WorldWideScience

Sample records for c f braun standard turbine island

  1. C. F. Braun. Standard turbine island design, safety analysis report

    International Nuclear Information System (INIS)

    A standard turbine island used with a BWR is described. It consists of the turbine-generator; steam system; condensate storage, cleanup, and transfer systems; control and instrumentation; water treatment plant; make-up demineralizer; potable and waste water systems; and a compressed air system. The turbine-generator is a tandem-compound nuclear-type turbine with one double-flow high-pressure section and a six-flow low-pressure section in three double-flow low-pressure casings. The turbine is direct connected to an 1800 rpm synchronous a-c generator. A combined moisture separator and two-stage reheater is provided. The main steam system delivers the steam generated in a BWR to the main turbine stop valves. The condensate system maintains proper water inventory. Protective features prevent loss of the system due to electrical failure of a component and isolates faults to ensure continuity of a power supply from alternate sources. (U.S.)

  2. Dr. Wernher Von Braun

    Science.gov (United States)

    1960-01-01

    On September 8, 1960 President Dwight D. Eisenhower visited Huntsville, Alabama to dedicate a new NASA field center in honor of General George C. Marshall, Eisenhower's wartime colleague and the founder of the famous Marshall Plan for European recover after World War II. The new George C. Marshall Space Flight Center was placed under the control of Dr. Wernher Von Braun shown here talking with President Eisenhower. As parto f his remarks dedicating the center, President Eisenhowe refereed to General Marshall as a 'man of yar, yet a builder of peace'. the Marshall Center's first major assignment including building the huge Saturn V rocket that launched human beings on their first journey to the surface of the moon in 1969.

  3. Resultados neonatais no parto vaginal espontâneo comparados aos dos partos com fórcipe de Simpson-Braun em primíparas Neonatal outcome of spontaneous deliveries as compared to Simpson-Braun forceps deliveries in nulliparous women

    Directory of Open Access Journals (Sweden)

    Belmiro Gonçalves Pereira

    2004-02-01

    Full Text Available OBJETIVO: comparar os resultados neonatais dos partos vaginais espontâneos ou assistidos com fórcipe de Simpson-Braun em nulíparas. MÉTODO: em estudo de corte retrospectivo foram avaliados dois grupos de primíparas atendidas no Centro Obstétrico do CAISM/UNICAMP, que tiveram parto vaginal sob analgesia epidural. O grupo fórcipe foi formado por 119 pacientes que tiveram parto a fórcipe de Simpson-Braun, e o grupo normal por 114 casos de parto vaginal espontâneo. Foram estudadas as variáveis neonatais imediatas como o estado do líquido amniótico e os índices de Apgar, assim como a evolução neonatal nos primeiros dias de vida. Para análise estatística foram utilizados os testes c², exato de Fisher e t de Student para comparação de médias e considerada significativa a diferença correspondente a pPURPOSE: to compare maternal and neonatal outcomes between spontaneous vaginal and Simpson-Braun forceps deliveries in nulliparous women. METHOD: a retrospective study including two groups of nulliparous women, who had vaginal delivery under peridural anesthesia in the obstetric unit of the CAISM-UNICAMP: the forceps group included 119 women who had Simpson-Braun forceps delivery, and the normal group included 114 women who delivered spontaneously. Neonatal outcomes, such as Apgar score and the evolution in the first days of life, were studied. Data were compared in both groups and, for statistical analysis, c² test, Fisher exact, and Student t tests were used. The differences were considered significant when p<0.05. RESULTS: the indications for Simpson-Braun forceps delivery were maternal-fetal relief (90 cases and abbreviation of the expulsive period (29 cases. In the forceps group there were 8 cases (6.7% of vaginal injuries; a similar result was observed in the normal group. The number of hospitalization days for the parturient and the newborns was identical, 2.4 days. The newborns in the two groups had similar Apgar scores

  4. Offshore Wind Turbines - Estimated Noise from Offshore Wind Turbine, Monhegan Island, Maine: Environmental Effects of Offshore Wind Energy Development

    Energy Technology Data Exchange (ETDEWEB)

    Aker, Pamela M.; Jones, Anthony M.; Copping, Andrea E.

    2010-11-23

    Deep C Wind, a consortium headed by the University of Maine will test the first U.S. offshore wind platforms in 2012. In advance of final siting and permitting of the test turbines off Monhegan Island, residents of the island off Maine require reassurance that the noise levels from the test turbines will not disturb them. Pacific Northwest National Laboratory, at the request of the University of Maine, and with the support of the U.S. Department of Energy Wind Program, modeled the acoustic output of the planned test turbines.

  5. Design, Licensing and Construction of the Turbine Island

    International Nuclear Information System (INIS)

    Olivier Mandement, Business Development Director of Alstom Thermal Power, presented the different specificities of turbine and explained to the audience the different steps of the construction of the Turbine Island. He made a focus on the ARABELLE turbine design that is used for the Flamanville 3 EPR reactor

  6. Gas turbine control for islanding operation of distribution systems

    DEFF Research Database (Denmark)

    Mahat, Pukar; Chen, Zhe; Bak-Jensen, Birgitte

    2009-01-01

    Danish distribution systems are characterized by a significant penetration of small gas turbine generators (GTGs) and fixed speed wind turbine generators (WTGs). Island operation of these distribution systems are becoming a viable option for economical and technical reasons. However, stabilizing...... frequency in an islanded system is one of the major challenges. This paper presents three different gas turbine governors for possible operation of distribution systems in an islanding mode. Simulation results are presented to show the performance of these governors in grid connected and islanding mode....

  7. Important conventional island design features: turbines

    International Nuclear Information System (INIS)

    Along with the introduction of a new series of 1500 MW nuclear power plants in France, a new project called Arabelle was started for developing a second generation of turbines. ALSTHOM, the only manufacturer of large turbines in France, aimed to construct turbines with lower capital and operating costs, extreme reliability by simplification of design, construction, operation and maintenance. In this report, the main properties of the Arabelle family are described. Next, the optimization of the steam path and optimization of the benefits are discussed. It goes into details as to components like blades, welded shafts, exhaust diffusers, LP turbine casing and main steam inlet valves. (G.J.P.)

  8. Quality assurance program. Braun topical report 21

    International Nuclear Information System (INIS)

    The Quality Assurance (QA) policies and procedures described have been developed specifically for use in commercial nuclear projects. These policies and procedures are intended to provide assurance to Braun Management and the client that the plant will be safe, reliable, and operable, plus meet the requirements of the Nuclear Regulatory Commission, NRC. The Braun QA Manual provides QA procedures for (1) engineering and design, (2) procurement of materials, equipment, and services, and (3) construction and installation. The controls for safety-related systems established in the manual cover all phases of work from project inception to plant completion prior to operation by the owner. The manual standardizes Braun QA control procedures. These procedures are supplemented by Project QA Instructions prepared for each project. (U.S.)

  9. Turbine Speed Governor Parameters Validation in Islanded Production

    OpenAIRE

    Nicolet, Christophe; Kawkabani, Basile; GREIVELDINGER, Bob; HÉROU, Jean-Jacques; Allenbach, Philippe; SIMOND, Jean-Jacques; Avellan, François

    2007-01-01

    The transient behavior of hydroelectric power plants is of high interest for ensuring stability of islanded electrical power networks. Therefore, it is suitable to determine and validate the set of parameters of a turbine speed governor using a realistic simulation model taking into account the hydraulic circuit, the rotating inertias, the electrical installations and the control systems. This paper presents the modeling of a 4x250 MW Francis turbine hydroelectric power plant taking into acco...

  10. European wind turbine standards 2 (EWTS-2)

    Energy Technology Data Exchange (ETDEWEB)

    Pierik, J.T.G.; Dekker, J.W.M.; Braam, H. [and others

    1999-03-01

    A summary is given of the main results of the European Wind Turbine Standards II project. EWTS-II was completed in 1998 and included investigations on: 1) wind farms-wind field and turbine loading; 2) complex terrain and fatigue loading; 3) extreme wind conditions; 4) quantification of failure probabilities; 5) integration of blade tests in design; 6) power performance in complex terrain; 7) site evaluation. In addition to these scientific evaluations, the EWTS-II participants established an organization of qualified measuring institute in the field of wind energy, the MEASNET organization. MEASNET unified measurement procedures of the participating institutes and guarantees qualified measurements and mutual acceptance among its members. (LN)

  11. Reduction in Delayed Gastric Emptying Following Non-Pylorus Preserving Pancreaticoduodenectomy by Addition of a Braun Enteroenterostomy

    Directory of Open Access Journals (Sweden)

    Mehrdad Nikfarjam

    2012-09-01

    Full Text Available Context Delayed gastric emptying is a major cause of morbidity following pancreaticoduodenectomy. Objective The impact of a Braun enteroenterostomy on delayed gastric emptying, used in reconstruction following classic pancreaticoduodenectomy, was assessed. Patients Forty-four consecutive patients undergoing non-pylorus preserving pancreaticoduodenectomy from 2009 to 2011 by a single surgeon were included in this study. Interventions The first 20 patients had a standard antecolic gastroenterostomy and the subsequent 24 had the addition of a Braun enteroenterostomy. Results Patient characteristics, the extent of surgery, surgical findings and tumor characteristics were similar between the two groups. The delayed gastric emptying rate in the Braun enteroenterostomy (1/24, 4.2% was significantly lower (P=0.008 than the standard reconstruction group (7/20, 35.0%. In the standard group, 6 of 7 cases (85.7% of delayed gastric emptying were class C in nature. After exclusion of 8 total pancreatectomy patients, the pancreatic fistula rate in the Braun enteroenterostomy group (4/19, 21.1% was similar (0.706 to the standard reconstruction group (5/17, 29.4% as was the median length of hospital stay (10 days vs. 15 days; P=0.291. Braun enteroenterostomy technique was the only significant independent factor associated with reduced delayed gastric emptying with an odds ratio of 0.08 (95% confidence interval: 0.01-0.73; P=0.025. Conclusion The use of Braun enteroenterostomy following nonpylorus preserving pancreaticoduodenectomy appears to result in a significant reduction in delayed gastric emptying.

  12. Advanced Micro Turbine System (AMTS) -C200 Micro Turbine -Ultra-Low Emissions Micro Turbine

    Energy Technology Data Exchange (ETDEWEB)

    Capstone Turbine Corporation

    2007-12-31

    In September 2000 Capstone Turbine Corporation commenced work on a US Department of Energy contract to develop and improve advanced microturbines for power generation with high electrical efficiency and reduced pollutants. The Advanced MicroTurbine System (AMTS) program focused on: (1) The development and implementation of technology for a 200 kWe scale high efficiency microturbine system (2) The development and implementation of a 65 kWe microturbine which meets California Air Resources Board (CARB) emissions standards effective in 2007. Both of these objectives were achieved in the course of the AMTS program. At its conclusion prototype C200 Microturbines had been designed, assembled and successfully completed field demonstration. C65 Microturbines operating on natural, digester and landfill gas were also developed and successfully tested to demonstrate compliance with CARB 2007 Fossil Fuel Emissions Standards for NOx, CO and VOC emissions. The C65 Microturbine subsequently received approval from CARB under Executive Order DG-018 and was approved for sale in California. The United Technologies Research Center worked in parallel to successfully execute a RD&D program to demonstrate the viability of a low emissions AMS which integrated a high-performing microturbine with Organic Rankine Cycle systems. These results are documented in AMS Final Report DOE/CH/11060-1 dated March 26, 2007.

  13. Influence of marine sources on 14C ages : isotopic data from Watom Island, Papua New Guinea inhumations and pig teeth in light of new dietary standards

    International Nuclear Information System (INIS)

    Gauging the effect of 14C-depleted marine foods on radiocarbon ages requires an accurate assessment of the likely proportion of marine foods in the diet. Several factors must be considered, including region-specific δ13C, δ15N and δ34S data values (regional stable isotope values can differ from global averages), temporal variations in δ13C which offset values in modern dietary standards by up to 1.5 permille, and that modelling which considers only 13C may overestimate the contribution of various dietary sources. Here, we compare previous calculations by linear interpolation of δ13C and a complex computer simulation of marine contribution to the diet of inhumations from the SAC archaeological site Watom Island, Papua New Guinea, with the ISOSOURCE mixing model and a revised database of regional dietary sources and their isotopic values, to estimate marine diet contributions and radiocarbon offsets for burials from the SAC site. Though different estimates of marine contribution to diet do not significantly alter previous calibrations of radiocarbon ages for the inhumations, the new ISOSOURCE calculations challenge the idea of excessive exploitation of marine resources and support evidence for arboriculture and horticulture being a major component in Lapita diet. (author). 87 refs., 3 figs., 8 tabs

  14. Modern turbine-generators for smaller standardized nuclear power plant

    International Nuclear Information System (INIS)

    There is an emerging interest in small standardized nuclear power plants for worldwide commercial application, and these are of a size for which well proven compact steam turbines are ideally suited. With its experience, GEC ALSTHOM is well placed to provide turbines for small standardized nuclear systems up to the 600 MW(e) currently envisaged. At this low power level, full-speed turbines are the appropriate choice. The paper describes relevant experience with these turbines, and the corresponding thermodynamic cycles. 4 refs., 13 figs

  15. Effect of Wind Turbine Classes on the Electricity Production of Wind Farms in Cyprus Island

    OpenAIRE

    2013-01-01

    This paper examines the effect of different wind turbine classes on the electricity production of wind farms in two areas of Cyprus Island, which present low and medium wind potentials: Xylofagou and Limassol. Wind turbine classes determine the suitability of installing a wind turbine in a particulate site. Wind turbine data from five different manufacturers have been used. For each manufacturer, two wind turbines with identical rated power (in the range of 1.5 MW–3 MW) and different wind tur...

  16. The need for output-based standards for gas turbines

    International Nuclear Information System (INIS)

    This article examines output-based emission standards based on overall thermal efficiency for combustion sources including gas turbines that are used in combined heat and power applications. The criteria for emission standards are outlined and traditional approaches to emission standards, and efficiency or output-based standards are considered. Issues and challenges related to the drive to ultra low NOx ppm concentration standards for gas turbines are highlighted, and the development of Canadian National Emission guidelines is discussed along with NOx emission target levels, power output allowances, heat recovery allowances, and cost effectiveness of NOx control systems

  17. CSA guide to Canadian wind turbine codes and standards

    International Nuclear Information System (INIS)

    The Canadian wind energy sector has become one of the fastest-growing wind energy markets in the world. Growth of the industry has been supported by various government agencies. However, many projects have experienced cost over-runs or cancellations as a result of unclear regulatory requirements, and wind energy developers are currently subject to a variety of approval processes involving several different authorities. This Canadian Standards Association (CSA) guide provided general information on codes and standards related to the design, approval, installation, operation, and maintenance of wind turbines in Canada. CSA codes and standards were developed by considering 5 new standards adopted by the International Electrotechnical Commission (IEC) Technical Committee on Wind Turbines. The standards described in this document related to acoustic noise measurement techniques; power performance measurements of electricity-producing wind turbines; lightning protection for wind turbine generator systems; design requirements for turbines; and design requirements for small wind turbines. The guide addressed specific subject areas related to the development of wind energy projects that involve formal or regulatory approval processes. Subject areas included issues related to safety, environmental design considerations, site selection, and mechanical systems. Information on associated standards and codes was also included

  18. Wind turbine generator interaction with conventional diesel generators on Block Island, Rhode Island. Volume 2: Data analysis

    Science.gov (United States)

    Wilreker, V. F.; Stiller, P. H.; Scott, G. W.; Kruse, V. J.; Smith, R. F.

    1984-01-01

    Assessing the performance of a MOD-OA horizontal axis wind turbine connected to an isolated diesel utility, a comprehensive data measurement program was conducted on the Block Island Power Company installation on Block Island, Rhode Island. The detailed results of that program focusing on three principal areas of (1) fuel displacement (savings), (2) dynamic interaction between the diesel utility and the wind turbine, (3) effects of three models of wind turbine reactive power control are presented. The approximate two month duration of the data acquisition program conducted in the winter months (February into April 1982) revealed performance during periods of highest wind energy penetration and hence severity of operation. Even under such conditions fuel savings were significant resulting in a fuel reduction of 6.7% while the MOD-OA was generating 10.7% of the total electrical energy. Also, electrical disturbance and interactive effects were of an acceptable level.

  19. Dr. von Braun Briefing Walt Disney

    Science.gov (United States)

    1965-01-01

    Dr. von Braun began his association with Walt Disney in the 1950s when the rocket scientist appeared in three Disney television productions related to the exploration of space. Years later, Dr. von Braun invited Disney and his associates to tour the Marshall Space Flight Center (MSFC) in Huntsville, Alabama. This photograph is dated April 13, 1965. From left are R.J. Schwinghamer from the MSFC, Disney, B.J. Bernight, and Dr. von Braun.

  20. Wind turbine generator interaction with conventional diesel generators on Block Island, Rhode Island. Volume 1: Executive summary

    Science.gov (United States)

    Wilreker, V. F.; Stiller, P. H.; Scott, G. W.; Kruse, V. J.; Smith, R. F.

    1984-01-01

    Primary results are summarized for a three-part study involving the effects of connecting a MOD-OA wind turbine generator to an isolated diesel power system. The MOD-OA installation considered was the third of four experimental nominal 200 kW wind turbines connected to various utilities under the Federal Wind Energy Program and was characterized by the highest wind energy penetration levels of four sites. The study analyses address: fuel displacement, dynamic interaction, and three modes of reactive power control. These analyses all have as their basis the results of the data acquisition program conducted on Block Island, Rhode Island.

  1. Design of wind turbines for non-standard air density

    DEFF Research Database (Denmark)

    Soraperra, Giusepe

    2005-01-01

    different pitch angel setting; (iii) adoption of extendeders to the blades can also help in restraining the standard rated power at the standard rated speed for p less than pst. The power curves for the three turbine configurations, each in three different air density conformations, have been calculated...

  2. Walt Disney and Dr. Wernher von Braun

    Science.gov (United States)

    1954-01-01

    Dr. Werhner von Braun, then Chief, Guided Missile Development Operation Division at Army Ballistic Missile Agency (ABMA) in Redstone Arsenal, Alabama, was visited by Walt Disney in 1954. In the 1950's, von Braun worked with Disney Studio as a technical director, making three films about space exploration for television. A model of the V-2 rocket is in background.

  3. Standard guide for use of thermocouples in creep and stress-rupture testing to 1800°F (1000°C) in air

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2000-01-01

    1.1 This guide covers the use of ANSI thermocouple Types K, N, R, and S for creep and stress-rupture testing at temperatures up to 1800°F (1000°C) in air at one atmosphere of pressure. It does not cover the use of sheathed thermocouples. 1.2 The values stated in inch-pound units are to be regarded as the standard. The values given in parentheses are for information only. 1.3This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  4. Investigation of ambient temperature on the performance of GE-F5 gas turbine

    International Nuclear Information System (INIS)

    The role of ambient temperature in determining the performance of GE-F5 gas turbine is analysed by investigating the Shirvan gas turbine power plant 10MW, 15MW and 20MW power output. These parameters have been brought as a function of ambient temperature. The results show when ambient temperature increases 1 deg C, The compressor pressure decreases about 20kPa, compressor outlet temperature increases about 1.13 deg C and exhaust temperature increases about 2.5 deg C. It is revealed that variations are due to decreasing the efficiency of compressor and less due to mass flow rate of air reduction as ambient temperature increases at constant power output. The results shows cycle efficiency reduces 3% with increasing 50 of ambient temperature, also the m increases as ambient temperature increase for constant turbine work. These are also because of reducing the compressor efficiency as ambient temperature increases

  5. Control of Steam-Turbine Regulators at Transition to an Island State

    Science.gov (United States)

    Georgiev, Georgi

    2009-01-01

    The simple operating algorithm is presented for steam turbine regulators of type Simadin (Siemens) at emergency switching-off of the generator from system together with some, unknown in advance, load. The given situation is known as "a transition to an island state (regime)". Keeping of turbine speed and preservation of its rating value at a generator blackout when its own needs will be load only, is an easy problem. When the generator remains in its island it is necessary to solve "on-line" two additional problems: to reveal a situation "island" and to estimate the island load for translating a regulator on the new task and providing dynamic stability of transition. The algorithm was tried and entered successfully into practice on Varna TPP, CEZ GROUP (Prague), in 2008.

  6. Control strategies for gas turbine generators for grid connected and islanding operations

    DEFF Research Database (Denmark)

    Mahat, Pukar; Chen, Zhe; Bak-Jensen, Birgitte

    fine while a DG is connected to a grid, might not work as desired while it is islanded and vise versa. This paper presents a strategy to operate distribution systems with a small gas turbine generator (GTG), which is capable of supplying local loads, in both islanding and grid connected conditions......Islanding operation of distribution systems with distributed generations (DG) is becoming a viable option for economical and technical reasons. However, there are various issues to be resolved before it can be a reality. One of the main issues is control of the DG. Control strategies, that may work....... Separate strategies are used to control the GTG while it is connected to the grid and while it is islanded. Switching between the control strategies is achieved through a state detection algorithm that includes islanding and grid re-connection detections. An existing islanding detection technique has been...

  7. Atmospheric histories and growth trends of C4F10, C5F12, C6F14, C7F16 and C8F18

    Directory of Open Access Journals (Sweden)

    R. F. Weiss

    2012-02-01

    Full Text Available The first atmospheric observations and trends are presented for the high molecular weight perfluorocarbons (PFCs: decafluorobutane (C4F10, dodecafluoropentane (C5F12, tetradecafluorohexane (C6F14, hexadecafluoroheptane (C7F16 and octadecafluorooctane (C8F18. Their atmospheric histories are based on measurements of 38 Northern Hemisphere and 46 Southern Hemisphere archived air samples collected between 1973 to 2011 using the Advanced Global Atmospheric Gases Experiment (AGAGE "Medusa" preconcentration gas chromatography-mass spectrometry systems. A new calibration scale was prepared for each PFC, with estimated accuracies of 6.8% for C4F10, 7.8% for C5F12, 4.0% for C6F14, 6.6% for C7F16 and 7.9% for C8F18. Based on our observations the 2011 globally averaged dry air mole fractions of these heavy PFCs are: 0.18 parts-per-trillion (ppt, i.e., parts per 1012 for C4F10, 0.12 ppt for C5F12, 0.28 ppt for C6F14, 0.12 ppt for C7F16 and 0.09 ppt for C8F18. These atmospheric mole fractions combine to contribute to a global average radiative forcing of 0.35 mW m−2, which is 3.6% of the total PFC radiative forcing. The globally averaged mean atmospheric growth rates of these PFCs during 1973–2011 are 4.58 parts per quadrillion (ppq, i.e., parts per 1015 per year (yr for C4F10, 3.29 ppq yr−1 for C5F12, 7.50 ppq yr−1 for C6F14, 3.19 ppq yr−1 for C7F16 and 2.51 ppq yr−1 for C8F18. The growth rates of the heavy perfluorocarbons were largest in the early 1990s for C4F10 and C5F12 and in the mid-to-late 1990s for C6F14, C7F16 and C8F18. The more recent slow down in the growth rates of the high molecular weight PFCs suggests that emissions are declining as compared to the 1980s and 1990s. Nevertheless continued monitoring of these potent, extremely long-lived greenhouse gases is necessary to verify that global PFC emissions continue to decline.

  8. Atmospheric histories and growth trends of C4F10, C5F12, C6F14, C7F16 and C8F18

    Directory of Open Access Journals (Sweden)

    R. F. Weiss

    2012-05-01

    Full Text Available Atmospheric observations and trends are presented for the high molecular weight perfluorocarbons (PFCs: decafluorobutane (C4F10, dodecafluoropentane (C5F12, tetradecafluorohexane (C6F14, hexadecafluoroheptane (C7F16 and octadecafluorooctane (C8F18. Their atmospheric histories are based on measurements of 36 Northern Hemisphere and 46 Southern Hemisphere archived air samples collected between 1973 to 2011 using the Advanced Global Atmospheric Gases Experiment (AGAGE "Medusa" preconcentration gas chromatography-mass spectrometry systems. A new calibration scale was prepared for each PFC, with estimated accuracies of 6.8% for C4F10, 7.8% for C5F12, 4.0% for C6F14, 6.6% for C7F16 and 7.9% for C8F18. Based on our observations the 2011 globally averaged dry air mole fractions of these heavy PFCs are: 0.17 parts-per-trillion (ppt, i.e., parts per 1012 for C4F10, 0.12 ppt for C5F12, 0.27 ppt for C6F14, 0.12 ppt for C7F16 and 0.09 ppt for C8F18. These atmospheric mole fractions combine to contribute to a global average radiative forcing of 0.35 mW m−2, which is 6% of the total anthropogenic PFC radiative forcing (Montzka and Reimann, 2011; Oram et al., 2012. The growth rates of the heavy perfluorocarbons were largest in the late 1990s peaking at 6.2 parts per quadrillion (ppq, i.e., parts per 1015 per year (yr for C4F10, at 5.0 ppq yr−1 for C5F12 and 16.6 ppq yr−1 for C6F14 and in the early 1990s for C7F16 at 4.7 ppq yr−1 and in the mid 1990s for C8F18 at 4.8 ppq yr−1. The 2011 globally averaged mean atmospheric growth rates of these PFCs are subsequently lower at 2.2 ppq yr−1 for C4F10, 1.4 ppq yr−1 for C5F12, 5.0 ppq yr−1 for C6F14, 3.4 ppq yr−1 for C7F16 and 0.9 ppq yr−1 for C8F18. The more recent slowdown in the growth rates suggests that emissions are declining as compared to the 1980s and 1990s.

  9. Body weight considerations in the B6C3F1 mouse and the use of dietary control to standardize background tumor incidence in chronic bioassays

    International Nuclear Information System (INIS)

    In B6C3F1 mice, the rate of body growth influences susceptibility to liver neoplasia and large variations in body weight can complicate the interpretation of bioassay data. The relationship between body weight and liver tumor incidence was calculated for historical control populations of male and female ad libitum-fed mice (approx. 2750 and 2300 animals, respectively) and in populations of male and female mice which had been subjected to forced body weight reduction due to either dietary restriction or exposure to noncarcinogenic chemicals (approx. 1600 and 1700, respectively). Resulting tumor risk data were then used to construct idealized weight curves for male and female B6C3F1 mice; these curves predict a terminal background liver tumor incidence of 15-20%. Use of dietary control to manipulate body growth of male B6C3F1 mice to fit the idealized weight curve was evaluated in a 2-year bioassay of chloral hydrate. Cohorts of mice were successfully maintained at weights approximating their idealized target weights throughout the study. These mice exhibited less body weight variation than their ad libitum-fed counterparts (e.g., standard deviations of body weight were 1.4 and 3.4 g for respective control groups at 36 weeks). Historical control body weight and tumor risk data from the two male mouse populations were utilized to predict background liver tumor rates for each experimental group of the chloral hydrate study. The predicted background tumor rates closely matched the observed rates for both the dietary controlled and ad libitum-fed chloral hydrate control groups when each mouse was evaluated according to either its weekly food consumption or its weekly change in body weight

  10. Global emission estimates and radiative impact of C4F10, C5F12, C6F14, C7F16 and C8F18

    Directory of Open Access Journals (Sweden)

    R. G. Prinn

    2012-08-01

    Full Text Available Global emission estimates based on new atmospheric observations are presented for the acylic high molecular weight perfluorocarbons (PFCs: decafluorobutane (C4F10, dodecafluoropentane (C5F12, tetradecafluorohexane (C6F14, hexadecafluoroheptane (C7F16 and octadecafluorooctane (C8F18. Emissions are estimated using a 3-dimensional chemical transport model and an inverse method that includes a growth constraint on emissions. The observations used in the inversion are based on newly measured archived air samples that cover a 39-yr period, from 1973 to 2011, and include 36 Northern Hemispheric and 46 Southern Hemispheric samples. The derived emission estimates show that global emission rates were largest in the 1980s and 1990s for C4F10 and C5F12, and in the 1990s for C6F14, C7F16 and C8F18. After a subsequent decline, emissions have remained relatively stable, within 20%, for the last 5 yr. Bottom-up emission estimates are available from the Emission Database for Global Atmospheric Research version 4.2 (EDGARv4.2 for C4F10, C5F12, C6F14 and C7F16, and inventories of C4F10, C5F12 and C6F14 are reported to the United Nations' Framework Convention on Climate Change (UNFCCC by Annex 1 countries that have ratified the Kyoto Protocol. The atmospheric measurement-based emission estimates are 20 times larger than EDGARv4.2 for C4F10 and over three orders of magnitude larger for C5F12 (with 2008 EDGARv4.2 estimates for C5F12 at 9.6 kg yr−1, as compared to 67±53 t yr−1 as derived in this study. The derived emission estimates for C6F14 largely agree with the bottom-up estimates from EDGARv4.2. Moreover, the C7F16 emission estimates are comparable to those of EDGARv4.2 at their peak in the 1990s, albeit significant underestimation for the other time periods. There are no bottom-up emission estimates for C8F18, thus the emission rates reported here are the first for C8F18. The reported inventories for C4F10, C5F12 and C6F14 to UNFCCC are five to ten times

  11. Global emission estimates and radiative impact of C4F10, C5F12, C6F14, C7F16 and C8F18

    Science.gov (United States)

    Ivy, D. J.; Rigby, M.; Baasandorj, M.; Burkholder, J. B.; Prinn, R. G.

    2012-08-01

    Global emission estimates based on new atmospheric observations are presented for the acylic high molecular weight perfluorocarbons (PFCs): decafluorobutane (C4F10), dodecafluoropentane (C5F12), tetradecafluorohexane (C6F14), hexadecafluoroheptane (C7F16) and octadecafluorooctane (C8F18). Emissions are estimated using a 3-dimensional chemical transport model and an inverse method that includes a growth constraint on emissions. The observations used in the inversion are based on newly measured archived air samples that cover a 39-yr period, from 1973 to 2011, and include 36 Northern Hemispheric and 46 Southern Hemispheric samples. The derived emission estimates show that global emission rates were largest in the 1980s and 1990s for C4F10 and C5F12, and in the 1990s for C6F14, C7F16 and C8F18. After a subsequent decline, emissions have remained relatively stable, within 20%, for the last 5 yr. Bottom-up emission estimates are available from the Emission Database for Global Atmospheric Research version 4.2 (EDGARv4.2) for C4F10, C5F12, C6F14 and C7F16, and inventories of C4F10, C5F12 and C6F14 are reported to the United Nations' Framework Convention on Climate Change (UNFCCC) by Annex 1 countries that have ratified the Kyoto Protocol. The atmospheric measurement-based emission estimates are 20 times larger than EDGARv4.2 for C4F10 and over three orders of magnitude larger for C5F12 (with 2008 EDGARv4.2 estimates for C5F12 at 9.6 kg yr-1, as compared to 67±53 t yr-1 as derived in this study). The derived emission estimates for C6F14 largely agree with the bottom-up estimates from EDGARv4.2. Moreover, the C7F16 emission estimates are comparable to those of EDGARv4.2 at their peak in the 1990s, albeit significant underestimation for the other time periods. There are no bottom-up emission estimates for C8F18, thus the emission rates reported here are the first for C8F18. The reported inventories for C4F10, C5F12 and C6F14 to UNFCCC are five to ten times lower than those

  12. Global emission estimates and radiative impact of C4F10, C5F12, C6F14, C7F16 and C8F18

    Directory of Open Access Journals (Sweden)

    R. G. Prinn

    2012-05-01

    Full Text Available Global emission estimates based on new atmospheric observations are presented for the acylic high molecular weight perfluorocarbons (PFCs: decafluorobutane (C4F10, dodecafluoropentane (C5F12, tetradecafluorohexane (C6F14, hexadecafluoroheptane (C7F16 and octadecafluorooctane (C8F18. Emissions are estimated using a 3-dimensional chemical transport model and an inverse method that includes a growth constraint on emissions. The observations used in the inversion are based on newly measured archived air samples that cover a 39-yr period, from 1973 to 2011, and include 36 Northern Hemispheric and 46 Southern Hemispheric samples (Ivy et al., 2012. The derived emission estimates show that global emission rates were largest in the 1980s and 1990s for C4F10 and C5F12, and in the 1990s for C6F14,C7F16 and C8F18. After a subsequent decline, emissions have remained relatively stable, within 20%, for the last 5 yr. Bottom-up emission estimates are available from the Emission Database for Global Atmospheric Research version 4.2 (EDGARv4.2 for C4F10, C5F12, C6F14 and C7F16, and inventories of C4F10, C5F12 andC6F14 are reported to the United Nations' Framework Convention on Climate Change (UNFCCC by Annex 1 countries that have ratified the Kyoto Protocol. The atmospheric measurement based emission estimates are 20 times larger than EDGARv4.2 for C4F10 and over three orders of magnitude for C5F12. The derived emission estimates for C6F14 largely agree with the bottom-up estimates from EDGARv4.2. Moreover, the C7F16 emission estimates are comparable to those of EDGARv4.2 at their peak in the 1990s, albeit significant underestimation for the other time periods. There are no bottom-up emission estimates for C8F18, thus the emission rates reported here are the first for C8F18. The reported inventories for C4F10, C5F12 and C6F14 to UNFCCC are five to ten times lower than those estimated in this study. In addition, we present measured infrared absorption spectra for C

  13. Islanding Control Architecture in future smart grid with both demand and wind turbine control

    DEFF Research Database (Denmark)

    Chen, Yu; Xu, Zhao; Østergaard, Jacob

    2013-01-01

    In recent years, a large number of Distributed Generation units (DG units) such as Wind Turbines (WTs) and Combined Heat and Power plants (CHPs) have been penetrating the distribution systems. Meanwhile, an intentional island operation of distribution systems is proposed as a potential measure...... against power supply outages by continuously running DG units during system emergencies. However, there are some challenging security issues for an island operation, such as the power imbalance during the islanding transition and the coordination of feeder protection systems. To tackle the former issue......, which is the focus of this paper, available resources including both DG units and demand should be fully utilized as reserves. The control and coordination among different resources requires an integral architecture to serve the purpose. This paper develops the Islanding Control Architecture (ICA) for...

  14. The Philosophy of Science of Ferdinand Braun

    Directory of Open Access Journals (Sweden)

    Pechenkin, Alexander

    2013-03-01

    Full Text Available The Nobel Prize winner Karl Ferdinand Braun has not left anyconsiderable writings on the philosophy of science. Nevertheless, hisphilosophical excursions help us to understand his creative work in physics and the philosophical positions of his disciples. Braun emphasized the fundamental position of the so-called “integral laws” to which the law of conservation of energy belongs. He was a consecutive empiricist and emphasized the relativity of physical schemes and models with respect to experimental devices. I n the style of some German physicists he proclaimed the oscillatory unification of the theory of electricity and optics.

  15. Dr. von Braun Discusses 'Bottle Suit' Concept

    Science.gov (United States)

    1954-01-01

    Dr. Wernher von Braun (center), then Chief of the Guided Missile Development Division at Redstone Arsenal, Alabama, discusses a 'bottle suit' model with Dr. Heinz Haber (left), an expert on aviation medicine, and Willey Ley, a science writer on rocketry and space exploration. The three men were at the Disney studios appearing in the motion picture, entitled 'Man in Space.'

  16. 10 October 2013 - D. Braun First Deputy Minister for Regional Development, Czech Republic, P. Styczeń Deputy Minister of Transport, Construction and Maritime Economy, Republic of Poland and F. Palko State Secretary, Ministry of Transport, Construction and Regional Development, Slovak Republic visiting the LHC tunnel at Point 1 with Technology Department, Vacuum, Surfaces and Coatings Group Leader J. M. Jimenez and signing the Guest book with CERN Director-General R. Heuer

    CERN Multimedia

    Anna Pantelia

    2013-01-01

    10 October 2013 - D. Braun First Deputy Minister for Regional Development, Czech Republic, P. Styczeń Deputy Minister of Transport, Construction and Maritime Economy, Republic of Poland and F. Palko State Secretary, Ministry of Transport, Construction and Regional Development, Slovak Republic visiting the LHC tunnel at Point 1 with Technology Department, Vacuum, Surfaces and Coatings Group Leader J. M. Jimenez and signing the Guest book with CERN Director-General R. Heuer

  17. Experience gained with development of steam turbine projects with the use of standardized modules

    Science.gov (United States)

    Valamin, A. E.; Kultyshev, A. Yu.; Sakhnin, Yu. A.; Stepanov, M. Yu.

    2014-12-01

    The possibilities of decreasing the amount of work required for preparing manufacture of the equipment of gas-turbine, boiler, and steam-turbine units in the design and technological respects through the use of standardized components are pointed out. In parallel with this, a fewer number of design and technological errors is achieved, due to which better quality of the products is obtained. The need to develop a series of standard equipment sizes used in the composition of a combined-cycle power plant is considered. Examples of designing a steam turbine using well-elaborated and proven components together with new ones required according to the turbine operating conditions are given.

  18. Atlas C++ Coding Standard Specification

    CERN Document Server

    Albrand, S; Barberis, D; Bosman, M; Jones, B; Stavrianakou, M; Arnault, C; Candlin, D; Candlin, R; Franck, E; Hansl-Kozanecka, Traudl; Malon, D; Qian, S; Quarrie, D; Schaffer, R D

    2001-01-01

    This document defines the ATLAS C++ coding standard, that should be adhered to when writing C++ code. It has been adapted from the original "PST Coding Standard" document (http://pst.cern.ch/HandBookWorkBook/Handbook/Programming/programming.html) CERN-UCO/1999/207. The "ATLAS standard" comprises modifications, further justification and examples for some of the rules in the original PST document. All changes were discussed in the ATLAS Offline Software Quality Control Group and feedback from the collaboration was taken into account in the "current" version.

  19. Migration of bats past a remote island offers clues toward the problem of bat fatalities at wind turbines

    Science.gov (United States)

    Cryan, P.M.; Brown, A.C.

    2007-01-01

    Wind energy is rapidly becoming a viable source of alternative energy, but wind turbines are killing bats in many areas of North America. Most of the bats killed by turbines thus far have been migratory species that roost in trees throughout the year, and the highest fatality events appear to coincide with autumn migration. Hoary bats (Lasiurus cinereus) are highly migratory and one of the most frequently killed species at wind turbines. We analyzed a long-term data set to investigate how weather and moonlight influenced the occurrence of hoary bats at an island stopover point along their migration route. We then related our results to the problem of bat fatalities at wind turbines. We found that relatively low wind speeds, low moon illumination, and relatively high degrees of cloud cover were important predictors of bat arrivals and departures, and that low barometric pressure was an additional variable that helped predict arrivals. Slight differences in the conditions under which bats arrived and departed from the island suggest that hoary bats may be more likely to arrive on the island with passing storm fronts in autumn. These results also indicate that fatalities of hoary bats at wind turbines may be predictable events, that the species may be drawn to prominent landmarks that they see during migration, and that they regularly migrate over the ocean. Additional observations from this and other studies suggest that the problem of bat fatalities at wind turbines may be associated with flocking and autumn mating behaviors.

  20. Portrait of Dr. Von Braun with Walt Disney, 1954.

    Science.gov (United States)

    1954-01-01

    Marshall Center Director Dr. Wernher Von Braun is pictured with Walt Disney during a visit to the Marshall Space Flight Center in 1954. In the 1950s, Dr. Von Braun while working in California on the Saturn project, also worked with Disney studios as a technical director in making three films about Space Exploration for television. Disney's tour of Marshall in 1965 was Von Braun's hope for a renewed public interest in the future of the Space Program at NASA.

  1. la teoría del desarrollo desigual de Óscar Braun. Un análisis critico

    Directory of Open Access Journals (Sweden)

    Wright Phil

    1979-12-01

    Full Text Available

    En este análisis crítico de la teoría del intercambio desigual de Oscar Braun, intentamos movernos consistentemente a través de un número de etapas analíticas distintas. Estas etapas son: a una discusión sobre el objeto del conocimiento en Braun, sin las restricciones de su propia problemática (sección 3; b una confrontación del objeto del conocímiento en Braun con el objeto real o concreto (sección4, y c una crítica a] objeto del conocimiento en Braun (secciones 2 y 5. La crítica del objeto del conocimiento en Braun se divide en dos partes ya que tratamos con dos problemas analíticos distintos: a la teoría del intercambio desigual puede estar representada como una teoría del imperialismo, y b la naturaleza del objeto del conocimiento contenida en la teoría del intercambio desigual de Braun es la que causa los problemas y la que lo lleva a constituirla como una teoría del imperialismo.

  2. Validation of the Standard Method for Assessing Flicker From Wind Turbines

    DEFF Research Database (Denmark)

    Barahona Garzon, Braulio; Sørensen, Poul Ejnar; Christensen, L.; Sørensen, T.; Nielsen, H.K.; Larsén, Xiaoli Guo

    2011-01-01

    This paper studies the validity of the standard method in IEC 61400-21 for assessing the flicker emission from multiple wind turbines. The standard method is based on testing a single wind turbine and then using the results of this test to assess the flicker emission from a number of wind turbines...... assess the flicker emission at the collection line; this assessment is then compared to the actual measurements in order to study the accuracy of the estimation. It was observed in both wind farms, that the assessment based on the standard method is statistically conservative compared to the measurements....... The reason for this is the statistical characteristics of flicker emission....

  3. Standards for measurements and testing of wind turbine power quality

    Energy Technology Data Exchange (ETDEWEB)

    Soerensen, P. [Risoe National Lab., Roskilde (Denmark); Gerdes, G.; Klosse, R.; Santjer, F. [DEWI, Wilhelmshaven (Germany); Robertson, N.; Davy, W. [NEL, Glasgow (United Kingdom); Koulouvari, M.; Morfiadakis, E. [CRES, Pikermi (Greece); Larsson, Aa. [Chalmers Univ. of Technology, Goeteborg (Sweden)

    1999-03-01

    The present paper describes the work done in power quality sub-task of the project `European Wind Turbine Testing Procedure Developments` funded by the EU SMT program. The objective of the power quality sub-task has been to make analyses and new recommendation(s) for the standardisation of measurement and verification of wind turbine power quality. The work has been organised in three major activities. The first activity has been to propose measurement procedures and to verify existing and new measurement procedures. This activity has also involved a comparison of the measurements and data processing of the participating partners. The second activity has been to investigate the influence of terrain, grid properties and wind farm summation on the power quality of wind turbines with constant rotor speed. The third activity has been to investigate the influence of terrain, grid properties and wind farm summation on the power quality of wind turbines with variable rotor speed. (au)

  4. Victor or Villain? Wernher von Braun and the Space Race

    Science.gov (United States)

    O'Brien, Jason L.; Sears, Christine E.

    2011-01-01

    Set during the Cold War and space race, this historical role-play focuses on Wernher von Braun's involvement in and culpability for the use of slave laborers to produce V-2 rockets for Nazi Germany. Students will grapple with two central questions. Should von Braun have been allowed to emigrate to the United States given his affiliation with the…

  5. Study on Modelling Standardization of Double-fed Wind Turbine and Its Application

    Directory of Open Access Journals (Sweden)

    Li Xiang

    2016-01-01

    Full Text Available Based on the standardized modelling of the International Modelling Team, study on double-fed induction generator (DFIG wind turbine is processed in this paper, aiming at capability of universally and reasonably reflecting key performance related to large scale system analysis. The standardized model proposed is of high degree of structural modularity, easy functional extension and universalization of control strategy and signal. Moreover, it is applicable for wind turbines produced by different manufacturers through model parameter adjustment. The complexity of the model can meet both needs of grid-connected characteristic simulation of wind turbine and large scale power system simulation.

  6. Influence of the fitted probability distribution type on the annual mean power generated by wind turbines: A case study at the Canary Islands

    International Nuclear Information System (INIS)

    This paper aims to quantify the influence that probability distribution selected to fit wind speed data has on the estimation of the annual mean energy production of wind turbines. To perform this task, a comparative analysis between the well-known two parameter wind speed Weibull distribution and alternative mixture of finite distribution models (less simple but providing better fits in many locations) is applied, in order to contrast simplicity versus accuracy. Data fitted from a set of weather stations located at the Canary Islands and a representative sample of commercial wind turbines are taken into account to carry out this analysis. The calculations provide a wide variety of numerical results but, as a general conclusion, the analysis evidences that any improvement in wind data fits given by the use of a mixture of finite distributions, instead of the standard Weibull distribution, is partially or even totally lost as the annual mean energy production is worked out, practically regardless the weather station, the wind speed distribution model, the turbine size or the turbine concept

  7. Influence of Intercept Valves on Control of Multiple Stages Steam Turbines During the Switching into the Island Operation

    Science.gov (United States)

    Laštovka, Ladislav; Hejtmánková, Pavla

    2015-03-01

    This paper presents control of a multiple stages steam turbine which is switched into the island operation. The frequency in an electrical grid is stated on nominal value which is in UCTE grid 50 Hz. When deviation of frequency is higher then 0.2 Hz, the switching of particular steam units into the island operation is only the chance how to maintain the supply of, at least, some small grids. The other possibility how to keep power units in operation, to be prepared for the next synchronization to the grid, is to switch them to operation status in which they supply only their self-consumption. This change of the operating state is the most dynamic load change for the control system of the unit. The multiple stages turbines are equipped with high pressure hydraulic valves for steam turbine governing. Influence of the intercept valve on steam turbine control during the switching process into the island operation is examined in Matlab Simuling software.

  8. Dr. von Braun and Army Ballistics Missile Agency (ABMA) Group

    Science.gov (United States)

    1959-01-01

    This photograph of Dr. von Braun, shown here to the left of General Bruce Medaris, was taken in the fall of 1959, immediately prior to Medaris' retirement from the Army. At the time, von Braun and his associates worked for the Army Ballistics Missile Agency in Huntsville, Alabama. Those in the photograph have been identified as Ernst Stuhlinger, Frederick von Saurma, Fritz Mueller, Hermarn Weidner, E.W. Neubert (partially hidden), W.A. Mrazek, Karl Heimburg, Arthur Rudolph, Otto Hoberg, von Braun, Oswald Lange, Medaris, Helmut Hoelzer, Hans Maus, E.D. Geissler, Hans Heuter, and George Constan.

  9. Aquantis C-Plane Ocean Current Turbine Project

    Energy Technology Data Exchange (ETDEWEB)

    Fleming, Alex [Dehlsen Associates, LLC, Santa Barbara, CA (United States)

    2015-09-16

    The Aquantis 2.5 MW Ocean Current Generation Device technology developed by Dehlsen Associates, LLC (DA) is a derivation of wind power generating technology (a means of harnessing a slow moving fluid) adapted to the ocean environment. The Aquantis Project provides an opportunity for accelerated technological development and early commercialization, since it involves the joining of two mature disciplines: ocean engineering and wind turbine design. The Aquantis Current Plane (C-Plane) technology is an ocean current turbine designed to extract kinetic energy from a current flow. The technology is capable of achieving competitively priced, continuous, base-load, and reliable power generation from a source of renewable energy not before possible in this scale or form.

  10. Does Braun Enteroenterostomy Reduce Delayed Gastric Emptying After Pancreaticoduodenectomy?

    OpenAIRE

    Zhang, Xu-Feng; Yin, Guo-Zhi; Liu, Qing-Guang; Liu, Xue-Min; Wang, Bo; Yu, Liang; Liu, Si-Nan; Cui, Hong-Ying; Lv, Yi

    2014-01-01

    Abstract Whether an additional Braun enteroenterostomy is necessary in reducing delayed gastric emptying (DGE) after pancreaticoduodenectomy (PD) has not yet been well investigated. Herein, in this retrospective study, 395 consecutive cases of patients undergoing classic PD from 2009 to 2013 were reviewed. Patients with and without Braun enteroenterostomy were compared in preoperative baseline characteristics, surgical procedure, postoperative diagnosis, and morbidity including DGE. The DGE w...

  11. INVESTIGATING THE STANDARD PROCESS OF INCINERATION IN LANGKAWI ISLAND, MALAYSIA

    Directory of Open Access Journals (Sweden)

    E. Shamshiry

    2014-01-01

    Full Text Available Development activities and increasing urbanization have direct impact on solid waste generation, especially in municipalities of the developing countries, which poses a major challenge to the authorities. Many various technologies and strategies can be used in the field of garbage procedures. Incineration is a well-organized approach and tool to decrease the volume of waste and insist for additional landfill area. One of the important benefits of using the incineration is its ability to decrease a significant amount of waste combustibles by 80 to 95%. Controlling air pollution in the process of using the incineration poses a challenge for solid waste disposal. The data utilized in this article include personal interview of the experts handling the incineration process in Langkawi and personal observation. Secondary data obtained from the Ministry of Housing and Local Government was used to investigate the external air pollution from using the incinerator in Langkawi. The results showed, through the analysis of raw data with SPSS IBM 19 and Pearson correlation analysis and identify cluster of dendrogram generated by UPGMA, an external pollution minimum (p<0.05 between sampling sites inside the incinerator. The reasons for the difference are related to untimely and inappropriate opening of the combustion chamber door, exorbitance blowing and improper use of the installed air pollution control devices. The proper treatment of solid waste is very crucial, especially in Langkawi Island which is a tourist destination. The use of incinerator can enhance solid waste treatment, but only when the standard operating procedure is observed. Without properly observing the procedure, the use of an incinerator can cause more environmental and personal health issues like air pollution and the releasing of hazardous waste and clinical waste s into the landfill. These are some of the reasons that motivated this study to investigate the use of incineration in

  12. Xeroderma pigmentosum groups C and F

    International Nuclear Information System (INIS)

    The differential bead-labelling method for heterodikaryon complementation enabled us to allocate xeroderma pigmentosum patients XP40KO and XP38KO to complementation groups C and F, respectively. Group C XP40KO cells exhibited 15 % UDS and the 5 and 1.5-fold hypersensitivities to UV and 4-nitroquinoline-1-oxide (4NQO) killings, respectively, while group F XP38KO cells showed a higher residual level of 20 - 25 % UDS and a less UV/4NQO hypersensitivity than did the previously assigned group F strains. We reviewed the thus far assigned Japanese groups C and F subjects for the repair and clinical characteristics. The present group C XP40KO was typical, while XP38KO was heterogrnous within group F with respect to repair. (author)

  13. Charging C60 islands with the AFM tip.

    Science.gov (United States)

    Hoff, Brice; Henry, Claude R; Barth, Clemens

    2016-01-01

    We show that electrons can be transferred on demand from an AFM tip into single bulk-like C60 islands, which are supported on the insulating NaCl(001) surface. We exemplify this by controlled charge-manipulation experiments conducted in ultrahigh vacuum by noncontact AFM (nc-AFM), electrostatic force microscopy (EFM) and Kelvin probe force microscopy (KPFM). KPFM shows a homogeneous contrast at the islands, which is a signature for an equal distribution of the electrons in the T1u band. The charge dissipates during half a day due to an interaction of the charged C60 islands with defects in the near surface region of NaCl. Our results open the perspective in photo-voltaics to study charge attachment, stability and charge exchange with the environment of any C60 bulk-like system. PMID:26617348

  14. 78 FR 63015 - Exhaust Emissions Standards for New Aircraft Gas Turbine Engines and Identification Plate for...

    Science.gov (United States)

    2013-10-23

    ... kilonewtons (kN) (76 FR 45012). The EPA also proposed adopting the gas turbine engine test procedures of the... 18, 2012 (77 FR 36342), and was effective July 18, 2012. On December 31, 2012, the FAA published a final rule with a request for comments (77 FR 76842) adopting the EPA's new emissions standards in...

  15. 78 FR 65554 - Exhaust Emission Standards for New Aircraft Turbine Engines and Identification Plate for Aircraft...

    Science.gov (United States)

    2013-11-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Federal Aviation Administration 14 CFR Parts 34 and 45 RIN 2120-AK15 Exhaust Emission Standards for New Aircraft Turbine Engines and Identification Plate for Aircraft Engines Correction In rule document...

  16. F2c at low x

    CERN Document Server

    Illarionov, A Yu

    2011-01-01

    We study the heavy-quark contributions to the proton structure function F2(x,Q2) at next-to-leading order using compact formulas at small values of Bjorken's x variable. The formulas provide a good agreement with the modern HERA data for F2c(x,Q2).

  17. Advanced SiC/SiC Ceramic Composites For Gas-Turbine Engine Components

    Science.gov (United States)

    Yun, H. M.; DiCarlo, J. A.; Easler, T. E.

    2004-01-01

    NASA Glenn Research Center (GRC) is developing a variety of advanced SiC/SiC ceramic composite (ASC) systems that allow these materials to operate for hundreds of hours under stress in air at temperatures approaching 2700 F. These SiC/SiC composite systems are lightweight (approximately 30% metal density) and, in comparison to monolithic ceramics and carbon fiber-reinforced ceramic composites, are able to reliably retain their structural properties for long times under aggressive gas-turbine engine environments. The key for the ASC systems is related first to the NASA development of the Sylramic-iBN Sic fiber, which displays higher thermal stability than any other SiC- based ceramic fibers and possesses an in-situ grown BN surface layer for higher environmental durability. This fiber is simply derived from Sylramic Sic fiber type that is currently produced at ATK COI Ceramics (COIC). Further capability is then derived by using chemical vapor infiltration (CVI) and/or polymer infiltration and pyrolysis (PIP) to form a Sic-based matrix with high creep and rupture resistance as well as high thermal conductivity. The objectives of this study were (1) to optimize the constituents and processing parameters for a Sylramic-iBN fiber reinforced ceramic composite system in which the Sic-based matrix is formed at COIC almost entirely by PIP (full PIP approach), (2) to evaluate the properties of this system in comparison to other 2700 F Sylramic-iBN systems in which the matrix is formed by full CVI and CVI + PIP, and (3) to examine the pros and cons of the full PIP approach for fabricating hot-section engine components. A key goal is the development of a composite system with low porosity, thereby providing high modulus, high matrix cracking strength, high interlaminar strength, and high thermal conductivity, a major property requirement for engine components that will experience high thermal gradients during service. Other key composite property goals are demonstration at

  18. Monte Carlo δf simulation of the bootstrap current in the presence of a magnetic island

    International Nuclear Information System (INIS)

    In the theoretical description of the neoclassical tearing mode the bootstrap current is assumed to completely vanish inside the magnetic island if finite perpendicular transport can be neglected. In this paper, the effects due to both the finite-orbit width of the trapped ions and their toroidal precession (not included in the standard analytic theory) on the island current are investigated. The evolution of the ion distribution function in toroidal geometry in the presence of a perturbed magnetic equilibrium is computed numerically employing the δf method, collisions being implemented by means of a Monte Carlo procedure. It is shown that a significant fraction of the (ion) bootstrap current survives inside the island when the ion banana width wb approaches the island width W, and no loss is observed for wb/W≥1. This effect is reduced when the collision time becomes longer than the toroidal drift time. The value of the current is found to be inconsistent with the local gradients in the island region. The finite-banana-width effect leads to a linear scaling of the value of the poloidal β at the mode onset with the normalized ion poloidal gyroradius ρ*p, in agreement with the experimental results of ASDEX Upgrade

  19. Improving standard C++ for the physics community

    Energy Technology Data Exchange (ETDEWEB)

    Paterno, M.; Brown, W.E.; /Fermilab

    2004-12-01

    As Fermilab's representatives to the C++ standardization effort, we have been promoting directions of special interest to the physics community. We here report on selected recent developments toward the next revision, informally denoted C++0x , of the C++ Standard.

  20. Automated electric control of a vertical axis wind turbine in island operation

    OpenAIRE

    Högberg, Lars

    2009-01-01

    At the Division of Electricity at Uppsala University, a wind power concept has been developed. The concept uses a vertical axis wind turbine with a direct driven generator. The turbine has fixed blades, making speed control the only way to regulate power absorption. The speed is controlled with the electric load. The turbine is not self-starting, but can be started using the generator as a motor. In this project, an unsupervised electric system with automatic control is designed and construct...

  1. Energisation of Wind Turbine Transformers with an Auxiliary Generator in a Large Offshore Wind Farm Under Islanded Operation

    DEFF Research Database (Denmark)

    Arana Aristi, Iván; Hernandez, Alvaro; Thumm, Gerhard;

    2011-01-01

    The prospective inrush currents during the energization of wind turbine transformers in a large offshore wind farm during islanded operation were estimated by time-domain simulations covering different energizing scenarios. In this way, worst case procedures could be identified. The energization of...... current limits of the synchronous generator. Based on the worst possible transformer energization scenario, an optimized procedure to reduce the loading of the auxiliary generator during transient conditions has been proposed based on the reduced generator terminal voltage, automatic voltage regulator...

  2. Dr. Space the life of Wernher von Braun

    CERN Document Server

    Ward, Bob

    2013-01-01

    Written by veteran aerospace journalist Bob Ward, who spent years investigating his subject, this biography presents a revealing but even-handed portrait of the father of modern rocketry. As he chronicles Wernher von Braun's life, Ward explodes many myths and misconceptions about the controversial genius who was a hero to some, a villain to others. The picture of von Braun that emerges is of a brilliant scientist with limitless curiosity and a drive to achieve his goals at almost any price from, developing the world's first ballistic missile used against the Allies in World War II to help

  3. 77 FR 52553 - Standards of Performance for Stationary Gas Turbines; Standards of Performance for Stationary...

    Science.gov (United States)

    2012-08-29

    ... steam generator (HRSG) would continue to comply with the same boiler NSPS as prior to the turbine engine... loads or devices powered by electricity, steam, hot water or directly by the gross output of the...-HQ- OAR-2004-0490, by one of the following methods: http://www.regulations.gov : Follow the...

  4. Diskette-based database covering standards etc. of relevance to the construction of wind turbines

    International Nuclear Information System (INIS)

    The project concerns the development of the database ''Diskettebaseret database med vindmoellestandarder'' (diskette-based database containing wind turbine standards), which contains information about standards, recommendations and other technical documents of relevance for the design, construction and approval of wind mills. The information in the database covers data from Denmark, UK, Germany, Holland and USA together with data from internationally recognized standards and recommendations. The database is contained on a single PC-diskette, which also contains the purpose-built userfriendly serchsoftware. About 5500 records are included in the database. The last edition of the database was updated January 1994. (au)

  5. Uncertainty analysis of integrated gasification combined cycle systems based on Frame 7H versus 7F gas turbines.

    Science.gov (United States)

    Zhu, Yunhua; Frey, H Christopher

    2006-12-01

    Integrated gasification combined cycle (IGCC) technology is a promising alternative for clean generation of power and coproduction of chemicals from coal and other feedstocks. Advanced concepts for IGCC systems that incorporate state-of-the-art gas turbine systems, however, are not commercially demonstrated. Therefore, there is uncertainty regarding the future commercial-scale performance, emissions, and cost of such technologies. The Frame 7F gas turbine represents current state-of-practice, whereas the Frame 7H is the most recently introduced advanced commercial gas turbine. The objective of this study was to evaluate the risks and potential payoffs of IGCC technology based on different gas turbine combined cycle designs. Models of entrained-flow gasifier-based IGCC systems with Frame 7F (IGCC-7F) and 7H gas turbine combined cycles (IGCC-7H) were developed in ASPEN Plus. An uncertainty analysis was conducted. Gasifier carbon conversion and project cost uncertainty are identified as the most important uncertain inputs with respect to system performance and cost. The uncertainties in the difference of the efficiencies and costs for the two systems are characterized. Despite uncertainty, the IGCC-7H system is robustly preferred to the IGCC-7F system. Advances in gas turbine design will improve the performance, emissions, and cost of IGCC systems. The implications of this study for decision-making regarding technology selection, research planning, and plant operation are discussed. PMID:17195484

  6. Dr. von Braun, Mayor Searcy, and General Medaris

    Science.gov (United States)

    1959-01-01

    Dr. Wernher von Braun, Director of the U.S. Army Ballistic Missile Agency's (ABMA) Development Operations Division, talks to Huntsville Mayor R. B. 'Speck' Searcy, center, and Army Ordnance Missile Command (ARMC) Major General John B. Medaris, right, during 'Moon Day' celebrations in downtown Huntsville, Alabama. (Courtesy of Huntsville/Madison County Public Library)

  7. Braun-Le Chatelier principle in dissipative thermodynamics

    CERN Document Server

    Pavelka, Michal

    2016-01-01

    Braun-Le Chatelier principle is a fundamental result of equilibrium thermodynamics, showing how stable equilibrium states shift when external conditions are varied. The principle follows from convexity of thermodynamic potential. Analogously, from convexity of dissipation potential it follows how steady non-equilibrium states shift when thermodynamic forces are varied, which is the extension of the principle to dissipative thermodynamics.

  8. Wernher von Braun: Reflections on His Contributions to Space Exploration

    Science.gov (United States)

    Goldman, Arthur E.

    2012-01-01

    In 1950, Dr. Wernher von Braun and approximately 100 of his team members came to Huntsville, Alabama, to begin work with the Army on what would later become America's historic space program. He would later serve as the first director of the Marshall Space Flight Center and led the development of the Saturn V launch vehicle that launched seven crewed American mission to the moon, as well as America s first space station, Skylab. Von Braun is best known for his team s technical achievements. He realized his dream of exploring outer space by helping place humans on the moon. His engineering and managerial talent during the Apollo era had contributed to a technological revolution. He was by all accounts a good engineer, but he was only one among many. What set Von Braun apart were his charisma, his vision, and his leadership skills. He inspired loyalty and dedication in the people around him. He understood the importance of communicating his vision to his team, to political and business leaders and the public. Today, the Marshall Center continues his vision by pursuing engineering and scientific projects that will continue to open space to exploration. This presentation will discuss Von Braun's impact on Huntsville, the Marshall Center, the nation and the world and look at his contributions in context of where world space exploration is today.

  9. Dynamic life-time assessing method for the N1C700 turbine's rotor

    International Nuclear Information System (INIS)

    The N1C700 turbine's rotor subject to different sorts of stress variations was investigated through dynamic life-time assessing method. To obtain the temperature fields at different steam parameters inside the turbine components, a computer code named DENOPAR was developed

  10. Heavy perfluorocarbons in the global atmosphere: Atmospheric histories and top-down global emission estimates for C4F10, C5F12, C6F14, C7F16 and C8F18

    Science.gov (United States)

    Ivy, D. J.; Arnold, T.; Rigby, M. L.; Baasandorj, M.; Muhle, J.; Harth, C.; Salameh, P.; Steele, P.; Leist, M.; Krummel, P. B.; Burkholder, J. B.; Fraser, P.; Weiss, R. F.; Prinn, R. G.

    2011-12-01

    The high molecular weight perfluorocarbons (PFCs) - perfluorobutane (C4F10), perfluoropentane (C5F12), perfluorohexane (C6F14), perfluoroheptane (C7F16) and perfluorooctane (C8F18) - are potent greenhouse gases with global warming potentials of ~ 9000 for a 100 year time horizon [Forster et al., 2007]. Currently, the heavy PFCs are regulated under the Kyoto Protocol of the United Nations Framework Convention on Climate Change (UNFCCC). However, no atmospheric observations or top-down emission estimates for these gases have been published. In this study, atmospheric histories of the heavy PFCs were determined through new measurements of the Cape Grim Air Archive and a collection of Northern Hemispheric archive flasks using the Advanced Global Atmospheric Gases Experiment (AGAGE) cryogenic preconcentration gas chromatography-mass spectrometry system "Medusa" [Miller et al., 2008]. Furthermore, global top-down emissions were estimated from 1973-2010 based on the atmospheric histories using an inverse method and the 3-D chemical transport model, Model of OZone and Related Tracers (MOZARTv4.5) [Emmons et al., 2009]. Comparison of the top-down emission estimates with bottom-up estimates from the Emissions Database for Global Atmospheric Research (EDGARv4.1) shows EDGARv4.1 emission estimates are underestimated by orders of magnitude for C4F10 and C5F12 [European Commission, 2009]. The bottom-up estimates from EDGARv4.1 are comparable to the top-down estimates for C6F14 and C7F16; no bottom-up emission estimates are available for C8F18. Generally, UNFCCC reported inventories by countries that have ratified the Kyoto Protocol are 5 to 10 times lower than the top-down emission estimates for C4F10, C5F12 and C6F14 (C7F16 and C8F18 are not reported to the UNFCCC). The atmospheric histories and top-down emission estimates presented are the most accurate and comprehensive compiled so far for the high molecular weight PFCs. Furthermore, this study illustrates the importance of

  11. Measured data from the Avery Island Site C heater test

    International Nuclear Information System (INIS)

    Over the past six years, a comprehensive field testing program was conducted in the Avery Island salt mine. Three single canister heater tests were included in the testing program. Specifically, electric heaters, which simulate canisters of heat-generating nuclear waste, were placed in the floor of the Avery Island salt mine, and measurements were made of the response of the salt to heating. These tests were in operation by June 1978. One of the three heater tests, Site C, operated for a period of 1858 days and was decommissioned during July and August 1983. This data report presents the temperature and displacement data gathered during the operation and decommissioning of the Site C heater test. The purpose of this data report is to transmit the data to the scientific community. Rigorous analysis and interpretation of the data are considered beyond the scope of a data report. 6 references, 21 figures, 1 table

  12. Optimizing NSSS power and turbine/generator performance for standardized nuclear power plant designs in tropical climates

    International Nuclear Information System (INIS)

    The EPR was developed by AREVA as a standardized nuclear power plant design that could be deployed throughout the world. The first EPR is currently being constructed at Olkiluoto, Finland. Many of the plant systems for this first-of-a-kind unit are optimized for the climate and heat rejection method (once-through cooling) used at Olkiluoto. Two such systems are the Nuclear Steam Supply System (NSSS) and the Turbine/Generator (T/G) system. To achieve the EPR's target net electrical output for tropical climates and various condenser heat rejection methods, design studies were performed that showed that the NSSS and T/G system designs developed for the Olkiluoto site conditions required modification. The business case for EPR on U.S. sites where average ambient temperature is above 60 F, implies an economical design that provides an average net electrical output of at least 1600 MWe. It has been shown through parametric studies that the key features of the design needed to achieve this goal are: -) rated core thermal power of 4590 MWth, which is supported by plant systems, structures and components; -) the use of mechanical draft cooling towers rather than natural draft cooling towers; -) a low pressure turbine design with reduced exhaust annulus area; and -) a multi-pressure condenser configuration

  13. Conservation status of Dendrobium tenuicaule Hook. f. (Orchidaceae, a Middle Andaman Island endemic, India

    Directory of Open Access Journals (Sweden)

    B.R.P. Rao

    2012-12-01

    Full Text Available The current distribution and threat assessment of Dendrobium tenuicaule Hook. f. (Orchidaceae, an endemic orchid of Middle Andaman Island is presented here. New data available from field surveys indicated the species is Critically Endangered as per the 2001 IUCN Red List Catagories and Criteria.

  14. Standard practice for radiographic examination of advanced aero and turbine materials and components

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This practice establishes the minimum requirements for radiographic examination of metallic and nonmetallic materials and components used in designated applications such as gas turbine engines and flight structures. 1.2 The requirements in this practice are intended to control the radiographic process to ensure the quality of radiographic images produced for use in designated applications such as gas turbine engines and flight structures; this practice is not intended to establish acceptance criteria for material or components. When examination is performed in accordance with this practice, engineering drawings, specifications or other applicable documents shall indicate the acceptance criteria. 1.3 All areas of this practice may be open to agreement between the cognizant engineering organization and the supplier, or specific direction from the cognizant engineering organization. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the respons...

  15. Modeling Creep Effects within SiC/SiC Turbine Components

    Science.gov (United States)

    DiCarlo, J. A.; Lang, J.

    2008-01-01

    Anticipating the implementation of advanced SiC/SiC ceramic composites into the hot section components of future gas turbine engines, the primary objective of this on-going study is to develop physics-based analytical and finite-element modeling tools to predict the effects of constituent creep on SiC/SiC component service life. A second objective is to understand how to possibly select and manipulate constituent materials, processes, and geometries in order to minimize these effects. In initial studies aimed at SiC/SiC components experiencing through-thickness stress gradients, creep models were developed that allowed an understanding of detrimental residual stress effects that can develop globally within the component walls. It was assumed that the SiC/SiC composites behaved as isotropic visco-elastic materials with temperature-dependent creep behavior as experimentally measured in-plane in the fiber direction of advanced thin-walled 2D SiC/SiC panels. The creep models and their key results are discussed assuming state-of-the-art SiC/SiC materials within a simple cylindrical thin-walled tubular structure, which is currently being employed to model creep-related effects for turbine airfoil leading edges subjected to through-thickness thermal stress gradients. Improvements in the creep models are also presented which focus on constituent behavior with more realistic non-linear stress dependencies in order to predict such key creep-related SiC/SiC properties as time-dependent matrix stress, constituent creep and content effects on composite creep rates and rupture times, and stresses on fiber and matrix during and after creep.

  16. Langage C manuel de référence

    CERN Document Server

    Harbison, Samuel P

    1990-01-01

    Traduction de la seconde édition d'un ouvrage de référence de réputation internationale, tenant compte de la proposition de normalisation ANSI C. Plus de 180 fonctions standards sont présentées et les plus récentes extensions du langage sont décrites : affectations de structure, type de données énumération, type de données "void".

  17. Hydraulic turbines and auxiliary equipment

    Energy Technology Data Exchange (ETDEWEB)

    Luo Gaorong [Organization of the United Nations, Beijing (China). International Centre of Small Hydroelectric Power Plants

    1995-07-01

    This document presents a general overview on hydraulic turbines and auxiliary equipment, emphasizing the turbine classification, in accordance with the different types of turbines, standard turbine series in China, turbine selection based on the basic data required for the preliminary design, general hill model curves, chart of turbine series and the arrangement of application for hydraulic turbines, hydraulic turbine testing, and speed regulating device.

  18. 13C and 15N enrichment in snipe (Coenocorypha spp.) from islands across the New Zealand biogeographic region

    International Nuclear Information System (INIS)

    The remaining five Coenocorypha snipes are restricted to remote islands in the New Zealand archipelago, so their ecology is difficult to study directly. To ascertain habitat types and ecological interactions across the different taxa and locations, we measured the δ13C and δ15N of feathers from known individual Auckland Island snipe C. aucklandica aucklandica [Adams I., n=12; Enderby I., n=4; Rose I., n=8), Chatham Island snipe C. pusilla (Rangatira, n=10), and Campbell Island snipe (Coenocorypha undescribed sp.; n=1). Data for Snares snipe C. a. huegeli (North East I., n=1) came from the literature. Developmental stage (nestling, juvenile, adult) and sex were statistically indistinguishable. Although significant differences in δ13C occurred between islands, the overall range was small (mean ± standard deviation, -22.7 ± 0.9 permille). The restricted δ13C show that the snipe we sampled occupied a consistent habitat regardless of taxa, island size, and disturbance history. Conversely, the range in δ15N was large at c. 18.5 permille and implied occupation of sites with a wide range of nutrient status. The δ15N from Adams I. (mean 5.9 ± 1.7 permille) was much lower than the other islands (mean 19.2 ± 2.0 permille) and could only be explained by including a 15N-depleted site not affected by seabirds or seals. Auckland Island snipe therefore integrate seabird breeding and non-breeding areas as well as inhabiting locations with seals and high seabird densities. Consequently, Coenocorypha snipes provide connectances between marine animals on land and the wider terrestrial environment and so may be considered for (re)-introduction to predator-proof mainland New Zealand restoration sites. (author). 24 refs., 1 fig., 1 tab

  19. F2-layer parameters long-term trends at the Argentine Islands and Port Stanley stations

    Directory of Open Access Journals (Sweden)

    A. D. Danilov

    Full Text Available The ionospheric sounding data at two southern hemisphere stations, the Argentine Islands and Port Stanley, are analyzed using a method previously developed by the authors. Negative trends of the critical frequency foF2 are found for both stations. The magnitudes of the trends are close to those at the corresponding (close geomagnetic latitude stations of the northern hemisphere, as considered previously by the authors. The values of the F2 layer height hmF2 absolute trends ΔhmF2 are considered. The effect of ΔhmF2 dependence on hmF2 found by Jarvis et al. (1998 is reproduced. A concept is considered that long-term changes of the geomagnetic activity may be an important (if not the only cause of all the trends of foF2 and hmF2 derived by several groups of authors. The dependence of both parameters on the geomagnetic index Ap corresponds to a smooth scheme of the ionospheric storm physics and morphology; thus, a principal cause of the foF2 and hmF2 geomagnetic trends is most probably a trend found in several publications in the number and intensity of ionospheric storms.

    Key words. Ionosphere (ionosphere-atmosphere interaction; ionospheric disturbances

  20. Temporal variation of Nitella furcata subsp. mucronata var. mucronata f. oligospira (Charophyceae) in the Ninféias pond, São Paulo State, southeast Brazil Variação temporal de Nitella furcata subsp. mucronata var. mucronata f. oligospira (Charophyceae) no Lago das Ninféias, São Paulo, sudeste do Brasil

    OpenAIRE

    Norma Catarina Bueno; Carlos Eduardo de Mattos Bicudo

    2006-01-01

    Temporal and spatial variation of Nitella furcata (Roxburgh ex Bruzelius) C. Agardh emend. R.D. Wood subsp. mucronata (A. Braun) R.D. Wood var. mucronata f. oligospira (A. Braun) R.D. Wood were studied at the Ninféias pond (23°38'18.9"S, 46°37'16.3"W), a tropical, shallow, mesotrophic reservoir located in the Parque Estadual das Fontes do Ipiranga Biological Reserve, Municipality of São Paulo, southeast Brazil. Water samples were collected monthly from October/1996 to October/1997 for...

  1. STM study of C60F18 high dipole moment molecules on Au(111)

    Science.gov (United States)

    Bairagi, K.; Bellec, A.; Chumakov, R. G.; Menshikov, K. A.; Lagoute, J.; Chacon, C.; Girard, Y.; Rousset, S.; Repain, V.; Lebedev, A. M.; Sukhanov, L. P.; Svechnikov, N. Yu.; Stankevich, V. G.

    2015-11-01

    Scanning tunneling microscopy and spectroscopy studies of C60F18 molecules deposited on Au(111) are reported and compared to C60 molecules both at liquid helium temperature and room temperature (RT). Whereas adsorption and electronic properties of C60F18 single molecules were studied at low temperature (LT), self-assemblies were investigated at RT. In both cases, the fluorine atoms of the C60F18 molecules are pointed towards the surface. Individual C60F18 molecules on Au(111) have a HOMO-LUMO gap of 2.9 eV. The self-assembled islands exhibit a close-packed hexagonal lattice with amorphous borders. The comparison with C60 molecules clearly demonstrates the influence of the C60F18 electric dipole moment (EDM) on the electronic properties of single molecules and on the thermodynamics of self-assembled islands. Besides, the apparent height value of a separate molecule increases in a self-assembly environment as a result of a depolarization phenomenon.

  2. 26-Eskader R.F.C.

    Directory of Open Access Journals (Sweden)

    Jan Ploeger

    2012-02-01

    Full Text Available Onder die opskrif 1915-1918 is, in die gedenk boek Per aspera ad astra 1920-1970, 'n (aantal bladsye aall 26-Eskader R.P.C. gewy en o.m. verklaar dat die Britse regering met die toenmalige Statebondslande ooreengekom het om alle afsonderlike Lugmag-eenhede by die Royal Flying Corps (R.F.C. in te Iyf. Vervolgens is verwys na 'n skrywe wat op 21 Augustus 1915 deur die War Office aan die Koloniale Ondersekretaris gerig is en waarin die gedagte uitgespreek is om 'n eenheid, bestaande uit Suid-Ajrikaallse personeel, m.a.w. die stigting van 'n suiwer Suid-Afrikaanse eskader van die R.P.C., te oonveeg.

  3. Psiloxylon mauritianum (Bouton ex Hook.f.) Baillon (Myrtaceae): A promising traditional medicinal plant from the Mascarene Islands

    OpenAIRE

    Mahomoodally, Mohamad Fawzi; Korumtollee, Housna Nazifah; Chady, Zaynab Zaina Banu Khan

    2014-01-01

    Psiloxylon mauritianum (PM) (Bouton ex Hook.f.) Baillon (Myrtaceae) is an evergreen endemic medicinal plant which has shown promising uses in traditional medicine from the Mascarene Islands (Mauritius and Réunion Islands). Folk use of this endemic plant in Mauritius and Réunion Islands has been geared toward the treatment and management of amenorrhea, dysentery and Type II diabetes mellitus. Recent findings from in vitro studies have led to the discovery of two potent acids namely corosolic a...

  4. Braun, Wernher von (1912-77)

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    Rocket scientist, born in Wirsitz, Germany, enthusiast of space travel from an early age, designer of the V-2 rocket used during the second World War. With 120 associates from Peenemunde, went to the United States and directed firings of captured V-2 rockets at White Sands Missile Range in New Mexico, following which he used a Jupiter-C (Juno I) to put America's first satellite, Explorer 1, into ...

  5. Deformation microstructure and orientation of F.C.C. crystals

    DEFF Research Database (Denmark)

    Liu, Q.; Hansen, N.

    1995-01-01

    The effect of crystallographic orientation on the microstructural evolution in f.c.c. metals with medium to high stacking fault energy is analyzed. This analysis is based on a literature review of the behaviour of single crystals and polycrystals supplemented with an experimental study of cold-rolled...... that dependent on the crystallographic orientation of the crystal the subdividing boundaries may be nearly parallel to slip planes or they may have a non-crystallographic orientation. This difference is discussed on the basis of an analysis of potential slip planes identified by a Schmid factor...

  6. Development of superalloys for 1700 C ultra-efficient gas turbines

    Energy Technology Data Exchange (ETDEWEB)

    Harada, Hiroshi [National Institute for Materials Science, Tsukuba, Ibaraki (Japan). High Temperature Materials Center

    2010-07-01

    Mitigation of global warming is one of the most outstanding issues for the humankind. The Japanese government announced that it will reduce its greenhouse gas emissions by 25% from the 1990 level by 2020 as a medium-term goal. One of the promising approaches to achieving this is to improve the efficiency of thermal power plants emitting one-third of total CO{sub 2} gas in Japan. The key to improving the thermal efficiency is high temperature materials with excellent temperature capabilities allowing higher inlet gas temperatures. In this context, new single crystal superalloys for turbine blades and vanes, new coatings and turbine disk superalloys have been successfully developed for various gas turbine applications, typically 1700 C ultra-efficient gas turbines for next generation combine cycle power plants. (orig.)

  7. Simulation of electricity supply of an Atlantic island by offshore wind turbines and wave energy converters associated with a medium scale local energy storage

    OpenAIRE

    Babarit, Aurélien; Ben Ahmed, Hamid; Clément, Alain; Debusschere, Vincent; Duclos, Gaelle; Multon, Bernard; Robin, Gaël

    2006-01-01

    International audience This paper describes the problem of sizing an electricity storage for an island supplied by both marine renewables (offshore wind and waves) and the mainland grid. This problem is addressed by a case study based on a full year resource and consumption data. Generators (wave energy converters and wind turbines), transmission lines and battery storage (Lead acid technology) are accounted for through basic simplified models while the focus is put on electricity import/e...

  8. Measured effects of wind turbine generation at the Block Island Power Company

    Science.gov (United States)

    Wilreker, V. F.; Smith, R. F.; Stiller, P. H.; Scot, G. W.; Shaltens, R. K.

    1984-01-01

    Data measurements made on the NASA MOD-OA 200-kw wind-turbine generator (WTG) installed on a utility grid form the basis for an overall performance analysis. Fuel displacement/-savings, dynamic interactions, and WTG excitation (reactive-power) control effects are studied. Continuous recording of a large number of electrical and mechanical variables on FM magnetic tape permit evaluation and correlation of phenomena over a bandwidth of at least 20 Hz. Because the wind-power penetration reached peaks of 60 percent, the impact of wind fluctuation and wind-turbine/diesel-utility interaction is evaluated in a worst-case scenario. The speed-governor dynamics of the diesel units exhibited an underdamped response, and the utility operation procedures were not altered to optimize overall WTG/utility performance. Primary findings over the data collection period are: a calculated 6.7-percent reduction in fuel consumption while generating 11 percent of the total electrical energy; acceptable system voltage and frequency fluctuations with WTG connected; and applicability of WTG excitation schemes using voltage, power, or VARS as the controlled variable.

  9. Longitudinal imaging of Alzheimer pathology using [11C]PIB, [18F]FDDNP and [18F]FDG PET

    International Nuclear Information System (INIS)

    [11C]PIB and [18F]FDDNP are PET tracers for in vivo detection of the neuropathology underlying Alzheimer's disease (AD). [18F]FDG is a glucose analogue and its uptake reflects metabolic activity. The purpose of this study was to examine longitudinal changes in these tracers in patients with AD or mild cognitive impairment (MCI) and in healthy controls. Longitudinal, paired, dynamic [11C]PIB and [18F]FDDNP (90 min each) and static [18F]FDG (15 min) PET scans were obtained in 11 controls, 12 MCI patients and 8 AD patients. The mean interval between baseline and follow-up was 2.5 years (range 2.0-4.0 years). Parametric [11C]PIB and [18F]FDDNP images of binding potential (BPND) and [18F]FDG standardized uptake value ratio (SUVr) images were generated. A significant increase in global cortical [11C]PIB BPND was found in MCI patients, but no changes were observed in AD patients or controls. Subsequent regional analysis revealed that this increase in [11C]PIB BPND in MCI patients was most prominent in the lateral temporal lobe (p 18F]FDDNP, no changes in global BPND were found. [18F]FDG uptake was reduced at follow-up in the AD group only, especially in frontal, parietal and lateral temporal lobes (all p 11C]PIB binding (ρ = -0.42, p 18F]FDG uptake (ρ = 0.54, p 18F]FDDNP binding (ρ = -0.18, p = 0.35) were not. [11C]PIB and [18F]FDG track molecular changes in different stages of AD. We found increased amyloid load in MCI patients and progressive metabolic impairment in AD patients. [18F]FDDNP seems to be less useful for examining disease progression. (orig.)

  10. C++ Coding Standards for the AMP Project

    Energy Technology Data Exchange (ETDEWEB)

    Evans, Thomas M [ORNL; Clarno, Kevin T [ORNL

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  11. Standardization of C-14 by tracing method

    International Nuclear Information System (INIS)

    The standardization of a 14C radioactive solution by means of the efficiency tracing technique is described. The 14C is a beta pure emitter with endpoint energy of 156 keV decaying to the ground state of 14N. The activity measurement was performed in a 4πβ-γ coincidence system, measuring the pure beta emitter mixed with a beta gamma emitter, which provides the beta detection efficiency. The radionuclide 60Co, which decays by beta particle followed by two gamma rays, was used as tracer and the efficiency was obtained by selecting the 1173 keV plus 1332 keV total energy absorption peak at the gamma channel. Known aliquots of the tracer, previously standardized by 4πβ (PC)-γ coincidence, were mixed with known aliquots of 14C. The sources of 14C + 60Co were prepared by dropping known aliquots from each radioactive solution. The events were registered by a Software Coincidence System (SCS). The activity of the solution was determined by using the extrapolation technique, changing the beta efficiency by pulse height discrimination. In order to determine the final activity, a Monte Carlo simulation was used to calculate the extrapolation curve. All the uncertainties involved were treated rigorously, by means of the covariance analysis methodology. Measurements using a HIDEX, a commercial liquid scintillator system, were carried out and the results were compared with the tracing technique, showing a good agreement. (author)

  12. Biologie en landbouw. F.A.F.C. Went en de Indische proefstations

    OpenAIRE

    Wim van der Schoor

    1994-01-01

    Biology and agriculture: F.A.F.C. Went (1863-1935) and the agricultural experiment stations in the Dutch East Indies.


    From the end of the nineteenth century, Dutch biologists stressed the practical significance of their discipline, especially for agriculture. According to the influential Dutch botanist F.A.F.C. Went, progress in agriculture could only ...

  13. Electron interactions with c-C4F8

    International Nuclear Information System (INIS)

    The limited electron collision cross-section and transport-coefficient data for the plasma processing gas perfluorocyclobutane (c-C4F8) are synthesized, assessed, and discussed. These include cross sections for total electron scattering, differential elastic electron scattering, partial and total ionization, dissociation into neutral fragments, and electron attachment, as well as data on electron transport, ionization, and attachment coefficients. The available data on both the electron collision cross sections and the electron transport coefficients require confirmation. Also, measurements are needed of the momentum transfer and elastic integral cross sections, and of the cross sections for other significant low-energy electron collision processes such as vibrational and electronic excitation. In addition, electron transport data over a wider range of values of the density-reduced electric field are needed. The present assessment of data on electron affinity, attachment, and scattering suggests the existence of negative ion states near -0.6, 4.9, 6.9, 9.0, and 10.5 eV

  14. Understanding IEC standard wind turbine models using SimPowerSystems

    DEFF Research Database (Denmark)

    Das, Kaushik; Hansen, Anca Daniela; Sørensen, Poul Ejnar

    2016-01-01

    This article describes and exemplifies the IEC 61400-27 generic wind turbine models through an interactive multimedia learning environment - Matlab SimPowerSystems. The article aims help engineers with different backgrounds to get a better understanding of wind turbine dynamics and control by...... easily conducting different study simulations in the SimPowerSystems platform ....

  15. To Question оf Using Power Reserve оf Power-and-Heat Supply Turbine Plants

    OpenAIRE

    S. A. Kachan; I. N. Baranovski

    2014-01-01

    The paper considers possibilities and limitations of various methods for obtaining power re-serve at power-and-heat supply turbo-generator sets.Approximate values of specific heat rate and quantity of reserve power and rate of its obtaining for various turbine plants are given in the paper.

  16. To Question оf Using Power Reserve оf Power-and-Heat Supply Turbine Plants

    Directory of Open Access Journals (Sweden)

    S. A. Kachan

    2014-06-01

    Full Text Available The paper considers possibilities and limitations of various methods for obtaining power re-serve at power-and-heat supply turbo-generator sets.Approximate values of specific heat rate and quantity of reserve power and rate of its obtaining for various turbine plants are given in the paper.

  17. The cooling capabilities of C2F6/C3F8 saturated fluorocarbon blends for the ATLAS silicon tracker

    International Nuclear Information System (INIS)

    We investigate and address the performance limitations of the ATLAS silicon tracker fluorocarbon evaporative cooling system operation in the cooling circuits of the barrel silicon microstrip (SCT) sub-detector. In these circuits the minimum achievable evaporation temperatures with C3F8 were higher than the original specification, and were thought to allow an insufficient safety margin against thermal runaway in detector modules subject to a radiation dose initially foreseen for 10 years operation at LHC. We have investigated the cooling capabilities of blends of C3F8 with molar admixtures of up to 25% C2F6, since the addition of the more volatile C2F6 component was expected to allow a lower evaporation temperature for the same evaporation pressure.A custom built recirculator allowed the in-situ preparation of C2F6/C3F8 blends. These were circulated through a representative mechanical and thermal setup reproducing an as-installed ATLAS SCT barrel tracker cooling circuit. Blend molar compositions were verified to a precision of 3.10−3 in a custom ultrasonic instrument.Thermal measurements in a range of C2F6/C3F8 blends were compared with measurements in pure C3F8. These indicated that a blend with 25% C2F6 would allow a reduction in evaporation temperature of around 9oC to below -15oC, even at the highest module power dissipations envisioned after 10 years operation at LHC. Such a reduction would allow more than a factor two in safety margin against temperature dependant leakage power induced thermal runaway.Furthermore, a blend containing up to 25% C2F6 could be circulated without changes to the on-detector elements of the existing ATLAS inner detector evaporative cooling system

  18. Fatigue and creep cracking of nickel alloys for 700 C steam turbines

    International Nuclear Information System (INIS)

    Four materials of the types Inconel 706 (two heat treatment states), Inconel 617, and Waspaloy were tested as shaft materials for 700 to 720 C steam turbines. At an extrapolation time ratio of 10, Waspaloy was expected to have the highest creep strength (about 270 MPa at 700 C), with values of about 140 MPa at 700 C for Inconel 617. A preliminary evaluation of the 700 C creep rupture tests showed the highest creep rupture resistance for Inconel 617, followed by Waspaloy and Inconel 706

  19. Special Issue on Signal Processing for Mechanical Systems in Honor of Professor Simon Braun

    Science.gov (United States)

    Fassois, Spilios D.

    2016-06-01

    This Special Issue is in honor of a pioneer of the area of Signal Processing for Mechanical Systems and, at the same time, Founding Editor of the Journal of Mechanical Systems and Signal Processing (MSSP), Professor Simon Braun.

  20. Selective growth of Pb islands on graphene/SiC buffer layers

    International Nuclear Information System (INIS)

    Graphene is fabricated by thermal decomposition of silicon carbide (SiC) and Pb islands are deposited by Pb flux in molecular beam epitaxy chamber. It is found that graphene domains and SiC buffer layer coexist. Selective growth of Pb islands on SiC buffer layer rather than on graphene domains is observed. It can be ascribed to the higher adsorption energy of Pb atoms on the 6√(3) reconstruction of SiC. However, once Pb islands nucleate on graphene domains, they will grow very large owing to the lower diffusion barrier of Pb atoms on graphene. The results are consistent with first-principle calculations. Since Pb atoms on graphene are nearly free-standing, Pb islands grow in even-number mode

  1. The k-ε-fP model applied to double wind turbine wakes using different actuator disk force methods

    DEFF Research Database (Denmark)

    Laan, van der, Paul Maarten; Sørensen, Niels N.; Réthoré, Pierre-Elouan; Mann, Jakob; Kelly, Mark C.; Troldborg, Niels

    2015-01-01

    The newly developed k-ε-fP  eddy viscosity model is applied to double wind turbine wake configurations in a neutral atmospheric boundary layer, using a Reynolds-Averaged Navier–Stokes solver. The wind turbines are represented by actuator disks. A proposed variable actuator disk force method is...... two methods overpredict it. The results of the k-ε-fP  eddy viscosity model are also compared with the original k-ε eddy viscosity model and large-eddy simulations. Compared to the large-eddy simulations-predicted velocity and power deficits, the k-ε-fP  is superior to the original k-ε model...

  2. Photoluminescence and band edge alignment of C-induced Ge islands and related SiGeC structures

    Science.gov (United States)

    Schmidt, O. G.; Eberl, K.

    1998-11-01

    Growth of less than 2 monolayers Ge on a submonolayer amount of predeposited C on Si results in the formation of very small Ge quantum islands. In a photoluminescence study, we compare these C-induced Ge (CGe) dots with carefully chosen reference structures incorporating the same total amount of C and Ge but with different deposition orders and with varied C distribution below the Ge islands. Our investigations imply that the special combination of pregrown low surface mobility C and post-grown high surface mobility Ge constitutes a distinct microstructure within the SiGeC material system, causing dot formation at a very early stage and showing particularly intense photoluminescence signal. Moreover, structures combining CGe dots with Si1-yCy quantum wells are well explained by the model of spatially indirect type-II recombination within the CGe islands.

  3. An MHD Rotating Machine: A New Type of a.c. Magnetohydrodynamic Power Generator and Turbine

    International Nuclear Information System (INIS)

    A new type of MHD machine is proposed in this paper. The conceptual structure of the machine is very similar to that of the conventional three-phase rotating synchronous machine, which consists of the rotor, for exciting the mechanically rotating d. c. magnetic field, and the stator with conventional three-phase a.c. windings. The only difference in concept is the existence of the MHD working fluid flowing in the duct space between the rotor- and the stator in the direction of rotation of the rotor. The paper presents the results of the preliminary theoretical analysis of the machine. It is shown that the machine may be operated as an a.c. MHD electrical power generator or as an electrically- controlled MHD turbine or as the combination of those. As an a.c. generator, the machine may be regarded as the combination of the synchronous and asynchronous generator, and can be operated under such conditions that the rotor is in the self-rotating condition at the synchronous speed, or in other words, that no external drive is required for the rotor. Thus all the energy of the MHD working fluid, except the Joule loss in the fluid itself, is converted into the a.c. electrical power. On the other hand, as an MHD turbine, the d.c. magnetic field of the rotor plays the role of the turbine blades, and in this case a small a.c. current in the stator windings can control the mechanical power output transferred from the working fluid to the turbine rotor. The very interesting results as an a.c. electrical power generator from the practical viewpoint are that (1) under the self- rotating condition the lagging power- factor operation (0.8∼1.0) is possible, cf. the MHD induction generator, and (2) the machine is practically feasible not only by using a liquid metal working fluid together with a relatively low d.c. exciting magnetic field, but also by using the gaseous plasma with a very high d.c. magnetic field excitation. (author)

  4. Potential Hazards Relating to Pyrolysis of c-C4F8O, n-C4F10 and c-C4F8 in selected gaseous diffusion plant operations

    International Nuclear Information System (INIS)

    As part of a program intended to replace the present evaporative coolant at the gaseous diffusion plants (GDPs) with a non-ozone-depleting alternate, a series of investigations of the suitability of candidate substitutes is under way. This report summarizes studies directed at estimating the chemical and thermal stability of three candidate coolants, c-C4F8O, n-C4F10 and c-C44F8, in a few specific environments to be found in gaseous diffusion plant operations

  5. Precise f_{D*,B*} and f_{B_c} from QCD spectral sum rules

    CERN Document Server

    Narison, Stephan

    2014-01-01

    Anticipating future precise measurements of the B-like leptonic decays for alternative determinations of the CKM mixing angles or/and for predicting their semi-leptonic and hadronic decays, we pursue our program on the B-like mesons by improving the estimates of f_D* and f_B* [analogue to f_\\pi=130.4(2) MeV] using suitable ratios of the well-established (inverse) Laplace sum rules less affected by the systematics and known to N2LO pQCD and where the full d=6 non-perturbative condensate contributions are included. An estimate of the N3LO terms based on geometric growth of the pQCD series is included in the error calculations. Our optimal results based on stability criteria and on an (in)dependence on the choice of the QCD subtraction point read: f_D*/f_D=1.209(22),f_B*/f_B=1.031(8) which imply : f_D*=246(7) MeV and f_B*=212(8) MeV if we use our recent results in [1] for f_D and f_B. We complete the analysis by a direct estimate of f_Bc using the complete NLO + N2LO for massless m_c pQCD expression and complete...

  6. Effect of thermal barrier coatings on the performance of steam and water-cooled gas turbine/steam turbine combined cycle system

    Science.gov (United States)

    Nainiger, J. J.

    1978-01-01

    An analytical study was made of the performance of air, steam, and water-cooled gas-turbine/steam turbine combined-cycle systems with and without thermal-barrier coatings. For steam cooling, thermal barrier coatings permit an increase in the turbine inlet temperature from 1205 C (2200 F), resulting in an efficiency improvement of 1.9 percentage points. The maximum specific power improvement with thermal barriers is 32.4 percent, when the turbine inlet temperature is increased from 1425 C (2600 F) to 1675 C (3050 F) and the airfoil temperature is kept the same. For water cooling, the maximum efficiency improvement is 2.2 percentage points at a turbine inlet temperature of 1683 C (3062 F) and the maximum specific power improvement is 36.6 percent by increasing the turbine inlet temperature from 1425 C (2600 F) to 1730 C (3150 F) and keeping the airfoil temperatures the same. These improvements are greater than that obtained with combined cycles using air cooling at a turbine inlet temperature of 1205 C (2200 F). The large temperature differences across the thermal barriers at these high temperatures, however, indicate that thermal stresses may present obstacles to the use of coatings at high turbine inlet temperatures.

  7. Elaboration of global quality standards for natural and low energy cooling in French tropical island buildings

    CERN Document Server

    Garde, F; Gatina, J C

    2012-01-01

    Electric load profiles of tropical islands in developed countries are characterised by morning, midday and evening peaks arising from all year round high power demand in the commercial and residential sectors, due mostly to air conditioning appliances and bad thermal conception of the building. The work presented in this paper has led to the conception of a global quality standards obtained through optimized bioclimatic urban planning and architectural design, the use of passive cooling architectural components, natural ventilation and energy efficient systems such as solar water heaters. We evaluated, with the aid of an airflow and thermal building simulation software (CODYRUN), the impact of each technical solution on thermal comfort within the building. These technical solutions have been implemented in 280 new pilot dwelling projects through the year 1996.

  8. Stationary gas turbines of all performance classes in a flexible power supply operation; Stationaere Gasturbinen. Gasturbinen aller Leistungsklassen im flexiblen Netzbetrieb

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-07-01

    Within the 8th VDI conference from 20th to 21st November, 2012, at the Electoral Palace Mainz (Mainz, Federal Republic of Germany), the following lectures were held: (1) Introduction of the twin-shaft industrial gas turbine SGT-300 (C. Engelbert); (2) The new 6 MW gas turbine for the power generation (Michael Blaswich); (3) Successful increase of the breakeven performance of the SGT5-2000E based on the Si3D blading (S. Kliesch); (4) Advanced Condition Monitoring at E.ON (T. Burridge-Oakland); (5) Experiences from 10 years of monitoring at gas turbine power plants (D. Therkon); (6) Operating experience with GE's Intercooled LMS100 (B. Mehmetli); (7) First long-term experience with the operational flexibility of the SGT5-8000H (C. Scholz); (8) Plant concept and operational concept with small gas turbines for the heat production and power generation meeting the demands in line with market conditions (D. Seibt); (9) Operational experiences with remote diagnostic services in the power range up to 25 MW (H. Berghaus); (10) European regulations having an influence on design and operation of gas turbines - An overview (M. Zelinger); (11) Future concepts for fuel flexibility - Experience with hydrogen-based fuels (R. Lachner); (12) Requirements from functional safety to gas turbines - Importance and benefit for gas turbine development (G. Weber); (13) Standard for the procurement of gas turbines: ISO 19859 Gas turbine applications - requirements for power generation (I. Rattmann); (14) Future projects for fuel flexibility in the test phase: Natural gas / hydrogen co-firing (G. Fruechtel); (15) Measures for the reduction of emissions at Siemens V64.3 gas turbines (K. Jordan); (16) Flexible operation of the SGT5-4000F by fuel transfers in a wide load range (J. Meisl); (17) Technical features of the GT26 gas turbine to improve the flexibility of the combined cycle system KA26 (W. Reiter).

  9. 12 CFR Appendix F to Part 225 - Interagency Guidelines Establishing Information Security Standards

    Science.gov (United States)

    2010-01-01

    ... (FDIC); and 12 CFR part 570, app. B (OTS). The “Interagency Guidelines Establishing Information Security.... 225, App. F Appendix F to Part 225—Interagency Guidelines Establishing Information Security Standards.... Standards for Safeguarding Customer Information A. Information Security Program B. Objectives...

  10. Behavior of ceramics at 1200 C in a simulated gas turbine environment

    Science.gov (United States)

    Sanders, W. A.; Probst, H. B.

    1974-01-01

    This report summarizes programs at the NASA Lewis Research Center evaluating several classes of commercial ceramics, in a high gas velocity burner rig simulating a gas turbine engine environment. Testing of 23 ceramics in rod geometry identified SiC and Si3N4 as outstanding in resistance to oxidation and thermal stress and identified the failure modes of other ceramics. Further testing of a group of 15 types of SiC and Si3N4 in simulated vane shape geometry has identified a hot pressed SiC, a reaction sintered SiC, and hot pressed Si3N4 as the best of that group. SiC and Si3N4 test specimens were compared on the basis of weight change, dimensional reductions, metallography, fluorescent penetrant inspection, X-ray diffraction analyses, and failure mode.

  11. The Development of 2700-3000 F Environmental Barrier Coatings for SiC/SiC Ceramic Matrix Composites: Challenges and Opportunities

    Science.gov (United States)

    Zhu, Dongming

    2015-01-01

    Environmental barrier coatings (EBCs) and SiCSiC ceramic matrix composites (CMCs) systems will play a crucial role in future turbine engines for hot-section component applications because of their ability to significantly increase engine operating temperatures, reduce engine weight and cooling requirements. The development of prime-reliant environmental barrier coatings is a key to enable the applications of the envisioned 2700-3000F EBC - CMC systems to help achieve next generation engine performance and durability goals. This paper will primarily address the performance requirements and design considerations of environmental barrier coatings for turbine engine applications. The emphasis is placed on current NASA candidate environmental barrier coating systems for SiCSiC CMCs, their performance benefits and design limitations in long-term operation and combustion environments. The efforts have been also directed to developing prime-reliant, self-healing 2700F EBC bond coat; and high stability, lower thermal conductivity, and durable EBC top coats. Major technical barriers in developing environmental barrier coating systems, the coating integrations with next generation CMCs having the improved environmental stability, cyclic durability, erosion-impact resistance, and long-term system performance will be described. The research and development opportunities for turbine engine environmental barrier coating systems by utilizing improved compositions, state-of-the-art processing methods, and simulated environment testing and durability modeling will be discussed.

  12. Development of submersible generator propeller turbines. Standard machines for low flow rates at small heights of fall; Entwicklung von Tauchgenerator-Propellerturbinen. Standard-Maschinen fuer geringe Abfluesse bei kleinen Fallhoeher

    Energy Technology Data Exchange (ETDEWEB)

    Breitenstein, Juerg

    2009-07-01

    Dee to the rapidly increasing energy prices and due to the partly attractive feed-in tariffs the use of small hydropower currently is experiencing an enormous upswing worldwide. What was missing was a cost-effective, robust and reliable water turbine which uses low flows at low height of fall. With the newly developed submersible generator propeller turbine from AZ ingenierie SA (Freiburg, Switzerland) in industrialized countries electricity now can be fed directly into the grid. In addition, with this a household canbe operated in island mode in third world countries.

  13. Standardization of 18F by digital coincidence counting

    International Nuclear Information System (INIS)

    The radioactivity of 18F has been measured by a digital coincidence counting (DCC) system. The main advantages of the digital coincidence counting technique are a shortening of the measurement time as compared with conventional coincidence counting and an ability to obtain activities with various experimental parameters through off-line analysis. The measurement results of radioactivity for 18F solution were compared with those of a conventional coincidence counting technique and a reference ion chamber method. - Highlights: ► Radioactivity of F-18 is measured by a DCC technique. ► DCC technique has an advantage for the radionuclide with short half-life. ► Activity results show a good agreement with those of other methods.

  14. A Review of NIST Primary Activity Standards for 18F: 1982 to 2013

    OpenAIRE

    Bergeron, Denis E; Cessna, Jeffrey T; Coursey, Bert M; Fitzgerald, Ryan; Zimmerman, Brian E

    2014-01-01

    The new NIST activity standardization for 18F, described in 2014 in Applied Radiation and Isotopes (v. 85, p. 77), differs from results obtained between 1998 and 2008 by 4 %. The new results are considered to be very reliable; they are based on a battery of robust primary measurement techniques and bring the NIST standard into accord with other national metrology institutes. This paper reviews all ten 18F activity standardizations performed at NIST from 1982 to 2013, with a focus on experimen...

  15. Quantitative relationship between hepatocytic neoplasms and islands of cellular alteration during hepatocarcinogenesis in the male F344 rat.

    OpenAIRE

    Kaufmann, W. K.; Mackenzie, S. A.; Kaufman, D G

    1985-01-01

    Hepatocytic neoplasms (nodules and carcinomas) and islands of cellular alteration which display abnormal retention of glycogen on fasting were quantified in F344 male rats at intervals after initiation of hepatocarcinogenesis by the combination of a two-thirds partial hepatectomy with a single treatment with methyl(acetoxymethyl)-nitrosamine during the subsequent peak of DNA synthesis in regenerating livers. In initiated rats fed the liver tumor promoter phenobarbital, yields of neoplasms and...

  16. C++ Coding Standards 101 Rules, Guidelines, and Best Practices

    CERN Document Server

    Sutter, Herb

    2005-01-01

    Consistent, high-quality coding standards improve software quality, reduce time-to-market, promote teamwork, eliminate time wasted on inconsequential matters, and simplify maintenance. Now, two of the world's most respected C++ experts distill the rich collective experience of the global C++ community into a set of coding standards that every developer and development team can understand and use as a basis for their own coding standards.

  17. Privatwirtschaftlicher Standard für ökologisches/biologisches Heimtierfutter

    OpenAIRE

    Rombach, Martin; Schick, Alissa

    2009-01-01

    In Deutschland existiert bisher weder ein nationaler Standard für Heimtierfutter noch ein anerkannter oder akzeptierter privatwirtschaftlicher Standard. Der vorliegende Standard soll diese Lücke schließen und den Herstellern und Inverkehrbringern von Heimtierfuttermitteln, welche mit einem Hinweis auf den ökologischen Landbau gekennzeichnet werden, eine Vermarktung erlauben und Rechtssicherheit geben.

  18. Atmospheric chemistry of C2F5CHO: mechanism of the C2F5C(O)O-2+HO2 reaction

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Hurley, MD; Wallington, TJ;

    2003-01-01

    Smog chamber/FTIR techniques were used to study the gas-phase reaction of C2F5C(O) with HO2 radicals in 100-700 Torr of air, or O-2, diluent at 296 K. The reaction proceeds by two pathways leading to formation of C2F5C(O)OH and O-3 in ayield of 24 +/- 4% and C2F5C(O)O radicals, OH radicals and O-2...... in a yield of 76 +/- 4 The gas phase reaction of CnF2n+1C(O)O-2 with HO2 radicals offers a potential explanation for at least part of the observed environmental burden of fluorinated carboxylic acids, CnF2n+1C(O)OH. As part of this work an upper limit for the rate constant of reaction of Cl atorns...... with C2F5C(O)OH at 296 K was determined; k(Cl + C2F5C(O)OH) <1 x 10(-11) cm(3) molecule(-1) s(-1). (C) 2003 Published by Elsevier B.V....

  19. Searches for physics beyond the standard model in $f\\bar{f}$ production at LEP II

    Indian Academy of Sciences (India)

    Peter John Holt

    2004-03-01

    Preliminary combinations of measurements of the 4 LEP Collaborations of the process $e^{+}e^{-} → f\\bar{f}$ at LEP II are presented. The combined results are interpreted in terms of contact interactions and the exchange of $Z’$ bosons and within models of low-scale gravity in large extra dimensions.

  20. Passivation of surface-nanostructured f-SiC and porous SiC

    DEFF Research Database (Denmark)

    Ou, Haiyan; Lu, Weifang; Ou, Yiyu;

    The further enhancement of photoluminescence from nanostructured fluorescent silicon carbide (f-SiC) and porous SiC by using atomic layer deposited (ALD) Al2O3 is studied in this paper.......The further enhancement of photoluminescence from nanostructured fluorescent silicon carbide (f-SiC) and porous SiC by using atomic layer deposited (ALD) Al2O3 is studied in this paper....

  1. Ceramic stationary gas turbine

    Energy Technology Data Exchange (ETDEWEB)

    Roode, M. van [Solar Turbines Inc., San Diego, CA (United States)

    1995-10-01

    The performance of current industrial gas turbines is limited by the temperature and strength capabilities of the metallic structural materials in the engine hot section. Because of their superior high-temperature strength and durability, ceramics can be used as structural materials for hot section components (blades, nozzles, combustor liners) in innovative designs at increased turbine firing temperatures. The benefits include the ability to increase the turbine inlet temperature (TIT) to about 1200{degrees}C ({approx}2200{degrees}F) or more with uncooled ceramics. It has been projected that fully optimized stationary gas turbines would have a {approx}20 percent gain in thermal efficiency and {approx}40 percent gain in output power in simple cycle compared to all metal-engines with air-cooled components. Annual fuel savings in cogeneration in the U.S. would be on the order of 0.2 Quad by 2010. Emissions reductions to under 10 ppmv NO{sub x} are also forecast. This paper describes the progress on a three-phase, 6-year program sponsored by the U.S. Department of Energy, Office of Industrial Technologies, to achieve significant performance improvements and emissions reductions in stationary gas turbines by replacing metallic hot section components with ceramic parts. Progress is being reported for the period September 1, 1994, through September 30, 1995.

  2. Rotor architecture in the yeast and bovine F1-c-ring complexes of F-ATP synthase.

    Science.gov (United States)

    Giraud, Marie-France; Paumard, Patrick; Sanchez, Corinne; Brèthes, Daniel; Velours, Jean; Dautant, Alain

    2012-02-01

    The F(1)F(O)-ATP synthase is a rotary molecular nanomotor. F(1) is a chemical motor driven by ATP hydrolysis while F(O) is an electrical motor driven by the proton flow. The two stepping motors are mechanically coupled through a common rotary shaft. Up to now, the three available crystal structures of the F(1)c(10) sub-complex of the yeast F(1)F(O)-ATP synthase were isomorphous and then named yF(1)c(10)(I). In this crystal form, significant interactions of the c(10)-ring with the F(1)-head of neighboring molecules affected the overall conformation of the F(1)-c-ring complex. The symmetry axis of the F(1)-head and the inertia axis of the c-ring were tilted near the interface between the F(1)-central stalk and the c-ring rotor, resulting in an unbalanced machine. We have solved a new crystal form of the F(1)c(10) complex, named yF(1)c(10)(II), inhibited by adenylyl-imidodiphosphate (AMP-PNP) and dicyclohexylcarbodiimide (DCCD), at 6.5Å resolution in which the crystal packing has a weaker influence over the conformation of the F(1)-c-ring complex. yF(1)c(10)(II) provides a model of a more efficient generator. yF(1)c(10)(II) and bovine bF(1)c(8) structures share a common rotor architecture with the inertia center of the F(1)-stator close to the rotor axis. PMID:22119846

  3. Cytogenetic studies of the F1 hybrids of Capsicum annuum with C. chinense and C. baccatum.

    Science.gov (United States)

    Aniel Kumar, O; Panda, R C; Raja Rao, K G

    1987-06-01

    Partially sterile interspecific hybrids were obtained between C. annuum var. 'cerasiformis' and C. chinense var. 'mishme' (H1), and C. annuum var. 'cerasiformis' and C. baccatum var. 'pendulum' (H2). Morphologically the F1 hybrids were intermediate between the corresponding parents. Meiosis was irregular in the two F1 hybrids. Cytological analysis of the two F1 hybrids revealed that the genome of C. annuum differs from C. chinense by two translocations and some minor structural alterations and from C. baccatum by two translocations, a single inversion and some minor structural alterations. Isolation barriers such as hybrid inviability, weakness and hybrid breakdown in the H1 hybrid and, inaddition, desynapsis in the H2, were operative in these taxa. The differences between the present findings and those reported earlier on the two F1hybrids were attributed to differences in the genetic architecture of the taxa employed in hybridization. PMID:24241571

  4. Quasiclassical Trajectory Study of Collisional Energy Transfer between Highly Excited C6F6 and N2 ,O2 and Ground State C6F6

    Institute of Scientific and Technical Information of China (English)

    Jian Hua ZHOU; Shao Kun WANG; Zhi Jun YU; Hai Hui JIANG; Yue Shu GU

    2003-01-01

    Quasiclassical trajectory calculation (QCT) is used frequently for studying collisional energy transfer between highly vibrationally excited molecules and bath gases. In this paper, the QCT of the energy transfer between highly vibrationally excited C6F6 and N2 ,O2 and ground state C6F6 were performed. The results indicate that highly vibrationally excited C6F6 transferred vibrational energy to vibrational distribution of N2, O2 and ground state C6F6, so they are V-V energy transfer. Especially it is mainly V-V resonance energy transfer between excited C6F6 and ground state C6F6, excited C6F6 transfers more vibrational energy to ground state C6F6 than to N2 and O2 . The values of QCT , -〈△Evib〉of excited C6F6 are smaller than those of experiments.

  5. H gas turbine combined cycle

    Energy Technology Data Exchange (ETDEWEB)

    Corman, J. [General Electric Co., Schenectady, NY (United States)

    1995-10-01

    A major step has been taken in the development of the Next Power Generation System - {open_quotes}H{close_quotes} Technology Combined Cycle. This new gas turbine combined-cycle system increases thermal performance to the 60% level by increasing gas turbine operating temperature to 1430 C (2600 F) at a pressure ratio of 23 to 1. Although this represents a significant increase in operating temperature for the gas turbine, the potential for single digit NOx levels (based upon 15% O{sub 2}, in the exhaust) has been retained. The combined effect of performance increase and environmental control is achieved by an innovative closed loop steam cooling system which tightly integrates the gas turbine and steam turbine cycles. The {open_quotes}H{close_quotes} Gas Turbine Combined Cycle System meets the goals and objectives of the DOE Advanced Turbine System Program. The development and demonstration of this new system is being carried out as part of the Industrial/Government cooperative agreement under the ATS Program. This program will achieve first commercial operation of this new system before the end of the century.

  6. A comparison of fatigue loads of wind turbine resulting from a non-Gaussian turbulence model vs. standard ones

    International Nuclear Information System (INIS)

    This project funded by the federal ministry of education and research from the research group 'Wind turbulence and its significance in the use of wind energy' handles a comparison between the load ranges for horizontal axis wind turbines resulting from different turbulence models, i.e. between the usual models as defined in the standards and a new model designed by Friedrich and Kleinhans. This should enable an evaluation of the relevance of this new model for wind modelling for wind turbines and if so, provide the community with new tools in wind simulation. Indeed, spectral models do not well reproduce extreme wind increments as met in gusts. Those models simulate using purely Gaussian statistics. However, measurements show that those increments do not follow normal statistics. The new model developed aims at correcting this problem. The turbulence models used are the Kaimal, von Karman and Mann models as defined in the IEC guidelines and the Friedrich-Kleinhans model, based on stochastic processes called Continuous Time Random Walks. The comparison is based on load ranges resulting from an RFC analysis of 100 time series obtained for 100 different seed numbers. Five wind speeds are investigated. The aeroelastic code used is FLEX5. The main conclusion that can be drawn from this study is that the non-Gaussian Friedrich-Kleinhans model produces loads that are significantly different from the loads obtained with the Kaimal model. That proves that the form of the tails of the increment distribution has a major influence on the loads of the wind turbine and should be considered when making fatigue calculations

  7. C-CAP Land Cover, Big Island, Hawaii

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set consists of land derived from high resolution imagery and was analyzed according to the Coastal Change Analysis Program (C-CAP) protocol to determine...

  8. Comet C/1917 F1 (Mellish) meteor shower complex

    Science.gov (United States)

    Hajdukova, M.; Neslusan, L.

    2014-07-01

    In this study, we mapped the whole meteor complex of the long-period comet C/1917 F1 (Mellish), using a procedure of proven reliability when investigating the 96P/Machholz and 2003 EH1 streams (Neslusan et al., 2013a; 2013b). For five perihelion passages of the comet C/1917 F1 in the past, we modeled associated theoretical streams, each consisting of 10000 test particles, and followed their dynamical evolution until the present. Subsequently, we analyzed the orbital characteristics of the parts of a stream that approach the Earth's orbit. These particles were used to predict the corresponding meteor showers. The predicted showers were searched for in the databases of actually observed meteors. According to our modeling, the meteoroid stream of the comet Mellish can be split into 4 filaments (F1 to F4), with 4 distinct radiant areas. The most numerous shower that originates in the comet nucleus of C/1917 F1 corresponds to theoretical filament F3. The meteoroids of this filament approach to the Earth's orbit relatively soon after their ejection from the nucleus. We identified this filament as the December Monocerotids (No. 19 in the IAU MDC list of the established showers). In the phase space of orbital elements, the shower occurs in the vicinity of another established shower, 250 November Orionids. However, shower No. 250 is obviously not related to C/1917 F1 since no single theoretical particle, in all five models, is in an orbit similar to the mean orbit of this shower. Filament F1 might be identified to 348 April rho-Cygnids, the meteoroid stream that was recently discovered by the Canadian Meteor Orbit Radar (Brown et al., 2010). In our models, this filament is numerous and, hence, the shower is well predicted. The particles of filament F1 and, therefore, the real April rho-Cygnids originating in C/1917 F1 can approach the Earth's orbit and collide with our planet not earlier than about 20 millennia after their release from the parent-comet nucleus. Despite this

  9. LHCb: F.E.C. for DAQ networks

    CERN Multimedia

    Floros, G; Neufeld, N

    2014-01-01

    The demand for faster and more reliable networks is growing day by day both in commercial and scientific applications, driving many innovations in network protocols, fiber optics and network-controllers. Operating fast links on relatively inexpensive hardware is a very important challenging aspect of this. One important way to enable this is to provide the network with an existing mechanism of error correction, called Forward Error Correction (F.E.C.). Although error-correcting codes exist for over six decades and F.E.C. is applied in various projects, it is still not widespread in Ethernet networks. F.E.C. introduces a very cost effective way to expand the limits of any network based on micro-controllers synthesized on FPGAs, but it is provided only for specific applications, such as backplane systems. Most of the FPGA and/or IP core vendors either do not provide this feature on their Ethernet implementations or their F.E.C. implementations are based on Ethernet micro-controllers that have a different struct...

  10. Psiloxylon mauritianum (Bouton ex Hook.f.) Baillon (Myrtaceae): A promising traditional medicinal plant from the Mascarene Islands.

    Science.gov (United States)

    Mahomoodally, Mohamad Fawzi; Korumtollee, Housna Nazifah; Chady, Zaynab Zaina Banu Khan

    2014-01-01

    Psiloxylon mauritianum (PM) (Bouton ex Hook.f.) Baillon (Myrtaceae) is an evergreen endemic medicinal plant which has shown promising uses in traditional medicine from the Mascarene Islands (Mauritius and Réunion Islands). Folk use of this endemic plant in Mauritius and Réunion Islands has been geared toward the treatment and management of amenorrhea, dysentery and Type II diabetes mellitus. Recent findings from in vitro studies have led to the discovery of two potent acids namely corosolic acid and asiatic acid which have been shown to bear most inhibitory activities against Staphylococcus aureus. Such findings tend to appraise the therapeutic potential of this medicinal plant against infectious diseases. The present monograph has tried to establish the botanical description, traditional uses and the main constituents identified from PM (Bouton ex Hook.f.) Baillon. The limited documentation of in vitro assays of this plant demonstrates an urgent need for extensive research in order to validate other traditional uses and hence open new avenues for drug development. PMID:26401372

  11. Hepatitis C Prevention and Needle Exchange Programs in Rhode Island: ENCORE.

    Science.gov (United States)

    Joseph, Raynald; Kofman, Aaron; Larney, Sarah; Fitzgerald, Paul

    2014-07-01

    As Rhode Island's only needle exchange program, ENCORE (Education, Needle Exchange, Counseling, Outreach, and REferrals) serves a wide range of clients infected or at risk for infection with hepatitis C virus (HCV). Through its on-site and outreach platforms across Rhode Island, ENCORE is in a unique position to serve at-risk individuals who may not otherwise present for prevention, testing and care for HCV, as well as human immunodeficiency virus (HIV). In this article, we discuss the role of needle exchange programs in preventing HCV transmission, and provide an overview of the history and current operations of ENCORE. PMID:24983019

  12. Epitaxy relationships between Ge-islands and SiC(0 0 0 1)

    International Nuclear Information System (INIS)

    Reflection high-energy electron diffraction (RHEED) has been used to determine epitaxy relationships and in-plane orientations between Ge and SiC(0 0 0 1). Three monolayers of Ge have been deposited at 500 deg. C on a graphitized SiC (6√3 x 6√3)R30 deg. reconstructed surface, this surface supporting epitaxial Ge island growth in a Volmer-Weber mode. Nucleation of relaxed Ge-islands gives rise to transmission electron diffraction patterns allowing to deduce that pure Ge grows according to only one epitaxy relationship Ge{1 1 1}//SiC(0 0 0 1). These {1 1 1}-Ge-islands have two in-plane orientations, a preferential one, Ge//SiC and a minority one, Ge//SiC, deduced one from the other by a 30 deg. rotation around the -Ge (or [0 0 0 1]-SiC) growth axis. Due to the three-fold symmetry of the {1 1 1}-Ge plane, each in-plane orientation is degenerated into two twin orientations, differing by a 180 deg. angle around Ge

  13. A Novel Topological Index F* and Its Correlation With Standard Formaton Enthalpies of ABn(g) Molecules

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The topological index F* is defined and obtained by the method of a non-dimensional unit calculation in which three matrices multiply with each other. These matrices represent the connective cases of atoms in a molecule, the structural features of atoms on top and the bonded cases of the adjacent atoms respectively. The standard formation enthalpies of ABn(g) molecules were correlated with F* (A= C, Al, Si, Ti, Zr, B =F, Cl, Br, I, H, n=1-4) and these correlation coefficients are all more than 0.96.Some molecules (e.g CH4, SiH4,etc.)can be preferably handled by F* but can not be dealt with by other topological indices.By contrast to traditional hydrogen suppressed graph,the contribution of hydrogen atoms to structures and properties of molecules is considered.

  14. SMART POWER TURBINE

    Energy Technology Data Exchange (ETDEWEB)

    Nirm V. Nirmalan

    2003-11-01

    remarkably high, that is a 1-2.5% change in ratio for an 11.1 C (20 F) change in temperature at flame temperatures between 1482.2 C (2700 F) and 1760 C (3200 F). Sensor ratio calibration was performed using flame temperatures determined by calculations using the amount of unburned oxygen in the exhaust and by the fuel/air ratio of the combustible gas mixture. The agreement between the results of these two methods was excellent. The sensor methods characterized are simple and viable. Experiments are underway to validate the GE Flame Temperature Sensor as a practical tool for use with multiburner gas turbine combustors. The lower heating value (LHV) Fuel Quality Sensor consists of a catalytic film deposited on the surface of a microhotplate. This micromachined design has low heat capacity and thermal conductivity, making it ideal for heating catalysts placed on its surface. Several methods of catalyst deposition were investigated, including micropen deposition and other proprietary methods, which permit precise and repeatable placement of the materials. The use of catalysts on the LHV sensor expands the limits of flammability (LoF) of combustion fuels as compared with conventional flames; an unoptimized LoF of 1-32% for natural gas (NG) in air was demonstrated with the microcombustor, whereas conventionally 4 to 16% is observed. The primary goal of this work was to measure the LHV of NG fuels. The secondary goal was to determine the relative quantities of the various components of NG mixes. This determination was made successfully by using an array of different catalysts operating at different temperatures. The combustion parameters for methane were shown to be dependent on whether Pt or Pd catalysts were used. In this project, significant effort was expended on making the LHV platform more robust by the addition of high-temperature stable materials, such as tantalum, and the use of passivation overcoats to protect the resistive heater/sensor materials from degradation in the

  15. Energy Self-Sufficient Island

    International Nuclear Information System (INIS)

    In order to analyze energy self-sufficient island, example of a smaller island, connected to the power system of a bigger island with an undersea cable, was taken. Mounting substation 10/0,4 is situated on the island and for the moment it provides enough electricity using the medium voltage line. It is assumed that the island is situated on the north part of the Adriatic Sea. The most important problem that occurs on the island is the population drop that occurs for a significant number of years, therefore, life standard needs to be improved, and economic development needs to be encouraged immediately. Local authorities to stimulate sustainable development on the island through different projects, to breath in a new life to the island, open new jobs and attract new people to come live there. Because of the planned development and increase of the population, energy projects, planned as a support to sustainable development, and later achievement of the energy self-sufficiency, is described in this paper. Therefore, Rewisland methodology appliance is described taking into the account three possible scenarios of energy development. Each scenario is calculated until year 2030. Also, what is taken into the account is 100% usage of renewable sources of energy in 2030. Scenario PTV, PP, EE - This scenario includes installation of solar photovoltaic modules and solar thermal collectors on the buildings roofs, as well as well as implementation of energy efficiency on the island (replacement of the street light bulbs with LED lightning, replacement of the old windows and doors on the houses, as well as the installation of the thermal insulation). Scenario PV island - This scenario, similarly to the previous one, includes installation of solar photovoltaic modules and solar thermal collectors an the residential buildings, as well as the 2 MW photovoltaic power plant and ''Green Hotel'', a building that satisfies all of its energy needs completely from renewable energy sources

  16. Stereotactic Comparison Study of 18F-Alfatide and 18F-FDG PET Imaging in an LLC Tumor-Bearing C57BL/6 Mouse Model

    Science.gov (United States)

    Wei, Yu-Chun; Gao, Yongsheng; Zhang, Jianbo; Fu, Zheng; Zheng, Jinsong; Liu, Ning; Hu, Xudong; Hou, Wenhong; Yu, Jinming; Yuan, Shuanghu

    2016-01-01

    This study aimed to stereotactically compare the PET imaging performance of 18F-Alfatide (18F-ALF-NOTA-PRGD2, denoted as 18F-Alfatide) and 18F-fluorodeoxyglucose (FDG) and immunohistochemistry (IHC) staining in Lewis lung carcinoma (LLC) tumor-bearing C57BL/6 mouse model. 18F-FDG standard uptake values (SUVs) were higher than 18F-Alfatide SUVs in tumors, most of the normal tissues and organs except for the bladder. Tumor-to-brain, tumor-to-lung, and tumor-to-heart ratios of 18F-Alfatide PET were significantly higher than those of 18F-FDG PET (P SUV and GLUT-1 (R = 0.895, P SUV and αvβ3 (R = 0.595, P = 0.019), 18F-FDG SUV and 18F-Alfatide SUV (R = 0.917, P < 0.001), and GLUT-1 and αvβ3 (R = 0.637, P = 0.011). Therefore, 18F-Alfatide PET may be an effective tracer for tumor detection, spatial heterogeneity imaging and an alternative supplement to 18F-FDG PET, particularly for patients with enhanced characteristics in the brain, chest tumors or diabetes, meriting further study. PMID:27350554

  17. Stereotactic Comparison Study of (18)F-Alfatide and (18)F-FDG PET Imaging in an LLC Tumor-Bearing C57BL/6 Mouse Model.

    Science.gov (United States)

    Wei, Yu-Chun; Gao, Yongsheng; Zhang, Jianbo; Fu, Zheng; Zheng, Jinsong; Liu, Ning; Hu, Xudong; Hou, Wenhong; Yu, Jinming; Yuan, Shuanghu

    2016-01-01

    This study aimed to stereotactically compare the PET imaging performance of (18)F-Alfatide ((18)F-ALF-NOTA-PRGD2, denoted as (18)F-Alfatide) and (18)F-fluorodeoxyglucose (FDG) and immunohistochemistry (IHC) staining in Lewis lung carcinoma (LLC) tumor-bearing C57BL/6 mouse model. (18)F-FDG standard uptake values (SUVs) were higher than (18)F-Alfatide SUVs in tumors, most of the normal tissues and organs except for the bladder. Tumor-to-brain, tumor-to-lung, and tumor-to-heart ratios of (18)F-Alfatide PET were significantly higher than those of (18)F-FDG PET (P SUV and GLUT-1 (R = 0.895, P SUV and αvβ3 (R = 0.595, P = 0.019), (18)F-FDG SUV and (18)F-Alfatide SUV (R = 0.917, P < 0.001), and GLUT-1 and αvβ3 (R = 0.637, P = 0.011). Therefore, (18)F-Alfatide PET may be an effective tracer for tumor detection, spatial heterogeneity imaging and an alternative supplement to (18)F-FDG PET, particularly for patients with enhanced characteristics in the brain, chest tumors or diabetes, meriting further study. PMID:27350554

  18. Development of standardized air-blown coal gasifier/gas turbine concepts for future electric power systems

    Energy Technology Data Exchange (ETDEWEB)

    Blough, E.; Russell, W.; Leach, J.W.

    1990-08-01

    Computer models have been developed for evaluating conceptual designs of integrated coal gasification combined cycle power plants. An overall system model was developed for performing thermodynamic cycle analyses, and detailed models were developed for predicting performance characteristics of fixed bed coal gasifiers and hot gas clean up subsystem components. The overall system model performs mass and energy balances and does chemical equilibrium analyses to determine the effects of changes in operating conditions, or to evaluate proposed design changes. An existing plug flow model for fixed bed gasifiers known as the Wen II model was revised and updated. Also, a spread sheet model of zinc ferrite sulfur sorbent regeneration subsystem was developed. Parametric analyses were performed to determine how performance depends on variables in the system design. The work was done to support CRS Sirrine Incorporated in their study of standardized air blown coal gasifier gas turbine concepts.

  19. Electronic excitation of C4F6 isomers by electron impact

    International Nuclear Information System (INIS)

    We have measured electronic excitation differential cross sections for C4F6 molecules isomers by electron impact. In the case of hexafluoro-1,3-butadiene we observed an optical forbidden transition at around 5 eV. The spectra of the three C4F6 isomers show the most intense band clearly shifted to lower energies when going from 2-C4F6, to c-C4F6 and to 1,3-C4F6.

  20. δ13C and 14C dating of sediments in Santa Cruz do Arari, Marajo Island (Brazil)

    International Nuclear Information System (INIS)

    The eastern domain of Marajo Island, in the surroundings of Santa Cruz do Arari (Para State), is occupied by holocenic sedimentary deposits, at present covered predominantly by natural grasslands. The analysis of stable carbon isotopes in organic matter of these sediments has been applied with the objective of to evaluate the paleovegetation dynamics, the retreat or the expansion of the Amazonian Forest (located in the westerner domain) over the different types of natural grasslands in Marajo Island, during Late Quaternary. From 3.60 m to 1.80 m the δ13C results are around -25 (reaching value up to -29 per mille) and indicate that the organic matter of these sediments are originated from C3 plants. In the interval of 1.80 m until 0.90 m all the samples present a gradual enrichment of 13C, indicating a higher influence of C4 plants in the vegetation cover. The intermediate δ13C values found in those depths (from -22 per mille to -18 per mille) indicate a mixture of C3 and C4 plants with gradual increase of areas with C4 plants. From 0.90 m to the shallow layer the δ13C values show a tendency to more depleted values, indicating higher influence of C3 plants in the recent and present period. The results demonstrate that the vegetation dynamics was significant in the Marajo Island from the past to the present. The chronology of these events is being determined by the 14C dating technique and possible causes (climatic, anthropogenic and/or neotectonic) for such changes investigate. (author)

  1. Small wind turbines

    CERN Document Server

    Wood, David

    2011-01-01

    Small Wind Turbines provides a thorough grounding in analysing, designing, building, and installing a small wind turbine. Small turbines are introduced by emphasising their differences from large ones and nearly all the analysis and design examples refer to small turbines.The accompanying software includes MATLAB(R) programs for power production and starting performance, as well as programs for detailed multi-objective optimisation of blade design. A spreadsheet is also given to help readers apply the simple load model of the IEC standard for small wind turbine safety. Small Wind Turbines repr

  2. F2OAS: Towards a Standard Framework to Organizing Software Architectural Styles

    Directory of Open Access Journals (Sweden)

    GholamAli

    2012-02-01

    Full Text Available The selection or development of software architectural style is one of the most important issues in the software architecture. The number and variety of architectural styles are rising. There is not any proper and standard classification to organizing software architectural styles.In this paper, a standard organization (F2OAS to all software architectural styles has been provided. To obtain this aim, all previous classifications and categories for architectural styles have been collected. Then by analysis of existing approaches, all different aspect of a standard organization has been investigated. Finally a new process model to developing a standard organization has been provided.F2OSA can help software architects to develop very powerful and robust architectures and the process of developing software architecture be done in less time. F2OAS can be used in software product line architecture or any intelligence and automatic software architecture projects.

  3. Transfer and quenching rate constants for XeF(B) and XeF(C) state in low vibrational levels

    Science.gov (United States)

    Brashears, H. C., Jr.; Setser, D. W.

    1982-05-01

    The relative XeF(B-X) and XeF(C-A) emission intensities from the steady-state vacuum ultraviolet photolysis of XeF2 have been used to measure the B-C transfer and quenching rate constants of XeF molecules in low vibrational levels. The rare gases N2, CF4, SF6, F2, NF3, CF3H, CF3Cl, HF, CO2, and XeF2 were investigated as buffer gases at room temperature. The transfer rate constants are much larger than the quenching rate constants for He, Ne, Ar, Kr, N2, CF4, and SF6. For Xe, NF3, CHF3, and CClF3 transfer is only 2-4 times faster than quenching and for F2, HF, and CO2 quenching is faster than B-C state transfer. Quenching for XeF(D) was studied for rare gases and for N2. No convincing evidence was found for three-body quenching by the rare gases and their quenching of the XeF(B, C) and XeF(D) states are reported as two-body processes for pressures below ˜5 atm. The XeF(D) quenching rate constants are of the same magnitude as the B-C state transfer rate constants. The photochemical and collisional (metastable rare gas atom) dissociative excitation of XeF2 and KrF2 are summarized in the Appendix.

  4. Environmental and Mechanical Stability of Environmental Barrier Coated SA Tyrannohex SiC Composites Under Simulated Turbine Engine Environments

    Science.gov (United States)

    Zhu, Dongming; Halbig, Michael Charles; Sing, Mrityunjay

    2014-01-01

    The environmental stability and thermal gradient cyclic durability performance of SA Tyrannohex composites were investigated for turbine engine component applications. The work has been focused on investigating the combustion rig recession, cyclic thermal stress resistance and thermomechanical low cycle fatigue of uncoated and environmental barrier coated Tyrannohex SiC SA composites in simulated turbine engine combustion water vapor, thermal gradients, and mechanical loading conditions. Flexural strength degradations have been evaluated, and the upper limits of operating temperature conditions for the SA composite material systems are discussed based on the experimental results.

  5. Partial discharges and breakdown in C3F8

    International Nuclear Information System (INIS)

    Traditional search processes of gases or gas mixtures for replacing SF6 involve time consuming measurements of partial discharges and breakdown behaviour for several voltage waveforms and different field configurations. Recently a model for prediction of this behaviour for SF6 was described in literature. The model only requires basic properties of the gas such as the critical field strength and the effective ionization coefficient, which can be obtained by swarm parameter measurements, and thermodynamic properties, which can be calculated. In this paper, we show for the well-known and electronegative gas octafluoropropane (C3F8) that it is possible to transfer the model developed for SF6 to this gas to describe the breakdown behaviour of C3F8. Thus the model can be beneficial in the screening process of new insulation gases. (paper)

  6. Defective fluid secretion from submucosal glands of nasal turbinates from CFTR-/- and CFTR (ΔF508/ΔF508 pigs.

    Directory of Open Access Journals (Sweden)

    Hyung-Ju Cho

    Full Text Available BACKGROUND: Cystic fibrosis (CF, caused by reduced CFTR function, includes severe sinonasal disease which may predispose to lung disease. Newly developed CF pigs provide models to study the onset of CF pathophysiology. We asked if glands from pig nasal turbinates have secretory responses similar to those of tracheal glands and if CF nasal glands show reduced fluid secretion. METHODOLOGY/PRINCIPAL FINDINGS: Unexpectedly, we found that nasal glands differed from tracheal glands in five ways, being smaller, more numerous (density per airway surface area, more sensitive to carbachol, more sensitive to forskolin, and nonresponsive to Substance P (a potent agonist for pig tracheal glands. Nasal gland fluid secretion from newborn piglets (12 CF and 12 controls in response to agonists was measured using digital imaging of mucus bubbles formed under oil. Secretion rates were significantly reduced in all conditions tested. Fluid secretory rates (Controls vs. CF, in pl/min/gland were as follows: 3 µM forskolin: 9.2±2.2 vs. 0.6±0.3; 1 µM carbachol: 143.5±35.5 vs. 52.2±10.3; 3 µM forskolin + 0.1 µM carbachol: 25.8±5.8 vs. CF 4.5±0.9. We also compared CF(ΔF508/ΔF508 with CFTR(-/- piglets and found significantly greater forskolin-stimulated secretion rates in the ΔF508 vs. the null piglets (1.4±0.8, n = 4 vs. 0.2±0.1, n = 7. An unexpected age effect was also discovered: the ratio of secretion to 3 µM forskolin vs. 1 µM carbachol was ∼4 times greater in adult than in neonatal nasal glands. CONCLUSIONS/SIGNIFICANCE: These findings reveal differences between nasal and tracheal glands, show defective fluid secretion in nasal glands of CF pigs, reveal some spared function in the ΔF508 vs. null piglets, and show unexpected age-dependent differences. Reduced nasal gland fluid secretion may predispose to sinonasal and lung infections.

  7. Using DNA Barcoding and Standardized Sampling to Compare Geographic and Habitat Differentiation of Crustaceans: A Hawaiian Islands Example

    Directory of Open Access Journals (Sweden)

    M. Julian Caley

    2011-09-01

    Full Text Available Recently, the Census of Marine Life has explored methods to assess coral reef diversity by combining standardized sampling (to permit comparison across sites with molecular techniques (to make rapid counts of species possible. To date, this approach has been applied across geographically broad scales (seven sites spanning the Indian, Pacific and Atlantic Oceans, focusing on similar habitats at all sites (10–12 m forereef. Here we examine crustacean spatial diversity patterns for a single atoll, comparing results for four sites (comprising forereef, backreef, and lagoon habitats at French Frigate Shoals (FFS, Northwestern Hawaiian Islands, Hawaii, USA, within the Papahanaumokuakea Marine National Monument. The Bray-Curtis index of similarity across these habitats at FFS was the same or greater than the similarity between similar habitats on Heron Island and Lizard Island in the Great Barrier Reef and much greater than similarity between more widely separated localities in the Indo-Pacific Ocean (e.g., Ningaloo, Moorea, French Polynesia or the Line Islands. These results imply that, at least for shallow reefs, sampling multiple locations versus sampling multiple habitats within a site maximizes the rate at which we can converge on the best global estimate of coral reef biodiversity.

  8. Comparative study of global warming effects during silicon nitride etching using C3F6O/O2 and C3F6/O2 gas mixtures

    Science.gov (United States)

    Kim, Ka Youn; Moon, Hock Key; Lee, Nae-Eung; Hong, Bo Han; Oh, Soo Ho

    2015-01-01

    C3F6 and C3F6 gases were investigated as replacement gases for SF6 used in display industry due to their low global warming potential and short lifetime. In the C3F6/O2 and C3F6/O2 capacitively coupled plasmas, Si3N4 etch conditions were varied by controlling process parameters. The global warming effects were quantified as million metric ton carbon equivalents (MMTCEs) obtained from the volumetric emission of by-product and etch gases. A lower MMTCE value and higher etch rate process with combination of high and low source frequencies, f HF (27.12 MHz)/ f LF (2 MHz), were observed for the C3F6/O2 chemistry than for the C3F6/O2 chemistry.

  9. On the spectrum of QCD(1+1) with large numbers of flavours N_F and colours N_C near N_F/N_C = 0

    CERN Document Server

    Engelhardt, M

    2001-01-01

    QCD(1+1) in the limit of a large number of flavours N_F and a large number of colours N_C is examined in the small N_F/N_C regime. Using perturbation theory in N_F/N_C, stringent results for the leading behaviour of the spectrum departing from N_F/N_C = 0 are obtained. These results provide benchmarks in the light of which previous truncated treatments of QCD(1+1) at large N_F and N_C are critically reconsidered.

  10. Copper Causes Regiospecific Formation of C4F8-Containing Six-Membered Rings and their Defluorination/Aromatization to C4F4-Containing Rings in Triphenylene/1,4-C4F8I2 Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Rippy, Kerry C.; Bukovsky, Eric V.; Clikeman, Tyler T.; Chen, Yu-Sheng; Hou, Gao-Lei; Wang, Xue B.; Popov, Alexey; Boltalina, Olga V.; Strauss, Steven H.

    2016-01-18

    The presence of Cu in reactions of triphenylene (TRPH) and 1,4-C4F8I2 at 360 °C led to regiospecific substitution of TRPH ortho C(β) atoms to form C4F8-containing rings, completely suppressing substitution on C(α) atoms. In addition, Cu caused selective reductive-defluorination/aromatization (RD/A) to form C4F4- containing aromatic rings. Without Cu, the reactions of TRPH and 1,4- C4F8I2 were not regiospecific and no RD/A was observed. These results, supported by DFT calculations, are the first examples of Cupromoted (i) regiospecific perfluoroannulation, (ii) preparative C–F activation, and (iii) RD/A. HPLC-purified products were characterized by X-ray diffraction, low-temperature PES, and 1H/19F NMR.

  11. C-H bond activation by f-block complexes.

    Science.gov (United States)

    Arnold, Polly L; McMullon, Max W; Rieb, Julia; Kühn, Fritz E

    2015-01-01

    Most homogeneous catalysis relies on the design of metal complexes to trap and convert substrates or small molecules to value-added products. Organometallic lanthanide compounds first gave a tantalizing glimpse of their potential for catalytic C-H bond transformations with the selective cleavage of one C-H bond in methane by bis(permethylcyclopentadienyl)lanthanide methyl [(η(5) -C5 Me5 )2 Ln(CH3 )] complexes some 25 years ago. Since then, numerous metal complexes from across the periodic table have been shown to selectively activate hydrocarbon C-H bonds, but the challenges of closing catalytic cycles still remain; many f-block complexes show great potential in this important area of chemistry. PMID:25384554

  12. Influence of management practices on C stabilization pathways in agricultural volcanic ash soils (Canary Islands, Spain)

    Science.gov (United States)

    Hernandez, Zulimar; María Álvarez, Ana; Carral, Pilar; de Figueiredo, Tomas; Almendros, Gonzalo

    2014-05-01

    Although C stabilization mechanisms in agricultural soils are still controversial [1], a series of overlapped pathways has been suggested [2] such as: i) insolubilization of low molecular weight precursors of soil organic matter (SOM) with reactive minerals through physical and chemical bonding, ii) selective accumulation of biosynthetic substances which are recalcitrant because of its inherent chemical composition, and iii) preservation and furter diagenetic transformation of particulate SOM entrapped within resistant microaggregates, where diffusion of soil enzymes is largely hampered. In some environments where carbohydrate and N compounds are not readily biodegraded, e.g., with water saturated micropores, an ill-known C stabilization pathway may involve the formation of Maillard's reaction products [3]. In all cases, these pathways converge in the formation of recalcitrant macromolecular substances, sharing several properties with the humic acid (HA) fraction [4]. In template forests, the selective preservation and further microbial reworking of plant biomass has been identified as a prevailing mechanism in the accumulation of recalcitrant SOM forms [5]. However, in volcanic ash soils with intense organomineral interactions, condensation reactions of low molecular weight precursors with short-range minerals may be the main mechanism [6]. In order to shed some light about the effect of agricultural management on soil C stabilization processes on volcanic ash soils, the chemical composition of HA and some structural proxies of SOM informing on its origin and potential resistance to biodegradation, were examined in 30 soils from Canary Islands (Spain) by visible, infrared (IR) and 13C nuclear magnetic resonance (NMR) spectroscopies, elementary analysis and pyrolytic techniques. The results of multivariate treatments, suggested at least three simultaneous C stabilization biogeochemical trends: i) diagenetic alteration of plant biomacromolecules in soils receiving

  13. The Discussion on the C-Ash of f-CaO Content Exceeding Standard in Concrete Construction%关于《f-CaO含量超标的C类灰在混凝土结构中的应用》一文的讨论

    Institute of Scientific and Technical Information of China (English)

    龚逸明; 赵一奇

    2008-01-01

    C类粉煤灰中的f-CaO数量、结构、矿物组成种类及熔剂矿物的包裹程度等诸多方面差异很大,产品中的f-CaO在性能上也有很大不同.增钙粉煤灰中的f-CaO具有多孔结构,粒级细小,熔剂矿物极少包裹.因此水化反应快,很易消解.在工程中应用不影响体积安定性,而且具有自凝、自硬性,需水比小,比强度高等优良性能特征,使用效果好、经济效益显著、性价比高,具有广泛使用价值.

  14. Investigation of dielectric properties of cold C3F8 mixtures and hot C3F8 gas as Substitutes for SF6

    Science.gov (United States)

    Wang, Xiaohua; Zhong, Linlin; Yan, Jing; Yang, Aijun; Han, Guohui; Han, Guiquan; Wu, Yi; Rong, Mingzhe

    2015-10-01

    In order to reduce the global warming potential resulting from SF6 widely used as an insulating and arc quenching medium, the substitutes need to be found. This paper focuses on different cold C3F8 mixtures (at room temperature) as an insulating gas and hot C3F8 gas (at temperatures of 300-3500 K) as an arc quenching medium, which seem to be a good replacement of SF6. Firstly, the dielectric properties, including the reduced ionization coefficient α / N, reduced electron attachment coefficient η / N and reduced critical electric field strength ( E / N)cr, of the cold C3F8-CF4, C3F8-CO2, C3F8-N2, C3F8-O2 and C3F8-Ar mixtures are calculated numerically using the two-term approximation of the Boltzmann equation. The dependence of such dielectric properties on the buffer gas proportion is investigated. Among the various C3F8 mixtures, the C3F8-N2 mixture has the lowest α / N and the C3F8-CF4 mixture has the largest η / N, and moreover, the C3F8-N2 mixture is the best insulator in terms of breakdown strength because it has the largest ( E / N)cr. Secondly, the ( E / N)cr of hot C3F8 at temperatures up to 3500 K and various pressures is determined and compared with that of hot SF6 gas. It is found that the hot C3F8 gas has much poorer dielectric performance than hot SF6 because the ( E / N)cr of C3F8 decreases significantly above room temperature.

  15. The low temperature magnetic properties of ytterbium in f.c.c. phase

    International Nuclear Information System (INIS)

    The nuclear orientation results obtained under pressure for 3d impurities dissolved in the f.c.c. Ytterbium are compared with magnetization and de Haas Van Alphen experiments performed on the matrix. Open questions are the description of the 3d impurities at the metal semiconductor transition and the origin of the magnetic carriers of the matrix

  16. Mineralization rate of eroded organic C in Andosols of the Canary Islands.

    Science.gov (United States)

    Mora, Juan Luis; Guerra, José Asterio; Armas, Cecilia María; Rodríguez-Rodríguez, Antonio; Arbelo, Carmen Dolores; Notario, Jesús Santiago

    2007-05-25

    The aim of this paper is to determine the biological dynamism of the organic C forms bonded to soil particles mobilized by water erosion in Andosols of the Canary Islands, to evaluate their susceptibility towards mineralization processes and the role of sediments as sources or sinks of atmospheric CO(2) in these soils. The study was carried out in Tenerife (Canary Islands) on three 200 m(2) experimental plots of the RESEL Programme on silic Andosols under forest, 3 years after being subjected to clear-cutting. Eroded sediments were collected for analysis from five significant winter rainfall episodes. For each event, samples of surface (0-5 cm) soil in situ were also collected. CO(2)-C was measured by incubation in all the samples, as well as microbial biomass-linked C. The results obtained show an enrichment in the eroded sediments of microbial biomass (7.5+/-1.6 g kg(-1) vs. 3.8+/-1.5 g kg(-1)) and of potentially mineralizable C (1419 mg CO(2)-C kg(-1) vs. 386 mg CO(2)-C kg(-1)). In addition, there was twice as much mineralization of C compounds in eroded sediments as in the soil surface horizon. PMID:17292946

  17. 78 FR 63017 - Exhaust Emissions Standards for New Aircraft Gas Turbine Engines and Identification Plate for...

    Science.gov (United States)

    2013-10-23

    ... engines with rated thrusts greater than 26.7 kilonewtons (kN) (76 FR 45012). The EPA also proposed...). The final rule adopting these proposals was published on June 18, 2012 (77 FR 36342), and was... (77 FR 76842) adopting the EPA's new emissions standards in part 34. Although the EPA's NPRM...

  18. Adsorption and evolution behavior of 4C1Si island configurations on diamond (0 0 1) surface: A first principle study

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xuejie, E-mail: xuejieliu2000@yahoo.com [School of Mechanical Engineering, Inner Mongolia University of Science and Technology, Baotou 014010 (China); Gengdan Institute of Beijing University of Technology, Beijing 101301 (China); Yin, Yongjie; Ren, Yuan; Wei, Huai [School of Mechanical Engineering, Inner Mongolia University of Science and Technology, Baotou 014010 (China)

    2015-01-05

    Highlights: • We investigate the adsorption energy of C-by-3C1Si islands on diamond (0 0 1) surface. • The adsorption energy of Si-by-4C island configurations was calculated by DFT. • The evolution manner from C5-by-3C1Si to Si3-by-4C island were calculated by NEB. - Abstract: The adsorption energy of the 4C1Si island configurations and the diffusion activation energies of carbon and silicon atoms on diamond (0 0 1) surface were calculated with first principle method based on density functional theory (DFT) to study the growth of diamond films and the growth position of silicon particles after they are mixed into the composite film. The 4C1Si island configurations consist of five types of C-by-3C1Si configurations and four types of Si-by-4C configurations. The adsorption energy and total energy of the 4C1Si island configurations were calculated firstly. In addition, the diffusion activation energies of the carbon and silicon atoms were calculated. The results show that: (1) the adsorption energy of the Si-by-4C island configurations is higher than that of the C-by-3C1Si island configurations. This indicates that it is not easy for silicon atoms to remain stable in the 3C1Si island. In contrast, silicon atoms are easy to move out of the island so that the carbon atoms out of the 3C1Si Island can enter the island to form the 4C island; (2) Compared with the carbon atom, silicon atom needs lower diffusion activation energy to move into or out of the island. This shows that silicon atoms are more active than carbon atoms. Thus, it is easier for silicon particles to fill the vacancy defects in diamond/Si films, improving the compactness of the diamond composite films.

  19. 25 CFR 542.42 - What are the minimum internal control standards for internal audit for Tier C gaming operations?

    Science.gov (United States)

    2010-04-01

    ... documented and retained for five years. (f) Role of management. (1) Internal audit findings shall be reported... internal audit for Tier C gaming operations? 542.42 Section 542.42 Indians NATIONAL INDIAN GAMING... the minimum internal control standards for internal audit for Tier C gaming operations? (a)...

  20. Standard terminology of C26.10 nondestructive assay methods

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 The terminology defined in this document is associated with nondestructive assay of nuclear material. 1.2 All of the definitions are associated with measurement techniques that measure nuclear emissions (that is, neutrons, gamma-rays, or heat) directly or indirectly. 1.3 definitions are relevant to any standards and guides written by subcommittee C26.10.

  1. Die Künstlerin als Produzentin – Johanna Braun im Gespräch

    Directory of Open Access Journals (Sweden)

    Johanna Braun

    2014-03-01

    Full Text Available Die Wiener Künstlerin Johanna Braun ist eine der prononciertesten Vertreterinnen eigenaktiver, kuratorischer Tätigkeit der künstlerisch Schaffenden. Mit zahlreichen internationalen Projekten hat sie die Richtigkeit ihrer Haltung immer wieder bewiesen – und sich dabei nicht selten an den ihr fragwürdig vorkommenden Konventionen kuratorischen Selbstverständnisses kritisch abgearbeitet. – Freimütig und provokant hat sie auf Fragen des MEDIENIMPULSE-Redakteurs Thomas Ballhausen geantwortet.

  2. ERCP for patients who have undergone Billroth II gastroenterostomy and Braun anastomosis

    OpenAIRE

    Wu, Wen-Guang; Gu, Jun; Zhang, Wen-Jie; Zhao, Ming-Ning; Zhuang, Ming; Tao, Yi-Jing; Liu, Ying-Bin; Xue-feng WANG

    2014-01-01

    Endoscopic retrograde cholangiopancreatography (ERCP) is efficacious in patients who have undergone Billroth II gastroenterostomies, but the success rate decreases in patients who also have experienced Braun anastomoses. There are currently no reports describing the preferred enterography route for cannulation in these patients. We first review the patient’s previous surgery records, which most often indicate that the efferent loop is at the greater curvature of the stomach. We recommend exte...

  3. Floral and Seed Variability Patterns among Ethiopian Mustard (B. carinata A. Braun) of East Africa

    OpenAIRE

    Adeniji, OT.; A. Aloyce, A.

    2012-01-01

    In East Africa, Ethiopian mustard (Brassica carinata A. Braun) is cultivated primarily for its leaves, but in Ethiopia preference is high for oil in the seed. Dual purpose importance of the seeds for planting and for oil suggests the need to improve seed production efficiency through understanding variation pattern for floral morphology and seed characters. We investigated genetic diversity and correlations for floral and seed characteristics among 14 accessions of Ethiopian mustard to improv...

  4. Dr. von Braun and Dr. Stuhlinger With a Model of the Nuclear-Electric Vehicles

    Science.gov (United States)

    2004-01-01

    In this photo, taken at the Walt Disney Studios in California, Dr. Wernher von Braun and Dr. Ernst Stuhlinger are shown discussing the concepts of nuclear-electric spaceships designed to undertake the mission to the planet Mars. As a part of the Disney 'Tomorrowland' series on the exploration of space, the nuclear-electric vehicles were shown in the last three television films, entitled 'Mars and Beyond,' which first aired in December 1957.

  5. 42 CFR Appendix F to Part 75 - Standards for Licensing Radiographers, Nuclear Medicine Technologists, and Radiation Therapy...

    Science.gov (United States)

    2010-10-01

    ... Medicine Technologists, and Radiation Therapy Technologists F Appendix F to Part 75 Public Health PUBLIC..., App. F Appendix F to Part 75—Standards for Licensing Radiographers, Nuclear Medicine Technologists... licensed as Radiographers, Nuclear Medicine Technologists, or Radiation Therapy Technologists. 2....

  6. PROGRAMSKI JEZIK F# IN NJEGOVA INTEGRACIJA V OKOLJE C#

    OpenAIRE

    Žalik, David

    2010-01-01

    V tej diplomski nalogi bomo predstavil ključne gradnike funkcijskega jezika F# in s pomočjo prenašanja podatkov v sorodno (.NET) C# okolje grafično obdelali in prikazali rezultate raziskovanja. Poudarek prenašanja podatkov bo predvsem na kreiranju standardnih podatkovnih tipov družine .NET jezikov. Predstavili bomo tudi različne pristope programiranja in s pomočjo algoritmov skušali približati razumevanje delovanje funkcijskega jezika. Za grajenje aplikacij smo uporabili Microsoftovo orodje V...

  7. Carbon and oxygen isotope working standards from C3 and C4 photosynthates.

    Science.gov (United States)

    Spangenberg, Jorge E

    2006-09-01

    A preparation of organic working standards for the online measurement of 13C/12C and 18O/16O ratios in biological material is presented. The organic working standards are simple and inexpensive C3 and C4 carbohydrates (sugars or cellulose) from distinct geographic origin, including white sugar, toilet and XEROX papers from Switzerland, maize from Ivory Coast, cane sugar from Brazil, papyrus from Egypt, and the core of the stem of a Cyperus papyrus plant from Kenya. These photosynthetic products were compared with International Atomic Energy standards CH-3 and CH-6 and other calibration materials. The presented working standards cover a 15% range of 13C/12C ratios and 9% for 18O/16O, with a precision10. PMID:16870558

  8. Long-term tropospheric trend of octafluorocyclobutane (c-C4F8 or PFC-318

    Directory of Open Access Journals (Sweden)

    T. Röckmann

    2011-07-01

    Full Text Available Air samples collected at Cape Grim, Tasmania between 1978 and 2008 and during a series of more recent aircraft sampling programmes have been analysed to determine the atmospheric abundance and trend of octafluorocyclobutane (-C4F8 or PFC-318. c-C4F8 has an atmospheric lifetime in excess of 3000 yr and a global warming potential (GWP of 10 300 (100 yr time horizon, making it one of the most potent greenhouse gases detected in the atmosphere to date. The abundance of c-C4F8 in the Southern Hemisphere has risen from 0.35 ppt in 1978 to 1.2 ppt in 2010, and is currently increasing at a rate of around 0.03 ppt yr−1. It is the third most abundant perfluorocarbon (PFC in the present day atmosphere, behind CF4 (~75 ppt and C2F6 (~4 ppt. The origin of c-C4F8 is unclear. Using a 2-D global model to derive top-down global emissions based on the Cape Grim measurements yields a recent (2007 emission rate of around 1.1 Gg yr−1 and a cumulative emission up to and including 2007 of 38.1 Gg. Emissions reported on the EDGAR emissions database for the period 1986–2005 represent less than 1 % of the top-down emissions for the same period, which suggests there is a large unaccounted for source of this compound. It is also apparent that the magnitude of this source has varied considerably over the past 30 yr, declining sharply in the late 1980s before increasing again in the mid-1990s.

  9. On the reliability of Fusarium oxysporum f. sp. niveum research: Do we need standardized testing methods?

    Science.gov (United States)

    Fusarium oxysporum f. sp. nivium (Fon) is a pathogen highly variable in aggressiveness that requires a standardized testing method to more accurately define isolate aggressiveness (races) and to identify resistant watermelon lines. Isolates of Fon vary in aggressiveness from weakly to highly aggres...

  10. NODC Standard Format Marine Mammals of Coastal Alaska Data (1979-1991): Sighting and Census (F127) (NODC Accession 0014197)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC maintains data in three NODC Standard Format Marine Mammal Data Sets: Marine Mammal Sighting and Census (F127); Marine Mammal Specimens (F025); Marine Mammal...

  11. NODC Standard Format Marine Mammals of Coastal Alaska Data (1975-1981): Marine Mammal Specimens (F025) (NODC Accession 0014150)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC maintains data in three NODC Standard Format Marine Mammal Data Sets: Marine Mammal Sighting and Census (F127); Marine Mammal Specimens (F025); Marine Mammal...

  12. Shock wave study of the thermal dissociations of C3F6 and c-C3F6. I. dissociation of hexafluoropropene.

    Science.gov (United States)

    Cobos, C J; Sölter, L; Tellbach, E; Troe, J

    2014-07-10

    The thermal dissociation of C3F6 was studied between 1330 and 2210 K in shock waves monitoring the UV absorption of CF2. CF2 yields of about 2.6 per parent C3F6 were obtained at reactant concentrations of 500-1000 ppm in the bath gas Ar. These yields dropped to about 1.8 when reactant concentrations were lowered to 60 ppm. The increase of the CF2 yield with increasing concentration was attributed to bimolecular reactions between primary and secondary dissociation products. Quantum-chemical and kinetic modeling calculations helped to estimate the contributions from the various primary dissociation steps. It was shown that the measurements correspond to unimolecular reactions in their falloff range. Falloff representations of the rate constants are given, leading to an overall high pressure rate constant k∞ = 2.0 × 10(17)(-104 kcal mol(-1)/RT) s(-1) and a relative rate of about 2/3:1/3 for the reactions C3F6 → CF3CF + CF2 versus C3F6 → C2F3 + CF3. PMID:24905383

  13. Development of a Primary Standard for Calibration of [18F]FDG Activity Measurement Systems

    International Nuclear Information System (INIS)

    The 18F national primary standard was developed by the INMRI-ENEA using the 4πβ Liquid Scintillation Spectrometry Method with 3H-Standard Efficiency Tracing. Measurements were performed at JRCIspra under a scientific collaboration between the Institute for Health and Consumer Production, the Amersham Health and the National Institute for Occupational Safety and Prevention (ISPESL). The goal of the work was to calibrate, with minimum uncertainty, the INMRI-ENEA transfer standard portable well-type ionisation chamber as well as other JRC-Ispra and Amersham Health reference Ionising Chambers used for FDG activity measurement

  14. Standardized Elemental Basis for Gas-Turbine Engine Heat Exchangers is the Key Factor for Their Cost Reduction

    Institute of Scientific and Technical Information of China (English)

    Soudarev A.V; Soudarev B.V; Kondratiev V.V; Lazarev M.V

    2001-01-01

    The competitiveness of the small gas turbine units (GTUs) (Ne<300 kW) in the world power market is dependent on both the maintenance expenses and the capital costs of production. Reduction in the maintenance expenditures could be achieved by increasing the plant efficiency. This task could be solved by some methods: increasing the cycle inlet temperature TIT, getting the cycle more complex (use of heat regeneration and compressed air intermediate cooling), cutting the power consumption on heat-stressed parts cooling. Putting the above into effect is linked with introduction of novel structural materials, a sharp increase in the mass-size values and the plant manufacture expenditures, in particular, at provision of its self-regulation.In connection with the above, the development of the combined metal-ceramic airheaters and standardization of the elemental basis of the metal gas-gas heat exchangers will promote reduction in the expenditures of the maintenance and the manufacture of the small-size independent power GTEs.

  15. April ρ Cygnids and comet C/1917 F1 Mellish

    Science.gov (United States)

    Hajdukova, Maria; Rudawska, Regina; Kornos, Leonard; Toth, Juraj

    2015-12-01

    We have examined the recently-established April ρ Cygnids meteor shower (ARC, IAU#348). The ARC was discovered by the Canadian Meteor Orbit Radar survey (Brown et al., 2010), and later confirmed by video observations made by the Cameras for Allsky Meteor Surveillance project in America (Phillips et al., 2011). As reported by Neslusan and Hajdukova (2014c), the shower could be part of a broader meteor-shower complex associated with the comet C/1917 F1 (Mellish). According to their model of the meteoroid stream originating from the comet, one of the filaments (F1) approximately corresponds to the ARC. The present study is based on an analysis of the orbital parameters of the ARC from the EDMOND (Kornos et al., 2014a), CAMS (Phillips et al., 2011), and SonotaCo (SonotaCo, 2009) databases. We followed dynamical evolutions of simulated meteoroid streams modeled from observational data. We found that the April ρ Cygnids may consist of both short and long-period components. However, it cannot be excluded that the meteors investigated belong to two different meteor showers situated in the same phase space. It was not possible to make a definitive conclusion concerning their relation to the proposed parent comet.

  16. Fabrication of injection molded sintered alpha SiC turbine components

    Science.gov (United States)

    Storm, R. S.; Ohnsorg, R. W.; Frechette, F. J.

    1981-01-01

    Fabrication of a sintered alpha silicon carbide turbine blade by injection molding is described. An extensive process variation matrix was carried out to define the optimum fabrication conditions. Variation of molding parameters had a significant impact on yield. Turbine blades were produced in a reasonable yield which met a rigid quality and dimensional specification. Application of injection molding technology to more complex components such as integral rotors is also described.

  17. A genomic island present along the bacterial chromosome of the Parachlamydiaceae UWE25, an obligate amoebal endosymbiont, encodes a potentially functional F-like conjugative DNA transfer system

    Directory of Open Access Journals (Sweden)

    Guy Lionel

    2004-12-01

    Full Text Available Abstract Background The genome of Protochlamydia amoebophila UWE25, a Parachlamydia-related endosymbiont of free-living amoebae, was recently published, providing the opportunity to search for genomic islands (GIs. Results On the residual cumulative G+C content curve, a G+C-rich 19-kb region was observed. This sequence is part of a 100-kb chromosome region, containing 100 highly co-oriented ORFs, flanked by two 17-bp direct repeats. Two identical gly-tRNA genes in tandem are present at the proximal end of this genetic element. Several mobility genes encoding transposases and bacteriophage-related proteins are located within this chromosome region. Thus, this region largely fulfills the criteria of GIs. The G+C content analysis shows that several modules compose this GI. Surprisingly, one of them encodes all genes essential for F-like conjugative DNA transfer (traF, traG, traH, traN, traU, traW, and trbC, involved in sex pilus retraction and mating pair stabilization, strongly suggesting that, similarly to the other F-like operons, the parachlamydial tra unit is devoted to DNA transfer. A close relatedness of this tra unit to F-like tra operons involved in conjugative transfer is confirmed by phylogenetic analyses performed on concatenated genes and gene order conservation. These analyses and that of gly-tRNA distribution in 140 GIs suggest a proteobacterial origin of the parachlamydial tra unit. Conclusions A GI of the UWE25 chromosome encodes a potentially functional F-like DNA conjugative system. This is the first hint of a putative conjugative system in chlamydiae. Conjugation most probably occurs within free-living amoebae, that may contain hundreds of Parachlamydia bacteria tightly packed in vacuoles. Such a conjugative system might be involved in DNA transfer between internalized bacteria. Since this system is absent from the sequenced genomes of Chlamydiaceae, we hypothesize that it was acquired after the divergence between

  18. Randomized trial comparing episiotomies with Braun-Stadler episiotomy scissors and EPISCISSORS-60®

    Directory of Open Access Journals (Sweden)

    Sawant G

    2015-06-01

    Full Text Available Ganpat Sawant, Divya Kumar Dr DY Patil Medical College and Hospital, Nerul, Navi Mumbai, India Introduction: Episiotomy angle is a crucial factor in causation of obstetric anal sphincter injuries (OASIS, which are the major cause of female bowel incontinence. Sutured episiotomies angled too close to the midline (<30 degree or too far away from the midline (.60 degree fail to unload the perineum sufficiently and predispose to OASIS. A 25-degree post-delivery episiotomy suture angle has a 10% risk of OASIS while 45-degree episiotomy is associated with 0.5% risk. To account for perineal distension at crowning, a 60-degree episiotomy incision is required to achieve 43–50 degree suture angles. We compared episiotomy suture angles with commonly used Braun-Stadler episiotomy scissors with the new fixed angle EPISCISSORS-60®. Methods: Ethical approval was obtained. A prospective cluster randomization design was chosen. Thirty-one patients were required in each group for a 12-degree difference with power at 90% and 5% significance. Sutured episiotomy angles and post-delivery linear distance from caudal end of the sutured episiotomy to the anus were measured with protractors and rulers. Two-tailed t-tests were used to compare the two groups. Results: Thirty-one nulliparae had episiotomies with EPISCISSORS-60®, 32 with Braun-Stadler. Mean age (25 versus 24.8 years was similar. EPISCISSORS-60® episiotomies were angled 12 degrees more laterally away from the anus compared to Braun-Stadler (40.6 degrees, 95% confidence interval [CI] ±2, interquartile range [IQR] 35–45 versus 28.3 degrees, 95% CI ±2, IQR 25–30, P<0.0001. The post-delivery linear distance from caudal end of the sutured episiotomy to the anus was 15 mm more with the EPISCISSORS-60® compared to Braun-Stadler (35 mm, 95% CI ±2.2, IQR =30–39 versus 19.5; 95% CI ±1.3, IQR =14.75–22.25 P<0.0001. EPISCISSORS-60® episiotomies measured longer (47 mm versus 40 mm, P<0.0001. There were

  19. Longitudinal imaging of Alzheimer pathology using [{sup 11}C]PIB, [{sup 18}F]FDDNP and [{sup 18}F]FDG PET

    Energy Technology Data Exchange (ETDEWEB)

    Ossenkoppele, Rik; Tolboom, Nelleke; Adriaanse, Sofie F. [VU University Medical Center, Department of Neurology and Alzheimer Center, PO Box 7057, Amsterdam (Netherlands); VU University Medical Center, Department of Nuclear Medicine and PET Research, Amsterdam (Netherlands); Foster-Dingley, Jessica C.; Boellaard, Ronald; Yaqub, Maqsood; Windhorst, Albert D.; Lammertsma, Adriaan A.; Berckel, Bart N.M. van [VU University Medical Center, Department of Nuclear Medicine and PET Research, Amsterdam (Netherlands); Barkhof, Frederik [VU University Medical Center, Department of Radiology, Amsterdam (Netherlands); Scheltens, Philip [VU University Medical Center, Department of Neurology and Alzheimer Center, PO Box 7057, Amsterdam (Netherlands); Flier, Wiesje M. van der [VU University Medical Center, Department of Neurology and Alzheimer Center, PO Box 7057, Amsterdam (Netherlands); VU University Medical Center, Department of Epidemiology and Biostatistics, Amsterdam (Netherlands)

    2012-06-15

    [{sup 11}C]PIB and [{sup 18}F]FDDNP are PET tracers for in vivo detection of the neuropathology underlying Alzheimer's disease (AD). [{sup 18}F]FDG is a glucose analogue and its uptake reflects metabolic activity. The purpose of this study was to examine longitudinal changes in these tracers in patients with AD or mild cognitive impairment (MCI) and in healthy controls. Longitudinal, paired, dynamic [{sup 11}C]PIB and [{sup 18}F]FDDNP (90 min each) and static [{sup 18}F]FDG (15 min) PET scans were obtained in 11 controls, 12 MCI patients and 8 AD patients. The mean interval between baseline and follow-up was 2.5 years (range 2.0-4.0 years). Parametric [{sup 11}C]PIB and [{sup 18}F]FDDNP images of binding potential (BP{sub ND}) and [{sup 18}F]FDG standardized uptake value ratio (SUVr) images were generated. A significant increase in global cortical [{sup 11}C]PIB BP{sub ND} was found in MCI patients, but no changes were observed in AD patients or controls. Subsequent regional analysis revealed that this increase in [{sup 11}C]PIB BP{sub ND} in MCI patients was most prominent in the lateral temporal lobe (p < 0.05). For [{sup 18}F]FDDNP, no changes in global BP{sub ND} were found. [{sup 18}F]FDG uptake was reduced at follow-up in the AD group only, especially in frontal, parietal and lateral temporal lobes (all p < 0.01). Changes in global [{sup 11}C]PIB binding ({rho} = -0.42, p < 0.05) and posterior cingulate [{sup 18}F]FDG uptake ({rho} = 0.54, p < 0.01) were correlated with changes in Mini-Mental-State Examination score over time across groups, whilst changes in [{sup 18}F]FDDNP binding ({rho} = -0.18, p = 0.35) were not. [{sup 11}C]PIB and [{sup 18}F]FDG track molecular changes in different stages of AD. We found increased amyloid load in MCI patients and progressive metabolic impairment in AD patients. [{sup 18}F]FDDNP seems to be less useful for examining disease progression. (orig.)

  20. Shock wave study of the thermal dissociations of C3F6 and c-C3F6. II. dissociation of hexafluorocyclopropane and dimerization of CF2.

    Science.gov (United States)

    Cobos, C J; Sölter, L; Tellbach, E; Troe, J

    2014-07-10

    The thermal dissociation of c-C3F6 has been studied in shock waves over the range 620-1030 K monitoring the UV absorption of CF2. The reaction was studied close to its high-pressure limit, but some high-temperature falloff was accounted for. Quantum-chemical and kinetic modeling rationalized the experimental data. The reaction is suggested to involve the 1,3 biradical CF2CF2CF2 intermediate. CF2 formed by the dissociation of c-C3F6 dimerizes to C2F4. The measured rate of this reaction is also found to correspond to the falloff range. Rate constants for 2CF2 → C2F4 as a function of temperature and bath gas concentration [Ar] are given and shown to be consistent with literature values for the high-pressure rate constants from experiments at lower temperatures and dissociation rate constants obtained in the falloff range at higher temperatures. The onset of falloff at intermediate temperatures is analyzed. PMID:24905207

  1. Thermochemical instability effects in SiC-based fibers and SiC{sub f}/SiC composites

    Energy Technology Data Exchange (ETDEWEB)

    Youngblood, G.E.; Henager, C.H.; Jones, R.H. [Pacific Northwest National Laboratory, Richland, WA (United States)

    1997-08-01

    Thermochemical instability in irradiated SiC-based fibers with an amorphous silicon oxycarbide phase leads to shrinkage and mass loss. SiC{sub f}/SiC composites made with these fibers also exhibit mass loss as well as severe mechanical property degradation when irradiated at 800{degrees}C, a temperature much below the generally accepted 1100{degrees}C threshold for thermomechanical degradation alone. The mass loss is due to an internal oxidation mechanism within these fibers which likely degrades the carbon interphase as well as the fibers in SiC{sub f}/SiC composites even in so-called {open_quotes}inert{close_quotes} gas environments. Furthermore, the mechanism must be accelerated by the irradiation environment.

  2. Standard potential of sodium amalgam at 250C

    International Nuclear Information System (INIS)

    From a set of critically selected literary data on the emf's of concentration cells consisting of sodium metal and sodium amalgam in a sodium salt non-aqueous electrolyte a value of E0sub(Na(Hg)/Na+) = -1.95584 V was calculated for the standard equilibrium potential of diluted liquid sodium amalgam at 250C. The standard state of the amalgam was derived from an amalgam at infinite dilution where fsub(Na)→ 1.0 for xsub(Na)→ 0. The activity coefficient of sodium in the amalgam at an arbitrary composition, corresponding to this standard state, is obtained from the expression 1g fsub(Na(Hg)) = 16.393 xsub(Na). (author)

  3. Morphological variability of oospores of Chara baueri A. Braun (Characeae

    Directory of Open Access Journals (Sweden)

    Andrzej Hutorowicz

    2011-04-01

    Full Text Available The shape and size of present-day specimens of Chara baueri are described. C. baueri is believed to have practically died out in Europe. Oospores of specimens of C. baueri collected in Kazachstan were subjected to morpholgical analysis. Data recorded included oospore length, oospore diameter, the ratio of length to diameter, the number of lateral convolutions, ridge width, the width of the fossules at the equator, and the diameter of the basal pore. Variation in oospore length and the number of convolutions was higher than had been previously reported in the literature, whereas variation in oospore width was identical to previous reports.

  4. Biodiesel production from Cynara cardunculus L. and Brassica carinata A. Braun seeds and their suitability as fuels in compression ignition engines

    Directory of Open Access Journals (Sweden)

    Stefania De Domenico

    2016-03-01

    Full Text Available The development of energy crops can provide environmental benefits and may represent an opportunity to improve agriculture in areas considered at low productivity. In this work, we studied the energy potential of two species (Brassica carinata A. Braun and Cynara cardunculus L. and their seed oil productivity under different growth conditions. Furthermore, the biodiesel from the oil extracted from the seeds of these species was produced and analysed in term of utilisation as fuels in compression ignition engines. In particular, the spray penetration and shape ratio were measured in a constant-volume chamber and compared with the results obtained with a standard diesel fuel. These results were obtained using a standard common rail injection system at different injection pressure, injection duration, and constant-volume chamber pressure.

  5. Influence of SiC coating thickness on mechanical properties of SiC{sub f}/SiC composite

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Haijiao, E-mail: yunzeyu2000@163.com [College of Aerospace and Materials Engineering, National University of Defence Technology, Changsha 410073 (China); Advanced Composites Centre for Innovation and Science (ACCIS), Department of Aerospace Engineering, University of Bristol, Bristol BS8 1TR (United Kingdom); Beijing Aeronautical Technology Research Centre, Beijing 100076 (China); Zhou, Xingui; Zhang, Wei [College of Aerospace and Materials Engineering, National University of Defence Technology, Changsha 410073 (China); Peng, Huaxin [Advanced Composites Centre for Innovation and Science (ACCIS), Department of Aerospace Engineering, University of Bristol, Bristol BS8 1TR (United Kingdom); Zhang, Changrui [College of Aerospace and Materials Engineering, National University of Defence Technology, Changsha 410073 (China)

    2013-11-15

    Highlights: •CVD SiC coating improves the mechanical properties of 2D KD-I/SiC composite. •The thickness of SiC coating determines the mechanical properties of the composite. •The optimal thickness of CVD SiC coating is 0.34–1 μm. -- Abstract: Silicon carbide (SiC) coatings with varying thickness (ranging from 0.14 μm to 2.67 μm) were deposited onto the surfaces of Type KD-I SiC fibres with native carbonaceous surface using chemical vapour deposition (CVD) process. Then, two dimensional SiC fibre reinforced SiC matrix (2D SiC{sub f}/SiC) composites were fabricated using polymer infiltration and pyrolysis (PIP) process. Influences of the fibre coating thickness on mechanical properties of SiC fibre and SiC{sub f}/SiC composite were investigated using single-filament test and three-point bending test. The results indicated that flexural strength of the composites initially increased with the increasing CVD SiC coating thickness and reached a peak value of 363 MPa at the coating thickness of 0.34 μm. Further increase in the coating thickness led to a rapid decrease in the flexural strength of the composites. The bending modulus of composites showed a monotonic increase with increasing coating thickness.

  6. Smart Resistance Thermometer Sensor Based on C8051F350

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    <正>A Smart resistance thermometer sensor is designed to overcome the shortages of the traditional ones, and Con-form to the world development trend of the sensor market.According to the constitutions of this Smart sensor and its application coverage,those parts with good -application and low-cost were chosen to constitute this sensor on the basis of full consideration of the linkage among every part.The whole testing system were controlled and processed by C8051F350 single-chip,it could measure precise temperature by PT100 resistance thermometer and circumstance temperature for temperature compensating automatically and simultane-ously,it also could amplify signals to convert analog signals to digital ones,and display results automatically by analysing and processing information.Furthermore,it could auto-compensate self-check,and spot communicate.

  7. Offshore wind farm siting procedures applied offshore of Block Island, Rhode Island

    Science.gov (United States)

    O'Reilly, Christopher M.

    Since 2008, the Rhode Island Coastal Resources Management Council (CRMC) has been leading a Rhode Island Ocean Area Management Plan (RIOSAMP) in partnership with the University of Rhode Island, resulting in an extensive multidisciplinary analysis of the Rhode Island offshore environment and its suitability for siting an offshore wind farm. As part of the RIOSAMP project, a standard siting optimization approach was first developed based on a siting index defined as the ratio of costs associated with the wind farm deployment to the available wind resource. This index, combined within a marine spatial planning approach to address ecological and societal constraints, provided an initial macro-siting tool (Spaulding et al., 2010). The multiple GIS layers required in this approach and the absence of theoretical support to optimize the resulting zoning, led to an extension of the initial optimization approach into a more comprehensive macro-siting optimization tool, integrating societal and ecological constraints into the siting tool, the Wind Farm Siting Index (WIFSI) (Grilli et al, 2012). The projects led to the definition of several favorable development areas including a Renewable Energy Zone (REZ) off of Block Island, in State Waters. Deep Water Wind Inc. (DWW) plans to install and commission five 6 MW direct drive Siemens lattice jacket turbines in the REZ area, by 2014. In this thesis two major steps are accomplished to refine and expand the RIOSAMP macro-siting tool. First the macro-siting tool is expanded to include a model simulating the exclusionary zones defined by the Federal Aviation Administration (FAA) regulations. Second a micro-siting model is developed, optimizing the relative position of each turbine within a wind farm area. The micro-siting objective is to minimize, (1) the loss in power due to the loss of wind resource in the wake of the turbines (wake "effect"), and (2) the cable costs that inter-connect the turbines and connecting the farm to the

  8. Generation and replication-dependent dilution of 5fC and 5caC during mouse preimplantation development

    Institute of Scientific and Technical Information of China (English)

    Azusa Inoue; Li Shen; Qing Dai; Chuan He; Yi Zhang

    2011-01-01

    One of the recent advances in the epigenetic field is the demonstration that the Tet family of proteins are capable of catalyzing conversion of 5-methylcytosine (5mC) of DNA to 5-hydroxymethylcytosine (5hmC).Interestingly,recent studies have shown that 5hmC can be further oxidized by Tet proteins to generate 5-formyicytosine (5fC) and 5-carboxylcytosine (5caC),which can be removed by thymine DNA glycosylase (TDG).To determine whether Tetcatalyzed conversion of 5mC to 5fC and 5caC occurs in vivo in zygotes,we generated antibodies specific for 5fC and 5caC.By immunostaining,we demonstrate that loss of 5mC in the paternal pronucleus is concurrent with the appearance of 5fC and 5caC,similar to that of 5hmC.Importantly,instead of being quickly removed through an enzyme-catalyzed process,both 5fC and 5caC exhibit replication-dependent dilution during mouse preimplantation development.These results not only demonstrate the conversion of 5mC to 5fC and 5caC in zygotes,but also indicate that both 5fC and 5caC are relatively stable and may be functional during preimplantation development.Together with previous studies,our study suggests that Tet-catalyzed conversion of 5mC to 5hmC/5fC/5caC followed by replication-dependent dilution accounts for paternal DNA demethylation during preimplantation development.

  9. System Impact Study of the Eastern Grid of Sumba Island, Indonesia: Steady-State and Dynamic System Modeling for the Integration of One and Two 850-kW Wind Turbine Generators

    Energy Technology Data Exchange (ETDEWEB)

    Oswal, R. [Innovation Wind Energy, Inc., Jacksonville, FL (United States); Jain, P. [Innovation Wind Energy, Inc., Jacksonville, FL (United States); Muljadi, Eduard [National Renewable Energy Lab. (NREL), Golden, CO (United States); Hirsch, Brian [National Renewable Energy Lab. (NREL), Golden, CO (United States); Castermans, B. [Winrock International Inc., Little Rock, AR (United States); Chandra, J. [Winrock International Inc., Little Rock, AR (United States); Raharjo, S. [Winrock International Inc., Little Rock, AR (United States); Hardison, R. [Winrock International Inc., Little Rock, AR (United States)

    2016-01-01

    The goal of this project was to study the impact of integrating one and two 850-kW wind turbine generators into the eastern power system network of Sumba Island, Indonesia. A model was created for the 20-kV distribution network as it existed in the first quarter of 2015 with a peak load of 5.682 MW. Detailed data were collected for each element of the network. Load flow, short-circuit, and transient analyses were performed using DIgSILENT PowerFactory 15.2.1.

  10. Measurement of Swarm Parameters of c-C4F8/CO2 and Its Insulation Characteristics Analysis

    Institute of Scientific and Technical Information of China (English)

    ZHANG Liu-chun; XIAO Deng-ming; ZHANG Dong; WU Bian-tao

    2008-01-01

    In c-C4F8 and c-C4F8/CO2 mixtures, the swarm parameters including ionization coefficient, attachment coefficient and effective ionization coefficient were obtained at the ratio of the electric field strength to the gas density between 150-550 Td by the steady-state Townsend (SST) method. Static breakdown voltages at each ratio were also measured at the SST condition. The limiting field strengths were obtained by two methods:computing the density-normalized effective ionization coefficient as a function of the overall density-reduced electric field strength; and measuring static breakdown voltages as a function of the product of gas density and electrode separation. Good agreement was obtained by these two methods, which ensures the correctness of the former method. The limiting field strengths of c-C4F8 and c-C4F8/CO2 mixtures were compared with those ofpure SF6, SF6/CO2 mixtures and pure c-C4Fs. It is found that buffer gas CO2 does not reduce the limiting field strengths of c-C4F8 greatly, the limiting field strengths of c-C4F8/CO2 mixtures are higher than those of SF6/CO2 mixtures or even pure SF6, and so c-C4F8/CO2 mixtures are suggested to be possible substitutes for SF6.

  11. 26 CFR 5c.168(f)(8)-5 - Term of lease.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Term of lease. 5c.168(f)(8)-5 Section 5c.168(f... Term of lease. (a) Term of lease—Basic rules. To qualify as a lease under section 168(f)(8) and § 5c.168 (f)(8)-1 (a), the lease agreement must provide for a term that does not exceed the maximum...

  12. Öffentlichkeitsbeteiligung ja, aber wie? Standards für qualitätsvolle Beteiligungsprozesse.

    Directory of Open Access Journals (Sweden)

    Kerstin Arbter

    2009-09-01

    Full Text Available Damit Öffentlichkeitsbeteiligung der Öffentlichkeit, der Politik und der Verwaltung nützt, muss sie qualitätsvoll durchgeführt werden. Daher entwickelte eine interministerielle Arbeitsgruppe unter Beteiligung von Ministerien, Interessenvertretungen, NGOs und externen FachexpertInnen im Rahmen eines Projekts im Auftrag des Bundes­kanzler­amtes und des Lebensministeriums "Standards der Öffentlich­keits­beteiligung". Die Standards wurden im Juli 2008 vom Ministerrat beschlossen und damit im Bereich der österreichischen Bundesverwaltung zur Anwendung empfohlen. Sie sollen nun VerwaltungsmitarbeiterInnen bei der konkreten Durchführung qualitätsvoller Beteiligungsprozesse unter­stützen. Die Standards der Öffentlichkeitsbeteiligung wurden selbst in einem partizipativen Prozess entwickelt. Zu Beginn wurde ein gemeinsames Begriffsverständnis zur Öffentlichkeit und zu den drei Intensitätsstufen der Beteiligung (Information, Konsultation und Kooperation geschaffen. Danach wurden Standards zu den drei Phasen eines Beteiligungsprozesses, der Vorbereitungsphase, der Durchführungsphase und der Monitoring- und Evaluierungsphase nach Abschluss des Prozesses, formuliert. Erste Anwendungsversuche – einerseits beim Konsultationsprozess zum Entwurf der Standards selbst, andererseits bei einem ersten Pilotprojekt – zeigen, dass die Standards der Öffentlich­keitsbeteiligung durchaus praxistauglich sind. Auch für elektronisch unterstützte Beteiligungs­prozesse sollen die Standards ein hilfreiches Qualitätsfundament bieten.

  13. Hennes & Mauritz. En studie av varumärket H&M och företagets historia på Island

    OpenAIRE

    Margrét Óda Ingimarsdóttir 1983

    2010-01-01

    Jag kommer att begränsa den här undersökningen till att behandla H&M:s historia och bakgrund för att vidare kunna undersöka vad företagets varumärke står för och hur det har lyckats nå sina framgångar. Efter att ha hört debatten om den omtalade boken No Logo (2000) av Naomi Klein, en kanadensisk författare och journalist, blev jag intresserad av att veta vad det är som gör ett varumärke framgångsrikt. Jag tänker också undersöka H&M:s historia på Island och försöka få svar på varför H&M inte l...

  14. Wind turbine sound power measurements.

    Science.gov (United States)

    Keith, Stephen E; Feder, Katya; Voicescu, Sonia A; Soukhovtsev, Victor; Denning, Allison; Tsang, Jason; Broner, Norm; Richarz, Werner; van den Berg, Frits

    2016-03-01

    This paper provides experimental validation of the sound power level data obtained from manufacturers for the ten wind turbine models examined in Health Canada's Community Noise and Health Study (CNHS). Within measurement uncertainty, the wind turbine sound power levels measured using IEC 61400-11 [(2002). (International Electrotechnical Commission, Geneva)] were consistent with the sound power level data provided by manufacturers. Based on measurements, the sound power level data were also extended to 16 Hz for calculation of C-weighted levels. The C-weighted levels were 11.5 dB higher than the A-weighted levels (standard deviation 1.7 dB). The simple relationship between A- and C- weighted levels suggests that there is unlikely to be any statistically significant difference between analysis based on either C- or A-weighted data. PMID:27036281

  15. A 19F NMR study of C-I....pi- halogen bonding

    DEFF Research Database (Denmark)

    Hauchecorne, Dieter; vand er Veken, Benjamin J.; Herrebout, Wouter A.; Hansen, Poul Erik

    The formation of halogen bonded complexes between toluene-d8 and the perfluoroiodopropanes 1-C3F7I and 2-C3F7I has been investigated using 19F NMR spectroscopy. For both Lewis acids, evidence was found for the formation of a C–I⋯π halogen bonded complex. The complex formed is a 1:1 type. Using...

  16. 17 CFR 240.15c3-1f - Optional market and credit risk requirements for OTC derivatives dealers (Appendix F to 17 CFR...

    Science.gov (United States)

    2010-04-01

    ... risk requirements for OTC derivatives dealers (Appendix F to 17 CFR 240.15c3-1). 240.15c3-1f Section... risk requirements for OTC derivatives dealers (Appendix F to 17 CFR 240.15c3-1). Application... charges for market and credit risk pursuant to this Appendix F in lieu of computing securities...

  17. The $O(\\alpha_s^3 n_f T_F^2 C_{A,F})$ contributions to the gluonic massive operator matrix elements

    OpenAIRE

    Blümlein, J.; Hasselhuhn, A.(Research Institute for Symbolic Computation (RISC), Johannes Kepler University, Altenbergerstraße 69, Linz, A-4040, Austria); Klein, S.; Schneider, C

    2013-01-01

    The $O(\\alpha_s^3 n_f T_F^2 C_{A,F})$ terms to the massive gluonic operator matrix elements are calculated for general values of the Mellin variable $N$. These twist-2 matrix elements occur as transition functions in the variable flavor number scheme at NNLO. The calculation uses sum-representations in generalized hypergeometric series turning into harmonic sums. The analytic continuation to complex values of $N$ is provided.

  18. Development of standardized air-blown coal gasifier/gas turbine concepts for future electric power systems

    Energy Technology Data Exchange (ETDEWEB)

    Sadowski, R.S.; Brown, M.J.; Harriz, J.T.; Ostrowski, E.

    1991-01-01

    The cost estimate provided for the DOE sponsored study of Air Blown Coal Gasification was developed from vendor quotes obtained directly for the equipment needed in the 50 MW, 100 MW, and 200 MW sized plants and from quotes from other jobs that have been referenced to apply to the particular cycle. Quotes were generally obtained for the 100 MW cycle and a scale up/down factor was used to generate the cost estimates for the 200 MW and 50 MW cycles, respectively. Information from GTPro (property of Thermoflow, Inc.) was used to estimate the cost of the 200 MW and 50 MW gas turbine, HRSG, and steam turbines. To available the use of GTPro's estimated values for this equipment, a comparison was made between the quotes obtained for the 100 MW cycle (ABB GT 11N combustion turbine and a HSRG) against the estimated values by GTPro.

  19. Telaprevir- and boceprevir-based tritherapies in real practice for F3-F4 pretreated hepatitis C virus patients

    Institute of Scientific and Technical Information of China (English)

    Delphine; Bonnet; Matthieu; Guivarch; Ana?s; Palacin; Laurent; Alric; Emilie; Bérard; Jean-Marc; Combis; Andre; Jean; Remy; Andre; Glibert; Jean-Louis; Payen; Sophie; Metivier; Karl; Barange; Herve; Desmorat; Florence; Nicot; Florence; Abravanel

    2014-01-01

    AIM:To assess,in a routine practice setting,the sus-tained virologic response(SVR) to telaprevir(TPV) or boceprevir(BOC) in hepatitis C virus(HCV) nullresponders or relapsers with severe liver fibrosis.METHODS:One hundred twenty-five patients were treated prospectively for 48 wk with TPV or BOC + pegylated-interferon(peg-INF) α2a + ribavirin(PR) according to standard treatment schedules without randomization.These patients were treated in routine practice settings in 10 public or private health care centers,and the data were prospectively collected.Only patients with severe liver fibrosis(Metavir scores of F3 or F4 upon liver biopsy or liver stiffness assessed by elastography),genotype 1 HCV and who were null-responders or relapsers to prior PR combination therapy were included in this study.RESULTS:The Metavir fibrosis scores were F3 in 35(28%) and F4 in 90(72%) of the patients.In total,62.9% of the patients were null-responders and 37.1% relapsers to the previous PR therapy.The overall SVR rate at 24 wk post-treatment withdrawal was 59.8%.The SVR was 65.9% in the TPV group and 44.1% in the BOC group.Independent predictive factors of an SVR included a response to previous treatment,relapsers vs null-responders [OR = 3.9;(1.4,10.6),P = 0.0084],a rapid virological response(RVR) [OR 6.9(2.6,18.2),P = 0.001] and liver stiffness lower than 21.3 kPa [OR = 8.2(2.3,29.5),P = 0.001].During treatment,63 patients(50.8%) had at least one severe adverse event(SAE) of grade 3 or 4.A multivariate analysis identified two factors associated with SAEs:female gender [OR = 2.4(1.1,5.6),P = 0.037] and a platelet count below 150 × 103/ mm3 [OR = 5.3(2.3,12.4),P ≤ 0.001].CONCLUSION:More than half of these difficult-to-treat patients achieved an SVR and had SAEs in an actual practice setting.The SVR rate was influenced by the response to previous PR treatment,the RVR and liver stiffness.

  20. The biomechanical properties of F1C pili

    CERN Document Server

    Castelain, Mickaël; Klinth, Jeanna; Lindberg, Stina; Andersson, Magnus; Uhlin, Bernt Eric; Axner, Ove

    2014-01-01

    Uropathogenic Escherichia coli (UPEC) express various kinds of organelles, so-called pili or fimbriae, that mediate adhesion to host tissue in the urinary tract through specific receptor-adhesin interactions. The biomechanical properties of these pili have been considered important for the ability of bacteria to withstand shear forces from rinsing urine flows. Force measuring optical tweezers have been used to characterize individual organelles of F1C type expressed by UPEC bacteria with respect to such properties. Qualitatively, the force-vs.-elongation response was found to be similar to that of other types of helix-like pili expressed by UPEC, i.e. type 1, P, and S, with force-induced elongation in three regions of which one represents the important uncoiling mechanism of the helix-like quaternary structure. Quantitatively, the steady-state uncoiling force was assessed to 26.4(1.4) pN, which is similar to those of other pili (which range from 21 pN for SI to 30 pN for type 1). The corner velocity for dynam...

  1. Supramolecular aggregation of Ni(salen) with (C6F5)2Hg and [o-C6F4Hg]3.

    Science.gov (United States)

    Tsunoda, Mitsukimi; Fleischmann, Martin; Jones, J Stuart; Bhuvanesh, Nattamai; Scheer, Manfred; Gabbaï, François P

    2016-03-15

    As part of our ongoing interest in the supramolecular chemistry of fluorinated organomercurials, we have investigated the interaction of bis(pentafluorophenyl)mercury ((C6F5)2Hg), and trimeric (perfluoro-o-phenylene)mercury ([o-C6F4Hg]3), with nickel(ii) N,N'-bis(salicylidene)ethylenediamine) (Ni(salen)). While solution studies monitored by UV-VIS spectroscopy suggest that Ni(salen) interacts with the trinuclear mercury complex in solution, the 1 : 1 adduct (Ni(salen)-(C6F5)2Hg) and the 1 : 1 adducts Ni(salen)-[o-C6F4Hg]3 and [Ni(salen)-[o-C6F4Hg]3-THF-H2O] can be obtained by slow evaporation of solutions containing the two building blocks. While arene-fluoroarene and hydrogen bonding interactions, as well as interactions between mercury and the salen ligand are the predominant forces responsible for the formation of these adducts, Ni(salen)-[o-C6F4Hg]3 and [Ni(salen)-[o-C6F4Hg]3-THF-H2O] also display short Ni-Hg separations consistent with the presence of metallophilic interactions. Quantum theory of atoms in molecules (QTAIM) analyses of the Ni-Hg interactions in these adducts finds that these interactions are dominated by electrostatic and dispersion forces, despite featuring non-negligible covalent contributions. PMID:26865181

  2. CFD prediction of unsteady wicket gate-runner interaction in Francis turbines: A new standard hydraulic design procedure

    OpenAIRE

    Nennemann, B.; Vu, T.C.; Farhat, M.

    2005-01-01

    GE Energy Hydro has developed a new procedure for the CFD analysis of the unsteady rotor-stator interaction between the wicket gates and runner blades of Francis turbines. The results from the CFD calculations have been successfully validated by means of high quality unsteady pressure measurements on a model turbine performed at École Polytechnique Fédérale de Lausanne. Due to the efficiency of the procedure and the available computational capacities, unsteady rotor-stator analyses are now ro...

  3. The processing of syntactic islands – an fMRI study

    DEFF Research Database (Denmark)

    Christensen, Ken Ramshøj; Kizach, Johannes; Nyvad, Anne Mette

    2013-01-01

    -related fMRI (n=30) was used to measure the cortical effects of the differences in acceptability between ungrammatical sentences and three types of wh-movement in Danish: short movement (to the front of an embedded clause), long movement (to the beginning of the matrix clause), and movement across another...... showing that acceptability correlates negatively with demands on syntactic working memory. Short movement is more acceptable than long movement, which is more acceptable than movement across another wh-phrase. Contrary to prediction, the imaging data showed no significant difference between long movement...... and movement across another wh-phrase, while both induced a significant increase in activation in LIFG compared to short movement. It is argued that the clause itself, rather than movement as such, is an important factor. Movement out of an embedded clause increases syntactic complexity, which in turn...

  4. Improvement of the thermal conductivity of SiC{sub F}/SiC composite

    Energy Technology Data Exchange (ETDEWEB)

    Youngblood, G.E. [Pacific Northwest National Laboratory, Richland, WA (United States); Kowbel, W. [MER Corporation, Tucson, AZ (United States)

    1996-04-01

    The methods, high temperature annealing and doping, were examined for improving the thermal conductivity of simulated CVI/{Beta}-SiC matrix material. For instance, a two hour 1500{degrees}C anneal led to the increase of the room temperature (RT) thermal conductivity from 38 to 59 W.mK. Be doping was even more effective in causing the thermal conductivity to increase with RT conductivity values up to 160 W/mK attained. To further optimize the thermal conductivity, hot-pressed SiC materials with carefully controlled amounts of Be-and B{sub 4}C-doping were investigated. Although a small improvement ({approx} 8%) was achieved with 2.0 wt % Be-doping, the effort to refine the amount of doping needed was largely unsuccessful. Apparently, hot-pressing SiC introduced numerous substructural stacking faults which effectively scattered phonons on the intermediate temperature range and nullified the benefits of doping. Nevertheless, Be and B{sub 4}C-doping and/or thermal treatments appear to be promising strategies to achieve the goal of eventually improving the thermal conductivity of SiC{sub f}/SiC composite.

  5. Novel SiGe Island Coarsening Kinetics: Ostwald Ripening and Elastic Interactions

    International Nuclear Information System (INIS)

    Real-time light scattering measurements of coherent island coarsening during SiGe/Si heteroepitaxy reveal unusual kinetics. In particular, the mean island volume increases superlinearly with time, while the areal density of islands decreases at a faster-than-linear rate. Neither observation is consistent with standard considerations of Ostwald ripening. Modification of the standard theory to incorporate the effect of elastic interactions in the growing island array reproduces the observed behavior. (c) 2000 The American Physical Society

  6. Low scale nonuniversal, nonanomalous U(1)F' in a minimal supersymmetric standard model

    Science.gov (United States)

    Chen, Mu-Chun; Huang, Jinrui

    2010-10-01

    We propose a nonuniversal U(1)F' symmetry combined with the minimal supersymmetric standard model. All anomaly cancellation conditions are satisfied without exotic fields other than three right-handed neutrinos. Because our model allows all three generations of chiral superfields to have different U(1)F' charges, upon the breaking of the U(1)F' symmetry at a low scale, realistic masses and mixing angles in both the quark and lepton sectors are obtained. In our model, neutrinos are predicted to be Dirac fermions and their mass ordering is of the inverted hierarchy type. The U(1)F' charges of the chiral superfields also naturally suppress the μ-term and automatically forbid baryon number and lepton number violating operators. While all flavor-changing neutral current constraints in the down quark and charged-lepton sectors can be satisfied, we find that the constraint from D0-D¯0 turns out to be much more stringent than the constraints from the precision electroweak data.

  7. Post-bomb coral Δ14C record from Iki Island, Japan: possible evidence of oceanographic conditions on the northern East China Sea shelf

    Science.gov (United States)

    Mitsuguchi, Takehiro; Hirota, Masashi; Paleo Labo AMS Dating Group; Yamazaki, Atsuko; Watanabe, Tsuyoshi; Yamano, Hiroya

    2016-07-01

    In this study, a sea-surface water Δ14C record of AD 1966-2000 (i.e., after the atmospheric nuclear-bomb testing period of the mid-1950s to early 1960s) was reconstructed from a coral sample collected from Iki Island, western Japan. The island is located in the Tsushima Strait where the Tsushima Current flows from the East China Sea (ECS) continental shelf into the Sea of Japan, indicating a strong influence of the ECS shelf water on the island. It is widely accepted that the Tsushima Current originates in the area between the ECS shelf break and the Nansei Islands further offshore as a branch of the Kuroshio Current, although another possible origin is the Taiwan-Tsushima Current System. The Δ14C record from Iki Island shows the following evidence of a response to the atmospheric nuclear testing: (1) an increase from ~55‰ in 1966 to ~133‰ in 1970, (2) a plateau ranging between ~123 and ~142‰ during the 1970s to the late 1980s, and (3) a gradual decrease from ~115‰ in 1990 to ~83‰ in 2000. Comparison of this record with coral Δ14C records from the Nansei Islands (Okinawa Island, Ishigaki Island and Kikai Island), located ~160-280 km off the ECS shelf break and little influenced by the shelf water, suggests that the surface-water Δ14C around Iki Island was ~30-45‰ lower than that of the Nansei Islands from the mid-1960s to late 1970s, and that the Δ14C difference between Iki Island and the Nansei Islands decreased from the end of the 1970s to ~0-15‰ in the mid-1980s to 2000. The lower Δ14C around Iki Island can be explained as follows: (1) in contrast to the Nansei Islands area, the ECS shelf area is a vertically mixed, highly concentrated carbon reservoir significantly connected to subsurface and deeper waters outside the shelf area, strongly suggesting that the surface-water Δ14C of the shelf area (perhaps excepting very shallow innermost shelf areas) was significantly less sensitive to the atmospheric nuclear-bomb 14C spike than that of the

  8. Collisional quenching reaction rate coefficients of N2 (A3Σu+) by C2F6 and C3F8

    Science.gov (United States)

    Suzuki, Susumu; Kuboaki, Masaru; Itoh, Haruo

    2015-09-01

    The collisional quenching reaction rate coefficient of N2 (A3Σu+) by various air pollutant gases were determined from the measurement of the effective lifetime of N2 (A3Σu+) in pure N2 (5-nine) with a small amount of air pollutant gases as an admixture. Derivation of the rate coefficient was performed the waveform analysis of the transient ionization current after turning off the UV light in the Townsend discharge. In this paper, we report that the obtained collisional quenching reaction rate coefficients of N2 (A3Σu+) by C2F6 and C3F8 are (2.3 +/- 1.8) × 10-15 cm3/s and (1.6 +/- 0.8) × 10-14 cm3/s, respectively. Furthermore, we investigate the relationship between the rate coefficient and the mass number of their quenching molecular gases. Firstly, it is confirmed that the rate coefficient take large value with an increase in the mass number of the quenching gases. Secondly, if H atom is included in the gas molecules such as CH4, C2F6 and C3F8 the rate coefficient take large value, but if the molecules including F atom such as C2F6 and C3F8 instead of H atom in this study, more smaller values of the collisional quenching reaction rate coefficient are observed.

  9. Radiation thermometry standards at NMIJ from −30 °C to 2800 °C

    International Nuclear Information System (INIS)

    NMIJ has established a national standard scale in radiation thermometry from −30 °C to 2800 °C. At low temperatures from 160 °C down to −30 °C large aperture fluid-bath blackbodies have been constructed for the calibration of thermal infrared thermometers. In the range from 160 °C to 420 °C, the standard scale has been realized on 1.6 μm thermometers calibrated against In, Sn, and Zn blackbodies. A variable temperature blackbody using an air-bath furnace has recently been developed for direct comparison measurements of a 10 μm thermometer with a 1.6 μm thermometers up to 500 °C. In the higher range of the temperature scale, dissemination consists of three schemes: the range from 400 °C to 1100 °C by Zn, Al, Ag and Cu fixed-point blackbodies: above the Ag point by 0.9 μm and 0.65 μm thermometers: and above the Cu point by metal-carbon high-temperature fixed points

  10. Silicon etch using SF6/C4F8/Ar gas mixtures

    International Nuclear Information System (INIS)

    While plasmas using mixtures of SF6, C4F8, and Ar are widely used in deep silicon etching, very few studies have linked the discharge parameters to etching results. The authors form such linkages in this report. The authors measured the optical emission intensities of lines from Ar, F, S, SFx, CF2, C2, C3, and CS as a function of the percentage C4F8 in the gas flow, the total gas flow rate, and the bias power. In addition, the ion current density and electron temperature were measured using a floating Langmuir probe. For comparison, trenches were etched of various widths and the trench profiles (etch depth, undercut) were measured. The addition of C4F8 to an SF6/Ar plasma acts to reduce the availability of F as well as increase the deposition of passivation film. Sulfur combines with carbon in the plasma efficiently to create a large optical emission of CS and suppress optical emissions from C2 and C3. At low fractional flows of C4F8, the etch process appears to be controlled by the ion flux more so than by the F density. At large C4F8 fractional flows, the etch process appears to be controlled more by the F density than by the ion flux or deposition rate of passivation film. CF2 and C2 do not appear to cause deposition from the plasma, but CS and other carbon containing molecules as well as ions do

  11. 18F standardization by means of a 4πβ-γ software coincidence system

    International Nuclear Information System (INIS)

    The standardization of 18F, a positron emitter of short half-life, used in PET (Positron Emission Tomography) by means of a software 4πβ-γ coincidence system is described. The 4πβ-γ coincidence system consists of a gas-flow proportional counter (PC) in 4π geometry operated at 0.1 MPA coupled to a 50 x 50 mm NaI(Tl) crystal. The data collection was made by means of a Software Coincidence System (SCS) developed at the LMN (Nuclear Metrology Laboratory) of the IPEN-CNEN/SP. The extrapolation technique was applied to determine the activity of the solution. (author)

  12. 31 CFR 315.32 - Series A, B, C, D, F, G, J, and K bonds.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Series A, B, C, D, F, G, J, and K.... SAVINGS BONDS, SERIES A, B, C, D, E, F, G, H, J, AND K, AND U.S. SAVINGS NOTES Interest § 315.32 Series A, B, C, D, F, G, J, and K bonds. All bonds of these series have matured and no longer earn interest....

  13. Contextualizing Next Generation Science Standards to Guide Climate Education in the U.S. Affiliated Pacific Islands (USAPI)

    Science.gov (United States)

    Sussman, A.; Fletcher, C. H.; Sachs, J. P.

    2012-12-01

    The USAPI has a population of about 1,800,000 people spread across 4.9 million square miles of the Pacific Ocean. The Pacific Islands are characterized by a multitude of indigenous cultures and languages. Many USAPI students live considerably below the poverty line. The Pacific Island region is projected to experience some of the most profound negative impacts of climate change considerably sooner than other regions. Funded by the National Science Foundation (NSF), the Pacific Islands Climate Education Partnership (PCEP) has developed a detailed strategic plan to collaboratively improve climate knowledge among the region's students and citizens in ways that exemplify modern science and indigenous environmental knowledge, address the urgency of climate change impacts, and honor indigenous cultures. Students and citizens within the region will have the knowledge and skills to advance understanding of climate change, and to adapt to its impacts. Core PCEP partners contribute expertise in climate science, the science of learning, the region's education infrastructure, and the region's cultures and indigenous knowledge and practices. PCEP's strategic education plan is guided by a general, multidisciplinary K-14 Climate Education Framework (CEF) that organizes fundamental science concepts and practices within appropriate grade-span progressions. This CEF is based largely upon the National Research Council's "A Framework for K-12 Science Education: Practices, Crosscutting Concepts, and Core Ideas" and the emerging Next Generation Science Standards. While the CEF is based upon these national Next Generation documents, it is also informed and strongly influenced by the region's geographic, climatic, cultural and socioeconomic contexts, notably indigenous knowledge and practices. Guided by the CEF, the PCEP in its initial development/planning phase has prototyped regional approaches to professional development, contextualizing curricula, and supporting community

  14. Morphology Change of C60 Islands on Organic Crystals Observed by Atomic Force Microscopy.

    Science.gov (United States)

    Freund, Sara; Hinaut, Antoine; Pawlak, Rémy; Liu, Shi-Xia; Decurtins, Silvio; Meyer, Ernst; Glatzel, Thilo

    2016-06-28

    Organic-organic heterojunctions are nowadays highly regarded materials for light-emitting diodes, field-effect transistors, and photovoltaic cells with the prospect of designing low-cost, flexible, and efficient electronic devices.1-3 However, the key parameter of optimized heterojunctions relies on the choice of the molecular compounds as well as on the morphology of the organic-organic interface,4 which thus requires fundamental studies. In this work, we investigated the deposition of C60 molecules at room temperature on an organic layer compound, the salt bis(benzylammonium)bis(oxalato)cupurate(II), by means of noncontact atomic force microscopy. Three-dimensional molecular islands of C60 having either triangular or hexagonal shapes are formed on the substrate following a "Volmer-Weber" type of growth. We demonstrate the dynamical reshaping of those C60 nanostructures under the local action of the AFM tip at room temperature. The dissipated energy is about 75 meV and can be interpreted as the activation energy required for this migration process. PMID:27219352

  15. Necessary and Sufficient Standards Closure Process pilot: F- and H-Area groundwater remediation

    International Nuclear Information System (INIS)

    The DOE Standards Committee's Necessary and Sufficient (N and S) Standards Closure Process was piloted at SRS on the F- and H- Area Seepage Basins Groundwater Remediation Project. For this existing Environmental Restoration project, the set of N and S standards for design and safety documentation were identified, independently confirmed and approved. Implementation of these standards on the project can lead to a $2.8 Million cost savings on the design, construction/installation, and safety documentation scope of $18 Million. These savings were primarily from site design of power distribution and piping for the water treatment units. Also contributing to the savings were a more appropriate level of safety documentation and the alternate ''commercial'' bids made by vendors in response to a request for proposals for water treatment units. The use of the N and S Process on an ER activity, details on the cost savings, lessons learned and recommendations for broader implementation of the N and S Process are described herein

  16. Automated synthesis of n.c.a. [18F]FDOPA via nucleophilic aromatic substitution with [18F]fluoride

    International Nuclear Information System (INIS)

    An improved, automated synthesis of [18F]FDOPA including four synthetic steps (fluorination, reductive iodination, alkylation and hydrolysis) is reported with each step optimized individually. In a home-made automatic synthesizer, 9064±3076 MBq of [18F]FDOPA were produced within 120 min from EOB (n=5). Radiochemical purity and enantiomeric excess were both ≥95%. Specific activity was ca. 50 GBq/μmol at EOS. This automatically operable synthesis is well suited for the multi-patient-dose routine production of n.c.a. [18F]FDOPA.

  17. 14C AMS dates on Rattus exulans bones from natural and archaeological contexts on Norfolk Island, south-west Pacific

    International Nuclear Information System (INIS)

    The Pacific rat (Rattus exulans) was transported throughout the western Pacific by migrant peoples in prehistory. Meredith et al (1985) reported a minimum date for the presence of Rattus exulans on Norfolk Island using dates on charcoal from an apparently enclosing layer (the upper part of their Unit C4) in Cemetery Bay. 8 refs., 3 tabs

  18. A continuous bivariate model for wind power density and wind turbine energy output estimations

    International Nuclear Information System (INIS)

    The wind power probability density function is useful in both the design process of a wind turbine and in the evaluation process of the wind resource available at a potential site. The continuous probability models used in the scientific literature to estimate the wind power density distribution function and wind turbine energy output assume that air density is independent of the wind speed. A constant annual value for air density of 1.225 kg m-3, corresponding to standard conditions (sea level, 15 oC), is generally used. A bivariate probability model (BPM) is presented in this paper for wind power density and wind turbine energy output estimations. This model takes into account the time variability of air density and wind speed, as well as the correlation existing between both variables. Contingency type bivariate distributions with specified marginal distributions have been used for this purpose. The proposed model is applied in this paper to meteorological data (temperature, pressure, relative humidity, wind speed) recorded over a one year period at a weather station located at the facilities of the Technological Institute of the Canary Islands (Spain). The conclusion reached is that the BPM presented in this paper is more realistic than the univariate probability models (UPMs) normally used in the scientific literature. In the particular case under study, and for all the situations analysed, the BPM has provided values for the annual mean wind power density and annual energy output of a wind turbine that fit the sample data better than the UPMs. However, as a result of the climatological characteristics of the area where the analysis was performed, the results do not differ notably from those obtained through the use of a UPM and the mean air density of the area

  19. De Haas - van Alphen effect in f.c.c. ytterbium under high pressure

    International Nuclear Information System (INIS)

    The first measurements concerning the de Haas-van Alphen effect in f.c.c. ytterbium under high pressure are presented. In a direction near to the (110) axis, the oscillation frequency was found to vary linearly as a function of the pressure: from 5.7 MG at 4 kbar to 2.3 MG at 8.6 kbar. The corresponding cyclotron effective mass increases slightly from (0.97+-0.03)m0 at 4 kbar to (1.11+-0.05)m0 at 7.4 kbar. The Dingle temperature was estimated to be (3+-0.8) K. A similarity was established between ytterbium and alkaline earth properties. The results were interpreted in the framework of Altmann, Harford and Blake band-calculations. A good agreement was observed between this interpretation and electron specific heat and magnetic susceptibility measurements. The desagreement observed for transport properties is explained in a simple way

  20. Progress in the development of a SiC{sub f}/SiC creep test

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, M.L.; Lewinsohn, C.A.; Jones, R.H.; Youngblood, G.E.; Garner, F.A. [Pacific Northwest National Lab., Richland, WA (United States); Hecht, S.L.

    1996-10-01

    An effort is now underway to design an experiment that will allow the irradiation creep behavior of SiC{sub f}/SiC composites to be quantified. Numerous difficulties must be overcome to achieve this goal, including determining an appropriate specimen geometry that will fit their radiation volumes available and developing a fabrication procedure for such a specimen. A specimen design has been selected, and development of fabrication methods is proceeding. Thermal and stress analyses are being performed to evaluate the viability of the specimen and to assist with determining the design parameters. A possible alternate type of creep test is also being considered. Progress in each of these areas is described in this report.

  1. CHP Gorzow - first Polish gas-steam CHP with GT8C turbine; EC Gorzow SA - pierwsza w Polsce elektrocieplownia gazowo-parowa z turbina GT8C

    Energy Technology Data Exchange (ETDEWEB)

    Woloncewicz, Z. [Elektrocieplownia Gorzow S.A., Gorzow Wielkopolski, (Poland); Rudny, S. [Energoprojekt Gliwice S.A., Gliwice (Poland); Wronkowski, H.; Dzierzgowski, J. [ABB Zamech Ltd., Elblag, (Poland)

    1996-06-01

    Combined-cycle power plant Gorzow generates heat and electric power for the needs of Gorzow Wielkopolski town and local industry. Old part of the plant with 4 coal-fired units will be replaced by gas-steam CHP in 1998. The basic technical data of CHP are given and GT8C turbine is described. The consequences for environment such as elimination of dust as well as substantial abatement of SO{sub 2} and NO{sub x} emission are stressed. A way of noise abatement is also presented. 7 figs.

  2. Albert Einstein and Wernher von Braun - the two great German-American physicists seen in a historical perspective.

    Science.gov (United States)

    Winterberg, Friedwardt

    2008-04-01

    It was Albert Einstein who for the first time changed our view of the universe to be a non-euclidean curved space-time. And it was Wernher von Braun who blazed the trail to take us into this universe, leaving for the first time the gravitational field of our planet earth, with the landing a man on the moon the greatest event in human history. Both these great physicists did this on the shoulders of giants. Albert Einstein on the shoulders of his landsman, the mathematician Bernhard Riemann, and Wernher von Braun on the shoulders of Goddard and Oberth. Both Einstein and von Braun made a Faustian pact with the devil, von Braun by accepting research funds from Hitler, and Einstein by urging Roosvelt to build the atom bomb (against Hitler). Both of these great men later regretted the use of their work for the killing of innocent bystanders, even though in the end the invention of nuclear energy and space flight is for the benefit of man. Their example serves as a warning for all of us. It can be formulated as follows: ``Can I in good conscience accept research funds from the military to advance scientific knowledge, for weapons developed against an abstract enemy I never have met in person?'' Weapons if used do not differentiate between the scientist, who invented these weapons, and the non-scientist.

  3. Detection of the urban heat island in Mexicali, B. C., México and its relationship with land use

    OpenAIRE

    O.R. García-Cueto; E. Jáuregui-Ostos; D. Toudert; A. Tejeda Martinez

    2007-01-01

    In this paper the urban heat islands (UHI), both atmospheric and surface, and their relationship with the land use in the city of Mexicali, Baja California, México, were examined by means of direct in situ measurements of air temperature, and the use of NOAA´s AVHRR and Ladsat thermal satellite images. The results show the development of a nocturnal urban heat island, whose highest mean value was recorded in autumn (4.5 °C), however during the day-time, in any season of the year, this situati...

  4. ASTM F1717 standard for the preclinical evaluation of posterior spinal fixators: can we improve it?

    Science.gov (United States)

    La Barbera, Luigi; Galbusera, Fabio; Villa, Tomaso; Costa, Francesco; Wilke, Hans-Joachim

    2014-10-01

    Preclinical evaluation of spinal implants is a necessary step to ensure their reliability and safety before implantation. The American Society for Testing and Materials reapproved F1717 standard for the assessment of mechanical properties of posterior spinal fixators, which simulates a vertebrectomy model and recommends mimicking vertebral bodies using polyethylene blocks. This set-up should represent the clinical use, but available data in the literature are few. Anatomical parameters depending on the spinal level were compared to published data or measurements on biplanar stereoradiography on 13 patients. Other mechanical variables, describing implant design were considered, and all parameters were investigated using a numerical parametric finite element model. Stress values were calculated by considering either the combination of the average values for each parameter or their worst-case combination depending on the spinal level. The standard set-up represents quite well the anatomy of an instrumented average thoracolumbar segment. The stress on the pedicular screw is significantly influenced by the lever arm of the applied load, the unsupported screw length, the position of the centre of rotation of the functional spine unit and the pedicular inclination with respect to the sagittal plane. The worst-case combination of parameters demonstrates that devices implanted below T5 could potentially undergo higher stresses than those described in the standard suggestions (maximum increase of 22.2% at L1). We propose to revise F1717 in order to describe the anatomical worst case condition we found at L1 level: this will guarantee higher safety of the implant for a wider population of patients. PMID:25319550

  5. Task 8.4 - High Temperature Turbine Disk Development

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-02-27

    The goal of this task is to demonstrate a bonding technique to produce a dual-alloy turbine disk concept which will satisfy the diverse property requirements of the rim and hub areas of the disk. The program examines methods of attaching a cast superalloy rim with sufficient rupture strength to a fine grain hub materials with the required LCF properties. The goals of the program were established in the context of a preliminary turbine design by Solar Turbines, Inc. designated ATS 5. The initial target for the ATS 5 application was to allow rim operating temperatures in the 1350-1400 {degrees} F range. The life goal of the Dual-Alloy Disk was envisioned to maintain Solar`s standard turbine disk philosophy of 1000,000 hours.

  6. Comparing the strength of f.c.c. and b.c.c. sub-micrometer pillars: Compression experiments and dislocation dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Greer, Julia R. [Department of Materials Science, California Institute of Technology, Pasadena, CA 91125-8100 (United States)], E-mail: jrgreer@caltech.edu; Weinberger, Christopher R.; Cai, Wei [Department of Mechanical Engineering, Stanford University, Stanford, CA 94305-4040 (United States)

    2008-10-15

    We compare mechanical strength of f.c.c. gold and b.c.c. molybdenum single crystal pillars of sub-micrometer diameter in uniaxial compression tests. Both crystals show an increase of flow stress with decreasing diameter, but the change is more pronounced in Au than in Mo. The ratio between the observed maximum flow stress and the theoretical strength is much larger in Au pillars than in Mo pillars. Dislocation dynamics simulations also reveal different dislocation behavior in these two metals. While in a f.c.c. crystal a dislocation loop nucleated from the surface simply moves on its glide plane and exits the pillar, in a b.c.c. crystal it can generate multiple new dislocations due to the ease of screw dislocations to change slip planes. We postulate that this difference in dislocation behavior is the fundamental reason for the observed difference in the plastic deformation behavior of f.c.c. and b.c.c. pillars.

  7. Modeling Temperature Dependence of fT in 4H-SiC Bipolar Transistors

    OpenAIRE

    Hussain, Muhammad Waqar; Rusu, Ana

    2015-01-01

    This paper models the temperature dependence of fT in 4H-SiC bipolar devices. The proposed model describes variation of the constituent parameters of fT as a function of temperature. The model assumes complete ionization of dopants in 4H-SiC. However, this assumption hampers the model’s utilityat temperatures below 300◦C. The model was simulated attemperatures between 300◦C and 700◦C and a drop in fT wasobserved. However, measurements are required to prove thecorrectness of the model or lack ...

  8. Harmonisation of wind turbine certification in Europe JOULE project EWTC

    Energy Technology Data Exchange (ETDEWEB)

    Nath, C. [Germanischer Lloyd, Hamburg (Germany); Eriksson, C. [Det Norske Veritas, Hellerup (Denmark); Hulle, F. van [Frans van Hulle, Petten (Netherlands); Skamris, C. [Risoe National Lab., Roskilde (Denmark); Stam, W. [CIWI Holland, Arnheim (Netherlands); Vionis, P. [CRES, Attki (Greece)

    1999-03-01

    Wind turbine certification requirements are currently fairly divers within Europe. Therefore the leading European certification bodies initiated a JOULE project to harmonise the certification procedure on the basis of the current set of IEC/EN 61400 series standards. The paper presents a review of the state of the art of wind turbine certification in European countries and an outline of the sturcture of the project. The main steps of the project are (a) the collection of differences in certification practices by round robin certification of three wind turbine types; (b) assessment of the different certification results and (c) the development of a harmonised certification procedure. (au) EU-JOULE-3. 19 refs.

  9. Functional control of ZnO nanoparticles by F, C-codoping

    Science.gov (United States)

    Cao, Jialei; Lu, Juan; Zhou, Xiufeng; Wang, Zuoshan; Li, Xiaobin

    2014-12-01

    F, C-codoped ZnO nanoparticles were synthesized by the precipitation method. X-ray photoelectron spectroscopy spectra (XPS) measurements confirmed the existence of F-Zn, C-F, -CF2- and O-C-O bonds in the lattices of ZnO nanoparticles. The band gap of ZnO was narrowed due to F and C dopants, which should be beneficial for the improvement of the photocatalytic activity. However, our experiments demonstrated that F, C-codoping restrained the photocatalytic activity of ZnO nanoparticles. To detect the possible microstructural defects, the analysis of electron paramagnetic resonance (EPR) was performed. It was suggested that the positive-charged F O defects were formed by the substitution of F ions for O lattice sites. F_O^{\\bullet} defects are deep donors and act as recombination centers for photo-generated electrons and holes, which could result in the decrease of the photocatalytic activity. Although the photocatalytic activity of F, C-codoped ZnO is depressed, the antibacterial activity still keeps a comparable level in comparison with that of pure ZnO. Therefore, this material has a potential application in textiles.

  10. Amyloid imaging in cognitively normal older adults: comparison between 18F-flutemetamol and 11C-Pittsburgh compound B

    International Nuclear Information System (INIS)

    Preclinical, or asymptomatic, Alzheimer's disease (AD) refers to the presence of positive AD biomarkers in the absence of cognitive deficits. This research concept is being applied to define target populations for clinical drug development. In a prospective community-recruited cohort of cognitively intact older adults, we compared two amyloid imaging markers within subjects: 18F-flutemetamol and 11C-Pittsburgh compound B (PIB). In 32 community-recruited cognitively intact older adults aged between 65 and 80 years, we determined the concordance between binary classification based on 18F-flutemetamol versus 11C-PIB according to semiquantitative assessment (standardized uptake value ratio in composite cortical volume, SUVRcomp) and, alternatively, according to visual reads. We also determined the correlation between 18F-flutemetamol and 11C-PIB SUVR and evaluated how this was affected by the reference region chosen (cerebellar grey matter versus pons) and the use of partial volume correction (PVC) in this population. Binary classification based on semiquantitative assessment was concordant between 18F-flutemetamol and 11C-PIB in 94 % of cases. Concordance of blinded binary visual reads between tracers was 84 %. The Spearman correlation between 18F-flutemetamol and 11C-PIB SUVRcomp with cerebellar grey matter as reference region was 0.84, with a slope of 0.98. Correlations in neocortical regions were significantly lower with the pons as reference region. PVC improved the correlation in striatum and medial temporal cortex. For the definition of preclinical AD based on 18F-flutemetamol, concordance with 11C-PIB was highest using semiquantitative assessment with cerebellar grey matter as reference region. (orig.)

  11. Measurements of ionization and attachment coefficients in 0.468% and 4.910% c-C4F8/Ar mixtures and pure c-C4F8

    International Nuclear Information System (INIS)

    We measured the density normalized ionization coefficients and attachment coefficients in diluted c-C4F8/Ar mixtures and in pure perfluorocyclobutane (c-C4F8) by the steady-state Townsend method. The ionization coefficients in the mixture gas are almost equal to those in pure argon at the high E/N range but differ considerably at the low E/N range. The present coefficients in pure c-C4F8 agree well with previously reported values at the high E/N range, but there are significant differences at the low E/N range. Measurements in the low E/N range were difficult, and there are few data of the attachment coefficients

  12. The Electronegativity Analysis of c-C4F8 as a Potential Insulation Substitute of SF6

    Science.gov (United States)

    Zhao, Xiaoling; Jiao, Juntao; Li, Bing; Xiao, Dengming

    2016-03-01

    The density distributions related to gas electronegativity for c-C4F8 gas, including negative ion, electron number and electron energy densities in the discharge process, are derived theoretically in both plane-to-plane and point-to-plane electrode geometries. These calculations have been performed through the Boltzmann equation in the condition of a steady-state Townsend (SST) experiment and a fluid model in the condition of both uniform and non-uniform electric fields. The electronegativity coefficients a = n-/ne of c-C4F8 and SF6 are compared to further describe the electron affinity of c-C4F8. The result shows that c-C4F8 represents an obvious electron-attachment performance in the discharge process. However, c-C4F8 still has much weaker gas electronegativity than SF6, whose electronegativity coefficient is lower than that of SF6 by at least three orders of magnitude. supported by National Natural Science Foundation of China (No. 51337006)

  13. Appointing silver and bronze standards for noncovalent interactions: A comparison of spin-component-scaled (SCS), explicitly correlated (F12), and specialized wavefunction approaches

    International Nuclear Information System (INIS)

    A systematic examination of noncovalent interactions as modeled by wavefunction theory is presented in comparison to gold-standard quality benchmarks available for 345 interaction energies of 49 bimolecular complexes. Quantum chemical techniques examined include spin-component-scaling (SCS) variations on second-order perturbation theory (MP2) [SCS, SCS(N), SCS(MI)] and coupled cluster singles and doubles (CCSD) [SCS, SCS(MI)]; also, method combinations designed to improve dispersion contacts [DW-MP2, MP2C, MP2.5, DW-CCSD(T)-F12]; where available, explicitly correlated (F12) counterparts are also considered. Dunning basis sets augmented by diffuse functions are employed for all accessible ζ-levels; truncations of the diffuse space are also considered. After examination of both accuracy and performance for 394 model chemistries, SCS(MI)-MP2/cc-pVQZ can be recommended for general use, having good accuracy at low cost and no ill-effects such as imbalance between hydrogen-bonding and dispersion-dominated systems or non-parallelity across dissociation curves. Moreover, when benchmarking accuracy is desirable but gold-standard computations are unaffordable, this work recommends silver-standard [DW-CCSD(T**)-F12/aug-cc-pVDZ] and bronze-standard [MP2C-F12/aug-cc-pVDZ] model chemistries, which support accuracies of 0.05 and 0.16 kcal/mol and efficiencies of 97.3 and 5.5 h for adenine·thymine, respectively. Choice comparisons of wavefunction results with the best symmetry-adapted perturbation theory [T. M. Parker, L. A. Burns, R. M. Parrish, A. G. Ryno, and C. D. Sherrill, J. Chem. Phys. 140, 094106 (2014)] and density functional theory [L. A. Burns, Á. Vázquez-Mayagoitia, B. G. Sumpter, and C. D. Sherrill, J. Chem. Phys. 134, 084107 (2011)] methods previously studied for these databases are provided for readers' guidance

  14. Gas--steam turbine combined cycle power plants

    Energy Technology Data Exchange (ETDEWEB)

    Christian, J.E.

    1978-10-01

    The purpose of this technology evaluation is to provide performance and cost characteristics of the combined gas and steam turbine, cycle system applied to an Integrated Community Energy System (ICES). To date, most of the applications of combined cycles have been for electric power generation only. The basic gas--steam turbine combined cycle consists of: (1) a gas turbine-generator set, (2) a waste-heat recovery boiler in the gas turbine exhaust stream designed to produce steam, and (3) a steam turbine acting as a bottoming cycle. Because modification of the standard steam portion of the combined cycle would be necessary to recover waste heat at a useful temperature (> 212/sup 0/F), some sacrifice in the potential conversion efficiency is necessary at this temperature. The total energy efficiency ((electric power + recovered waste heat) divided by input fuel energy) varies from about 65 to 73% at full load to 34 to 49% at 20% rated electric power output. Two major factors that must be considered when installing a gas--steam turbine combines cycle are: the realiability of the gas turbine portion of the cycle, and the availability of liquid and gas fuels or the feasibility of hooking up with a coal gasification/liquefaction process.

  15. Simulation for F.C.C. deformation texture by modified pencil glide theory[Face Centered Cubic

    Energy Technology Data Exchange (ETDEWEB)

    Masui, H.

    1999-11-26

    Inspired by the pencil glide theory for b.c.c. metal, modified pencil glide theory for f.c.c. metal was proposed, dividing the 12 glide systems of f.c.c. metal into three groups individually composed of eight {l{underscore}brace}111{r{underscore}brace}{l{underscore}angle}110{r{underscore}angle} glide systems around the principal axes X[100], Y[010] and Z[001]. These assumptions yielded two mathematical solutions {Omega}(3) and {Omega}(1). In {Omega}(3), from the three groups with four complete conjugated glide systems composed of, respectively, two glide systems of common {l{underscore}angle}110{r{underscore}angle} direction, only one group with the maximum plastic work may operate if the requirements are satisfied, otherwise glide systems in {Omega}(1) where one of the four conjugated glide systems is zero are activated. The model considering the 12 glide systems of f.c.c. as a whole explained many experimentally stable orientations in axisymmetric and rolling deformation. The differences between the two pencil glide theories for b.c.c. and f.c.c. are also discussed with data.

  16. Gas turbine GT8C newest hit of ABB Zamech Ltd; Turbina gazowa GT8C najnowszym szlagierem ABB Zamech Ltd

    Energy Technology Data Exchange (ETDEWEB)

    Rutkowiak, L.; Wronkowski, H. [ABB Zamech Ltd, Elblag (Poland). Biuro Turbin Gazowych

    1994-08-01

    The 53 MW turbine produced by ABB Zamech Ltd in Elblag is described. It is a modernized version of GT8 turbine. It`s main characteristics are given and all components of power plants produced in Elblag are shortly described. The production of the modernized turbine is shown on photos. 4 figs., 1 tab., 12 ills.

  17. Effect of temperature on the electron attachment and detachment properties of c-C4F6

    International Nuclear Information System (INIS)

    The temperature dependence of the low-energy electron attachment and autodetachment processes for c-C4F6 in a N2 buffer gas has been studied in the temperature, T, range of 300 to 600 K and the mean electron energy, , range from 0.19 to 1.0 eV. The low-energy electron attachment rate constant for c-C4F6 shows only a slight dependence on gas temperature. In contrast, the autodetachment frequency increases by more than four orders of magnitude when T is increased from 300 to 600 K. This increase in autodetachment is due to the increase in the internal energy content of the c-C4,F6- anion with increasing T. The autodetachment process under consideration is a heat-activated process and has an activation energy E* of 0.24 eV. Significance of these results to gaseous dielectrics is indicated

  18. RAMS/LCC Anforderungen im IRIS Standard - Herausforderung für Unternehmen aus der Schienenfahrzeugindustrie

    Directory of Open Access Journals (Sweden)

    Fatih ÖZTÜRK

    2014-12-01

    Full Text Available Um eine Teilhabe am internationalen Markt zu garantieren bzw. zu ermöglichen ist auch für Unternehmen aus dem Schienensektor ein funktionierendes Qualitätsmanagementsystem von Nöten. Zuspruch fand hierfür vor allem der Branchenstandard IRIS, welches im Jahre 2006 erstmals in Anwendung kam und mittlerweile auch 13 Unternehmen aus der Türkei ein Zertifikat besitzen. Der Trend ist steigend. In vielerlei Hinsicht scheint dieser Standard den Wünschen der Unternehmungen gerecht zu werden, doch auch Unmutstöne sind von einigen zuhören, die besonders auf die geringen Kenntnisse und Erfahrung der einzelnen Klienten zurückzuführen sind. Anzuführen ist auch die Tatsache, dass IRIS ein erst recht neuer Standard ist und deshalb auch je nach Schwierigkeiten und Wünschen des Klientels nach oben hin Aufbaufähig ist. Schwierigkeiten seitens der Befragten Unternehmen sind vor allem im Bereich des RAMS/LCC Management zu hören, die einige Firmen überfordern. In dieser Arbeit wird auch genauer auf dieses eingegangen und genauer aus der Sicht der  Unternehmen betrachtet.

  19. C-CAP Big Island, Hawaii 2005-2010 Land Cover Change Analysis

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains the 2005 and 2010 classifications of Big Island and can be used to analyze change. This data set utilized utilized 7 full or partial...

  20. 基于C8051F040的CAN通信软件设计%Design of CAN Communication Software Base on C8051F040

    Institute of Scientific and Technical Information of China (English)

    冯晓岗; 杨雪芹; 曹洲

    2008-01-01

    本文详细地介绍一种基于C8051F040的军用控制系统中CAN通信软件的设计过程,阐述了C8051F040 CAN控制器构成及访问方式,给出了CAN通信软件的设计流程图及初始化设置,得出了设计和调试过程中应注意的关键问题,为CAN通信软件的设计起到了一定的借鉴作用.

  1. Comparison of API & IEC Standards for Offshore Wind Turbine Applications in the U.S. Atlantic Ocean: Phase II; March 9, 2009 - September 9, 2009

    Energy Technology Data Exchange (ETDEWEB)

    Jha, A.; Dolan, D.; Gur, T.; Soyoz, S.; Alpdogan, C.

    2013-01-01

    This report compares two design guidelines for offshore wind turbines: Recommended Practice for Planning, Designing, and Constructing Fixed Offshore Platform Structures and the International Electrotechnical Commission 61400-3 Design Requirements for Offshore Wind Turbines.

  2. Fundamentals for remote structural health monitoring of wind turbine blades - a preproject. Annex C. Fibre transducer for damage detection in adhesive layers of wind turbine blades

    DEFF Research Database (Denmark)

    Sendrup, P.

    2002-01-01

    suggestion for a micro-bend transducer design specifically suitable for detection of damage in adhesive layers between larger composite structures, as the shellsin a wind turbine blade. Such a damage will cause the joined parts to move slightly relative to each other, and the transducer is designed to change...... displacement transducer for detection of damage in adhesive layers of wind turbine blades. It was chosen to base the transducer on the fibre optic micro-bend principle. The report contains the result of measurementsand optical simulations of light transmittance through optical fibres with micro-bends and a...... optic micro-bend transducer would be in the range between0.5%/um to 1 %/um depending on the number of bends on the fibre. A measurement on the final transducer showed that the sensitivity was 1.2 %/um. A large 50 % change in transmittance, that is easy to measure, is then obtained for displacements of...

  3. A Fault Diagnosis Approach for Gas Turbine Exhaust Gas Temperature Based on Fuzzy C-Means Clustering and Support Vector Machine

    Directory of Open Access Journals (Sweden)

    Zhi-tao Wang

    2015-01-01

    Full Text Available As an important gas path performance parameter of gas turbine, exhaust gas temperature (EGT can represent the thermal health condition of gas turbine. In order to monitor and diagnose the EGT effectively, a fusion approach based on fuzzy C-means (FCM clustering algorithm and support vector machine (SVM classification model is proposed in this paper. Considering the distribution characteristics of gas turbine EGT, FCM clustering algorithm is used to realize clustering analysis and obtain the state pattern, on the basis of which the preclassification of EGT is completed. Then, SVM multiclassification model is designed to carry out the state pattern recognition and fault diagnosis. As an example, the historical monitoring data of EGT from an industrial gas turbine is analyzed and used to verify the performance of the fusion fault diagnosis approach presented in this paper. The results show that this approach can make full use of the unsupervised feature extraction ability of FCM clustering algorithm and the sample classification generalization properties of SVM multiclassification model, which offers an effective way to realize the online condition recognition and fault diagnosis of gas turbine EGT.

  4. The derivation of 14C dating standards for fresh-water shell-fish

    International Nuclear Information System (INIS)

    14C analyses of hyridella shell-fish from four different localities were used to determine suitable 14C dating standards for these shell-fish. For each locality the dating standard deduced was considerably less than the 0.95 NBS oxalic acid standard, and notably the estimated standard for a group of Lake Taupo shell-fish was estimated to be only 55% to 62% of the NBS oxalic acid standard level. Variability of hyridella 14C standards with locality and time may limit the confidence that can be placed in radiocarbon dates from hyridella

  5. On Univalence of the Power Deformation z(f(z)/z)c

    Institute of Scientific and Technical Information of China (English)

    Yong Chan KIM; Toshiyuki SUGAWA

    2012-01-01

    The authors mainly concern the set Uf of c ∈( C) such that the power deformationz(f(z/z))c is univalent in the unit disk |z| < 1 for a given analytic univalent function f(z) =z + a2z2 +...in the unit disk.It is shown that Uf is a compact,polynomially convex subset of the complex plane (C) unless f is the identity function.In particular,the interior of Uf is simply connected.This fact enables us to apply various versions of the λ-lemma for the holomorphic family z(f(z)/z)c of injections parametrized over the interior of Uf.The necessary or sufficient conditions for Uf to contain 0 or 1 as an interior point are also given.

  6. Equilibrium Structures and Isomerization Reactions of the Unsaturated Germylenoid H2C=GeLiF

    Institute of Scientific and Technical Information of China (English)

    LI Wen-Zuo; CHENG Jian-Bo; GONG Bao-An; XIAO Cui-Ping

    2007-01-01

    The unsaturated germylenoid H2C=GeLiF has been studied by using DFT method at the B3LYP/6-311+G (d, p) level. Geometry optimization calculations indicate that H2C=GeLiF has three equilibrium configurations, in which the p-complex is the lowest in energy and the most stable structure. Two transition states for isomerization reactions of H2C=GeLiF are located and the energy barriers are calculated. For the most stable one, vibrational frequencies and infrared intensities have been predicted.

  7. Bridging Binding Modes of Phosphine-Stabilized Nitrous Oxide to Zn(C6F5)2

    OpenAIRE

    Neu, Rebecca C.; Otten, Edwin; Stephan, Douglas W.

    2009-01-01

    Reaction of [tBu3PN2O(B(C6H4F)3)] with 1, 1.5, or 2 equivalents of Zn(C6F5)2 affords the species [{tBu3PN2OZn(C6F5)2}2], [{tBu3PN2OZn(C6F5)2}2Zn(C6F5)2], and [tBu3PN2O{Zn(C6F5)2}2] displaying unique binding modes of Zn to the phosphine-stabilized N2O fragment.

  8. Future needs and requirements for AMS C-14 standards and reference materials

    NARCIS (Netherlands)

    Scott, EM; Boaretto, E; Bryant, C; Cook, GT; Gulliksen, S; Harkness, DD; Heinemeier, J; McGee, E; Naysmith, P; Possnert, G; van der Plicht, H; van Strydonck, M; Cook, Gordon T.

    2004-01-01

    C-14 measurement uses a number of standards and reference materials with different properties. Historically the absolute calibration of C-14 measurement was tied to 1890 wood, through the 'primary' standard of NBS-OxI (produced by the National Bureau of Standards, now NIST - National Institute of St

  9. Dissociative electron attachment to C{sub 2}F{sub 5} radicals

    Energy Technology Data Exchange (ETDEWEB)

    Haughey, Sean A.; Field, Thomas A. [Centre for Plasma Physics, School of Mathematics and Physics, Queen' s University Belfast, Belfast BT7 1NN (United Kingdom); Langer, Judith [Technische Universitaet Berlin, Institut Optik und Atomare Physik, Hardenbergstr. 36, 10623 Berlin (Germany); Shuman, Nicholas S.; Miller, Thomas M.; Friedman, Jeffrey F.; Viggiano, A. A. [Air Force Research Laboratory, Space Vehicles Directorate, Kirtland Air Force Base, New Mexico 87117-5776 (United States)

    2012-08-07

    Dissociative electron attachment to the reactive C{sub 2}F{sub 5} molecular radical has been investigated with two complimentary experimental methods; a single collision beam experiment and a new flowing afterglow Langmuir probe technique. The beam results show that F{sup -} is formed close to zero electron energy in dissociative electron attachment to C{sub 2}F{sub 5}. The afterglow measurements also show that F{sup -} is formed in collisions between electrons and C{sub 2}F{sub 5} molecules with rate constants of 3.7 Multiplication-Sign 10{sup -9} cm{sup 3} s{sup -1} to 4.7 Multiplication-Sign 10{sup -9} cm{sup 3} s{sup -1} at temperatures of 300-600 K. The rate constant increases slowly with increasing temperature, but the rise observed is smaller than the experimental uncertainty of 35%.

  10. 45 CFR Appendix A to Subpart C of... - Security Standards: Matrix

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Security Standards: Matrix A Appendix A to Subpart C of Part 164 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA STANDARDS... Standards: Matrix Standards Sections Implementation Specifications (R)=Required,...

  11. Using Florida Keys Reference Sites As a Standard for Restoration of Forest Structure in Everglades Tree Islands

    OpenAIRE

    Pablo L. Ruiz; Ross, Michael S.; Danielle E. Ogurcak; Jay P. Sah

    2010-01-01

    In south Florida, tropical hardwood forests (hammocks) occur in Everglades tree islands and as more extensive forests in coastal settings in the nearby Florida Keys. Keys hammocks have been less disturbed by humans, and many qualify as “old-growth,” while Everglades hammocks have received much heavier use. With improvement of tree island condition an important element in Everglades restoration efforts, we examined stand structure in 23 Keys hammocks and 69 Everglades tree isla...

  12. Measurement of Small Molecular Dopant F4TCNQ and C60F36 Diffusion in Organic Bilayer Architectures.

    Science.gov (United States)

    Li, Jun; Rochester, Chris W; Jacobs, Ian E; Friedrich, Stephan; Stroeve, Pieter; Riede, Moritz; Moulé, Adam J

    2015-12-30

    The diffusion of molecules through and between organic layers is a serious stability concern in organic electronic devices. In this work, the temperature-dependent diffusion of molecular dopants through small molecule hole transport layers is observed. Specifically we investigate bilayer stacks of small molecules used for hole transport (MeO-TPD) and p-type dopants (F4TCNQ and C60F36) used in hole injection layers for organic light emitting diodes and hole collection electrodes for organic photovoltaics. With the use of absorbance spectroscopy, photoluminescence spectroscopy, neutron reflectometry, and near-edge X-ray absorption fine structure spectroscopy, we are able to obtain a comprehensive picture of the diffusion of fluorinated small molecules through MeO-TPD layers. F4TCNQ spontaneously diffuses into the MeO-TPD material even at room temperature, while C60F36, a much bulkier molecule, is shown to have a substantially higher morphological stability. This study highlights that the differences in size/geometry and thermal properties of small molecular dopants can have a significant impact on their diffusion in organic device architectures. PMID:26673846

  13. Atmospheric chemistry of C2F5CHO: reaction with Cl atoms and OH radicals, IR spectrum of C2F5C(O)O2NO2

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Hurley, MD; Wallington, TJ;

    2003-01-01

    Smog chamber/FTIR techniques were used to measure k(Cl + C2F5CHO) = (1. 96 +/- 0.28) X 10(-12) and k(OH + C2F5CHO) = (5.26 +/- 0.80) x 10(-13) cm(3) molecule(-1) s(-1) in 700 Torr of N-2 or air at 296 +/- 2 K. The C1 initiated oxidation Of C2F5CHO in the presence of NO in air diluent gave COF2, CF3......ONO2, and C2F5C(O)O2NO2 in molar yields of 180 +/- 19 6.1 +/- 0.6 and 1.0 +/- 0.3 respectively. The IR spectrum for C2F5C(O)O2NO2 is reported. Results are discussed with respect to the potential for the atmospheric degradation of fluorinated aldehydes, CnF2n+1CHO, to contribute to the observed...... environmental burden of fluorinated carboxylic acids, CnF2n+1C(O)OH. (C) 2003 Elsevier B.V. All rights reserved....

  14. CAN Bus Communication Based on C8051F040%基于C8051F040的CAN总线通信

    Institute of Scientific and Technical Information of China (English)

    李如石; 张津津; 任富争

    2013-01-01

    In the communications system of railroad train, because of rapid transmission and high reliability, CAN bus obtains the widespread application. Firstly, this article briefly describes the origin and characteristic of CAN bus. Secondly an introduction of C8051F040 microcontroller unit and CAN controlled. 0 is narrated. Finally, it takes the FFR and C8051F040 as an example of communication. The communication program completes initialization, receiving and sending.%在铁路列车通信系统中,CAN总线通信以其传输速率快,可靠性高而得到广泛应用.本文首先简单介绍CAN总线的起源及特点,其次简要介绍C8051F040单片机及其内部芯片CAN2.0控制器,最后以柴油机控制单元FFR与C8051F040间的数据通信为例,编写CAN总线初始化程序、数据接收程序和数据发送程序.

  15. Simulation of electricity supply of an Atlantic island by offshore wind turbines and wave energy converters associated with a medium scale local energy storage

    International Nuclear Information System (INIS)

    The problem of sizing an electricity storage for a 5000 inhabitants island supplied by both marine renewables (offshore wind and waves) and the mainland grid is addressed by a case study based on a full year resource and consumption data. Generators, transmission lines and battery storage are accounted for through basic simplified models while the focus is put on electricity import/export budget. Self-sufficiency does not seem a reasonable goal to pursue, but partial autonomy provided by renewable sources and a medium size storage would probably be profitable to the island community. (author)

  16. Evaluation results of the 700 deg C Chinese strain gauges. [for gas turbine engine

    Science.gov (United States)

    Hobart, H. F.

    1985-01-01

    Gauges fabricated from specially developed Fe-Cr-Al-V-Ti-Y alloy wire in the Republic of China were evaluated for use in static strain measurement of hot gas turbine engines. Gauge factor variation with temperature, apparent strain, and drift were included. Results of gauge factor versus temperature tests show gauge factor decreasing with increasing temperature. The average slope is -3-1/2 percent/100 K, with an uncertainty band of + or - 8 percent. Values of room temperature gauge factor for the Chinese and Kanthal A-1 gauges averaged 2.73 and 2.12, respectively. The room temperature gauge factor of the Chinese gauges was specified to be 2.62. The apparent strain data for both the Chinese alloy and Kanthal A-1 showed large cycle to cycle nonrepeatability. All apparent strain curves had a similar S-shape, first going negative and then rising to positive value with increasing temperatures. The mean curve for the Chinese gauges between room temperature and 100 K had a total apparent strain of 1500 microstrain. The equivalent value for Kanthal A-1 was about 9000 microstrain. Drift tests at 950 K for 50 hr show an average drift rate of about -9 microstrain/hr. Short-term (1 hr) rates are higher, averaging about -40 microstrain for the first hour. In the temperature range 700 to 870 K, however, short-term drift rates can be as high as 1700 microstrain for the first hour. Therefore, static strain measurements in this temperature range should be avoided.

  17. 46 CFR 154.625 - Design temperature below 0 °C (32 °F) and down to −165 °C (−265 °F).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below 0 °C (32 °F) and down to â165... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.625 Design temperature below 0 °C (32 °F... process piping for a design temperature below 0 °C (32 °F) and down to −165 °C (−265 °F) must meet §...

  18. Standardization of (18)F using the 4pi(beta+gamma) integral counting technique.

    Science.gov (United States)

    Yamada, T; Kawada, Y; Sato, Y; Yunoki, A; Hino, Y

    2008-01-01

    Alpha 4pi(beta+gamma) integral counting technique using a 4pibeta-4pigamma detector configuration was adopted for the standardization of (18)F. In this technique, the beta-detector is composed of two thin plastic scintillators sandwiching the source, coupled with a slender photomultiplier tube. The beta-detector part with the source was inserted into a large well-type NaI(Tl) scintillation detector for gamma-ray detection, making a 4pibeta-4pigamma coincidence counting system. In this work, positron particles were detected with high efficiency in the beta-channel and annihilation quanta were also detected with high efficiency in the 4pigamma channel. The very small inefficiency of the 4pi(beta+gamma) integral counter for the beta-plus branch has been confirmed by EGS5 Monte Carlo simulation. The result using this technique agreed within the uncertainties with the result obtained by the conventional 4pibeta-gamma coincidence counting with the efficiency extrapolation technique using the same detector configuration and a conventional 4pibeta-gamma coincidence counter. PMID:18378155

  19. Ein Molekül-Atom-Datenmodell für Non-Standard-Anwendungen : Anwendungsanalyse, Datenmodellentwurf und Implementierungskonzepte

    OpenAIRE

    Mitschang, Bernhard

    1988-01-01

    Ziel der vorliegenden Arbeit ist die Erarbeitung und Nutzbarmachung von Datenbankkonzepten für sog. Non-Standard-Anwendungen. Darunter versteht man im OB-Bereich Anwendungen aus den Gebieten CAD/CAM, VLSI-Entwurf, Software-Entwicklung, Büroautomatisierung, Expertensysteme etc. Die zentralen Fragestellungen, zu denen es Antworten zu finden gilt, sind: - Welche Anforderungen werden von den Non-Standard-Anwendungen an die Datenhaltung gestellt? - Wie sehen dazu passende Architekturen und D...

  20. An atmospheric-pressure plasma process for C2F6 removal.

    Science.gov (United States)

    Chang, M B; Yu, S J

    2001-04-15

    Perfluorocompounds (PFCs) are widely used in the semiconductor industry for plasma etching and chemical vapor deposition (CVD). They are relatively inert gases that intensely absorb infrared radiation and, therefore, aggravate the greenhouse effect. A bench-scale experimental system was designed and constructed to evaluate the effectiveness of C2F6 conversion by using dielectric barrier discharges (DBD) with atmospheric-pressure plasma processing. Experimental results indicated that the removal efficiency of C2F6 increased with applications of higher voltage and frequency. Combined plasma catalysis (CPC) is an innovative way for abatement of PFCs, and experimental results revealed that combining plasma generation with catalysts could effectively enhance C2F6 removal efficiency achieved with DBD. The major products of C2F6 with DBD processing include CO2, COF2, and CO, when O2 was included in the discharge process. Experimental results indicated that as high as 94.5% of C2F6 were removed via CPC at applied voltage of 15 kV, frequency of 240 Hz in the gas stream of N2:Ar:O2:C2F6 = 50:40:10:0.03. PMID:11329706

  1. EBV Nuclear Antigen 3C Mediates Regulation of E2F6 to Inhibit E2F1 Transcription and Promote Cell Proliferation.

    Science.gov (United States)

    Pei, Yonggang; Banerjee, Shuvomoy; Sun, Zhiguo; Jha, Hem Chandra; Saha, Abhik; Robertson, Erle S

    2016-08-01

    Epstein-Barr virus (EBV) is considered a ubiquitous herpesvirus with the ability to cause latent infection in humans worldwide. EBV-association is evidently linked to different types of human malignancies, mainly of epithelial and lymphoid origin. Of interest is the EBV nuclear antigen 3C (EBNA3C) which is critical for EBV-mediated immortalization. Recently, EBNA3C was shown to bind the E2F1 transcription regulator. The E2F transcription factors have crucial roles in various cellular functions, including cell cycle, DNA replication, DNA repair, cell mitosis, and cell fate. Specifically, E2F6, one of the unique E2F family members, is known to be a pRb-independent transcription repressor of E2F-target genes. In our current study, we explore the role of EBNA3C in regulating E2F6 activities. We observed that EBNA3C plays an important role in inducing E2F6 expression in LCLs. Our study also shows that EBNA3C physically interacts with E2F6 at its amino and carboxy terminal domains and they form a protein complex in human cells. In addition, EBNA3C stabilizes the E2F6 protein and is co-localized in the nucleus. We also demonstrated that both EBNA3C and E2F6 contribute to reduction in E2F1 transcriptional activity. Moreover, E2F1 forms a protein complex with EBNA3C and E2F6, and EBNA3C competes with E2F1 for E2F6 binding. E2F6 is also recruited by EBNA3C to the E2F1 promoter, which is critical for EBNA3C-mediated cell proliferation. These results demonstrate a critical role for E2F family members in EBV-induced malignancies, and provide new insights for targeting E2F transcription factors in EBV-associated cancers as potential therapeutic intervention strategies. PMID:27548379

  2. Seroprevalence of Human Immunodeficiency Virus, Hepatitis B Virus, Hepatitis C Virus, and Treponema pallidum Infections among Blood Donors on Bioko Island, Equatorial Guinea.

    Directory of Open Access Journals (Sweden)

    Dong-De Xie

    Full Text Available Regular screening of transfusion-transmissible infections (TTIs, such as human immunodeficiency virus (HIV, hepatitis B and hepatitis C virus (HBV and HCV, respectively, and Treponema pallidum, in blood donors is essential to guaranteeing clinical transfusion safety. This study aimed to determine the seroprevalence of four TTIs among blood donors on Bioko Island, Equatorial Guinea (EG.A retrospective survey of blood donors from January 2011 to April 2013 was conducted to assess the presence of HIV, HBV, HCV and T. pallidum. The medical records were analyzed to verify the seroprevalence of these TTIs among blood donations stratified by gender, age and geographical region.Of the total 2937 consecutive blood donors, 1098 (37.39% had a minimum of one TTI and 185 (6.29% harbored co-infections. The general seroprevalence of HIV, HBV, HCV and T. pallidum were 7.83%, 10.01%, 3.71% and 21.51%, respectively. The most frequent TTI co-infections were HBV-T. pallidum 60 (2.04% and HIV-T. pallidum 46 (1.57%. The seroprevalence of HIV, HBV, HCV and T. pallidum were highest among blood donors 38 to 47 years, 18 to 27 years and ≥ 48 years age, respectively (P<0.05. The seroprevalence of TTIs varied according to the population from which the blood was collected on Bioko Island.Our results firstly provide a comprehensive overview of TTIs among blood donors on Bioko Island. Strict screening of blood donors and improved hematological examinations using standard operating procedures are recommended.

  3. Mechanism study of c.f.c Fe-Ni-Cr alloy corrosion in supercritical water

    International Nuclear Information System (INIS)

    Supercritical water can be use as a high pressure coolant in order to improve the thermodynamic efficiency of power plants. For nuclear concept, lifetime is an important safety parameter for materials. Thus materials selection criteria concern high temperature yield stress, creep resistance, resistance to irradiation embrittlement and also to both uniform corrosion and stress corrosion cracking.This study aims for supplying a new insight on uniform corrosion mechanism of Fe-Ni-Cr f.c.c. alloys in deaerated supercritical water at 600 C and 25 MPa. Corrosion tests were performed on 316L and 690 alloys as sample autoclaves taking into account the effect of surface finishes. Morphologies, compositions and crystallographic structure of the oxides were determined using FEG scanning electron microscopy, glow discharge spectroscopy and X-ray diffraction. If supercritical water is expected to have a gas-like behaviour in the test conditions, the results show a significant dissolution of the alloy species. Thus the corrosion in supercritical water can be considered similar to corrosion in under-critical water assuming the higher temperature and its effect on the solid state diffusion. For alloy 690, the protective oxide layer formed on polished surface consists of a chromia film topped with an iron and nickel mixed chromite or spinel. The double oxide layer formed on 316L steel seems less protective with an outer porous layer of magnetite and an inhomogeneous Cr-rich inner layer. For each alloy, the study of the inner protective scale growth mechanisms by marker or tracer experiments reveals that diffusion in the oxide scale is governed by an anionic process. However, surface finishes impact deeply the growth mechanisms. Comparisons between the results for the steel suggest that there is a competition between the oxidation of iron and chromium in supercritical water. Sufficient available chromium is required in order to form a thin oxide layer. Highly deformed or ultra fine

  4. Using Florida Keys Reference Sites As a Standard for Restoration of Forest Structure in Everglades Tree Islands

    International Nuclear Information System (INIS)

    In south Florida, tropical hardwood forests (hammocks) occur in Everglades tree islands and as more extensive forests in coastal settings in the nearby Florida Keys. Keys hammocks have been less disturbed by humans, and many qualify as old-growth, while Everglades hammocks have received much heavier use. With improvement of tree island condition an important element in Everglades restoration efforts, we examined stand structure in 23 Keys hammocks and 69 Everglades tree islands. Based on Stand Density Index and tree diameter distributions, many Everglades hammocks were characterized by low stocking and under-representation in the smaller size classes. In contrast, most Keys forests had the dense canopies and open under stories usually associated with old-growth hardwood hammocks. Subject to the same caveats that apply to off-site references elsewhere, structural information from mature Keys hammocks can be helpful in planning and implementing forest restoration in Everglades tree islands. In many of these islands, such restoration might involve supplementing tree stocking by planting native trees to produce more complete site utilization and a more open under story.

  5. Using Florida Keys Reference Sites As a Standard for Restoration of Forest Structure in Everglades Tree Islands

    Directory of Open Access Journals (Sweden)

    Michael S. Ross

    2010-01-01

    Full Text Available In south Florida, tropical hardwood forests (hammocks occur in Everglades tree islands and as more extensive forests in coastal settings in the nearby Florida Keys. Keys hammocks have been less disturbed by humans, and many qualify as “old-growth,” while Everglades hammocks have received much heavier use. With improvement of tree island condition an important element in Everglades restoration efforts, we examined stand structure in 23 Keys hammocks and 69 Everglades tree islands. Based on Stand Density Index and tree diameter distributions, many Everglades hammocks were characterized by low stocking and under-representation in the smaller size classes. In contrast, most Keys forests had the dense canopies and open understories usually associated with old-growth hardwood hammocks. Subject to the same caveats that apply to off-site references elsewhere, structural information from mature Keys hammocks can be helpful in planning and implementing forest restoration in Everglades tree islands. In many of these islands, such restoration might involve supplementing tree stocking by planting native trees to produce more complete site utilization and a more open understory.

  6. A Low Cost C8051F006 SoC-Based Quasi-Static C-V Meter for Characterizing Semiconductor Devices

    Directory of Open Access Journals (Sweden)

    Khairurrijal Khairurrijal

    2012-10-01

    Full Text Available Based on a C8051F006 SoC (system on-a-chip, a simple and low cost quasi-static capacitance-voltage (C-V meter was designed and developed to obtain C-V characteristics of semiconductor devices. The developed C-V meter consists of a capacitance meter, a programmable voltage source, a C8051F006 SoC-based slave controller, and a personal computer (PC as a master controller. The communication between the master and slave controllers is facilitated by the RS 232 serial communication. The accuracy of the C-V meter was guaranteed by the calibration functions, which are employed by the program in the PC and obtained through the calibration processes of analog to digital converter (ADC, digital to analog converters (DACs of the C8051F006 SoC, and the programmable voltage source.  Examining 33-pF and 1000-pF capacitors as well three different p-n junction diodes, it was found that the capacitances of common capacitors are in the range of specified values and typical C-V curves of p-n junction diodes are achieved.

  7. SF6 and C4F8 global kinetic models coupled to sheath models

    International Nuclear Information System (INIS)

    Global kinetic models combined with Monte Carlo sheath models are developed for SF6 and C4F8 plasma discharges for silicon etching under the Bosch process. In SF6 plasma, the dominant positive ions are SF5+, SF4+, SF3+ and F+ while in C4F8 the dominant positive ions are CF3+ and C2F3+. The simulation results show that the electrical parameters, such as the electron density and electron temperature, clearly affect the sheath dynamics and consequently the ion energy distribution function evolutions. In this context, we showed the effects of the operating conditions, such as the pressure and the radiofrequency power, on the electron density and electron temperature evolutions as well as the reactive particle fluxes (neutral and positive ions) involved in the plasma surface interactions for etching/deposition under the Bosch process. Ion energy distribution functions obtained from SF6 and C4F8 plasmas are compared with each other as regards the electrical properties of their associated plasmas. The simulation results show that the bimodal peaks of ion energy distribution functions are wider for SF6 plasma than for C4F8 plasma due to the high sheath thickness of SF6 compared to that of C4F8. This is explained by the low electron density due to the high electronegativity of SF6 in comparison to that of C4F8. The simulations also reveal that the bimodal peak of the ion energy distribution function is wider when the ion mass is low. (paper)

  8. Air Density Climate of Two Caribbean Tropical Islands and Relevance to Wind Power

    OpenAIRE

    Xsitaaz Twinkle Chadee; Ricardo Marcus Clarke

    2013-01-01

    The standard air density of 1.225 kg m−3 is often used in determining the energy output of a wind turbine although the energy output is dependent on a site's air density. By using measurements of temperature, dew-point temperature, and pressure, we calculate the monthly air density of moist tropical climates at two sites in the small-island state of Trinidad and Tobago. In addition, we calculate the energy output of a BOREAS 30 kW small wind turbine using the 10 m level wind speed distributio...

  9. Uso de C3F8 no descolamento da membrana de Descemet pós-facectomia C3F8 use in Descemet detachment after cataract surgery

    Directory of Open Access Journals (Sweden)

    Abrahão da Rocha Lucena

    2006-06-01

    Full Text Available INTRODUÇÃO: O descolamento da membrana de Descemet é complicação rara, mas devastadora após facectomia. Algumas alternativas têm sido usadas para reposição da Descemet: bolha de ar, sutura com transfixação da córnea, viscoelástico associado com bolha de ar e gás SF6 ou C3F8. O transplante de córnea é o último recurso utilizado. OBJETIVO: Avaliar os resultados anatômicos e funcionais, do descolamento iatrogênico da membrana de Descemet, com uso de C3F8 (16% na câmara anterior em seis olhos pós-facectomia. MÉTODOS: Após colocação de 0,5 ml do gás em câmara anterior avaliou-se localização justa-estromal da membrana de Descemet em lâmpada de fenda. Os olhos com deslocamento superior/central eram orientados a ficar em decúbito elevado por dois dias e no caso do deslocamento inferior solicitamos decúbito dorsal com leve supraversão. RESULTADOS: A média de idade foi de 71,3 ± 9,3 anos, sendo quatro do sexo feminino e dois do sexo masculino. Todos os olhos tiveram sucesso com a colocação do C3F8, havendo aumento da pressão intra-ocular em um caso. O edema corneano regrediu a partir do segundo dia com resolução completa até o quarto dia. A acuidade visual melhorou em todos os casos logo após regressão do edema, sendo reavaliada quarenta e cinco dias depois. CONCLUSÃO: A introdução unicamente do gás C3F8 não expansivo para colar a membrana de Descemet é citado pela primeira vez na literatura brasileira. O restabelecimento da acuidade visual é rápida, o método é seguro, efetivo e de fácil execução, sendo realizado sob anestesia tópica.INTRODUCTION: Descemet's membrane detachment is a rare but serious complication following cataract surgery. Extensive detachments that affect the visual axis may result in poor vision and require penetrating corneal grafts. Some alternatives have been used to reattach Descemet's membrane: air bubble, transcorneal sutures and intracameral viscoelastic gel plus SF6 or C3F

  10. The unexpectedly bright comet C/2012 F6 (Lemmon) unveiled at near-infrared wavelengths

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Lucas; DiSanti, Michael A.; Mumma, Michael J.; Villanueva, Geronimo L.; Bonev, Boncho P. [Goddard Center for Astrobiology, NASA GSFC, MS 690, Greenbelt, MD 20771 (United States); Keane, Jacqueline V.; Meech, Karen J. [Institute for Astronomy, University of Hawaii, Honolulu, HI 96822 (United States); Gibb, Erika L. [Department of Physics and Astronomy, University of Missouri, St. Louis, MO 63121 (United States); Boehnhardt, Hermann, E-mail: lucas.paganini@nasa.gov [Max-Planck-Institut für Sonnensystemforschung, D-37191, Katlenburg-Lindau (Germany)

    2014-01-01

    We acquired near-infrared spectra of the Oort cloud comet C/2012 F6 (Lemmon) at three different heliocentric distances (R {sub h}) during the comet's 2013 perihelion passage, providing a comprehensive measure of the outgassing behavior of parent volatiles and cosmogonic indicators. Our observations were performed pre-perihelion at R {sub h} = 1.2 AU with CRIRES (on 2013 February 2 and 4), and post-perihelion at R {sub h} = 0.75 AU with CSHELL (on March 31 and April 1) and R {sub h} = 1.74 AU with NIRSPEC (on June 20). We detected 10 volatile species (H{sub 2}O, OH* prompt emission, C{sub 2}H{sub 6}, CH{sub 3}OH, H{sub 2}CO, HCN, CO, CH{sub 4}, NH{sub 3}, and NH{sub 2}), and obtained upper limits for two others (C{sub 2}H{sub 2} and HDO). One-dimensional spatial profiles displayed different distributions for some volatiles, confirming either the existence of polar and apolar ices, or of chemically distinct active vents in the nucleus. The ortho-para ratio for water was 3.31 ± 0.33 (weighted mean of CRIRES and NIRSPEC results), implying a spin temperature >37 K at the 95% confidence limit. Our (3σ) upper limit for HDO corresponds to D/H < 2.45 × 10{sup –3} (i.e., <16 Vienna Standard Mean Ocean Water, VSMOW). At R {sub h} = 1.2 AU (CRIRES), the production rate for water was Q(H{sub 2}O) = 1.9 ± 0.1 × 10{sup 29} s{sup –1} and its rotational temperature was T {sub rot} ∼ 69 K. At R {sub h} = 0.75 AU (CSHELL), we measured Q(H{sub 2}O) = 4.6 ± 0.6 × 10{sup 29} s{sup –1} and T {sub rot} = 80 K on March 31, and 6.6 ± 0.9 × 10{sup 29} s{sup –1} and T {sub rot} = 100 K on April 1. At R {sub h} = 1.74 AU (NIRSPEC), we obtained Q(H{sub 2}O) = 1.1 ± 0.1 × 10{sup 29} s{sup –1} and T {sub rot} ∼ 50 K. The measured volatile abundance ratios classify comet C/2012 F6 as rather depleted in C{sub 2}H{sub 6} and CH{sub 3}OH, while HCN, CH{sub 4}, and CO displayed abundances close to their median values found among comets. H{sub 2}CO was the only volatile

  11. Bluetooth Low Energy som trådlös standard för hemautomation

    OpenAIRE

    Englund, Albin; Suther, Magnus

    2013-01-01

    Allmänheten har en stor efterfrågan av produkter inom området för hemautomation. Den senaste bluetoothstandarden Bluetooth Low Energy skapar nya möjligheter för intressanta produkter som underlättar vardagen. Lösningar som IR och Wi-Fi ger inte de förutsättningar som krävs för att på ett energisnålt och praktiskt sätt erbjuda sådana produkter, något som Bluetooth Low Energy gör. I denna rapport diskuteras standarden i syfte att redogöra för hur den kan användas för att automatisera ett hem. F...

  12. Wind turbine

    International Nuclear Information System (INIS)

    The title invention concerns a wind turbine with a rotor, consisting of a number of blades, each with a front edge and an irregular shaped (sawtooth) back edge. This wind turbine aims at reducing the noise pollution of wind turbines. 1 fig

  13. Design and implementation of photon correlator based on C8051F

    Science.gov (United States)

    Shen, Jin; Li, Yuming; Liu, Wei; Yang, Yan; Cheng, Yanting

    2008-02-01

    Correlation techniques are widely used to extract spectral information from light scattering and other stochastic processes. Within the photon correlation system, the correlating operation must work at a high speed. In this paper, a photon correlator based on microcontroller C8051F was developed. In the photon correlator, the work of counting and scratch is completed by the two 4-bits binary adder 74F161, which is connected to form an 8-bits adder., and the correlation operation of every channel is carried out by the software of C8051F. By probably choosing high speed devices counting of 10ns in width pulses can be counted. The correlation operations including multiplying and addition operation of 56 channels with the circulation program within 3μs were made in interrupt service routine of the C8051F. The work in this paper can be applied in the ultra-fine particle sizing with photon correlation spectroscopy.

  14. Plasma deposition of fluorocarbon thin films from c-C4F8 using pulsed and continuous rf excitation

    International Nuclear Information System (INIS)

    Fluorocarbon films of varying composition have been deposited from pulsed and continuous plasmas of octafluorocyclobutane (c-C4F8) and c-C4F8/Ar. Continuous plasma deposition rates are a very weak function of applied rf power (may be within experimental error). Pulsed plasma deposition rates are significantly lower than continuous plasma rates at the same average power. The pulsed plasma deposition rates can be attributed almost entirely to the plasma on time during the pulse, but there is a slight dependence on pulse off time. Ar addition affects the deposition rates through a residence time effect, but also affects the deposition chemistry by reducing the degree of C4F8 dissociation, resulting in more fluorinated films. Refractive indices for all films increase approximately linearly with applied rf power, with the pulsed plasma-deposited films falling on the same curve. Carbon 1s x-ray photoelectron spectroscopy shows that the continuous plasma-deposited films become increasingly fluorinated as the rf power is decreased. Pulsed plasma films are more fluorinated than similar average power continuous plasma films: 44% CF2 for 10/50 (400 W on time, 67 W average power) versus 37% for 50 W continuous. Literature and preliminary gas-phase measurements suggest that the C4F8 is not fully dissociated in either plasma system and that larger species in the gas phase may play a significant role in the deposition mechanisms

  15. NODC Standard Format Marine Mammals of Coastal Alaska Data (1975-1976): Marine Mammal Sighting 2 (F026) (NODC Accession 0014151)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC maintains data in three NODC Standard Format Marine Mammal Data Sets: Marine Mammal Sighting and Census (F127); Marine Mammal Specimens (F025); Marine Mammal...

  16. Both core and F proteins of hepatitis C virus could enhance cell proliferation in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Wen-Ta [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Li, Hui-Chun [Department of Biochemistry, Tzu Chi University, Hualien, Taiwan (China); Lee, Shen-Kao; Ma, Hsin-Chieh; Yang, Chee-Hing; Chen, Hung-Ling [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Lo, Shih-Yen, E-mail: losylo@mail.tcu.edu.tw [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Department of Laboratory Medicine, Buddhist Tzu Chi General Hospital, Hualien, Taiwan (China)

    2013-05-24

    Highlights: •HCV core and F proteins could induce hepatocyte proliferation in the transgenic mice. •β-Catenin signaling pathway was activated by core protein in the transgenic mice. •β-Catenin signaling pathway was activated by myc-F protein in the transgenic mice. •Expression of SMA protein was enhanced by core but not myc-F protein. -- Abstract: The role of the protein encoded by the alternative open reading frame (ARF/F/core+1) of the Hepatitis C virus (HCV) genome in viral pathogenesis remains unknown. The different forms of ARF/F/core+1 protein were labile in cultured cells, a myc-tag fused at the N-terminus of the F protein made it more stable. To determine the role of core and F proteins in HCV pathogenesis, transgenic mice with either protein expression under the control of Albumin promoter were generated. Expression of core protein and F protein with myc tag (myc-F) could be detected by Western blotting analysis in the livers of these mice. The ratio of liver to body weight is increased for both core and myc-F transgenic mice compared to that of wild type mice. Indeed, the proliferating cell nuclear antigen protein, a proliferation marker, was up-regulated in the transgenic mice with core or myc-F protein. Further analyses by microarray and Western blotting suggested that β-catenin signaling pathway was activated by either core or myc-F protein in the transgenic mice. These transgenic mice were further treated with either Diethynitrosamine (a tumor initiator) or Phenobarbital (a tumor promoter). Phenobarbital but not Diethynitrosamine treatment could increase the liver/body weight ratio of these mice. However, no tumor formation was observed in these mice. In conclusion, HCV core and myc-F proteins could induce hepatocyte proliferation in the transgenic mice possibly through β-catenin signaling pathway.

  17. Both core and F proteins of hepatitis C virus could enhance cell proliferation in transgenic mice

    International Nuclear Information System (INIS)

    Highlights: •HCV core and F proteins could induce hepatocyte proliferation in the transgenic mice. •β-Catenin signaling pathway was activated by core protein in the transgenic mice. •β-Catenin signaling pathway was activated by myc-F protein in the transgenic mice. •Expression of SMA protein was enhanced by core but not myc-F protein. -- Abstract: The role of the protein encoded by the alternative open reading frame (ARF/F/core+1) of the Hepatitis C virus (HCV) genome in viral pathogenesis remains unknown. The different forms of ARF/F/core+1 protein were labile in cultured cells, a myc-tag fused at the N-terminus of the F protein made it more stable. To determine the role of core and F proteins in HCV pathogenesis, transgenic mice with either protein expression under the control of Albumin promoter were generated. Expression of core protein and F protein with myc tag (myc-F) could be detected by Western blotting analysis in the livers of these mice. The ratio of liver to body weight is increased for both core and myc-F transgenic mice compared to that of wild type mice. Indeed, the proliferating cell nuclear antigen protein, a proliferation marker, was up-regulated in the transgenic mice with core or myc-F protein. Further analyses by microarray and Western blotting suggested that β-catenin signaling pathway was activated by either core or myc-F protein in the transgenic mice. These transgenic mice were further treated with either Diethynitrosamine (a tumor initiator) or Phenobarbital (a tumor promoter). Phenobarbital but not Diethynitrosamine treatment could increase the liver/body weight ratio of these mice. However, no tumor formation was observed in these mice. In conclusion, HCV core and myc-F proteins could induce hepatocyte proliferation in the transgenic mice possibly through β-catenin signaling pathway

  18. Low frequency sound from wind turbine arrays

    International Nuclear Information System (INIS)

    Due to the effects of tower wakes and atmospheric turbulence, wind turbines emit sounds at low frequencies characterized by the turbine blade passage frequency and its harmonics. These frequencies range from the sub-audible tones of a few hertz up to frequencies in the lower audible range of 50 to 100 Hz. The results of tests on a small controlled array of turbines at the U.S. Windpower Windplant in Altamont Pass, California, indicate that the low frequency sound propagates according to the well established physical principle of spherical spreading. The effect of operating multiple turbines can be accurately modeled by considering each turbine to be a randomly phased acoustic point source. In order to characterize the low frequency sound, the AWEA Standard, Low-Frequency, C-Weighted metric is recommended for both rms and impulse-hold transient signal processing. To assess the effects of this low frequency sound on community receptors an appropriate criterion based on previous results and a corresponding simplified methodology are developed. (Author)

  19. Comparative Global Gene Expression Profiles of Wild-Type Yersinia pestis CO92 and Its Braun Lipoprotein Mutant at Flea and Human Body Temperatures

    Directory of Open Access Journals (Sweden)

    Cristi L. Galindo

    2010-01-01

    Full Text Available Braun/murein lipoprotein (Lpp is involved in inflammatory responses and septic shock. We previously characterized a Δlpp mutant of Yersinia pestis CO92 and found that this mutant was defective in surviving in macrophages and was attenuated in a mouse inhalation model of plague when compared to the highly virulent wild-type (WT bacterium. We performed global transcriptional profiling of WT Y. pestis and its Δlpp mutant using microarrays. The organisms were cultured at 26 and 37 degrees Celsius to simulate the flea vector and mammalian host environments, respectively. Our data revealed vastly different effects of lpp mutation on the transcriptomes of Y. pestis grown at 37 versus 26C. While the absence of Lpp resulted mainly in the downregulation of metabolic genes at 26C, the Y. pestis Δlpp mutant cultured at 37C exhibited profound alterations in stress response and virulence genes, compared to WT bacteria. We investigated one of the stress-related genes (htrA downregulated in the Δlpp mutant relative to WT Y. pestis. Indeed, complementation of the Δlpp mutant with the htrA gene restored intracellular survival of the Y. pestis Δlpp mutant. Our results support a role for Lpp in Y. pestis adaptation to the host environment, possibly via transcriptional activation of htrA.

  20. Wind characterization for design and comparison with standards, an example from Lyse at the Swedish west coast

    Energy Technology Data Exchange (ETDEWEB)

    Ganander, H. [Teknikgruppen AB, Sollentuna (Sweden); Carlen, I. [Chalmers Univ. of Technology, Goeteborg (Sweden). Div. of Building Technology; Bergstroem, H. [Uppsala Univ. (Sweden). Dept. of Meteorology

    1996-12-01

    The Lyse site at the Swedish west coast is an area with an archipelago of rocky islands to the west and an equally rocky mainland to the east. In between there are some open sea areas. As being the responsible project manager for the erection and the operation of a turbine at a site like Lyse, the question arises about characterization of the wind for design or purchase of a wind turbine. Or in other words what wind turbine class has to be used for the design, according to existing standards like for example IEC-1400 ? 3 refs, 10 figs

  1. Calibration control of PET cameras participating at the multi centers study F.N.C.L.C.C.-F.L.T. (P.H.R.C.01/0505)

    International Nuclear Information System (INIS)

    The principal objective of the P.H.R.C. F.L.T. 01/0505 is to evaluate the response to the neo-adjuvant therapy of breast cancers by PET with 18F-fluoro thymidine (F.L.T.) imaging. The PET cameras of the participating centers were from different models, so the study includes an inter-sites protocol of calibration control whom we give here the first results. The conclusions are that no important deviation appeared on the PET cameras calibrations. these first very encouraging results confirm that the multi centers protocols allow to get data as reliable as if they were got on a single PET system. (N.C.)

  2. Compatibility of SiC{sub f}/SiC composite exposed to liquid Pb-Li flow

    Energy Technology Data Exchange (ETDEWEB)

    Park, C., E-mail: changho@iae.kyoto-u.ac.jp [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Noborio, K. [Institute of Sustainability Science, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Kasada, R.; Yamamoto, Y.; Konishi, S. [Institute of Advanced Energy, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan)

    2011-10-01

    SiC{sub f}/SiC composites are candidate structural and functional materials for fusion blankets, attractive for their potential application for higher temperature liquid metal blankets compared to the range possible for metallic materials. However, the experimental data on the long term compatibility of SiC{sub f}/SiC composites with high temperature liquid metal is inadequate. To acquire parametric data on the compatibility of NITE SiC{sub f}/SiC composites with a high temperature liquid metal stream, the corrosion behavior was examined in liquid Pb-Li using a rotating disk apparatus. The materials used in this study were exposed to relative flow velocity of {approx}10-37 cm/s at 900 deg. C for 1000 h. Oxidation layers were detected on the matrix and fiber near the surface exposed to liquid Pb-Li at 900 deg. C for 1000 h. Additional results for shorter exposure times and relationship to flow velocity are discussed.

  3. Nasopharyngeal cancer pathology - correlation with 18F-Fluorodeoxyglucose PETCT derived standardized uptake values

    International Nuclear Information System (INIS)

    Full text: Objective: To investigate the relationship between nasopharyngeal cancer (NPC) pathological type, EBY positivity and uptake of 18F-Fluorodeoxyglucose (FDG) as measured on PETCT Methods: This retrospective investigation included 15 patients consisting of 10 males and 5 females (age range: 18-84 years old) who were referred to our department for whole-body positron emission tomography-computed tomography (PETCT) with newly diagnosed, biopsy-proven nasopharyngeal carcinoma (NPC). Medical records and PETCT images were reviewed to obtain the histological subtypes, the tumour staging (T), EBV positivity and the FDG uptake, measured as maximum standardized uptake value (SUY) of the primary tumour. Results: The histopthologic subtypes were: squamous keratinizing WHO Type I (n=3), n=1 in each of T2, T3 and T4; non-keratinizing squamous WHO Type II (n=4), all 4 are of T I; and undifferentiated WHO Type III (n=8), Tl(n=3), T3(n=3) and T4(n=2). The SUY of the primary tumour ranges from 4.5-32.8. The mean SUV is 12.3, 15.2 and 11.1 for histological type I, II and III respectively (p=0.49). There is also no significant association between SUY and tumour grade (p=0.71). 6 (Type II: n=3; Type Ill: n=3) out of 15 patients are positive for EBV The mean SUV for positive and negative EBV group is 14.6+/-10.1 and 11.0+/-7.2 respectively (p=0.43). Conclusions: Our study observed that Type II NPC exhibited a higher FDG uptake than either Type I or Type Ill; also higher SUY is found in EBY positive tumour. However, the difference do not reach statistical significant. Further study with bigger sample size is necessary.

  4. 18F fluoroethylations: different strategies for the rapid translation of 11C-methylated radiotracers

    International Nuclear Information System (INIS)

    Introduction: The translation of 11C-labeled compounds into their respective 18F-labeled derivatives is an important tool in the rapid development of positron emission tomography (PET) tracers. Thus, our aim was the development of a general method for the preparation of 18F-fluoroethylated compounds that (a) is applicable to a variety of precursors, (b) can be performed in a fully automated commercially available synthesizer and (c) enables this rapid translation of 11C-methylated tracers into their 18F-fluoroethylated analogs sharing the same precursor molecules. Methods: Ten methods for the preparation and purification of different 18F-fluoroethylating agents were compared. Subsequently, five 18F-labeled PET tracers were synthesized under fully automated conditions. Results: Radiochemical yields ranged from 34.4% to 60.8%, and time consumption ranged from 20 to 55 min for all methods. Use of 1-bromo-2-[18F]fluoroethane and distillation evinced as the method of choice. Conclusions: We were able to develop a general method for the preparation of a variety of 18F-fluoroethylated molecules. The provided tool is solely based on commercially available resources and has the potential to simplify and accelerate innovative PET tracer development in the future

  5. Synthesis of n.c.a. 18F-fluorinated NMDA- and D4-receptor ligands via [18F]fluorobenzenes

    International Nuclear Information System (INIS)

    In this thesis new strategies were developed and evaluated for the no-carrier-added (n.c.a.) 18F-labelling of receptor ligands as radiodiagnostics for characterization of brain receptors using positron-emission-tomography (PET). Special emphasis was placed on the synthesis of n.c.a. (±)-3-(4-hydroxy-4-(4-[18F]fluorophenyl)-piperidin-l-yl)chroman-4,7-diol, a ligand with high affinity for the NR2B subtype of NMDA receptors and n.c.a. (3-(4-[18F]fluorphenoxy)propyl)-(2-(4-tolylphenoxy)ethyl)amine ([18F]FPTEA) a dopamine D4 receptor ligand. In order to synthesize n.c.a. (±)-3-(4-hydroxy-4-(4-[18F]fluorophenyl)-piperidin-l-yl)chroman-4,7-diol the 18F-fluoroarylation method via metallorganic intermediates was modified and improved. The suitability of the organometallic 18F-fluoroarylation agents was proven with several model compounds. High radiochemical yields of 20-30% were obtained also with piperidinone-derivatives. The preparation of a suitable precursor for the synthesis of the NMDA receptor ligand, however, could not be achieved by synthesis of appropriate 1,3-dioxolane protected piperidinone derivatives. Further, the synthesis of n.c.a. ([18F]fluoroaryloxy)alkylamines via n.c.a. 4-[18F]fluorophenol was developed and evaluated. The synthesis of n.c.a. [18F]fluoroarylethers with corresponding model compounds was optimized and led to a radiochemical yield of 25-60%, depending on the alkylhalide used. The preparation of n.c.a. 1-(3-bromopropoxy)-4-[18F]fluorobenzene proved advantageous in comparison to direct use of 4-[18]fluorophenol for coupling with a corresponding N-protected precursor for the synthesis of n.c.a. [18F]FPTEA. With regard to the radiochemical yields and the loss of activity during the synthesis and isolation of n.c.a. 4-[18F]fluorophenol and n.c.a. 1-(3-bromopropoxy)-4-[18F]fluorobenzene, [18F]FPTEA was obtained by reaction with 2-(4-tolyloxy)ethylamine in radiochemical yields of about 25-30% in ethanol or 2-butanone as solvent with a synthesis

  6. Theoretical study of lanthanide mono cation-mediated C-F bond activation

    International Nuclear Information System (INIS)

    Graphical abstract: Performing density functional B3LYP and multi-reference CASPT2 calculations, we found that all Ln+ reactions can be classified into one of two different reaction mechanisms, 'harpoon-like' and 'insertion-elimination', which were experimentally proposed by Cohrnel et al. and Konayagi et al., respectively. The two mechanisms have been proposed exclusive to each other. Our results show that both reaction mechanisms are possible in Ln+ reaction systems. Research highlights: → The lanthanide mono-cations (Ln+) activate C-F bond. → The C-F bond activation reactions with Ln+ proceed with two mechanisms, harpoon-like and insertion-elimination mechanisms. → Gd+ shows extremely high C-F bond activation ability. - Abstract: The potential energy surface corresponding to the reaction of lanthanide mono-cations (Ln+; Ln = Ce-Yb) with CH3F has been investigated using density functional theory calculations. In the initial step of the C-F activation reaction, Ln+ directly coordinates to the F atom of CH3F, and forms same [Ln...F...CH3]+ type transition state structures with an accompanying electron-transfer from the Ln+ to the F atom. Performing intrinsic reaction coordinate calculations from the transition states, we found that all Ln+ reactions can be classified into one of two different reaction mechanisms, 'harpoon-like' and 'insertion-elimination', which were experimentally proposed by Cohrnel et al. and Konayagi et al., respectively. The two mechanisms have been proposed exclusive to each other. Our results show that both reaction mechanisms are possible in Ln+ reaction systems.

  7. Telaprevir: Changing the standard of care of chronic hepatitis C

    Directory of Open Access Journals (Sweden)

    A K Rajani

    2013-01-01

    Full Text Available Chronic hepatitis C is a major public health problem and its burden is expected to increase in the near future. Out of six genotypes of hepatitis C virus (HCV identified, genotype 1 is the most prevalent genotype in America and Europe. With peg-interferon alpha and ribavirin dual therapy, sustained virological response (SVR is achieved in less than half of the patients infected with HCV genotype 1. Moreover, this dual therapy also causes many intolerable adverse effects. Telaprevir is an HCV protease inhibitor approved for chronic hepatitis C genotype 1 mono-infection. It is a type of direct acting antiviral drug acting through inhibition of viral non-structural 3/4A protease. It can be safely administered in mild hepatic dysfunction. Due to inhibition of CYP3A4 and P-glycoprotein, significant drug-drug interactions are possible with telaprevir. Trials have shown significantly higher SVR rates when telaprevir is added to peg-interferon alpha and ribavirin, particularly in patients with unfavorable prognostic factors. It is approved for use in treatment-naïve and previously treated patients. Rash and anemia are the major troublesome side-effects. Next-generation protease inhibitors may overcome the drawbacks of telaprevir and another approved HCV protease inhibitor - boceprevir. Evidence from small scale studies suggests that telaprevir may be used in conditions like HIV co-infection, post-transplantation and some HCV non-1 genotype infections also. Preliminary data show higher SVR rates with triple therapy even in patients with unfavorable interleukin-28B (IL28B genotype. With development of other direct acting antivirals, it might be possible to treat chronic hepatitis C with interferon-free regimens in future. This article briefly reviews the properties of telaprevir and its status in the context of rapidly evolving aspects of management of chronic hepatitis C.

  8. Corrosion behaviour of Ti3SiC2 with LiF-NaF-KF molten salt

    International Nuclear Information System (INIS)

    Background: Recently, the molten salt reactor (MSR), a generation IV fission reactor candidate, has drawn much attention because of its intrinsic safety. However, the harsh service environment of the MSR, especially the corrosion environment, raises many challenges in terms of applying structural materials, such as intergranular cracking and embrittlement. MAX phases materials are promising structural materials that can be used in MSRs. However, the corrosion behaviour of these materials in molten LiF-NaF-KF (FLiNaK) is yet to be evaluated. Purpose: The present work is a preliminary investigation of the corrosion behaviour of MAX phase materials in molten fluoride salts and aims to understand the corrosion mechanism of MAX phases to enable their application in next generation MSR. Methods: We choose two common MAX phases: Ti3SiC2 and Ti3AlC2 as experiment subject. The corrosion tests were performed at 850℃ for 144 h in airtight graphite crucibles under an argon cover gas. Results and Conclusion: The corrosion of these two MAX phases in molten FLiNaK salt mainly showed as the corrosion of element A and then left us mostly cubic TiCx. The difference was that Ti3AlC2 lost Al entirely, however, the loss of Si in Ti3SiC2 occurred only 150 μm depth below the surface. The weight loss data showed that Ti3SiC2 had a much better corrosion resistance than Ti3AlC2. (authors)

  9. 基于C8051f040的CAN与SMBus协议适配器%Adapter Based on the CAN and MSBus of C8051F1040 SOC

    Institute of Scientific and Technical Information of China (English)

    刘兴辉; 胡深明; 王璐

    2008-01-01

    设计了一种基于高性能C8051f040单片机的CAN与SMBus协议适配器系统.介绍了C8051f040单片机内部CAN控制器与SMBus协议的特点及适配器的工作原理,并给出了软硬件的设计思想和具体实现方法.实际测试表明:上位机通过该适配器系统与焊机进行数据通信,对数据进行处理,很好地实现了对汽车生产线焊机智能控制的目的.该系统具有抗干扰性好,工作效率高,使用方便等优点.

  10. USL/DBMS NASA/PC R and D project C programming standards

    Science.gov (United States)

    Dominick, Wayne D. (Editor); Moreau, Dennis R.

    1984-01-01

    A set of programming standards intended to promote reliability, readability, and portability of C programs written for PC research and development projects is established. These standards must be adhered to except where reasons for deviation are clearly identified and approved by the PC team. Any approved deviation from these standards must also be clearly documented in the pertinent source code.

  11. In Vivo Kinetics of [F-18]MEFWAY: A comparison with [C-11]WAY100635 and [F-18]MPPF in the nonhuman primate

    OpenAIRE

    Wooten, DW; Moraino, JD; Hillmer, AT; Engle, JW; DeJesus, OJ; Murali, D.; Barnhart, TE; Nickles, RJ; Davidson, RJ; Schneider, ML; J. Mukherjee; Christian, BT

    2010-01-01

    [F-18]Mefway was developed to provide an F-18 labeled PET neuroligand with high affinity for the serotonin 5-HT1A receptor to improve the in vivo assessment of the 5-HT1A system. The goal of this work was to compare the in vivo kinetics of [F-18]mefway, [F-18]MPPF, and [C-11]WAY100635 in the rhesus monkey.

  12. Electrochemical studies of the molten system K2NbF7-Na2O-Nb-(LiF-NaF-KF)(eut) at 700 degrees C

    DEFF Research Database (Denmark)

    Rosenkilde, C.; Vik, A.; Østvold, T.; Christensen, Erik; Bjerrum, Niels

    2000-01-01

    indications of the coexistence of the oxygen rich Nb(V)OF complexes and O-2(-) ions in FLINAK at n(O)(0)/n(Nb)(0) > 4 have been found. An equilibrium/sampling/analysis technique was also used to study this system without Nb metal added. The results mainly agree with the results of the voltammetric studies......Various voltammetric methods have been used to study FLINAK (LiF-NaF-KF eutectic melt 46.5-11.5-42 mol %) melts containing about 1 mol % niobium-fluoro and -oxofluoro complexes with Nh in oxidation states (V) and (IV) at 700 degrees C and varying amounts of Na2O in the range 0 F(7)(2-) + Nb reversible arrow 5NbF(x)((x-4)-). The solubilities of...

  13. Predicting the Dielectric Strength of c-C4F8 and SF6 Gas Mixtures by Monte Carlo Method

    Institute of Scientific and Technical Information of China (English)

    WU Bian-tao; XIAO Deng-ming

    2007-01-01

    An improved Monte Carlo method was used to simulate the motion of electrons in c-C4F8 and SF6 gas mixtures for pulsed townsend discharge. The electron swarm parameters such as effective ionization coefficient, (-α) and drift velocity over the E/N range from 280~700 Td(1Td= 10-21 V·m2) were calculated by employing a set of cross sections available in literature. From the variation cure of (-α) with SF6 partial pressure p, the limiting field (E/N)lim of gas mixture at different gas content was determined. It is found that the limiting field of c-C4F8 and SF6gas mixture is higher than that of pure SF6 at any SF6 mixture ratio. Simulation results show excellent agreement with experiment data available in previous literature.

  14. Future needs and requirements for AMS 14C standards and reference materials

    International Nuclear Information System (INIS)

    14C measurement uses a number of standards and reference materials with different properties. Historically the absolute calibration of 14C measurement was tied to 1890 wood, through the 'primary' standard of NBS-OxI (produced by the National Bureau of Standards, now NIST - National Institute of Standards and technology) subsequently replaced by NBS-OxII. These are both internationally calibrated and certified materials, whose 14C activities are known absolutely. A second tier of materials, often called secondary standards or reference materials, and including internationally recognised materials such as ANU-sucrose (now also IAEA-C6), Chinese - sucrose and the IAEA C1-C6 series, augmented by additional oxalic acid samples are also used routinely. The activity of these materials has been estimated from large numbers of measurements made by many laboratories. Recently, further natural materials from the Third and Fourth International Radiocarbon Inter-comparisons (TIRI and FIRI) have been added to this list. The activities of these standards and reference materials span both the applied 14C age range and the chemical composition range of typical samples, but this is not achieved uniformly and there is a continuing need for reference materials for laboratory quality control and measurement-traceability purposes. In this paper, we review the development of 14C standards and reference materials and consider the future requirements for such materials within the 14C AMS community

  15. Regenerative superheated steam turbine cycles

    Science.gov (United States)

    Fuller, L. C.; Stovall, T. K.

    1980-01-01

    PRESTO computer program was developed to analyze performance of wide range of steam turbine cycles with special attention given to regenerative superheated steam turbine cycles. It can be used to model standard turbine cycles, including such features as process steam extraction, induction and feedwater heating by external sources, peaking, and high back pressure. Expansion line efficiencies, exhaust loss, leakages, mechanical losses, and generator losses are used to calculate cycle heat rate and generator output. Program provides power engineer with flexible aid for design and analysis of steam turbine systems.

  16. Agronomic performance for biodiesel production potential of Brassica carinata A. Braun in Mediterranean marginal areas

    Directory of Open Access Journals (Sweden)

    Francesco Montemurro

    2016-03-01

    Full Text Available Brassicaceae are promising oil feedstock for cultivation in centralsouthern Italy. Therefore, a two-year investigation on Brassica carinata A. Braun (cv. CT 204 was carried out in three sites of Apulia region [Site 1, Alberobello - Murgia foreland; Site 2, Troia (Foggia - Daunian sub-Apennines; Site 3, Monteroni (Lecce - Area of Salento], and in one site of Basilicata region (Site 4, Hill of Matera. The aim was to identify site-specific management practices [by comparing minimum vs conventional tillage, low sowing density vs high sowing density; different levels of nitrogen (N supply and organic fertilisers] in the four different marginal areas, to achieve optimum yield performance for biodiesel prospective production. The crop showed a good adaptability in the study sites, and the highest N level positively influenced the yield performance in Sites 1, 2 and 3. Moreover, the reduction of mechanical operations (minimum tillage did not negatively influence crop production and seed oil content. The highest density of sowing tested determined the best crop performance in Site 3, particularly showing the maximum seed oil content with the lowest N supply. Finally, in Site 4 the compost mixed with mineral N fertiliser as well as the sewage sludge from urban wastewater determined productive results comparable to those obtained with mineral fertiliser, evidencing that organic fertilisers could (partially or completely substitute the mineral one for this crop in the study site. On the whole, seed yield and oil content showed a potential for biodiesel production of Brassica carinata cultivated with site-specific agronomic techniques in four different marginal areas of Southern Italy, suggesting it can be likely achieved the crop environmental adaptation.

  17. Floral and Seed Variability Patterns among Ethiopian Mustard (B. carinata A. Braun of East Africa

    Directory of Open Access Journals (Sweden)

    Adeniji, OT.

    2012-01-01

    Full Text Available In East Africa, Ethiopian mustard (Brassica carinata A. Braun is cultivated primarily for its leaves, but in Ethiopia preference is high for oil in the seed. Dual purpose importance of the seeds for planting and for oil suggests the need to improve seed production efficiency through understanding variation pattern for floral morphology and seed characters. We investigated genetic diversity and correlations for floral and seed characteristics among 14 accessions of Ethiopian mustard to improve seed set and yield. Field trials were conducted during 2008 and 2009; flowers were examined for short stamen height, long stamen height, pistil height, and silliqua for seed weight, seeds/silliqua and silliqua/plant. Results were largely consistent between years, indicating that the variation measured was mainly controlled by genetic factors. High genetic variation for seed characters and reproductive phenology among the accessions was noted. The number of days to appearance of flowers showed high discriminatory ability among the accessions. A wide continuous variation was observed among accessions for anther-stigma separation. Accessions 1, 3 and 14 were identified as early flowering. A significant and positive correlation coefficient between short stamen height and seed weight indicated a substantial complementation among these characters for seed yield improvement. The short stamen height is a good indicator for selection in favour of seed commercialization and indices for selection of pollen parent for seed yield improvement. Accessions 5, 7, 14, 16 and 22 are best for multiple characters and are recommended for seed production for any of the seasons in Arusha, Tanzania.

  18. Standard Hydrogen Monitoring System-C operation and maintenance manual

    International Nuclear Information System (INIS)

    The primary function of the SHMS-C is to monitor specifically for hydrogen in the waste tank vapor space which may also contain (but not be limited to) unknown quantities of air, nitrous oxide (N2O), ammonia (NH3), water vapor, carbon dioxide (CO2), carbon monoxide (CO) and other gaseous constituents. An electronically controlled grab sampler has replaced the manually operated sample system that was used in the original SHMS enclosure. Samples can now be operator or automatically initiated. Automatic initiation occurs based on the high hydrogen alarm level. Once a sample is obtained it is removed from the sampler and transported to a laboratory for analysis. This system is used to identify other gaseous constituents which are not measured by the hydrogen monitor. The design does not include any remote data acquisition or remote data logging equipment but provides a 4--20 mA dc process signals, and discrete alarm contacts, that can be utilized for remote data logging and alarming when desired. The SHMS-C arrangement consists of design modifications (piping, valves, filters, supports) to the SHMS-B arrangement necessary for the installation of a dual column gas chromatograph and associated sample and calibration gas lines. The gas chromatograph will provide real time, analytical quality, specific hydrogen measurements in low and medium range concentrations. The system is designed to sample process gases that are classified by NEC code as Class 1, Division 1, Group B

  19. Standardized F1: a consistent measure of strength of modulation of visual responses to sine-wave drifting gratings.

    Science.gov (United States)

    Wypych, M; Wang, C; Nagy, A; Benedek, G; Dreher, B; Waleszczyk, W J

    2012-11-01

    The magnitude of spike-responses of neurons in the mammalian visual system to sine-wave luminance-contrast-modulated drifting gratings is modulated by the temporal frequency of the stimulation. However, there are serious problems with consistency and reliability of the traditionally used methods of assessment of strength of such modulation. Here we propose an intuitive and simple tool for assessment of the strength of modulations in the form of standardized F1 index, zF1. We define zF1 as the ratio of the difference between the F1 (component of amplitude spectrum of the spike-response at temporal frequency of stimulation) and the mean value of spectrum amplitudes to standard deviation along all frequencies in the spectrum. In order to assess the validity of this measure, we have: (1) examined behavior of zF1 using spike-responses to optimized drifting gratings of single neurons recorded from four 'visual' structures (area V1 of primary visual cortex, superior colliculus, suprageniculate nucleus and caudate nucleus) in the brain of commonly used visual mammal - domestic cat; (2) compared the behavior of zF1 with that of classical statistics commonly employed in the analysis of steady-state responses; (3) tested the zF1 index on simulated spike-trains generated with threshold-linear model. Our analyses indicate that zF1 is resistant to distortions due to the low spike count in responses and therefore can be particularly useful in the case of recordings from neurons with low firing rates and/or low net mean responses. While most V1 and a half of caudate neurons exhibit high zF1 indices, the majorities of collicular and suprageniculate neurons exhibit low zF1 indices. We conclude that despite the general shortcomings of measuring strength of modulation inherent in the linear system approach, zF1 can serve as a sensitive and easy to interpret tool for detection of modulation and assessment of its strength in responses of visual neurons. PMID:23000273

  20. Preparation & characterization of SiO{sub 2} interface layer by dip coating technique on carbon fibre for C{sub f}/SiC composites

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Kundan, E-mail: kundanemails@gmail.com [Fusion Reactor Material Development & Characterization Division, Institute for Plasma Research, GIDC Electronics Estate, Sector-25, Gandhinagar-382016 (India); Centre for Nanotechnology, Central University of Jharkhand, Ratu-Lohardaga Road, Brambe, Ranchi-835205 INDIA (India); Jariwala, C., E-mail: chetan@ipr.res.in; Pillai, R.; Chauhan, N.; Raole, P. M. [Fusion Reactor Material Development & Characterization Division, Institute for Plasma Research, GIDC Electronics Estate, Sector-25, Gandhinagar-382016 (India)

    2015-08-28

    Carbon fibres (C{sub f}) are one of the most important reinforced materials for ceramic matrix composites such as C{sub f} - SiC composites and they are generally sought for high temperature applications in as space application, nuclear reactor and automobile industries. But the major problem arise when C{sub f} reinforced composites exposed to high temperature in an oxidizing environment, C{sub f} react with oxygen and burnt away. In present work, we have studied the effect of silica (SiO{sub 2}) coating as a protective coating on C{sub f} for the C{sub f} / SiC composites. The silica solution prepared by the sol-gel process and coating on C{sub f} is done by dip coating technique with varying the withdrawing speed i.e. 2, 5, 8 mm/s with fixed dipping cycle (3 Nos.). The uniform silica coating on the C{sub f} is shown by the Scanning Electron Microscope (SEM) analysis. The tensile test shows the increase in tensile strength with respect to increase in withdrawing speed. The isothermal oxidation analysis confirmed enhancement of oxidation resistance of silica coated C{sub f} as compared tothe uncoated C{sub f}.

  1. Stabilization of F-actin prevents cAMP-elicited Cl- secretion in T84 cells.

    OpenAIRE

    Shapiro, M.; Matthews, J.; Hecht, G; Delp, C; Madara, J. L.

    1991-01-01

    T84 cells, a human intestinal epithelial cell line, serve as a model of electrogenic Cl- secretion. We find that cAMP-elicited Cl- secretion in T84 cells is accompanied by a marked redistribution of F-actin in the basolateral portion of the cell. To prevent this F-actin redistribution and thereby assess its importance to Cl- secretion, we have defined simple conditions under which this model epithelium can be loaded with nitrobenzoxadiazole (NBD)-phallicidin. This reagent binds F-actin with h...

  2. C-(4-[18F]fluorophenyl)-N-phenyl nitrone: A novel 18F-labeled building block for metal free [3+2]cycloaddition

    International Nuclear Information System (INIS)

    Radiofluorination via [3+2]-nitrone-alkene cycloaddition was studied using the model reaction between 18F-labeled C-(4-fluorophenyl)-N-phenyl nitrone ([18F]1) and substituted maleimides 2a–c. [18F]1 was prepared in RCY of 73.6±5.8% and radiochemical purity of >95%. Cycloaddition of [18F]1 to 2a in toluene at 80 °C and in EtOH at 110 °C gave the respective isoxazolidine [18F]5a in >80% RCY at 10 min reaction time. Reaction between [18F]1 and 2b, c also went smoothly to afford the respective cycloaddition products in high radiochemical yields. - Highlights: ► [2+3]-Nitrone-alkene metal-free cycloaddition for radiolabelling. ► Optimized radiosynthesis of C-(4-[18F]fluorophenyl)-N-phenyl nitrone ([18F]1). ► Fast and high-yielding cycloaddition of [18F]1 to model maleimides.

  3. Estradiol Receptors Regulate Differential Connexin 43 Expression in F98 and C6 Glioma Cell Lines.

    Directory of Open Access Journals (Sweden)

    Zahra Moinfar

    Full Text Available Glioma is the most common malignant primary brain tumour with male preponderance and poor prognosis. Glioma cells express variable amounts of connexin 43 (Cx43 and estrogen receptors (ERs. Both, Cx43 and ERs, play important roles in cell proliferation and migration. Therefore, we investigated the effects of 17-ß estradiol (E2 on Cx43 expression in two glioma cell lines with variable native expression of Cx43.F98 and C6 rat glioma cells were cultured for 24 h in the presence of 10 nM or 100 nM E2, and the E2-antagonist, Fulvestrant. An MTT assay was performed to evaluate cell viability. ERα, ERβ and Cx43 protein expressions were analysed by western blotting and Cx43 mRNA expression was analysed by real-time polymerase chain reaction. To quantify cell migration, an exclusive zone migration assay was used. Functional coupling of cells via gap junctions was examined using whole-cell patch-clamp technique.E2 reduced Cx43 expression in C6 cells, but increased Cx43 expression in F98 cultures. These effects were mediated via ERs. Moreover, E2 promoted C6 cell migration, but it did not affect F98 cell migration. The expression level of ERα was found to be high in C6, but low in F98 cells. ERβ was exclusively expressed in C6 cells. In addition, E2 treatment induced a significant decrease of ERβ in C6 cultures, while it decreased ERα expression in F98 glioma cells.These findings show that E2 differentially modulates Cx43 expression in F98 and C6 glioma cells, likely due to the differential expression of ERs in each of these cell lines. Our findings point to the molecular mechanisms that might contribute to the gender-specific differences in the malignancy of glioma and could have implications for therapeutic strategies against glioma.

  4. Radar observations of F region field-aligned irregularities over Hainan island, China in 2014-2015

    Science.gov (United States)

    Shang, She-Ping; Wu, Qiongzhi; Chunxiao, Yan; Yan, Jingye; Shi, Jiankui; Yang, Guotao

    2016-07-01

    The morphology characteristics of low latitude F region 3-m scale field-aligned irregularities (FAIs) have been investigated by using the continuous observation of Hainan VHF radar (19.5ºN,109.1ºE,dip latitude:14.0ºN) in 2014-2015. The monthly mean F10.7 solar flux show the clear decrease from the peak in the start of 2014 to the foot in the end of 2015. F region FAIs can be further classified into the three cases: radar plumes (RP), broad spread F (BSF) and weak spread F (WSF), in which the first are mainly generated and developed within the field of view (FoV) of radar and the latter two generally originate outside of the FoV of radar and drift into the FoV of radar. They indicate the different phases of generation, evolution and decay of low latitude F region irregularities. The main results exhibit the F region FAIs mainly present in Feb.-Apr. and in Sep.-Nov. near the two equinoxes and are greatly reduced in May-Aug. near summer solstice, and almost completely disappeared in Dec.-Jan. near winter solstice, which are greatly affected by the solar activity. F region FAIs are more robust in spring equinox than in fall equinox, which can be shown as the occurrence rate, the structure and evolution, the duration time and so on. In spring equinox, the occurrence rate is far higher, and F region FAIs show the more structures and the longer duration time. RP near sunset are greatly enhanced. The following BSF and WSF can present intermittently and may persist into the post-midnight. F region FAIs in summer solstice mainly show BSF and WSF with the clear time delay. BSF mainly present in the pre-midnight, and there are mostly WSF in the post-midnight. The clear decrease of sola flux cause different effects to the occurrence of F region FAIs in the equinoxes and summer solstice. F region FAIs are greatly reduced in the equinoxes, in which RP are greatly reduced compared with BSF and WSF. F region FAIs seem not to be evidently affected in the summer solstice, in which

  5. 46 CFR 154.615 - Design temperature below 0 °C (32 °F) and down to −55 °C (−67 °F).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below 0 °C (32 °F) and down to â55... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.615 Design temperature below 0 °C (32 °F... tanks and secondary barriers for a design temperature below 0 °C (32 °F) and down to −55 °C (−67...

  6. 46 CFR 154.620 - Design temperature below −55 °C (−67 °F) and down to −165 °C (−265 °F).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below â55 °C (â67 °F) and down to... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.620 Design temperature below −55 °C (−67... design temperature below −55 °C (−67 °F) and down to −165 °C (−265 °F) must: (a) Meet §...

  7. High-resolution climate recorded in the δ 13 C of Porites lutea from Nansha Islands of China

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A Porites lutea core from Yongshu Reef of Nansha Islands covering 50_year growth history is analyzed for carbon isotopic composition with monthly and seasonal resolution, and the results show that the coral δ 13 C generally has clear yearly cycles. The calibration indicates that the coral δ 13 C can record the sunshine duration, total cloud cast and rainfall of the Yongshu Reef, and it also shows significant association to El Nio events. From 1950 to 1999, the δ 13 C shows a clear long-term declining trend, which indicates a decrease in the sunshine duration and an increase in cloud cast and rainfall over Yongshu Reef over the past fifty years.

  8. Origin of the high p-doping in F intercalated graphene on SiC

    KAUST Repository

    Cheng, Y. C.

    2011-08-04

    The atomic and electronic structures of F intercalated epitaxialgraphene on a SiC(0001) substrate are studied by first-principles calculations. A three-step fluorination process is proposed. First, F atoms are intercalated between the graphene and the SiC, which restores the Dirac point in the band structure. Second, saturation of the topmost Si dangling bonds introduces p-doping up to 0.37 eV. Third, F atoms bond covalently to the graphene to enhance the p-doping. Our model explains the highly p-doped state of graphene on SiC after fluorination [A. L. Walter et al., Appl. Phys. Lett. 98, 184102 (2011)].

  9. C-F sp(2) bond functionalization mediated by niobium complexes.

    Science.gov (United States)

    Nechayev, Michael; Gianetti, Thomas L; Bergman, Robert G; Arnold, John

    2015-12-01

    Insertion chemistry of isocyanide molecules was used to functionalize C-F sp(2) bonds after their oxidative addition across the metal center in a β-diketiminate niobium(iii) imido complex (BDI)Nb(N(t)Bu)(C6H6). The complexes formed, 3a-b ([BDI]Nb(PhC[double bond, length as m-dash]N)(N(t)Bu)(F) (R = 1,6-diisopropylphenyl, tert-butyl), were characterized by NMR spectroscopy and X-ray analysis. Further treatment with phenylsilane induced H/F exchange under mild conditions, which was followed by hydride transfer to the inserted isocyanide. Divergent reactivity was observed when the two analogous aryl and tert-butyl isocyanide insertion products were treated with phenylsilane. PMID:26216334

  10. SCALE: A modular code system for performing standardized computer analyses for licensing evaluation: Functional modules, F9-F11

    International Nuclear Information System (INIS)

    This Manual represents Revision 5 of the user documentation for the modular code system referred to as SCALE. The history of the SCALE code system dates back to 1969 when the current Computational Physics and Engineering Division at Oak Ridge National Laboratory (ORNL) began providing the transportation package certification staff at the U.S. Atomic Energy Commission with computational support in the use of the new KENO code for performing criticality safety assessments with the statistical Monte Carlo method. From 1969 to 1976 the certification staff relied on the ORNL staff to assist them in the correct use of codes and data for criticality, shielding, and heat transfer analyses of transportation packages. However, the certification staff learned that, with only occasional use of the codes, it was difficult to become proficient in performing the calculations often needed for an independent safety review. Thus, shortly after the move of the certification staff to the U.S. Nuclear Regulatory Commission (NRC), the NRC staff proposed the development of an easy-to-use analysis system that provided the technical capabilities of the individual modules with which they were familiar. With this proposal, the concept of the Standardized Computer Analyses for Licensing Evaluation (SCALE) code system was born. This volume consists of the section of the manual dealing with three of the functional modules in the code. Those are the Morse-SGC for the SCALE system, Heating 7.2, and KENO V.a. The manual describes the latest released versions of the codes

  11. SCALE: A modular code system for performing standardized computer analyses for licensing evaluation: Functional modules, F9-F11

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This Manual represents Revision 5 of the user documentation for the modular code system referred to as SCALE. The history of the SCALE code system dates back to 1969 when the current Computational Physics and Engineering Division at Oak Ridge National Laboratory (ORNL) began providing the transportation package certification staff at the U.S. Atomic Energy Commission with computational support in the use of the new KENO code for performing criticality safety assessments with the statistical Monte Carlo method. From 1969 to 1976 the certification staff relied on the ORNL staff to assist them in the correct use of codes and data for criticality, shielding, and heat transfer analyses of transportation packages. However, the certification staff learned that, with only occasional use of the codes, it was difficult to become proficient in performing the calculations often needed for an independent safety review. Thus, shortly after the move of the certification staff to the U.S. Nuclear Regulatory Commission (NRC), the NRC staff proposed the development of an easy-to-use analysis system that provided the technical capabilities of the individual modules with which they were familiar. With this proposal, the concept of the Standardized Computer Analyses for Licensing Evaluation (SCALE) code system was born. This volume consists of the section of the manual dealing with three of the functional modules in the code. Those are the Morse-SGC for the SCALE system, Heating 7.2, and KENO V.a. The manual describes the latest released versions of the codes.

  12. The master activator of IncA/C conjugative plasmids stimulates genomic islands and multidrug resistance dissemination.

    Directory of Open Access Journals (Sweden)

    Nicolas Carraro

    2014-10-01

    Full Text Available Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo and RNA sequencing (RNA-seq approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes in two widespread classes of genomic islands (GIs phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands.

  13. 26 CFR 5c.168(f)(8)-7 - Reporting of income, deductions and investment tax credit; at risk rules.

    Science.gov (United States)

    2010-04-01

    ... the owner of the leased property for Federal tax law purposes, the lessor under a section 168(f)(8... tax credit; at risk rules. 5c.168(f)(8)-7 Section 5c.168(f)(8)-7 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) TEMPORARY INCOME TAX...

  14. Bulk plasma fragmentation in a C4F8 inductively coupled plasma: A hybrid modeling study

    International Nuclear Information System (INIS)

    A hybrid model is used to investigate the fragmentation of C4F8 inductive discharges. Indeed, the resulting reactive species are crucial for the optimization of the Si-based etching process, since they determine the mechanisms of fluorination, polymerization, and sputtering. In this paper, we present the dissociation degree, the density ratio of F vs. CxFy (i.e., fluorocarbon (fc) neutrals), the neutral vs. positive ion density ratio, details on the neutral and ion components, and fractions of various fc neutrals (or ions) in the total fc neutral (or ion) density in a C4F8 inductively coupled plasma source, as well as the effect of pressure and power on these results. To analyze the fragmentation behavior, the electron density and temperature and electron energy probability function (EEPF) are investigated. Moreover, the main electron-impact generation sources for all considered neutrals and ions are determined from the complicated C4F8 reaction set used in the model. The C4F8 plasma fragmentation is explained, taking into account many factors, such as the EEPF characteristics, the dominance of primary and secondary processes, and the thresholds of dissociation and ionization. The simulation results are compared with experiments from literature, and reasonable agreement is obtained. Some discrepancies are observed, which can probably be attributed to the simplified polymer surface kinetics assumed in the model

  15. R.F. magnetron sputtering of multilayered c-BN films on cemented carbide tool.

    Science.gov (United States)

    Park, Sungtae; Jeong, Sehoon; Lee, Kwangmin

    2011-02-01

    A c-BN thin film was deposited using a B4C target in a r.f. magnetron sputtering system. The c-BN layer was coated with a TiAIN adhesion layer (approximately 2 microm), boron carbide (approximately 1 microm) and BCN (10 approximately 15 nm) nano-gradient layer system. The c-BN layers with thicknesses of more than 0.5 microm were successfully deposited onto cemented carbide substrates. The high resolution XPS spectra analysis of B1s and N1s revealed that the c-BN film was mainly composed of sp3 BN bonds. PMID:21456217

  16. Design of CAN-COM Conversion Interface Based on C8051F040%基于C8051F040的CAN-COM转换器设计

    Institute of Scientific and Technical Information of China (English)

    付勇智; 张洪昌

    2010-01-01

    针对CAN总线应用中的一些问题,提出了一种新的CAN-COM转换的应用解决方案.选用C8051FD40单片机为主要控制器,在分析、理解嵌入式单片机C8051F040内嵌的CAN模块的特点和工作环境要求的基础上,为充分、有效、合理地利用其对CAN总线网络进行数据传输和管理,设计了基于C8051F040的CAN控制器的硬件电路,并在Keil C51 uVsion3的编程环境下,利用C语言设计了相应的总线数据接收、发送和管理程序,并对主要控制程序做了分析说明.通过试验测试,对该方案的特性做了具体分析,结果表明:设计原理简单,转换可靠性高,转换模块操作简单.

  17. Happy Island

    CERN Document Server

    McLerran, Larry

    2011-01-01

    I discuss the phase diagram for QCD in the baryon chemical potential and temperature plane. I argue that there is a new phase of matter different from the deconfined Quark Gluon Plasma: Quarkyonic Matter. Quarkyonic Matter is confined and exists at densities parametrically large compared to the QCD scale, when the number of quark colors, $N_c$ is large. I motivate the possibility that Quarkyonic Matter is in an inhomogeneous phase, and is surrounded by lines of phase transitions, making a Happy Island in the $\\mu_B$-T plane. I conjecture about the geography of Happy Island.

  18. SODIUM POLYPHOSPHATE-MODIFIED CLASS C/CLASS F FLY ASH BLEND CEMENTS FOR GEOTHERMAL WELLS.

    Energy Technology Data Exchange (ETDEWEB)

    SUGAMA, T.; BROTHERS, L.E.; KASPEREIT, D.

    2006-02-01

    The authors investigated the usefulness of the coal combustion by-products, Class C fly ash (C) and Class F fly ash (F), in developing cost-effective acid-resistant phosphate-based cements for geothermal wells. In the temperature range of 20-100 C, sodium polyphosphate (NaP) as the acidic cement-forming solution preferentially reacted with calcium sulfate and lime in the C as the base solid reactant through the exothermic acid-base reaction route, rather than with the tricalcium aluminate in C. This reaction led to the formation of hydroxyapatite (HOAp). In contrast, there was no acid-base reaction between the F as the acidic solid reactant and NaP. After autoclaving the cements at 250 C, a well-crystallized HOAp phase was formed in the NaP-modified C cement that was responsible for densifying the cement's structure, thereby conferring low water permeability and good compressive strength on the cement. however, the HOAp was susceptible to hot CO{sub 2}-laden H{sub 2}SO{sub 4} solution (pH 1.1), allowing some acid erosion of the cement. On the other hand, the mullite in F hydrothermally reacted with the Na from NaP to form the analcime phase. Although this phase played a pivotal role in abating acid erosion, its generation created an undesirable porous structure in the cement. They demonstrated that blending fly ash with a C/F ratio of 70/30 resulted in the most suitable properties for acid-resistant phosphate-based cement systems.

  19. The impact of high-dose vitamin C on blood glucose testing in ¹⁸F-FDG PET imaging.

    Science.gov (United States)

    Bahr, Rebekah L; Wilson, Don C

    2015-03-01

    Complementary and alternative therapies in addition to standard oncology protocols are commonly sought by cancer patients; however, few patients disclose their complementary treatments to their cancer care team. A lack of communication may result in unforeseen side effects and the potential for some alternative therapies to interfere with or inhibit conventional treatment. High-dose vitamin C therapy, in particular, may lead to an inability to measure a patient's blood glucose level before (18)F-FDG injection for PET/CT scanning. We report a case of a 52-y-old woman referred for (18)F-FDG PET/CT to evaluate the extent of recurrent colorectal cancer. The PET/CT scan immediately followed a single intravenous dose of 25 g of ascorbic acid from her naturopath. A glucometer that applies the glucose oxidase method for measuring fasting blood glucose was used, for which high doses of vitamin C are listed as a contraindication. The high concentration of ascorbic acid in the patient's blood sample interfered with the chemical reaction on the glucose strip, and therefore no blood glucose measurement could be attained. With more patients receiving alternative and complementary cancer therapies, it is important to know what the implications of orthomolecular therapy might be on routine blood glucose testing for (18)F-FDG PET scans. (18)F-FDG is in direct competition with glucose; therefore, elevated blood glucose levels will cause a decrease in (18)F-FDG absorption and may lead to a false-negative scan. PMID:25104819

  20. SCALE: A modular code system for performing standardized computer analyses for licensing evaluation: Functional modules F1-F8

    International Nuclear Information System (INIS)

    This Manual represents Revision 5 of the user documentation for the modular code system referred to as SCALE. The history of the SCALE code system dates back to 1969 when the current Computational Physics and Engineering Division at Oak Ridge National Laboratory (ORNL) began providing the transportation package certification staff at the U.S. Atomic Energy Commission with computational support in the use of the new KENO code for performing criticality safety assessments with the statistical Monte Carlo method. From 1969 to 1976 the certification staff relied on the ORNL staff to assist them in the correct use of codes and data for criticality, shielding, and heat transfer analyses of transportation packages. However, the certification staff learned that, with only occasional use of the codes, it was difficult to become proficient in performing the calculations often needed for an independent safety review. Thus, shortly after the move of the certification staff to the U.S. Nuclear Regulatory Commission (NRC), the NRC staff proposed the development of an easy-to-use analysis system that provided the technical capabilities of the individual modules with which they were familiar. With this proposal, the concept of the Standardized Computer Analyses for Licensing Evaluation (SCALE) code system was born. This volume consists of the section of the manual dealing with eight of the functional modules in the code. Those are: BONAMI - resonance self-shielding by the Bondarenko method; NITAWL-II - SCALE system module for performing resonance shielding and working library production; XSDRNPM - a one-dimensional discrete-ordinates code for transport analysis; XSDOSE - a module for calculating fluxes and dose rates at points outside a shield; KENO IV/S - an improved monte carlo criticality program; COUPLE; ORIGEN-S - SCALE system module to calculate fuel depletion, actinide transmutation, fission product buildup and decay, and associated radiation source terms; ICE

  1. SCALE: A modular code system for performing standardized computer analyses for licensing evaluation: Functional modules F1-F8

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This Manual represents Revision 5 of the user documentation for the modular code system referred to as SCALE. The history of the SCALE code system dates back to 1969 when the current Computational Physics and Engineering Division at Oak Ridge National Laboratory (ORNL) began providing the transportation package certification staff at the U.S. Atomic Energy Commission with computational support in the use of the new KENO code for performing criticality safety assessments with the statistical Monte Carlo method. From 1969 to 1976 the certification staff relied on the ORNL staff to assist them in the correct use of codes and data for criticality, shielding, and heat transfer analyses of transportation packages. However, the certification staff learned that, with only occasional use of the codes, it was difficult to become proficient in performing the calculations often needed for an independent safety review. Thus, shortly after the move of the certification staff to the U.S. Nuclear Regulatory Commission (NRC), the NRC staff proposed the development of an easy-to-use analysis system that provided the technical capabilities of the individual modules with which they were familiar. With this proposal, the concept of the Standardized Computer Analyses for Licensing Evaluation (SCALE) code system was born. This volume consists of the section of the manual dealing with eight of the functional modules in the code. Those are: BONAMI - resonance self-shielding by the Bondarenko method; NITAWL-II - SCALE system module for performing resonance shielding and working library production; XSDRNPM - a one-dimensional discrete-ordinates code for transport analysis; XSDOSE - a module for calculating fluxes and dose rates at points outside a shield; KENO IV/S - an improved monte carlo criticality program; COUPLE; ORIGEN-S - SCALE system module to calculate fuel depletion, actinide transmutation, fission product buildup and decay, and associated radiation source terms; ICE.

  2. NODC Standard Format Marine Bacteria (F009) Data (1975-1979) (NODC Accession 0014148)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Marine Bacteria (F009) data set contains data from bacteriological studies of the water column and ocean bottom. Data include the density (number per unit...

  3. NODC Standard Format Fish Pathology Format (F013) Data (1975-1980) (NCEI Accession 0014146)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Fish Pathology (F013) data set contains data from examinations of diseased fishes. Although these data may be from field observations, they derive primarily...

  4. Two isomers of C6H6F9O9Tb

    International Nuclear Information System (INIS)

    Two isomeric forms of terbium tetrahydrate trifluoroacetate, featuring the composition C6H6F9O9Tb, were prepared as a result of interaction between terbium hydroxide or carbonate and trifluoroacetic acid. The compounds were characterized by the methods of elementary analysis, IR spectroscopy and X-ray diffraction analysis. It has been ascertained that isomerism of the compounds stems from different positions of protons. Crystals of both forms are isostructural, forming a continuous series of solid solutions with C6H6F9O9Eu

  5. Volcanic history and 40Ar/39Ar and 14C geochronology of Terceira Island, Azores, Portugal

    Science.gov (United States)

    Calvert, A.T.; Moore, R.B.; McGeehin, J.P.; Rodrigues da Silva, A.M.

    2006-01-01

    Seven new 40Ar/39Ar and 23 new radiocarbon ages of eruptive units, in support of new geologic mapping, improve the known chronology of Middle to Late Pleistocene and Holocene volcanic activity on the island of Terceira, Azores and define an east-to-west progression in stratovolcano growth. The argon ages indicate that Cinco Picos Volcano, the oldest on Terceira, completed its main subaerial cone building activity by about 370-380??ka. Collapse of the upper part of the stratovolcanic edifice to form a 7 ?? 9??km caldera occurred some time after 370??ka. Postcaldera eruptions of basalt from cinder cones on and near the caldera floor and trachytic pyroclastic flow and pumice fall deposits from younger volcanoes west of Cinco Picos have refilled much of the caldera. The southern portion of Guilherme Moniz Volcano, in the central part of the island, began erupting prior to 270??ka and produced trachyte domes, flows, and minor pyroclastic deposits until at least 111??ka. The northern part of Guilherme Moniz Caldera is less well exposed than the southern part, but reflects a similar age range. The northwest portion of the caldera was formed sometime after 44??ka. Several well-studied ignimbrites that blanket much of the island likely erupted from Guilherme Moniz Volcano. The Pico Alto Volcanic Center, a tightly spaced cluster of trachyte domes and short flows, is a younger part of Guilherme Moniz Volcano. Stratigraphic studies and our new radiocarbon ages suggest that most of the Pico Alto eruptions occurred during the period from about 9000 to 1000??years BP. Santa Barbara Volcano is the youngest stratovolcano on Terceira, began erupting prior to 29??ka, and has been active historically. ?? 2006.

  6. CLEC4F is an inducible C-type lectin in F4/80-positive cells and is involved in alpha-galactosylceramide presentation in liver.

    Directory of Open Access Journals (Sweden)

    Chih-Ya Yang

    Full Text Available CLEC4F, a member of C-type lectin, was first purified from rat liver extract with high binding affinity to fucose, galactose (Gal, N-acetylgalactosamine (GalNAc, and un-sialylated glucosphingolipids with GalNAc or Gal terminus. However, the biological functions of CLEC4F have not been elucidated. To address this question, we examined the expression and distribution of murine CLEC4F, determined its binding specificity by glycan array, and investigated its function using CLEC4F knockout (Clec4f-/- mice. We found that CLEC4F is a heavily glycosylated membrane protein co-expressed with F4/80 on Kupffer cells. In contrast to F4/80, CLEC4F is detectable in fetal livers at embryonic day 11.5 (E11.5 but not in yolk sac, suggesting the expression of CLEC4F is induced as cells migrate from yolk cells to the liver. Even though CLEC4F is not detectable in tissues outside liver, both residential Kupffer cells and infiltrating mononuclear cells surrounding liver abscesses are CLEC4F-positive upon Listeria monocytogenes (L. monocytogenes infection. While CLEC4F has strong binding to Gal and GalNAc, terminal fucosylation inhibits CLEC4F recognition to several glycans such as Fucosyl GM1, Globo H, Bb3∼4 and other fucosyl-glycans. Moreover, CLEC4F interacts with alpha-galactosylceramide (α-GalCer in a calcium-dependent manner and participates in the presentation of α-GalCer to natural killer T (NKT cells. This suggests that CLEC4F is a C-type lectin with diverse binding specificity expressed on residential Kupffer cells and infiltrating monocytes in the liver, and may play an important role to modulate glycolipids presentation on Kupffer cells.

  7. Toxicity and carcinogenicity studies of Caramel Colour IV in F344 rats and B6C3F1 mice.

    Science.gov (United States)

    MacKenzie, K M; Boysen, B G; Field, W E; Petsel, S R; Chappel, C I; Emerson, J L; Stanley, J

    1992-05-01

    Caramel Colour IV, a type of caramel colour used in the manufacture of cola soft drinks, was evaluated for subchronic and chronic toxicity in rats, and carcinogenicity in Fischer-344 (F344) rats and B6C3F1 mice. In each of the studies, Caramel Colour IV was mixed with demineralized water and the solutions given to the animals ad lib. in the drinking fluid. The concentrations of Caramel Colour IV in the drinking fluid were adjusted periodically to achieve the desired caramel colour intake per kg body weight. In the range-finding studies, groups of 30 rats/sex were given Caramel Colour IV at levels of 0, 15, 20, 25 or 30 g/kg for 13 wk, and groups of 10 male rats were given levels of 0, 2.5, 5, 10 or 15 g/kg for 6 wk followed, for some dose groups, by a 2-wk withdrawal period, and then re-initiation of dosing for another 2 wk. In the rat chronic toxicity study, levels of Caramel Colour IV of 0, 2.5, 5, 7.5 or 10 g/kg were given to groups of 25 rats/sex for 12 months. The test groups in the rat and mouse carcinogenicity studies were composed of 50 animals/sex and each species was given the caramel colour at levels of 0, 0, 2.5, 5 or 10 g/kg for 24 months. In each of the studies, treated animals tended to have dose-related lower water consumption than controls. This was attributed to poor palatability of the drinking fluid, and was generally associated with decreased food consumption and body weights. Rats given caramel colour often had soft or liquid malodorous faeces although there were no treatment-related ante-mortem observations in mice. Blood biochemical changes in the rat (i.e. reduced blood urea nitrogen, alkaline phosphatase and total serum protein) appeared to be related to dietary influences and were not considered toxicologically significant. There were no treatment-related alterations in haematological variables or treatment-related differences in survival or in the incidence of benign or malignant tumours among treated and control groups and no

  8. Steam Turbines

    Science.gov (United States)

    1981-01-01

    Turbonetics Energy, Inc.'s steam turbines are used as power generating systems in the oil and gas, chemical, pharmaceuticals, metals and mining, and pulp and paper industries. The Turbonetics line benefited from use of NASA research data on radial inflow steam turbines and from company contact with personnel of Lewis Research Center, also use of Lewis-developed computer programs to determine performance characteristics of turbines.

  9. Comparative study of the oospore morphology of two populations of a rare species Chara baueri A. Braun in Cedynia (Poland and Batzlow (Germany

    Directory of Open Access Journals (Sweden)

    Andrzej Pukacz

    2012-06-01

    Full Text Available Morphological features of oospores of Chara baueri A. Braun, one of the rarest charophyte species worldwide, were studied based on 100 oospores collected from a small and temporarily dried mid-field pond near Cedynia, Western Poland. This is the first Polish and fifth presently known locality of this species. For comparison 67 oospores from a German population (similar pond localized near Batzlow, Germany were also measured. So far, data on morphology of C. baueri oospores as well as the species ecology are limited. The only more detailed study of oospores for this species was earlier performed on 15 oospores from Kazakhstan. Largest polar axis (LPA, length, largest equatorial diameter (LED, width, isopolarity index (ISI = LPA/LED × 100, number of ridges, width of fossa, distance from apical pole to LED (AND and anisipolarity index (ANI = AND/LPA × 100 were measured. The comparative analysis revealed that the oospores from Poland are generally bigger and more prolate than the Ger­man ones. The differences for most of studied parameters were statistically significant. The finding is discussed in the context of habitat differentiation of both studied sites. Moreover, the results obtained of oospore measurements for both populations differs from most of the data known so far from the literature.

  10. CYP4F18-Deficient Neutrophils Exhibit Increased Chemotaxis to Complement Component C5a

    Directory of Open Access Journals (Sweden)

    Rachel Vaivoda

    2015-01-01

    Full Text Available CYP4Fs were first identified as enzymes that catalyze hydroxylation of leukotriene B4 (LTB4. CYP4F18 has an unusual expression in neutrophils and was predicted to play a role in regulating LTB4-dependent inflammation. We compared chemotaxis of wild-type and Cyp4f18 knockout neutrophils using an in vitro assay. There was no significant difference in the chemotactic response to LTB4, but the response to complement component C5a increased 1.9–2.25-fold in knockout cells compared to wild-type (P < 0.01. This increase was still observed when neutrophils were treated with inhibitors of eicosanoid synthesis. There were no changes in expression of other CYP4 enzymes in knockout neutrophils that might compensate for loss of CYP4F18 or lead to differences in activity. A mouse model of dextran sodium sulfate colitis was used to investigate the consequences of increased C5a-dependent chemotaxis in vivo, but there was no significant difference in weight loss, disease activity, or colonic tissue myeloperoxidase between wild-type and Cyp4f18 knockout mice. This study demonstrates the limitations of inferring CYP4F function based on an ability to use LTB4 as a substrate, points to expanding roles for CYP4F enzymes in immune regulation, and underscores the in vivo challenges of CYP knockout studies.

  11. Assessment of full power turbine trip start-up test for C. Trillo 1 with RELAP5/MOD2. International Agreement Report

    Energy Technology Data Exchange (ETDEWEB)

    Lozano, M.F.; Moreno, P.; de la Cal, C.; Larrea, E.; Lopez, A.; Santamaria, J.G.; Lopez, E.; Novo, M. [Consejo de Seguridad Nuclear, Madrid (Spain)

    1993-07-01

    C. Trillo I has developed a model of the plant with RELAP5/MOD2/36.04. This model will be validated against a selected set of start-up tests. One of the transients selected to that aim is the turbine trip, which presents very specific characteristics that make it significantly different from the same transient in other PWRs of different design, the main difference being that the reactor is not tripped: a reduction in primary power is carried out instead. Pre-test calculations were done of the Turbine Trip Test and compared against the actual test. Minor problems in the first model, specially in the Control and Limitation Systems, were identified and post-test calculations had been carried out. The results show a good agreement with data for all the compared variables.

  12. Stigmaphyllon patricianum-firmenichianum (Malpighiaceae, a new species from Loyalty Islands, New Caledonia

    Directory of Open Access Journals (Sweden)

    Jean-François Butaud

    2015-08-01

    Full Text Available A new species of Stigmaphyllon (Malpighiaceae is described: Stigmaphyllon patricianum-firmenichianum Butaud. It is restricted to the coral islands of Ouvéa, Lifou and Maré in the Loyalty Islands Province (New Caledonia and is most similar to S. discolor (Gand. C.E.Anderson, known from New Caledonia and Solomon Islands. Previously, plants now known as S. patricianum-firmenichianum were included in Stigmaphyllon taomense (Baker f. C.E.Anderson, endemic to the northern part of Grande-Terre and Belep Islands (New Caledonia. A new circumscription of S. taomense is proposed. The regional key for New Caledonian species of Stigmaphyllon is updated.

  13. Radiological characterization of the standard package of compacted wastes - CSD{sub C}; Caracterisation radiologique du colis standard de dechets compactes - CSD{sub C}

    Energy Technology Data Exchange (ETDEWEB)

    Gain, T. [Cogema, Etablissement de la Hague, 50 - Beaumont Hague (France)

    2001-07-01

    In order to reduce the volume of radioactive waste, Cogema has studied the compacting of waste coming from fuel structure, zirconium claddings, but on these wastes there is no knowledge about irradiation characteristics. A large program of of qualification has been made relative to every element of the system: measurement cells, standardization, configuration, algorithm and a phase of active qualification. (N.C.)

  14. Structures and electronic properties of C12Si8X8 (X = H, F, and Cl)

    Science.gov (United States)

    Naderi, F.

    2016-07-01

    The structural stabilities and electronic properties of C12Si8X8 where X = H, F, and Cl are probed on the basis of density functional theory at the B3LYP/6-311++G**//B3LYP/6-31+G* level. Vibrational frequency calculations show that all the systems are true minima. The infrared spectra of the most stable C12Si8X8 molecules are simulated to assist further experimental characterization. The functionalized structures and energy gaps between the highest occupied molecular orbital, HOMO, and the lowest unoccupied molecular orbital, LUMO, have been systematically investigated. It seems that C12Si8H8 has more stability against electronic excitations via increasing the HOMO-LUMO gap comparing with C12Si8Cl8 and C12Si8F8. High charge transfer on the surfaces of our stable compounds, provokes further investigations on their possible application for hydrogen storage. The addition reaction energies of C12Si8X8 are high exothermic, and C12Si8F8 is more thermodynamically accessible.

  15. Shock wave study and theoretical modeling of the thermal decomposition of c-C4F8.

    Science.gov (United States)

    Cobos, C J; Hintzer, K; Sölter, L; Tellbach, E; Thaler, A; Troe, J

    2015-12-28

    The thermal dissociation of octafluorocyclobutane, c-C4F8, was studied in shock waves over the range 1150-2300 K by recording UV absorption signals of CF2. It was found that the primary reaction nearly exclusively produces 2 C2F4 which afterwards decomposes to 4 CF2. A primary reaction leading to CF2 + C3F6 is not detected (an upper limit to the yield of the latter channel was found to be about 10 percent). The temperature range of earlier single pulse shock wave experiments was extended. The reaction was shown to be close to its high pressure limit. Combining high and low temperature results leads to a rate constant for the primary dissociation of k1 = 10(15.97) exp(-310.5 kJ mol(-1)/RT) s(-1) in the range 630-1330 K, over which k1 varies over nearly 14 orders of magnitude. Calculations of the energetics of the reaction pathway and the rate constants support the conclusions from the experiments. Also they shed light on the role of the 1,4-biradical CF2CF2CF2CF2 as an intermediate of the reaction. PMID:26577435

  16. Thermosyphon Method for Cooling the Rotor Blades of High-Temperature Steam Turbines

    Science.gov (United States)

    Bogomolov, Alexander R.; Temnikova, Elena Yu.

    2016-02-01

    The design scheme of closed two-phase thermosyphon were suggested that can provide standard thermal operation of blades of high-temperature steam turbine. The method for thermosyphon calculation is developed. The example of thermal calculation was implemented, it showed that to cool the steam turbine blades at their heating by high-temperature steam, the heat can be removed in the rear part of the blades by air with the temperature of about 440°C.

  17. Thermosyphon Method for Cooling the Rotor Blades of High-Temperature Steam Turbines

    Directory of Open Access Journals (Sweden)

    Bogomolov Alexander R.

    2016-01-01

    Full Text Available The design scheme of closed two-phase thermosyphon were suggested that can provide standard thermal operation of blades of high-temperature steam turbine. The method for thermosyphon calculation is developed. The example of thermal calculation was implemented, it showed that to cool the steam turbine blades at their heating by high-temperature steam, the heat can be removed in the rear part of the blades by air with the temperature of about 440°C.

  18. Thermosyphon Method for Cooling the Rotor Blades of High-Temperature Steam Turbines

    OpenAIRE

    Bogomolov Alexander R.; Temnikova Elena Yu.

    2016-01-01

    The design scheme of closed two-phase thermosyphon were suggested that can provide standard thermal operation of blades of high-temperature steam turbine. The method for thermosyphon calculation is developed. The example of thermal calculation was implemented, it showed that to cool the steam turbine blades at their heating by high-temperature steam, the heat can be removed in the rear part of the blades by air with the temperature of about 440°C.

  19. Final Technical Report for grant entitled "New Horizons in C-F Activation by Main Group Electrophiles"

    Energy Technology Data Exchange (ETDEWEB)

    Ozerov, Oleg V [Texas A& M University; Ozerov, Oleg V.

    2014-01-16

    We became interested in developing new methods for hydrodefluorination (HDF) and other types of C-F bond conversion in polyfluoroalkanes under mild conditions. We were attracted to an approach to C-F activation, where the key C-F cleavage proceeds by a Lewis acid abstraction of fluoride rather than a redox event. The efforts during the previous period were aimed at a) advancing the HDF reactivity with improvement in scope and catalyst longevity; b) extending C-F activation beyond HDF; c) generating insight about the elementary steps of the reaction and potential intermediates.

  20. C8051F040中CAN控制器的应用%Application of CAN Control in C8051F040

    Institute of Scientific and Technical Information of China (English)

    蔡华锋; 廖冬初; 潘健; 张杰; 陈小薇

    2005-01-01

    介绍C8051F040单片机内部CAN控制器的应用.详细叙述此控制器的构成及其访问方式,指出在使用时是如何配置控制器的相关控制寄存器,并且给出CAN控制器在应用中的物理层硬件电路和应用层软件设计.

  1. C8051F040的CAN模块应用研究%Research on Application of CAN Module Based on C8051F040

    Institute of Scientific and Technical Information of China (English)

    袁越阳; 鲁植雄; 陈明江

    2008-01-01

    以嵌入式单片机C8051F040内部嵌入的CAN模块为核心,介绍其CAN控制器的应用.在CAN通信模块的应用硬件电路基础上,设计了其具体的应用程序,并通过程序阐述了对其CAN模块相关控制器的读、写和控制原理,指出在使用时应注意的问题.

  2. Comparison of standardized uptake values measured on 18F-NaF PET/CT scans using three different tube current intensities

    Directory of Open Access Journals (Sweden)

    Agnes Araujo Valadares

    2015-02-01

    Full Text Available Objective: To analyze standardized uptake values (SUVs using three different tube current intensities for attenuation correction on 18FNaF PET/CT scans. Materials and Methods: A total of 254 18F-NaF PET/CT studies were analyzed using 10, 20 and 30 mAs. The SUVs were calculated in volumes of interest (VOIs drawn on three skeletal regions, namely, right proximal humeral diaphysis (RH, right proximal femoral diaphysis (RF, and first lumbar vertebra (LV1 in a total of 712 VOIs. The analyses covered 675 regions classified as normal (236 RH, 232 RF, and 207 LV1. Results: Mean SUV for each skeletal region was 3.8, 5.4 and 14.4 for RH, RF, and LV1, respectively. As the studies were grouped according to mAs value, the mean SUV values were 3.8, 3.9 and 3.7 for 10, 20 and 30 mAs, respectively, in the RH region; 5.4, 5.5 and 5.4 for 10, 20 and 30 mAs, respectively, in the RF region; 13.8, 14.9 and 14.5 for 10, 20 and 30 mAs, respectively, in the LV1 region. Conclusion: The three tube current values yielded similar results for SUV calculation.

  3. Comparison of standardized uptake values measured on 18F-NaF PET/CT scans using three different tube current intensities

    International Nuclear Information System (INIS)

    Objective: to analyze standardized uptake values (SUVs) using three different tube current intensities for attenuation correction on 18FNaF PET/CT scans. Materials and methods: a total of 254 18F-NaF PET/CT studies were analyzed using 10, 20 and 30 mAs. The SUVs were calculated in volumes of interest (VOIs) drawn on three skeletal regions, namely, right proximal humeral diaphysis (RH), right proximal femoral diaphysis (RF), and first lumbar vertebra (LV1) in a total of 712 VOIs. The analyses covered 675 regions classified as normal (236 RH, 232 RF, and 207 LV1). Results: mean SUV for each skeletal region was 3.8, 5.4 and 14.4 for RH, RF, and LV1, respectively. As the studies were grouped according to mAs value, the mean SUV values were 3.8, 3.9 and 3.7 for 10, 20 and 30 mAs, respectively, in the RH region; 5.4, 5.5 and 5.4 for 10, 20 and 30 mAs, respectively, in the RF region; 13.8, 14.9 and 14.5 for 10, 20 and 30 mAs, respectively, in the LV1 region. Conclusion: the three tube current values yielded similar results for SUV calculation. (author)

  4. Comparison of standardized uptake values measured on {sup 18}F-NaF PET/CT scans using three different tube current intensities

    Energy Technology Data Exchange (ETDEWEB)

    Valadares, Agnes Araujo; Woellner, Eduardo Bechtloff; Sapienza, Marcelo Tatit; Buchpiguel, Carlos Alberto, E-mail: agnesvaladares@me.com [Universidade de Sao Paulo (HC/FMUSP), Sao Paulo, SP (Brazil). Fac. de Medicina. Hospital das Clinicas; Duarte, Paulo Schiavom; Coura-Filho, George Barberio [Instituto do Cancer do Estado de Sao Paulo Octavio Frias de Oliveira (ICESP), Sao Paulo, SP (Brazil)

    2015-01-15

    Objective: to analyze standardized uptake values (SUVs) using three different tube current intensities for attenuation correction on {sup 18}FNaF PET/CT scans. Materials and methods: a total of 254 {sup 18}F-NaF PET/CT studies were analyzed using 10, 20 and 30 mAs. The SUVs were calculated in volumes of interest (VOIs) drawn on three skeletal regions, namely, right proximal humeral diaphysis (RH), right proximal femoral diaphysis (RF), and first lumbar vertebra (LV1) in a total of 712 VOIs. The analyses covered 675 regions classified as normal (236 RH, 232 RF, and 207 LV1). Results: mean SUV for each skeletal region was 3.8, 5.4 and 14.4 for RH, RF, and LV1, respectively. As the studies were grouped according to mAs value, the mean SUV values were 3.8, 3.9 and 3.7 for 10, 20 and 30 mAs, respectively, in the RH region; 5.4, 5.5 and 5.4 for 10, 20 and 30 mAs, respectively, in the RF region; 13.8, 14.9 and 14.5 for 10, 20 and 30 mAs, respectively, in the LV1 region. Conclusion: the three tube current values yielded similar results for SUV calculation. (author)

  5. Labeling of complex molecules with 18F, 13N, and 11C

    International Nuclear Information System (INIS)

    The overall objective during the period covered by this report was to develop a broad spectrum of radiopharmaceuticals labeled with short-lived cyclotron positron emitters, 11C, 13N and 18F. The goals of the program during the last year were: (1) to complete the modular automated system for important precursor production - formaldehyde, methyliodide, cyanide; (2) to perform animal studies with the 18F-glucose analogues 2FDG and 3FDG and measure the constants for both agents in different animals; and (3) to initiate the development of new fatty acid analogues for the myocardial imaging and metabolism. As part of a collaboration with other groups seeking new agents for myocardium and brain, 9-/sup 123m/Te-telluriumheptadecanoic acid as a myocardial imaging agent was studied. This compound could be used for designing new fatty acid analogues labeled with 11C and 18F that stay in the myocardium because of metabolic inhibition

  6. Powdery mildew fungal effector candidates share N-terminal Y/F/WxC-motif

    Directory of Open Access Journals (Sweden)

    Emmersen Jeppe

    2010-05-01

    Full Text Available Abstract Background Powdery mildew and rust fungi are widespread, serious pathogens that depend on developing haustoria in the living plant cells. Haustoria are separated from the host cytoplasm by a plant cell-derived extrahaustorial membrane. They secrete effector proteins, some of which are subsequently transferred across this membrane to the plant cell to suppress defense. Results In a cDNA library from barley epidermis containing powdery mildew haustoria, two-thirds of the sequenced ESTs were fungal and represented ~3,000 genes. Many of the most highly expressed genes encoded small proteins with N-terminal signal peptides. While these proteins are novel and poorly related, they do share a three-amino acid motif, which we named "Y/F/WxC", in the N-terminal of the mature proteins. The first amino acid of this motif is aromatic: tyrosine, phenylalanine or tryptophan, and the last is always cysteine. In total, we identified 107 such proteins, for which the ESTs represent 19% of the fungal clones in our library, suggesting fundamental roles in haustoria function. While overall sequence similarity between the powdery mildew Y/F/WxC-proteins is low, they do have a highly similar exon-intron structure, suggesting they have a common origin. Interestingly, searches of public fungal genome and EST databases revealed that haustoria-producing rust fungi also encode large numbers of novel, short proteins with signal peptides and the Y/F/WxC-motif. No significant numbers of such proteins were identified from genome and EST sequences from either fungi which do not produce haustoria or from haustoria-producing Oomycetes. Conclusion In total, we identified 107, 178 and 57 such Y/F/WxC-proteins from the barley powdery mildew, the wheat stem rust and the wheat leaf rust fungi, respectively. All together, our findings suggest the Y/F/WxC-proteins to be a new class of effectors from haustoria-producing pathogenic fungi.

  7. Standard cosmological evolution in the f(R) model to Kaluza-Klein cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Aghmohammadi, A; Abolhassani, M R [Plasma Physics Research Center, Science and Research Branch, Islamic Azad University of Tehran (Iran, Islamic Republic of); Saaidi, Kh; Vajdi, A [Department of Physics, Faculty of Science, University of Kurdistan, Pasdaran Ave., Sanandaj (Iran, Islamic Republic of)], E-mail: agha35484@yahoo.com, E-mail: ksaaidi@uok.ac.ir, E-mail: mrhasani@modares.ac.ir, E-mail: Avajdi@uok.ac.ir

    2009-12-15

    In this paper, using f(R) theory of gravity we explicitly calculate cosmological evolution in the presence of a perfect fluid source in four- and five-dimensional space-time in which this cosmological evolution in self-creation is presented by Reddy et al (2009 Int. J. Theor. Phys. 48 10). An exact cosmological model is presented using a relation between Einstein's gravity field equation components due to a metric with the same component from f(R) theory of gravity. Some physics and kinematical properties of the model are also discussed.

  8. Interfacing Of PIC 18F252 Microcontroller with Real Time Clock via I2C Protocol

    Directory of Open Access Journals (Sweden)

    Arnab G. Samanta

    2014-09-01

    Full Text Available This paper describes a microcontroller based digital clock which can be used in real time systems. The system is constructed using PIC18F252 (microcontroller, DS1307 (real time clock IC and its software program is written with C programming language. A 3v battery backup is provided to real time clock IC. Communication between PIC microcontroller and DS1307 takes place through I²C Bus protocol.

  9. Elucidating the trophodynamics of four coral reef fishes of the Solomon Islands using δ15N and δ13C

    Science.gov (United States)

    Greenwood, N. D. W.; Sweeting, C. J.; Polunin, N. V. C.

    2010-09-01

    Size-related diet shifts are important characteristics of fish trophodynamics. Here, body size-related changes in muscle δ15N and δ13C of four coral reef fishes, Acanthurus nigrofuscus (herbivore), Chaetodon lunulatus (corallivore) , Chromis xanthura (planktivore) and Plectropomus leopardus (piscivore) were investigated at two locations in the Solomon Islands. All four species occupied distinct isotopic niches and the concurrent δ13C' values of C. xanthura and P. leopardus suggested a common planktonic production source. Size-related shifts in δ15N, and thus trophic level, were observed in C. xanthura, C. lunulatus and P. leopardus, and these trends varied between location, indicating spatial differences in trophic ecology. A literature review of tropical fishes revealed that positive δ15N-size trends are common while negative δ15N-size trends are rare. Size-δ15N trends fall into approximately equal groups representing size-based feeding within a food chain, and that associated with a basal resource shift and occurs in conjunction with changes in production source, indicated by δ13C. The review also revealed large scale differences in isotope-size trends and this, combined with small scale location differences noted earlier, highlights a high degree of plasticity in the reef fishes studied. This suggests that trophic size analysis of reef fishes would provide a productive avenue to identify species potentially vulnerable to reef impacts as a result of constrained trophic behaviour.

  10. 48 CFR 1819.201 - General policy. (NASA supplements paragraphs (a), (c), (d), and (f))

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true General policy. (NASA supplements paragraphs (a), (c), (d), and (f)) 1819.201 Section 1819.201 Federal Acquisition Regulations System NATIONAL AERONAUTICS AND SPACE ADMINISTRATION SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Policies 1819.201 General policy....

  11. Guido Kangur toob C. F. Hahni pubisse jatsu / Urmas Hännile

    Index Scriptorium Estoniae

    Hännile, Urmas

    2009-01-01

    Eesti Draamateatri näitleja ja muusikafestivali Sõru Jazz korraldaja Guido Kanguri eestvõttel hakkab Pärnus C. F. Hahni pubis (Riia mnt 129a) kolmapäeviti kõlama džässmuusika, G. Kanguri tegemistest

  12. Measurement of the figure of merit M for 1-C3F6/SF6 mixtures

    DEFF Research Database (Denmark)

    Christensen, Jørn Erik Berril; McAllister, Iain Wilson

    1997-01-01

    High precision measurements of the linear part of the Paschen curve are reported for 1-C3F6/SF6 mixtures. From these measurements, values for the pressure-reduced limiting electric field strength (E/p)lim and the associated figure of merit M are derived. These two parameters can be used to...

  13. 26 CFR 5c.168(f)(8)-1 - Special rules for leases.

    Science.gov (United States)

    2010-04-01

    ... parties to the agreement as lessors and lessees for Federal tax law purposes. These rules apply only with... through 5c.168(f)(8)-11 may be treated by the parties as a lease for Federal Tax law purposes only... parties as a sale for Federal tax law purposes only. The agreements need not comply with State...

  14. Flood Hazard Recurrence Frequencies for C-, F-, E-, S-, H-, Y-, and Z-Areas

    Energy Technology Data Exchange (ETDEWEB)

    Chen, K.F.

    1999-11-18

    A method was developed to determine the probabilistic flood elevation curves for Savannah River Site facilities. This report presents the method used to determine the probabilistic flood elevation curves for C-, F-, E-, H-, S-, Y-, and Z-Areas due to runoff from the Upper Three Runs and Fourmile Branch basins.

  15. Ab Initio Investigations of the C2F4S Isomers and of Their Interconversions

    DEFF Research Database (Denmark)

    Shim, Irene; Vallano-Lorenzo, Sandra; Lisbona-Martin, Pilar;

    2003-01-01

    The transition states and the activation energies for the unobserved isomerization reactions between the three possible C2F4S isomers with divalent sulfur, trifluorothioacetyl fluoride 1, tetrafluorothiirane 2, and trifluoroethenesulfenyl fluoride 3, have been determined by ab initio Hartree-Fock...

  16. 48 CFR 47.303-14 - C.i.f. destination.

    Science.gov (United States)

    2010-10-01

    ... and marine insurance paid by the contractor. (b) Contractor responsibilities. The contractor's... of marine insurance coverage specified in the contract or agreed upon by the Government contracting... delivery term. C.i.f. (Cost, insurance, freight) destination means free of expense to the...

  17. Atmospheric chemistry of n-C(x)F(2)(x)(+1)CHO (x = 1, 2, 3, 4)

    DEFF Research Database (Denmark)

    Hurley, M D; Ball, J C; Wallington, T J;

    2006-01-01

    Smog chamber/FTIR techniques were used to study the atmospheric fate of n-C(x)F(2)(x)(+1)C(O) (x = 1, 2, 3, 4) radicals in 700 Torr O(2)/N(2) diluent at 298 +/- 3 K. A competition is observed between reaction with O(2) to form n-C(x)()F(2)(x)()(+1)C(O)O(2) radicals and decomposition to form n-C(x...... atmospheric chemistry of n-C(x)F(2)(x)(+1)C(O) radicals and their possible role in contributing to the formation of perfluorocarboxylic acids in the environment....

  18. Electrodiagnostic values through the thoracic outlet using C8 root needle studies, F-waves, and cervical somatosensory evoked potentials.

    Science.gov (United States)

    Livingstone, E F; DeLisa, J A; Halar, E M

    1984-11-01

    Mid-humerus cadaver determinations of ulnar F-wave, C7 spinal somatosensory evoked potential (SEP), and modified C8 root stimulation (RS) were performed bilaterally on 20 normal subjects to standardize technique and obtain normal values for the segment from mid-humerus to cervical spine. Our cadaver study shows that the best position for upper extremity measurement of mid-humerus-cervical spine distance is at 60 degrees of shoulder abduction, 45 degrees of internal rotation, and at the distance of 35cm, measured by caliper. Using this position and distance the following normal values were obtained: 1) Mid-humerus F-wave minimal, maximal, and mean latencies, and minimal nerve conduction velocity (NCV) were 21.8 +/- 1.2msec, 22.3 +/- 1.2msec, 22.3 +/- 1.1msec, and 59.7 +/- 2.4m/sec, respectively. Latency difference between minimal and maximal F-wave was 1.4 +/- 0.4msec. 2) Cervical spine SEP was 5.1 +/- 0.4msec, with left to right difference of less than 0.9msec. 3) C8 RS and mid-humerus ulnar nerve (UN) pick-up latency and NCV were 4.9 +/- 0.2msec and 71.4 +/- 2.2m/sec, whereas C8 root pick-up and mid-humerus UN stimulation latency and NCV were 5.2 +/- 0.4msec and 66.9 +/- 5.2m/sec, respectively. To evaluate proximal nerve conductivity through the thoracic outlet, the sequential use of the three modified techniques for 35cm mid-humerus-cervical spine distance is recommended. PMID:6497620

  19. Leonardsenite, MgAlF5(H2O)(2), a new mineral species from Eldfell Volcano, Heimaey Island, Iceland

    DEFF Research Database (Denmark)

    Mitolo, Donatella; Garavelli, Anna; Zunic, Tonci Balic;

    2013-01-01

    Leonardsenite (IMA2011-059), with ideal formula MgAlF5(H2O)(2), is a new fumarole mineral from Eldfell volcano, Iceland. It has also been found in volcanic encrustations from the Hekla crater, Iceland. The mineral forms a soft and friable mass of white crystals up to 20 mu m in length. The streak...

  20. A comparison of U/Th and rapid-screen 14C dates from Line Island fossil corals

    Science.gov (United States)

    Grothe, Pamela R.; Cobb, Kim M.; Bush, Shari L.; Cheng, Hai; Santos, Guaciara M.; Southon, John R.; Lawrence Edwards, R.; Deocampo, Daniel M.; Sayani, Hussein R.

    2016-03-01

    Time-consuming and expensive radiometric dating techniques limit the number of dates available to construct absolute chronologies for high-resolution paleoclimate reconstructions. A recently developed rapid-screen 14C dating technique reduces sample preparation time and per sample costs by 90%, but its accuracy has not yet been tested on shallow-water corals. In this study, we test the rapid-screen 14C dating technique on shallow-water corals by comparing 44 rapid-screen 14C dates to both high-precision 14C dates and U/Th dates from mid- to late-Holocene fossil corals collected from the central tropical Pacific (2-4°N, 157-160°W). Our results show that 42 rapid-screen 14C and U/Th dates agree within uncertainties, confirming closed-system behavior and ensuring chronological accuracy. However, two samples that grew ˜6500 years ago have calibrated 14C ages ˜1000 years younger than the corresponding U/Th ages, consistent with diagenetic alteration as indicated by the presence of 15-23% calcite. Mass balance calculations confirm that the observed dating discrepancies are consistent with 14C addition and U removal, both of which occur during diagenetic calcite recrystallization. Under the assumption that aragonite-to-calcite replacement is linear through time, we estimate the samples' true ages using the measured 14C and U/Th dates and percent calcite values. Results illustrate that the rapid-screen 14C dates of Holocene-aged fossil corals are accurate for samples with less than 2% calcite. Application of this rapid-screen 14C method to the fossil coral rubble fields from Kiritimati Island reveal significant chronological clustering of fossil coral across the landscape, with older ages farther from the water's edge.

  1. Search for Physics Beyond the Standard Model via Positron Polarization Measurements with Polarized $ ^{17} $F.

    CERN Multimedia

    Versyck, S

    2002-01-01

    This proposal aims at measuring the longitudinal polarization of positrons emitted from polarized $^{17} $F~nuclei. The experiment will have a comparable sensitivity to possible right-handed current contributions in the weak interaction as the experiment which was recently carried out with $ ^{107} $In in Louvain-la-Neuve, but will provide a more stringent limit due to the fact that, since $ ^{17} $F decays through a superallowed $\\beta$ -transition, the recoil-order corrections to the allowed approximation can be taken into account very precisely. Furthermore, because $ ^{17} $F decays via a mixed Fermi/Gamow-Teller $\\beta$ -transition, this experiment will also yield a new limit on possible scalar contributions to the weak interaction. While the $^{17}$F beam is being developed, part of the beamtime was used to perform a similar experiment with $^{118}$ Sb. As this isotope decays via a pure GT $\\beta$ -transition, this experiment will yield new limits on the possible presence of both right-handed and tensor...

  2. Factors affecting 18 F FDOPA standardized uptake value in patients with primary brain tumors after treatment

    International Nuclear Information System (INIS)

    Aim: To investigate the factors affecting 18 F FDOPA uptake in patients with primary brain tumors (PBT) after treatment. Materials and methods: 97 patients with PBT (6 were grade I, 40 were grade II, 29 were grade III and 22 were grade IV) underwent 18 F FDOPA positron emission tomography/computed tomography (PET/CT) after treatment. Intervals from surgery, chemotherapy (CHT) and radiotherapy (RT) were 41.48 (± 42.27), 16.04 (± 29.08) and 28.62 (± 34.49) months respectively. Results: 18 F FDOPA uptake in the site of recurrence was not related to the interval from surgery and CHT while a significant relationship has been found with the interval from RT and tumor grade. Conclusions: The results of our study show that the interval from RT and the grade of PBT should be considered carefully when evaluating brain PET/CT scans since these factors could directly affect 18 F FDOPA uptake

  3. Effect of curvature on C-F bonding in fluorinated carbons: from fullerene and derivatives to graphite.

    Science.gov (United States)

    Zhang, W; Dubois, M; Guérin, K; Bonnet, P; Kharbache, H; Masin, F; Kharitonov, A P; Hamwi, A

    2010-02-14

    The effect of the curvature of the carbon lattice is discussed taking into account NMR data on various fluorinated carbons including C(60) fullerenes, single, double and multiwall carbon nanotubes. Graphite fluorides and highly fluorinated fullerenes are used as limit model compounds for planar and spherical geometries, respectively. The curvature results in a weakening of the C-F bonding covalence. First of all, various highly fluorinated fullerenes with increasing F/C molar ratio were prepared by treatment with pure gaseous fluorine. A preliminary study using XRD, EPR and IR spectroscopy confirms that the highest fluorination level can be reached either at 133 or at 300 degrees C. In order to extract the correlation between fluorine and carbon atoms and the C-F bond length, specific sequences such as solid echo, two-dimensional (19)F -->(13)C cross polarization wide-line separation and inverse (19)F -->(13)C cross polarization were also used for fluorinated C(60). PMID:20119617

  4. 46 CFR 154.610 - Design temperature not colder than 0 °C (32 °F).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature not colder than 0 °C (32 °F). 154..., Construction and Equipment Materials § 154.610 Design temperature not colder than 0 °C (32 °F). Materials for cargo tanks for a design temperature not colder than 0 °C (32 °F) must meet the following: (a) The...

  5. Numerical modelling of micro-machining of f.c.c. single crystal: Influence of strain gradients

    KAUST Repository

    Demiral, Murat

    2014-11-01

    A micro-machining process becomes increasingly important with the continuous miniaturization of components used in various fields from military to civilian applications. To characterise underlying micromechanics, a 3D finite-element model of orthogonal micro-machining of f.c.c. single crystal copper was developed. The model was implemented in a commercial software ABAQUS/Explicit employing a user-defined subroutine VUMAT. Strain-gradient crystal-plasticity and conventional crystal-plasticity theories were used to demonstrate the influence of pre-existing and evolved strain gradients on the cutting process for different combinations of crystal orientations and cutting directions. Crown Copyright © 2014.

  6. Turbine system

    Energy Technology Data Exchange (ETDEWEB)

    McMahan, Kevin Weston; Dillard, Daniel Jackson

    2016-05-03

    A turbine system is disclosed. The turbine system includes a transition duct having an inlet, an outlet, and a passage extending between the inlet and the outlet and defining a longitudinal axis, a radial axis, and a tangential axis. The outlet of the transition duct is offset from the inlet along the longitudinal axis and the tangential axis. The turbine system further includes a turbine section connected to the transition duct. The turbine section includes a plurality of shroud blocks at least partially defining a hot gas path, a plurality of buckets at least partially disposed in the hot gas path, and a plurality of nozzles at least partially disposed in the hot gas path. At least one of a shroud block, a bucket, or a nozzle includes means for withstanding high temperatures.

  7. Wind Turbine Generator System Safety and Function Test Report for the Entegrity EW50 Wind Turbine

    Energy Technology Data Exchange (ETDEWEB)

    Smith, J.; Huskey, A.; Jager, D.; Hur, J.

    2012-11-01

    This report summarizes the results of a safety and function test that NREL conducted on the Entegrity EW50 wind turbine. This test was conducted in accordance with the International Electrotechnical Commissions' (IEC) standard, Wind Turbine Generator System Part 2: Design requirements for small wind turbines, IEC 61400-2 Ed.2.0, 2006-03.

  8. Wind Turbine Generator System Safety and Function Test Report for the Ventera VT10 Wind Turbine

    Energy Technology Data Exchange (ETDEWEB)

    Smith, J.; Huskey, A.; Jager, D.; Hur, J.

    2012-11-01

    This report summarizes the results of a safety and function test that NREL conducted on the Ventera VT10 wind turbine. This test was conducted in accordance with the International Electrotechnical Commissions' (IEC) standard, Wind Turbine Generator System Part 2: Design requirements for small wind turbines, IEC 61400-2 Ed.2.0, 2006-03.

  9. The structure of the Ca{sup 2+}-binding , glycosylated F-spondin domain of F-spondin- A C2-domain variant in an extracellular matrix protein.

    Energy Technology Data Exchange (ETDEWEB)

    Tan, K.; Lawler, J. (Biosciences Division); (Beth Israel Deaconess Medical Center); (Harvard Medical School)

    2011-05-10

    F-spondin is a multi-domain extracellular matrix (ECM) protein and a contact-repellent molecule that directs axon outgrowth and cell migration during development. The reelin{_}N domain and the F-spondin domain (FS domain) comprise a proteolytic fragment that interacts with the cell membrane and guides the projection of commissural axons to floor plate. The FS domain is found in F-spondins, mindins, M-spondin and amphiF-spondin. We present the crystal structure of human F-spondin FS domain at 1.95{angstrom} resolution. The structure reveals a Ca{sup 2+}-binding C2 domain variant with an 8-stranded antiparallel {beta}-sandwich fold. Though the primary sequences of the FS domains of F-spondin and mindin are less than 36% identical, their overall structures are very similar. The unique feature of F-spondin FS domain is the presence of three disulfide bonds associated with the N- and C-termini of the domain and a highly conserved N-linked glycosylation site. The integrin-binding motif found in mindin is not conserved in the F-spondin FS domain. The structure of the F-spondin FS domain completes the structural studies of the multiple-domain ECM molecule. The homology of its core structure to a common Ca{sup 2+}- and lipid-binding C2 domain suggests that the F-spondin FS domain may be responsible for part of the membrane targeting of F-spondin in its regulation of axon development. The structural properties of the FS domain revealed in this study pave the way for further exploration into the functions of F-spondin.

  10. The structure of the Ca2+-binding, glycosylated F-spondin domain of F-spondin - A C2-domain variant in an extracellular matrix protein

    Directory of Open Access Journals (Sweden)

    Lawler Jack

    2011-05-01

    Full Text Available Abstract Background F-spondin is a multi-domain extracellular matrix (ECM protein and a contact-repellent molecule that directs axon outgrowth and cell migration during development. The reelin_N domain and the F-spondin domain (FS domain comprise a proteolytic fragment that interacts with the cell membrane and guides the projection of commissural axons to floor plate. The FS domain is found in F-spondins, mindins, M-spondin and amphiF-spondin. Results We present the crystal structure of human F-spondin FS domain at 1.95Å resolution. The structure reveals a Ca2+-binding C2 domain variant with an 8-stranded antiparallel β-sandwich fold. Though the primary sequences of the FS domains of F-spondin and mindin are less than 36% identical, their overall structures are very similar. The unique feature of F-spondin FS domain is the presence of three disulfide bonds associated with the N- and C-termini of the domain and a highly conserved N-linked glycosylation site. The integrin-binding motif found in mindin is not conserved in the F-spondin FS domain. Conclusion The structure of the F-spondin FS domain completes the structural studies of the multiple-domain ECM molecule. The homology of its core structure to a common Ca2+- and lipid-binding C2 domain suggests that the F-spondin FS domain may be responsible for part of the membrane targeting of F-spondin in its regulation of axon development. The structural properties of the FS domain revealed in this study pave the way for further exploration into the functions of F-spondin.

  11. Budding yeast cDNA sequencing project: Y091_K02_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y091_K02_F.ab1 - - - Show Y091_K02_F.ab1 Seqid Y091_K02_F.ab1 Link to SGD - Link to dbEST - Link ... GNNATATACAGATATAAAAGAAGATAAATAAAATTTTTGT TTATAACCAATCC ACGAGATAAATTATTATTCATAACTTGGTTAAACTTT AAAGTGGGGGTGT ... TGACTAAGAATATATCTTACTATA ATTTATTAAAAAAAAAATAACTACCTTCC AGTATTAATATATTATTTTGT AATATCTAAAACAATATTTTTACGAAATG ... T TTTCTAAGATAAAACAAAAACTAATAATAAAATTTTTTTTTTCTTTTAAT CC AAAATTGGGAGGGGGGTGGATTTAATATCTCTATAAAAGATTTTCTTC C ... ACATACCGCATAACATAATGATTTAAA AGAGTGAGAGTATTTATAAACAATCC ATATTCC TTATATCATAATATATT TACTATACTTACACCTTAAGCTTATT ...

  12. Industrial Advanced Turbine Systems Program overview

    Energy Technology Data Exchange (ETDEWEB)

    Esbeck, D.W. [Solar Turbines Inc., San Diego, CA (United States)

    1995-10-01

    The U.S. Department of Energy (DOE), in partnership with industry, has set new performance standards for industrial gas turbines through the creation of the Industrial Advanced Turbine System Program. Their leadership will lead to the development of an optimized, energy efficient, and environmentally friendly gas turbine power systems in this size class (3-to-20 MW). The DOE has already created a positive effect by encouraging gas turbine system manufacturers to reassess their product and technology plans using the new higher standards as the benchmark. Solar Turbines has been a leader in the industrial gas turbine business, and is delighted to have joined with the DOE in developing the goals and vision for this program. We welcome the opportunity to help the national goals of energy conservation and environmental enhancement. The results of this program should lead to the U.S. based gas turbine industry maintaining its international leadership and the creation of highly paid domestic jobs.

  13. Wear Behavior of Cold Pressed and Sintered Al2O3/TiC/CaF2Al2O3/TiC Laminated Ceramic Composite

    Institute of Scientific and Technical Information of China (English)

    Xuefeng YANG; Jian CHENG; Peilong SONG; Shouren WANG; Liying YANG; Yanjun WANG; Ken MAO

    2013-01-01

    A novel laminated Al2O3/TiC/CaF2-Al2O3/TiC sandwich ceramic composite was fabricated through cold pressing and sintering to achieve better anti-wear performance,such as low friction coefficient and low wear rate.Al2O3/TiC/CaF2 and Al2O3/TiC composites were alternatively built layer-by-layer to obtain a sandwich structure.Solid lubricant CaF2 was added evenly into the Al2O3/TiC/CaF2 layer to reduce the friction and wear.Al2O3/TiC ceramic was also cold pressed and sintered for comparison.Friction analysis of the two ceramics was then conducted via a wear-and-tear machine.Worn surface and surface compositions were examined by scanning electron microscopy and energy dispersion spectrum,respectively.Results showed that the laminated Al2O3/TiC/CaF2-Al2O3/TiC sandwich ceramic composite has lower friction coefficient and lower wear rate than those of Al2O3/TiC ceramic alone because of the addition of CaF2 into the laminated Al2O3/TiC/CaF2-Al2O3/TiC sandwich ceramic composite.Under the friction load,the tiny CaF2 particles were scraped from the Al2O3/TiC/CaF2 layer and spread on friction pairs before falling off into micropits.This process formed a smooth,self-lubricating film,which led to better anti-wear properties.Adhesive wear is the main wear mechanism of Al2O3/TiC/CaF2 layer and abrasive wear is the main wear mechanism of Al2O3/TiC layer.

  14. Vermittlung von Informationskompetenz an deutschen Bibliotheken : Standards der Informationskompetenz für Studierende

    OpenAIRE

    Netzwerk Informationskompetenz Baden-Württemberg

    2008-01-01

    Informationskompetenz ist eine berufs- und fachübergreifende Schlüsselqualifikation. Sie bildet die Grundlage zur selbständigen und effizienten Informationsgewinnung und -bewertung. Damit ist Informationskompetenz eine wichtige Voraussetzung für ein erfolgreiches Studium und lebenslanges Lernen. Der Begriff Informationskompetenz umfasst umfangreiche und komplexe Qualifikationen, deren Vermittlung sehr aufwändig ist. Angesichts der Dynamik und des steigenden Umfangs an Informationsangebote...

  15. MAD : ein Datenmodell für den Kern eines Non-Standard-Datenbanksystems

    OpenAIRE

    Mitschang, Bernhard

    1987-01-01

    Eine zentrale Anforderung an Datenbanksysteme für den Einsatz in den sog. nichtkonventionellen Anwendungen besteht in der anwendungsgerechten Modellierung und Verwaltung der Anwendungsobjekte. Von dem Architekturkonzept der DBS-Kern-Architektur ausgehend, werden zum einen Anforderungen an die Datenmodelle der DBS-Kern-Schnittstelle erarbeitet und zum anderen verschiedene Datenmodelle diesbezüglich analysiert. Dieser Kriterienkatalog und die (teilweise) Unzulänglichkeit der untersuchten Datenm...

  16. Comparison of 11C-PiB and 18F-florbetaben for Aβ imaging in ageing and Alzheimer's disease

    International Nuclear Information System (INIS)

    Amyloid imaging with 18F-labelled radiotracers will allow widespread use of this technique, facilitating research, diagnosis and therapeutic development for Alzheimer's disease (AD). The purpose of this analysis was to compare data on cortical Aβ deposition in subjects who had undergone both 11C-PiB (PiB) and 18F-florbetaben (FBB) PET imaging. We identified ten healthy elderly controls (HC) and ten patients with AD who had undergone PET imaging after intravenous injection of 370 MBq of PiB and 300 MBq of FBB under separate research protocols. PiB and FBB images were coregistered so that placement of regions of interest was identical on both scans and standard uptake value ratios (SUVR) using the cerebellar cortex as reference region were calculated between 40 and 70 min and between 90 and 110 min after injection for PiB and FBB, respectively. Significantly higher SUVR values (p 18F radiotracer for imaging AD pathology in vivo. (orig.)

  17. Preparation of n.c.a. [18F]-CH2BrF via aminopolyether supported nucleophilic substitution

    International Nuclear Information System (INIS)

    A complex of the macrocyclic aminopolyether Kryptofix 2.2.2. and potassium carbonate was used to synthesize the positron emission tomography radiopharmaceutical, [18F]-CH2BrF, from dibromomethane. At the no-carrier-added level the nucleophilic 18F-for-Br exchange gives rise to a corrected radiochemical yield up to 62%. (author)

  18. Low Scale Non-universal, Non-anomalous U(1)'_F in a Minimal Supersymmetric Standard Model

    CERN Document Server

    Chen, Mu-Chun

    2010-01-01

    We propose a non-universal U(1)'_F symmetry combined with the Minimal Supersymmetric Standard Model. All anomaly cancellation conditions are satisfied without exotic fields other than three right-handed neutrinos. Because our model allows all three generations of chiral superfields to have different U(1)'_F charges, upon the breaking of the U(1)'_F symmetry at a low scale, realistic masses and mixing angles in both the quark and lepton sectors are obtained. In our model, neutrinos are predicted to be Dirac fermions and their mass ordering is of the inverted hierarchy type. The U(1)'_F charges of the chiral super-fields also naturally suppress the mu term and automatically forbid baryon number and lepton number violating operators. While all flavor-changing neutral current constraints in the down quark and charged lepton sectors can be satisfied, we find that constraint from D0-D0bar turns out to be much more stringent than the constraints from the precision electroweak data.

  19. Inter-comparison of 18F-FDG PET/CT standardized uptake values in Korea

    International Nuclear Information System (INIS)

    The number of PET/CT tests for diagnosing and treating tumors are increasing every year, and thus it is considered necessary to compare PET/CT images among medical institutions or among different PET/CT systems within the same medical institution. We present to get the variation of standardized uptake values (SUV) among PET/CT systems, to derive an SUV calibration table that enables quantitative comparison of PET/CT systems, and to test the usefulness of the calibration table through comparing patient's SUV with the SUV calibration table. The correlation coefficients that inter-compared the calibration constants of normal patients and the calibration constants of the mean standardized uptake value with the calibration constants of the standardized uptake value of phantom are 0.88938 (P<0.0001).

  20. Kinematic viscosity and speed of sound in gaseous CO, CO2, SiF4, SF6, C4F8, and NH3 from 220 K to 375 K and pressures up to 3.4 MPa

    International Nuclear Information System (INIS)

    An acoustic Greenspan viscometer was used to measure the kinematic viscosity and speed of sound in the gases: CO, CO2, SiF4, SF6, C4F8, and NH3. The measurements cover the temperature range 220 K to 375 K, and pressures up to 3.4 MPa or 80% of the saturation pressure. The viscometer was calibrated at 298.16 K using five reference gases, Ar, He, N2, CH4, and C3H8, for which the viscosity and the speed of sound are known. With this calibration, we estimated the relative standard uncertainty of the kinematic viscosity ur(η/ρ) = 0.006 and the uncertainty of speed of sound ur(c) = 0.0001, except for very low pressures where the signal-to-noise ratio deteriorates and quality factor for the Helmholtz mode is ≤20

  1. Radiocarbon, 13C and tritium in water samples from basaltic aquifers and carbonate aquifers on the island of Oahu, Hawaii

    International Nuclear Information System (INIS)

    Principal fresh water aquifers on the subtropical island of Oahu consist of basaltic rocks that are devoid of fossil carbonate minerals. In southern Oahu fresh water occurs as semi-independent basal lenses which float on salt water and are bounded by sedimentary formations along the coast and in valley bottoms. The latter formations contain carbonate aquifers. Fresh water also occurs in dike compartments located in the central parts of the mountains. The radiocarbon content of groundwater recharge on Oahu is between 96 and 100% modern. The 13C concentration associated with fresh groundwater is between -17 and -19 δ per mille PDB and remains constant while such waters reside in, or travel through, basaltic rock aquifers. Radiocarbon and tritium data on basal waters withdrawn by major pumping stations show these waters to have ages between a few decades and several hundred years. Differences in these ages relate systematically to individual pumping rates of the stations, well depths and local lens thickness. (author)

  2. Effects of irradiation and post-irradiation annealing on the thermal conductivity/diffusivity of monolithic SiC and f-SiC/SiC composites

    Science.gov (United States)

    Youngblood, G. E.; Senor, D. J.; Jones, R. H.

    2004-08-01

    Laser flash thermal diffusivity measurements were made on high-purity monolithic CVD-SiC and 2D f-SiC(Hi-Nicalon™)/ICVI-SiC composite samples before and after irradiation (250-800 °C, 4-8 dpa-SiC) and after post-irradiation annealing composite samples to 1200 °C. For irradiated CVD-SiC, the defect concentrations at saturation were estimated to range from 25 300 appm (250 °C) down to 940 appm (800 °C). The transverse thermal conductivity ratios after-to-before irradiation ( Kir/ Ko) determined at the irradiation temperatures ranged from: 0.044 (250 °C) up to 0.12 (800 °C) for irradiated CVD-SiC and 0.18 (330 °C) up to 0.29 (800 °C) for the irradiated Hi-Nicalon™ composite. Analysis of thermal diffusivity values for the Hi-Nicalon composite measured in air, argon, helium and vacuum indicated that thermal conductivity degradation occurred primarily due to point defect accumulation in the matrix component. After annealing to 1200 °C and cooling to ambient, fiber/matrix debonding occurred due to net shrinkage in the fiber and PyC interface components.

  3. Effects of irradiation and post-irradiation annealing on the thermal conductivity/diffusivity of monolithic SiC and f-SiC/SiC composites

    International Nuclear Information System (INIS)

    Laser flash thermal diffusivity measurements were made on high-purity monolithic CVD-SiC and 2D f-SiC(Hi-NicalonTM)/ICVI-SiC composite samples before and after irradiation (250-800 deg. C, 4-8 dpa-SiC) and after post-irradiation annealing composite samples to 1200 deg. C. For irradiated CVD-SiC, the defect concentrations at saturation were estimated to range from 25 300 appm (250 deg. C) down to 940 appm (800 deg. C). The transverse thermal conductivity ratios after-to-before irradiation (Kir/Ko) determined at the irradiation temperatures ranged from: 0.044 (250 deg. C) up to 0.12 (800 deg. C) for irradiated CVD-SiC and 0.18 (330 deg. C) up to 0.29 (800 deg. C) for the irradiated Hi-NicalonTM composite. Analysis of thermal diffusivity values for the Hi-Nicalon composite measured in air, argon, helium and vacuum indicated that thermal conductivity degradation occurred primarily due to point defect accumulation in the matrix component. After annealing to 1200 deg. C and cooling to ambient, fiber/matrix debonding occurred due to net shrinkage in the fiber and PyC interface components

  4. The stability, frontier orbitals, bond character, and static linear polarizability of the fluorinated fullerene H20@C80F60

    International Nuclear Information System (INIS)

    This paper uses the density functional theory under generalised gradient approximation to analyse the stability, frontier orbitals, bond character, and static linear polarizability of H20@C80F60, which has not been isolated, as well as those of the synthesised H20@C80F60. The H20@C80F60 should be considerably stable by analysing its energy and aromaticity. The inside H and outside X will play different role in the chemical reaction involving H20@C80X60 (X = H and F). The covalence of C–H bond is in the order that the inside C–H bond of H20@C80F60 > the inside C–H bond of H20@C80H60 > the outside C–H bond of H20@C80H60, whereas the C–F bond of H20@C80F60 have both the covalent and ionic characters. The static linear polarizabilities of C80 and H20@C80X60 (X = H and F) are all isotropic

  5. The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.

    Science.gov (United States)

    Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra

    2016-04-01

    The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target. PMID:26621635

  6. 34 CFR Appendix C to Part 300 - National Instructional Materials Accessibility Standard (NIMAS)

    Science.gov (United States)

    2010-07-01

    ..., the NIMAS-compliant digital text should be provided as a single document.) 3. Modular Extensions The... 34 Education 2 2010-07-01 2010-07-01 false National Instructional Materials Accessibility Standard (NIMAS) C Appendix C to Part 300 Education Regulations of the Offices of the Department of...

  7. Creación de un Plan de Comunicación para el Burgos C.F.

    OpenAIRE

    Ruiz Miguel, Victoria

    2015-01-01

    Este trabajo presenta dos conceptos destacados en la sociedad de hoy en la actualidad: la comunicación y el fútbol. La comunicación es esencial en el día a día, tanto para las personas como para las empresas, y el fútbol es el deporte que más seguidores tiene. El trabajo muestra la situación comunicativa actual del equipo de fútbol Burgos C.F. y una posible mejora de su plan de comunicación. El Burgos C.F. juega en una liga muy competitiva pero ...

  8. Thermoluminescence comparison among Al2O3:C, LiF:Mg, Ti and LiF:Mg, Cu, P for natural radiation background measurement

    International Nuclear Information System (INIS)

    To select thermoluminescent dosimeters (TLDs) for low radiation research,thermoluminescence responses of Al2O3:C, LiF:Mg, Ti and LiF:Mg, Cu, P were measured under natural radiation background in Zhanjiang city, China. TL sensitivity of the three TLDs, in terms of the threshold dose, is sequenced as Al2O3:C(1-2 μGy), LiF:Mg, Cu, P(about 2 μGy), and LiF:Mg, Ti(>10 μGy). However, as the temperature of glow peak of Al2O3:C is not so high, its TL decays in a relatively long period,hence the non-linearity of the TL dose response curve of Al2O3:C, while temperatures of glow peaks of LiF:Mg, Ti and LiF:Mg, Cu, P are higher, hence their linear TL dose response. Therefore, LiF:Mg, Cu, P is the best TLD for low radiation cumulative dose detection. (authors)

  9. Inclusive production of ρ0 and f2 mesons in π-p interactions at 360 GeV/c

    International Nuclear Information System (INIS)

    We report on a study of ρ0 and f2 inclusive production in π--p interactions at 360 GeV/c, using the LEBC-EHS set-up at CERN and reconstructing about 165000 events. The ρ0, f2 and ρ30 cross sections are determined for χF > 0, χF > 0.4 and χF > 0.6 respectively and the ρ0 and f2 Feynman-χ distributions and transverse momentum distributions are presented. (orig.)

  10. Type IV Wind Turbine Model

    DEFF Research Database (Denmark)

    Hansen, Anca Daniela; Margaris, Ioannis D.

    project to be incorporated in the wind power plant level. This document describes the Type 4 wind turbine simulation model, implemented in the EaseWind project. The implemented wind turbine model is one of the initial necessary steps toward integrating new control services in the wind power plant level....... In the project, this wind turbine model will be further incorporated in a wind power plant model together with the implementation in the wind power control level of the new control functionalities (inertial response, synchronising power and power system damping). For this purpose an aggregate wind...... power plant (WPP) will be considered. The aggregate WPP model, which will be based on the upscaling of the individual wind turbine model on the electrical part, will make use of an equivalent wind speed. The implemented model follows the basic structure of the generic standard Type 4 wind turbine model...

  11. Comparison of qualitative and quantitative imaging characteristics of [11C]PiB and [18F]flutemetamol in normal control and Alzheimer's subjects

    Directory of Open Access Journals (Sweden)

    James M. Mountz

    2015-01-01

    Conclusions: [11C]PiB and [18F]flutemetamol have similar retention characteristics across a range of amyloid negative to positive subjects. Both tracers performed similarly when a standardized visual read technique was used to classify scans as amyloid-positive or amyloid-negative and correlated well with SUVR classifications. However, care in visual interpretation of amyloid positive versus amyloid negative regions should be taken, particularly in the case of [18F]flutemetamol when considering cortical vs. white-matter retention.

  12. IRMS detection of testosterone manipulated with 13C labeled standards in human urine by removing the labeled 13C

    International Nuclear Information System (INIS)

    Highlights: • 13C labeled testosterone can be used to adjust the isotope ratio of testosterone. • The novel testosterone cannot be detected by the regular IRMS method in doping test. • A method was explored to remove the labeled 13C. • The established method can be used to detect the manipulated testosterone. - Abstract: Isotope ratio mass spectrometry (IRMS) is applied to confirm testosterone (T) abuse by determining the carbon isotope ratios (δ13C value). However, 13C labeled standards can be used to control the δ13C value and produce manipulated T which cannot be detected by the current method. A method was explored to remove the 13C labeled atom at C-3 from the molecule of androsterone (Andro), the metabolite of T in urine, to produce the resultant (A-nor-5α-androstane-2,17-dione, ANAD). The difference in δ13C values between Andro and ANAD (Δδ13CAndro–ANAD, ‰) would change significantly in case manipulated T is abused. Twenty-one volunteers administered T manipulated with different 13C labeled standards. The collected urine samples were analyzed with the established method, and the maximum value of Δδ13CAndro–ANAD post ingestion ranged from 3.0‰ to 8.8‰. Based on the population reference, the cut-off value of Δδ13CAndro–ANAD for positive result was suggested as 1.2‰. The developed method could be used to detect T manipulated with 3-13C labeled standards

  13. Gas turbines

    Energy Technology Data Exchange (ETDEWEB)

    Farahan, E.; Eudaly, J.P.

    1978-10-01

    This evaluation provides performance and cost data for commercially available simple- and regenerative-cycle gas turbines. Intercooled, reheat, and compound cycles are discussed from theoretical basis only, because actual units are not currently available, except on a special-order basis. Performance characteristics investigated include unit efficiency at full-load and off-design conditions, and at rated capacity. Costs are tabulated for both simple- and regenerative-cycle gas turbines. The output capacity of the gas turbines investigated ranges from 80 to 134,000 hp for simple units and from 12,000 to 50,000 hp for regenerative units.

  14. 32 CFR Attachment C to Subpart B... - Standard C-Single Scope Background Investigation Periodic Reinvestigation (SSBI-PR)

    Science.gov (United States)

    2010-07-01

    ... institutions, international transportation of currency or monetary instruments, foreign bank and financial... DETERMINING ELIGIBILITY FOR ACCESS TO CLASSIFIED INFORMATION Investigative Standards Pt. 147, Subpt. B, Att. C... (including TOP SECRET Special Access Programs) and Sensitive Compartmented Information; (2) “Q”...

  15. Development of ASTM Standard for SiC-SiC Joint Testing Final Scientific/Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Jacobsen, George [General Atomics, San Diego, CA (United States); Back, Christina [General Atomics, San Diego, CA (United States)

    2015-10-30

    As the nuclear industry moves to advanced ceramic based materials for cladding and core structural materials for a variety of advanced reactors, new standards and test methods are required for material development and licensing purposes. For example, General Atomics (GA) is actively developing silicon carbide (SiC) based composite cladding (SiC-SiC) for its Energy Multiplier Module (EM2), a high efficiency gas cooled fast reactor. Through DOE funding via the advanced reactor concept program, GA developed a new test method for the nominal joint strength of an endplug sealed to advanced ceramic tubes, Fig. 1-1, at ambient and elevated temperatures called the endplug pushout (EPPO) test. This test utilizes widely available universal mechanical testers coupled with clam shell heaters, and specimen size is relatively small, making it a viable post irradiation test method. The culmination of this effort was a draft of an ASTM test standard that will be submitted for approval to the ASTM C28 ceramic committee. Once the standard has been vetted by the ceramics test community, an industry wide standard methodology to test joined tubular ceramic components will be available for the entire nuclear materials community.

  16. Lyophilized standards for the calibration of real time PCR assay for hepatitis C virus RNA

    Institute of Scientific and Technical Information of China (English)

    WANG Lu-nan; WU Jian-min; DENG Wei; SHEN Zi-yu; CHEN Wen-xiang; LI Jin-ming

    2006-01-01

    Background Since October 1997, an international standard for hepatitis C virus (HCV) nucleic acid amplification technology assay, 96/790, has been available. We compared a series of lyophilized standards with known HCV RNA concentrations against the international standard in fluorescence quantitative PCR detection.Methods A series of lyophilized sera were calibrated by ROCHE COBAS AMPLICOR HCV Monitor test against the international standard and sent to various manufacturers to analyse the samples using their own kits.Then calibration curves from the series were compared with that obtained from the external standard calibration curve with the manufacture's series.Results The standard calibration curve with the series of lyophilized serum showed an excellent correlation(R2>0.98), slope and intercept that were similar to those from the manufacture's series. When the standard calibration curve from the series of lyophilized standards were used to define the values of the given sample,lower coefficients of variation between kits from different manufactures were obtained.Conclusion The results showed that the lyophilized standards could be used to setup the standard calibration curve for clinical HCV RNA quantitative PCR detection.

  17. 49 CFR Appendix C to Part 215 - FRA Freight Car Standards Defect Code

    Science.gov (United States)

    2010-10-01

    ... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD FREIGHT CAR SAFETY STANDARDS Pt. 215, App. C Appendix C to... 13/4″. (C)(1) Rim thickness is 11/16″ or less; (2) Rim thickness is 5/8″ or less; (3) Rim thickness is 9/16″ or less; (D) Wheel cracked or broken in: (1) rim, (2) flange, (3) plate or (4) hub area....

  18. Steam turbine materials and corrosion

    Energy Technology Data Exchange (ETDEWEB)

    Holcomb, G.R.; Ziomek-Moroz, M.

    2007-01-01

    Ultra supercritical (USC) power plants offer the promise of higher efficiencies and lower emissions. Current goals of the U.S. Department of Energy’s Advanced Power Systems Initiatives include coal generation at 60% efficiency, which would require steam temperatures of up to 760°C. This research examines the steamside oxidation of alloys for use in USC systems, with emphasis placed on applications in high- and intermediate-pressure turbines. The list of alloys being examined is discussed, including the addition of new alloys to the study. These include alloy 625, selected because of its use as one of the two alloys used for turbine rotors, valves, casings, blading and bolts in the European AD700 full-scale demonstration plant (Scholven Unit F). The other alloy, alloy 617, is already one of the alloys currently being examined by this project. Other new alloys to the study are the three round robin alloys in the UK-US collaboration: alloys 740, TP347HFG, and T92. Progress on the project is presented on cyclic oxidation in 50% air – 50% water vapor, furnace exposures in moist air, and thermogravimetric analysis in argon with oxygen saturated steam. An update on the progress towards obtaining an apparatus for high pressure exposures is given.

  19. Razões para a falta de rendimento esportivo do Comercial F.C. Reasons for the lack of sports performance of Comercial F.C.

    Directory of Open Access Journals (Sweden)

    Cesar Machado Carvalho

    2012-04-01

    Full Text Available The international football, according to the report of the Plan for Modernization of the Brazilian Football FGV (2000 annual turnover of approximately $ 250 billion, while Brazil represents only 1% of the total. The Commercial F. C. headquartered in the city of Ribeirão Preto (SP, had its poly auctioned sports stadium partially forbidden for 23 years and not disputed the series A1, A3series being relegated to the Campeonato Paulista in 2009. This study aimed to identify those factors that hinder sports performance of the Commercial F. C., to do so, we studied its history, its relations with the government and legislation, market performance, partnerships established, administrative structures and results in the tournaments played between 2007 and 2008 to discuss their management problems. The methods used were research-explanatory and qualitative semi-structured interview to build a case study. We conclude that the gap between the formal structure and practice of members of the answers as a key element in the absence of the club's sports performance. O futebol internacional, segundo o relatório do Plano de Modernização do Futebol Brasileiro da FGV (2000, movimenta anualmente cerca de 250 bilhões de dólares, sendo que o Brasil participa com apenas 1% desse total. O Comercial F. C., sediado na Cidade de  Ribeirão Preto (SP, teve seu poliesportivo leiloado, estádio parcialmente interditado, e, há 23 anos, não disputava a série A1, sendo rebaixado para série A3 no Campeonato Paulista, em 2009. Este trabalho buscou identificar quais são os fatores que dificultam o rendimento esportivo do Comercial F. C., para tanto, foi estudada sua história, suas relações com o governo, sua legislação, seu mercado de atuação, suas parcerias realizadas, suas estruturas administrativas e seus  resultados  nos campeonatos disputados entre 2007 e 2008, a fim de discorrer

  20. 基于C8051F040单片机的伺服系统设计%Design of Servo System Based on C8051F040

    Institute of Scientific and Technical Information of China (English)

    蔡文莉

    2008-01-01

    随着微处理器的出现和控制算法的改进,控制系统的数字化已经成为其发展的主要方向之一.给出了一种基于C8051F040单片机的伺服系统设计方法,分析了数字校正环路的结构以及软件操作流程,着重介绍了数字PI调节器以及数字脉宽调制信号(PWM)的设计原理.该设计硬件电路简单,调试方便.试验证明,其性能稳定可靠,在工程实践中具较高的推广和应用价值.

  1. The DOE Next-Generation Drivetrain for Wind Turbine Applications: Gearbox, Generator, and Advanced Si/SiC Hybrid Inverter System: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Erdman, William; Keller, Jonathan

    2016-08-01

    This paper reports on the design and testing results from the U.S. Department of Energy Next-Generation Wind Turbine Drivetrain Project. The drivetrain design reduces the cost of energy by increasing energy capture through drivetrain efficiency improvements; by reducing operation and maintenance costs through reducing gearbox failures; and by lowering capital costs through weight reduction and a series of mechanical and electronic innovations. The paper provides an overview of the drivetrain gearbox and generator and provides a deeper look into the power converter system. The power converter has a number of innovations including the use of hybrid silicon (Si)/silicon carbide (SiC) isolated baseplate switching modules. Switching energies are compared between SiC and Si PIN diodes. The efficiency improvement by use of the SiC diode in a three-level converter is also described. Finally, a brief discussion covering utility interconnect requirements for turbines is provided with a particular focus on utility events that lead to high transient torque loads on drivetrain mechanical elements.

  2. Dark Matter Search Results from the PICO-2L C$_3$F$_8$ Bubble Chamber

    CERN Document Server

    Amole, C; Asner, D M; Baxter, D; Behnke, E; Bhattacharjee, P; Borsodi, H; Bou-Cabo, M; Brice, S J; Broemmelsiek, D; Clark, K; Collar, J I; Cooper, P S; Crisler, M; Dahl, C E; Daley, S; Das, M; Debris, F; Dhungana, N; Farine, J; Felis, I; Filgas, R; Fines-Neuschild, M; Girard, F; Giroux, G; Hai, M; Hall, J; Harris, O; Jackson, C M; Jin, M; Krauss, C B; Lafrenière, M; Laurin, M; Lawson, I; Levine, I; Lippincott, W H; Mann, E; Martin, J P; Maurya, D; Mitra, P; Neilson, R; Noble, A J; Plante, A; Podviianiuk, R B; Priya, S; Robinson, A E; Ruschman, M; Scallon, O; Seth, S; Sonnenschein, A; Starinski, N; Štekl, I; Vàzquez-Jaùregui, E; Wells, J; Wichoski, U; Zacek, V; Zhang, J

    2015-01-01

    New data are reported from the operation of a 2-liter C$_3$F$_8$ bubble chamber in the 2100 meter deep SNOLAB underground laboratory, with a total exposure of 211.5 kg-days at four different recoil energy thresholds ranging from 3.2 keV to 8.1 keV. These data show that C3F8 provides excellent electron recoil and alpha rejection capabilities at very low thresholds, including the first observation of a dependence of acoustic signal on alpha energy. Twelve single nuclear recoil event candidates were observed during the run. The candidate events exhibit timing characteristics that are not consistent with the hypothesis of a uniform time distribution, and no evidence for a dark matter signal is claimed. These data provide the most sensitive direct detection constraints on WIMP-proton spin-dependent scattering to date, with significant sensitivity at low WIMP masses for spin-independent WIMP-nucleon scattering.

  3. Dark Matter Search Results from the PICO-2L C3F8 Bubble Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Amole, C.; Ardid, M.; Asner, David M.; Baxter, D.; Behnke, E.; Bhattacharjee, P. S.; Borsodi, H.; Bou-Cabo, M.; Brice, S. J.; Broemmelsiek, D.; Clark, K.; Collar, J. I.; Cooper, P. S.; Crisler, M.; Dahl, C. E.; Daley, S.; Das, Madhusmita; Debris, F.; Dhungana, N.; Farine, J.; Felis, I.; Filgas, R.; Fines-Neuschild, M.; Girard, Francoise; Giroux, G.; Hai, M.; Hall, Jeter C.; Harris, O.; Jackson, C. M.; Jin, M.; Krauss, C. B.; Lafreniere, M.; Laurin, M.; Lawson, I.; Levine, I.; Lippincott, W. H.; Mann, E.; Martin, J. P.; Maurya, D.; Mitra, Pitam; Neilson, R.; Noble, A. J.; Plante, A.; Podviianiuk, R. B.; Priya, S.; Robinson, A. E.; Ruschman, M.; Scallon, O.; Seth, S.; Sonnenschein, Andrew; Starinski, N.; Stekl, I.; Vazquez-Jauregui, E.; Wells, J.; Wichoski, U.; Zacek, V.; Zhang, J.

    2015-06-12

    New data are reported from the operation of a 2-liter C3F8 bubble chamber in the 2100 meter deep SNOLAB underground laboratory, with a total exposure of 211.5 kg-days at four different recoil energy thresholds ranging from 3.2 keV to 8.1 keV. These data show that C3F8 provides excellent electron recoil and alpha rejection capabilities at very low thresholds, including the rst observation of a dependence of acoustic signal on alpha energy. Twelve single nuclear recoil event candidates were observed during the run. The candidate events exhibit timing characteristics that are not consistent with the hypothesis of a uniform time distribution, and no evidence for a dark matter signal is claimed. These data provide the most sensitive direct detection constraints on WIMP-proton spin-dependent scattering to date, with signicant sensitivity at low WIMP masses for spin-independent WIMP-nucleon scattering.

  4. Effects of irradiation and post-irradiation annealing on the thermal conductivity/diffusivity of monolithic SiC and f-SiC/SiC composites

    International Nuclear Information System (INIS)

    Laser flash thermal diffusivity measurements were made on high-purity monolithic CVD-SiC and 2D f-SiC(Hi-Nicalon)/ICVI-SiC composite samples before and after irradiation (250 to 800 C, 4-8 dpa-SiC) and after post-irradiation annealing composite samples to 1200 C. For irradiated CVD-SiC, the defect concentrations at saturation were estimated to range from 25,300 appm (250 C) down to 940 appm (800 C). The transverse thermal conductivity ratios after-to-before irradiation (Kir/Ko) determined at the irradiation temperatures were: 0.044 up to 0.12 (250 up to 800 C) for irradiated CVD-SiC and 0.18 up to 0.29 (330 up to 800 C) for the irradiated Hi-Nicalon composite. Analysis of thermal diffusivity values for the Hi-Nicalon composite measured in air, argon, helium and vacuum indicated that thermal conductivity degradation occurred primarily due to point defect accumulation in the matrix component. After annealing to 1200 C and cooling to the irradiation temperature, fiber/matrix debonding occurred due to net shrinkage in the fiber and PyC interface components

  5. Comparison of temperature standards. 800 deg C to 1500 deg C (radiation pyrometers). Pt. 2

    International Nuclear Information System (INIS)

    A comparison between implementations of the temperature scale (IPTS-68) between 800 deg C to 1500 deg C was made at the Department of Physics and Metrology at INTI, using pyrometric lamps with a tungsten filament which were calibrated at the Physikalisch-Technische Bundesanstalt (PTB). The purpose of this analysis was the detection of possible systematic errors as well as the evaluation of the uncertainty limit. (Author)

  6. Dynamic Modeling of a Wind Turbine System

    OpenAIRE

    Liseth, Hilde Evensen

    2011-01-01

    The objective of this paper is to derive a simple dynamic model of a wind turbine system, with focus on mechanical conditions. The investigated system is assumed to be a 10 MW reference wind turbine, with variable speed operations and a direct-drive permanent magnet synchronous generator. The model will include the mechanical dynamics where the joint inertia, the electromagnetic torque and the aerodynamic torque will influence the turbine rotational speed. Three different control strategies f...

  7. Bond between concrete and steel reinforcement at temperatures to 1490C (3000F)

    International Nuclear Information System (INIS)

    Oak Ridge National Laboratory conducted a series of bond pull-out tests to determine the effect of elevated temperatures [ranging from 24 to 1490C (75 to 3000F)] on the bond strength between concrete and deformed steel reinforcement. This report summarizes the findings of the study, describes the tests and results, and offers recommendations for incorporating these results into the design of structures that must operate within the prescribed range of elevated temperatures

  8. Nuclear medium modification of F2N (x, Q2) in 12C

    International Nuclear Information System (INIS)

    In this work, we have studied nuclear effect in electromagnetic structure function of nucleon F2N (x, Q2) in 12C in the deep inelastic lepton nucleus scattering process by taking into account Fermi motion, binding, pion and rho meson cloud contributions, target mass correction, shadowing and anti-shadowing corrections. The calculations have been done in a local density approximation using a relativistic nuclear spectral function which include nucleon correlations for nuclear matter

  9. Ekonomika fotbalového klubu Manchester United F.C.

    OpenAIRE

    Procházka, Martin

    2014-01-01

    The main aim of this Bachelor's thesis is to assess economic situation of the football club Manchester United F. C. and to compare it with competing clubs in the period from 2009 to 2013. The partial aim is to assess fulfilment of the new UEFA Financial Fair Play Regulations. The theoretical part states specific characteristics of the economics of sports clubs. Furthermore, it describes the content of the UEFA Financial Fair Play Regulations. It is followed by description of the methods and i...

  10. Analysis of 18F-FDG maximum standardized uptake value in gastric cancer with coincidence imaging

    International Nuclear Information System (INIS)

    Objective: To investigate the value of 18F-FDG SUVmax in gastric cancer diagnosis with coincidence imaging. Methods: The coincidence imaging was performed in 92 patients with gastric diseases (60 males, 32 females,age 65 (32-85) years; 78 malignant cases, 14 benign cases). The malignant cases included 3 remnant gastric cancers and 75 primary gastric cancers (staging: 4 of Tis, 13 of T1, 9 of T2, 33 of T3, 11 of T4 and 5 without surgery). The well-, moderately-and poorly-differentiated adenocarcinomas were 22, 15 and 28, respectively. Images were analyzed retrospectively with visual method and 18F-FDG SUVmax, and the diagnostic results were compared with the histopathological findings. The ROC curve was used to analyze the SUVmax. The Pearson's correlation analysis was performed to evaluate the relationship between SUVmax and tumor size. The Wilcoxon rank sum test was applied to determine the difference of SUVmax between early and advanced gastric cancers. The Kruskal-Wallis test was used to analyze the difference of SUVmax in various types of differentiated adenocarcinoma. Results: No matter visual method or SUVmax was used, the sensitivity, specificity and accuracy of coincidence imaging in diagnosis of gastric cancer were 64.1% (50/78), 64.3% (9/14) and 64.1% (59/92), respectively. The AUC of SUVmax was 0.695 and the cut-off value was 0.700. SUVmax Was positively correlated with tumor size significantly (r=0.489, P<0.001). There was statistically significant difference between SUVmax of Tis-1 and that of T2-4 (0.676± 1.288 vs 3.851 ±3.764; Z=-3.754, P<0.001). However, there was no statistically significant difference among SUVmax of various grades of differentiated adenocarcinoma(2.805±4.008, 3.447±2.365, 3.413± 3.737; χ2=2.459, P> 0.05). Conclusions: SUVmax provides more information than visual method in assessing gastric cancer with 18F-FDG coincidence imaging. Appropriate cut-off value of SUV is necessary for improvement of the diagnostic efficiency

  11. A vegetation survey of the Cape of Good Hope Nature Reserve. I. The use of association-analysis and Braun-Blanquet methods*

    Directory of Open Access Journals (Sweden)

    H. C. Taylor

    1984-12-01

    Full Text Available The survey aimed to establish broad vegetation units that could be mapped on an extensive scale in the Cape of Good Hope Nature Reserve at the southern tip of the Cape Peninsula. This paper compares the performance of two methods, association-analysis and the Braun-Blanquet method as developed by the Zurich-Montpellier School of Phytosociology. One hundred 50 m2  sample plots, covering the whole Reserve, were placed systematically at grid intersections on the 1:18 000 topographical map. at 1 000-yard (914 m intervals. Species lists, recording merely presence of all species with permanently recognizable aerial parts, were made for each plot. The association-analysis resulted in a classification of 23 final groups of sample plots, of which only five groups showed high floristic and ecological homogeneity. Of the remainder, eight groups contained some anomalous, misplaced plots, and ten represented small, isolated fragments of natural units. The original data were then analysed using Braun-Blanquet methods to provide an independent classification for comparison with the former. The Braun-Blanquet communities were found to be more homogeneous in terms of previously defined habitat groupings and showed floristic relationships consistent with these groupings. It is concluded that, with the type of sampling used, the synthetic phytosociological Braun-Blanquet method provides a more natural classification of plant communities of the Reserve than does the monothetic divisive association-analysis method.

  12. Enhancement of natural killer cell activity in healthy subjects by Immulina®, a Spirulina extract enriched for Braun-type lipoproteins

    DEFF Research Database (Denmark)

    Nielsen, Claus Henrik; Balachandran, Premalatha; Christensen, Ole;

    2010-01-01

    Immulina®, a commercial extract of Arthrospira (Spirulina) platensis is a potent activator of THP-1 monocytes and CD4+ T cells IN VITRO and enhances several immunological functions in mice. We further characterized Immulina® by determining that Braun-type lipoproteins are responsible for a major...

  13. Syntheses of 18F-labeled reduced haloperidol and 11C-labeled reduced 3-N-methylspiperone

    International Nuclear Information System (INIS)

    18F-Labeled reduced haloperidol and 11C-labeled reduced 3-N-methylspiperone were synthesized in a convenient and quantitative one step reduction from 18F-labeled haloperidol and 11C-labeled N-methylspiperone, respectively. Both products were purified by semipreparative HPLC and were obtained at high specific activity and radiochemical purity. (author)

  14. Pelton turbines

    CERN Document Server

    Zhang, Zhengji

    2016-01-01

    This book concerns the theoretical foundations of hydromechanics of Pelton turbines from the engineering viewpoint. For reference purposes, all relevant flow processes and hydraulic aspects in a Pelton turbine have been analyzed completely and systematically. The analyses especially include the quantification of all possible losses existing in the Pelton turbine and the indication of most available potential for further enhancing the system efficiency. As a guideline the book therefore supports further developments of Pelton turbines with regard to their hydraulic designs and optimizations. It is thus suitable for the development and design engineers as well as those working in the field of turbo machinery. Many laws described in the book can also be directly used to simplify aspects of computational fluid dynamics (CFD) or to develop new computational methods. The well-executed examples help better understand the related flow mechanics.

  15. Dark Matter Limits From a 2L C3F8 Filled Bubble Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Alan Edward [Univ. of Chicago, IL (United States)

    2015-12-01

    The PICO-2L C3F8 bubble chamber search forWeakly Interacting Massive Particle (WIMP) dark matter was operated in the SNOLAB underground laboratory at the same location as the previous CF3I lled COUPP-4kg detector. Neutron calibrations using photoneutron sources in C3F8 and CF3I lled calibration bubble chambers were performed to verify the sensitivity of these target uids to dark matter scattering. This data was combined with similar measurements using a low-energy neutron beam at the University of Montreal and in situ calibrations of the PICO-2L and COUPP-4kg detectors. C3F8 provides much greater sensitivity to WIMP-proton scattering than CF3I in bubble chamber detectors. PICO-2L searched for dark matter recoils with energy thresholds below 10 keV. Radiopurity assays of detector materials were performed and the expected neutron recoil background was evaluated to be 1.6+0:3

  16. Scleral depressed vitreous shaving, 360 laser, and perfluoropropane (C 3 F 8 for retinal detachment

    Directory of Open Access Journals (Sweden)

    Vivek Chaturvedi

    2014-01-01

    Full Text Available Purpose : To review the characteristics and outcomes of patients who underwent pars plana vitrectomy (PPV with scleral depressed vitreous shaving, 360 degree peripheral endolaser, and 14% C3F8 gas for rhegmatogenous retinal detachment (RRD. Materials and Methods : A retrospective review of a consecutive series of patients who underwent primary repair of RRD by PPV with scleral depressed vitreous shaving, 360 degree peripheral endolaser, and 14% perfluoropropane (C 3 F 8 was conducted. Patients with less than 3 months follow-up, previous retinal surgery, and higher than grade B proliferative vitreoretinopathy were excluded. Results : Ninety-one eyes were included in the study. The mean age was 60.1 years. The mean follow-up was 13.7 months. The macula was detached in 63% (58/91 of the eyes. The reattachment rate after one surgical procedure was 95% (86/91 while overall reattachment rate was 100%. There was no statistically significant difference between reattachment rates of superior, nasal/temporal, or inferior RRDs. The mean final best corrected visual acuity (BCVA was 20/40. Of all the patients, 66% of patients with macula-off RRDs had a final BCVA of 20/40 or better. Conclusions: PPV with scleral depressed vitreous shaving, 360 degree peripheral endolaser, and 14% C 3 F 8 leads to successful anatomical reattachment with visual improvement in patients with primary RRD.

  17. Real-time Operating System μC/OS-Ⅱ Based on C8051F040 of Transplantation%基于C8051F040的实时操作系统μC/OS-Ⅱ的移植

    Institute of Scientific and Technical Information of China (English)

    朱光远; 徐海贤

    2014-01-01

    Real time operating system μC/OS-Ⅱ can run on most 8 bit,16 bit,32 bit and 64 bit microprocessor,microcontrol er.This paper expounds the method of the μC/OS-Ⅱ transplantation to microcontrol er C8051F040,and through a simple test program to check the correctness of transplantation and running stability.%实时操作系统μC/OS-Ⅱ可以在绝大多数8位、16位、32位及64位微处理器、微控制器上运行。阐述了μC/OS-Ⅱ移植到微控制器C8051F040上的方法,并通过编写简单测试程序来检验移植的正确性及运行的稳定性。

  18. Noninvasive Evaluation of Metabolic Tumor Volume in Lewis Lung Carcinoma Tumor-Bearing C57BL/6 Mice with Micro-PET and the Radiotracers 18F-Alfatide and 18F-FDG: A Comparative Analysis.

    Directory of Open Access Journals (Sweden)

    Yu-Chun Wei

    Full Text Available To explore the value of a new simple lyophilized kit for labeling PRGD2 peptide (18F-ALF-NOTA-PRGD2, denoted as 18F-alfatide in the determination of metabolic tumor volume (MTV with micro-PET in lewis lung carcinoma (LLC tumor-bearing C57BL/6 mice verified by pathologic examination and compared with those using 18F-fluorodeoxyglucose (FDG PET.All LLC tumor-bearing C57BL/6 mice underwent two attenuation-corrected whole-body micro-PET scans with the radiotracers 18F-alfatide and 18F-FDG within two days. 18F-alfatide metabolic tumor volume (VRGD and 18F-FDG metabolic tumor volume (VFDG were manually delineated slice by slice on PET images. Pathologic tumor volume (VPath was measured in vitro after the xenografts were removed.A total of 37 mice with NSCLC xenografts were enrolled and 33 of them underwent 18F-alfatide PET, and 35 of them underwent 18F-FDG PET and all underwent pathological examination. The mean ± standard deviation of VPath, VRGD, and VFDG were 0.59±0.32 cm3 (range,0.13~1.64 cm3, 0.61±0.37 cm3 (range,0.15~1.86 cm3, and 1.24±0.53 cm3 (range,0.17~2.20 cm3, respectively. VPath vs. VRGD, VPath vs. VFDG, and VRGD vs. VFDG comparisons were t = -0.145, P = 0.885, t = -6.239, P<0.001, and t = -5.661, P<0.001, respectively. No significant difference was found between VPath and VRGD. VFDG was much larger than VRGD and VPath. VRGD seemed more approximate to the pathologic gross tumor volume. Furthermore, VPath was more strongly correlated with VRGD (R = 0.964,P<0.001 than with VFDG (R = 0.584,P<0.001.18F-alfatide PET provided a better estimation of gross tumor volume than 18F-FDG PET in LLC tumor-bearing C57BL/6 mice.

  19. Wind turbines

    Energy Technology Data Exchange (ETDEWEB)

    Yeoman, J.C. Jr.

    1978-12-01

    This evaluation of wind turbines is part of a series of Technology Evaluations of possible components and subsystems of community energy systems. Wind turbines, ranging in size from 200 W to 10 MW, are discussed as candidates for prime movers in community systems. Estimates of performance characteristics and cost as a function of rated capacity and rated wind speed are presented. Data concerning material requirements, environmental effects, and operating procedures also are given and are represented empirically to aid computer simulation.

  20. Steam turbine

    OpenAIRE

    Vališ, Petr

    2010-01-01

    The master´s thesis concentrates on a project of steam turbine with controlled extraction points destined for a communal waste incineration plant. First, there the history of devices using steam as a moving medium is introduced and than follows the description of computing program, where the calculation was running. The master´s thesis subject consists in the thermodynamic project of turbine vaning, in basic project of gearbox including the check calculations and in technical economic compari...

  1. Synthesis of tailored 2D SiC f/SiC ceramic matrix composites with BN/C interphase through ICVI

    Science.gov (United States)

    Udayakumar, A.; Raole, P. M.; Balasubramanian, M.

    2011-10-01

    Synthesis of 2D SiC f /SiC composites for applications in fusion reactors is a challenging task due to the stringent specification requirements on various mechanical and thermo-mechanical properties, chemical compatibility (with Pb-Li), oxidation resistance and irradiation resistance. Three types of SiC f/SiC composites with C interface and BN interface, with and without intermediate heat treatment are prepared through isothermal and isobaric chemical vapor infiltration process. Dense SiC seal coat applied to the composites has improved their oxidation resistance. The tensile, flexural and fracture toughness values of composite with BN interface were found to be improved by stabilizing the BN interface through thermal treatment. The electrical and thermal conductivity values obtained for composites with C interface are in the range of 10-29 S/m and 2.5-3.25 W/mK for the temperature range 500-900 °C as required for fusion reactor applications.

  2. C-CAP Land Cover, Commonwealth of the Northern Mariana Islands (CNMI), Rota 1946

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set consists of land derived from scanned black and white aerial photographs and was analyzed according to the Coastal Change Analysis Program (C-CAP)...

  3. Apostle Islands National Lakeshore Data Landcover Product - NOAA C-CAP Source

    Data.gov (United States)

    National Park Service, Department of the Interior — NPScape CCAP landcover (CCAP_LAC - 1996, 2001 and 2006) and landcover change (CCAP_LCC) products. Landcover change is produced from the 1996-2001 NOAA C-CAP and...

  4. San Juan Island National Historical Park Data Landcover Product - NOAA C-CAP Source

    Data.gov (United States)

    National Park Service, Department of the Interior — NPScape CCAP landcover (CCAP_LAC - 1996, 2001 and 2006) and landcover change (CCAP_LCC) products. Landcover change is produced from the 1996-2001 NOAA C-CAP and...

  5. C-CAP Land Cover, United States Virgin Islands, St. Croix, 2012

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set consists of land cover derived from high resolution imagery and was analyzed according to the Coastal Change Analysis Program (C-CAP) protocol to...

  6. C-CAP Land Cover, United States Virgin Islands, St Thomas, 2012

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set consists of land cover derived from high resolution imagery and was analyzed according to the Coastal Change Analysis Program (C-CAP) protocol to...

  7. Development of standardized air-blown coal gasifier/gas turbine concepts for future electric power systems. Volume 5, Appendix D: Cost support information: Final report

    Energy Technology Data Exchange (ETDEWEB)

    Sadowski, R.S.; Brown, M.J.; Harriz, J.T.; Ostrowski, E.

    1991-01-01

    The cost estimate provided for the DOE sponsored study of Air Blown Coal Gasification was developed from vendor quotes obtained directly for the equipment needed in the 50 MW, 100 MW, and 200 MW sized plants and from quotes from other jobs that have been referenced to apply to the particular cycle. Quotes were generally obtained for the 100 MW cycle and a scale up/down factor was used to generate the cost estimates for the 200 MW and 50 MW cycles, respectively. Information from GTPro (property of Thermoflow, Inc.) was used to estimate the cost of the 200 MW and 50 MW gas turbine, HRSG, and steam turbines. To available the use of GTPro`s estimated values for this equipment, a comparison was made between the quotes obtained for the 100 MW cycle (ABB GT 11N combustion turbine and a HSRG) against the estimated values by GTPro.

  8. Amyloid imaging in cognitively normal older adults: comparison between {sup 18}F-flutemetamol and {sup 11}C-Pittsburgh compound B

    Energy Technology Data Exchange (ETDEWEB)

    Adamczuk, Katarzyna; Schaeverbeke, Jolien; Neyens, Veerle; Dupont, Patrick [KU Leuven, Laboratory for Cognitive Neurology, Leuven (Belgium); Leuven Institute of Neuroscience and Disease, Alzheimer Research Centre KU Leuven, Leuven (Belgium); Nelissen, Natalie [KU Leuven, Laboratory for Cognitive Neurology, Leuven (Belgium); Oxford University, Department of Psychiatry, Oxford (United Kingdom); Vandenbulcke, Mathieu [University Hospitals Leuven, Old Age Psychiatry Department, Leuven (Belgium); Goffin, Karolien [KU Leuven and University Hospitals Leuven, Nuclear Medicine and Molecular Imaging Department, Leuven (Belgium); Lilja, Johan [GE Healthcare, Uppsala (Sweden); Department of Surgical Sciences, Radiology, Uppsala University Hospital, Uppsala University, Uppsala (Sweden); Hilven, Kelly [KU Leuven, Laboratory for Neuroimmunology, Leuven (Belgium); Laere, Koen van [Leuven Institute of Neuroscience and Disease, Alzheimer Research Centre KU Leuven, Leuven (Belgium); KU Leuven and University Hospitals Leuven, Nuclear Medicine and Molecular Imaging Department, Leuven (Belgium); Vandenberghe, Rik [KU Leuven, Laboratory for Cognitive Neurology, Leuven (Belgium); Leuven Institute of Neuroscience and Disease, Alzheimer Research Centre KU Leuven, Leuven (Belgium); University Hospitals Leuven, Neurology Department, Leuven (Belgium)

    2016-01-15

    Preclinical, or asymptomatic, Alzheimer's disease (AD) refers to the presence of positive AD biomarkers in the absence of cognitive deficits. This research concept is being applied to define target populations for clinical drug development. In a prospective community-recruited cohort of cognitively intact older adults, we compared two amyloid imaging markers within subjects: {sup 18}F-flutemetamol and {sup 11}C-Pittsburgh compound B (PIB). In 32 community-recruited cognitively intact older adults aged between 65 and 80 years, we determined the concordance between binary classification based on {sup 18}F-flutemetamol versus {sup 11}C-PIB according to semiquantitative assessment (standardized uptake value ratio in composite cortical volume, SUVR{sub comp}) and, alternatively, according to visual reads. We also determined the correlation between {sup 18}F-flutemetamol and {sup 11}C-PIB SUVR and evaluated how this was affected by the reference region chosen (cerebellar grey matter versus pons) and the use of partial volume correction (PVC) in this population. Binary classification based on semiquantitative assessment was concordant between {sup 18}F-flutemetamol and {sup 11}C-PIB in 94 % of cases. Concordance of blinded binary visual reads between tracers was 84 %. The Spearman correlation between {sup 18}F-flutemetamol and {sup 11}C-PIB SUVR{sub comp} with cerebellar grey matter as reference region was 0.84, with a slope of 0.98. Correlations in neocortical regions were significantly lower with the pons as reference region. PVC improved the correlation in striatum and medial temporal cortex. For the definition of preclinical AD based on {sup 18}F-flutemetamol, concordance with {sup 11}C-PIB was highest using semiquantitative assessment with cerebellar grey matter as reference region. (orig.)

  9. NODC Standard Format Marine Birds from Coastal Alaska and Puget Sound Data (1975-1980): Marine Bird Sighting, Land Census (F034) (NODC Accession 0014156)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Standard Marine Bird Sighting, Land Census (F034) is one of a group of seven datasets related to Marine Birds from Coastal Alaska and Puget Sound Data (1975...

  10. 11C-choline vs. 18F-FDG PET/CT in assessing bone involvement in patients with multiple myeloma

    Directory of Open Access Journals (Sweden)

    Ambrosini Valentina

    2007-06-01

    Full Text Available Abstract Background Multiple Myeloma (MM is a B cell neoplasm causing lytic or osteopenic bone abnormalities. Whole body skeletal survey (WBSS, Magnetic resonance (MR and 18F-FDG PET/CT are imaging techniques routinely used for the evaluation of bone involvement in MM patients. Aim As MM bone lesions may present low 18F-FDG uptake; the aim of this study was to assess the possible added value and limitations of 11C-Choline to that of 18F-FDG PET/CT in patients affected with MM. Methods Ten patients affected with MM underwent a standard 11C-Choline PET/CT and an 18F-FDG PET/CT within one week. The results of the two scans were compared in terms of number, sites and SUVmax of lesions. Results Four patients (40% had a negative concordant 11C-Choline and 18F-FDG PET/CT scans. Two patients (20% had a positive 11C-Choline and 18F-FDG PET/CT scans that identified the same number and sites of bone lesions. The remaining four patients (40% had a positive 11C-Choline and 18F-FDG PET/CT scan, but the two exams identified different number of lesions. Choline showed a mean SUVmax of 5 while FDG showed a mean SUVmax of 3.8 (P = 0.042. Overall, 11C-Choline PET/CT scans detected 37 bone lesions and 18F-FDG PET/CT scans detected 22 bone lesions but the difference was not significant (P = 0.8. Conclusion According to these preliminary data, 11C-Choline PET/CT appears to be more sensitive than 18F-FDG PET/CT for the detection of bony myelomatous lesions. If these data are confirmed in larger series of patients, 11C-Choline may be considered a more appropriate functional imaging in association with MRI for MM bone staging.

  11. SU-F-BRD-10: Lung IMRT Planning Using Standardized Beam Bouquet Templates

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, L; Wu, Q J.; Yin, F [Duke University Medical Center, Durham, NC (United States); Ge, Y [University of North Carolina at Charlotte, Charlotte, NC (United States)

    2014-06-15

    Purpose: We investigate the feasibility of choosing from a small set of standardized templates of beam bouquets (i.e., entire beam configuration settings) for lung IMRT planning to improve planning efficiency and quality consistency, and also to facilitate automated planning. Methods: A set of beam bouquet templates is determined by learning from the beam angle settings in 60 clinical lung IMRT plans. A k-medoids cluster analysis method is used to classify the beam angle configuration into clusters. The value of the average silhouette width is used to determine the ideal number of clusters. The beam arrangements in each medoid of the resulting clusters are taken as the standardized beam bouquet for the cluster, with the corresponding case taken as the reference case. The resulting set of beam bouquet templates was used to re-plan 20 cases randomly selected from the database and the dosimetric quality of the plans was evaluated against the corresponding clinical plans by a paired t-test. The template for each test case was manually selected by a planner based on the match between the test and reference cases. Results: The dosimetric parameters (mean±S.D. in percentage of prescription dose) of the plans using 6 beam bouquet templates and those of the clinical plans, respectively, and the p-values (in parenthesis) are: lung Dmean: 18.8±7.0, 19.2±7.0 (0.28), esophagus Dmean: 32.0±16.3, 34.4±17.9 (0.01), heart Dmean: 19.2±16.5, 19.4±16.6 (0.74), spinal cord D2%: 47.7±18.8, 52.0±20.3 (0.01), PTV dose homogeneity (D2%-D99%): 17.1±15.4, 20.7±12.2 (0.03).The esophagus Dmean, cord D02 and PTV dose homogeneity are statistically better in the plans using the standardized templates, but the improvements (<5%) may not be clinically significant. The other dosimetric parameters are not statistically different. Conclusion: It's feasible to use a small number of standardized beam bouquet templates (e.g. 6) to generate plans with quality comparable to that of clinical

  12. SU-F-BRD-10: Lung IMRT Planning Using Standardized Beam Bouquet Templates

    International Nuclear Information System (INIS)

    Purpose: We investigate the feasibility of choosing from a small set of standardized templates of beam bouquets (i.e., entire beam configuration settings) for lung IMRT planning to improve planning efficiency and quality consistency, and also to facilitate automated planning. Methods: A set of beam bouquet templates is determined by learning from the beam angle settings in 60 clinical lung IMRT plans. A k-medoids cluster analysis method is used to classify the beam angle configuration into clusters. The value of the average silhouette width is used to determine the ideal number of clusters. The beam arrangements in each medoid of the resulting clusters are taken as the standardized beam bouquet for the cluster, with the corresponding case taken as the reference case. The resulting set of beam bouquet templates was used to re-plan 20 cases randomly selected from the database and the dosimetric quality of the plans was evaluated against the corresponding clinical plans by a paired t-test. The template for each test case was manually selected by a planner based on the match between the test and reference cases. Results: The dosimetric parameters (mean±S.D. in percentage of prescription dose) of the plans using 6 beam bouquet templates and those of the clinical plans, respectively, and the p-values (in parenthesis) are: lung Dmean: 18.8±7.0, 19.2±7.0 (0.28), esophagus Dmean: 32.0±16.3, 34.4±17.9 (0.01), heart Dmean: 19.2±16.5, 19.4±16.6 (0.74), spinal cord D2%: 47.7±18.8, 52.0±20.3 (0.01), PTV dose homogeneity (D2%-D99%): 17.1±15.4, 20.7±12.2 (0.03).The esophagus Dmean, cord D02 and PTV dose homogeneity are statistically better in the plans using the standardized templates, but the improvements (<5%) may not be clinically significant. The other dosimetric parameters are not statistically different. Conclusion: It's feasible to use a small number of standardized beam bouquet templates (e.g. 6) to generate plans with quality comparable to that of clinical

  13. Draft I.E.C. standard for monitoring PWR internal structures

    International Nuclear Information System (INIS)

    EDF has proposed to the I.E.C. (International Electrotechnical Commission) a draft standard for monitoring the vessel internal structures of PWRs. The standard applies to systems used for monitoring the vibratory behavior of the internal structures of PWRs (core barrel, thermal shield, fuel assemblies) on the basis of neutron fluctuations observed outside the vessel as well as of vessel vibrations. It covers the systems characteristics and the monitoring procedures. It should facilitate standardization of monitoring and comparisons on an international level. (author)

  14. Experiment Analysis of Decomposition Products in Typical Fault of c-C_4F_8 Gas and Insulating Gas Mixture Containing c-C_4F_8 and N_2%c-C4F8及其与N2混合绝缘气体在典型故障时分解生成物的试验分析

    Institute of Scientific and Technical Information of China (English)

    李康; 张国强; 邢卫军; 韩冬; 牛文豪

    2012-01-01

    氟碳气体由于其温室效益小,同时具有很高的耐电强度,是较好的替代SF6的气体。使用氟碳混合气体作为绝缘介质的气体绝缘开关和变压器,将成为一类新型的环境友好的输变电设备。因此用试验方法研究氟碳气体及其与N2的混合气体在局部过热、局部放电、火花放电及电弧放电等故障下的分解生成物,并对故障生成物的危害性进行了探讨。试验在自建的模型上进行,故障后的生成物使用气相色谱与质谱联用(gas chromatography-mass spectrometry,GC-MS)的方法来检测。试验结果表明:可稳定存在的过热故障下主要生成物为C2F4、C3F6;纯气体放电性故障的主要生成物为CF4、C2F6、C2F4、C3F8、C3F6;混合气体放电性故障另外产生C3F6N2;故障分解生成物毒性很小。根据故障生成物的特点,提出可根据故障生成物组分来区分氟碳气体绝缘电气设备中的过热性故障与放电性故障。%Because of its high dielectric strength,low global warming potential(GWP),fluorocarbon gas is considered as a good substitute for SF6.Electrical equipment using fluorocarbon gas mixtures will be a new type of environment-friendly power delivery apparatus.Consequently,we experimentally studied main components of decomposition gas generated by four major faults: overheating,partial discharge,spark discharge and arc discharge,and discussed the perniciousness of fault decomposition products.Moreover,we analyzed the decomposition products by means of gas chromatography-mass spectrometry(GC-MS) and identified the toxicity of the decomposition gas by searching the toxicity database.It is found that the main by-products are C2F4,C3F6 for overheating,CF4,C2F6,C2F4,C3F8,C3F6 for pure gas discharge faults,and CF4,C2F6,C2F4,C3F8,C3F6,C3F6N2 for mixture gas discharge fault.The toxicity of by-products is low.Finally,the fault type of overheating or discharge can be confirmed based on the main

  15. Testing the Activity of Complement Convertases in Serum/Plasma for Diagnosis of C4NeF-Mediated C3 Glomerulonephritis.

    Science.gov (United States)

    Blom, Anna M; Corvillo, Fernando; Magda, Michal; Stasiłojć, Grzegorz; Nozal, Pilar; Pérez-Valdivia, Miguel Ángel; Cabello-Chaves, Virginia; Rodríguez de Córdoba, Santiago; López-Trascasa, Margarita; Okrój, Marcin

    2016-07-01

    Autoantibodies termed C3-nephritic factor (C3NeF), which stabilize convertases of the alternative complement pathway, often stimulate autoinflammatory diseases. However, knowledge about analogous autoantibodies acting on the classical pathway (C4NeF) is limited to a few reports, which indicate association with kidney dysfunction, systemic lupus erythematous, and infections. C4NeF may appear independently from C3NeF, but the lack of a routine diagnostic method predisposes C4NeF for being an underestimated player in autoinflammatory episodes. We tested the activity of classical convertases directly in serum/plasma to screen samples from 13 patients with C3 glomerulopathies and identified one patient showing significantly prolonged half-life of these enzymes. Observed effect was reproduced by immunoglobulins purified from patient's plasma and additionally confirmed on classical convertase built from purified components. Isolated immunoglobulins protected classical convertases from both spontaneous and inhibitor-driven decay but not from C4b proteolysis. The patient had a decreased serum level of C3, elevated sC5b-9, and normal concentrations of factor B and C4. Neither C3NeF nor other autoantibodies directed against alternative pathway proteins (factor H, factor B, factor I, C3, and properdin) were found. Genetic analysis showed no mutations in C3, CFB, CFH, CFI, MCP, THBD, and DGKE genes. Renal biopsy revealed a membranoproliferative pattern with intense C3 deposits. Our results underline the importance of C4NeF as an independent pathogenic factor and a need for the implementation of routine examination of classical convertase activity. Proposed method may enable robust inspection of such atypical cases. PMID:27146825

  16. [18F]Flutemetamol amyloid-beta PET imaging compared with [11C]PIB across the spectrum of Alzheimer's disease

    International Nuclear Information System (INIS)

    The aim was to identify the amyloid beta (Aβ) deposition by positron emission tomography (PET) imaging with the 18F-labeled Pittsburgh compound B (PIB) derivative [18F]flutemetamol (FMM) across a spectrum of Alzheimer's disease (AD) and to compare Aβ deposition between [18F]FMM and [11C]PIB PET imaging. The study included 36 patients with AD, 68 subjects with mild cognitive impairment (MCI), 41 older healthy controls (HC) (aged ≥56), 11 young HC (aged ≤45), and 10 transitional HC (aged 46-55). All 166 subjects underwent 30-min static [18F]FMM PET 85 min after injection, 60-min dynamic [11C]PIB PET, and cognitive testing. [18F]FMM scans were assessed visually, and standardized uptake value ratios (SUVR) were defined quantitatively in regions of interest identified on coregistered MRI (cerebellar cortex as a reference region). The PIB distribution volume ratios (DVR) were determined in the same regions. Of 36 AD patients, 35 had positive scans, while 36 of 41 older HC subjects had negative scans. [18F]FMM scans had a sensitivity of 97.2 % and specificity of 85.3 % in distinguishing AD patients from older HC subjects, and a specificity of 100 % for young and transitional HC subjects. The [11C]PIB scan had the same results. Interreader agreement was excellent (kappa score = 0.81). The cortical FMM SUVR in AD patients was significantly greater than in older HC subjects (1.76 ± 0.23 vs 1.30 ± 0.26, p 18F]FMM PET imaging detects Aβ deposition in patients along the continuum from normal cognitive status to dementia of AD and discriminates AD patients from HC subjects, similar to [11C]PIB PET. (orig.)

  17. Reproductive Ecology Of The Florida Scrub-Jay (Aphelocoma Coerulescens) On John F. Kennedy Space Center/Merritt Island National Wildlife Refuge: A Long-Term Study

    Science.gov (United States)

    Carter, Geoffry M.; Breininger, David R.; Larson, Vicky L.; Oddy, Donna M.; Smith, Rebecca B.; Stolen, Eric D.

    2005-01-01

    From 1988 to 2002 we studied the breeding ecology of Florida Scrub-Jays (Aphelocoma coerulescens) on John F. Kennedy Space Center/Merritt Island National Wildlife Refuge. We examined phenology, clutch size, hatching failure rates, fledgling production, nest success, predation rates, sources egg and nestling mortality, and the effects of helpers on these measures. Nesting phenology was similar among sites. Mean clutch size at Titan was significantly larger than at HC or T4. Pairs with helpers did not produce larger clutches than pairs without helpers. Fledgling production at T4 was significantly greater than at HC and similar to Titan. Pairs with helpers at HC produced significantly more fledglings than pairs without helpers; helpers did not influence fledgling production at the other sites. Nest success at HC and Titan was low, 19% and 32% respectively. Nest success at T4 was 48% and was significantly greater than at HC. Average predation rates at all sites increased with season progression. Predation rates at all sight rose sharply by early June. The main cause of nest failure at all sites was predation, 93%.

  18. A Conservation Strategy for the Florida Scrub-Jay on John F. Kennedy Space Center/Merritt Island National Wildlife Refuge: An Initial Scientific Basis for Recovery

    Science.gov (United States)

    Breininger, D. R.; Larson, V. L.; Schaub, R.; Duncan, B. W.; Schmalzer, P. A.; Oddy, D. M.; Smith, R. B.; Adrian, F.; Hill, H., Jr.

    1996-01-01

    The Florida Scrub-Jay (Aphelocoma coerulescens) is an indicator of ecosystem integrity of Florida scrub, an endangered ecosystem that requires frequent fire. One of the largest populations of this federally threatened species occurs on John F. Kennedy Space Center/Merritt Island National Wildlife Refuge. Population trends were predicted using population modeling and field data on reproduction and survival of Florida Scrub-Jays collected from 1988 - 1995. Analyses of historical photography indicated that habitat suitability has been declining for 30 years. Field data and computer simulations suggested that the population declined by at least 40% and will decline by another 40% in 1 0 years, if habitat management is not greatly intensified. Data and computer simulations suggest that habitat suitability cannot deviate greatly from optimal for the jay population to persist. Landscape trajectories of vegetation structure, responsible for declining habitat suitability, are associated with the disruption of natural fire regimes. Prescribed fire alone can not reverse the trajectories. A recovery strategy was developed, based on studies of Florida Scrub-Jays and scrub vegetation. A reserve design was formulated based on conservation science principles for scrub ecosystems. The strategy emphasizes frequent fire to restore habitat, but includes mechanical tree cutting for severely degraded areas. Pine thinning across large areas can produce rapid increases in habitat quality. Site-specific strategies will need to be developed, monitored, and modified to achieve conditions suitable for population persistence.

  19. Flexible charge balanced stimulator with 5.6 fC accuracy for 140 nC injections.

    Science.gov (United States)

    Nag, Sudip; Jia, Xiaofeng; Thakor, Nitish V; Sharma, Dinesh

    2013-06-01

    Electrical stimulations of neuronal structures must ensure net injected charges to be zero for biological safety and voltage compliance reasons. We present a novel architecture of general purpose biphasic constant current stimulator that exhibits less than 5.6 fC error while injecting 140 nC charges using 1.4 mA currents. The floating current sources and conveyor switch based system can operate in monopolar or bipolar modes. Anodic-first or cathodic-first pulses with optional inter-phase delays have been demonstrated with zero quiescent current requirements at the analog front-end. The architecture eliminates blocking capacitors, electrode shorting and complex feedbacks. Bench-top and in-vivo measurement results have been presented with emulated electrode impedances (resistor-capacitor network), Ag-AgCl electrodes in saline and in-vivo (acute) peripheral nerve stimulations in anesthetized rats. PMID:23853326

  20. Cerium(III) and Uranium(IV) Complexes of the 2-Fluorophenyl Trimethylsilyl Amide Ligand: C-F → Ln/An Interactions that Modulate the Coordination Spheres of f-Block Elements.

    Science.gov (United States)

    Yin, Haolin; Carroll, Patrick J; Schelter, Eric J

    2016-06-01

    2-fluorophenyl trimethylsilyl amide, N(SiMe3)(C6H4F)(-) was shown to engage in stronger C-F → Ce(III) interactions than pentafluorophenyl trimethylsilyl amide, N(SiMe3)(C6F5)(-), through a comparative study of the Ce(III) model complexes Ce[N(SiMe3)(C6H4F)]3 (1-F1) and Ce[N(SiMe3)(C6F5)]3 (1-F5). The presence of multiple C-F → U(IV) interactions led to complexes 2-X (X = Cl, C≡CPh, OMe) with threefold geometries, featuring a trigonal pyramidal UN3Cl core in the solid-state structures. Density functional theory calculations were applied to 2-Cl to investigate the strength of the C-F → U(IV) interactions and the influence of such interactions on resulting geometries. PMID:27227729

  1. Solvothermal indium fluoride chemistry: Syntheses and crystal structures of K 5In 3F 14, β-(NH 4) 3InF 6 and [NH 4] 3[C 6H 21N 4] 2[In 4F 21

    Science.gov (United States)

    Jayasundera, Anil C. A.; Goff, Richard J.; Li, Yang; Finch, Adrian A.; Lightfoot, Philip

    2010-02-01

    The solvothermal syntheses and crystal structures of three indium fluorides are presented. K 5In 3F 14 ( 1) and β-(NH 4) 3InF 6 ( 2) are variants on known inorganic structure types chiolite and cryolite, respectively, with the latter exhibiting a complex and apparently novel structural distortion. [NH 4] 3[C 6H 21N 4] 2[In 4F 21] ( 3) represents a new hybrid composition displaying a unique trimeric metal fluoride building unit.

  2. A standardized [18F]-FDG-PET template for spatial normalization in statistical parametric mapping of dementia.

    Science.gov (United States)

    Della Rosa, Pasquale Anthony; Cerami, Chiara; Gallivanone, Francesca; Prestia, Annapaola; Caroli, Anna; Castiglioni, Isabella; Gilardi, Maria Carla; Frisoni, Giovanni; Friston, Karl; Ashburner, John; Perani, Daniela

    2014-10-01

    [18F]-fluorodeoxyglucose (FDG) Positron Emission Tomography (PET) is a widely used diagnostic tool that can detect and quantify pathophysiology, as assessed through changes in cerebral glucose metabolism. [18F]-FDG PET scans can be analyzed using voxel-based statistical methods such as Statistical Parametric Mapping (SPM) that provide statistical maps of brain abnormalities in single patients. In order to perform SPM, a "spatial normalization" of an individual's PET scan is required to match a reference PET template. The PET template currently used for SPM normalization is based on [15O]-H2O images and does not resemble either the specific metabolic features of [18F]-FDG brain scans or the specific morphological characteristics of individual brains affected by neurodegeneration. Thus, our aim was to create a new [18F]-FDG PET aging and dementia-specific template for spatial normalization, based on images derived from both age-matched controls and patients. We hypothesized that this template would increase spatial normalization accuracy and thereby preserve crucial information for research and diagnostic purposes. We investigated the statistical sensitivity and registration accuracy of normalization procedures based on the standard and new template-at the single-subject and group level-independently for subjects with Mild Cognitive Impairment (MCI), probable Alzheimer's Disease (AD), Frontotemporal lobar degeneration (FTLD) and dementia with Lewy bodies (DLB). We found a significant statistical effect of the population-specific FDG template-based normalisation in key anatomical regions for each dementia subtype, suggesting that spatial normalization with the new template provides more accurate estimates of metabolic abnormalities for single-subject and group analysis, and therefore, a more effective diagnostic measure. PMID:24952892

  3. KomTronic® - Aktorische Werkzeugsysteme für die Einsatzerweiterung von Standard-Bearbeitungszentren

    Science.gov (United States)

    Fronius, Jürgen

    Die Entwickler spanender Fertigungssysteme stehen seit geraumer Zeit unter erhöhtem Innovationsdruck. Neben dem entscheidenden Aspekt der Stückkosten spielt das gesteigerte Umweltbewusstsein eine zunehmende Rolle. Die aktuelleKrise des Kreditwesens tut ein Übriges um den Forderungen nach geringen Investitionskosten und damit geringem Kreditbedarf oder erhöhter Flexibilität zur Kosteneinsparung bei Serienumstellung, geringem Energiebedarfund ressourcenschonendem Betrieb neuen Nachdruck zu verschaffen. Auf genau diesen Forderungskatalog wurde die KomTronic® - Produktpalette zugeschnitten. Ausgangspunkt war die Flexibilität die besonders bei komplexen, asymmetrischen Bauteilen eine Herausforderung darstellt. Quaderförmige Bauteile wie Hydraulikventilblöcke oder Zylinderköpfe von Verbrennungsmotoren stellen in ihrer Kombination aus Fräs- Drehbearbeitungen die "Königsklasse“ der spanenden Fertigung dar. Die Lösungen, besonders für die Drehkonturen sind im Allgemeinen großserientauglich ausgelegt. Die Konsequenz sind bauteilbezogen ausgelegte Transferstrassen oder Rundtaktmaschinen, eine Kombination dieser Bearbeitungen auf einem flexiblen BAZ waren bislang nicht möglich.

  4. G4-Flux and Standard Model Vacua in F-theory

    CERN Document Server

    Lin, Ling

    2016-01-01

    We study the geometry of gauge fluxes in four-dimensional F-theory vacua with gauge group SU(3)xSU(2)xU(1)xU(1) and its implications for phenomenology. The models are defined by a previously introduced class of elliptic fibrations whose fibre is given as a cubic hypersurface in ${\\rm Bl}_2{\\mathbb P}^2$, with the non-abelian gauge group factors SU(3)xSU(2) engineered torically via the top construction. To describe gauge fluxes on these fibrations we provide a classification of the primary vertical middle cohomology group in a fashion valid for any choice of base space. Using the ideal theoretic technique of primary decomposition we compute the cohomology classes of the matter surfaces associated with states charged under the non-abelian gauge group. These expressions allow us to interpret the cancellation of the pure and mixed non-abelian anomalies geometrically as a result of the general form of the matter surfaces, without reference to a specific type of gauge flux. Explicit results for the chiral indices o...

  5. Component Test Facility (Comtest) Phase 1 Engineering For 760°C (1400°F) Advanced Ultrasupercritical (A-USC) Steam Generator Development

    Energy Technology Data Exchange (ETDEWEB)

    Weitzel, Paul [Babcock & Wilcox Power Generation Group, Inc., Barberton, OH (United States)

    2016-05-13

    The Babcock & Wilcox Company (B&W) performed a Pre-Front End Engineering Design (Pre-FEED) of an A-USC steam superheater for a proposed component test program achieving 760°C (1400°F) steam temperature. This would lead to follow-on work in a Phase 2 and Phase 3 that would involve detail design, manufacturing, construction and operation of the ComTest. Phase 1 results have provided the engineering data necessary for proceeding to the next phase of ComTest. The steam generator superheater would subsequently supply the steam to an A-USC prototype intermediate pressure steam turbine. The ComTest program is important in that it will place functioning A-USC components in operation and in coordinated boiler and turbine service. It is also important to introduce the power plant operation and maintenance personnel to the level of skills required and provide the first background experience with hands-on training. The project will provide a means to exercise the complete supply chain events required in order to practice and perfect the process for A-USC power plant design, supply, manufacture, construction, commissioning, operation and maintenance. Representative participants will then be able to transfer knowledge and recommendations to the industry. ComTest is conceived in the manner of using a separate standalone plant facility that will not jeopardize the host facility or suffer from conflicting requirements in the host plant’s mission that could sacrifice the nickel alloy components and not achieve the testing goals. ComTest will utilize smaller quantities of the expensive materials and reduce the risk in the first operational practice for A-USC technology in the United States. Components at suitable scale in ComTest provide more assurance before putting them into practice in the full size A-USC demonstration plant.

  6. Imaging of amyloid deposition in human brain using positron emission tomography and [{sup 18}F]FACT: comparison with [{sup 11}C]PIB

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Hiroshi [National Institute of Radiological Sciences, Molecular Imaging Center, Chiba (Japan); National Institute of Radiological Sciences, Biophysics Program, Molecular Imaging Center, Chiba (Japan); Shinotoh, Hitoshi; Shimada, Hitoshi; Miyoshi, Michie; Takano, Harumasa; Takahashi, Hidehiko; Arakawa, Ryosuke; Kodaka, Fumitoshi; Ono, Maiko; Eguchi, Yoko; Higuchi, Makoto; Fukumura, Toshimitsu; Suhara, Tetsuya [National Institute of Radiological Sciences, Molecular Imaging Center, Chiba (Japan); Yanai, Kazuhiko; Okamura, Nobuyuki [Tohoku University School of Medicine, Department of Pharmacology, Sendai (Japan)

    2014-04-15

    The characteristic neuropathological changes in Alzheimer's disease (AD) are deposition of amyloid senile plaques and neurofibrillary tangles. The {sup 18}F-labeled amyloid tracer, [{sup 18}F]2-[(2-{(E)-2-[2-(dimethylamino)-1,3-thiazol-5-yl]vinyl}-1, 3-benzoxazol-6-yl)oxy ]-3-fluoropropan-1-ol (FACT), one of the benzoxazole derivatives, was recently developed. In the present study, deposition of amyloid senile plaques was measured by positron emission tomography (PET) with both [ {sup 11}C ]Pittsburgh compound B (PIB) and [ {sup 18}F ]FACT in the same subjects, and the regional uptakes of both radiotracers were directly compared. Two PET scans, one of each with [ {sup 11}C ]PIB and [ {sup 18}F ]FACT, were performed sequentially on six normal control subjects, two mild cognitive impairment (MCI) patients, and six AD patients. The standardized uptake value ratio of brain regions to the cerebellum was calculated with partial volume correction using magnetic resonance (MR) images to remove the effects of white matter accumulation. No significant differences in the cerebral cortical uptake were observed between normal control subjects and AD patients in [ {sup 18}F ]FACT studies without partial volume correction, while significant differences were observed in [ {sup 11}C ]PIB. After partial volume correction, the cerebral cortical uptake was significantly larger in AD patients than in normal control subjects for [ {sup 18}F ]FACT studies as well as [ {sup 11}C ]PIB. Relatively lower uptakes of [ {sup 11}C ]PIB in distribution were observed in the medial side of the temporal cortex and in the occipital cortex as compared with [ {sup 18}F ]FACT. Relatively higher uptake of [ {sup 11}C ]PIB in distribution was observed in the frontal and parietal cortices. Since [ {sup 18}F ]FACT might bind more preferentially to dense-cored amyloid deposition, regional differences in cerebral cortical uptake between [ {sup 11}C ]PIB and [ {sup 18}F ]FACT might be due to differences

  7. Imaging of amyloid deposition in human brain using positron emission tomography and [18F]FACT: comparison with [11C]PIB

    International Nuclear Information System (INIS)

    The characteristic neuropathological changes in Alzheimer's disease (AD) are deposition of amyloid senile plaques and neurofibrillary tangles. The 18F-labeled amyloid tracer, [18F]2-[(2-{(E)-2-[2-(dimethylamino)-1,3-thiazol-5-yl]vinyl}-1, 3-benzoxazol-6-yl)oxy ]-3-fluoropropan-1-ol (FACT), one of the benzoxazole derivatives, was recently developed. In the present study, deposition of amyloid senile plaques was measured by positron emission tomography (PET) with both [ 11C ]Pittsburgh compound B (PIB) and [ 18F ]FACT in the same subjects, and the regional uptakes of both radiotracers were directly compared. Two PET scans, one of each with [ 11C ]PIB and [ 18F ]FACT, were performed sequentially on six normal control subjects, two mild cognitive impairment (MCI) patients, and six AD patients. The standardized uptake value ratio of brain regions to the cerebellum was calculated with partial volume correction using magnetic resonance (MR) images to remove the effects of white matter accumulation. No significant differences in the cerebral cortical uptake were observed between normal control subjects and AD patients in [ 18F ]FACT studies without partial volume correction, while significant differences were observed in [ 11C ]PIB. After partial volume correction, the cerebral cortical uptake was significantly larger in AD patients than in normal control subjects for [ 18F ]FACT studies as well as [ 11C ]PIB. Relatively lower uptakes of [ 11C ]PIB in distribution were observed in the medial side of the temporal cortex and in the occipital cortex as compared with [ 18F ]FACT. Relatively higher uptake of [ 11C ]PIB in distribution was observed in the frontal and parietal cortices. Since [ 18F ]FACT might bind more preferentially to dense-cored amyloid deposition, regional differences in cerebral cortical uptake between [ 11C ]PIB and [ 18F ]FACT might be due to differences in regional distribution between diffuse and dense-cored amyloid plaque shown in the autoradiographic

  8. Dipole model analysis of F2cc¯${m{F}}_2^{{m{car c}}} $ derived from the new D* data in DIS at HERA

    Directory of Open Access Journals (Sweden)

    Luszczak Agnieszka

    2012-12-01

    Full Text Available I analyse the new D* deep inelastic scattering data from HERA with the help of dipole models. I calculate F2cc¯${m{F}}_2^{{m{car c}}} $ from the GBW [1] and BGK [2] saturation models. I compare results with the last values determined by H1 at low Q2. I find good agreement with the data.

  9. ToF-MEIS stopping measurements in thin SiC films

    International Nuclear Information System (INIS)

    Electronic stopping in thin, amorphous, SiC films has been studied by time-of-flight medium energy ion scattering and conventional Rutherford backscattering spectrometry. Amorphous SiC films (8, 21 and 36 nm) were prepared by laser ablation using a single crystalline silicon carbide target. Two kinds of substrate films, one with a lower atomic mass (carbon) and one with higher atomic mass (iridium) compared to silicon has been used. Monte Carlo simulations have been used to evaluate electronic stopping from the shift in energy for the signal scattered from Ir with and without SiC. The two kinds of samples are used to illustrate the strength and challenges for ToF-MEIS compared to conventional RBS

  10. ToF-MEIS stopping measurements in thin SiC films

    Science.gov (United States)

    Linnarsson, M. K.; Khartsev, S.; Primetzhofer, D.; Possnert, G.; Hallén, A.

    2014-08-01

    Electronic stopping in thin, amorphous, SiC films has been studied by time-of-flight medium energy ion scattering and conventional Rutherford backscattering spectrometry. Amorphous SiC films (8, 21 and 36 nm) were prepared by laser ablation using a single crystalline silicon carbide target. Two kinds of substrate films, one with a lower atomic mass (carbon) and one with higher atomic mass (iridium) compared to silicon has been used. Monte Carlo simulations have been used to evaluate electronic stopping from the shift in energy for the signal scattered from Ir with and without SiC. The two kinds of samples are used to illustrate the strength and challenges for ToF-MEIS compared to conventional RBS.

  11. Refining and blending of aviation turbine fuels.

    Science.gov (United States)

    White, R D

    1999-02-01

    Aviation turbine fuels (jet fuels) are similar to other petroleum products that have a boiling range of approximately 300F to 550F. Kerosene and No.1 grades of fuel oil, diesel fuel, and gas turbine oil share many similar physical and chemical properties with jet fuel. The similarity among these products should allow toxicology data on one material to be extrapolated to the others. Refineries in the USA manufacture jet fuel to meet industry standard specifications. Civilian aircraft primarily use Jet A or Jet A-1 fuel as defined by ASTM D 1655. Military aircraft use JP-5 or JP-8 fuel as defined by MIL-T-5624R or MIL-T-83133D respectively. The freezing point and flash point are the principle differences between the finished fuels. Common refinery processes that produce jet fuel include distillation, caustic treatment, hydrotreating, and hydrocracking. Each of these refining processes may be the final step to produce jet fuel. Sometimes blending of two or more of these refinery process streams are needed to produce jet fuel that meets the desired specifications. Chemical additives allowed for use in jet fuel are also defined in the product specifications. In many cases, the customer rather than the refinery will put additives into the fuel to meet their specific storage or flight condition requirements. PMID:10189575

  12. Quality assurance standards: comparison between IAEA 50-C/SG-Q and ISO 9001:1994

    International Nuclear Information System (INIS)

    The International Atomic Energy Agency (IAEA) and the International Organization for Standardization (ISO) agreement regarding the scope and coverage of documents published by both organizations points out that the standards of safety developed by the IAEA are recommendations for use by its Member States in the framework of national regulations for the safe utilization of nuclear energy. Such standards should be considered as nuclear safety regulatory documents. The standards developed by the ISO are complementary technical documents emphasizing industrial application and contractual aspects. Regarding the quality assurance topic, the IAEA standards 50-C/SG-Q are mostly used directly or indirectly to establish the nuclear safety requirements at the utility-regulatory interface. The industrial ISO 9001 standards have progressively been used to implement the quality assurance requirements at the interface utility-supplier. The relationship between both standards is growing in significance owing to the impact upon the owners/operators of nuclear facilities and their contractors/suppliers. The relationship between the IAEA and ISO standards is considered critical, in particular regarding suppliers with a small range of nuclear supplies. These organizations are not always willing to prepare special quality assurance programmes based on nuclear safety standards. On the other hand, these organizations may be qualified on the basis of the ISO quality assurance standards. In any case, for delivering nuclear items and services the quality assurance programme must comply with the requirements established in the nuclear safety regulatory standards. This implies that the utility-supplier will have to demonstrate that the acceptable degree of quality assurance in relation to nuclear safety is accomplished. This may be achieved by imposing additional requirements on the supplier over and above those contained within the ISO. In order to provide a description of the differences

  13. Standards for medical device communication: X73 PoC-MDC.

    Science.gov (United States)

    Galarraga, Miguel; Serrano, Luis; Martínez, Ignacio; de Toledo, Paula

    2006-01-01

    When using a number of medical devices from very different manufacturers with different proprietary formats the problem of a lack of interoperability emerges. Connectivity and communications are then limited and the systems and users can not exploit all the possibilities that Information and Communication Technologies offer today. The use and application of standards can be the solution to bring light to this confusion of languages in this Tower of Babel. There are several standards applicable to medical information systems interoperability and, analyzing these different options, the X73 PoC-MDC (ISO11073/IEEE1073) set of standards for Point of Care Medical Device Communication is the best positioned international standard to provide interoperability in these communications. PMID:17095823

  14. Standard Molar Enthalpy of Formation of RE(C5H8NS2)3(C12H8N2)

    Institute of Scientific and Technical Information of China (English)

    Meng Xiangxin; Shuai Qi; Chen Sanping; Xie Gang; Gao Shengli; Shi Qizhen

    2005-01-01

    Four solid ternary complexes of RE (C5H8NS2)3(C12H8N2) (RE=Eu, Gd, Tb, Dy) were synthesized in absolute ethanol by rare earth chloride low hydrate with the mixed ligands of ammonium pyrrolidinedi-thiocarbamate (APDC) and 1, 10-phenanthroline*H2O (o-phen*H2O) in the ordinary laboratory atmosphere without any cautions against moisture or air sensitivity. IR spectra of the complexes show that the RE3+ coordinated with six sulfur atoms of three PDC- and two nitrogen atoms of o-phen*H2O. It was assumed that the coordination number of RE3+ is eight. The constant-volume combustion energies of the complexes, ΔcU, were determined as (-16937.88±9.79 ), (-17588.79±8.62 ), (-17747.14±8.25 ) and (-17840.37±8.87 ) kJ*mol-1, by a precise rotating-bomb calorimeter at 298.15 K. Its standard molar enthalpies of combustion, ΔcHθm, and standard molar enthalpies of formation, ΔfHθm, were calculated as (-16953.37±9.79), (-17604.28±8.62), (-17762.63±8.25), (-17855.86±8.87) kJ*mol-1 and (-857.04±10.52), (-282.43±9.58), (-130.08±9.13), (-55.75±9.83) kJ*mol-1.

  15. Role of the N-terminal signal peptide in the membrane insertion of Aquifex aeolicus F1F0 ATP synthase c-subunit.

    Science.gov (United States)

    Zhang, Chunli; Marcia, Marco; Langer, Julian D; Peng, Guohong; Michel, Hartmut

    2013-07-01

    Rotary ATPases are membrane protein complexes that couple ATP hydrolysis to ion translocation across the membrane. Overall, they are evolutionarily well conserved, but the N-terminal segments of their rotary subunits (c-subunits) possess different lengths and levels of hydrophobicity across species. By analyzing the N-terminal variability, we distinguish four phylogenetic groups of c-subunits (groups 1-4). We characterize a member of group 2, the c-subunit from Aquifex aeolicus F1F0 ATP synthase, both in native cells and in a heterologous expression system. We demonstrate that its N-terminal segment forms a signal peptide with signal recognition particle (SRP) recognition features and is obligatorily required for membrane insertion. Based on our study and on previous characterizations of c-subunits from other organisms, we propose that c-subunits follow different membrane insertion pathways. PMID:23663226

  16. Stress corrosion characterization of turbine rotor materials: phase I

    International Nuclear Information System (INIS)

    This report describes a research program conducted to determine susceptibility of steels used in low-pressure (LP) turbine rotors of power plants to stress corrosion cracking (SCC) in LP turbine environments. The program included slow-strain-rate and sustained-load SCC tests on samples from two 3.5 NiCrMoV rotor forgings. Environments included pure NaOH solutions, 3.5% NaCl, pure water, and mixtures of NaOH and NaCl, Na2S, Na2SO4, or CuO. Tests were conducted over a temperature range of 38 to 2040C (100 to 4000F). Supplementary electrochemical data also were generated. Slow-strain-rate test results indicate that the minimum NaOH concentration required to produce detectable SCC decreases with increasing temperature. Addition of small amounts of NaCl reduced the concentration of NaOH necessary to produce SCC at 1570C (3150F). Pure 3.5% NaCl induced SCC at 1210C (2500F). SCC was not detected in either steel in tests in pure water at 1570C (3150F). Sustained-load test results indicate that long exposure times and high stress levels are necessary to initiate detectable cracking in NaOH solutions

  17. Display of cell surface sites for fibronectin assembly is modulated by cell adherence to (1F3 and C-terminal modules of fibronectin.

    Directory of Open Access Journals (Sweden)

    Jielin Xu

    Full Text Available BACKGROUND: Fibronectin-null cells assemble soluble fibronectin shortly after adherence to a substrate coated with intact fibronectin but not when adherent to the cell-binding domain of fibronectin (modules (7F3-(10F3. Interactions of adherent cells with regions of adsorbed fibronectin other than modules (7F3-(10F3, therefore, are required for early display of the cell surface sites that initiate and direct fibronectin assembly. METHODOLOGY/PRINCIPAL FINDINGS: To identify these regions, coatings of proteolytically derived or recombinant pieces of fibronectin containing modules in addition to (7F3-(10F3 were tested for effects on fibronectin assembly by adherent fibronectin-null fibroblasts. Pieces as large as one comprising modules (2F3-(14F3, which include the heparin-binding and cell adhesion domains, were not effective in supporting fibronectin assembly. Addition of module (1F3 or the C-terminal modules to modules (2F3-(14F3 resulted in some activity, and addition of both (1F3 and the C-terminal modules resulted in a construct, (1F3-C, that best mimicked the activity of a coating of intact fibronectin. Constructs (1F3-C V0, (1F3-C V64, and (1F3-C Delta(V(15F3(10F1 were all able to support fibronectin assembly, suggesting that (1F3 through (11F1 and/or (12F1 were important for activity. Coatings in which the active parts of (1F3-C were present in different proteins were much less active than intact (1F3-C. CONCLUSIONS: These results suggest that (1F3 acts together with C-terminal modules to induce display of fibronectin assembly sites on adherent cells.

  18. Two-wire Low-power Instrument Based on C8051F040%C8051F040的两线制低功耗仪表

    Institute of Scientific and Technical Information of China (English)

    王大鹏; 张海

    2007-01-01

    应用C8051F040单片机设计两线制低功耗显示仪.系统采用低功耗的电压转换芯片LT1934、电压/电流转换芯片XTR115UA和LCD等器件,对传感器输入的电压信号进行处理,通过键盘和液晶屏实现人机交互,可以按照需要提供4~20 mA的环路电流.系统设有辅助模块,增加了LCD背光显示,以及将采集到的数据以数字量形式输出等功能,使得系统的功能更加完善.经过验证,系统具有低功耗、低成本的特点,能够实现两线制环路输出电流及数字量的输出.

  19. 18 F-FDG PET standard uptake values of the normal pons in children: establishing a reference value for diffuse intrinsic pontine glioma

    OpenAIRE

    Jansen, Marc H. A.; Kloet, Reina W.; van Vuurden, Dannis G.; van Zanten, Sophie EM Veldhuijzen; Witte, Birgit I.; Goldman, Serge; Vandertop, W. Peter; Comans, Emile FI; Hoekstra, Otto S.; Boellaard, Ronald; Kaspers, Gert-Jan JL

    2014-01-01

    Background Positron emission tomography (PET) scanning with [18 F]fluorodeoxyglucose (18 F-FDG) is a useful diagnostic and prediction tool in brain tumors, but its value in childhood diffuse intrinsic pontine glioma (DIPG) is still unclear. For interpretation of 18 F-FDG PET results in DIPG, uptake values of the normal pons of children of increasing ages are mandatory. The aim of this study was to determine 18 F-FDG standard uptake value ratios (SUVr) of the normal pons and to compare these t...

  20. Establishment of a Method to Measure Length of the Ulnar Nerve and Standardize F-wave Values in Clinically Normal Beagles

    OpenAIRE

    HIRASAWA, Shun; Shimizu, Miki; MARUI, Yuumi; KISHIMOTO, Miori; OKUNO, Seiichi

    2014-01-01

    We designed a new method of measuring the length of the ulnar nerve and determining standard values for F-wave parameters of the ulnar nerve in clinically normal beagles. Nerve length must be precisely measured to determine F-wave latency and conduction velocity. The length of the forelimb has served as the length of the ulnar nerve for F-wave assessments, but report indicates that F-wave latency is proportional to the length of the pathway traveled by nerve impulses. Therefore, we measured t...

  1. New orbit recalculations of comet C/1890 F1 Brooks and its dynamical evolution

    Science.gov (United States)

    Królikowska, Małgorzata; Dybczyński, Piotr A.

    2016-04-01

    C/1890 F1 Brooks belongs to a group of nineteen comets used by Jan Oort to support his famous hypothesis on the existence of a spherical cloud containing hundreds of billions of comets with orbits of semimajor axes between 50 and 150 thousand au. Comet Brooks stands out from this group because of a long series of astrometric observations as well as nearly two-year long observational arc. Rich observational material makes this comet an ideal target for testing the rationality of an effort to recalculate astrometric positions on the basis of original (comet-star)-measurements using modern star catalogues. This paper presents the results of such new analysis based on two different methods: (i) automatic re-reduction based on cometary positions and the (comet-star)-measurements, and (ii) partially automatic re-reduction based on the contemporary data for originally used reference stars. We show that both methods offer a significant reduction of orbital elements uncertainties. Based on the most preferred orbital solution, the dynamical evolution of comet Brooks during three consecutive perihelion passages is discussed. We conclude that C/1890 F1 is a dynamically old comet that passed the Sun at a distance below 5 au during its previous perihelion passage. Furthermore, its next perihelion passage will be a little closer than during the 1890-1892 apparition. C/1890 F1 is interesting also because it suffered extremely small planetary perturbations when it travelled through the planetary zone. Therefore, in the next passage through perihelion it will be once again a comet from the Oort spike.

  2. New orbit recalculations of comet C/1890 F1 Brooks and its dynamical evolution

    Science.gov (United States)

    Królikowska, Małgorzata; Dybczyński, Piotr A.

    2016-08-01

    C/1890 F1 Brooks belongs to a group of 19 comets used by Jan Oort to support his famous hypothesis on the existence of a spherical cloud containing hundreds of billions of comets with orbits of semi-major axes between 50 000 and 150 000 au. Comet Brooks stands out from this group because of a long series of astrometric observations as well as a nearly 2-yr-long observational arc. Rich observational material makes this comet an ideal target for testing the rationality of an effort to recalculate astrometric positions on the basis of original (comet-star) measurements using modern star catalogues. This paper presents the results of such a new analysis based on two different methods: (i) automatic re-reduction based on cometary positions and the (comet-star) measurements and (ii) partially automatic re-reduction based on the contemporary data for the reference stars originally used. We show that both methods offer a significant reduction in the uncertainty of orbital elements. Based on the most preferred orbital solution, the dynamical evolution of comet Brooks during three consecutive perihelion passages is discussed. We conclude that C/1890 F1 is a dynamically old comet that passed the Sun at a distance below 5 au during its previous perihelion passage. Furthermore, its next perihelion passage will be a little closer than during the 1890-1892 apparition. C/1890 F1 is interesting also because it suffered extremely small planetary perturbations when it travelled through the planetary zone. Therefore, in the next passage through perihelion, it will once again be a comet from the Oort spike.

  3. Integrated optimization of floating wind turbine systems

    OpenAIRE

    Sandner, Frank; Schlipf, David; Matha, Denis; Cheng, Po Wen

    2014-01-01

    An exemplary methodology is shown for the integrated conceptioning of a floating wind turbine system with focus on the spar-type hull and the wind turbine blade-pitch-to-feather controller. It is a special interest to use a standard controller, which is easily implementable, even at early design stages. The optimization of the system is done with adapted static and dynamic models through a stepwise narrowing of the design space according to the requirements of floating wind turbines. After se...

  4. Wind turbine

    Science.gov (United States)

    Cheney, Jr., Marvin C.

    1982-01-01

    A wind turbine of the type having an airfoil blade (15) mounted on a flexible beam (20) and a pitch governor (55) which selectively, torsionally twists the flexible beam in response to wind turbine speed thereby setting blade pitch, is provided with a limiter (85) which restricts unwanted pitch change at operating speeds due to torsional creep of the flexible beam. The limiter allows twisting of the beam by the governor under excessive wind velocity conditions to orient the blades in stall pitch positions, thereby preventing overspeed operation of the turbine. In the preferred embodiment, the pitch governor comprises a pendulum (65,70) which responds to changing rotor speed by pivotal movement, the limiter comprising a resilient member (90) which engages an end of the pendulum to restrict further movement thereof, and in turn restrict beam creep and unwanted blade pitch misadjustment.

  5. Longitudinal Structure Function FL from Charm Structure Function F2c

    Institute of Scientific and Technical Information of China (English)

    B.Rezaei; G.R.Boroun

    2013-01-01

    We predict the effect of the charm structure function on the longitudinal structure function at small x.In NLO analysis we find that the hard Pomeron behavior gives a good description of FL and Fkc (k =2,L) at small x values.We conclude that a direct relation between FL∝ F2c would provide useful information on how to measure longitudinal structure function at high Q2 values.Having checked that this model gives a good description of the data,when compared with other models.

  6. Binary reaction channels in the 12C+19F and 16O+15N nuclear collisions

    International Nuclear Information System (INIS)

    The 19F on 12C and 15N on 16O reactions are studied not only in order to search for resonances but furthermore to perform a comparative study of binary reaction channels in two collisions leading to the same excitation energies of the composite system. The main feature of the experimental procedure is an exclusive detection of the two fragments in the exit channel using the kinematical coincidence method. Angular distributions and excitation functions of the main binary channels are presented and discussed

  7. C-Band Airport Surface Communications System Standards Development, Phase I

    Science.gov (United States)

    Hall, Edward; Isaacs, James; Zelkin, Natalie; Henriksen. Steve

    2010-01-01

    This document is being provided as part of ITT's NASA Glenn Research Center Aerospace Communication Systems Technical Support (ACSTS) contract NNC05CA85C, Task 7: "New ATM Requirements--Future Communications, C-Band and L-Band Communications Standard Development." The proposed future C-band (5091- to 5150-MHz) airport surface communication system, referred to as the Aeronautical Mobile Airport Communications System (AeroMACS), is anticipated to increase overall air-to-ground data communications systems capacity by using a new spectrum (i.e., not very high frequency (VHF)). Although some critical services could be supported, AeroMACS will also target noncritical services, such as weather advisory and aeronautical information services as part of an airborne System Wide Information Management (SWIM) program. AeroMACS is to be designed and implemented in a manner that will not disrupt other services operating in the C-band. This report defines the AeroMACS concepts of use, high-level system requirements, and architecture; the performance of supporting system analyses; the development of AeroMACS test and demonstration plans; and the establishment of an operational AeroMACS capability in support of C-band aeronautical data communications standards to be advanced in both international (International Civil Aviation Organization, ICAO) and national (RTCA) forums. This includes the development of system parameter profile recommendations for AeroMACS based on existing Institute of Electrical and Electronics Engineering (IEEE) 802.16e- 2009 standards

  8. European wind turbine testing procedure developments. Task 1: Measurement method to verify wind turbine performance characteristics

    DEFF Research Database (Denmark)

    Hunter, R.; Friis Pedersen, Troels; Dunbabin, P.; Antoniou, Ioannis; Frandsen, Sten Tronæs; Klug, H.; Albers, A.; Lee, W.K.

    2001-01-01

    There is currently significant standardisation work ongoing in the context of wind farm energy yield warranty assessment and wind turbine power performance testing. A standards maintenance team is revising the current IEC (EN) 61400-12 Ed 1 standard forwind turbine power performance testing. The...

  9. Investigation of Advanced Processed Single-Crystal Turbine Blade Alloys

    Science.gov (United States)

    Peters, B. J.; Biondo, C. M.; DeLuca, D. P.

    1995-01-01

    This investigation studied the influence of thermal processing and microstructure on the mechanical properties of the single-crystal, nickel-based superalloys PWA 1482 and PWA 1484. The objective of the program was to develop an improved single-crystal turbine blade alloy that is specifically tailored for use in hydrogen fueled rocket engine turbopumps. High-gradient casting, hot isostatic pressing (HIP), and alternate heat treatment (HT) processing parameters were developed to produce pore-free, eutectic-free microstructures with different (gamma)' precipitate morphologies. Test materials were cast in high thermal gradient solidification (greater than 30 C/cm (137 F/in.)) casting furnaces for reduced dendrite arm spacing, improved chemical homogeneity, and reduced interdendritic pore size. The HIP processing was conducted in 40 cm (15.7 in.) diameter production furnaces using a set of parameters selected from a trial matrix study. Metallography was conducted on test samples taken from each respective trial run to characterize the as-HIP microstructure. Post-HIP alternate HT processes were developed for each of the two alloys. The goal of the alternate HT processing was to fully solution the eutectic gamma/(gamma)' phase islands and to develop a series of modified (gamma)' morphologies for subsequent characterization testing. This was accomplished by slow cooling through the (gamma)' solvus at controlled rates to precipitate volume fractions of large (gamma)'. Post-solution alternate HT parameters were established for each alloy providing additional volume fractions of finer precipitates. Screening tests included tensile, high-cycle fatigue (HCF), smooth and notched low-cycle fatigue (LCF), creep, and fatigue crack growth evaluations performed in air and high pressure (34.5 MPa (5 ksi)) hydrogen at room and elevated temperature. Under the most severe embrittling conditions (HCF and smooth and notched LCF in 34.5 MPa (5 ksi) hydrogen at 20 C (68 F), screening test

  10. Improving the Neutron Cross-section Standards 238U(n,f) and 6Li(n,a) : Measurements and Simulations

    OpenAIRE

    Jansson, Kaj

    2015-01-01

    Improving or extending the range of cross-section standards, which in general are believed to be well known, require good control of the experimental conditions and the uncertainties involved. Two experiments that aspire to improve two different neutron cross-section standards, 238U(n,f) and 6Li(n,a, are presented in this thesis. Both standards have previously been extensively measured, but outside certain energy ranges discrepancies exist. In this thesis, a future precision measurement of th...

  11. Preclinical evidence for the potential of a bivalent fHBP vaccine to prevent Neisseria meningitidis Serogroup C Disease.

    Science.gov (United States)

    Harris, Shannon L; Zhu, Duzhang; Murphy, Ellen; McNeil, Lisa K; Wang, Xin; Mayer, Leonard W; Harrison, Lee H; Jansen, Kathrin U; Anderson, Annaliesa S

    2011-01-01

    A bivalent factor H binding protein (fHBP) vaccine for the prevention of disease caused by Neisseria meningitidis serogroup B is currently in clinical development. Since fHBP is also expressed by other meningococcal serogroups, anti-fHBP antibodies may have bactericidal activity against meningococci independent of serogroup. To begin examining the susceptibility of other meningococcal serogroups to anti-fHBP antibodies, meningococcal serogroup C invasive isolates (n = 116) were collected from the Centers for Disease Control and Prevention's Active Bacterial Core surveillance (ABCs) sites during 2000-2001. These isolates were analyzed for the presence of the fhbp gene. All serogroup C isolates contained the gene, and sequence analysis grouped the proteins into two subfamilies, A and B. Flow cytometry analysis demonstrated that fHBP was expressed on the surface of ~70% of isolates in vitro with varying levels of expression. fHBP was accessible to antibodies on the cell surface even in the presence of the polysaccharide capsule. Nine isolates from different geographic regions were identified which harboured an identical single nucleotide deletion that could result in a truncated subfamily B fHBP. Analysis by flow cytometry using a polyclonal fHBP antibody preparation revealed that a subpopulation of each of these isolates expressed fHBP. Rabbit and non-human primate immune sera generated with bivalent fHBP vaccine were tested for bactericidal activity against a panel of diverse serogroup C clinical isolates using human complement. Sera from both species demonstrated serum bactericidal antibody activity against the serogroup C isolates tested. These promising findings suggest that a bivalent fHBP vaccine may be capable of providing protection against meningococcal disease caused by both serogroup C and B. PMID:21245657

  12. Producing a new in-house C-14 standard by irradiating graphite

    International Nuclear Information System (INIS)

    Full text: Accelerator mass spectrometry (AMS) always performs measurements relative to a standard, which significantly improves the precision. C-14 measurements need a chemical treatment to transform carbon into graphite, to be used in the popular Cs-sputter sources. A homogeneous bulk of several gram of graphite containing C-14 would allow to study the performance of the mass spectrometer independent of sample preparation chemistry. Unfortunately, this material is not available so far. The aim was to produce such a new in-house standard for the VERA facility (University of Vienna). We started from dead (p.e. no C-14) graphite powder and irradiated it with thermal neutrons at the TRIGA Mark II reactor from the Institute of Atomic and Subatomic Physics (TU Vienna). Via the 13C(n, γ)14C reaction we produced a C-14 isotopic abundance in the natural range of ∼10-12. The challenge of this work was to deal with an inhomogeneous neutron flux and the low cross section for the mentioned above reaction, compared to the much more efficient 14N(n,p)14C. The homogeneity of the produced material was successfully verified by measurements of small aliquots. (author)

  13. Metal free and selective activation of one C-F bond in a bound CF3 group.

    OpenAIRE

    Azhakar, Ramachandran; Roesky, Herbert W.; Wolf, Hilke; Stalke, Dietmar

    2013-01-01

    The first metal free selective C-F bond activation of a CF(3) group was observed with N-heterocyclic silylenes [PhC(NtBu)(2)SiCl] (1) and [CH{(C=CH(2))(CMe)(2,6-iPr(2)C(6)H(3)N)(2)}Si] (2) with PhN=C(CF(3))(2). The reaction proceeds in a 1 : 1 molar ratio to yield the mono C-F bond activated products 3 and 4 with each containing a CF(2) group. Both the reactions proceed through an unprecedented selective activation of one of the C-F bonds rather than forming the [1+2] cycloaddition product co...

  14. $f_0(500)$, $f_0(980)$ and $a_0(980)$ production in the $\\chi_{c1} \\to \\eta \\pi^+\\pi^-$ reaction

    CERN Document Server

    Liang, Wei-Hong; Oset, E

    2016-01-01

    We study the $\\chi_{c1} \\to \\eta \\pi^+ \\pi^-$ decay, paying attention to the production of $f_0(500)$, $f_0(980)$ and $a_0(980)$ from the final state interaction of pairs of mesons that can lead to these three mesons in the final state, which is implemented using the chiral unitary approach. Very clean and strong signals are obtained for the $a_0(980)$ excitation in the $\\eta \\pi$ invariant mass distribution and for the $f_0(500)$ in the $\\pi^+ \\pi^-$ mass distribution. A smaller, but also clear signal for the $f_0(980)$ excitation is obtained. The results are contrasted with experimental data and the agreement found is good, providing yet one more test in support of the picture where these resonances are dynamically generated from the meson-meson interaction.

  15. PET STUDIES WITH L-[1-C-11]TYROSINE, L-[METHYL-C-11]METHIONINE AND F-18 FLUORODEOXYGLUCOSE IN PROLACTINOMAS IN RELATION TO BROMOCRYPTINE TREATMENT

    NARCIS (Netherlands)

    DAEMEN, BJG; ZWERTBROEK, R; ELSINGA, PH; PAANS, AMJ; DOORENBOS, H; VAALBURG, W

    1991-01-01

    Aspects of metabolism in prolactinomas were investigated by positron emission tomography using L-[1-C-11]tyrosine, L-[methyl-C-11]methionine and F-18-fluorodeoxyglucose (18FDG). Using L-[1-C-11]tyrosine, four patients were monitored prior to and 18 h after an injection of 50 mg bromocryptine. At 18

  16. Cross sectoral impacts on water availability at +2 °C and +3 °C for east Mediterranean island states: The case of Crete

    Science.gov (United States)

    Koutroulis, A. G.; Grillakis, M. G.; Daliakopoulos, I. N.; Tsanis, I. K.; Jacob, D.

    2016-01-01

    Ensemble pan-European projections under a 2 °C global warming relative to the preindustrial period reveal a more intense warming in south Eastern Europe by up to +3 °C, thus indicating that impacts of climate change will be disproportionately high for certain regions. The Mediterranean is projected as one of the most vulnerable areas to climatic and anthropogenic changes with decreasing rainfall trends and a continuous gradual warming causing a progressive decline of average stream flow. Many Mediterranean regions are currently experiencing high to severe water stress induced by human and climate drivers. Changes in average climate conditions will increase this stress notably because of a 10-30% decline in freshwater resources. For small island states, where accessibility to freshwater resources is limited the impact will be more pronounced. Here we use a generalized cross-sectoral framework to assess the impact of climatic and socioeconomic futures on the water resources of an Eastern Mediterranean island. A set of representative regional climate models simulations from the EURO-CORDEX initiative driven by different RCP2.6, RCP4.5, and RCP8.5 GCMs are used to form a comparable set of results and a useful basis for the assessment of uncertainties related to impacts of 2° warming and above. A generalized framework of a cross-sectoral water resources analysis was developed in collaboration with the local water authority exploring and costing adaptation measures associated with a set of socioeconomic pathways (SSPs). Transient hydrological modeling was performed to describe the projected hydro-climatological regime and water availability for each warming level. The robust signal of less precipitation and higher temperatures that is projected by climate simulations results to a severe decrease of local water resources which can be mitigated by a number of actions. Awareness of the practical implications of plausible hydro-climatic and socio-economic scenarios in the

  17. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M;

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  18. Dynamic survey of wind turbine vibrations

    Science.gov (United States)

    Chiang, Chih-Hung; Hsu, Keng-Tsang; Cheng, Chia-Chi; Pan, Chieh-Chen; Huang, Chi-Luen; Cheng, Tao-Ming

    2016-04-01

    Six wind turbines were blown to the ground by the wind gust during the attack of Typhoon Soudelor in August 2015. Survey using unmanned aerial vehicle, UAV, found the collapsed wind turbines had been broken at the lower section of the supporting towers. The dynamic behavior of wind turbine systems is thus in need of attention. The vibration of rotor blades and supporting towers of two wind turbine systems have been measured remotely using IBIS, a microwave interferometer. However the frequency of the rotor blade can be analyzed only if the microwave measurements are taken as the wind turbine is parked and secured. Time-frequency analyses such as continuous wavelet transform and reassigned spectrograms are applied to the displacement signals obtained. A frequency of 0.44Hz exists in both turbines B and C at various operating conditions. Possible links between dynamic characteristics and structural integrity of wind turbine -tower systems is discussed.

  19. Phylogeography of the Land Snail Eobania vermiculata (O.F. Müller, 1774 (Gastropoda: Pulmonata along the Croatian Coast and Islands

    Directory of Open Access Journals (Sweden)

    Jasna Puizina

    2013-08-01

    Full Text Available Eobania vermiculata (O.F. Müller, 1774, is a typical Mediterranean species of large land snails. Nonindigenous populations of this species, however, are already established in the USA, Australia and elsewhere in the world, where this species is considered to represent a potentially serious threat as a pest and invasive species. The aims of this study were: 1 to determine the pattern of genetic variation within the Croatian E. vermiculata populations based on analyses of sequence diversity of two mitochondrial genes, 16S rDNA and the cytochrome oxidase I (COI, and 2 to shed more light upon the phylogeography of E. vermiculata in this area. Seventy-seven specimens of land snail Eobania vermiculata were sampled at 19 sampling sites along Croatian coastal region and islands. The partial 16S rRNA gene sequences (379 bp grouped into 14 haplotypes, whereas the partial COI gene sequences (523 bp grouped into 13 haplotypes. The overall population is characterized by relatively high haplotype (gene diversity (0.719±0.042 for 16S rDNA and 0.869±0.020 for COI. Demographic Fu F’s tests and Tajima's D value indicated no significant change in the population size, thus suggesting long historical presence of E. vermiculata in this region. Maximum likelihood phylogenetic analysis, Bayesian inference and median joining haplotype network showed a genetic splitting of Croatian 16S rRNA and COI sequences, with a clear distinction between south-Adriatic and north-Adriatic haplotypes. A possible explanation for the observed phylogeography of E. vermiculata, could be related to the climate change, glaciations and the Adriatic Sea level oscillations during the Quaternary

  20. C/NOFS Observations of AC Electric Field Fields Associated with Equatorial Spread-F

    Science.gov (United States)

    Pfaff, R.; Liebrecht, C.

    2009-01-01

    The Vector Electric Field Investigation (VEFI) on the C/NOFS equatorial satellite provides a unique data set in which to acquire detailed knowledge of irregularities associated with the equatorial ionosphere and in particular with spread-F depletions. We present vector AC electric field observations, primarily gathered within the ELF band (1 Hz to 250 Hz) on C/NOFS that address a variety of key questions regarding how plasma irregularities, from meter to kilometer scales, are created and evolve. The data will be used to explore the anisotropy/isotropy of the waves, their wavelength and phase velocity, as well as their spectral distributions. When analyzed in conjunction with the driving DC electric fields and detailed plasma number density measurements, the combined data reveal important information concerning the instability mechanisms themselves. We also present high resolution, vector measurements of intense lower hybrid waves that have been detected on numerous occasions by the VEFI burst memory VLF electric field channels.

  1. XPS depth profile analysis of ArF immersion resists by using C60 ion beam

    International Nuclear Information System (INIS)

    Argon ion sputtering is one of the most accepted techniques for depth profiling in practical X-ray photoelectron spectroscopy (XPS) analysis, while this technique is known to cause severe degradation especially with organic materials. Sputtering system using buckminsterfullerene (C60) ion beam has recently been introduced to XPS apparatus as a new sputtering tool for depth profiling. It enables the XPS depth analysis of organic materials such as photoresists without chemical damages. In this paper, the XPS analysis using the C60 ion sputtering was applied to examine the depth distributions of a fluoropolymer in ArF immersion resists to clarify the mechanism of the water-repellency change between the co-polymer and blend polymer. In addition, the depth profiling of the resist is compared to those observed with other techniques such as angle resolved XPS analysis and XPS analysis on the gradient shaved surfaces. (author)

  2. A comparative investigation of γ-ray and C5+ ion beam impact on thermoluminescence response of Mg2BO3F:Dy phosphor

    International Nuclear Information System (INIS)

    Mg2BO3F:Dy phosphor is a low Z material with an effective atomic number 9.92. This phosphor was synthesized by two different methods, because the solid state method failed to produce single phase Mg2BO3F:Dy phosphor. This study reports a comparative investigation of γ-ray and C5+ ion beam impact on thermoluminescence (TL) properties of Mg2BO3F:Dy phosphor. TRIM/SRIM calculations were performed to correlate the changes in TL properties of Mg2BO3F:Dy phosphor. Phosphor possesses good TL response towards γ-rays as well as C5+ ion beam irradiation. TL glow curves of the C5+ ion irradiated phosphor show a small shift in the position of the glow peaks towards the lower temperature side. With an increase in energy of the ion beam increase in TL intensity was observed. This increase in the TL efficiency with a decrease in linear energy transfer (LET) agrees well with the results reported in literature. Trapping parameters of the γ-ray and C5+ ion beam irradiated phosphor were calculated from the TL data using computerized glow curve deconvolution method. The trapping analysis suggests that ion beam irradiation causes only minor changes in the activation energy. The different types of defects responsible for TL glow curves were identified using the EPR technique. - Highlights: • A promising high sensitive Mg2BO3F:Dy (low Zeff) phosphor was firstly reported. • Effect of C5+ ion beam irradiation on TL properties was investigated in detail. • Glow peaks found to be stable over ion beam irradiation. • The phosphor found to be 4.8 times more sensitive than standard CaSO4:Dy. • This work provides a potential dosimetric material for ion beam dosimetry

  3. 一种C8051F单片机读取SSI信号的设计%Design Method of C8051F MCU Acquire SSI Signal

    Institute of Scientific and Technical Information of China (English)

    金彧; 金克一; 许海洪

    2014-01-01

    目前许多角度编码器将采集后的角度数字量通过SSI接口输出,供处理器读取。基于C8051F单片机内部所带PCA0可编程计数器阵列外设,设计一种适用于读取SSI接口信号的接口。通过实际应用运行,证明该设计方案稳定可靠,并且配置灵活,完全符合SSI接口协议标准。%Nowadays there are so many angular encoders use SSI to output digital data. In this article, C8051F MCU’s digital peripheral Programmable Counter Array (PCA0)is used to design an interface to acquire the Synchronous Serial Interface (SSI). Through practical operation,it is verified that this design method is stable and reliable, also flexible,and in full compliance with the SSI protocol standard.

  4. Orthorectification and Mosaicking of Color Aerial Photography for the Main Eight Hawaiian Islands: Kauai (103-104c-0430)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Habitat maps of the main Hawaiian Islands were created by visual interpretation of aerial photos and hyperspectral imagery using the Habitat Digitizer extension....

  5. Kauai Photomosaic 2000 (103-104c-0430) - Orthorectification and Mosaicing of Color Aerial Photography Main Eight Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Habitat maps of the main Hawaiian Islands were created by visual interpretation of aerial photos and hyperspectral imagery using the Habitat Digitizer extension....

  6. C-CAP Commonwealth of the Northern Mariana Islands (CNMI), Saipan 1945-2005-Era Land Cover Change Analysis

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains the 1945-era and 2005-era classifications of Saipan, Commonwealth of the Northern Mariana Islands and can be used to analyze change. This...

  7. Orthorectification and Mosaicking of Color Aerial Photography for the Main Eight Hawaiian Islands: Molokai (328c-0516)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Habitat maps of the main Hawaiian Islands were created by visual interpretation of aerial photos and hyperspectral imagery using the Habitat Digitizer extension....

  8. Budding yeast cDNA sequencing project: Y074_N01_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y074_N01_F.ab1 - - - Show Y074_N01_F.ab1 Seqid Y074_N01_F.ab1 Link to SGD - Link to dbEST - Link ... to UC SC ... Genome Browser - Sequenc e >Y074_N01_F.ab1 301 0 ... 301 ABI GAACCCC AACCCCC AAAAAAGGC ATC AGGNATTCC GAAAC AC ACCCCC AA CC AC C AAAC AC ACC AAC ACC AAC AAC AAC AC AC AC AAC AAACCC ACCCCC ... AAAAAAAAC ... AC ACCC AC AC AACCCC AAAC AC AAC AAAC AC AAAAAAAC AA AAAAACC AC AA ...

  9. SnF2标准生成Gibbs自由能的测定%Measurement of SnF2 Standard Gibbs Free Energy of Formation

    Institute of Scientific and Technical Information of China (English)

    韩元山; 王常珍; 田彦文; 翟玉春

    2004-01-01

    采用LaF3单晶(掺杂)作为固体电解质,在多次抽空充氩气的操作箱内,将Pb,Sn磨细过筛,按照4∶1的比例分别将Pb,PbF2,Sn,SnF2混合并压成片.Pb-PbF2为参比电极,Sn-SnF2为工作电极,银丝为电极引线组成工作电池.电池的结构为:(+)Ag|Pb,PbF2|LaF3单晶(掺杂) |Sn,SnF2|Ag(-).用高阻数字电压表准确测定了电池在293.15~353.15K范围内的电动势.以两种PbF2标准生成Gibbs自由能数据和电池电动势为基础,计算得到SnF2标准生成自由能同温度的关系.电池电动势测量的实验误差远远小于PbF2标准生成Gibbs自由能数据中所给定的误差,采用两种不同的PbF2标准生成Gibbs自由能数据所得到的SnF2标准生成自由能的数值,彼此之间的偏差很小.所以上述两种计算结果都是可靠的.

  10. Comparative response of platelet fV and plasma fV to activated protein C and relevance to a model of acute traumatic coagulopathy.

    Directory of Open Access Journals (Sweden)

    James E Campbell

    Full Text Available BACKGROUND: Acute traumatic coagulopathy (ATC has been linked to an increase in activated protein C (aPC from 40 pM in healthy individuals to 175 pM. aPC exerts its activity primarily through cleavage of active coagulation factor Va (fVa. Platelets reportedly possess fVa which is more resistant to aPC cleavage than plasma fVa; this work examines the hypothesis that normal platelets are sufficient to maintain coagulation in the presence of elevated aPC. METHODS: Coagulation responses of normal plasma, fV deficient plasma (fVdp, and isolated normal platelets in fVdp were conducted: prothrombin (PT tests, turbidimetry, and thromboelastography (TEG, including the dose response of aPC on the samples. RESULTS: PT and turbidimetric assays demonstrate that normal plasma is resistant to aPC at doses much higher than those found in ATC. Additionally, an average physiological number of washed normal platelets (200,000 platelets/mm3 was sufficient to eliminate the anti-coagulant effects of aPC up to 10 nM, nearly two orders of magnitude above the ATC concentration and even the steady-state pharmacological concentration of human recombinant aPC, as measured by TEG. aPC also demonstrated no significant effect on clot lysis in normal plasma samples with or without platelets. CONCLUSIONS: Although platelet fVa shows slightly superior resistance to aPC's effects compared to plasma fVa in static models, neither fVa is sufficiently cleaved in simulations of ATC or pharmacologically-delivered aPC to diminish coagulation parameters. aPC is likely a correlative indicator of ATC or may play a cooperative role with other activity altering products generated in ATC.

  11. F12-46C/T polymorphism as modifier of the clinical phenotype of hereditary angioedema.

    Science.gov (United States)

    Speletas, M; Szilágyi, Á; Csuka, D; Koutsostathis, N; Psarros, F; Moldovan, D; Magerl, M; Kompoti, M; Varga, L; Maurer, M; Farkas, H; Germenis, A E

    2015-12-01

    The factors influencing the heterogeneous clinical manifestation of hereditary angioedema due to C1-INH deficiency (C1-INH-HAE) represent one of the oldest unsolved problems of the disease. Considering that factor XII (FXII) levels may affect bradykinin production, we investigated the contribution of the functional promoter polymorphism F12-46C/T in disease phenotype. We studied 258 C1-INH-HAE patients from 113 European families, and we explored possible associations of F12-46C/T with clinical features and the SERPING1 mutational status. Given that our cohort consisted of related subjects, we implemented generalized estimating equations (GEEs), an extension of the generalized linear model accounting for the within-subject correlation. F12-46C/T carriers exhibited a significantly delayed disease onset (P < 0.001) and did not need long-term treatment (P = 0.02). In a GEE linear regression model, the presence of F12-46C/T was significantly associated with a 7-year delay in disease onset (P < 0.0001) regardless of SERPING1 mutational status. It is concluded that F12-46C/T carriage acts as an independent modifier of C1-INH-HAE severity. PMID:26248961

  12. Quality standards: Comparison between IAEA 50-C/SG-Q and ISO 9001:2000

    International Nuclear Information System (INIS)

    The International Atomic Energy Agency (IAEA) has the statutory mandate to seek to accelerate and enlarge the contribution of atomic energy to peace, health and prosperity throughout the world. As part of the activities to achieve its objectives, the IAEA is authorized to establish standards of safety for the protection of health and the minimization of danger to life and property. The standards of safety developed by the IAEA are recommendations for use by its Member States in the framework of national regulations for the safe utilization of nuclear energy. Such standards should be considered as nuclear safety regulatory documents. The standards developed by the International Organization for Standardization (ISO) are complementary technical documents emphasizing industrial application and contractual aspects. Regarding the quality assurance topic, the IAEA developed the publication Safety Series No. 50-C/SG-Q, Quality Assurance for Safety in Nuclear Power Plants and other Nuclear Installations, which is mostly used directly or indirectly to establish the nuclear safety requirements at the nuclear utility-regulator interface. The ISO 9001:2000 standard, Quality Management Systems Requirements, is often used to define the quality management system requirements at the utility-supplier interface. The relationship between the IAEA and ISO quality standards is growing in significance owing to their increasing impact upon utilities (owners/operators of nuclear facilities) and their contractors/suppliers. The relationship between the IAEA and ISO standards is considered critical in particular with respect to contractors/suppliers with a small range of nuclear supplies. These contractors-suppliers are not always willing to prepare special quality assurance programmes based on nuclear safety standards. On the other hand, these contractors/suppliers may be qualified on the basis of the ISO quality standard. In any case, for delivering nuclear items and services the

  13. Dark Matter Search Results from the PICO-2L C3F8 Bubble Chamber

    Science.gov (United States)

    Amole, C.; Ardid, M.; Asner, D. M.; Baxter, D.; Behnke, E.; Bhattacharjee, P.; Borsodi, H.; Bou-Cabo, M.; Brice, S. J.; Broemmelsiek, D.; Clark, K.; Collar, J. I.; Cooper, P. S.; Crisler, M.; Dahl, C. E.; Daley, S.; Das, M.; Debris, F.; Dhungana, N.; Farine, J.; Felis, I.; Filgas, R.; Fines-Neuschild, M.; Girard, F.; Giroux, G.; Hai, M.; Hall, J.; Harris, O.; Jackson, C. M.; Jin, M.; Krauss, C. B.; Lafrenière, M.; Laurin, M.; Lawson, I.; Levine, I.; Lippincott, W. H.; Mann, E.; Martin, J. P.; Maurya, D.; Mitra, P.; Neilson, R.; Noble, A. J.; Plante, A.; Podviianiuk, R. B.; Priya, S.; Robinson, A. E.; Ruschman, M.; Scallon, O.; Seth, S.; Sonnenschein, A.; Starinski, N.; Štekl, I.; Vázquez-Jáuregui, E.; Wells, J.; Wichoski, U.; Zacek, V.; Zhang, J.; PICO Collaboration

    2015-06-01

    New data are reported from the operation of a 2 liter C3F8 bubble chamber in the SNOLAB underground laboratory, with a total exposure of 211.5 kg days at four different energy thresholds below 10 keV. These data show that C3F8 provides excellent electron-recoil and alpha rejection capabilities at very low thresholds. The chamber exhibits an electron-recoil sensitivity of 98.2 %. These data also include the first observation of a dependence of acoustic signal on alpha energy. Twelve single nuclear recoil event candidates were observed during the run. The candidate events exhibit timing characteristics that are not consistent with the hypothesis of a uniform time distribution, and no evidence for a dark matter signal is claimed. These data provide the most sensitive direct detection constraints on WIMP-proton spin-dependent scattering to date, with significant sensitivity at low WIMP masses for spin-independent WIMP-nucleon scattering.

  14. Dark Matter Search Results from the PICO-2L C3F8 Bubble Chamber.

    Science.gov (United States)

    Amole, C; Ardid, M; Asner, D M; Baxter, D; Behnke, E; Bhattacharjee, P; Borsodi, H; Bou-Cabo, M; Brice, S J; Broemmelsiek, D; Clark, K; Collar, J I; Cooper, P S; Crisler, M; Dahl, C E; Daley, S; Das, M; Debris, F; Dhungana, N; Farine, J; Felis, I; Filgas, R; Fines-Neuschild, M; Girard, F; Giroux, G; Hai, M; Hall, J; Harris, O; Jackson, C M; Jin, M; Krauss, C B; Lafrenière, M; Laurin, M; Lawson, I; Levine, I; Lippincott, W H; Mann, E; Martin, J P; Maurya, D; Mitra, P; Neilson, R; Noble, A J; Plante, A; Podviianiuk, R B; Priya, S; Robinson, A E; Ruschman, M; Scallon, O; Seth, S; Sonnenschein, A; Starinski, N; Štekl, I; Vázquez-Jáuregui, E; Wells, J; Wichoski, U; Zacek, V; Zhang, J

    2015-06-12

    New data are reported from the operation of a 2 liter C3F8 bubble chamber in the SNOLAB underground laboratory, with a total exposure of 211.5 kg days at four different energy thresholds below 10 keV. These data show that C3F8 provides excellent electron-recoil and alpha rejection capabilities at very low thresholds. The chamber exhibits an electron-recoil sensitivity of 98.2%. These data also include the first observation of a dependence of acoustic signal on alpha energy. Twelve single nuclear recoil event candidates were observed during the run. The candidate events exhibit timing characteristics that are not consistent with the hypothesis of a uniform time distribution, and no evidence for a dark matter signal is claimed. These data provide the most sensitive direct detection constraints on WIMP-proton spin-dependent scattering to date, with significant sensitivity at low WIMP masses for spin-independent WIMP-nucleon scattering. PMID:26196790

  15. Stigmaphyllon patricianum-firmenichianum (Malpighiaceae), a new species from Loyalty Islands, New Caledonia

    OpenAIRE

    Butaud, Jean-François

    2015-01-01

    A new species of Stigmaphyllon (Malpighiaceae) is described: Stigmaphyllon patricianum-firmenichianum Butaud. It is restricted to the coral islands of Ouvéa, Lifou and Maré in the Loyalty Islands Province (New Caledonia) and is most similar to S. discolor (Gand.) C.E.Anderson, known from New Caledonia and Solomon Islands. Previously, plants now known as S. patricianum-firmenichianum were included in Stigmaphyllon taomense (Baker f.) C.E.Anderson, endemic to the northern part of Grande-Terre a...

  16. Direct determination of the NaF/AlF3 molar ratio by Raman spectroscopy in NaF-AlF3-CaF2 melts at 1000 °C.

    Science.gov (United States)

    Malherbe, Cedric; Gilbert, Bernard

    2013-09-17

    For the last 40 years, Raman spectroscopy has been very useful in investigating the structure of corrosive molten salts, such as the cryolite-based melts widely used as electrolyte in the Hall-Heroult process. Even if this process remains the most economically efficient for metallic aluminum electro-production, it suffers from a high energy loss, which is dependent on the melt composition. Therefore, controlling the chemical composition of the electrolyte is essential. The present paper proposes to apply Raman spectroscopy for the direct determination of the NaF-AlF3 molar ratio in NaF-AlF3-CaF2-based melts. Despite the experimental difficulties, a calibration curve based on equilibria taking place in the melt has been developed and the procedure has been successfully compared to industrial samples of known compositions. The possible exportation of the laboratory scale procedure to an industrial environment application for the control of the Hall-Heroult process is finally discussed. PMID:23988269

  17. Finite element modeling of AP1000 nuclear island

    International Nuclear Information System (INIS)

    The AP1000 is a standard design developed by Westinghouse and its partners for an advanced nuclear power plant utilizing passive safety features. It is based on the certified design of the AP600 and has been uprated to 1000 MWe. The plant has five principal building structures; the nuclear island, the turbine building; the annex building; the diesel generator building and the radwaste building. The nuclear island consists of the containment building (the steel containment vessel and the containment internal structures), the shield building, and the auxiliary building. These structures are founded on a common basemat and are collectively known as the nuclear island. This paper describes use of the general purpose finite element program ANSYS [2] in structural analyses and qualification of the AP1000 nuclear island buildings. It describes the modeling of the shield building and the auxiliary building and the series of analyses and the flow of information from the global analyses to the detailed analyses and building qualification. (author)

  18. Standardization of medfly trapping for use in sterile insect technique programmes: Assessment of various trap types on the island of Chios, Greece

    International Nuclear Information System (INIS)

    This paper contains information from a 5-year experimental programme, coordinated by the International Atomic Energy Agency (IAEA), on medfly (Ceratitis capitata, Diptera, Tephritidae) trapping. The experiments aimed at standardizing trapping methods for use in Sterile Insect Technique programmes under various climatic and other ecological conditions. They were conducted during the months July to September 1987-1991 on the island of Chios, Greece, in citrus orchards with low to medium medfly populations. Seven different trap types and several trap treatments consisting of combinations of visual and olfactory (food, sexual) attractants were tested in a research coordinated protocol. Additional trap types and treatments were also assessed in side experiments. Among the treatments tested the most effective in total captures was the International Pheromones plastic McPhail (yellow bottom) trap type (IPMT), baited with a 300 ml water solution containing the protein Nulure 9%, borax 5% and provided with a Trimedlure (TML) plug in a basket hung from the trap-ceiling. This treatment captured predominantly males and was relatively selective for medflies because apparently TML has repellent effects on non-target insects and in part, on medfly females. The same treatment without TML was almost as effective capturing predominantly females but also a large number of non-target insects, which renders its service difficult. The IPMT was as effective as the other McPhail trap versions tested, including the classical glass trap. 15 refs, 7 tabs, 1 fig

  19. Materials for advanced ultrasupercritical steam turbines

    Energy Technology Data Exchange (ETDEWEB)

    Purgert, Robert [Energy Industries Of Ohio Inc., Independence, OH (United States); Shingledecker, John [Energy Industries Of Ohio Inc., Independence, OH (United States); Saha, Deepak [Energy Industries Of Ohio Inc., Independence, OH (United States); Thangirala, Mani [Energy Industries Of Ohio Inc., Independence, OH (United States); Booras, George [Energy Industries Of Ohio Inc., Independence, OH (United States); Powers, John [Energy Industries Of Ohio Inc., Independence, OH (United States); Riley, Colin [Energy Industries Of Ohio Inc., Independence, OH (United States); Hendrix, Howard [Energy Industries Of Ohio Inc., Independence, OH (United States)

    2015-12-01

    The U.S. Department of Energy (DOE) and the Ohio Coal Development Office (OCDO) have sponsored a project aimed at identifying, evaluating, and qualifying the materials needed for the construction of the critical components of coal-fired power plants capable of operating at much higher efficiencies than the current generation of supercritical plants. This increased efficiency is expected to be achieved principally through the use of advanced ultrasupercritical (A-USC) steam conditions. A limiting factor in this can be the materials of construction for boilers and for steam turbines. The overall project goal is to assess/develop materials technology that will enable achieving turbine throttle steam conditions of 760°C (1400°F)/35MPa (5000 psi). This final technical report covers the research completed by the General Electric Company (GE) and Electric Power Research Institute (EPRI), with support from Oak Ridge National Laboratory (ORNL) and the National Energy Technology Laboratory (NETL) – Albany Research Center, to develop the A-USC steam turbine materials technology to meet the overall project goals. Specifically, this report summarizes the industrial scale-up and materials property database development for non-welded rotors (disc forgings), buckets (blades), bolting, castings (needed for casing and valve bodies), casting weld repair, and casting to pipe welding. Additionally, the report provides an engineering and economic assessment of an A-USC power plant without and with partial carbon capture and storage. This research project successfully demonstrated the materials technology at a sufficient scale and with corresponding materials property data to enable the design of an A-USC steam turbine. The key accomplishments included the development of a triple-melt and forged Haynes 282 disc for bolted rotor construction, long-term property development for Nimonic 105 for blading and bolting, successful scale-up of Haynes 282 and Nimonic 263 castings using

  20. Potential Hazards Relating to Pyrolysis of c-C4F8 in Selected Gaseous Diffusion Plant Operations

    International Nuclear Information System (INIS)

    As part of a program intended to replace the present evaporative coolant at the gaseous diffusion plants (GDPs) with a non-ozone-depleting alternate, a series of investigations of the suitability of candidate substitutes in under way. One issue concerning a primary candidate, c-C4F8, is the possibility that it might produce the highly toxic perfluoroisobutylene (PFIB) in high temperature environments. This study was commissioned to determine the likelihood and severity of decomposition under two specific high temperature thermal environments, namely the use of a flame test for the presence of coolant vapors and welding in the presence of coolant vapors. The purpose of the study was to develop and evaluate available data to provide information that will allow the technical and industrial hygiene staff at the GDPs to perform appropriate safety evaluations and to determine the need for field testing or experimental work. The scope of this study included a literature search and an evaluation of the information developed therefrom. Part of that evaluation consists of chemical kinetics modeling of coolant decomposition in the two operational environments. The general conclusions are that PFIB formation is unlikely in either situation but that it cannot be ruled out completely under extreme conditions. The presence of oxygen, moisture, and combustion products will tend to lead to formation of oxidation products (COF2, CO, CO2, and HF) rather than PFIB