use of Non-Centralized Treatment Devices § 141.101...

  3. 48 CFR 9903.101 - Cost Accounting Standards.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Cost Accounting Standards. 9903.101 Section 9903.101 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD... ACCOUNTING STANDARDS CONTRACT COVERAGE General 9903.101 Cost Accounting Standards. Public Law 100-679 (41 U.S...

  4. 41 CFR 101-39.402 - Recommendations for disciplinary action.

    Science.gov (United States)

    2010-07-01

    ... VEHICLES 39-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.4-Accidents and Claims § 101-39.402 Recommendations for... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Recommendations for disciplinary action. 101-39.402 Section 101-39.402 Public Contracts and Property Management Federal Property...

  5. 41 CFR 101-39.407 - Accident records.

    Science.gov (United States)

    2010-07-01

    ...-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.4-Accidents and Claims § 101-39.407 Accident records. If GSA's records... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Accident records. 101-39.407 Section 101-39.407 Public Contracts and Property Management Federal Property Management...

  6. 41 CFR 101-39.4900 - Scope of subpart.

    Science.gov (United States)

    2010-07-01

    ...-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.49-Forms § 101-39.4900 Scope of subpart. This subpart provides the... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Scope of subpart. 101-39.4900 Section 101-39.4900 Public Contracts and Property Management Federal Property Management...

  7. 37 CFR 2.101 - Filing an opposition.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Filing an opposition. 2.101 Section 2.101 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE RULES OF PRACTICE IN TRADEMARK CASES Opposition § 2.101 Filing an opposition. (a) An opposition...

  8. 7 CFR 1427.101 - Eligible upland cotton.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...

  9. 19 CFR 10.1 - Domestic products; requirements on entry.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Domestic products; requirements on entry. 10.1 Section 10.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... Articles Exported and Returned § 10.1 Domestic products; requirements on entry. (a) Except as otherwise...

  10. 46 CFR 309.101 - Amendment of interim binders.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Amendment of interim binders. 309.101 Section 309.101... INSURANCE § 309.101 Amendment of interim binders. The interim binder for a vessel whose stated valuation is... after the attachment of the insurance under the interim binder to which such valuation applies...

  11. 41 CFR 101-1.100 - Scope of subpart.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Scope of subpart. 101-1.100 Section 101-1.100 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101-1.100...

  12. 41 CFR 101-1.4902 - GSA forms.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true GSA forms. 101-1.4902 Section 101-1.4902 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.49-Illustrations of Forms § 101-1.4902...

  13. 41 CFR 101-1.105 - Authority for FPMR System.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Authority for FPMR System. 101-1.105 Section 101-1.105 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101...

  14. 41 CFR 101-1.112 - Change lines.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Change lines. 101-1.112 Section 101-1.112 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101-1.112 Change...

  15. 41 CFR 101-1.104-1 - Publication.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Publication. 101-1.104-1 Section 101-1.104-1 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101-1.104-1...

  16. 41 CFR 101-1.111 - Retention of FPMR amendments.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Retention of FPMR amendments. 101-1.111 Section 101-1.111 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101...

  17. 41 CFR 101-1.109 - Numbering in FPMR System.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Numbering in FPMR System. 101-1.109 Section 101-1.109 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101...

  18. 41 CFR 101-1.106 - Applicability of FPMR.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Applicability of FPMR. 101-1.106 Section 101-1.106 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101...

  19. 41 CFR 101-1.104-2 - Distribution.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Distribution. 101-1.104-2 Section 101-1.104-2 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101-1.104-2...

  20. 41 CFR 101-1.103 - FPMR temporary regulations.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true FPMR temporary regulations. 101-1.103 Section 101-1.103 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101...

  1. 41 CFR 101-27.102 - Economic order quantity principle.

    Science.gov (United States)

    2010-07-01

    ... principle. 101-27.102 Section 101-27.102 Public Contracts and Property Management Federal Property... MANAGEMENT 27.1-Stock Replenishment § 101-27.102 Economic order quantity principle. The economic order quantity (EOQ) principle is a means for achieving economical inventory management. Application of the EOQ...

  2. 45 CFR 98.101 - Case Review Methodology.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Case Review Methodology. 98.101 Section 98.101... FUND Error Rate Reporting § 98.101 Case Review Methodology. (a) Case Reviews and Sampling—In preparing... conduct comprehensive reviews of case records using a methodology established by the Secretary. For...

  3. 48 CFR 1503.101-370 - Personal conflicts of interest.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Personal conflicts of interest. 1503.101-370 Section 1503.101-370 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 1503.101-370...

  4. 19 CFR 101.6 - Hours of business.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Hours of business. 101.6 Section 101.6 Customs... GENERAL PROVISIONS § 101.6 Hours of business. Except as specified in paragraphs (a) through (g) of this section, each CBP office shall be open for the transactions of general CBP business between the hours of 8...

  5. 19 CFR 101.2 - Authority of Customs officers.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Authority of Customs officers. 101.2 Section 101.2 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY GENERAL PROVISIONS § 101.2 Authority of Customs officers. (a) Supremacy of delegated authority...

  6. 41 CFR 101-25.402 - Motor vehicles.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Motor vehicles. 101-25.402 Section 101-25.402 Public Contracts and Property Management Federal Property Management... Standards § 101-25.402 Motor vehicles. Replacement of motor vehicles shall be in accordance with the...

  7. 47 CFR 101.207 - Suspension of transmission.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Suspension of transmission. 101.207 Section 101.207 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Operational Requirements § 101.207 Suspension of transmission. Transmission...

  8. 21 CFR 101.10 - Nutrition labeling of restaurant foods.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Nutrition labeling of restaurant foods. 101.10... restaurant foods. Nutrition labeling in accordance with § 101.9 shall be provided upon request for any restaurant food or meal for which a nutrient content claim (as defined in § 101.13 or in subpart D of this...

  9. 41 CFR 101-25.106 - Servicing of office machines.

    Science.gov (United States)

    2010-07-01

    ...) Number of machines; including overall frequency of repairs required; (10) Security restrictions, if any... machines. 101-25.106 Section 101-25.106 Public Contracts and Property Management Federal Property...-General Policies § 101-25.106 Servicing of office machines. (a) The determination as to whether office...

  10. 7 CFR 97.101 - Notice of allowance.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Notice of allowance. 97.101 Section 97.101 Agriculture... PLANT VARIETY AND PROTECTION Examinations, Allowances, and Denials § 97.101 Notice of allowance. If, on examination, it shall appear that the applicant is entitled to a certificate, a notice of allowance shall be...

  11. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S

    2002-01-01

    The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose of the st......The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose....... Experience from cadmium-poisoned humans and laboratory mammals indicates that concentrations above 50-200 microg/g wet wt. may induce histopathological changes. Overall, 31 of the ringed seals had cadmium concentrations in the kidney cortex above 50 microg/g wet wt., 11 had concentrations above 100 and one...

  12. A Model of Cadmium Uptake and Transport in Caco-2 Cells.

    Science.gov (United States)

    Gerasimenko, T N; Senyavina, N V; Anisimov, N U; Tonevitskaya, S A

    2016-05-01

    We created a physiologically substantiated kinetic model of cadmium transport and toxicity in intestinal cell model (Caco-2 cells). Transcriptome profiling of Caco-2 cells revealed high content of transporter DMT1 and ZIP14 and intensive expression of some calcium channels of the CACN family. The mathematical model describing three types of transporters, as well as intracellular cadmium binding with metallothionein and excretion through the basolateral membrane allowed us to construct cadmium uptake and transport curves that approximated the previously obtained experimental data. Using the proposed model, we determined toxic intracellular cadmium concentration leading to cell death and impairing the integrity of cell monolayer and described cadmium transport in this case.

  13. Zinc-Nickel Codeposition in Sulfate Solution Combined Effect of Cadmium and Boric Acid

    Directory of Open Access Journals (Sweden)

    Y. Addi

    2011-01-01

    Full Text Available The combined effect of cadmium and boric acid on the electrodeposition of zinc-nickel from a sulfate has been investigated. The presence of cadmium ion decreases zinc in the deposit. In solution, cadmium inhibits the zinc ion deposition and suppresses it when deposition potential value is more negative than −1.2 V. Low concentration of CdSO4 reduces the anomalous nature of Zn-Ni deposit. Boric acid decreases current density and shifts potential discharge of nickel and hydrogen to more negative potential. The combination of boric acid and cadmium increases the percentage of nickel in the deposit. Boric acid and cadmium.

  14. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador.

    Science.gov (United States)

    Chavez, E; He, Z L; Stoffella, P J; Mylavarapu, R S; Li, Y C; Moyano, B; Baligar, V C

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg(-1)) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0-5, 5-15, 15-30, and 30-50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg(-1), respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg(-1). Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg(-1)), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans>shell>leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg(-1), and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0-5 and 5-15 cm depths (r=0.80 and 0.82 for M3, and r=0.78 and 0.82 for HCl; P<0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: zhe@ufl.edu [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  16. Potentiation of cadmium nephrotoxicity by acetaminophen

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, A.M.; Russis, R. de; Ouled Amor, A.; Lauwerys, R.R.

    1988-10-01

    The possible interactions between acetaminophen and cadmium (Cd) on the kidney were investigated in female Sprague-Dawley rats. Acetaminophen was administered in the food at an average dose of 900 mg/kg and Cd in drinking water at the concentration of 200 ppm. The treatment with acetaminophen and Cd lasted 2 and 10 months, respectively. No interaction between Cd and acetaminophen was observed during the period of their concomitant administration: the increase in albuminuria caused by Cd and acetaminophen was additive, while the tubular impairment caused by acetaminophen (increased ..beta../sub 2/-microglobulinuria and decreased kidney concentrating ability) was not exacerbated by Cd. None of these treatments affected the glomerular filtration rate. Four months after the end of acetaminophen treatment, the renal changes had almost completely disappeared in the rats which had received the analgesic alone. Those continously exposed to Cd had developed slight tubular damage, as evidenced by an increased urinary excretion of ..beta../sub 2/-microglobulin and ..beta..-N-acetylglucosaminidase. By contrast, rats pretreated with acetaminophen for 2 months and exposed to Cd showed a marked increase in urinary excretion of albumin and ..beta../sub 2/-microglobulin, suggesting an interaction between both treatments. At the end of the study, only the interaction with ..beta../sub 2/-microglobulin excretion was still evident; that with the urinary excretion of ..beta..-N-acetylglucosaminidase and albumin having been masked by the chronic progessive nephrosis affecting most animals at that stage. As acetaminophen had no effect on the renal accumulation of Cd, it may be concluded that pretreatment with this analygesic at a dose causing slight tubular dysfunction renders rat kidney more sensitive to the nephrotoxic action of Cd. This observation may be of clinical relevance for population groups occupationally or environmentally exposed to Cd.

  17. [Physiological response and bioaccumulation of Panax notoginseng to cadmium under hydroponic].

    Science.gov (United States)

    Li, Zi-wei; Yang, Ye; Cui, Xiu-ming; Liao, Pei-ran; Ge, Jin; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui

    2015-08-01

    The physiological response and bioaccumulation of 2-year-old Panax notoginseng to cadmium stress was investigated under a hydroponic experiment with different cadmium concentrations (0, 2.5, 5, 10 μmol · L(-1)). Result showed that low concentration (2.5 μmol · L(-1)) of cadmium could stimulate the activities of SOD, POD, APX in P. notoginseng, while high concentration (10 μmol · L(-1)) treatment made activities of antioxidant enzyme descended obviously. But, no matter how high the concentration of cadmium was, the activities of CAT were inhibited. The Pn, Tr, Gs in P. notoginseng decreased gradually with the increase of cadmium concentration, however Ci showed a trend from rise to decline. The enrichment coefficients of different parts in P. notoginseng ranked in the order of hair root > root > rhizome > leaf > stem, and all enrichment coefficients decreased with the increase of concentration of cadmium treatments; while the cadmium content in different parts of P. notoginseng and the transport coefficients rose. To sum up, cadmium could affect antioxidant enzyme system and photosynthetic system of P. notoginseng; P. notoginseng had the ability of cadmium enrichment, so we should plant it in suitable place reduce for reducing the absorption of cadmium; and choose medicinal parts properly to lessen cadmium intake.

  18. Sexual dimorphism of cadmium-induced toxicity in rats: involvement of sex hormones.

    Science.gov (United States)

    Shimada, Hideaki; Hashiguchi, Takashi; Yasutake, Akira; Waalkes, Michael P; Imamura, Yorishige

    2012-09-01

    The toxic effect of cadmium varies with sex in experimental animals. Previous studies have demonstrated that pretreatment of male Fischer 344 (F344) rats with the female sex hormone progesterone markedly enhances the susceptibility to cadmium, suggesting a role for progesterone in the sexual dimorphism of cadmium toxicity. In the present study, we attempted to further elucidate the mechanism for sex differences in cadmium-induced toxicity in F344 rats. A single exposure to cadmium (5.0 mg Cd/kg, sc) was lethal in 10/10 (100 %) female compared with 6/10 (60 %) male rats. Using a lower dose of cadmium (3.0 mg Cd/kg), circulating alanine aminotransferase activity, indicative of hepatotoxicity, was highly elevated in the cadmium treated females but not in males. However, no gender-based differences occurred in the hepatic cadmium accumulation, metallothionein or glutathione levels. When cadmium (5.0 mg Cd/kg) was administered to young rats at 5 weeks of age, the sex-related difference in lethality was minimal. Furthermore, although ovariectomy blocked cadmium-induced lethality, the lethal effects of the metal were restored by pretreatment with progesterone (40 mg/kg, sc, 7 consecutive days) or β-estradiol (200 μg/kg, sc, 7 consecutive days) to ovariectomized rats. These results provide further evidence that female sex hormones such as progesterone and β-estradiol are involved in the sexual dimorphism of cadmium toxicity in rats.

  19. Cadmium determination in urine by atomic absorption spectrometry as a screening test in industrial medicine

    Science.gov (United States)

    Lehnert, G.; Klavis, G.; Schaller, K. H.; Haas, T.

    1969-01-01

    Lehnert, G., Klavis, G., Schaller, K. H., and Haas, T. (1969).Brit. J. industr. Med.,26, 156-158. Cadmium determination in urine by atomic absorption spectrometry as a screening test in industrial medicine. Cadmium was determined by atomic absorption spectrometry in the urine and serum of 18 workers exposed to cadmium dust and fume in a zinc smelting plant. In all cases the concentrations of cadmium in the serum were within the normal range, but those in the urine were elevated. The elevated urine concentrations showed that the exposed group had taken up more cadmium than normal, although they showed no clinical symptoms of cadmium poisoning. Analysis of urine for cadmium is therefore of value in preventive medicine, and should be used for periodic check-ups on those occupationally exposed. PMID:5780108

  20. Antagonism between cadmium and magnesium: a possible role of magnesium in therapy of cadmium intoxication.

    Science.gov (United States)

    Matović, Vesna; Plamenac Bulat, Zorica; Djukić-Cosić, Danijela; Soldatović, Danilo

    2010-03-01

    One of the important mechanisms of cadmium (Cd) toxicity is its interactions with bioelements, including magnesium (Mg). Exposure to Cd leads to disturbances in Mg metabolism in the organism, while Mg supplementation has an adverse effect on Cd absorption, accumulation and toxicity. According to the available results, which indicate a protective role of Mg against Cd toxicity, it remains to be seen whether magnesium may influence the important unsolved problem of Cd intoxication therapy. In this review, the interactions between the toxic metal Cd and the bioelement Mg are discussed on the basis of the available literature and our own results. We discuss these interactions mainly based on experimental data because data from human studies are scarce.

  1. LPIC-1 (Exams 101 and 102)

    CERN Document Server

    Smith, Roderick W

    2011-01-01

    Offering you thorough coverage of the new version of the leading Linux certification from Linux Professional Institute (LPI), this book covers both objectives and materials tested in the two required LPIC-1 exams: LPI 101 and LPI 102. You'll certainly appreciate the clear, concise information on key exam topics, including using Linux command line tools, managing software, configuring hardware, managing files and filesystems, working with the X Window system, administering the system, basic networking, and more.

  2. Cadmium and cadmium-tolerant soil bacteria in cacao crops from northeastern Colombia.

    Science.gov (United States)

    Bravo, D; Pardo-Díaz, S; Benavides-Erazo, J; Rengifo-Estrada, G; Braissant, O; Leon-Moreno, C

    2018-01-18

    This research aims to assess total-cadmium soil content and microbiological aspects to understand the dynamics of culturable cadmium-tolerant bacteria (CdtB) in cacao soils from northeastern Colombia. An integration of inverted dish plating, Cd determination and a microcalorimetry assay (IMC) was carried out. A farm in Boyacá showed the highest level of total soil Cd (3·74 mg kg -1 ) followed by farms in Santander and Arauca (2·76 and 1·16 mg kg -1 , respectively). Coefficient of determination between total soil Cd and CFU of CdtB was high (R 2  = 0·83) for the farm in Boyacá. Moreover, a pool of 129 CdtB was isolated, and phylogeny of 21 CdtB was discussed. Among CdtB strains isolated, Enterobacter sp. CdDB41 showed major Cd immobilization capacity (Q max of 2·21 and 2·32 J at 6 and 24 mg l -1 of CdCl 2 ), with an immobilization rate of 0·220 mg kg -1  h -1 . Among CdtB strains isolated, Enterobacter sp. CdDB41 showed major Cd immobilization capacity (Q max of 2·21 and 2·32 J at 6 and 24 mg l -1 of CdCl 2 ), with an immobilization rate of 0·220 mg kg -1  h -1 . Nothing is known about soil CdtB in cacao. Our data showed that CdtB such as Enterobacter sp. has high immobilization capacity. Furthermore, the otavite found in situ might be mineralized due to the bacterial metabolic activity of CdtB. © 2018 The Society for Applied Microbiology.

  3. Future trends in soil cadmium concentration under current cadmium fluxes to European agricultural soils.

    Science.gov (United States)

    Six, L; Smolders, E

    2014-07-01

    The gradual increase of soil cadmium concentrations in European soils during the 20th century has prompted environmental legislation to limit soil cadmium (Cd) accumulation. Mass balances (input-output) reflecting the period 1980-1995 predicted larger Cd inputs via phosphate (P) fertilizers and atmospheric deposition than outputs via crop uptake and leaching. This study updates the Cd mass balance for the agricultural top soils of EU-27+Norway (EU-27+1). Over the past 15 years, the use of P fertilizers in the EU-27+1 has decreased by 40%. The current mean atmospheric deposition of Cd in EU is 0.35 g Cd ha(-1) yr(-1), this is strikingly smaller than values used in the previous EU mass balances (~3 g Cd ha(-1) yr(-1)). Leaching of Cd was estimated with most recent data of soil solution Cd concentrations in 151 soils, which cover the range of European soil properties. No significant time trends were found in the data of net applications of Cd via manure, compost, sludge and lime, all being small sources of Cd at a large scale. Modelling of the future long-term changes in soil Cd concentrations in agricultural top soils under cereal or potato culture predicts soil Cd concentrations to decrease by 15% over the next 100 years in an average scenario, with decreasing trends in some scenarios being more prevalent than increasing trends in other scenarios. These Cd balances have reverted from the general positive balances estimated 10 or more years ago. Uncertainty analysis suggests that leaching is the most uncertain relative to other fluxes. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. 101 ready-to-use Excel formulas

    CERN Document Server

    Alexander, Michael

    2014-01-01

    Mr. Spreadsheet has done it again with 101 easy-to-apply Excel formulas 101 Ready-to-Use Excel Formulas is filled with the most commonly-used, real-world Excel formulas that can be repurposed and put into action, saving you time and increasing your productivity. Each segment of this book outlines a common business or analysis problem that needs to be solved and provides the actual Excel formulas to solve the problem-along with detailed explanation of how the formulas work. Written in a user-friendly style that relies on a tips and tricks approach, the book details how to perform everyday Excel tasks with confidence. 101 Ready-to-Use Excel Formulas is sure to become your well-thumbed reference to solve your workplace problems. The recipes in the book are structured to first present the problem, then provide the formula solution, and finally show how it works so that it can be customized to fit your needs. The companion website to the book allows readers to easily test the formulas and provides visual confirmat...

  5. Cadmium and zinc accumulation in soybean: A threat to food safety?

    Energy Technology Data Exchange (ETDEWEB)

    Shute, Tracy [Department of Biology, University of Western Ontario, London, ON N6A 5B7 (Canada); Macfie, Sheila M. [Department of Biology, University of Western Ontario, London, ON N6A 5B7 (Canada)]. E-mail: smacfie@uwo.ca

    2006-12-01

    A greenhouse study was conducted to quantify cadmium and zinc accumulated by soybean (Glycine max (L.) Merr.) when the metals were supplied separately and together. The highest dose of cadmium (100 mg/kg) reduced plant height and dry weight (down to 40% and 34% of control, respectively); the highest dose of zinc (2000 mg/kg) reduced plant height to 55% of control and dry weight to 70% of control. With both metals present, the plants were approximately the same size as those treated with cadmium only. The concentration of cadmium in the roots was unaffected by zinc. In other tissues, the effect of zinc on the accumulation of cadmium depended on the doses provided. At low doses, the addition of zinc reduced the concentration of cadmium in aboveground tissues to 40-50% of that found in plants exposed to cadmium only. However, when applied in high doses, the presence of zinc in cadmium-contaminated soils increased the uptake and accumulation of cadmium in aboveground tissues by up to 42%. In contrast, at high doses, the presence of cadmium in zinc-contaminated soil resulted in approximately 35% lower concentrations of zinc in all tissues. At a lower dose, cadmium had no effect on concentration of zinc in the plant tissues. The effects of high doses of one metal on the uptake of the other metal can be partially explained by the effects of one metal on the bioavailability of the other metal. In soils to which only one metal was added, bioavailable cadmium was 70-80% of the total cadmium, and bioavailable zinc was 50-70% of the total zinc. When both metals were added to the soil, 80-100% of the cadmium and 46-60% of the zinc were bioavailable. Concentrations of both metals were highest in root tissues (10-fold higher for cadmium, and up to 2-fold higher for zinc). Although relatively little cadmium was translocated to pods and seeds, the seeds of all plants (including those from control and zinc-treated plants) had concentrations of cadmium 3-4 times above the limit of 0

  6. Identification of TSG101 functional domains and p21 loci required for TSG101-mediated p21 gene regulation.

    Directory of Open Access Journals (Sweden)

    Yu-Shiuan Lin

    Full Text Available TSG101 (tumor susceptibility gene 101 is a multi-domain protein known to act in the cell nucleus, cytoplasm, and periplasmic membrane. Remarkably, TSG101, whose location within cells varies with the stage of the cell cycle, affects biological events as diverse as cell growth and proliferation, gene expression, cytokinesis, and endosomal trafficking. The functions of TSG101 additionally are recruited for viral and microvesicle budding and for intracellular survival of invading bacteria. Here we report that the TSG101 protein also interacts with and down-regulates the promoter of the p21 (CIP1/WAF1 tumor suppressor gene, and identify a p21 locus and TSG101 domains that mediate this interaction. TSG101 deficiency in Saos-2 human osteosarcoma cells was accompanied by an increased abundance of p21 mRNA and protein and the retardation of cell proliferation. A cis-acting element in the p21 promoter that interacts with TSG101 and is required for promoter repression was located using chromatin immunoprecipitation (ChIP analysis and p21-driven luciferase reporter gene expression, respectively. Additional analysis of TSG101 deletion mutants lacking specific domains established the role of the central TSG101 domains in binding to the p21 promoter and demonstrated the additional essentiality of the TSG101 C-terminal steadiness box (SB in the repression of p21 promoter activity. Neither binding of TSG101 to the p21 promoter nor repression of this promoter required the TSG101 N-terminal UEV domain, which mediates the ubiquitin-recognition functions of TSG101 and its actions as a member of ESCRT endocytic trafficking complexes, indicating that regulation of the p21 promoter by TSG101 is independent of its role in such trafficking.

  7. Purification of cadmium up to 5N+ by vacuum distillation

    Indian Academy of Sciences (India)

    Cadmium was refined by vacuum distillation, a technique suitable for low boiling and melting point materials, to remove the heavy and low vapour pressure impurities at ppm level. The detailed analysis of the purified Cd as well as raw Cd was done by ICP–OES techniques for 27 impurity elements. Purification was carried ...

  8. Cadmium induced oxidative stress in Dunaliella salina | Moradshahi ...

    African Journals Online (AJOL)

    The unicellular green algae Dunaliella salina contains various antioxidants which protect the cell from oxidative damage due to environmental stresses such as heavy metal stress. In the present study, the response of D. salina at the stationary growth phase to oxidative stress generated by cadmium chloride was ...

  9. Mechanism of cadmium ion removal by base treated juniper fiber

    Science.gov (United States)

    Soo-Hong Min; J.K. Park; James S. Han; Eun Woo Shin

    2003-01-01

    Pinyon juniper, Juniperus Monosperma, is a small-diameter and underutilized (SDU) lignocellulosic material. Evaluated were efficacy of base-treated juniper fiber (BTJF) sample for cadmium (Cd 2+ ) sorption and the viability of juniper fiber as a sorbent for the removal of Cd 2+ from water. Fourier Transform Infrared Spectroscopy (FTIR) analysis indicated that...

  10. Optical characterisation of thin film cadmium oxide prepared by a ...

    African Journals Online (AJOL)

    The optical transmission spectra of transparent conducting cadmium oxide (CdO) thin films deposited by a modified reactive evaporation process onto glass substrates have been measured. The interference fringes were used to calculate the refractive index, thickness variation, average thickness and absorption coefficient ...

  11. Homogeneity and Magnetic Susceptibility in Some Substituted Cadmium Spinels,

    Science.gov (United States)

    1983-11-25

    the excess cadmium was removed. Analysis of the rhodium complex precursor was performed by reduction under flowing 85% argon/1S% hydrogen at 500C...Acta Cryst. B25, 925 (1969). 11. P.W. Selwood, " Magnetochemistry " 2nd ed., Interscience: New York, 1956, p. 78. *l m .. .. ...- 5 -10- TABLE I

  12. Cadmium translocation and accumulation in developing barley grains

    DEFF Research Database (Denmark)

    Chen, Fei; Wu, Feibo; Dong, Jing

    2007-01-01

     Soil cadmium (Cd) contamination has posed a serious problem for safe food production and become a potential agricultural and environmental hazard worldwide. In order to study the transport of Cd into the developing grains, detached ears of two-rowed barley cv. ZAU 3 were cultured in Cd stressed ...

  13. Effects of cadmium on the growth and physiological characteristics ...

    African Journals Online (AJOL)

    The effects of cadmium (Cd) stress on the growth and physiological characteristics were studied in 3 sorghum species viz., sweet sorghum [Sorghum bicolor (L.) Moench. cv. Hunnigreen], sorghum hybrid sudangrass (Sorghum bicolor × Sorghum sudanense, cv. Everlush) and sudangrass [Sorghum sudanense (Piper) Stapf ...

  14. Monitoring the distribution of cadmium in sediment samples from ...

    African Journals Online (AJOL)

    The distribution of cadmium species in sediments of different depths from Obajana stream was investigated by sequential extraction procedure and flame atomic absorption spectrometric detection. Index of geoaccumulation was used to assess the level of sediment pollution and it was found not to be polluted. However, the ...

  15. Copper, nickel, zinc, cadmium and lead contamination of soil at ...

    African Journals Online (AJOL)

    This paper discussed heavy metals such as coppper (Cu), nickel (Ni), zinc (Zn), cadmium (Cd) and lead (Pb) in the soil collected from three sites from the solid waste dumping ground at Kureepuzha, very close to Ashtamudi Lake. Also, control samples were collected and analyzed for the said heavy metals. The levels of all ...

  16. Two new hexacoordinated coordination polymers of cadmium(II ...

    Indian Academy of Sciences (India)

    Two new hexacoordinated coordination polymers of cadmium(II) containing bridging units only: Syntheses, structures and molecular properties. DIPU SUTRADHARa, HABIBAR CHOWDHURYb,∗, SUSHOVAN KONERa, SUBHASIS ROYa and BARINDRA KUMAR GHOSHa,∗. aDepartment of Chemistry, The University of ...

  17. Effect of exposure to cadmium on the tropical freshwater prawn ...

    African Journals Online (AJOL)

    The effect of cadmium (Cd) on mortality, resistance and bioaccumulation in the tropical freshwater prawn Macrobrachium rosenbergii from Egypt were studied. Survival of prawns exposed to Cd doses over 60 μg l-1 were sig nificantly lower than that of prawns exposed to lower doses. After 96 h prawns ex posed to >40 μg ...

  18. Histopathological changes in the head kidney induced by cadmium ...

    African Journals Online (AJOL)

    We evaluated the effect of cadmium (Cd) on the structure and function of the head kidney in the freshwater fish Colossoma macropomum (C. macropomum). Juveniles were exposed to 0.1 mg/L CdCl2 for 31 days. Blood samples were examined using hematological tests and head kidney histology was determined by light ...

  19. Spatial and temporal variation in cadmium body loads of four ...

    African Journals Online (AJOL)

    Increasing urbanization and industrialization along the coastal areas of False Bay in South Africa can endanger coastal ecosystems because of increasing metal pollution. To obtain baseline data on contamination levels in the intertidal zone, cadmium (Cd) body loads of four invertebrate species were measured seasonally ...

  20. Biosorption of Cadmium from Aqueous Solutions Using A local ...

    African Journals Online (AJOL)

    Cadmium (Cd) (II) resistant strain of a marine fungus, named Aspergillus cristatus was isolated from heavy metals polluted area in the Mediterranean Sea, Alexandria, Egypt during autumn, 2009. It could tolerate up to 100 mg l–1. Optimization of culture conditions for production of fungal biomass fortifying maximum Cd (II) ...

  1. The Determination of Lead, Arsenic, Mercury, Cadmium Contents in ...

    African Journals Online (AJOL)

    A total of sixty samples per variety of fish used in this study was prepared for analysis by processes of homogenization and digestion of the whole fish (after their intestines have been removed); after which their individual lead, cadmium, arsenic and chromium contents were estimated by atomic absorption spectrophotometry ...

  2. Cadmium accumulation and antioxidative defenses in leaves of ...

    African Journals Online (AJOL)

    Corn (Zea Mays L.) and wheat (Triticum aestivum L. ) seedlings were grown in four cadmium (Cd) concentration levels (0 - 1 mg/l) in a hydroponic system to analyze the antioxidant enzyme system, Cd concentration in the shoots and roots of plants, proline contents, growth responses and chlorophyll contents in the leaves of ...

  3. Fertility of male workers exposed to cadmium, lead, or manganese.

    Science.gov (United States)

    Gennart, J P; Buchet, J P; Roels, H; Ghyselen, P; Ceulemans, E; Lauwerys, R

    1992-06-01

    The effect of exposure to cadmium, lead, or manganese on male reproductive function was examined in 1988-1989 in Belgian blue-collar workers. The workers were exposed to cadmium in two smelters (n = 83; geometric mean urinary cadmium level = 6.94 micrograms/g of creatinine; mean duration of exposure = 24 years), to lead in a battery factory (n = 74; mean blood lead level = 46.3 micrograms/dl; mean duration of exposure = 10.7 years), or to manganese (manganese dioxide) in a dry alkaline battery plant (n = 70; median atmospheric concentration of total manganese dust = 0.71 mg/m3; mean duration of exposure = 6.2 years). Fertility in these workers and in an unexposed population (n = 138) was assessed by examining the birth experiences of their wives through a logistic regression model. The probability of a live birth was not different between the unexposed workers and the cadmium- or manganese-exposed workers before or after the onset of exposure. While the fertility of the lead-exposed workers was somewhat greater than that of the unexposed before the onset of exposure, a significant decrease in fertility was observed during the period of exposure to the metal (odds ratio = 0.65, 95% confidence interval 0.43-0.98).

  4. Phytoextraction potential of cadmium and lead contamination using ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-12-31

    Dec 31, 2014 ... Lead accumulation in plant tissue impairs various morphological, physiological, and biochemical functions .... chlorophyll meter (based on light transmittance through leaves) was used as a non-destructive tool for .... of cadmium on the photosynthetic system cause several structural and functional disorders.

  5. Biosorption of cadmium (ii) ion from aqueous solution by Afzelia ...

    African Journals Online (AJOL)

    The batch adsorption of cadmium (II) ion from aqueous solution using low-cost adsorbent of biological origin, Afzelia africana shell under different experimental conditions was investigated in this study. The influences of initial Cd (II) ion concentration, initial pH, contact times and temperature were reported. Adsorption of Cd ...

  6. Cadmium sulphide thin film for application in gamma radiation ...

    African Journals Online (AJOL)

    Cadmium Sulphide (CdS) thin film was prepared using pyrolytic spraying technique and then irradiated at varied gamma dosage. The CdS thin film absorption before gamma irradiation was 0.6497. Absorbed doses were computed using standard equation established for an integrating dosimeter. The plot of absorbed dose ...

  7. Production of high purity granular metals: cadmium, zinc, lead

    Directory of Open Access Journals (Sweden)

    Shcherban A. P.

    2017-04-01

    Full Text Available Cadmium, zinc and lead are constituent components of many semiconductor compounds. The obtained high purity distillates and ingots are large-size elements, which is not always convenient to use, and thus require additional grinding, which does not always allow maintaining the purity of the original materials. For the growth of semiconductor and scintillation single crystals it is advisable to use "friable" granular high-purity distillates, which can be processed without the risk of contamination. For example, the European low-background experiment LUCIFER required more than 20 kg of high-purity granulated zinc, which was agreed to be supplied by NSC KIPT. This task was then extended to cadmium and lead. Motivated by these tasks, the authors of this paper propose complex processes of deep refining of cadmium, zinc and lead by vacuum distillation. A device producing granules has been developed. The process of granulation of high-purity metals is explored. The purity of produced granules for cadmium and zinc is >99,9999, and >99,9995% for lead granules. To prevent oxidation of metal granules during exposition to air, chemical methods of surface passivation were used. Organic solvent based on dimethylformamide used as a coolant improves the resistance of granules to atmospheric corrosion during the granulation of high purity Cd, Zn and Pb.

  8. Operational speciation of lead, cadmium, and zinc in farmlands ...

    African Journals Online (AJOL)

    This study was undertaken to evaluate the geochemical fractions and risk potential of lead (Pb), cadmium (Cd) and zinc (Zn) in farmlands around a polluted goldmine in Dareta, northern Nigeria. The total heavy metal concentrations were obtained through a mixed acid digestion. A modified sequential extraction procedure ...

  9. Thermoelectric material comprising scandium doped zinc cadmium oxide

    DEFF Research Database (Denmark)

    2016-01-01

    There is presented a composition of scandium doped Zinc Cadmium Oxide with the general formula ZnzCdxScyO which the inventors have prepared, and for which material the inventors have made the insight that it is particularly advantageous as an n-type oxide material, such as particularly advantageous...

  10. Effect of Pyrolysis Temperature on Cadmium and Lead ...

    African Journals Online (AJOL)

    Consumption of tobacco as cigarette or otherwise has been demonstrated to contribute to air pollution via smoke generation resulting in adverse health effect. Therefore, this study investigates the effect of pyrolysis temperature on the concentration, distribution of cadmium and lead between ash residue and smoke in some ...

  11. High cadmium / zinc ratio in cigarette smokers: potential implications ...

    African Journals Online (AJOL)

    Tobacco smoke may be one of the most common sources of cadmium (Cd) in the general population, particularly in the rising population of smokers in developing countries. Although a relationship between both cigarette smoking and environmental Cd contamination with prostate cancer exist, the mechanisms are unclear.

  12. The biosorption of cadmium and lead ions from aqueous Solution ...

    African Journals Online (AJOL)

    The biosorption potentiality of Musa paradisiaca stalk at removing cadmium and lead ions from aqueous solution was investigated. The biosorption experiment was carried out as a function of contact time, initial pH, initial metal ion concentration and biosorbent dose. Adsorption equilibria were obtained from batch ...

  13. Evaluation of some trace elements (zinc, chromium, cadmium and ...

    African Journals Online (AJOL)

    Throughout the world, tuberculosis (TB) infection is on the increase and it has remained one of the most important causes of death among adults in developing countries. This study evaluated the serum concentrations of some trace elements -Zinc (Zn), Manganese (Mn), Chromium (Cr) and Cadmium (Cd), in 100 blood ...

  14. Cadmium distribution in coastal sediments and mollusks of the US.

    Science.gov (United States)

    Apeti, Dennis A; Lauenstein, Gunnar G; Riedel, Gerhardt F

    2009-07-01

    Cadmium (Cd) concentrations in the coastal United States were assessed using the National Status and Trends (NS&T) Mussel Watch dataset, which is based on the analysis of sediments and bivalves collected from 280 sites since 1986. Using the 1997 sediment data, Pearson correlation (r=0.44, pmollusk Cd content were not well correlated.

  15. Adsorption kinetics of cadmium and lead by chitosan | Bamgbose ...

    African Journals Online (AJOL)

    An evaluation of the kinetics and capacity of chitosan to trap lead and cadmium ions in aqueous solution was carried out at 25oC using concentration and contact time as parameters. The experiments were done as batch process. Our results show that the adsorption process is concentration-driven with high capacity of ...

  16. Phytoextraction potential of cadmium and lead contamination using ...

    African Journals Online (AJOL)

    Vegetative growth, biomass, chemical content and uptake of cadmium (Cd) and lead (Pb) in Melia azedarach L. (chinaberry) and Populus alba L. (white poplar) seedlings were investigated using a 2-year pot experiment. The results indicated that P. alba and M. azedarach are tolerant to contaminated soil by Cd or Pb ...

  17. Hydrogen bonding in thiobenzamide synthon and its Cadmium ...

    Indian Academy of Sciences (India)

    1403. 3.4 Thermal behavior of [Cd(TBA)Cl2]. Several complexes of Cadmium with sulfur- contain- ing ligands have been used as precursors to synthesize. CdS nanoparticules.37,38 Accordingly, thermal stability of [Cd(TBA)Cl2] complex (Figure S9) was carried out in the temperature range 0–900. ◦. C under nitrogen atmo-.

  18. Evaluation of cadmium bioaccumulation and translocation by Hopea ...

    African Journals Online (AJOL)

    parisa

    2012-04-10

    Apr 10, 2012 ... the metal concentration ratio of plant roots to soil), translocation factor (TF, the metal concentration ratio of plant shoots to .... pH (1:2.5 soil to water). 4.62 ..... with high levels of CdSo4 (50 µM) in hydroponic culture. Cadmium ...

  19. Propagation of a cadmium spill through an impounded river system

    NARCIS (Netherlands)

    Klaver, G.T.; Joziasse, J.; Bakker, I.

    2009-01-01

    In this paper, the influence of impoundments (sluices, weirs, etc.) and stream components (tributaries, river branches, associated canals) on the metal content in water and suspended particulate matter (SPM) in the Dutch part of the River Meuse is assessed using the decrease in the cadmium content

  20. Cadmium, copper and nickel levels in vegetables from industrial and ...

    African Journals Online (AJOL)

    The levels of cadmium, copper and nickel in five different edible vegetables viz Talinum triangulare, Celosia trigyna, Corchorus olitorus, Venomia amygydalina and Telfaria accidentalis, and the soils on which they were grown from three industrial and three residential areas of Lagos City, in Nigeria, were determined using ...

  1. Impact of cadmium on the ecdysteroids production in Gammarus fossarum.

    Science.gov (United States)

    Abidi, Sondes; Abbaci, Khedidja Tair; Geffard, Olivier; Boumaiza, Moncef; Dumet, Adeline; Garric, Jeanne; Mondy, Nathalie

    2016-07-01

    Gammarus fossarum is an important test organism which is currently used as a bio-indicator as well as in ecotoxicological tests. Nevertheless, data on ecdysteroids in endocrine toxicity test are not yet available for these species, despite its crucial role in molting and reproduction. In the present paper, ecdysteroids concentrations were studied during the molt cycle (in females) and embryonic development in G. fossarum (Crustacea, Amphipoda) in order to propose an ecdysteroids toxicity test. Ecdysteroids levels in G. fossarum showed a single peak during premolt at stage Dl-D2. In embryos, ecdysteroids levels progressively increased over stages 3 and 4, with peak levels at stage 4. A Cadmium toxicity test was proposed to examine if the molting and embryogenesis disturbances previously observed after cadmium exposure (Geffard et al. 2010) could be attributed to changes in ecdysteroids titers. Exposure to the different cadmium concentrations (3; 9; 300; 900 µg/l) increased ecdysteroids secretion by Y-organs in vitro, but it had no significant effect on exposed embryos (in vivo). Based on previous findings, we are led to conclude that the molting impairments in cadmium-exposed females of G. fossarum is connected to the changes in ecdysteroids concentrations.

  2. Lead and cadmium in wild birds in southeastern Spain

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Fernandez, A.J.; Sanchez-Garcia, J.A.; Luna, A. [Univ. of Murcia (Spain); Jimenez-Montalban, P. [Regional Environmental Agency, Murcia (Spain). Centro de Recuperacion de Fauna Silvestre El Valle

    1995-12-01

    The main purpose of this study was to monitor exposure to lead and cadmium in wild birds in Murcia, a southeastern region of Spain on the Mediterranean coast. This region lies on one of the African-European flyways. Samples of liver, kidney, brain, bone, and whole blood from several species of wild birds were obtained during 1993. The authors found a clear relationship between cadmium and lead concentrations in birds and their feedings habits. Vultures (Gyps fulvus) had the highest concentrations of lead (mean 40 {micro}g/dl in blood), and seagulls (Larus argentatus and Larus ridibundus) the highest concentrations of cadmium (mean 4.43 {micro}g/g in kidney). Insectivores had high concentrations of both metals, and diurnal and nocturnal raptors showed the lowest tissue concentrations. The findings that tissue and blood concentrations were generally not elevated suggests environmental (rather than acute) exposure. Birds from more industrialized areas of the region studied here had higher concentrations of both lead and cadmium.

  3. Evaluation of cadmium bioaccumulation and translocation by Hopea ...

    African Journals Online (AJOL)

    parisa

    2012-04-10

    Apr 10, 2012 ... species such as lettuce (Lactuca sativa L.), cabbage. (Brassica oleracea L.) and tobacco (Nicotiana tabacum. L.) with ability to accumulate high concentrations of Cd in leaves rather than roots (Jadia and Fulekar, 2008a). Total cadmium concentration in the plant. Total plant Cd concentration varied under ...

  4. Influence of diethyldithiocarbamate on cadmium and copper toxicity ...

    African Journals Online (AJOL)

    drinie

    phenomena linked to the natural medium complexity and to evaluate the interactions between two heavy metals cadmium, (Cd) and copper (Cd), and a fungicide, diethyldithiocarbamate (DDTC). The choice of these three chemicals was based on the fact that Cd and Cu are common and worrying environmental pollutants ...

  5. Effects of cadmium stress on growth, metal accumulation and ...

    African Journals Online (AJOL)

    A study quantifying the effects of exogenous cadmium (Cd) on growth, Cd bioaccumulation and organic acids of Spartina alterniflora was conducted. The experiment consisted of three levels of exogenous Cd2+ concentrations: 0, 50, and 200 mg/kg. Total Cd and water-soluble Cd were determined. Plant height, tiller number ...

  6. Concentration and bioavailability of cadmium by some plants ...

    African Journals Online (AJOL)

    A survey was carried out to evaluate the existing level of cadmium in three plant species within and around a refuse site at Ojota, Lagos State, Nigeria. Concentration ranged from background levels to levels well in excess of the maximum tolerable limit in agricultural soils. In the leaves, the least (highest in bracket) of ...

  7. Extraction of cadmium(II) from acidic medium with macroporous ...

    African Journals Online (AJOL)

    Extraction of cadmium(II) from acidic medium with macroporous resin impregnated with bis(2-ethylhexyl) ammonium bis(2-ethylhexyl)dithiocarbamate. I Fall, M Diaw, S A Ndiaye, R N Mendoza, M A Rodriguez, T I Saucedo Medina ...

  8. Rapid biosynthesis of cadmium sulfide (CdS) nanoparticles using ...

    African Journals Online (AJOL)

    Cell-associated biosynthesis of cadmium sulfide (CdS) nanoparticles has been reported to be rather slow and costly. In this study, we report on a rapid and low cost biosynthesis of CdS using culture supernatants of Escherichia coli ATCC 8739, Bacillus subtilis ATCC 6633 and Lactobacillus acidophilus DSMZ 20079T.

  9. Lead and Cadmium Levels of Five Commonly and Widely ...

    African Journals Online (AJOL)

    ... Corchorus olitorius, and Corchorus tridens) consumed by Kano inhabitants were investigated and found to be at concentration below the environmental lead action level set by US EPA/WHO. Cadmium was not detected in the samples. Low concentration of Pb and absence of Cd in all the plant samples analyzed are clear ...

  10. Effects of Cadmium on the Growth and Physiological Characteristics ...

    African Journals Online (AJOL)

    Administrator

    2011-11-09

    Nov 9, 2011 ... The effects of cadmium (Cd) stress on the growth and physiological characteristics were studied in 3 sorghum species viz., sweet sorghum [Sorghum bicolor (L.) Moench. cv. Hunnigreen], sorghum hybrid sudangrass (Sorghum bicolor × Sorghum sudanense, cv. Everlush) and sudangrass [Sorghum.

  11. Purification of cadmium by selective volatilization in vacuum in ...

    Indian Academy of Sciences (India)

    experiments were conducted at the level of nearly 1·5 kg a batch to study the impurities behaviour due to upscaling. The detailed chemical analysis of 58 impurity elements in Cd in presence and absence of oxide layer was carried out by glow discharge mass spectrometry (GDMS). Keywords. High purity; cadmium; selective ...

  12. Effect of Low Level Cadmium Exposure on Superoxide Dismutase ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of low level cadmium (Cd) exposure on the activity of superoxide dismutase (SOD) in rat. Methods: Thirty-two male albino rats were divided into four groups of eight animals each. Group one received distilled water and served as control. The other three groups were exposed to 100, 200 ...

  13. Antioxidants, cadmium-induced toxicity, serum biochemical and the ...

    African Journals Online (AJOL)

    While the ACP and ACPT changed from 32.6±0.72 and 7 ±Units in the control to 54 and 17 units respectively at 40mg/kg of CD. Furthermore Cadmium also caused positively correlated dose- and time-dependent destruction of the histology of the liver, kidney and testes. These were characterized by vascular congestion, ...

  14. Adsorption mechanism of cadmium on juniper bark and wood

    Science.gov (United States)

    Eun Woo Shin; K. G. Karthikeyan; Mandla A. Tshabalala

    2007-01-01

    In this study the capacity of sorbents prepared from juniper wood (JW) and bark (JB) to adsorb cadmium (Cd) from aqueous solutions at different pH values was compared. Adsorption behavior was characterized through adsorption kinetics, adsorption isotherms, and adsorption edge experiments. Results from kinetics and isotherm experiments showed that JB (76.3–91.6 lmol Cd...

  15. Lead and Cadmium in Vinyl Children's Products. A Greenpeace Expose.

    Science.gov (United States)

    Di Gangi, Joseph

    Polyvinyl chloride (vinyl or PVC) is a substance widely used in children's products. Because children in contact with these products may ingest substantial quantities of potentially harmful chemicals during normal play, especially when they chew on the product, this Greenpeace study examined the levels of lead and cadmium in a variety of consumer…

  16. Adsorption of Acetic Acid, Cadmium ions, Lead ions and Iodine ...

    African Journals Online (AJOL)

    Michael Horsfall

    pesticides, as plant nutrients and as a constituent of waste products. These heavy metals may include cadmium, zinc ... effluent might contain non-biodegradable matter, toxic heavy metals, organic matter and also might ..... (2003) Wastewater Engineering Treatment and. Reuse, 4th Edition, Tata McGraw-Hill Publishing.

  17. Effects of Cadmium Exposure on Bone and Kidney Alkaline ...

    African Journals Online (AJOL)

    were given chow (('lu.inca Feed, Nig. Plc) and water ad Iibitum and left to acclimatisc for at period of two weeks before the experiment was commenced. Clremicals and Reagents: Cadmium sulphate. (3CdS().,.8ll2()), chloroform, sodium chloride (E. Merck, Darmstadt, W. Germany). Acid and alkaline phosphatase assay kits ...

  18. Carryover of cadmium from feed in growing pigs

    NARCIS (Netherlands)

    Hoogenboom, L.A.P.; Hattink, J.; Polanen, van A.; Oostrom, van J.J.; Verbunt, J.T.; Traag, W.A.; Kan, K.A.; Eijkeren, J.C.H.; Boeck, de G.; Zeilmaker, M.J.

    2015-01-01

    Growing male pigs were exposed to cadmium (Cd) at levels around 1 and 10 mg kg–1 feed for up to 12 weeks, administered as CdCl2 or Cd-cysteine (CdCys). Pigs exposed to 10 mg kg–1 showed decreased growth during the last 3 weeks. Liver and kidney concentrations of Cd continuously increased over the

  19. Cadmium uptake by Telfaria Occidentalis Hook F.(cucurbitaceae ...

    African Journals Online (AJOL)

    Anova tests showed that the differences between cadmium levels accumulated for control and treatment plants were significant (no overlap in standard error) at 5% level of probability. There were no such significant differences (P 0.05) for the amount of crude protein yields when the control was compared to the treatments.

  20. Physiological and molecular characterisation of cadmium stress in Schmidtea mediterranea.

    Science.gov (United States)

    Plusquin, Michelle; Stevens, An-Sofie; Van Belleghem, Frank; Degheselle, Olivier; Van Roten, Andromeda; Vroonen, Jessica; Blust, Ronny; Cuypers, Ann; Artois, Tom; Smeets, Karen

    2012-01-01

    The planarian Schmidtea mediterranea is a well-studied model organism for developmental research, because of its stem cell system. This characteristic also provides a unique opportunity to study stress management and the effect of stress on stem cells. In this study, we characterised the stress signature at different levels of biological organization. The carcinogenic metal cadmium was used as a model chemical stressor. We focused on stem cell activity and its interaction with other known stress parameters. Here, we have found that S. mediterranea is able to cope with high internal levels of cadmium. At endpoints such as size and mobility, cadmium-related stress effects were detected but all of these responses were transient. Correspondingly, cadmium exposure led to an elevated mitotic activity of the neoblasts, at the same time points when the other responses disappeared. At the molecular level, we observed redox-related responses that can be linked with both repair as well as proliferation mechanisms. Together, our results suggest that these animals have a high plasticity. The induction of stem cell activity may underlie this 'restoring' effect, although a carcinogenic outcome after longer exposure times cannot be excluded.