WorldWideScience

Sample records for buds reveals links

  1. Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

    Directory of Open Access Journals (Sweden)

    Peter Hevezi

    Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

  2. Electron tomography reveals the steps in filovirus budding.

    Directory of Open Access Journals (Sweden)

    Sonja Welsch

    2010-04-01

    Full Text Available The filoviruses, Marburg and Ebola, are non-segmented negative-strand RNA viruses causing severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. The sequence of events that leads to release of filovirus particles from cells is poorly understood. Two contrasting mechanisms have been proposed, one proceeding via a "submarine-like" budding with the helical nucleocapsid emerging parallel to the plasma membrane, and the other via perpendicular "rocket-like" protrusion. Here we have infected cells with Marburg virus under BSL-4 containment conditions, and reconstructed the sequence of steps in the budding process in three dimensions using electron tomography of plastic-embedded cells. We find that highly infectious filamentous particles are released at early stages in infection. Budding proceeds via lateral association of intracellular nucleocapsid along its whole length with the plasma membrane, followed by rapid envelopment initiated at one end of the nucleocapsid, leading to a protruding intermediate. Scission results in local membrane instability at the rear of the virus. After prolonged infection, increased vesiculation of the plasma membrane correlates with changes in shape and infectivity of released viruses. Our observations demonstrate a cellular determinant of virus shape. They reconcile the contrasting models of filovirus budding and allow us to describe the sequence of events taking place during budding and release of Marburg virus. We propose that this represents a general sequence of events also followed by other filamentous and rod-shaped viruses.

  3. Trichomes control flower bud shape by linking together young petals.

    Science.gov (United States)

    Tan, Jiafu; Walford, Sally-Anne; Dennis, Elizabeth S; Llewellyn, Danny

    2016-01-01

    Trichomes are widespread in plants and develop from surface cells on different tissues(1). They have many forms and functions, from defensive spines to physical barriers that trap layers of air to insulate against desiccation, but there is growing evidence that trichomes can also have developmental roles in regulating flower structure(2,3). We report here that the trichomes on petals of cotton, Gossypium hirsutum L., are essential for correct flower bud shape through a mechanical entanglement of the trichomes on adjacent petals that anchor the edges to counter the opposing force generated by asymmetric expansion of overlapping petals. Silencing a master regulator of petal trichomes, GhMYB-MIXTA-Like10 (GhMYBML10), by RNA interference (RNAi) suppressed petal trichome growth and resulted in flower buds forming into abnormal corkscrew shapes that exposed developing anthers and stigmas to desiccation damage. Artificially gluing petal edges together could partially restore correct bud shape and fertility. Such petal 'Velcro' is present in other Malvaceae and perhaps more broadly in other plant families, although it is not ubiquitous. This mechanism for physical association between separate organs to regulate flower shape and function is different from the usual organ shape control(4) exerted through cell-to-cell communication and differential cell expansion within floral tissues(5,6). PMID:27322517

  4. A Fate Map of the Murine Pancreas Buds Reveals a Multipotent Ventral Foregut Organ Progenitor

    OpenAIRE

    Angelo, Jesse R.; Guerrero-Zayas, Mara-Isel; Tremblay, Kimberly D.

    2012-01-01

    The definitive endoderm is the embryonic germ layer that gives rise to the budding endodermal organs including the thyroid, lung, liver and pancreas as well as the remainder of the gut tube. DiI fate mapping and whole embryo culture were used to determine the endodermal origin of the 9.5 days post coitum (dpc) dorsal and ventral pancreas buds. Our results demonstrate that the progenitors of each bud occupy distinct endodermal territories. Dorsal bud progenitors are located in the medial endod...

  5. Screening the Budding Yeast Genome Reveals Unique Factors Affecting K2 Toxin Susceptibility

    OpenAIRE

    Elena Servienė; Juliana Lukša; Irma Orentaitė; Lafontaine, Denis L. J.; Jaunius Urbonavičius

    2012-01-01

    BACKGROUND: Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae) killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion...

  6. Screening the budding yeast genome reveals unique factors affecting K2 toxin susceptibility.

    Directory of Open Access Journals (Sweden)

    Elena Servienė

    Full Text Available BACKGROUND: Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion leakage. K28 toxin is active in the cell nucleus, blocking DNA synthesis and cell cycle progression, thereby triggering apoptosis. Genome-wide screens in the budding yeast S. cerevisiae identified several hundred effectors of K1 and K28 toxins. Surprisingly, no such screen had been performed for K2 toxin, the most frequent killer toxin among industrial budding yeasts. PRINCIPAL FINDINGS: We conducted several concurrent genome-wide screens in S. cerevisiae and identified 332 novel K2 toxin effectors. The effectors involved in K2 resistance and hypersensitivity largely map in distinct cellular pathways, including cell wall and plasma membrane structure/biogenesis and mitochondrial function for K2 resistance, and cell wall stress signaling and ion/pH homeostasis for K2 hypersensitivity. 70% of K2 effectors are different from those involved in K1 or K28 susceptibility. SIGNIFICANCE: Our work demonstrates that despite the fact that K1 and K2 toxins share some aspects of their killing strategies, they largely rely on different sets of effectors. Since the vast majority of the host factors identified here is exclusively active towards K2, we conclude that cells have acquired a specific K2 toxin effectors set. Our work thus indicates that K1 and K2 have elaborated different biological pathways and provides a first step towards the detailed characterization of K2 mode of action.

  7. Visual screening for localized RNAs in yeast revealed novel RNAs at the bud-tip

    International Nuclear Information System (INIS)

    Several RNAs, including rRNAs, snRNAs, snoRNAs, and some mRNAs, are known to be localized at specific sites in a cell. Although methods have been established to visualize RNAs in a living cell, no large-scale visual screening of localized RNAs has been performed. In this study, we constructed a genomic library in which random genomic fragments were inserted downstream of U1A-tag sequences under a GAL1 promoter. In a living yeast cell, transcribed U1A-tagged RNAs were visualized by U1A-GFP that binds the RNA sequence of the U1A-tag. In this screening, many RNAs showed nuclear signals. Since the nuclear signals of some RNAs were not seen when the U1A-tag was connected to the 3' ends of the RNAs, it is suggested that their nuclear signals correspond to nascent transcripts on GAL1 promoter plasmids. Using this screening method, we successfully identified two novel localized mRNAs, CSR2 and DAL81, which showed bud-tip localization

  8. Comparative live-cell imaging analyses of SPA-2, BUD-6 and BNI-1 in Neurospora crassa reveal novel features of the filamentous fungal polarisome.

    Directory of Open Access Journals (Sweden)

    Alexander Lichius

    Full Text Available A key multiprotein complex involved in regulating the actin cytoskeleton and secretory machinery required for polarized growth in fungi, is the polarisome. Recognized core constituents in budding yeast are the proteins Spa2, Pea2, Aip3/Bud6, and the key effector Bni1. Multicellular fungi display a more complex polarized morphogenesis than yeasts, suggesting that the filamentous fungal polarisome might fulfill additional functions. In this study, we compared the subcellular organization and dynamics of the putative polarisome components BUD-6 and BNI-1 with those of the bona fide polarisome marker SPA-2 at various developmental stages of Neurospora crassa. All three proteins exhibited a yeast-like polarisome configuration during polarized germ tube growth, cell fusion, septal pore plugging and tip repolarization. However, the localization patterns of all three proteins showed spatiotemporally distinct characteristics during the establishment of new polar axes, septum formation and cytokinesis, and maintained hyphal tip growth. Most notably, in vegetative hyphal tips BUD-6 accumulated as a subapical cloud excluded from the Spitzenkörper (Spk, whereas BNI-1 and SPA-2 partially colocalized with the Spk and the tip apex. Novel roles during septal plugging and cytokinesis, connected to the reinitiation of tip growth upon physical injury and conidial maturation, were identified for BUD-6 and BNI-1, respectively. Phenotypic analyses of gene deletion mutants revealed additional functions for BUD-6 and BNI-1 in cell fusion regulation, and the maintenance of Spk integrity. Considered together, our findings reveal novel polarisome-independent functions of BUD-6 and BNI-1 in Neurospora, but also suggest that all three proteins cooperate at plugged septal pores, and their complex arrangement within the apical dome of mature hypha might represent a novel aspect of filamentous fungal polarisome architecture.

  9. Role of epithelial mesenchymal transition (EMT in pancreatic ductal adenocarcinoma (PDAC: is tumor budding the missing link?

    Directory of Open Access Journals (Sweden)

    EvaKaramitopoulou

    2013-09-01

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC ranks as the fourth commonest cause of cancer death while its incidence is increasing worldwide. For all stages, survival at 5 years is <5%. The lethal nature of pancreatic cancer is attributed to its high metastatic potential to the lymphatic system and distant organs. Lack of effective therapeutic options contributes to the high mortality rates of PDAC. Recent evidence suggests that epithelial-mesenchymal transition (EMT plays an important role to the disease progression and development of drug resistance in PDAC. Tumor budding is thought to reflect the process of epithelial-mesenchymal transition (EMT which allows neoplastic epithelial cells to acquire a mesenchymal phenotype thus increasing their capacity for migration and invasion and help them become resistant to apoptotic signals. In a recent study by our own group the presence and prognostic significance of tumor budding in PDAC were investigated and an association between high-grade budding and aggressive clinicopathological features of the tumors as well as worse outcome of the patients was found. The identification of EMT phenotypic targets may help identifying new molecules so that future therapeutic strategies directed specifically against them could potentially have an impact on drug resistance and invasiveness and hence improve the prognosis of PDAC patients. The aim of this short review is to present an insight on the morphological and molecular aspects of EMT and on the factors that are involved in the induction of EMT in PDAC.

  10. A Geometrically-Constrained Mathematical Model of Mammary Gland Ductal Elongation Reveals Novel Cellular Dynamics within the Terminal End Bud.

    Directory of Open Access Journals (Sweden)

    Ingrid Paine

    2016-04-01

    Full Text Available Mathematics is often used to model biological systems. In mammary gland development, mathematical modeling has been limited to acinar and branching morphogenesis and breast cancer, without reference to normal duct formation. We present a model of ductal elongation that exploits the geometrically-constrained shape of the terminal end bud (TEB, the growing tip of the duct, and incorporates morphometrics, region-specific proliferation and apoptosis rates. Iterative model refinement and behavior analysis, compared with biological data, indicated that the traditional metric of nipple to the ductal front distance, or percent fat pad filled to evaluate ductal elongation rate can be misleading, as it disregards branching events that can reduce its magnitude. Further, model driven investigations of the fates of specific TEB cell types confirmed migration of cap cells into the body cell layer, but showed their subsequent preferential elimination by apoptosis, thus minimizing their contribution to the luminal lineage and the mature duct.

  11. A Geometrically-Constrained Mathematical Model of Mammary Gland Ductal Elongation Reveals Novel Cellular Dynamics within the Terminal End Bud

    Science.gov (United States)

    Chauviere, Arnaud; Landua, John; Sreekumar, Amulya; Cristini, Vittorio; Rosen, Jeffrey; Lewis, Michael T.

    2016-01-01

    Mathematics is often used to model biological systems. In mammary gland development, mathematical modeling has been limited to acinar and branching morphogenesis and breast cancer, without reference to normal duct formation. We present a model of ductal elongation that exploits the geometrically-constrained shape of the terminal end bud (TEB), the growing tip of the duct, and incorporates morphometrics, region-specific proliferation and apoptosis rates. Iterative model refinement and behavior analysis, compared with biological data, indicated that the traditional metric of nipple to the ductal front distance, or percent fat pad filled to evaluate ductal elongation rate can be misleading, as it disregards branching events that can reduce its magnitude. Further, model driven investigations of the fates of specific TEB cell types confirmed migration of cap cells into the body cell layer, but showed their subsequent preferential elimination by apoptosis, thus minimizing their contribution to the luminal lineage and the mature duct. PMID:27115287

  12. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.

    Science.gov (United States)

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  13. Integrative modelling reveals mechanisms linking productivity and plant species richness

    Science.gov (United States)

    Grace, James B.; Anderson, T. Michael; Seabloom, Eric W.; Borer, Elizabeth T.; Adler, Peter B.; Harpole, W. Stanley; Hautier, Yann; Hillebrand, Helmut; Lind, Eric M.; Pärtel, Meelis; Bakker, Jonathan D.; Buckley, Yvonne M.; Crawley, Michael J.; Damschen, Ellen I.; Davies, Kendi F.; Fay, Philip A.; Firn, Jennifer; Gruner, Daniel S.; Hector, Andy; Knops, Johannes M. H.; MacDougall, Andrew S.; Melbourne, Brett A.; Morgan, John W.; Orrock, John L.; Prober, Suzanne M.; Smith, Melinda D.

    2016-01-01

    How ecosystem productivity and species richness are interrelated is one of the most debated subjects in the history of ecology. Decades of intensive study have yet to discern the actual mechanisms behind observed global patterns. Here, by integrating the predictions from multiple theories into a single model and using data from 1,126 grassland plots spanning five continents, we detect the clear signals of numerous underlying mechanisms linking productivity and richness. We find that an integrative model has substantially higher explanatory power than traditional bivariate analyses. In addition, the specific results unveil several surprising findings that conflict with classical models. These include the isolation of a strong and consistent enhancement of productivity by richness, an effect in striking contrast with superficial data patterns. Also revealed is a consistent importance of competition across the full range of productivity values, in direct conflict with some (but not all) proposed models. The promotion of local richness by macroecological gradients in climatic favourability, generally seen as a competing hypothesis, is also found to be important in our analysis. The results demonstrate that an integrative modelling approach leads to a major advance in our ability to discern the underlying processes operating in ecological systems.

  14. Cliques in complex networks reveal link formation and community evolution

    OpenAIRE

    Liu, Zhen; He, Jia-Lin; Srivastava, Jaideep

    2013-01-01

    Missing link prediction in indirected and un-weighted network is an open and challenge problem which has been studied intensively in recent years. In this paper, we studied the relationships between community structure and link formation and proposed a Fast Block probabilistic Model(FBM). In accordance with the experiments on four real world networks, we have yielded very good accuracy of missing link prediction and huge improvement in computing efficiency compared to conventional methods. By...

  15. "Missing Link" Revealing Fast-Spinning Pulsar Mysteries

    Science.gov (United States)

    2009-05-01

    telescope during a large sky survey in 1998, and had been observed in visible light by the Sloan Digital Sky Survey in 1999, revealing a Sun-like star. When observed again in 2000, the object had changed dramatically, showing evidence for a rotating disk of material, called an accretion disk, surrounding the neutron star. By May of 2002, the evidence for this disk had disappeared. "This strange behavior puzzled astronomers, and there were several different theories for what the object could be," said Ingrid Stairs of the University of British Columbia, who has been visiting the Australia Telescope National Facility and Swinburne University this year. The 2007 GBT observations showed that the object is a millisecond pulsar, spinning 592 times per second. "No other millisecond pulsar has ever shown evidence for an accretion disk," Archibald said. "We know that another type of binary-star system, called a low-mass X-ray binary (LMXB), also contains a fast-spinning neutron star and an accretion disk, but these don't emit radio waves. We've thought that LMXBs probably are in the process of getting spun up, and will later emit radio waves as a pulsar. This object appears to be the 'missing link' connecting the two types of systems," she explained. "It appears this thing has flipped from looking like an LMXB to looking like a pulsar, as it experienced an episode during which material pulled from the companion star formed an accretion disk around the neutron star. Later, that mass transfer stopped, the disk disappeared, and the pulsar emerged," said Scott Ransom of the NRAO. The scientists have studied J1023 in detail with the GBT, with the Westerbork radio telescope in the Netherlands, with the Arecibo radio telescope in Puerto Rico, and with the Parkes radio telescope in Australia. Their results indicate that the neutron star's companion has less than half the Sun's mass, and orbits the neutron star once every four hours and 45 minutes. "This system gives us an unparalled 'cosmic

  16. Bud Dormancy and Growth

    Science.gov (United States)

    Nearly all land plants produce ancillary meristems in the form of axillary or adventitious buds in addition to the shoot apical meristem. Outgrowth of these buds has a significant impact on plant architecture and the ability of plants to compete with neighboring plants, as well as to respond to and ...

  17. Reactivation from latency displays HIV particle budding at plasma membrane, accompanying CD44 upregulation and recruitment

    Directory of Open Access Journals (Sweden)

    Sano Kouichi

    2009-07-01

    Full Text Available Abstract Background It has been accepted that HIV buds from the cell surface in T lymphocytes, whereas in macrophages it buds into intracellular endosomes. Recent studies, on the other hand, suggest that HIV preferentially buds from the cell surface even in monocytic cells. However, most studies are based on observations in acutely infected cells and little is known about HIV budding concomitant with reactivation from latency. Such studies would provide a better understanding of a reservoir for HIV. Results We observed HIV budding in latently infected T lymphocytic and monocytic cell lines following TNF-α stimulation and examined the upregulation of host factors that may be involved in particle production. Electron microscopy analysis revealed that reactivation of latently infected J1.1 cells (latently infected Jurkat cells with HIV-1 and U1 cells (latently infected U937 cells with HIV-1 displayed HIV particle budding predominantly at the plasma membrane, a morphology that is similar to particle budding in acutely infected Jurkat and U937 cells. When mRNA expression levels were quantified by qRT-PCR, we found that particle production from reactivated J1.1 and U1 cells was accompanied by CD44 upregulation. This upregulation was similarly observed when Jurkat and U937 cells were acutely infected with HIV-1 but not when just stimulated with TNF-α, suggesting that CD44 upregulation was linked with HIV production but not with cell stimulation. The molecules in endocytic pathways such as CD63 and HRS were also upregulated when U1 cells were reactivated and U937 cells were acutely infected with HIV-1. Confocal microscopy revealed that these upregulated host molecules were recruited to and accumulated at the sites where mature particles were formed at the plasma membrane. Conclusion Our study indicates that HIV particles are budded at the plasma membrane upon reactivation from latency, a morphology that is similar to particle budding in acute

  18. New loci for body fat percentage reveal link between adiposity and cardiometabolic disease risk

    DEFF Research Database (Denmark)

    Lu, Yingchang; Day, Felix R; Gustafsson, Stefan;

    2016-01-01

    To increase our understanding of the genetic basis of adiposity and its links to cardiometabolic disease risk, we conducted a genome-wide association meta-analysis of body fat percentage (BF%) in up to 100,716 individuals. Twelve loci reached genome-wide significance (P<5 × 10(-8)), of which eight...... effects on BMI than on BF%, suggesting association with both fat and lean mass. In particular, the loci more strongly associated with BF% showed distinct cross-phenotype association signatures with a range of cardiometabolic traits revealing new insights in the link between adiposity and disease risk....

  19. In vitro inhibition activity of polyphenol-rich extracts from Syzygium aromaticum (L.) Merr. & Perry (Clove) buds against carbohydrate hydrolyzing enzymes linked to type 2 diabetes and Fe2+-induced lipid peroxidation in rat pancreas

    Institute of Scientific and Technical Information of China (English)

    Stephen Adeniyi Adefegha; Ganiyu Oboh

    2012-01-01

    To investigate and compare the inhibitory properties of free and bound phenolic extracts of clove bud against carbohydrate hydrolyzing enzymes (alpha-amylase & alpha-glucosidase) and Fe2+-induced lipid peroxidation in rat pancreas in vitro. Methods: The free phenolics were extracted with 80% (v/v) acetone, while bound phenolics were extracted from the alkaline and acid hydrolyzed residue with ethyl acetate. Then, the interaction of the extracts with alpha-amylase and alpha-glucosidase was subsequently assessed. Thereafter, the total phenolic contents and antioxidant activities of the extracts were determined. Results: The result revealed that both extracts inhibited alpha-amylase and alpha-glucosidase in a dose-dependent manner. However, the alpha-glucosidase inhibitory activity of the extracts were significantly (P<0.05) higher than their alpha-amylase inhibitory activity. The free phenolics (31.67 mg/g) and flavonoid (17.28 mg/g) contents were significantly (P<0.05) higher than bound phenolic (23.52 mg/g) and flavonoid (13.70 mg/g) contents. Both extracts also exhibited high antioxidant activities as typified by their high reducing power, 1,1 diphenyl-2- picrylhydrazyl (DPPH) and 2, 2-azinobis-3-ethylbenzo-thiazoline-6-sulfonate (ABTS) radical scavenging abilities, as well as inhibition of Fe2+-induced lipid peroxidation in rat pancreas in vitro. Conclusions: This study provides a biochemical rationale by which clove elicits therapeutic effect on type 2 diabetes.

  20. New loci for body fat percentage reveal link between adiposity and cardiometabolic disease risk.

    Science.gov (United States)

    Lu, Yingchang; Day, Felix R; Gustafsson, Stefan; Buchkovich, Martin L; Na, Jianbo; Bataille, Veronique; Cousminer, Diana L; Dastani, Zari; Drong, Alexander W; Esko, Tõnu; Evans, David M; Falchi, Mario; Feitosa, Mary F; Ferreira, Teresa; Hedman, Åsa K; Haring, Robin; Hysi, Pirro G; Iles, Mark M; Justice, Anne E; Kanoni, Stavroula; Lagou, Vasiliki; Li, Rui; Li, Xin; Locke, Adam; Lu, Chen; Mägi, Reedik; Perry, John R B; Pers, Tune H; Qi, Qibin; Sanna, Marianna; Schmidt, Ellen M; Scott, William R; Shungin, Dmitry; Teumer, Alexander; Vinkhuyzen, Anna A E; Walker, Ryan W; Westra, Harm-Jan; Zhang, Mingfeng; Zhang, Weihua; Zhao, Jing Hua; Zhu, Zhihong; Afzal, Uzma; Ahluwalia, Tarunveer Singh; Bakker, Stephan J L; Bellis, Claire; Bonnefond, Amélie; Borodulin, Katja; Buchman, Aron S; Cederholm, Tommy; Choh, Audrey C; Choi, Hyung Jin; Curran, Joanne E; de Groot, Lisette C P G M; De Jager, Philip L; Dhonukshe-Rutten, Rosalie A M; Enneman, Anke W; Eury, Elodie; Evans, Daniel S; Forsen, Tom; Friedrich, Nele; Fumeron, Frédéric; Garcia, Melissa E; Gärtner, Simone; Han, Bok-Ghee; Havulinna, Aki S; Hayward, Caroline; Hernandez, Dena; Hillege, Hans; Ittermann, Till; Kent, Jack W; Kolcic, Ivana; Laatikainen, Tiina; Lahti, Jari; Mateo Leach, Irene; Lee, Christine G; Lee, Jong-Young; Liu, Tian; Liu, Youfang; Lobbens, Stéphane; Loh, Marie; Lyytikäinen, Leo-Pekka; Medina-Gomez, Carolina; Michaëlsson, Karl; Nalls, Mike A; Nielson, Carrie M; Oozageer, Laticia; Pascoe, Laura; Paternoster, Lavinia; Polašek, Ozren; Ripatti, Samuli; Sarzynski, Mark A; Shin, Chan Soo; Narančić, Nina Smolej; Spira, Dominik; Srikanth, Priya; Steinhagen-Thiessen, Elisabeth; Sung, Yun Ju; Swart, Karin M A; Taittonen, Leena; Tanaka, Toshiko; Tikkanen, Emmi; van der Velde, Nathalie; van Schoor, Natasja M; Verweij, Niek; Wright, Alan F; Yu, Lei; Zmuda, Joseph M; Eklund, Niina; Forrester, Terrence; Grarup, Niels; Jackson, Anne U; Kristiansson, Kati; Kuulasmaa, Teemu; Kuusisto, Johanna; Lichtner, Peter; Luan, Jian'an; Mahajan, Anubha; Männistö, Satu; Palmer, Cameron D; Ried, Janina S; Scott, Robert A; Stancáková, Alena; Wagner, Peter J; Demirkan, Ayse; Döring, Angela; Gudnason, Vilmundur; Kiel, Douglas P; Kühnel, Brigitte; Mangino, Massimo; Mcknight, Barbara; Menni, Cristina; O'Connell, Jeffrey R; Oostra, Ben A; Shuldiner, Alan R; Song, Kijoung; Vandenput, Liesbeth; van Duijn, Cornelia M; Vollenweider, Peter; White, Charles C; Boehnke, Michael; Boettcher, Yvonne; Cooper, Richard S; Forouhi, Nita G; Gieger, Christian; Grallert, Harald; Hingorani, Aroon; Jørgensen, Torben; Jousilahti, Pekka; Kivimaki, Mika; Kumari, Meena; Laakso, Markku; Langenberg, Claudia; Linneberg, Allan; Luke, Amy; Mckenzie, Colin A; Palotie, Aarno; Pedersen, Oluf; Peters, Annette; Strauch, Konstantin; Tayo, Bamidele O; Wareham, Nicholas J; Bennett, David A; Bertram, Lars; Blangero, John; Blüher, Matthias; Bouchard, Claude; Campbell, Harry; Cho, Nam H; Cummings, Steven R; Czerwinski, Stefan A; Demuth, Ilja; Eckardt, Rahel; Eriksson, Johan G; Ferrucci, Luigi; Franco, Oscar H; Froguel, Philippe; Gansevoort, Ron T; Hansen, Torben; Harris, Tamara B; Hastie, Nicholas; Heliövaara, Markku; Hofman, Albert; Jordan, Joanne M; Jula, Antti; Kähönen, Mika; Kajantie, Eero; Knekt, Paul B; Koskinen, Seppo; Kovacs, Peter; Lehtimäki, Terho; Lind, Lars; Liu, Yongmei; Orwoll, Eric S; Osmond, Clive; Perola, Markus; Pérusse, Louis; Raitakari, Olli T; Rankinen, Tuomo; Rao, D C; Rice, Treva K; Rivadeneira, Fernando; Rudan, Igor; Salomaa, Veikko; Sørensen, Thorkild I A; Stumvoll, Michael; Tönjes, Anke; Towne, Bradford; Tranah, Gregory J; Tremblay, Angelo; Uitterlinden, André G; van der Harst, Pim; Vartiainen, Erkki; Viikari, Jorma S; Vitart, Veronique; Vohl, Marie-Claude; Völzke, Henry; Walker, Mark; Wallaschofski, Henri; Wild, Sarah; Wilson, James F; Yengo, Loïc; Bishop, D Timothy; Borecki, Ingrid B; Chambers, John C; Cupples, L Adrienne; Dehghan, Abbas; Deloukas, Panos; Fatemifar, Ghazaleh; Fox, Caroline; Furey, Terrence S; Franke, Lude; Han, Jiali; Hunter, David J; Karjalainen, Juha; Karpe, Fredrik; Kaplan, Robert C; Kooner, Jaspal S; McCarthy, Mark I; Murabito, Joanne M; Morris, Andrew P; Bishop, Julia A N; North, Kari E; Ohlsson, Claes; Ong, Ken K; Prokopenko, Inga; Richards, J Brent; Schadt, Eric E; Spector, Tim D; Widén, Elisabeth; Willer, Cristen J; Yang, Jian; Ingelsson, Erik; Mohlke, Karen L; Hirschhorn, Joel N; Pospisilik, John Andrew; Zillikens, M Carola; Lindgren, Cecilia; Kilpeläinen, Tuomas Oskari; Loos, Ruth J F

    2016-01-01

    To increase our understanding of the genetic basis of adiposity and its links to cardiometabolic disease risk, we conducted a genome-wide association meta-analysis of body fat percentage (BF%) in up to 100,716 individuals. Twelve loci reached genome-wide significance (P<5 × 10(-8)), of which eight were previously associated with increased overall adiposity (BMI, BF%) and four (in or near COBLL1/GRB14, IGF2BP1, PLA2G6, CRTC1) were novel associations with BF%. Seven loci showed a larger effect on BF% than on BMI, suggestive of a primary association with adiposity, while five loci showed larger effects on BMI than on BF%, suggesting association with both fat and lean mass. In particular, the loci more strongly associated with BF% showed distinct cross-phenotype association signatures with a range of cardiometabolic traits revealing new insights in the link between adiposity and disease risk. PMID:26833246

  1. New loci for body fat percentage reveal link between adiposity and cardiometabolic disease risk

    Science.gov (United States)

    Lu, Yingchang; Day, Felix R.; Gustafsson, Stefan; Buchkovich, Martin L.; Na, Jianbo; Bataille, Veronique; Cousminer, Diana L.; Dastani, Zari; Drong, Alexander W.; Esko, Tõnu; Evans, David M.; Falchi, Mario; Feitosa, Mary F.; Ferreira, Teresa; Hedman, Åsa K.; Haring, Robin; Hysi, Pirro G.; Iles, Mark M.; Justice, Anne E.; Kanoni, Stavroula; Lagou, Vasiliki; Li, Rui; Li, Xin; Locke, Adam; Lu, Chen; Mägi, Reedik; Perry, John R. B.; Pers, Tune H.; Qi, Qibin; Sanna, Marianna; Schmidt, Ellen M.; Scott, William R.; Shungin, Dmitry; Teumer, Alexander; Vinkhuyzen, Anna A. E.; Walker, Ryan W.; Westra, Harm-Jan; Zhang, Mingfeng; Zhang, Weihua; Zhao, Jing Hua; Zhu, Zhihong; Afzal, Uzma; Ahluwalia, Tarunveer Singh; Bakker, Stephan J. L.; Bellis, Claire; Bonnefond, Amélie; Borodulin, Katja; Buchman, Aron S.; Cederholm, Tommy; Choh, Audrey C.; Choi, Hyung Jin; Curran, Joanne E.; de Groot, Lisette C. P. G. M.; De Jager, Philip L.; Dhonukshe-Rutten, Rosalie A. M.; Enneman, Anke W.; Eury, Elodie; Evans, Daniel S.; Forsen, Tom; Friedrich, Nele; Fumeron, Frédéric; Garcia, Melissa E.; Gärtner, Simone; Han, Bok-Ghee; Havulinna, Aki S.; Hayward, Caroline; Hernandez, Dena; Hillege, Hans; Ittermann, Till; Kent, Jack W.; Kolcic, Ivana; Laatikainen, Tiina; Lahti, Jari; Leach, Irene Mateo; Lee, Christine G.; Lee, Jong-Young; Liu, Tian; Liu, Youfang; Lobbens, Stéphane; Loh, Marie; Lyytikäinen, Leo-Pekka; Medina-Gomez, Carolina; Michaëlsson, Karl; Nalls, Mike A.; Nielson, Carrie M.; Oozageer, Laticia; Pascoe, Laura; Paternoster, Lavinia; Polašek, Ozren; Ripatti, Samuli; Sarzynski, Mark A.; Shin, Chan Soo; Narančić, Nina Smolej; Spira, Dominik; Srikanth, Priya; Steinhagen-Thiessen, Elisabeth; Sung, Yun Ju; Swart, Karin M. A.; Taittonen, Leena; Tanaka, Toshiko; Tikkanen, Emmi; van der Velde, Nathalie; van Schoor, Natasja M.; Verweij, Niek; Wright, Alan F.; Yu, Lei; Zmuda, Joseph M.; Eklund, Niina; Forrester, Terrence; Grarup, Niels; Jackson, Anne U.; Kristiansson, Kati; Kuulasmaa, Teemu; Kuusisto, Johanna; Lichtner, Peter; Luan, Jian'an; Mahajan, Anubha; Männistö, Satu; Palmer, Cameron D.; Ried, Janina S.; Scott, Robert A.; Stancáková, Alena; Wagner, Peter J.; Demirkan, Ayse; Döring, Angela; Gudnason, Vilmundur; Kiel, Douglas P.; Kühnel, Brigitte; Mangino, Massimo; Mcknight, Barbara; Menni, Cristina; O'Connell, Jeffrey R.; Oostra, Ben A.; Shuldiner, Alan R.; Song, Kijoung; Vandenput, Liesbeth; van Duijn, Cornelia M.; Vollenweider, Peter; White, Charles C.; Boehnke, Michael; Boettcher, Yvonne; Cooper, Richard S.; Forouhi, Nita G.; Gieger, Christian; Grallert, Harald; Hingorani, Aroon; Jørgensen, Torben; Jousilahti, Pekka; Kivimaki, Mika; Kumari, Meena; Laakso, Markku; Langenberg, Claudia; Linneberg, Allan; Luke, Amy; Mckenzie, Colin A.; Palotie, Aarno; Pedersen, Oluf; Peters, Annette; Strauch, Konstantin; Tayo, Bamidele O.; Wareham, Nicholas J.; Bennett, David A.; Bertram, Lars; Blangero, John; Blüher, Matthias; Bouchard, Claude; Campbell, Harry; Cho, Nam H.; Cummings, Steven R.; Czerwinski, Stefan A.; Demuth, Ilja; Eckardt, Rahel; Eriksson, Johan G.; Ferrucci, Luigi; Franco, Oscar H.; Froguel, Philippe; Gansevoort, Ron T.; Hansen, Torben; Harris, Tamara B.; Hastie, Nicholas; Heliövaara, Markku; Hofman, Albert; Jordan, Joanne M.; Jula, Antti; Kähönen, Mika; Kajantie, Eero; Knekt, Paul B.; Koskinen, Seppo; Kovacs, Peter; Lehtimäki, Terho; Lind, Lars; Liu, Yongmei; Orwoll, Eric S.; Osmond, Clive; Perola, Markus; Pérusse, Louis; Raitakari, Olli T.; Rankinen, Tuomo; Rao, D. C.; Rice, Treva K.; Rivadeneira, Fernando; Rudan, Igor; Salomaa, Veikko; Sørensen, Thorkild I. A.; Stumvoll, Michael; Tönjes, Anke; Towne, Bradford; Tranah, Gregory J.; Tremblay, Angelo; Uitterlinden, André G.; van der Harst, Pim; Vartiainen, Erkki; Viikari, Jorma S.; Vitart, Veronique; Vohl, Marie-Claude; Völzke, Henry; Walker, Mark; Wallaschofski, Henri; Wild, Sarah; Wilson, James F.; Yengo, Loïc; Bishop, D. Timothy; Borecki, Ingrid B.; Chambers, John C.; Cupples, L. Adrienne; Dehghan, Abbas; Deloukas, Panos; Fatemifar, Ghazaleh; Fox, Caroline; Furey, Terrence S.; Franke, Lude; Han, Jiali; Hunter, David J.; Karjalainen, Juha; Karpe, Fredrik; Kaplan, Robert C.; Kooner, Jaspal S.; McCarthy, Mark I.; Murabito, Joanne M.; Morris, Andrew P.; Bishop, Julia A. N.; North, Kari E.; Ohlsson, Claes; Ong, Ken K.; Prokopenko, Inga; Richards, J. Brent; Schadt, Eric E.; Spector, Tim D.; Widén, Elisabeth; Willer, Cristen J.; Yang, Jian; Ingelsson, Erik; Mohlke, Karen L.; Hirschhorn, Joel N.; Pospisilik, John Andrew; Zillikens, M. Carola; Lindgren, Cecilia

    2016-01-01

    To increase our understanding of the genetic basis of adiposity and its links to cardiometabolic disease risk, we conducted a genome-wide association meta-analysis of body fat percentage (BF%) in up to 100,716 individuals. Twelve loci reached genome-wide significance (P<5 × 10−8), of which eight were previously associated with increased overall adiposity (BMI, BF%) and four (in or near COBLL1/GRB14, IGF2BP1, PLA2G6, CRTC1) were novel associations with BF%. Seven loci showed a larger effect on BF% than on BMI, suggestive of a primary association with adiposity, while five loci showed larger effects on BMI than on BF%, suggesting association with both fat and lean mass. In particular, the loci more strongly associated with BF% showed distinct cross-phenotype association signatures with a range of cardiometabolic traits revealing new insights in the link between adiposity and disease risk. PMID:26833246

  2. Individual Apostichopus japonicus fecal microbiome reveals a link with polyhydroxybutyrate producers in host growth gaps.

    Science.gov (United States)

    Yamazaki, Yohei; Meirelles, Pedro Milet; Mino, Sayaka; Suda, Wataru; Oshima, Kenshiro; Hattori, Masahira; Thompson, Fabiano L; Sakai, Yuichi; Sawabe, Toko; Sawabe, Tomoo

    2016-01-01

    Gut microbiome shapes various aspects of a host's physiology, but these functions in aquatic animal hosts have yet to be fully investigated. The sea cucumber Apostichopus japonicus Selenka is one such example. The large growth gap in their body size has delayed the development of intensive aquaculture, nevertheless the species is in urgent need of conservation. To understand possible contributions of the gut microbiome to its host's growth, individual fecal microbiome comparisons were performed. High-throughput 16S rRNA sequencing revealed significantly different microbiota in larger and smaller individuals; Rhodobacterales in particular was the most significantly abundant bacterial group in the larger specimens. Further shotgun metagenome of representative samples revealed a significant abundance of microbiome retaining polyhydroxybutyrate (PHB) metabolism genes in the largest individual. The PHB metabolism reads were potentially derived from Rhodobacterales. These results imply a possible link between microbial PHB producers and potential growth promotion in Deuterostomia marine invertebrates. PMID:26905381

  3. A chemical screen for biological small molecule-RNA conjugates reveals CoA-linked RNA.

    Science.gov (United States)

    Kowtoniuk, Walter E; Shen, Yinghua; Heemstra, Jennifer M; Agarwal, Isha; Liu, David R

    2009-05-12

    Compared with the rapidly expanding set of known biological roles for RNA, the known chemical diversity of cellular RNA has remained limited primarily to canonical RNA, 3'-aminoacylated tRNAs, nucleobase-modified RNAs, and 5'-capped mRNAs in eukaryotes. We developed two methods to detect in a broad manner chemically labile cellular small molecule-RNA conjugates. The methods were validated by the detection of known tRNA and rRNA modifications. The first method analyzes small molecules cleaved from RNA by base or nucleophile treatment. Application to Escherichia coli and Streptomyces venezuelae RNA revealed an RNA-linked hydroxyfuranone or succinyl ester group, in addition to a number of other putative small molecule-RNA conjugates not previously reported. The second method analyzes nuclease-generated mononucleotides before and after treatment with base or nucleophile and also revealed a number of new putative small molecule-RNA conjugates, including 3'-dephospho-CoA and its succinyl-, acetyl-, and methylmalonyl-thioester derivatives. Subsequent experiments established that these CoA species are attached to E. coli and S. venezuelae RNA at the 5' terminus. CoA-linked RNA cannot be generated through aberrant transcriptional initiation by E. coli RNA polymerase in vitro, and CoA-linked RNA in E. coli is only found among smaller (approximately < 200 nucleotide) RNAs that have yet to be identified. These results provide examples of small molecule-RNA conjugates and suggest that the chemical diversity of cellular RNA may be greater than previously understood. PMID:19416889

  4. A chemical screen for biological small molecule–RNA conjugates reveals CoA-linked RNA

    Science.gov (United States)

    Kowtoniuk, Walter E.; Shen, Yinghua; Heemstra, Jennifer M.; Agarwal, Isha; Liu, David R.

    2009-01-01

    Compared with the rapidly expanding set of known biological roles for RNA, the known chemical diversity of cellular RNA has remained limited primarily to canonical RNA, 3′-aminoacylated tRNAs, nucleobase-modified RNAs, and 5′-capped mRNAs in eukaryotes. We developed two methods to detect in a broad manner chemically labile cellular small molecule–RNA conjugates. The methods were validated by the detection of known tRNA and rRNA modifications. The first method analyzes small molecules cleaved from RNA by base or nucleophile treatment. Application to Escherichia coli and Streptomyces venezuelae RNA revealed an RNA-linked hydroxyfuranone or succinyl ester group, in addition to a number of other putative small molecule–RNA conjugates not previously reported. The second method analyzes nuclease-generated mononucleotides before and after treatment with base or nucleophile and also revealed a number of new putative small molecule–RNA conjugates, including 3′-dephospho-CoA and its succinyl-, acetyl-, and methylmalonyl-thioester derivatives. Subsequent experiments established that these CoA species are attached to E. coli and S. venezuelae RNA at the 5′ terminus. CoA-linked RNA cannot be generated through aberrant transcriptional initiation by E. coli RNA polymerase in vitro, and CoA-linked RNA in E. coli is only found among smaller (≲200 nucleotide) RNAs that have yet to be identified. These results provide examples of small molecule-RNA conjugates and suggest that the chemical diversity of cellular RNA may be greater than previously understood. PMID:19416889

  5. In vitro inhibition activity of polyphenol-rich extracts from Syzygium aromaticum(L.)Merr.& Perry(Clove)buds against carbohydrate hydrolyzing enzymes linked to type 2 diabetes and Fe2+-induced lipid peroxidation in rat pancreas

    Institute of Scientific and Technical Information of China (English)

    Stephen; Adeniyi; Adefegha; Ganiyu; Oboh

    2012-01-01

    Objective:To investigate and compare the inhibitor)’properties)of free and bound phenolic extracts of clove bud against carbohydrate hydrolyzing enzymes(alpha-amylase&alphaglucosidase)and Fe2+-induced lipid peroxidation in rat pancreas in vitro.Methods:The free phenolics were extracted with 80%.(v/v)acetone,while bound phenolics were extracted from the alkaline and acid hydrolyzed residue with ethyl acetate.Then,the interaction of the extracts with alpha-amylase and alpha-glucosidase was subsequently assessed.Thereafter,the total phenolic contents and antioxidant activities of the extracts were determined.Results:The result revealed that both extracts inhibited alpha-amylase and alpha-glucosidase in a dose-dependent manner.However,the alpha-glucosidase inhibitory activity of the extracts were significantly(P<0.05)higher than their alpha-amylase inhibitory activity.The free phenolics(31.67 mg/g)and flavonoid(17.28 mg/g)contents were significantly(P<0.05)higher than bound phenolic(23.52 mg/g)and flavonoid(13.70 mg/g)contents.Both extracts also exhibited high antioxidant activities as typified by their high reducing power,LI diphenyl-2-picrylhydrazyl(DPPH)and 2,2-azinobis-3-ethylbenzo-thiazoline-6-sulfonate(ABTS)radical scavenging abilities,as well as inhibition of Fe2+-induced lipid peroxidation in rat pancreas in vitro.Conclusions:This study provides a biochemical rationale by which clove elicits therapeutic effect on type 2 diabetes.

  6. Tumor Budding in Colorectal Carcinomas

    Directory of Open Access Journals (Sweden)

    Sevda SERT BEKTAŞ

    2012-01-01

    Full Text Available Objective: In colorectal carcinomas, tumor budding has been defined as the presence of isolated single tumor cells or small cell clusters in the stroma at the invasive tumor margin. In this study, the relationship between tumor budding density at the invasive tumor margin and pathological parameters is investigated.Material and Method: Haematoxylin and eosin stained slides of 73 cases with colorectal carcinoma were retrospectively evaluated for the presence and intensity of tumor budding by 2 observers. After the specimens were assessed, the highest density of tumor budding area was counted in a microscopic field of x200. Cases were separated into 2 groups according to tumor budding density as low grade (<10 and high grade (≥10. The relationship of these groups with depth of tumor invasion, histological grade, vascular invasion and lymph node involvement was investigated.Results: Of the 73 colorectal carcinoma cases, 33 (45.2% had low and 40 (54.8% had high grade tumor budding density, respectively. There was a statistically significant relationship between high grade tumor budding density and histological grade (p=0.042, lymph node involvement (p=0.0001 and vascular invasion (p=0.0034.Conclusion: High grade tumor budding density is associated with aggressive phenotypical features in colorectal carcinoma.

  7. Ubiquitin is part of the retrovirus budding machinery

    Science.gov (United States)

    Patnaik, Akash; Chau, Vincent; Wills, John W.

    2000-11-01

    Retroviruses contain relatively large amounts of ubiquitin, but the significance of this finding has been unknown. Here, we show that drugs that are known to reduce the level of free ubiquitin in the cell dramatically reduced the release of Rous sarcoma virus, an avian retrovirus. This effect was suppressed by overexpressing ubiquitin and also by directly fusing ubiquitin to the C terminus of Gag, the viral protein that directs budding and particle release. The block to budding was found to be at the plasma membrane, and electron microscopy revealed that the reduced level of ubiquitin results in a failure of mature virus particles to separate from each other and from the plasma membrane during budding. These data indicate that ubiquitin is actually part of the budding machinery.

  8. Proteomic analysis of a segregant population reveals candidate proteins linked to mealiness in peach.

    Science.gov (United States)

    Almeida, Andréa Miyasaka; Urra, Claudio; Moraga, Carol; Jego, Marcela; Flores, Alejandra; Meisel, Lee; González, Mauricio; Infante, Rodrigo; Defilippi, Bruno G; Campos-Vargas, Reinaldo; Orellana, Ariel

    2016-01-10

    Peaches are stored at low temperatures to delay ripening and increase postharvest life. However some varieties are susceptible to chilling injury,which leads to fruit mealiness, browning and flesh bleeding. In order to identify potentialmarkers associated with chilling injury,we performed proteomic analyses on a segregating population with contrasting susceptibility to chilling-induced mealiness. Chilling-induced mealiness was assessed by measuring juiciness in fruits that have been stored in cold and then allowed to ripen. Fruitmesocarp and leaf proteome from contrasting segregants were analyzed using 2-DE gels. Comparison of protein abundance between segregants revealed 133 spots from fruit mesocarp and 36 from leaf. Thirty four fruit mesocarp proteins were identified from these spots. Most of these proteins were related to ethylene synthesis, ABA response and stress response. Leaf protein analyses identified 22 proteins, most of which related to energy metabolism. Some of the genes that code for these proteins have been previously correlated with chilling injury through transcript analyses and co-segregation with mealiness QTLs. The results from this study, further deciphers the molecular mechanisms associated with chilling response in peach fruit, and identifies candidate proteins linked to mealiness in peach which may be used as putative markers for this trait. PMID:26459401

  9. New loci for body fat percentage reveal link between adiposity and cardiometabolic disease risk

    DEFF Research Database (Denmark)

    Lu, Yingchang; Day, Felix R; Gustafsson, Stefan;

    2016-01-01

    To increase our understanding of the genetic basis of adiposity and its links to cardiometabolic disease risk, we conducted a genome-wide association meta-analysis of body fat percentage (BF%) in up to 100,716 individuals. Twelve loci reached genome-wide significance (P<5 × 10(-8)), of which eigh...

  10. New loci for body fat percentage reveal link between adiposity and cardiometabolic disease risk

    NARCIS (Netherlands)

    Lu, Yingchang; Day, Felix R; Gustafsson, Stefan; Buchkovich, Martin L; Na, Jianbo; Bataille, Veronique; Cousminer, Diana L; Dastani, Zari; Drong, Alexander W; Esko, Tõnu; Evans, David M; Falchi, Mario; Feitosa, Mary F; Ferreira, Teresa; Hedman, Åsa K; Haring, Robin; Hysi, Pirro G; Iles, Mark M; Justice, Anne E; Kanoni, Stavroula; Lagou, Vasiliki; Li, Rui; Li, Xin; Locke, Adam; Lu, Chen; Mägi, Reedik; Perry, John R B; Pers, Tune H; Qi, Qibin; Sanna, Marianna; Schmidt, Ellen M; Scott, William R; Shungin, Dmitry; Teumer, Alexander; Vinkhuyzen, Anna A E; Walker, Ryan W; Westra, Harm-Jan; Zhang, Mingfeng; Zhang, Weihua; Zhao, Jing Hua; Zhu, Zhihong; Afzal, Uzma; Ahluwalia, Tarunveer Singh; Bakker, Stephan J L; Bellis, Claire; Bonnefond, Amélie; Borodulin, Katja; Buchman, Aron S; Cederholm, Tommy; Choh, Audrey C; Choi, Hyung Jin; Curran, Joanne E; de Groot, Lisette C P G M; De Jager, Philip L; Dhonukshe-Rutten, Rosalie A M; Enneman, Anke W; Eury, Elodie; Evans, Daniel S; Forsen, Tom; Friedrich, Nele; Fumeron, Frédéric; Garcia, Melissa E; Gärtner, Simone; Han, Bok-Ghee; Havulinna, Aki S; Hayward, Caroline; Hernandez, Dena; Hillege, Hans; Ittermann, Till; Kent, Jack W; Kolcic, Ivana; Laatikainen, Tiina; Lahti, Jari; Mateo Leach, Irene; Lee, Christine G; Lee, Jong-Young; Liu, Tian; Liu, Youfang; Lobbens, Stéphane; Loh, Marie; Lyytikäinen, Leo-Pekka; Medina-Gomez, Carolina; Michaëlsson, Karl; Nalls, Mike A; Nielson, Carrie M; Oozageer, Laticia; Pascoe, Laura; Paternoster, Lavinia; Polašek, Ozren; Ripatti, Samuli; Sarzynski, Mark A; Shin, Chan Soo; Narančić, Nina Smolej; Spira, Dominik; Srikanth, Priya; Steinhagen-Thiessen, Elisabeth; Sung, Yun Ju; Swart, Karin M A; Taittonen, Leena; Tanaka, Toshiko; Tikkanen, Emmi; van der Velde, Nathalie; van Schoor, Natasja M; Verweij, Niek; Wright, Alan F; Yu, Lei; Zmuda, Joseph M; Eklund, Niina; Forrester, Terrence; Grarup, Niels; Jackson, Anne U; Kristiansson, Kati; Kuulasmaa, Teemu; Kuusisto, Johanna; Lichtner, Peter; Luan, Jian'an; Mahajan, Anubha; Männistö, Satu; Palmer, Cameron D; Ried, Janina S; Scott, Robert A; Stancáková, Alena; Wagner, Peter J; Demirkan, Ayse; Döring, Angela; Gudnason, Vilmundur; Kiel, Douglas P; Kühnel, Brigitte; Mangino, Massimo; Mcknight, Barbara; Menni, Cristina; O'Connell, Jeffrey R; Oostra, Ben A; Shuldiner, Alan R; Song, Kijoung; Vandenput, Liesbeth; van Duijn, Cornelia M; Vollenweider, Peter; White, Charles C; Boehnke, Michael; Boettcher, Yvonne; Cooper, Richard S; Forouhi, Nita G; Gieger, Christian; Grallert, Harald; Hingorani, Aroon; Jørgensen, Torben; Jousilahti, Pekka; Kivimaki, Mika; Kumari, Meena; Laakso, Markku; Langenberg, Claudia; Linneberg, Allan; Luke, Amy; Mckenzie, Colin A; Palotie, Aarno; Pedersen, Oluf; Peters, Annette; Strauch, Konstantin; Tayo, Bamidele O; Wareham, Nicholas J; Bennett, David A; Bertram, Lars; Blangero, John; Blüher, Matthias; Bouchard, Claude; Campbell, Harry; Cho, Nam H; Cummings, Steven R; Czerwinski, Stefan A; Demuth, Ilja; Eckardt, Rahel; Eriksson, Johan G; Ferrucci, Luigi; Franco, Oscar H; Froguel, Philippe; Gansevoort, Ron T; Hansen, Torben; Harris, Tamara B; Hastie, Nicholas; Heliövaara, Markku; Hofman, Albert; Jordan, Joanne M; Jula, Antti; Kähönen, Mika; Kajantie, Eero; Knekt, Paul B; Koskinen, Seppo; Kovacs, Peter; Lehtimäki, Terho; Lind, Lars; Liu, Yongmei; Orwoll, Eric S; Osmond, Clive; Perola, Markus; Pérusse, Louis; Raitakari, Olli T; Rankinen, Tuomo; Rao, D C; Rice, Treva K; Rivadeneira, Fernando; Rudan, Igor; Salomaa, Veikko; Sørensen, Thorkild I A; Stumvoll, Michael; Tönjes, Anke; Towne, Bradford; Tranah, Gregory J; Tremblay, Angelo; Uitterlinden, André G; van der Harst, Pim; Vartiainen, Erkki; Viikari, Jorma S; Vitart, Veronique; Vohl, Marie-Claude; Völzke, Henry; Walker, Mark; Wallaschofski, Henri; Wild, Sarah; Wilson, James F; Yengo, Loïc; Bishop, D Timothy; Borecki, Ingrid B; Chambers, John C; Cupples, L Adrienne; Dehghan, Abbas; Deloukas, Panos; Fatemifar, Ghazaleh; Fox, Caroline; Furey, Terrence S; Franke, Lude; Han, Jiali; Hunter, David J; Karjalainen, Juha; Karpe, Fredrik; Kaplan, Robert C; Kooner, Jaspal S; McCarthy, Mark I; Murabito, Joanne M; Morris, Andrew P; Bishop, Julia A N; North, Kari E; Ohlsson, Claes; Ong, Ken K; Prokopenko, Inga; Richards, J Brent; Schadt, Eric E; Spector, Tim D; Widén, Elisabeth; Willer, Cristen J; Yang, Jian; Ingelsson, Erik; Mohlke, Karen L; Hirschhorn, Joel N; Pospisilik, John Andrew; Zillikens, M Carola; Lindgren, Cecilia; Kilpeläinen, Tuomas Oskari; Loos, Ruth J F

    2016-01-01

    To increase our understanding of the genetic basis of adiposity and its links to cardiometabolic disease risk, we conducted a genome-wide association meta-analysis of body fat percentage (BF%) in up to 100,716 individuals. Twelve loci reached genome-wide significance (P<5 × 10(-8)), of which eight w

  11. The metabolic enzyme ManA reveals a link between cell wall integrity and chromosome morphology.

    OpenAIRE

    Maya Elbaz; Sigal Ben-Yehuda

    2010-01-01

    Author Summary The bacterial cell is resistant to extremes of osmotic pressure and protected against mechanical damages by the existence of a rigid outer shell defined as the cell wall. The strength of the cell wall is achieved by the presence of long glycan strands cross-linked by peptide side bridges. The cell wall is a dynamic structure continuously being synthesized and modified to allow for cell growth and division. Damaging the cell wall leads to abnormal cellular morphologies and cell ...

  12. Adventitious bud regeneration from the stigma of Sinapis alba L.

    Directory of Open Access Journals (Sweden)

    Elżbieta Zenkteler

    2012-12-01

    Full Text Available Stigmas isolated from flower buds of 'Nakielska' variety of Sinapis alba were used to develop a micropropagation method suitable for breeding of new cultivars. The origin of adventitious bud regeneration was studied on MS medium, under stimulation by bezylaminopurine (BAP in combination with 2,4-D - dichlorophenoxyacetic acid (2,4-D. Histological analysis showed the structure of Sinapis stigma (composed from four types of tissue: papillae, transmitting tissue, parenchyma and vascular bundles and revealed that numerous meristematic centers developed from parenchyma cells in close vicinity of vascular bundles. Buds very quickly appeared on the surface of initial explants and later formed multiplantlets that were easily rooted in the soil.

  13. New loci for body fat percentage reveal link between adiposity and cardiometabolic disease risk

    OpenAIRE

    Lu, Yingchang; Day, Felix R.; Gustafsson, Stefan; Buchkovich, Martin L; Na, Jianbo; Bataille, Veronique; Cousminer, Diana L.; Dastani, Zari; Drong, Alexander W.; Esko, Tõnu; Evans, David M; Falchi, Mario; Feitosa, Mary F.; Ferreira, Teresa; Hedman, Åsa K.

    2016-01-01

    To increase our understanding of the genetic basis of adiposity and its links to cardiometabolic disease risk, we conducted a genome-wide association meta-analysis of body fat percentage (BF%) in up to 100,716 individuals. Twelve loci reached genome-wide significance (P<5 × 10(-8)), of which eight were previously associated with increased overall adiposity (BMI, BF%) and four (in or near COBLL1/GRB14, IGF2BP1, PLA2G6, CRTC1) were novel associations with BF%. Seven loci showed a larger effe...

  14. High-throughput sequencing reveals an altered T cell repertoire in X-linked agammaglobulinemia

    OpenAIRE

    Ramesh, Manish; Simchoni, Noa; Hamm, David; Cunningham-Rundles, Charlotte

    2015-01-01

    To examine the T cell receptor structure in the absence of B cells, the TCR β CDR3 was sequenced from DNA of 15 X-linked agammaglobulinemia (XLA) subjects and 18 male controls, using the Illumina HiSeq platform and the ImmunoSEQ analyzer. V gene usage and the V–J combinations, derived from both productive and nonproductive sequences, were significantly different between XLA samples and controls. Although the CDR3 length was similar for XLA and control samples, the CDR3 region of the XLA T cel...

  15. Cryptic diversity of African tigerfish (genus Hydrocynus reveals palaeogeographic signatures of linked neogene geotectonic events.

    Directory of Open Access Journals (Sweden)

    Sarah A M Goodier

    Full Text Available The geobiotic history of landscapes can exhibit controls by tectonics over biotic evolution. This causal relationship positions ecologically specialized species as biotic indicators to decipher details of landscape evolution. Phylogeographic statistics that reconstruct spatio-temporal details of evolutionary histories of aquatic species, including fishes, can reveal key events of drainage evolution, notably where geochronological resolution is insufficient. Where geochronological resolution is insufficient, phylogeographic statistics that reconstruct spatio-temporal details of evolutionary histories of aquatic species, notably fishes, can reveal key events of drainage evolution. This study evaluates paleo-environmental causes of mitochondrial DNA (mtDNA based phylogeographic records of tigerfishes, genus Hydrocynus, in order to reconstruct their evolutionary history in relation to landscape evolution across Africa. Strong geographical structuring in a cytochrome b (cyt-b gene phylogeny confirms the established morphological diversity of Hydrocynus and reveals the existence of five previously unknown lineages, with Hydrocynus tanzaniae sister to a clade comprising three previously unknown lineages (Groups B, C and D and H. vittatus. The dated phylogeny constrains the principal cladogenic events that have structured Hydrocynus diversity from the late Miocene to the Plio-Pleistocene (ca. 0-16 Ma. Phylogeographic tests reveal that the diversity and distribution of Hydrocynus reflects a complex history of vicariance and dispersals, whereby range expansions in particular species testify to changes to drainage basins. Principal divergence events in Hydrocynus have interfaced closely with evolving drainage systems across tropical Africa. Tigerfish evolution is attributed to dominant control by pulses of geotectonism across the African plate. Phylogenetic relationships and divergence estimates among the ten mtDNA lineages illustrates where and when local

  16. Cryptic diversity of African tigerfish (genus Hydrocynus) reveals palaeogeographic signatures of linked neogene geotectonic events.

    Science.gov (United States)

    Goodier, Sarah A M; Cotterill, Fenton P D; O'Ryan, Colleen; Skelton, Paul H; de Wit, Maarten J

    2011-01-01

    The geobiotic history of landscapes can exhibit controls by tectonics over biotic evolution. This causal relationship positions ecologically specialized species as biotic indicators to decipher details of landscape evolution. Phylogeographic statistics that reconstruct spatio-temporal details of evolutionary histories of aquatic species, including fishes, can reveal key events of drainage evolution, notably where geochronological resolution is insufficient. Where geochronological resolution is insufficient, phylogeographic statistics that reconstruct spatio-temporal details of evolutionary histories of aquatic species, notably fishes, can reveal key events of drainage evolution. This study evaluates paleo-environmental causes of mitochondrial DNA (mtDNA) based phylogeographic records of tigerfishes, genus Hydrocynus, in order to reconstruct their evolutionary history in relation to landscape evolution across Africa. Strong geographical structuring in a cytochrome b (cyt-b) gene phylogeny confirms the established morphological diversity of Hydrocynus and reveals the existence of five previously unknown lineages, with Hydrocynus tanzaniae sister to a clade comprising three previously unknown lineages (Groups B, C and D) and H. vittatus. The dated phylogeny constrains the principal cladogenic events that have structured Hydrocynus diversity from the late Miocene to the Plio-Pleistocene (ca. 0-16 Ma). Phylogeographic tests reveal that the diversity and distribution of Hydrocynus reflects a complex history of vicariance and dispersals, whereby range expansions in particular species testify to changes to drainage basins. Principal divergence events in Hydrocynus have interfaced closely with evolving drainage systems across tropical Africa. Tigerfish evolution is attributed to dominant control by pulses of geotectonism across the African plate. Phylogenetic relationships and divergence estimates among the ten mtDNA lineages illustrates where and when local tectonic events

  17. Phenotypic Analysis Reveals that the 2010 Haiti Cholera Epidemic Is Linked to a Hypervirulent Strain.

    Science.gov (United States)

    Satchell, Karla J F; Jones, Christopher J; Wong, Jennifer; Queen, Jessica; Agarwal, Shivani; Yildiz, Fitnat H

    2016-09-01

    Vibrio cholerae O1 El Tor strains have been responsible for pandemic cholera since 1961. These strains have evolved over time, spreading globally in three separate waves. Wave 3 is caused by altered El Tor (AET) variant strains, which include the strain with the signature ctxB7 allele that was introduced in 2010 into Haiti, where it caused a devastating epidemic. In this study, we used phenotypic analysis to compare an early isolate from the Haiti epidemic to wave 1 El Tor isolates commonly used for research. It is demonstrated that the Haiti isolate has increased production of cholera toxin (CT) and hemolysin, increased motility, and a reduced ability to form biofilms. This strain also outcompetes common wave 1 El Tor isolates for colonization of infant mice, indicating that it has increased virulence. Monitoring of CT production and motility in additional wave 3 isolates revealed that this phenotypic variation likely evolved over time rather than in a single genetic event. Analysis of available whole-genome sequences and phylogenetic analyses suggested that increased virulence arose from positive selection for mutations found in known and putative regulatory genes, including hns and vieA, diguanylate cyclase genes, and genes belonging to the lysR and gntR regulatory families. Overall, the studies presented here revealed that V. cholerae virulence potential can evolve and that the currently prevalent wave 3 AET strains are both phenotypically distinct from and more virulent than many El Tor isolates. PMID:27297393

  18. A Nanoprinted Model of Interstitial Cancer Migration Reveals a Link between Cell Deformability and Proliferation.

    Science.gov (United States)

    Panagiotakopoulou, Magdalini; Bergert, Martin; Taubenberger, Anna; Guck, Jochen; Poulikakos, Dimos; Ferrari, Aldo

    2016-07-26

    Metastatic progression of tumors requires the coordinated dissemination of cancerous cells through interstitial tissues and their replication in distant body locations. Despite their importance in cancer treatment decisions, key factors, such as cell shape adaptation and the role it plays in dense tissue invasion by cancerous cells, are not well understood. Here, we employ a 3D electrohydrodynamic nanoprinting technology to generate vertical arrays of topographical pores that mimic interstitial tissue resistance to the mesenchymal migration of cancerous cells, in order to determine the effect of nuclear size, cell deformability, and cell-to-substrate adhesion on tissue invasion efficiency. The high spatial and temporal resolution of our analysis demonstrates that the ability of cells to deform depends on the cell cycle phase, peaks immediately after mitosis, and is key to the invasion process. Increased pore penetration efficiency by cells in early G1 phase also coincided with their lower nuclear volume and higher cell deformability, compared with the later cell cycle stages. Furthermore, artificial decondensation of chromatin induced an increase in cell and nuclear deformability and improved pore penetration efficiency of cells in G1. Together, these results underline that along the cell cycle cells have different abilities to dynamically remodel their actin cytoskeleton and induce nuclear shape changes, which determines their pore penetration efficiency. Thus, our results support a mechanism in which cell proliferation and pore penetration are functionally linked to favor the interstitial dissemination of metastatic cells. PMID:27268411

  19. Coevolutionary patterning of teeth and taste buds.

    Science.gov (United States)

    Bloomquist, Ryan F; Parnell, Nicholas F; Phillips, Kristine A; Fowler, Teresa E; Yu, Tian Y; Sharpe, Paul T; Streelman, J Todd

    2015-11-01

    Teeth and taste buds are iteratively patterned structures that line the oro-pharynx of vertebrates. Biologists do not fully understand how teeth and taste buds develop from undifferentiated epithelium or how variation in organ density is regulated. These organs are typically studied independently because of their separate anatomical location in mammals: teeth on the jaw margin and taste buds on the tongue. However, in many aquatic animals like bony fishes, teeth and taste buds are colocalized one next to the other. Using genetic mapping in cichlid fishes, we identified shared loci controlling a positive correlation between tooth and taste bud densities. Genome intervals contained candidate genes expressed in tooth and taste bud fields. sfrp5 and bmper, notable for roles in Wingless (Wnt) and bone morphogenetic protein (BMP) signaling, were differentially expressed across cichlid species with divergent tooth and taste bud density, and were expressed in the development of both organs in mice. Synexpression analysis and chemical manipulation of Wnt, BMP, and Hedgehog (Hh) pathways suggest that a common cichlid oral lamina is competent to form teeth or taste buds. Wnt signaling couples tooth and taste bud density and BMP and Hh mediate distinct organ identity. Synthesizing data from fish and mouse, we suggest that the Wnt-BMP-Hh regulatory hierarchy that configures teeth and taste buds on mammalian jaws and tongues may be an evolutionary remnant inherited from ancestors wherein these organs were copatterned from common epithelium. PMID:26483492

  20. Energy Landscape Topography Reveals the Underlying Link Between Binding Specificity and Activity of Enzymes

    Science.gov (United States)

    Chu, Wen-Ting; Wang, Jin

    2016-06-01

    Enzyme activity (often quantified by kcat/Km) is the main function of enzyme when it is active against the specific substrate. Higher or lower activities are highly desired for the design of novel enzyme and drug resistance. However, it is difficult to measure the activities of all possible variants and find the “hot-spot” within the limit of experimental time. In this study, we explore the underlying energy landscape of enzyme-substrate interactions and introduce the intrinsic specificity ratio (ISR), which reflects the landscape topography. By studying two concrete systems, we uncover the statistical correlation between the intrinsic specificity and the enzyme activity kcat/Km. This physics-based concept and method show that the energy landscape topography is valuable for understanding the relationship between enzyme specificity and activity. In addition, it can reveal the underlying mechanism of enzyme-substrate actions and has potential applications on enzyme design.

  1. Differential proteomic analysis reveals novel links between primary metabolism and antibiotic production in Amycolatopsis balhimycina

    DEFF Research Database (Denmark)

    Gallo, G.; Renzone, G.; Alduina, R.;

    2010-01-01

    constitutively expressed protein isoforms, which were associated with 203 ORFs in the A. balhimycina genome. These data, providing insights on the major metabolic pathways/molecular processes operating in this organism, were used to compile 2-DE reference maps covering 3-10, 4-7 and 4.5-5.5 pH gradients...... available over the World Wide Web as interactive web pages (http://www.unipa.it/ampuglia/Abal-proteome-maps). Functional clustering analysis revealed that differentially expressed proteins belong to functional groups involved in central carbon metabolism, amino acid metabolism and protein biosynthesis......, energetic and redox balance, sugar/amino sugar metabolism, balhimycin biosynthesis and transcriptional regulation or with hypothetical and/or unknown function. Interestingly, proteins involved in the biosynthesis of balhimycin precursors, such as amino acids, amino sugars and central carbon metabolism...

  2. High-resolution mapping reveals links of HP1 with active and inactive chromatin components.

    Directory of Open Access Journals (Sweden)

    Elzo de Wit

    2007-03-01

    Full Text Available Heterochromatin protein 1 (HP1 is commonly seen as a key factor of repressive heterochromatin, even though a few genes are known to require HP1-chromatin for their expression. To obtain insight into the targeting of HP1 and its interplay with other chromatin components, we have mapped HP1-binding sites on Chromosomes 2 and 4 in Drosophila Kc cells using high-density oligonucleotide arrays and the DNA adenine methyltransferase identification (DamID technique. The resulting high-resolution maps show that HP1 forms large domains in pericentric regions, but is targeted to single genes on chromosome arms. Intriguingly, HP1 shows a striking preference for exon-dense genes on chromosome arms. Furthermore, HP1 binds along entire transcription units, except for 5' regions. Comparison with expression data shows that most of these genes are actively transcribed. HP1 target genes are also marked by the histone variant H3.3 and dimethylated histone 3 lysine 4 (H3K4me2, which are both typical of active chromatin. Interestingly, H3.3 deposition, which is usually observed along entire transcription units, is limited to the 5' ends of HP1-bound genes. Thus, H3.3 and HP1 are mutually exclusive marks on active chromatin. Additionally, we observed that HP1-chromatin and Polycomb-chromatin are nonoverlapping, but often closely juxtaposed, suggesting an interplay between both types of chromatin. These results demonstrate that HP1-chromatin is transcriptionally active and has extensive links with several other chromatin components.

  3. Genome-wide association study of metabolic traits reveals novel gene-metabolite-disease links.

    Directory of Open Access Journals (Sweden)

    Rico Rueedi

    2014-02-01

    Full Text Available Metabolic traits are molecular phenotypes that can drive clinical phenotypes and may predict disease progression. Here, we report results from a metabolome- and genome-wide association study on (1H-NMR urine metabolic profiles. The study was conducted within an untargeted approach, employing a novel method for compound identification. From our discovery cohort of 835 Caucasian individuals who participated in the CoLaus study, we identified 139 suggestively significant (P<5×10(-8 and independent associations between single nucleotide polymorphisms (SNP and metabolome features. Fifty-six of these associations replicated in the TasteSensomics cohort, comprising 601 individuals from São Paulo of vastly diverse ethnic background. They correspond to eleven gene-metabolite associations, six of which had been previously identified in the urine metabolome and three in the serum metabolome. Our key novel findings are the associations of two SNPs with NMR spectral signatures pointing to fucose (rs492602, P = 6.9×10(-44 and lysine (rs8101881, P = 1.2×10(-33, respectively. Fine-mapping of the first locus pinpointed the FUT2 gene, which encodes a fucosyltransferase enzyme and has previously been associated with Crohn's disease. This implicates fucose as a potential prognostic disease marker, for which there is already published evidence from a mouse model. The second SNP lies within the SLC7A9 gene, rare mutations of which have been linked to severe kidney damage. The replication of previous associations and our new discoveries demonstrate the potential of untargeted metabolomics GWAS to robustly identify molecular disease markers.

  4. The kinome of Phytophthora infestans reveals oomycete-specific innovations and links to other taxonomic groups

    Directory of Open Access Journals (Sweden)

    Ah-Fong Audrey MV

    2010-12-01

    Full Text Available Abstract Background Oomycetes are a large group of economically and ecologically important species. Its most notorious member is Phytophthora infestans, the cause of the devastating potato late blight disease. The life cycle of P. infestans involves hyphae which differentiate into spores used for dispersal and host infection. Protein phosphorylation likely plays crucial roles in these stages, and to help understand this we present here a genome-wide analysis of the protein kinases of P. infestans and several relatives. The study also provides new insight into kinase evolution since oomycetes are taxonomically distant from organisms with well-characterized kinomes. Results Bioinformatic searches of the genomes of P. infestans, P. ramorum, and P. sojae reveal they have similar kinomes, which for P. infestans contains 354 eukaryotic protein kinases (ePKs and 18 atypical kinases (aPKs, equaling 2% of total genes. After refining gene models, most were classifiable into families seen in other eukaryotes. Some ePK families are nevertheless unusual, especially the tyrosine kinase-like (TKL group which includes large oomycete-specific subfamilies. Also identified were two tyrosine kinases, which are rare in non-metazoans. Several ePKs bear accessory domains not identified previously on kinases, such as cyclin-dependent kinases with integral cyclin domains. Most ePKs lack accessory domains, implying that many are regulated transcriptionally. This was confirmed by mRNA expression-profiling studies that showed that two-thirds vary significantly between hyphae, sporangia, and zoospores. Comparisons to neighboring taxa (apicomplexans, ciliates, diatoms revealed both clade-specific and conserved features, and multiple connections to plant kinases were observed. The kinome of Hyaloperonospora arabidopsidis, an oomycete with a simpler life cycle than P. infestans, was found to be one-third smaller. Some differences may be attributable to gene clustering, which

  5. Network analysis reveals ecological links between N-fixing bacteria and wood-decaying fungi.

    Directory of Open Access Journals (Sweden)

    Björn Hoppe

    Full Text Available Nitrogen availability in dead wood is highly restricted and associations with N-fixing bacteria are thought to enable wood-decaying fungi to meet their nitrogen requirements for vegetative and generative growth. We assessed the diversity of nifH (dinitrogenase reductase genes in dead wood of the common temperate tree species Fagus sylvatica and Picea abies from differently managed forest plots in Germany using molecular tools. By incorporating these genes into a large compilation of published nifH sequences and subsequent phylogenetic analyses of deduced proteins we verified the presence of diverse pools corresponding to functional nifH, almost all of which are new to science. The distribution of nifH genes strongly correlated with tree species and decay class, but not with forest management, while higher fungal fructification was correlated with decreasing nitrogen content of the dead wood and positively correlated with nifH diversity, especially during the intermediate stage of wood decay. Network analyses based on non-random species co-occurrence patterns revealed interactions among fungi and N-fixing bacteria in the dead wood and strongly indicate the occurrence of at least commensal relationships between these taxa.

  6. Primary School Age Students' Spontaneous Comments about Math Reveal Emerging Dispositions Linked to Later Mathematics Achievement

    Directory of Open Access Journals (Sweden)

    Michèle M. M. Mazzocco

    2012-01-01

    Full Text Available To longitudinally explore children's developing beliefs towards mathematics, we asked 207 children to define “math” and “reading” at grades 2 and 3 and coded for spontaneous references to likability or difficulty of math (or reading in their definitions. We found that children attributed more difficulty to math than to reading despite their relatively neutral comments on the likability of either subject. Children described math and reading with comparable degrees of specificity, but girls' definitions were more specific than boys'. Relative to their peers, children with mathematics learning disability (MLD provided less specific definitions overall, were more likely to describe math as more difficult than reading, and were more likely to show a decrease in likability ratings of math (but not reading from grades 2 to 3. Grade 2 ratings predicted math ability at grade 3, more so than predictors from grade 3. These findings, although based on informal analyses not intended to substitute for validated assessments of disposition, support the notions that distinct aspects of dispositions towards math emerge in early childhood, are revealed through casual discourse, and are predictive of later math achievement outcomes. This further supports current interests in developing formal measures of academic disposition in early childhood.

  7. Temporal fate mapping reveals age-linked heterogeneity in naive T lymphocytes in mice.

    Science.gov (United States)

    Hogan, Thea; Gossel, Graeme; Yates, Andrew J; Seddon, Benedict

    2015-12-15

    Understanding how our T-cell compartments are maintained requires knowledge of their population dynamics, which are typically quantified over days to weeks using the administration of labels incorporated into the DNA of dividing cells. These studies present snapshots of homeostatic dynamics and have suggested that lymphocyte populations are heterogeneous with respect to rates of division and/or death, although resolving the details of such heterogeneity is problematic. Here we present a method of studying the population dynamics of T cells in mice over timescales of months to years that reveals heterogeneity in rates of division and death with respect to the age of the host at the time of thymic export. We use the transplant conditioning drug busulfan to ablate hematopoetic stem cells in young mice but leave the peripheral lymphocyte compartments intact. Following their reconstitution with congenically labeled (donor) bone marrow, we followed the dilution of peripheral host T cells by donor-derived lymphocytes for a year after treatment. Describing these kinetics with mathematical models, we estimate rates of thymic production, division and death of naive CD4 and CD8 T cells. Population-averaged estimates of mean lifetimes are consistent with earlier studies, but we find the strongest support for a model in which both naive T-cell pools contain kinetically distinct subpopulations of older host-derived cells with self-renewing capacity that are resistant to displacement by naive donor lymphocytes. We speculate that these incumbent cells are conditioned or selected for increased fitness through homeostatic expansion into the lymphopenic neonatal environment. PMID:26607449

  8. Distributed Modeling Reveals the Ecohydrological Dynamics Linked with Woody Plant Encroachment in the Sonoran Desert

    Science.gov (United States)

    Pierini, N. A.; Vivoni, E. R.; Anderson, C.; Saripalli, S.; Robles-Morua, A.

    2012-12-01

    the two study years (2011-2012). Numerical experiments are designed to reveal the influence of the mesquite encroachment patterns on the watershed dynamics. Through the spatiotemporal analysis of model outputs, we identify how and when mesquite trees affect the spatial patterns of energy and water fluxes and their linkage to runoff production. As a result, the distributed model application provides a more complete understanding of the impact of woody encroachment on watershed-scale hydrologic patterns.

  9. HIV Pol inhibits HIV budding and mediates the severe budding defect of Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Xin Gan

    Full Text Available The prevailing hypothesis of HIV budding posits that the viral Gag protein drives budding, and that the Gag p6 peptide plays an essential role by recruiting host-cell budding factors to sites of HIV assembly. HIV also expresses a second Gag protein, p160 Gag-Pol, which lacks p6 and fails to bud from cells, consistent with the prevailing hypothesis of HIV budding. However, we show here that the severe budding defect of Gag-Pol is not caused by the absence of p6, but rather, by the presence of Pol. Specifically, we show that (i the budding defect of Gag-Pol is unaffected by loss of HIV protease activity and is therefore an intrinsic property of the Gag-Pol polyprotein, (ii the N-terminal 433 amino acids of Gag and Gag-Pol are sufficient to drive virus budding even though they lack p6, (iii the severe budding defect of Gag-Pol is caused by a dominant, cis-acting inhibitor of budding in the HIV Pol domain, and (iv Gag-Pol inhibits Gag and virus budding in trans, even at normal levels of Gag and Gag-Pol expression. These and other data support an alternative hypothesis of HIV budding as a process that is mediated by the normal, non-viral pathway of exosome/microvesicle biogenesis.

  10. Repellence of the red bud borer (Resseliella oculiperda) to grafted apple trees by impregnation of budding tape with essential oils

    NARCIS (Netherlands)

    Tol, van R.W.H.M.; Linden, van der A.; Swarts, H.J.; Visser, J.H.

    2007-01-01

    The red bud borer Resseliella oculiperda (Rübs.) is a pest insect of apple trees when rootstocks are grafted with scion buds by shield budding. The female midges are attracted to the wounds of the grafted buds where they lay their eggs. The larvae feed on the cambium and destroy the buds completely

  11. Vacuum structure revealed by over-improved stout-link smearing compared with the overlap analysis for quenched QCD

    International Nuclear Information System (INIS)

    A detailed comparison is made between the topological structure of quenched QCD as revealed by the recently proposed over-improved stout-link smearing in conjunction with an improved gluonic definition of the topological density on one hand and a similar analysis made possible by the overlap-fermionic topological charge density both with and without variable ultraviolet cutoff λcut. The matching is twofold, provided by fitting the density-density two-point functions on one hand and by a point-by-point fitting of the topological densities according to the two methods. We point out the similar cluster structure of the topological density for moderate smearing and 200 MeVcut<600 MeV, respectively. We demonstrate the relation of the gluonic topological density for extensive smearing to the location of the overlap zero modes and the lowest overlap non-zero mode as found for the unsmeared configurations. (orig.)

  12. Vacuum structure revealed by over-improved stout-link smearing compared with the overlap analysis for quenched QCD

    Energy Technology Data Exchange (ETDEWEB)

    Ilgenfritz, E.M.; Leinweber, D.; Moran, P. [Adelaide Univ., SA (AU). Special Research Centre for the Subatomic Structure of Matter (CSSM); Koller, K. [Muenchen Univ. (Germany). Sektion Physik; Schierholz, G. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Weinberg, V. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Freie Univ. Berlin (Germany). Inst. fuer Theoretische Physik

    2008-01-11

    A detailed comparison is made between the topological structure of quenched QCD as revealed by the recently proposed over-improved stout-link smearing in conjunction with an improved gluonic definition of the topological density on one hand and a similar analysis made possible by the overlap-fermionic topological charge density both with and without variable ultraviolet cutoff {lambda}{sub cut}. The matching is twofold, provided by fitting the density-density two-point functions on one hand and by a point-by-point fitting of the topological densities according to the two methods. We point out the similar cluster structure of the topological density for moderate smearing and 200 MeV<{lambda}{sub cut}<600 MeV, respectively. We demonstrate the relation of the gluonic topological density for extensive smearing to the location of the overlap zero modes and the lowest overlap non-zero mode as found for the unsmeared configurations. (orig.)

  13. Gravity-induced buds formation from protonemata apical cells in the mosses

    Science.gov (United States)

    Kyyak, Natalia; Khorkavtsiv, Yaroslava

    The acceleration of moss protonemata development after the exit it to light from darkness is important gravidependent morphogenetic manifestation of the moss protonemata. The accelerated development of mosses shows in transformation of apical protonemata cells into the gametophores buds (Ripetskyj et al., 1999). In order to establish, that such reaction on gravitation is general property of gravisensity species, or its typical only for single moss species, experiments with the following moss species - Bryum intermedium (Ludw.) Brig., Bryum caespiticium Hedw., Bryum argenteum Hedw., Dicranodontium denudatum (Brid.) Britt. were carried out. All these species in response to influence of gravitation were capable to form rich bunches of gravitropical protonemata in darkness, that testified to their gravisensity. After the transference of Petri dishes with gravitropical protonemata from darkness on light was revealed, that in 3 of the investigated species the gametophores buds were absent. Only B. argenteum has reacted to action of gravitation by buds formation from apical cells of the gravitropical protonemata. With the purpose of strengthening of buds formation process, the experiments with action of exogenous kinetin (in concentration of 10 (-6) M) were carried out. Kinetin essentially stimulated apical buds formation of B. argenteum. The quantity of apical buds has increased almost in three times in comparison with the control. Besides, on separate stolons a few (3-4) buds from one apical cell were formed. Experimentally was established, that the gametophores buds formation in mosses is controlled by phytohormones (Bopp, 1985; Demkiv et al., 1991). In conditions of gravity influence its essentially accelerated. Probably, gravity essentially strengthened acropetal transport of phytohormones and formation of attractive center in the protonemata apical cell. Our investigations have allowed to make the conclusion, that gravi-dependent formation of the apical buds is

  14. Un-“ESCRT”-ed Budding

    Directory of Open Access Journals (Sweden)

    Mark Yondola

    2011-01-01

    Full Text Available In their recent publication, Rossman et al. [1] describe how the inherent budding capability of its M2 protein allows influenza A virus to bypass recruitment of the cellular ESCRT machinery enlisted by several other enveloped RNA and DNA viruses, including HIV, Ebola, rabies, herpes simplex type 1 and hepatitis B. Studies from the same laboratory [2] and other laboratories [3–6] indicate that budding of plasmid-derived virus-like particles can be mediated by the influenza virus hemagglutinin and neuraminidase proteins in the absence of M2. These events are also independent of canonical ESCRT components [2,7]. Understanding how intrinsic properties of these influenza virus proteins permit ESCRT-independent budding expands our understanding of the budding process itself.

  15. Integrating nap and night-time sleep into sleep patterns reveals differential links to health-relevant outcomes.

    Science.gov (United States)

    Devine, Jaime K; Wolf, Jutta M

    2016-04-01

    Both night-time sleep and nap behaviour have been linked consistently to health outcomes. Although reasons for napping are usually tied to night-time sleep, the majority of studies assess their effects independently. The current study thus aimed to examine the health relevance of patterns of sleep behaviour that take into account both night-time and daytime sleep habits. Night-time sleep, recorded during 7 days via actigraphy from 313 participants (aged 34-82 years) of the Midlife in the United States II Biomarker study, was assessed. Blood and urine specimens were assayed for noradrenaline, interleukin-6 and C-reactive protein. Participants self-reported nap behaviour, depressive symptoms, perceived chronic stress and the presence of medical symptoms and conditions. Overall, nappers (n = 208) showed elevated waist-hip ratios, C-reactive protein and interleukin-6 levels compared to non-nappers and reported more physiological symptoms and conditions (all P ≤ 0.019). Within nappers, cluster analysis revealed three patterns of sleep behaviour-infrequent nappers with good night-time sleep, frequent nappers with good night-time sleep and nappers with poor night-time sleep. Nappers with poor night-time sleep thereby exhibited elevated noradrenaline levels, depressive symptoms and perceived stress scores compared to other groups (all P ≤ 0.041). These findings support the idea that nap-health relationships are complex, in that frequency of napping and accumulation of nap sleep is not related linearly to health consequences. Assessing nap behaviour in conjunction with night-time sleep behaviour appeared crucial to elucidate further the health relevance of napping, particularly in terms of psychological health outcomes, including chronic stress and depressive symptoms. PMID:26718988

  16. Structure of Complement C3(H2O) Revealed By Quantitative Cross-Linking/Mass Spectrometry And Modeling*

    Science.gov (United States)

    Pellarin, Riccardo; Sali, Andrej; Barlow, Paul N.

    2016-01-01

    The slow but spontaneous and ubiquitous formation of C3(H2O), the hydrolytic and conformationally rearranged product of C3, initiates antibody-independent activation of the complement system that is a key first line of antimicrobial defense. The structure of C3(H2O) has not been determined. Here we subjected C3(H2O) to quantitative cross-linking/mass spectrometry (QCLMS). This revealed details of the structural differences and similarities between C3(H2O) and C3, as well as between C3(H2O) and its pivotal proteolytic cleavage product, C3b, which shares functionally similarity with C3(H2O). Considered in combination with the crystal structures of C3 and C3b, the QCMLS data suggest that C3(H2O) generation is accompanied by the migration of the thioester-containing domain of C3 from one end of the molecule to the other. This creates a stable C3b-like platform able to bind the zymogen, factor B, or the regulator, factor H. Integration of available crystallographic and QCLMS data allowed the determination of a 3D model of the C3(H2O) domain architecture. The unique arrangement of domains thus observed in C3(H2O), which retains the anaphylatoxin domain (that is excised when C3 is enzymatically activated to C3b), can be used to rationalize observed differences between C3(H2O) and C3b in terms of complement activation and regulation. PMID:27250206

  17. Structure of Complement C3(H2O) Revealed By Quantitative Cross-Linking/Mass Spectrometry And Modeling.

    Science.gov (United States)

    Chen, Zhuo A; Pellarin, Riccardo; Fischer, Lutz; Sali, Andrej; Nilges, Michael; Barlow, Paul N; Rappsilber, Juri

    2016-08-01

    The slow but spontaneous and ubiquitous formation of C3(H2O), the hydrolytic and conformationally rearranged product of C3, initiates antibody-independent activation of the complement system that is a key first line of antimicrobial defense. The structure of C3(H2O) has not been determined. Here we subjected C3(H2O) to quantitative cross-linking/mass spectrometry (QCLMS). This revealed details of the structural differences and similarities between C3(H2O) and C3, as well as between C3(H2O) and its pivotal proteolytic cleavage product, C3b, which shares functionally similarity with C3(H2O). Considered in combination with the crystal structures of C3 and C3b, the QCMLS data suggest that C3(H2O) generation is accompanied by the migration of the thioester-containing domain of C3 from one end of the molecule to the other. This creates a stable C3b-like platform able to bind the zymogen, factor B, or the regulator, factor H. Integration of available crystallographic and QCLMS data allowed the determination of a 3D model of the C3(H2O) domain architecture. The unique arrangement of domains thus observed in C3(H2O), which retains the anaphylatoxin domain (that is excised when C3 is enzymatically activated to C3b), can be used to rationalize observed differences between C3(H2O) and C3b in terms of complement activation and regulation. PMID:27250206

  18. Programmed cell death during terminal bud senescence in a sympodial branching tree,Eucommia ulmoides

    Institute of Scientific and Technical Information of China (English)

    XU Wenjie; Kalima-N'Koma MWANGE; CUI Keming

    2004-01-01

    Eucommia ulmoides Oliv. is a typical sympodial branching tree. The apical bud of the branch ages and dies every year, replaced by the nearby axillary bud in the second year. Structural assays and a series of biochemical analyses were performed to analyze the senescence mechanism in the apical bud. It was revealed that most cells of the apical bud underwent the programmed cell death (PCD) during the senescence: the chromosomes were congregated and the nuclear contents were condensed, as shown by 4′,6-diamidino-2-phenylindole (DAPI) fluorescence. DNA fragmentation was detected during senescence using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end in situ labeling (TUNEL) method, coincident with the appearance of a DNA ladder. Moreover, a 20 kD DNase related to fragmentation was found. PCD was initiated first in the young leaves, leaf primordia and peripheral zone cells, then in the central mother cells and initial layer cells in the apical meristem. The terminal buds remain in vegetative growth during senescence, in contrast to buds of many annual plants.

  19. Differentiated dynamics of bud dormancy and growth in temperate fruit trees relating to bud phenology adaptation, the case of apple and almond trees

    Science.gov (United States)

    El Yaacoubi, Adnane; Malagi, Gustavo; Oukabli, Ahmed; Citadin, Idemir; Hafidi, Majida; Bonhomme, Marc; Legave, Jean-Michel

    2016-04-01

    Few studies have focused on the characterization of bud dormancy and growth dynamics for temperate fruit species in temperate and mild cropping areas, although this is an appropriate framework to anticipate phenology adaptation facing future warming contexts which would potentially combine chill declines and heat increases. To examine this issue, two experimental approaches and field observations were used for high- and low-chill apple cultivars in temperate climate of southern France and in mild climates of northern Morocco and southern Brazil. Low-chill almond cultivars offered an additional relevant plant material for comparison with apple in northern Morocco. Divergent patterns of dormancy and growth dynamics were clearly found in apple tree between southern France and southern Brazil. Divergences were less pronounced between France and Morocco. A global view outlined main differences in the dormancy chronology and intensity, the transition between endordormancy and ecodormancy and the duration of ecodormancy. A key role of bud rehydration in the transition period was shown. High-chill cultivars would be submitted in mild conditions to heterogeneous rehydration capacities linked to insufficient chill fulfillment and excessive forcing linked to high temperatures. This would favor bud competitions and consequently excessive flowering durations and weak flowering. Low chilling requirements in apple and almond would conversely confer biological capacities to tolerate superficial dormancy and abrupt transition from endordormancy to ecodormancy without important heterogeneous rehydration states within buds. It may also assume that low-chill cultivars can also tolerate high temperatures during ecodormancy as well as extended flowering durations.

  20. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection

    Directory of Open Access Journals (Sweden)

    Yi-ke Li

    2015-01-01

    Full Text Available The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: control, unilateral chorda tympani nerve transection and unilateral chorda tympani nerve transection + lingual nerve transection. Rats were allowed up to 42 days of recovery before being euthanized. The taste buds were visualized using a cytokeratin 8 antibody. Taste bud counts, volumes and taste receptor cell numbers were quantified and compared among groups. No significant difference was detected between the chorda tympani nerve transection and chorda tympani nerve transection + lingual nerve transection groups. Taste bud counts, volumes and taste receptor cell numbers on the ipsilateral side all decreased significantly compared with control. On the contralateral side, the number of taste buds remained unchanged over time, but they were larger, and taste receptor cells were more numerous postoperatively. There was no evidence for a role of the trigeminal branch of the lingual nerve in maintaining the structural integrity of the anterior taste buds.

  1. Molecular contacts for chlorosome envelope proteins revealed by cross-linking studies with chlorosomes from Chlorobium tepidum

    DEFF Research Database (Denmark)

    Li, Hui; Frigaard, Niels-Ulrik; Bryant, Donald A

    2006-01-01

    replaced with glutaraldehyde. Specific interactions between chlorosome proteins in cross-linked products were identified by immunoblotting with polyclonal antibodies raised against recombinant chlorosome proteins. We confirmed these interactions by demonstrating that these products were missing in...... type and mutants lacking a single chlorosome protein were cross-linked with the zero-length cross-linker 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide (EDC) and analyzed by gel electrophoresis. Similar cross-linking products were observed when the time and temperature were varied or when EDC was...

  2. Oxytocin signaling in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Michael S Sinclair

    Full Text Available BACKGROUND: The neuropeptide, oxytocin (OXT, acts on brain circuits to inhibit food intake. Mutant mice lacking OXT (OXT knockout overconsume salty and sweet (i.e. sucrose, saccharin solutions. We asked if OXT might also act on taste buds via its receptor, OXTR. METHODOLOGY/PRINCIPAL FINDINGS: Using RT-PCR, we detected the expression of OXTR in taste buds throughout the oral cavity, but not in adjacent non-taste lingual epithelium. By immunostaining tissues from OXTR-YFP knock-in mice, we found that OXTR is expressed in a subset of Glial-like (Type I taste cells, and also in cells on the periphery of taste buds. Single-cell RT-PCR confirmed this cell-type assignment. Using Ca2+ imaging, we observed that physiologically appropriate concentrations of OXT evoked [Ca2+]i mobilization in a subset of taste cells (EC50 approximately 33 nM. OXT-evoked responses were significantly inhibited by the OXTR antagonist, L-371,257. Isolated OXT-responsive taste cells were neither Receptor (Type II nor Presynaptic (Type III cells, consistent with our immunofluorescence observations. We also investigated the source of OXT peptide that may act on taste cells. Both RT-PCR and immunostaining suggest that the OXT peptide is not produced in taste buds or in their associated nerves. Finally, we also examined the morphology of taste buds from mice that lack OXTR. Taste buds and their constituent cell types appeared very similar in mice with two, one or no copies of the OXTR gene. CONCLUSIONS/SIGNIFICANCE: We conclude that OXT elicits Ca2+ signals via OXTR in murine taste buds. OXT-responsive cells are most likely a subset of Glial-like (Type I taste cells. OXT itself is not produced locally in taste tissue and is likely delivered through the circulation. Loss of OXTR does not grossly alter the morphology of any of the cell types contained in taste buds. Instead, we speculate that OXT-responsive Glial-like (Type I taste bud cells modulate taste signaling and afferent

  3. Competitive canalization of PIN-dependent auxin flow from axillary buds controls pea bud outgrowth.

    Science.gov (United States)

    Balla, Jozef; Kalousek, Petr; Reinöhl, Vilém; Friml, Jiří; Procházka, Stanislav

    2011-02-01

    Shoot branching is one of the major determinants of plant architecture. Polar auxin transport in stems is necessary for the control of bud outgrowth by a dominant apex. Here, we show that following decapitation in pea (Pisum sativum L.), the axillary buds establish directional auxin export by subcellular polarization of PIN auxin transporters. Apical auxin application on the decapitated stem prevents this PIN polarization and canalization of laterally applied auxin. These results support a model in which the apical and lateral auxin sources compete for primary channels of auxin transport in the stem to control the outgrowth of axillary buds. PMID:21219506

  4. Comprehensive Cross-Linking Mass Spectrometry Reveals Parallel Orientation and Flexible Conformations of Plant HOP2-MND1.

    Science.gov (United States)

    Rampler, Evelyn; Stranzl, Thomas; Orban-Nemeth, Zsuzsanna; Hollenstein, David Maria; Hudecz, Otto; Schloegelhofer, Peter; Mechtler, Karl

    2015-12-01

    The HOP2-MND1 heterodimer is essential for meiotic homologous recombination in plants and other eukaryotes and promotes the repair of DNA double-strand breaks. We investigated the conformational flexibility of HOP2-MND1, important for understanding the mechanistic details of the heterodimer, with chemical cross-linking in combination with mass spectrometry (XL-MS). The final XL-MS workflow encompassed the use of complementary cross-linkers, quenching, digestion, size exclusion enrichment, and HCD-based LC-MS/MS detection prior to data evaluation. We applied two different homobifunctional amine-reactive cross-linkers (DSS and BS(2)G) and one zero-length heterobifunctional cross-linker (EDC). Cross-linked peptides of four biological replicates were analyzed prior to 3D structure prediction by protein threading and protein-protein docking for cross-link-guided molecular modeling. Miniaturization of the size-exclusion enrichment step reduced the required starting material, led to a high amount of cross-linked peptides, and allowed the analysis of replicates. The major interaction site of HOP2-MND1 was identified in the central coiled-coil domains, and an open colinear parallel arrangement of HOP2 and MND1 within the complex was predicted. Moreover, flexibility of the C-terminal capping helices of both complex partners was observed, suggesting the coexistence of a closed complex conformation in solution. PMID:26535604

  5. Organization of Subunits in the Membrane Domain of the Bovine F-ATPase Revealed by Covalent Cross-linking*

    Science.gov (United States)

    Lee, Jennifer; Ding, ShuJing; Walpole, Thomas B.; Holding, Andrew N.; Montgomery, Martin G.; Fearnley, Ian M.; Walker, John E.

    2015-01-01

    The F-ATPase in bovine mitochondria is a membrane-bound complex of about 30 subunits of 18 different kinds. Currently, ∼85% of its structure is known. The enzyme has a membrane extrinsic catalytic domain, and a membrane intrinsic domain where the turning of the enzyme's rotor is generated from the transmembrane proton-motive force. The domains are linked by central and peripheral stalks. The central stalk and a hydrophobic ring of c-subunits in the membrane domain constitute the enzyme's rotor. The external surface of the catalytic domain and membrane subunit a are linked by the peripheral stalk, holding them static relative to the rotor. The membrane domain contains six additional subunits named ATP8, e, f, g, DAPIT (diabetes-associated protein in insulin-sensitive tissues), and 6.8PL (6.8-kDa proteolipid), each with a single predicted transmembrane α-helix, but their orientation and topography are unknown. Mutations in ATP8 uncouple the enzyme and interfere with its assembly, but its roles and the roles of the other five subunits are largely unknown. We have reacted accessible amino groups in the enzyme with bifunctional cross-linking agents and identified the linked residues. Cross-links involving the supernumerary subunits, where the structures are not known, show that the C terminus of ATP8 extends ∼70 Å from the membrane into the peripheral stalk and that the N termini of the other supernumerary subunits are on the same side of the membrane, probably in the mitochondrial matrix. These experiments contribute significantly toward building up a complete structural picture of the F-ATPase. PMID:25851905

  6. Identification and Quality Assessment of Chrysanthemum Buds by CE Fingerprinting

    Directory of Open Access Journals (Sweden)

    Xiaoping Xing

    2015-01-01

    Full Text Available A simple and efficient fingerprinting method for chrysanthemum buds was developed with the aim of establishing a quality control protocol based on biochemical makeup. Chrysanthemum bud samples were successively extracted by water and alcohol. The fingerprints of the chrysanthemum buds samples were obtained using capillary electrophoresis and electrochemical detection (CE-ED employing copper and carbon working electrodes to capture all of the chemical information. 10 batches of chrysanthemum buds were collected from different regions and various factories to establish the baseline fingerprint. The experimental data of 10 batches electropherogram buds by CE were analyzed by correlation coefficient and the included angle cosine methods. A standard chrysanthemum bud fingerprint including 24 common peaks was established, 12 from each electrode, which was successfully applied to identify and distinguish between chrysanthemum buds from 2 other chrysanthemum species. These results demonstrate that fingerprint analysis can be used as an important criterion for chrysanthemum buds quality control.

  7. Bilingual Buds: The Evolution of a Program

    Science.gov (United States)

    Huang, Sharon

    2009-01-01

    The impetus to begin Bilingual Buds came about six years ago when the author, pregnant with twins and commuting into New York City, was reading about the numerous cognitive benefits for children of acquiring a second language early in their lives. She was surprised to learn that even by the age of six months, children begin to lose the ability to…

  8. mtDNA analysis shows common ancestry in two kindreds with X-linked recessive hypoparathyroidism and reveals a heteroplasmic silent mutation.

    OpenAIRE

    Mumm, S; Whyte, M. P.; Thakker, R V; Buetow, K H; Schlessinger, D.

    1997-01-01

    Two kindreds residing in eastern Missouri and exhibiting X-linked recessive idiopathic hypoparathyroidism have been described. Genealogical records extending back five generations revealed no common ancestor. To investigate the possibility of relatedness, the DNA sequence of the mitochondrial D-loop was compared among several individuals in both kindreds. The mtDNA D-loop was amplified from the total DNA of individuals by use of nested PCR reactions, and the resulting 430-bp fragment was sequ...

  9. Bipolar budding in yeasts - an electron microscope study

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    Bud formation in yeasts with bipolar budding was studied by electron microscopy of thin sections. Budding in yeasts of the species Saccharomycodes ludwigii, Hanseniaspora valbyensis and Wickerhamia fluorescens resulted in concentric rings of scar ridges on the wall of the mother cell. The wall betwe

  10. Requirement of RNA synthesis for bud morphogenesis in hydra

    International Nuclear Information System (INIS)

    Inhibition of RNA synthesis in hydra resulted in complete suppression of bud morphogenesis. A partial inhibition allowed the bud formation, but affected the development of nematocysts, gland cells and interstitial cells. These results indicate that bud morphogenesis in hydra is associated with new DNA-dependent RNA synthesis. (author)

  11. Exome capture reveals ZNF423 and CEP164 mutations, linking renal ciliopathies to DNA damage response signaling

    DEFF Research Database (Denmark)

    Chaki, Moumita; Airik, Rannar; Ghosh, Amiya K;

    2012-01-01

    Nephronophthisis-related ciliopathies (NPHP-RC) are degenerative recessive diseases that affect kidney, retina, and brain. Genetic defects in NPHP gene products that localize to cilia and centrosomes defined them as "ciliopathies." However, disease mechanisms remain poorly understood. Here, we......, known to activate ATM at sites of DNA damage. We show that knockdown of CEP164 or ZNF423 causes sensitivity to DNA damaging agents and that cep164 knockdown in zebrafish results in dysregulated DDR and an NPHP-RC phenotype. Our findings link degenerative diseases of the kidney and retina, disorders of...

  12. Lamin Mutations Accelerate Aging via Defective Export of Mitochondrial mRNAs through Nuclear Envelope Budding.

    Science.gov (United States)

    Li, Yihang; Hassinger, Linda; Thomson, Travis; Ding, Baojin; Ashley, James; Hassinger, William; Budnik, Vivian

    2016-08-01

    Defective RNA metabolism and transport are implicated in aging and degeneration [1, 2], but the underlying mechanisms remain poorly understood. A prevalent feature of aging is mitochondrial deterioration [3]. Here, we link a novel mechanism for RNA export through nuclear envelope (NE) budding [4, 5] that requires A-type lamin, an inner nuclear membrane-associated protein, to accelerated aging observed in Drosophila LaminC (LamC) mutations. These LamC mutations were modeled after A-lamin (LMNA) mutations causing progeroid syndromes (PSs) in humans. We identified mitochondrial assembly regulatory factor (Marf), a mitochondrial fusion factor (mitofusin), as well as other transcripts required for mitochondrial integrity and function, in a screen for RNAs that exit the nucleus through NE budding. PS-modeled LamC mutations induced premature aging in adult flight muscles, including decreased levels of specific mitochondrial protein transcripts (RNA) and progressive mitochondrial degradation. PS-modeled LamC mutations also induced the accelerated appearance of other phenotypes associated with aging, including a progressive accumulation of polyubiquitin aggregates [6, 7] and myofibril disorganization [8, 9]. Consistent with these observations, the mutants had progressive jumping and flight defects. Downregulating marf alone induced the above aging defects. Nevertheless, restoring marf was insufficient for rescuing the aging phenotypes in PS-modeled LamC mutations, as other mitochondrial RNAs are affected by inhibition of NE budding. Analysis of NE budding in dominant and recessive PS-modeled LamC mutations suggests a mechanism by which abnormal lamina organization prevents the egress of these RNAs via NE budding. These studies connect defects in RNA export through NE budding to progressive loss of mitochondrial integrity and premature aging. PMID:27451905

  13. The proteomic profile of Stichodactyla duerdeni secretion reveals the presence of a novel O-linked glycopeptide

    DEFF Research Database (Denmark)

    Cassoli, Juliana Silva; Verano-Braga, Thiago; Oliveira, Joacir Stolarz;

    2013-01-01

    , a new peptide of 3431Da, named U-SHTX-Sdd1, was purified and completely sequenced by automated Edman's degradation and tandem mass spectrometry. An analysis of U-SHTX-Sdd1 revealed a modified O-HexNAc-Threonine at position 1, which, at the best of our knowledge, constitutes the first sea anemone toxin...

  14. Variant of X-Linked Chronic Granulomatous Disease Revealed by a Severe Burkholderia cepacia Invasive Infection in an Infant

    Directory of Open Access Journals (Sweden)

    Saul Oswaldo Lugo Reyes

    2013-01-01

    Full Text Available Chronic granulomatous disease (CGD is a primary immunodeficiency characterized by increased susceptibility to bacteria and fungi since early in life, caused by mutations in any of the five genes coding for protein subunits in NADPH oxidase. X-linked variant CGD can be missed during routine evaluation or present later in life due to hypomorphic mutations and a residual superoxide production. The case of a 10-month-old boy who died of pneumonia is reported. The isolation of Burkholderia cepacia from his lung, together with a marginally low nitroblue tetrazolium reduction assay (NBT, made us suspect and pursue the molecular diagnosis of CGD. A postmortem genetic analysis finally demonstrated CGD caused by a hypomorphic missense mutation with normal gp91phox expression. In a patient being investigated for unusually severe or recurrent infection, a high index of suspicion of immunodeficiency must be maintained.

  15. Molecular Mechanism of Arenavirus Assembly and Budding

    OpenAIRE

    Shuzo Urata; Jiro Yasuda

    2012-01-01

    Arenaviruses have a bisegmented negative-strand RNA genome, which encodes four viral proteins: GP and NP by the S segment and L and Z by the L segment. These four viral proteins possess multiple functions in infection, replication and release of progeny viruses from infected cells. The small RING finger protein, Z protein is a matrix protein that plays a central role in viral assembly and budding. Although all arenaviruses encode Z protein, amino acid sequence alignment showed a huge variety ...

  16. Architecture of the RNA polymerase II-TFIIF complex revealed by cross-linking and mass spectrometry

    DEFF Research Database (Denmark)

    Chen, Zhuo Angel; Jawhari, Anass; Fischer, Lutz;

    2010-01-01

    Higher-order multi-protein complexes such as RNA polymerase II (Pol II) complexes with transcription initiation factors are often not amenable to X-ray structure determination. Here, we show that protein cross-linking coupled to mass spectrometry (MS) has now sufficiently advanced as a tool to...... extend the Pol II structure to a 15-subunit, 670 kDa complex of Pol II with the initiation factor TFIIF at peptide resolution. The N-terminal regions of TFIIF subunits Tfg1 and Tfg2 form a dimerization domain that binds the Pol II lobe on the Rpb2 side of the active centre cleft near downstream DNA. The...... C-terminal winged helix (WH) domains of Tfg1 and Tfg2 are mobile, but the Tfg2 WH domain can reside at the Pol II protrusion near the predicted path of upstream DNA in the initiation complex. The linkers between the dimerization domain and the WH domains in Tfg1 and Tfg2 are located to the jaws and...

  17. 6-benzyladenine metabolism during reinvigoration of mature Pinus radiata buds in vitro.

    Science.gov (United States)

    Zhang, Huaibi; Horgan, Kathryn J; Reynolds, Paul H S; Jameson, Paula E

    2010-04-01

    Maturation or phase change is a serious challenge in the deployment of superior trees of Pinus radiata D. Don because of the difficulties associated with propagation of cuttings from mature trees. We used an in vitro system to study 6-benzyladenine (BA)-induced reinvigoration of the fascicle meristems of mature buds during in vitro culture. Anatomical examinations revealed that BA inhibited the development of secondary needle primordia and 'rejuvenated' the fascicle meristems of the mature bud to produce primary needles, which are characteristic of the juvenile phase in P. radiata. Without BA supplement in the culture media, fascicle primordia continued developing secondary needles and quiescent fascicle meristems. BA metabolite analysis showed that the novel cytokinin pathway reported previously in P. radiata (H. Zhang, K.J. Horgan, P.H.S. Reynolds, G.E. Norris and P.E. Jameson. 2001. Novel cytokinins: The predominant forms in mature buds of Pinus radiata. Physiol. Plant. 112: 127-134) was mirrored in vitro, with BA converted into a variety of metabolites including 6-benzylamino-9-glucopyranosylribosyl-purine and its novel phosphorylated form, 6-benzylamino-9-glucopyranosylribosyl-purine. The culture of mature buds in the presence of BA caused a reduction in the level of endogenous cytokinins, suggesting a direct action of BA itself. Similar correlations are noted between levels of certain metabolites and the maturation status of buds from field-grown trees and buds in culture, indicating that this in vitro system may be a good model for studying the processes of maturation and reinvigoration. PMID:20144924

  18. CPAG: software for leveraging pleiotropy in GWAS to reveal similarity between human traits links plasma fatty acids and intestinal inflammation.

    Science.gov (United States)

    Wang, Liuyang; Oehlers, Stefan H; Espenschied, Scott T; Rawls, John F; Tobin, David M; Ko, Dennis C

    2015-01-01

    Meta-analyses of genome-wide association studies (GWAS) have demonstrated that the same genetic variants can be associated with multiple diseases and other complex traits. We present software called CPAG (Cross-Phenotype Analysis of GWAS) to look for similarities between 700 traits, build trees with informative clusters, and highlight underlying pathways. Clusters are consistent with pre-defined groups and literature-based validation but also reveal novel connections. We report similarity between plasma palmitoleic acid and Crohn's disease and find that specific fatty acids exacerbate enterocolitis in zebrafish. CPAG will become increasingly powerful as more genetic variants are uncovered, leading to a deeper understanding of complex traits. CPAG is freely available at www.sourceforge.net/projects/CPAG/. PMID:26374098

  19. Motor dysfunction in the tottering mouse is linked to cerebellar spontaneous low frequency oscillations revealed by flavoprotein autofluorescence optical imaging

    Science.gov (United States)

    Chen, Gang; Popa, Laurentiu S.; Wang, Xinming; Gao, Wangcai; Barnes, Justin; Hendrix, Claudia M.; Hess, Ellen J.; Ebner, Timothy J.

    2009-02-01

    Flavoprotein autofluorescence optical imaging is developing into a powerful research tool to study neural activity, particularly in vivo. In this study we used this imaging technique to investigate the neuronal mechanism underlying the episodic movement disorder that is characteristic of the tottering (tg) mouse, a model of episodic ataxia type 2. Both EA2 and the tg mouse are caused by mutations in the gene encoding Cav2.1 (P/Q-type) voltage-gated Ca2+ channels. These mutations result in a reduction in P/Q Ca2+ channel function. Both EA2 patients and tg mice have a characteristic phenotype consisting of transient motor attacks triggered by stress, caffeine or ethanol. The neural events underlying these episodes of dystonia are unknown. Flavoprotein autofluorescence optical imaging revealed spontaneous, transient, low frequency oscillations in the cerebellar cortex of the tg mouse. Lasting from 30 - 120 minutes, the oscillations originate in one area then spread to surrounding regions over 30 - 60 minutes. The oscillations are reduced by removing extracellular Ca2+ and blocking Cav 1.2/1.3 (L-type) Ca2+ channels. The oscillations are not affected by blocking AMPA receptors or by electrical stimulation of the parallel fiber - Purkinje cell circuit, suggesting the oscillations are generated intrinsically in the cerebellar cortex. Conversely, L-type Ca2+ agonists generate oscillations with similar properties. In the awake tg mouse, transcranial flavoprotein imaging revealed low frequency oscillations that are accentuated during caffeine induced attacks of dystonia. The oscillations increase during the attacks of dystonia and are coupled to oscillations in face and hindlimb EMG activity. These transient oscillations and the associated cerebellar dysfunction provide a novel mechanism by which an ion channel disorder results in episodic motor dysfunction.

  20. Post-transcriptional regulation in budding yeast meiosis.

    Science.gov (United States)

    Jin, Liang; Neiman, Aaron M

    2016-05-01

    The precise regulation of gene expression is essential for developmental processes in eukaryotic organisms. As an important post-transcriptional regulatory point, translational control is complementary to transcriptional regulation. Sporulation in the budding yeast Saccharomyces cerevisiae is a developmental process controlled by a well-studied transcriptional cascade that drives the cell through the events of DNA replication, meiotic chromosome segregation, and spore assembly. Recent studies have revealed that as cells begin the meiotic divisions, translational regulation of gene expression fine tunes this transcriptional cascade. The significance and mechanisms of this translational regulation are beginning to emerge. These studies may also provide insights into translational regulation in germ cell development of multicellular organisms. PMID:26613728

  1. High-resolution time series of vessel density in Kenyan mangrove trees reveal a link with climate.

    Science.gov (United States)

    Verheyden, Anouk; De Ridder, Fjo; Schmitz, Nele; Beeckman, Hans; Koedam, Nico

    2005-08-01

    Tropical trees are often excluded from dendrochronological investigations because of a lack of distinct growth ring boundaries, causing a gap in paleoclimate reconstructions from tropical regions. The potential use of time series of vessel features (density, diameter, surface area and hydraulic conductivity) combined with spectral analysis as a proxy for environmental conditions in the mangrove Rhizophora mucronata was investigated. Intra-annual differences in the vessel features revealed a trade-off between hydraulic efficiency (large vessels) during the rainy season and hydraulic safety (small, more numerous vessels) during the dry season. In addition to the earlywood-latewood variations, a semiannual signal was discovered in the vessel density and diameters after Fourier transformation. The similarity in the Fourier spectra of the vessel features and the climate data, in particular mean relative humidity and precipitation, provides strong evidence for a climatic driving force for the intra-annual variability of the vessel features. The high-resolution approach used in this study, in combination with spectral analysis, may have great potential for the study of climate variability in tropical regions. PMID:15998396

  2. Sequence analysis of the ERCC2 gene regions in human, mouse, and hamster reveals three linked genes

    Energy Technology Data Exchange (ETDEWEB)

    Lamerdin, J.E.; Stilwagen, S.A.; Ramirez, M.H. [Lawrence Livermore National Lab., CA (United States)] [and others

    1996-06-15

    The ERCC2 (excision repair cross-complementing rodent repair group 2) gene product is involved in transcription-coupled repair as an integral member of the basal transcription factor BTF2/TFIIH complex. Defects in this gene can result in three distinct human disorders, namely the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. We report the comparative analysis of 91.6 kb of new sequence including 54.3 kb encompassing the human ERCC2 locus, the syntenic region in the mouse (32.6 kb), and a further 4.7 kb of sequence 3{prime} of the previously reported ERCC2 region in the hamster. In addition to ERCC2, our analysis revealed the presence of two previously undescribed genes in all three species. The first is centromeric (in the human) to ERCC2 and is most similar to the kinesin light chain gene in sea urchin. The second gene is telomeric (in the human) to ERCC2 and contains a motif found in ankyrins, some cell proteins, and transcription factors. Multiple EST matches to this putative new gene indicate that it is expressed in several human tissues, including breast. The identification and description of two new genes provides potential candidate genes for disorders mapping to this region of 19q13.2. 42 refs., 6 figs., 3 tabs.

  3. Sequence analysis of the ERCC2 gene regions in human, mouse, and hamster reveals three linked genes.

    Science.gov (United States)

    Lamerdin, J E; Stilwagen, S A; Ramirez, M H; Stubbs, L; Carrano, A V

    1996-06-15

    The ERCC2 (excision repair cross-complementing rodent repair group 2) gene product is involved in transcription-coupled repair as an integral member of the basal transcription factor BTF2/TFIIH complex. Defects in this gene can result in three distinct human disorders, namely the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. We report the comparative analysis of 91.6 kb of new sequence including 54.3 kb encompassing the human ERCC2 locus, the syntenic region in the mouse (32.6 kb), and a further 4.7 kb of sequence 3' of the previously reported ERCC2 region in the hamster. In addition to ERCC2, our analysis revealed the presence of two previously undescribed genes in all three species. The first is centromeric (in the human) to ERCC2 and is most similar to the kinesin light chain gene in sea urchin. The second gene is telomeric (in the human) to ERCC2 and contains a motif found in ankyrins, some cell cycle proteins, and transcription factors. Multiple EST matches to this putative new gene indicate that it is expressed in several human tissues, including breast. The identification and description of two new genes provides potential candidate genes for disorders mapping to this region of 19q13.2. PMID:8786141

  4. Breadth of Tuning and Taste Coding in Mammalian Taste Buds

    OpenAIRE

    Tomchik, Seth M.; Berg, Stephanie; Kim, Joung Woul; Chaudhari, Nirupa; Roper, Stephen D.

    2007-01-01

    A longstanding question in taste research concerns taste coding and, in particular, how broadly are individual taste bud cells tuned to taste qualities (sweet, bitter, umami, salty, and sour). Taste bud cells express G-protein-coupled receptors for sweet, bitter, or umami tastes but not in combination. However, responses to multiple taste qualities have been recorded in individual taste cells. We and others have shown previously there are two classes of taste bud cells directly involved in gu...

  5. A Monitor for Bud Emergence in the Yeast Morphogenesis Checkpoint

    OpenAIRE

    Theesfeld, Chandra L.; Zyla, Trevin R.; Bardes, Elaine G.S.; Lew, Daniel J.

    2003-01-01

    Cell cycle transitions are subject to regulation by both external signals and internal checkpoints that monitor satisfactory progression of key cell cycle events. In budding yeast, the morphogenesis checkpoint arrests the cell cycle in response to perturbations that affect the actin cytoskeleton and bud formation. Herein, we identify a step in this checkpoint pathway that seems to be directly responsive to bud emergence. Activation of the kinase Hsl1p is dependent upon...

  6. Processing Umami and Other Tastes in Mammalian Taste Buds

    OpenAIRE

    Roper, Stephen D.; Chaudhari, Nirupa

    2009-01-01

    Neuroscientists are now coming to appreciate that a significant degree of information processing occurs in the peripheral sensory organs of taste prior to signals propagating to the brain. Gustatory stimulation causes taste bud cells to secrete neurotransmitters that act on adjacent taste bud cells (paracrine transmitters) as well as on primary sensory afferent fibers (neurocrine transmitters). Paracrine transmission, representing cell-cell communication within the taste bud, has the potentia...

  7. The bud break process and its variation among local populations of boreal black spruce.

    Science.gov (United States)

    Rossi, Sergio; Bousquet, Jean

    2014-01-01

    Phenology of local populations can exhibit adaptations to the current environmental conditions resulting from a close interaction between climate and genotype. The bud break process and its variations among populations were analyzed in greenhouse by monitoring the growth resumption in black spruce [Picea mariana (Mill.) BSP] seedlings originating from seeds of five stands across the closed boreal forest in Quebec, Canada. Bud break lasted 15 days and occurred earlier and quicker in northern provenances. Provenance explained between 10.2 and 32.3% of the variance in bud break, while the families accounted for a smaller but still significant part of the variance. The late occurrence of one phenological phase corresponded to a delayed occurrence of the others according to linear relationships. A causal model was proposed in the form of a chain of events with each phase of bud break being related to the previous and successive one, while no link was observed between non-adjacent phases. The adaptation of black spruce populations along the latitudinal gradient points toward a strategy based on rapid physiological processes triggered by temperature increase inducing high metabolic activity. The variation observed in bud break reflects an evolutionary trade-off between maximization of security and taking advantage of the short growing season. This work provides evidence of the phenological adaptations of black spruce to its local environmental conditions while retaining sizeable genetic diversity within populations. Because of the multigenic nature of phenology, this diversity should provide some raw material for adaptation to changing local environmental conditions. PMID:25389430

  8. Essential Oil of Betula pendula Roth. Buds

    Directory of Open Access Journals (Sweden)

    Betül Demirci

    2004-01-01

    Full Text Available The essential oil of Betula pendula Roth. buds was obtained using both hydrodistillation and microdistillation techniques and their chemical compositions were analyzed using both gas chromatography (GC and gas chromatography–mass spectrometry (GC-MS. Overall, more than 50 compounds were identified representing 80% and 92% for hydrodistillation and microdistillation, respectively. The main components (by hydrodistillation and microdistillation, respectively found were α-copaene (12% and 10%, germacrene D (11% and 18% and δ-cadinene (11% and 15% in the analyzed essential oils. The microdistillation technique proved to be a useful tool and compliant alternative when compared to hydrodistillation.

  9. Essential Oil of Betula pendula Roth. Buds.

    Science.gov (United States)

    Demirci, Betül; Paper, Dietrich H; Demirci, Fatih; Can Başer, K Hüsnü; Franz, Gerhard

    2004-12-01

    The essential oil of Betula pendula Roth. buds was obtained using both hydrodistillation and microdistillation techniques and their chemical compositions were analyzed using both gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS). Overall, more than 50 compounds were identified representing 80% and 92% for hydrodistillation and microdistillation, respectively. The main components (by hydrodistillation and microdistillation, respectively) found were alpha-copaene (12% and 10%), germacrene D (11% and 18%) and delta-cadinene (11% and 15%) in the analyzed essential oils. The microdistillation technique proved to be a useful tool and compliant alternative when compared to hydrodistillation. PMID:15841263

  10. Development Correlations of the Buds of Grapevine (Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Liliana ROTARU

    2010-06-01

    Full Text Available The development characteristics of different buds of the grapevine are mainly related by stimulation and/or inhibition effects, the action of which is still inexplicable. The present study examines the development dynamics of the buds of a one-year old branch after excision of different buds and the application of ?-naphtyl acetic acid (ANA, as well as the growth capacity of each bud individually. We verified the effects of acrotony cited previously by various researchers. These effects are due to different developmental characteristics of which could to lay the groundwork for the improvement of different productions methods.

  11. Perception of photoperiod in individual buds of mature trees regulates leaf-out.

    Science.gov (United States)

    Zohner, Constantin M; Renner, Susanne S

    2015-12-01

    Experimental data on the perception of day length and temperature in dormant temperate zone trees are surprisingly scarce. In order to investigate when and where these environmental signals are perceived, we carried out bagging experiments in which buds on branches of Fagus sylvatica, Aesculus hippocastanum and Picea abies trees were exposed to natural light increase or kept at constant 8-h days from December until June. Parallel experiments used twigs cut from the same trees, harvesting treated and control twigs seven times and then exposing them to 8- or 16-h days in a glasshouse. Under 8-h days, budburst in Fagus outdoors was delayed by 41 d and in Aesculus by 4 d; in Picea, day length had no effect. Buds on nearby branches reacted autonomously, and leaf primordia only reacted to light cues in late dormancy after accumulating warm days. Experiments applying different wavelength spectra and high-resolution spectrometry to buds indicate a phytochrome-mediated photoperiod control. By demonstrating local photoperiodic control of buds, revealing the time when these signals are perceived, and showing the interplay between photoperiod and chilling, this study contributes to improved modelling of the impact of climate warming on photosensitive species. PMID:26096967

  12. Visualization of Assembly Intermediates and Budding Vacuoles of Singapore Grouper Iridovirus in Grouper Embryonic Cells

    Science.gov (United States)

    Liu, Yang; Tran, Bich Ngoc; Wang, Fan; Ounjai, Puey; Wu, Jinlu; Hew, Choy L.

    2016-01-01

    Iridovirid infection is associated with the catastrophic loss in aquaculture industry and the population decline of wild amphibians and reptiles, but none of the iridovirid life cycles have been well explored. Here, we report the detailed visualization of the life cycle of Singapore grouper iridovirus (SGIV) in grouper cells by cryo-electron microscopy (cryoEM) and tomography (ET). EM imaging revealed that SGIV viral particles have an outer capsid layer, and the interaction of this layer with cellular plasma membrane initiates viral entry. Subsequent viral replication leads to formation of a viral assembly site (VAS), where membranous structures emerge as precursors to recruit capsid proteins to form an intermediate, double-shell, crescent-shaped structure, which curves to form icosahedral capsids. Knockdown of the major capsid protein eliminates the formation of viral capsids. As capsid formation progresses, electron-dense materials known to be involved in DNA encapsidation accumulate within the capsid until it is fully occupied. Besides the well-known budding mechanism through the cell periphery, we demonstrate a novel budding process in which viral particles bud into a tubular-like structure within vacuoles. This budding process may denote a new strategy used by SGIV to disseminate viral particles into neighbor cells while evading host immune response. PMID:26727547

  13. Specific residues of the GDP/GTP exchange factor Bud5p are involved in establishment of the cell type-specific budding pattern in yeast.

    Science.gov (United States)

    Kang, Pil Jung; Lee, Bongyong; Park, Hay-Oak

    2004-07-01

    Cells of the budding yeast undergo oriented cell division by choosing a specific site for growth depending on their cell type. Haploid a and alpha cells bud in an axial pattern whereas diploid a/alpha cells bud in a bipolar pattern. The Ras-like GTPase Rsr1p/Bud1p, its GDP-GTP exchange factor Bud5p, and its GTPase-activating protein Bud2p are essential for selecting the proper site for polarized growth in all cell types. Here we showed that specific residues at the N terminus and the C terminus of Bud5p were important for bipolar budding, while some residues were involved in both axial and bipolar budding. These bipolar-specific mutations of BUD5 disrupted proper localization of Bud5p in diploid a/alpha cells without affecting Bud5p localization in haploid alpha cells. In contrast, Bud5p expressed in the bud5 mutants defective in both budding patterns failed to localize in all cell types. Thus, these results identify specific residues of Bud5p that are likely to be involved in direct interaction with spatial landmarks, which recruit Bud5p to the proper bud site. Finally, we found a new start codon of BUD5, which extends the open reading frame to 210 bp upstream of the previously estimated start site, thus encoding a polypeptide of 608 amino acid residues. Bud5p with these additional N-terminal residues interacted with Bud8p, a potential bipolar landmark, suggesting that the N-terminal region is necessary for recognition of the spatial cues. PMID:15136576

  14. Architecture of a Full-length Retroviral Integrase Monomer and Dimer, Revealed by Small Angle X-ray Scattering and Chemical Cross-linking

    Energy Technology Data Exchange (ETDEWEB)

    Bojja, Ravi S.; Andrake, Mark D.; Weigand, Steven; Merkel, George; Yarychkivska, Olya; Henderson, Adam; Kummerling, Marissa; Skalka, Anna Marie (Fox Chase); (NWU)

    2012-02-07

    We determined the size and shape of full-length avian sarcoma virus (ASV) integrase (IN) monomers and dimers in solution using small angle x-ray scattering. The low resolution data obtained establish constraints for the relative arrangements of the three component domains in both forms. Domain organization within the small angle x-ray envelopes was determined by combining available atomic resolution data for individual domains with results from cross-linking coupled with mass spectrometry. The full-length dimer architecture so revealed is unequivocally different from that proposed from x-ray crystallographic analyses of two-domain fragments, in which interactions between the catalytic core domains play a prominent role. Core-core interactions are detected only in cross-linked IN tetramers and are required for concerted integration. The solution dimer is stabilized by C-terminal domain (CTD-CTD) interactions and by interactions of the N-terminal domain in one subunit with the core and CTD in the second subunit. These results suggest a pathway for formation of functional IN-DNA complexes that has not previously been considered and possible strategies for preventing such assembly.

  15. Sponzoring fotbalového klubu SK Slavia České Budějovice

    OpenAIRE

    Bohůnek, Matěj

    2013-01-01

    This bachelor thesis reveals the role of sponsoring of non-professional regional football club SK Slavia České Budějovice. Field research examines the fans of the club and their perception of sponsors as well as the sponsor's motivation which made them cooperate with this club. Obtained results based on this research could be used for improving cooperatition between the club and its sponsors.

  16. The role of spatially controlled cell proliferation in limb bud morphogenesis.

    Directory of Open Access Journals (Sweden)

    Bernd Boehm

    Full Text Available Although the vertebrate limb bud has been studied for decades as a model system for spatial pattern formation and cell specification, the cellular basis of its distally oriented elongation has been a relatively neglected topic by comparison. The conventional view is that a gradient of isotropic proliferation exists along the limb, with high proliferation rates at the distal tip and lower rates towards the body, and that this gradient is the driving force behind outgrowth. Here we test this hypothesis by combining quantitative empirical data sets with computer modelling to assess the potential role of spatially controlled proliferation rates in the process of directional limb bud outgrowth. In particular, we generate two new empirical data sets for the mouse hind limb--a numerical description of shape change and a quantitative 3D map of cell cycle times--and combine these with a new 3D finite element model of tissue growth. By developing a parameter optimization approach (which explores spatial patterns of tissue growth our computer simulations reveal that the observed distribution of proliferation rates plays no significant role in controlling the distally extending limb shape, and suggests that directional cell activities are likely to be the driving force behind limb bud outgrowth. This theoretical prediction prompted us to search for evidence of directional cell orientations in the limb bud mesenchyme, and we thus discovered a striking highly branched and extended cell shape composed of dynamically extending and retracting filopodia, a distally oriented bias in Golgi position, and also a bias in the orientation of cell division. We therefore provide both theoretical and empirical evidence that limb bud elongation is achieved by directional cell activities, rather than a PD gradient of proliferation rates.

  17. Kinetics of human immunodeficiency virus budding and assembly

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan

    2009-03-01

    Human immunodeficiency virus (HIV) belongs to a large family of RNA viruses, retroviruses. Unlike budding of regular enveloped viruses, retroviruses bud concurrently with the assembly of retroviral capsids on the cell membrane. The kinetics of HIV (and other retroviruses) budding and assembly is therefore strongly affected by the elastic energy of the membrane and fundamentally different from regular viruses. The main result of this work shows that the kinetics is tunable from a fast budding process to a slow and effectively trapped partial budding process, by varying the attractive energy of retroviral proteins (call Gags), relative to the membrane elastic energy. When the Gag-Gag attraction is relatively high, the membrane elastic energy provides a kinetic barrier for the two pieces of the partial capsids to merge. This energy barrier determines the slowest step in the kinetics and the budding time. In the opposite limit, the membrane elastic energy provides not only a kinetic energy barrier, but a free energy barrier. The budding and assembly is effectively trapped at local free energy minimum, corresponding to a partially budded state. The time scale to escape from this metastable state is exponentially large. In both cases, our result fit with experimental measurements pretty well.

  18. A Monitor for Bud Emergence in the Yeast Morphogenesis Checkpoint

    Science.gov (United States)

    Theesfeld, Chandra L.; Zyla, Trevin R.; Bardes, Elaine G.S.; Lew, Daniel J.

    2003-01-01

    Cell cycle transitions are subject to regulation by both external signals and internal checkpoints that monitor satisfactory progression of key cell cycle events. In budding yeast, the morphogenesis checkpoint arrests the cell cycle in response to perturbations that affect the actin cytoskeleton and bud formation. Herein, we identify a step in this checkpoint pathway that seems to be directly responsive to bud emergence. Activation of the kinase Hsl1p is dependent upon its recruitment to a cortical domain organized by the septins, a family of conserved filament-forming proteins. Under conditions that delayed or blocked bud emergence, Hsl1p recruitment to the septin cortex still took place, but hyperphosphorylation of Hsl1p and recruitment of the Hsl1p-binding protein Hsl7p to the septin cortex only occurred after bud emergence. At this time, the septin cortex spread to form a collar between mother and bud, and Hsl1p and Hsl7p were restricted to the bud side of the septin collar. We discuss models for translating cellular geometry (in this case, the emergence of a bud) into biochemical signals regulating cell proliferation. PMID:12925763

  19. An elastic model of partial budding of retroviruses

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan

    2008-03-01

    Retroviruses are characterized by their unique infection strategy of reverse transcription, in which the genetic information flows from RNA back to DNA. The most well known representative is the human immunodeficiency virus (HIV). Unlike budding of traditional enveloped viruses, retrovirus budding happens together with the formation of spherical virus capsids at the cell membrane. Led by this unique budding mechanism, we proposed an elastic model of retrovirus budding in this work. We found that if the lipid molecules of the membrane are supplied fast enough from the cell interior, the budding always proceeds to completion. In the opposite limit, there is an optimal size of partially budded virions. The zenith angle of these partially spherical capsids, α, is given by α˜(2̂/κσ)^1/4, where κ is the bending modulus of the membrane, σ is the surface tension of the membrane, and τ characterizes the strength of capsid protein interaction. If τ is large enough such that α˜π, the budding is complete. Our model explained many features of retrovirus partial budding observed in experiments.

  20. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones Data detail Data name 5'-end sequence...s of budding yeast full-length cDNA clones Description of data contents cDNA sequence...e Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive ...

  1. This bud's for you: mechanisms of cellular nucleocytoplasmic trafficking via nuclear envelope budding.

    Science.gov (United States)

    Fradkin, Lee G; Budnik, Vivian

    2016-08-01

    The nuclear envelope (NE) physically separates the cytoplasmic and nuclear compartments. While this barrier provides advantages, it also presents a challenge for the nuclear export of large ribonucleoprotein (RNP) complexes. Decades-old dogma holds that all such border-crossing is via the nuclear pore complex (NPC). However, the diameter of the NPC central channel limits the passage of large cargos. Here, we review evidence that such large RNPs employ an endogenous NE-budding pathway, previously thought to be exclusive to the nuclear egress of Herpes viruses. We discuss this and other models proposed, the likelihood that this pathway is conserved, and the consequences of disrupting NE-budding for synapse development, localized translation of synaptic mRNAs, and laminopathies inducing accelerated aging. PMID:27236823

  2. Budding and Fission of a multiphase vesicle

    CERN Document Server

    Allain, J M; Allain, Jean-Marc; Amar, Martine Ben

    2005-01-01

    We present a model of bi-phasic vesicle in the limit of large surface tension. In this regime, the vesicle is completely stretched and well described by two spherical caps with a fold which concentrates the membrane stress. The conservation laws and geometric constraints restrict the space of possible shapes to a pair of solutions labeled by a parameter $\\tau$ given by {\\it line tension/pressure}. For a given $\\tau$ value, the two solutions differ by the length of the interface between domains. For a critical value $\\tau\\_c$, the two vesicle shapes become identical and no solution exists above this critical value. This model sheds new light on two proposed mechanisms (osmotic shocks and molecule absorption) to explain the budding and the fission in recent experiments.

  3. Calling Card Analysis in Budding Yeast.

    Science.gov (United States)

    Mayhew, David; Mitra, Robi D

    2016-02-01

    Calling card analysis is a high-throughput method for identifying the genomic binding sites of multiple transcription factors in a single experiment in budding yeast. By tagging a DNA-binding protein with a targeting domain that directs the insertion of the Ty5 retrotransposon, the genomic binding sites for that transcription factor are marked. The transposition locations are then identified en masse by Illumina sequencing. The calling card protocol allows for simultaneous analysis of multiple transcription factors. By cloning barcodes into the Ty5 transposon, it is possible to pair a unique barcode with every transcription factor in the experiment. The method presented here uses expression of transcription factors from their native loci; however, it can also be altered to measure binding sites of transcription factors overexpressed from a plasmid. PMID:26832687

  4. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  5. Accounting for eXentricities: Analysis of the X Chromosome in GWAS Reveals X-Linked Genes Implicated in Autoimmune Diseases

    Science.gov (United States)

    Chang, Diana; Gao, Feng; Slavney, Andrea; Ma, Li; Waldman, Yedael Y.; Sams, Aaron J.; Billing-Ross, Paul; Madar, Aviv; Spritz, Richard; Keinan, Alon

    2014-01-01

    Many complex human diseases are highly sexually dimorphic, suggesting a potential contribution of the X chromosome to disease risk. However, the X chromosome has been neglected or incorrectly analyzed in most genome-wide association studies (GWAS). We present tailored analytical methods and software that facilitate X-wide association studies (XWAS), which we further applied to reanalyze data from 16 GWAS of different autoimmune and related diseases (AID). We associated several X-linked genes with disease risk, among which (1) ARHGEF6 is associated with Crohn's disease and replicated in a study of ulcerative colitis, another inflammatory bowel disease (IBD). Indeed, ARHGEF6 interacts with a gastric bacterium that has been implicated in IBD. (2) CENPI is associated with three different AID, which is compelling in light of known associations with AID of autosomal genes encoding centromere proteins, as well as established autosomal evidence of pleiotropy between autoimmune diseases. (3) We replicated a previous association of FOXP3, a transcription factor that regulates T-cell development and function, with vitiligo; and (4) we discovered that C1GALT1C1 exhibits sex-specific effect on disease risk in both IBDs. These and other X-linked genes that we associated with AID tend to be highly expressed in tissues related to immune response, participate in major immune pathways, and display differential gene expression between males and females. Combined, the results demonstrate the importance of the X chromosome in autoimmunity, reveal the potential of extensive XWAS, even based on existing data, and provide the tools and incentive to properly include the X chromosome in future studies. PMID:25479423

  6. Crystal Structures of Wild-type and Mutant Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase Reveal an Alternative Conformation of NADPH that may be Linked to Trimethoprim Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Frey, K.; Liu, J; Lombardo, M; Bolstad, D; Wright, D; Anderson, A

    2009-01-01

    Both hospital- and community-acquired Staphylococcus aureus infections have become major health concerns in terms of morbidity, suffering and cost. Trimethoprim-sulfamethoxazole (TMP-SMZ) is an alternative treatment for methicillin-resistant S. aureus (MRSA) infections. However, TMP-resistant strains have arisen with point mutations in dihydrofolate reductase (DHFR), the target for TMP. A single point mutation, F98Y, has been shown biochemically to confer the majority of this resistance to TMP. Using a structure-based approach, we have designed a series of novel propargyl-linked DHFR inhibitors that are active against several trimethoprim-resistant enzymes. We screened this series against wild-type and mutant (F98Y) S. aureus DHFR and found that several are active against both enzymes and specifically that the meta-biphenyl class of these inhibitors is the most potent. In order to understand the structural basis of this potency, we determined eight high-resolution crystal structures: four each of the wild-type and mutant DHFR enzymes bound to various propargyl-linked DHFR inhibitors. In addition to explaining the structure-activity relationships, several of the structures reveal a novel conformation for the cofactor, NADPH. In this new conformation that is predominantly associated with the mutant enzyme, the nicotinamide ring is displaced from its conserved location and three water molecules complete a network of hydrogen bonds between the nicotinamide ring and the protein. In this new position, NADPH has reduced interactions with the inhibitor. An equilibrium between the two conformations of NADPH, implied by their occupancies in the eight crystal structures, is influenced both by the ligand and the F98Y mutation. The mutation induced equilibrium between two NADPH-binding conformations may contribute to decrease TMP binding and thus may be responsible for TMP resistance.

  7. Whole genome sequencing reveals novel non-synonymous mutation in ectodysplasin A (EDA) associated with non-syndromic X-linked dominant congenital tooth agenesis.

    Science.gov (United States)

    Sarkar, Tanmoy; Bansal, Rajesh; Das, Parimal

    2014-01-01

    Congenital tooth agenesis in human is characterized by failure of tooth development during tooth organogenesis. 300 genes in mouse and 30 genes in human so far have been known to regulate tooth development. However, candidature of only 5 genes viz. PAX9, MSX1, AXIN2, WNT10A and EDA have been experimentally established for congenitally missing teeth like hypodontia and oligodontia. In this study an Indian family with multiple congenital tooth agenesis was identified. Pattern of inheritance was apparently autosomal dominant type with a rare possibility to be X-linked. Whole genome sequencing of two affected individuals was carried out which revealed 119 novel non-synonymous single nucleotide variations (SNVs) distributed among 117 genes. Out of these only one variation (c.956G>T) located at exon 9 of X-linked EDA gene was considered as pathogenic and validated among all the affected and unaffected family members and unrelated controls. This variation leads to p.Ser319Ile change in the TNF homology domain of EDA (transcript variant 1) protein. In silico analysis predicts that this Ser319 is well conserved across different vertebrate species and a part of putative receptor binding site. Structure based homology modeling predicts that this amino acid residue along with four other amino acid residues nearby, those when mutated known to cause selective tooth agenesis, form a cluster that may have functional significance. Taken together these results suggest that c.956G>T (p.Ser319Ile) mutation plausibly reduces the receptor binding activity of EDA leading to distinct tooth agenesis in this family. PMID:25203534

  8. Whole genome sequencing reveals novel non-synonymous mutation in ectodysplasin A (EDA associated with non-syndromic X-linked dominant congenital tooth agenesis.

    Directory of Open Access Journals (Sweden)

    Tanmoy Sarkar

    Full Text Available Congenital tooth agenesis in human is characterized by failure of tooth development during tooth organogenesis. 300 genes in mouse and 30 genes in human so far have been known to regulate tooth development. However, candidature of only 5 genes viz. PAX9, MSX1, AXIN2, WNT10A and EDA have been experimentally established for congenitally missing teeth like hypodontia and oligodontia. In this study an Indian family with multiple congenital tooth agenesis was identified. Pattern of inheritance was apparently autosomal dominant type with a rare possibility to be X-linked. Whole genome sequencing of two affected individuals was carried out which revealed 119 novel non-synonymous single nucleotide variations (SNVs distributed among 117 genes. Out of these only one variation (c.956G>T located at exon 9 of X-linked EDA gene was considered as pathogenic and validated among all the affected and unaffected family members and unrelated controls. This variation leads to p.Ser319Ile change in the TNF homology domain of EDA (transcript variant 1 protein. In silico analysis predicts that this Ser319 is well conserved across different vertebrate species and a part of putative receptor binding site. Structure based homology modeling predicts that this amino acid residue along with four other amino acid residues nearby, those when mutated known to cause selective tooth agenesis, form a cluster that may have functional significance. Taken together these results suggest that c.956G>T (p.Ser319Ile mutation plausibly reduces the receptor binding activity of EDA leading to distinct tooth agenesis in this family.

  9. Structural and Biochemical Studies of ALIX/AlP1 and Its Role in Retrovirus Budding

    Energy Technology Data Exchange (ETDEWEB)

    Fisher,R.; Chung, H.; Zhai, Q.; Robinson, H.; Sundquist, W.; Hill, C.

    2007-01-01

    ALIX/AIP1 functions in enveloped virus budding, endosomal protein sorting, and many other cellular processes. Retroviruses, including HIV-1, SIV, and EIAV, bind and recruit ALIX through YPXnL late-domain motifs (X = any residue; n = 1-3). Crystal structures reveal that human ALIX is composed of an N-terminal Bro1 domain and a central domain that is composed of two extended three-helix bundles that form elongated arms that fold back into a 'V.'. The structures also reveal conformational flexibility in the arms that suggests that the V domain may act as a flexible hinge in response to ligand binding. YPXnL late domains bind in a conserved hydrophobic pocket on the second arm near the apex of the V, whereas CHMP4/ESCRT-III proteins bind a conserved hydrophobic patch on the Bro1 domain, and both interactions are required for virus budding. ALIX therefore serves as a flexible, extended scaffold that connects retroviral Gag proteins to ESCRT-III and other cellular-budding machinery.

  10. A New 13 Million Year Old Gavialoid Crocodylian from Proto-Amazonian Mega-Wetlands Reveals Parallel Evolutionary Trends in Skull Shape Linked to Longirostry

    Science.gov (United States)

    Salas-Gismondi, Rodolfo; Flynn, John J.; Baby, Patrice; Tejada-Lara, Julia V.; Claude, Julien; Antoine, Pierre-Olivier

    2016-01-01

    Gavialoid crocodylians are the archetypal longirostrine archosaurs and, as such, understanding their patterns of evolution is fundamental to recognizing cranial rearrangements and reconstructing adaptive pathways associated with elongation of the rostrum (longirostry). The living Indian gharial Gavialis gangeticus is the sole survivor of the group, thus providing unique evidence on the distinctive biology of its fossil kin. Yet phylogenetic relationships and evolutionary ecology spanning ~70 million-years of longirostrine crocodylian diversification remain unclear. Analysis of cranial anatomy of a new proto-Amazonian gavialoid, Gryposuchus pachakamue sp. nov., from the Miocene lakes and swamps of the Pebas Mega-Wetland System reveals that acquisition of both widely separated and protruding eyes (telescoped orbits) and riverine ecology within South American and Indian gavialoids is the result of parallel evolution. Phylogenetic and morphometric analyses show that, in association with longirostry, circumorbital bone configuration can evolve rapidly for coping with trends in environmental conditions and may reflect shifts in feeding strategy. Our results support a long-term radiation of the South American forms, with taxa occupying either extreme of the gavialoid morphospace showing preferences for coastal marine versus fluvial environments. The early biogeographic history of South American gavialoids was strongly linked to the northward drainage system connecting proto-Amazonian wetlands to the Caribbean region. PMID:27097031

  11. Charged Propargyl-Linked Antifolates Reveal Mechanisms of Antifolate Resistance and Inhibit Trimethoprim-Resistant MRSA Strains Possessing Clinically Relevant Mutations.

    Science.gov (United States)

    Reeve, Stephanie M; Scocchera, Eric; Ferreira, Jacob J; G-Dayanandan, Narendran; Keshipeddy, Santosh; Wright, Dennis L; Anderson, Amy C

    2016-07-14

    Drug-resistant enzymes must balance catalytic function with inhibitor destabilization to provide a fitness advantage. This sensitive balance, often involving very subtle structural changes, must be achieved through a selection process involving a minimal number of eligible point mutations. As part of a program to design propargyl-linked antifolates (PLAs) against trimethoprim-resistant dihydrofolate reductase (DHFR) from Staphylococcus aureus, we have conducted a thorough study of several clinically observed chromosomal mutations in the enzyme at the cellular, biochemical, and structural levels. Through this work, we have identified a promising lead series that displays significantly greater activity against these mutant enzymes and strains than TMP. The best inhibitors have enzyme inhibition and MIC values near or below that of trimethoprim against wild-type S. aureus. Moreover, these studies employ a series of crystal structures of several mutant enzymes bound to the same inhibitor; analysis of the structures reveals a more detailed molecular understanding of drug resistance in this important enzyme. PMID:27308944

  12. Mechanical feedback stabilizes budding yeast morphogenesis

    Science.gov (United States)

    Banavar, Samhita; Trogdon, Michael; Petzold, Linda; Campas, Otger

    Walled cells have the ability to remodel their shape while sustaining an internal turgor pressure that can reach values up to 10 atmospheres. This requires a tight and simultaneous regulation of cell wall assembly and mechanochemistry, but the underlying mechanisms by which this is achieved remain unclear. Using the growth of mating projections in budding yeast (S. cerevisiae) as a motivating example, we have developed a theoretical description that couples the mechanics of cell wall expansion and assembly via a mechanical feedback. In the absence of a mechanical feedback, cell morphogenesis is inherently unstable. The presence of a mechanical feedback stabilizes changes in cell shape and growth, and provides a mechanism to prevent cell lysis in a wide range of conditions. We solve for the dynamics of the system and obtain the different dynamical regimes. In particular, we show that several parameters affect the stability of growth, including the strength of mechanical feedback in the system. Finally, we compare our results to existing experimental data.

  13. Micropropagation of Helleborus through axillary budding.

    Science.gov (United States)

    Beruto, Margherita; Viglione, Serena; Bisignano, Alessandro

    2013-01-01

    Helleborus genus, belonging to the Ranunculaceae family, has 20 species of herbaceous perennial flowering plants. The commercial exploitation of this plant is dependent on the selection and propagation of appropriate lines. High propagation rate could be accomplished by using a suitable tissue culture method enabling the rapid introduction of valuable selections in the market. However, in vitro cultivation of Helleborus is still very difficult. Thereby the development of reliable in vitro propagation procedures is crucial for future production systems. Axillary buds cultured on agar-solidified Murashige and Skoog medium supplemented with 1 mg/L benzyladenine, 0.1 mg/L β-naphthoxyacetic acid, and 2 mg/L isopentenyl adenine develop shoots after 16 weeks of culture under 16 h light regime, 50-60 μmol/s/m(2), and 19 ± 1°C. The multiplication rate ranges from 1.4 to 2.1. However, the genotype and the number of subcultures affect the efficiency of the micropropagation process. The rooting of shoots is about 80% in solidified MS medium containing 1 mg/L 1-naphthaleneacetic acid and 3 mg/L indole-3-butyric acid. The described protocol provides information which can contribute to the commercial production of Helleborus plants. PMID:23179705

  14. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  15. Apoptosis at inflection point in liquid culture of budding yeasts.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Hagiwara

    Full Text Available Budding yeasts are highly suitable for aging studies, because the number of bud scars (stage proportionally correlates with age. Its maximum stages are known to reach at 20-30 stages on an isolated agar medium. However, their stage dynamics in a liquid culture is virtually unknown. We investigate the population dynamics by counting scars in each cell. Here one cell division produces one new cell and one bud scar. This simple rule leads to a conservation law: "The total number of bud scars is equal to the total number of cells." We find a large discrepancy: extremely fewer cells with over 5 scars than expected. Almost all cells with 6 or more scars disappear within a short period of time in the late log phase (corresponds to the inflection point. This discrepancy is confirmed directly by the microscopic observations of broken cells. This finding implies apoptosis in older cells (6 scars or more.

  16. A novel role for the GTPase-activating protein Bud2 in the spindle position checkpoint.

    Directory of Open Access Journals (Sweden)

    Scott A Nelson

    Full Text Available The spindle position checkpoint (SPC ensures correct mitotic spindle position before allowing mitotic exit in the budding yeast Saccharomyces cerevisiae. In a candidate screen for checkpoint genes, we identified bud2Δ as deficient for the SPC. Bud2 is a GTPase activating protein (GAP, and the only known substrate of Bud2 was Rsr1/Bud1, a Ras-like GTPase and a central component of the bud-site-selection pathway. Mutants lacking Rsr1/Bud1 had no checkpoint defect, as did strains lacking and overexpressing Bud5, a guanine-nucleotide exchange factor (GEF for Rsr1/Bud1. Thus, the checkpoint function of Bud2 is distinct from its role in bud site selection. The catalytic activity of the Bud2 GAP domain was required for the checkpoint, based on the failure of the known catalytic point mutant Bud2(R682A to function in the checkpoint. Based on assays of heterozygous diploids, bud2(R682A, was dominant for loss of checkpoint but recessive for bud-site-selection failure, further indicating a separation of function. Tem1 is a Ras-like protein and is the critical regulator of mitotic exit, sitting atop the mitotic exit network (MEN. Tem1 is a likely target for Bud2, supported by genetic analyses that exclude other Ras-like proteins.

  17. Real Life Science with Dandelions and Project BudBurst

    OpenAIRE

    Johnson, Katherine A.

    2016-01-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education

  18. Real Life Science with Dandelions and Project BudBurst

    Directory of Open Access Journals (Sweden)

    Katherine A. Johnson

    2015-12-01

    Full Text Available Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone.

  19. Real Life Science with Dandelions and Project BudBurst.

    Science.gov (United States)

    Johnson, Katherine A

    2016-03-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education. PMID:27047605

  20. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  1. Dielectric modelling of cell division for budding and fission yeast

    Science.gov (United States)

    Asami, Koji; Sekine, Katsuhisa

    2007-02-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast.

  2. Generation of micronuclei during interphase by coupling between cytoplasmic membrane blebbing and nuclear budding.

    Directory of Open Access Journals (Sweden)

    Koh-ichi Utani

    Full Text Available Micronucleation, mediated by interphase nuclear budding, has been repeatedly suggested, but the process is still enigmatic. In the present study, we confirmed the previous observation that there are lamin B1-negative micronuclei in addition to the positive ones. A large cytoplasmic bleb was found to frequently entrap lamin B1-negative micronuclei, which were connected to the nucleus by a thin chromatin stalk. At the bottom of the stalk, the nuclear lamin B1 structure appeared broken. Chromatin extrusion through lamina breaks has been referred to as herniation or a blister of the nucleus, and has been observed after the expression of viral proteins. A cell line in which extrachromosomal double minutes and lamin B1 protein were simultaneously visualized in different colors in live cells was established. By using these cells, time-lapse microscopy revealed that cytoplasmic membrane blebbing occurred simultaneously with the extrusion of nuclear content, which generated lamin B1-negative micronuclei during interphase. Furthermore, activation of cytoplasmic membrane blebbing by the addition of fresh serum or camptothecin induced nuclear budding within 1 to 10 minutes, which suggested that blebbing might be the cause of the budding. After the induction of blebbing, the frequency of lamin-negative micronuclei increased. The budding was most frequent during S phase and more efficiently entrapped small extrachromosomal chromatin than the large chromosome arm. Based on these results, we suggest a novel mechanism in which cytoplasmic membrane dynamics pulls the chromatin out of the nucleus through the lamina break. Evidence for such a mechanism was obtained in certain cancer cell lines including human COLO 320 and HeLa. The mechanism could significantly perturb the genome and influence cancer cell phenotypes.

  3. Affective decision-making deficits, linked to a dysfunctional ventromedial prefrontal cortex, revealed in 10th grade Chinese adolescent binge drinkers.

    Science.gov (United States)

    Johnson, C Anderson; Xiao, Lin; Palmer, Paula; Sun, Ping; Wang, Qiong; Wei, Yonglan; Jia, Yong; Grenard, Jerry L; Stacy, Alan W; Bechara, Antoine

    2008-01-31

    The primary aim of this study was to test the hypothesis that adolescent binge drinkers, but not lighter drinkers, would show signs of impairment on tasks of affective decision-making as measured by the Iowa Gambling Test (IGT), when compared to adolescents who never drank. We tested 207 10th grade adolescents in Chengdu City, China, using two versions of the IGT, the original and a variant, in which the reward/punishment contingencies were reversed. This enables one to distinguish among different possibilities of impaired decision-making, such as insensitivity to long-term consequences, or hypersensitivity to reward. Furthermore, we tested working memory capacity using the Self-ordered Pointing Test (SOPT). Paper and pencil questionnaires were used to assess drinking behaviors and school academic performance. Results indicated that relative to never-drinkers, adolescent binge drinkers, but not other (ever, past 30-day) drinkers, showed significantly lower net scores on the original version of the IGT especially in the latter trials. Furthermore, the profiles of behavioral performance from the original and variant versions of the IGT were consistent with a decision-making impairment attributed to hypersensitivity to reward. In addition, working memory and school academic performance revealed no differences between drinkers (at all levels) and never-drinkers. Logistic regression analysis showed that after controlling for demographic variables, working memory, and school academic performance, the IGT significantly predicted binge-drinking. These findings suggest that a "myopia" for future consequences linked to hypersensitivity to reward is a key characteristic of adolescents with binge-drinking behavior, and that underlying neural mechanisms for this "myopia" for future consequences may serve as a predisposing factor that renders some adolescents more susceptible to future addictive behaviors. PMID:17996909

  4. Functional genomics of pH homeostasis in Corynebacterium glutamicum revealed novel links between pH response, oxidative stress, iron homeostasis and methionine synthesis

    Directory of Open Access Journals (Sweden)

    Persicke Marcus

    2009-12-01

    Full Text Available Abstract Background The maintenance of internal pH in bacterial cells is challenged by natural stress conditions, during host infection or in biotechnological production processes. Comprehensive transcriptomic and proteomic analyses has been conducted in several bacterial model systems, yet questions remain as to the mechanisms of pH homeostasis. Results Here we present the comprehensive analysis of pH homeostasis in C. glutamicum, a bacterium of industrial importance. At pH values between 6 and 9 effective maintenance of the internal pH at 7.5 ± 0.5 pH units was found. By DNA microarray analyses differential mRNA patterns were identified. The expression profiles were validated and extended by 1D-LC-ESI-MS/MS based quantification of soluble and membrane proteins. Regulators involved were identified and thereby participation of numerous signaling modules in pH response was found. The functional analysis revealed for the first time the occurrence of oxidative stress in C. glutamicum cells at neutral and low pH conditions accompanied by activation of the iron starvation response. Intracellular metabolite pool analysis unraveled inhibition of the TCA and other pathways at low pH. Methionine and cysteine synthesis were found to be activated via the McbR regulator, cysteine accumulation was observed and addition of cysteine was shown to be toxic under acidic conditions. Conclusions Novel limitations for C. glutamicum at non-optimal pH values were identified by a comprehensive analysis on the level of the transcriptome, proteome, and metabolome indicating a functional link between pH acclimatization, oxidative stress, iron homeostasis, and metabolic alterations. The results offer new insights into bacterial stress physiology and new starting points for bacterial strain design or pathogen defense.

  5. The cellular robustness by genetic redundancy in budding yeast.

    Directory of Open Access Journals (Sweden)

    Jingjing Li

    2010-11-01

    Full Text Available The frequent dispensability of duplicated genes in budding yeast is heralded as a hallmark of genetic robustness contributed by genetic redundancy. However, theoretical predictions suggest such backup by redundancy is evolutionarily unstable, and the extent of genetic robustness contributed from redundancy remains controversial. It is anticipated that, to achieve mutual buffering, the duplicated paralogs must at least share some functional overlap. However, counter-intuitively, several recent studies reported little functional redundancy between these buffering duplicates. The large yeast genetic interactions released recently allowed us to address these issues on a genome-wide scale. We herein characterized the synthetic genetic interactions for ∼500 pairs of yeast duplicated genes originated from either whole-genome duplication (WGD or small-scale duplication (SSD events. We established that functional redundancy between duplicates is a pre-requisite and thus is highly predictive of their backup capacity. This observation was particularly pronounced with the use of a newly introduced metric in scoring functional overlap between paralogs on the basis of gene ontology annotations. Even though mutual buffering was observed to be prevalent among duplicated genes, we showed that the observed backup capacity is largely an evolutionarily transient state. The loss of backup capacity generally follows a neutral mode, with the buffering strength decreasing in proportion to divergence time, and the vast majority of the paralogs have already lost their backup capacity. These observations validated previous theoretic predictions about instability of genetic redundancy. However, departing from the general neutral mode, intriguingly, our analysis revealed the presence of natural selection in stabilizing functional overlap between SSD pairs. These selected pairs, both WGD and SSD, tend to have decelerated functional evolution, have higher propensities of co

  6. Lipopolysaccharide-induced inflammation attenuates taste progenitor cell proliferation and shortens the life span of taste bud cells

    Directory of Open Access Journals (Sweden)

    Brand Joseph

    2010-06-01

    Full Text Available Abstract Background The mammalian taste bud, a complex collection of taste sensory cells, supporting cells, and immature basal cells, is the structural unit for detecting taste stimuli in the oral cavity. Even though the cells of the taste bud undergo constant turnover, the structural homeostasis of the bud is maintained by balancing cell proliferation and cell death. Compared with nongustatory lingual epithelial cells, taste cells express higher levels of several inflammatory receptors and signalling proteins. Whether inflammation, an underlying condition in some diseases associated with taste disorders, interferes with taste cell renewal and turnover is unknown. Here we report the effects of lipopolysaccharide (LPS-induced inflammation on taste progenitor cell proliferation and taste bud cell turnover in mouse taste tissues. Results Intraperitoneal injection of LPS rapidly induced expression of several inflammatory cytokines, including tumor necrosis factor (TNF-α, interferon (IFN-γ, and interleukin (IL-6, in mouse circumvallate and foliate papillae. TNF-α and IFN-γ immunoreactivities were preferentially localized to subsets of cells in taste buds. LPS-induced inflammation significantly reduced the number of 5-bromo-2'-deoxyuridine (BrdU-labeled newborn taste bud cells 1-3 days after LPS injection, suggesting an inhibition of taste bud cell renewal. BrdU pulse-chase experiments showed that BrdU-labeled taste cells had a shorter average life span in LPS-treated mice than in controls. To investigate whether LPS inhibits taste cell renewal by suppressing taste progenitor cell proliferation, we studied the expression of Ki67, a cell proliferation marker. Quantitative real-time RT-PCR revealed that LPS markedly reduced Ki67 mRNA levels in circumvallate and foliate epithelia. Immunofluorescent staining using anti-Ki67 antibodies showed that LPS decreased the number of Ki67-positive cells in the basal regions surrounding circumvallate taste buds

  7. Differences in cross-link chemistry between rigid and flexible dithiol molecules revealed by optical studies of CdTe quantum dots

    OpenAIRE

    Koole, R; Luigjes, B.; Tachiya, M.; Pool, R.; Vlugt, T.J.H.; De Mello Donega, C.; Meijerink, A.; Vanmaekelbergh, D.A.M.

    2007-01-01

    The cross-link chemistry of CdTe quantum dots (QDs) in solution is studied for different types of aliphatic (flexible) and aromatic (rigid) dithiol linker molecules. A remarkable difference in the cross-linking efficiency is observed: the rigid dithiols are shown to form aggregates at much lower concentrations. Qualitative and quantitative information on the formation of aggregates is obtained from cryogenic transmission electron microscopy (cryo-TEM) images and photoluminescence decay measur...

  8. Structure of N-linked oligosaccharides attached to chlorovirus PBCV-1 major capsid protein reveals unusual class of complex N-glycans

    OpenAIRE

    De Castro, Cristina; Molinaro, Antonio; Piacente, Francesco; Gurnon, James R.; Sturiale, Luisa; Palmigiano, Angelo; Lanzetta, Rosa; Parrilli, Michelangelo; Garozzo, Domenico; Tonetti, Michela G.; Van Etten, James L.

    2013-01-01

    The major capsid protein Vp54 from the prototype chlorovirus Paramecium bursaria chlorella virus 1 (PBCV-1) contains four Asn-linked glycans. The structure of the four N-linked oligosaccharides and the type of substitution at each glycosylation site was determined by chemical, spectroscopic, and spectrometric analyses. Vp54 glycosylation is unusual in many ways, including: (i) unlike most viruses, PBCV-1 encodes most, if not all, of the machinery to glycosylate its major capsid protein; (ii) ...

  9. The centromeric nucleosome of budding yeast is perfectly positioned and covers the entire centromere

    OpenAIRE

    Cole, Hope A.; Howard, Bruce H.; David J Clark

    2011-01-01

    The centromeres of budding yeast are ∼120 bp in size and contain three functional elements: an AT-rich region flanked by binding sites for Cbf1 and CBF3. A specialized nucleosome containing the H3 variant Cse4 (CenH3) is formed at the centromere. Our genome-wide paired-end sequencing of nucleosomal DNA reveals that the centromeric nucleosome contains a micrococcal nuclease-resistant kernel of 123–135 bp, depending on the centromere, and is therefore significantly shorter than the canonical nu...

  10. Optical properties of bud scales and protochlorophyll(ide) forms in leaf primordia of closed and opened buds.

    Science.gov (United States)

    Solymosi, Katalin; Böddi, Béla

    2006-08-01

    The transmission spectra of bud scales of 14 woody species and the 77 K fluorescence emission spectra of the innermost leaf primordia of closed and opened buds of 37 woody species were studied. Pigment concentrations were determined in some species. Bud scales had low transmittance between 400 and 680 nm with a local minimum around 680 nm. Transmittance increased steeply above 680 nm and was > 80% in the 700-800 nm spectral region. Significant protochlorophyllide (Pchlide) accumulation was observed in leaf primordia of tightly packed, closed buds with relatively thick, dark bud scales. In common ash (Fraxinus excelsior L.) and Hungarian ash (Fraxinus angustifolia Vahl.), the innermost leaf primordia of the closed buds contained protochlorophyll (Pchl) and Pchlide (abbreviated as Pchl(ide)), but no chlorophyll. We observed Pchl(ide) forms with emission maxima at 633, 643 and 655 nm in these leaves. Complete transformation of Pchlide(655) (protochlorophyllide form with maximum emission at 655 nm) into Chlide(692) (chlorophyllide form with maximum emission at 692 nm) occurred after irradiation for 10 s. The innermost leaf primordia of the buds of four species (flowering ash (Fraxinus ornus L.), horse chestnut (Aesculus hippocastanum L.), tree of heaven (Ailanthus altissima P. Mill.) and common walnut (Juglans regia L.)) contained Pchl(ide)(633), Pchl(ide)(643) and Pchlide(655) as well as an emission band at 688 nm corresponding to a chlorophyll form. The Pchlide(655) was fully photoactive in these species. The outermost leaf primordia of these four species and the innermost leaf primordia of 28 other species contained all of the above described Pchl(ide) forms in various ratios but in small amounts. In addition, Chl forms were present and the main bands in the fluorescence emission spectra were at 690 or 740 nm, or both. The results indicate that Pchl(ide) accumulation occurs in leaf primordia in near darkness inside the tightly closed buds, where the bud scales and

  11. Respiratory Response of Dormant Nectarine Floral Buds on Chilling Deficiency

    Institute of Scientific and Technical Information of China (English)

    TAN Yue; GAO Dong-sheng; LI Ling; CHEN Xiu-de; XU Ai-hong

    2010-01-01

    Changes in main biochemical respiratory pathways in dormant nectarine floral buds were studied with nectarine trees (Prunus persica.var,nectariana cv.Shuguang) in order to determine the function of respiration in dormancy release.Oxygen-electrode system and respiratory inhibitors were used to measure total respiratory rates and rates of respiratory pathways.Results showed that chilling deficiency blocked the transition of respiratory mode,and made buds stay in a state of high level pentose phosphate pathway (PPP) and low level tricarboxylic acid cycle (TCA).The decline of PPP and activation of TCA occurred synchronously with the release of dormancy.In addition,the inhibition of PPP stimulated a respiration increase related with TCA.It could be concluded that the function of PPP activation in dormancy release might be limited and PPP declination inducing TCA activation might be part of respiration mode transition mechanism during bud sprouting.

  12. EARLY BUD-BREAK1 (EBB1) defines a conserved mechanism for control of bud-break in woody perennials

    Science.gov (United States)

    Busov, Victor; Carneros, Elena; Yakovlev, Igor

    2016-01-01

    Bud-break is an environmentally and economically important trait in trees, shrubs and vines from temperate latitudes. Poor synchronization of bud-break timing with local climates can lead to frost injuries, susceptibility to pests and pathogens and poor crop yields in fruit trees and vines. The rapid climate changes outpace the adaptive capacities of plants to respond through natural selection. This is particularly true for trees which have long generation cycle and thus the adaptive changes are significantly delayed. Therefore, to devise appropriate breeding and conservation strategies, it is imperative to understand the molecular underpinnings that govern dormancy mechanisms. We have recently identified and characterized the poplar EARLY BUD-BREAK 1 (EBB1) gene. EBB1 is a positive regulator of bud-break and encodes a transcription factor from the AP2/ERF family. Here, using comparative and functional genomics approaches we show that EBB1 function in regulation of bud-break is likely conserved across wide range of woody perennial species with importance to forestry and agriculture. PMID:26317150

  13. GABA, its receptors, and GABAergic inhibition in mouse taste buds

    OpenAIRE

    Dvoryanchikov, Gennady; Huang, Yijen A.; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D.

    2011-01-01

    Taste buds consist of at least three principal cell types that have different functions in processing gustatory signals — glial-like Type I cells, Receptor (Type II) cells, and Presynaptic (Type III) cells. Using a combination of Ca2+ imaging, single cell RT-PCR, and immunostaining, we show that γ-amino butyric acid (GABA) is an inhibitory transmitter in mouse taste buds, acting on GABA-A and GABA-B receptors to suppress transmitter (ATP) secretion from Receptor cells during taste stimulation...

  14. Project BudBurst: People, Plants, and Climate Change

    Science.gov (United States)

    Henderson, S.; Ward, D.; Havens, K.; Gardiner, L. S.; Alaback, P.

    2010-12-01

    Providing opportunities for individuals to contribute to a better understanding of climate change is the hallmark of Project BudBurst (www.budburst.org). This highly successful, national citizen science program, now in its third year, is bringing climate change education outreach to thousands of individuals. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, thousands of participants from all 50 states have submitted data. Project BudBurst has been the subject of almost 200 media outlets including NPR, national and regional television broadcasts, and most of the major national and regional newspapers. This presentation will provide an overview of Project BudBurst and will report on the results of the 2009 field campaign and discuss plans to expand Project BudBurst in 2010 including the use of mobile phones applications for data collection and reporting from the field. Project BudBurst co managed by the National Ecological Observatory Network and

  15. Requirements for Recruitment of a G Protein-coupled Receptor to Clathrin-coated Pits in Budding Yeast

    OpenAIRE

    Toshima, Junko Y.; Nakanishi, Jun-ichi; Mizuno, Kensaku; Toshima, Jiro; Drubin, David G.

    2009-01-01

    Endocytic internalization of G protein-coupled receptors (GPCRs) plays a critical role in down-regulation of GPCR signaling. The yeast mating pheromone receptor Ste2p has been used as a model to investigate mechanisms of signal transduction, modification, and endocytic internalization of GPCRs. We previously used a fluorescently labeled mating pheromone derivative to reveal unappreciated molecular and spatiotemporal features of GPCR endocytosis in budding yeast. Here, we identify recruitment ...

  16. Mitochondrial quality control during inheritance is associated with lifespan and mother-daughter age asymmetry in budding yeast

    OpenAIRE

    McFaline-Figueroa, José Ricardo; Vevea, Jason; Swayne, Theresa C.; Zhou, Chun; Liu, Christopher; Leung, Galen; Boldogh, Istvan R.; Pon, Liza A.

    2011-01-01

    Fluorescence loss in photobleaching experiments and analysis of mitochondrial function using superoxide and redox potential biosensors revealed that mitochondria within individual yeast cells are physically and functionally distinct. Mitochondria that are retained in mother cells during yeast cell division have significantly lower redox potential and higher superoxide levels compared to mitochondria in buds. Retention of mitochondria with lower redox potential in mother cells occurs to the sa...

  17. Ruffed grouse feeding behavior and its relationship to secondary metabolites of quaking aspen flower buds.

    Science.gov (United States)

    Jakubas, W J; Gullion, G W; Clausen, T P

    1989-06-01

    Quaking aspen (Populus tremuloides Michx.) staminate flower buds and the extended catkins are primary food resources for ruffed grouse (Bonasa umbellus). Winter feeding observations indicate that ruffed grouse select specific trees or clones of quaking aspen to feed in. Flower buds and catkins of quaking aspen were analyzed for secondary compounds (tannins, alkaloids, and phenolics) that might cause ruffed grouse to avoid trees with high levels of these compounds. Coniferyl benzoate, a compound that has not been previously found in quaking aspen, exists in significantly higher concentrations in buds from trees with no feeding history as compared to ruffed grouse feeding trees. Aspen catkins were also significantly lower in coniferyl benzoate than buds from the same tree. Ruffed grouse feeding preference was not related to the tannin or total phenolic levels found in buds or catkins. Buds from feeding trees had higher protein levels than trees with no feeding history; however, catkins did not differ from buds in protein concentration. The high use of extended catkins in the spring by ruffed grouse is probably due to a lower percentage of bud scale material in the catkin as opposed to the dormant bud. Bud scales contain almost all of the nontannin phenolics in catkins and dormant buds. A feeding strategy where bud scales are avoided may exist for other bird species that feed on quaking aspen. Dormant flower buds are significantly lower in protein-precipitable tannins than catkins and differ in secondary metabolite composition from other aspen foliage. PMID:24272191

  18. A secreted BMP antagonist, Cer1, fine tunes the spatial organization of the ureteric bud tree during mouse kidney development.

    Directory of Open Access Journals (Sweden)

    Lijun Chi

    Full Text Available The epithelial ureteric bud is critical for mammalian kidney development as it generates the ureter and the collecting duct system that induces nephrogenesis in dicrete locations in the kidney mesenchyme during its emergence. We show that a secreted Bmp antagonist Cerberus homologue (Cer1 fine tunes the organization of the ureteric tree during organogenesis in the mouse embryo. Both enhanced ureteric expression of Cer1 and Cer1 knock out enlarge kidney size, and these changes are associated with an altered three-dimensional structure of the ureteric tree as revealed by optical projection tomography. Enhanced Cer1 expression changes the ureteric bud branching programme so that more trifid and lateral branches rather than bifid ones develop, as seen in time-lapse organ culture. These changes may be the reasons for the modified spatial arrangement of the ureteric tree in the kidneys of Cer1+ embryos. Cer1 gain of function is associated with moderately elevated expression of Gdnf and Wnt11, which is also induced in the case of Cer1 deficiency, where Bmp4 expression is reduced, indicating the dependence of Bmp expression on Cer1. Cer1 binds at least Bmp2/4 and antagonizes Bmp signalling in cell culture. In line with this, supplementation of Bmp4 restored the ureteric bud tip number, which was reduced by Cer1+ to bring it closer to the normal, consistent with models suggesting that Bmp signalling inhibits ureteric bud development. Genetic reduction of Wnt11 inhibited the Cer1-stimulated kidney development, but Cer1 did not influence Wnt11 signalling in cell culture, although it did inhibit the Wnt3a-induced canonical Top Flash reporter to some extent. We conclude that Cer1 fine tunes the spatial organization of the ureteric tree by coordinating the activities of the growth-promoting ureteric bud signals Gndf and Wnt11 via Bmp-mediated antagonism and to some degree via the canonical Wnt signalling involved in branching.

  19. Differential expression of a BMP4 reporter allele in anterior fungiform versus posterior circumvallate taste buds of mice

    Directory of Open Access Journals (Sweden)

    Barlow Linda A

    2010-10-01

    Full Text Available Abstract Background Bone Morphogenetic Protein 4 (BMP4 is a diffusible factor which regulates embryonic taste organ development. However, the role of BMP4 in taste buds of adult mice is unknown. We utilized transgenic mice with LacZ under the control of the BMP4 promoter to reveal the expression of BMP4 in the tongues of adult mice. Further we evaluate the pattern of BMP4 expression with that of markers of specific taste bud cell types and cell proliferation to define and compare the cell populations expressing BMP4 in anterior (fungiform papillae and posterior (circumvallate papilla tongue. Results BMP4 is expressed in adult fungiform and circumvallate papillae, i.e., lingual structures composed of non-taste epithelium and taste buds. Unexpectedly, we find both differences and similarities with respect to expression of BMP4-driven ß-galactosidase. In circumvallate papillae, many fusiform cells within taste buds are BMP4-ß-gal positive. Further, a low percentage of BMP4-expressing cells within circumvallate taste buds is immunopositive for markers of each of the three differentiated taste cell types (I, II and III. BMP4-positive intragemmal cells also expressed a putative marker of immature taste cells, Sox2, and consistent with this finding, intragemmal cells expressed BMP4-ß-gal within 24 hours after their final mitosis, as determined by BrdU birthdating. By contrast, in fungiform papillae, BMP4-ß-gal positive cells are never encountered within taste buds. However, in both circumvallate and fungiform papillae, BMP4-ß-gal expressing cells are located in the perigemmal region, comprising basal and edge epithelial cells adjacent to taste buds proper. This region houses the proliferative cell population that gives rise to adult taste cells. However, perigemmal BMP4-ß-gal cells appear mitotically silent in both fungiform and circumvallate taste papillae, as we do not find evidence of their active proliferation using cell cycle immunomarkers

  20. RESEARCH OF SOPHORA JAPONICA L. FLOWER BUDS VOLATILE COMPOUNDS WITH GAS-CHROMATOGRAPHY/MASS- SPECTROMETRY METHOD

    Directory of Open Access Journals (Sweden)

    Cholak I.S.

    2013-10-01

    Full Text Available This work represents the results of the research ofessential oil contained in Sophora japonica L. flowerbuds volatile compounds collected during the nextstages of their development: green flower buds, formedflower buds and the beginning of flower buds opening.Essential oil assay content in Sophora japonica L.flower buds was determined with hydrodistillationmethod. Content of essential oil in the raw material isless than 0,1%. Qualitative composition and assaycontent of Sophora japonica L. flower buds essential oilconstituents were determined with chromato-massspectrometry method. In consequence of the research 80constituents were identified in Sophora japonica L.flower buds out of which 61 substances are during thegreen flower buds and beginning of flower budsopening stages, 66 substances are during formed flowerbuds stage. Substances are represented by aliphatic andcyclic terpenoids, their alcohols and ketones. Mostvolatile substances were extracted on the stage offormed buds.

  1. Effect of gamma irradiated parenchyma on the growth of irradiated potato tuber buds

    International Nuclear Information System (INIS)

    The development of buds greffed on irradiated potato parenchyma was studied. The irradiated parenchyma does not influence the sprouting capacity of buds, but it affects the way they develop. (Author) 9 refs

  2. Extending the dormant bud cryopreservation method to new tree species

    Science.gov (United States)

    In cryopreservation of germplasm, using dormant winter buds (DB) as source plant material is economically favorable over tissue culture options. Although the DB cryopreservation method has been known for many years, the approach is feasible only for cryopreserving a select number of temperate tree s...

  3. Contribution of the tooth bud mesenchyme to alveolar bone

    Czech Academy of Sciences Publication Activity Database

    Diep, L.; Matalová, Eva; Mitsiadis, T. A.; Tucker, A. S.

    312B, č. 5 (2009), 510-517. ISSN 1552-5007 R&D Projects: GA ČR GC524/08/J032; GA AV ČR KJB500450802 Institutional research plan: CEZ:AV0Z50450515 Keywords : tooth * alveolar bone * bud Subject RIV: FF - HEENT, Dentistry Impact factor: 2.938, year: 2009

  4. Structure of N-linked oligosaccharides attached to chlorovirus PBCV-1 major capsid protein reveals unusual class of complex N-glycans.

    Science.gov (United States)

    De Castro, Cristina; Molinaro, Antonio; Piacente, Francesco; Gurnon, James R; Sturiale, Luisa; Palmigiano, Angelo; Lanzetta, Rosa; Parrilli, Michelangelo; Garozzo, Domenico; Tonetti, Michela G; Van Etten, James L

    2013-08-20

    The major capsid protein Vp54 from the prototype chlorovirus Paramecium bursaria chlorella virus 1 (PBCV-1) contains four Asn-linked glycans. The structure of the four N-linked oligosaccharides and the type of substitution at each glycosylation site was determined by chemical, spectroscopic, and spectrometric analyses. Vp54 glycosylation is unusual in many ways, including: (i) unlike most viruses, PBCV-1 encodes most, if not all, of the machinery to glycosylate its major capsid protein; (ii) the glycans are attached to the protein by a β-glucose linkage; (iii) the Asn-linked glycans are not located in a typical N-X-(T/S) consensus site; and (iv) the process probably occurs in the cytoplasm. The four glycoforms share a common core structure, and the differences are related to the nonstoichiometric presence of two monosaccharides. The most abundant glycoform consists of nine neutral monosaccharide residues, organized in a highly branched fashion. Among the most distinctive features of the glycoforms are (i) a dimethylated rhamnose as the capping residue of the main chain, (ii) a hyperbranched fucose unit, and (iii) two rhamnose residues with opposite absolute configurations. These glycoforms differ from what has been reported so far in the three domains of life. Considering that chloroviruses and other members of the family Phycodnaviridae may have a long evolutionary history, we suggest that the chlorovirus glycosylation pathway is ancient, possibly existing before the development of the endoplasmic reticulum and Golgi pathway, and involves still unexplored mechanisms. PMID:23918378

  5. Project BudBurst: Citizen Science for All Seasons

    Science.gov (United States)

    Meymaris, K.; Henderson, S.; Alaback, P.; Havens, K.

    2008-12-01

    Providing opportunities for individuals to contribute to a better understanding of climate change is the hallmark of Project BudBurst (www.budburst.org). This highly successful, national citizen science program, now in its second year, is bringing climate change education outreach to thousands of individuals. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, participants from 49 states have submitted data that is being submitted to the USA National Phenology Network (www.usanpn.org) database. Project BudBurst has been the subject of almost 200 media outlets including NPR, national and regional television broadcasts, and most of the major national and regional newspapers. This presentation will provide an overview of Project Budburst and will report on the results of the 2008 field campaign and discuss plans to expand Project BudBurst in 2009. Project BudBurst is a Windows to the Universe Citizen Science program managed by the University

  6. Global gene expression profiling of brown to white adipose tissue transformation in sheep reveals novel transcriptional components linked to adipose remodeling

    DEFF Research Database (Denmark)

    Basse, Astrid L.; Dixen, Karen; Yadav, Rachita;

    2015-01-01

    time course study of the perirenal adipose depot. We observed changes in tissue morphology, gene expression and metabolism within the first two weeks of postnatal life consistent with the expected transition from BAT to WAT. The transformation was characterized by massively decreased mitochondrial......, including NR1H3, MYC, KLF4, ESR1, RELA and BCL6, which were linked to the overall changes in gene expression during the adipose tissue remodeling. Finally, the perirenal adipose tissue expressed both brown and brite/beige adipocyte marker genes at birth, the expression of which changed substantially over...

  7. Tumor Budding Cells, Cancer Stem Cells and Epithelial-Mesenchymal Transition-type Cells in Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    EvaKaramitopoulou

    2013-01-01

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC is one of the most lethal cancers with a 5-year survival rate of less than 5%. Moreover, PDAC escapes early detection and resists treatment. Multiple combinations of genetic alterations are known to occur in PDAC including mutational activation of KRAS, inactivation of p16/CDKN2A and SMAD4 (DPC4 and dysregulation of PTEN/PI3K/AKT signaling. Through their interaction with WNT pathway, the downstream molecules of these pathways have been implicated in the promotion of epithelial-mesenchymal transition (EMT. Emerging evidence has demonstrated that cancer stem cells (CSCs, small populations of which have been identified in PDAC, and EMT-type cells play critical roles in drug resistance, invasion and metastasis in pancreatic cancer. EMT may be histologically represented by the presence of tumor budding which is described as the occurrence of single tumor cells or small clusters (<5 of dedifferentiated cells at the invasive front of gastrointestinal (including colorectal, oesophageal, gastric and ampullary carcinomas and is linked to poor prognosis. Tumor budding has recently been shown to occur frequently in PDAC and to be associated with adverse clinicopathological features and decreased disease-free and overall survival. The aim of this review is to present a short overview on the morphological and molecular aspects that underline the relationship between tumor budding cells, CSCs and EMT-type cells in PDAC.

  8. A Bioinformatics Analysis Reveals a Group of MocR Bacterial Transcriptional Regulators Linked to a Family of Genes Coding for Membrane Proteins

    Directory of Open Access Journals (Sweden)

    Teresa Milano

    2016-01-01

    Full Text Available The MocR bacterial transcriptional regulators are characterized by an N-terminal domain, 60 residues long on average, possessing the winged-helix-turn-helix (wHTH architecture responsible for DNA recognition and binding, linked to a large C-terminal domain (350 residues on average that is homologous to fold type-I pyridoxal 5′-phosphate (PLP dependent enzymes like aspartate aminotransferase (AAT. These regulators are involved in the expression of genes taking part in several metabolic pathways directly or indirectly connected to PLP chemistry, many of which are still uncharacterized. A bioinformatics analysis is here reported that studied the features of a distinct group of MocR regulators predicted to be functionally linked to a family of homologous genes coding for integral membrane proteins of unknown function. This group occurs mainly in the Actinobacteria and Gammaproteobacteria phyla. An analysis of the multiple sequence alignments of their wHTH and AAT domains suggested the presence of specificity-determining positions (SDPs. Mapping of SDPs onto a homology model of the AAT domain hinted at possible structural/functional roles in effector recognition. Likewise, SDPs in wHTH domain suggested the basis of specificity of Transcription Factor Binding Site recognition. The results reported represent a framework for rational design of experiments and for bioinformatics analysis of other MocR subgroups.

  9. Global gene expression profiling of brown to white adipose tissue transformation in sheep reveals novel transcriptional components linked to adipose remodeling

    DEFF Research Database (Denmark)

    Basse, Astrid L.; Dixen, Karen; Yadav, Rachita;

    2015-01-01

    Background: Large mammals are capable of thermoregulation shortly after birth due to the presence of brown adipose tissue (BAT). The majority of BAT disappears after birth and is replaced by white adipose tissue (WAT). Results: We analyzed the postnatal transformation of adipose in sheep with a......, including NR1H3, MYC, KLF4, ESR1, RELA and BCL6, which were linked to the overall changes in gene expression during the adipose tissue remodeling. Finally, the perirenal adipose tissue expressed both brown and brite/beige adipocyte marker genes at birth, the expression of which changed substantially over...... time course study of the perirenal adipose depot. We observed changes in tissue morphology, gene expression and metabolism within the first two weeks of postnatal life consistent with the expected transition from BAT to WAT. The transformation was characterized by massively decreased mitochondrial...

  10. Divergence of a conserved elongation factor and transcription regulation in budding and fission yeast.

    Science.gov (United States)

    Booth, Gregory T; Wang, Isabel X; Cheung, Vivian G; Lis, John T

    2016-06-01

    Complex regulation of gene expression in mammals has evolved from simpler eukaryotic systems, yet the mechanistic features of this evolution remain elusive. Here, we compared the transcriptional landscapes of the distantly related budding and fission yeast. We adapted the Precision Run-On sequencing (PRO-seq) approach to map the positions of RNA polymerase active sites genome-wide in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Additionally, we mapped preferred sites of transcription initiation in each organism using PRO-cap. Unexpectedly, we identify a pause in early elongation, specific to S. pombe, that requires the conserved elongation factor subunit Spt4 and resembles promoter-proximal pausing in metazoans. PRO-seq profiles in strains lacking Spt4 reveal globally elevated levels of transcribing RNA Polymerase II (Pol II) within genes in both species. Messenger RNA abundance, however, does not reflect the increases in Pol II density, indicating a global reduction in elongation rate. Together, our results provide the first base-pair resolution map of transcription elongation in S. pombe and identify divergent roles for Spt4 in controlling elongation in budding and fission yeast. PMID:27197211

  11. Membrane-elasticity model of Coatless vesicle budding induced by ESCRT complexes.

    Directory of Open Access Journals (Sweden)

    Bartosz Różycki

    Full Text Available The formation of vesicles is essential for many biological processes, in particular for the trafficking of membrane proteins within cells. The Endosomal Sorting Complex Required for Transport (ESCRT directs membrane budding away from the cytosol. Unlike other vesicle formation pathways, the ESCRT-mediated budding occurs without a protein coat. Here, we propose a minimal model of ESCRT-induced vesicle budding. Our model is based on recent experimental observations from direct fluorescence microscopy imaging that show ESCRT proteins colocalized only in the neck region of membrane buds. The model, cast in the framework of membrane elasticity theory, reproduces the experimentally observed vesicle morphologies with physically meaningful parameters. In this parameter range, the minimum energy configurations of the membrane are coatless buds with ESCRTs localized in the bud neck, consistent with experiment. The minimum energy configurations agree with those seen in the fluorescence images, with respect to both bud shapes and ESCRT protein localization. On the basis of our model, we identify distinct mechanistic pathways for the ESCRT-mediated budding process. The bud size is determined by membrane material parameters, explaining the narrow yet different bud size distributions in vitro and in vivo. Our membrane elasticity model thus sheds light on the energetics and possible mechanisms of ESCRT-induced membrane budding.

  12. Influences of polar auxin transport on polarity of adventitious bud formation in hybrid populas

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Myung Won (Yonsei Univ. Kangwondo (Korea)); Hackett, W. (Univ of Minnesota, St. Paul (USA))

    1989-04-01

    The role of auxin and cytokinin distribution of polar regeneration of adventitious bud has been investigated. Explants from leaf midvein were labelled with {sup 14}C-NAA and {sup 14}C-BA and the radioactivity in proximal, mid, and distal portions was counted after 24h and 48h. Explants showing polar regeneration of buds on the proximal end showed a clear polar distribution of {sup 14}CNAA. Auxin transport inhibitors (NPA, TIBA) eliminated polar distribution of auxin and reduced polarity of bud formation and the total number of buds formed, but did not reduce callus formation. Increased concentration of Ca(NO{sub 3}){sub 2} decreased polarity of bud formation and increased the number of buds formed but did not affect the distribution of auxin of cytokinin. Some factor in addition to polar distribution of auxin or cytokinin-auxin ratio appears to influence the polarity of adventitious bud formation.

  13. Accelerated turnover of taste bud cells in mice deficient for the cyclin-dependent kinase inhibitor p27Kip1

    Directory of Open Access Journals (Sweden)

    Perna Marla K

    2011-04-01

    Full Text Available Abstract Background Mammalian taste buds contain several specialized cell types that coordinately respond to tastants and communicate with sensory nerves. While it has long been appreciated that these cells undergo continual turnover, little is known concerning how adequate numbers of cells are generated and maintained. The cyclin-dependent kinase inhibitor p27Kip1 has been shown to influence cell number in several developing tissues, by coordinating cell cycle exit during cell differentiation. Here, we investigated its involvement in the control of taste cell replacement by examining adult mice with targeted ablation of the p27Kip1 gene. Results Histological and morphometric analyses of fungiform and circumvallate taste buds reveal no structural differences between wild-type and p27Kip1-null mice. However, when examined in functional assays, mutants show substantial proliferative changes. In BrdU incorporation experiments, more S-phase-labeled precursors appear within circumvallate taste buds at 1 day post-injection, the earliest time point examined. After 1 week, twice as many labeled intragemmal cells are present, but numbers return to wild-type levels by 2 weeks. Mutant taste buds also contain more TUNEL-labeled cells and 50% more apoptotic bodies than wild-type controls. In normal mice, p27 Kip1 is evident in a subset of receptor and presynaptic taste cells beginning about 3 days post-injection, correlating with the onset of taste cell maturation. Loss of gene function, however, does not alter the proportions of distinct immunohistochemically-identified cell types. Conclusions p27Kip1 participates in taste cell replacement by regulating the number of precursor cells available for entry into taste buds. This is consistent with a role for the protein in timing cell cycle withdrawal in progenitor cells. The equivalence of mutant and wild-type taste buds with regard to cell number, cell types and general structure contrasts with the hyperplasia

  14. Recurrent peripheral odontogenic fibroma associated with basal cell budding

    Directory of Open Access Journals (Sweden)

    C Sreeja

    2014-01-01

    Full Text Available Peripheral odontogenic fibroma (POdF is a rare benign odontogenic neoplasm. It represents the soft tissue counterpart of central odontogenic fibroma. The embryonic source of POdF has been suggested by many as arising from the rest of dental lamina that has persisted in the gingiva following its disintegration. It presents clinically as a firm, slow growing and sessile gingival mass, which is difficult to distinguish with more common inflammatory lesions. Very few cases of recurrence have been documented. It has been stated that histological budding of basal cell layer of the surface squamous epithelium is associated with higher recurrence and the presence of calcification in direct apposition to the epithelial rest is associated with lower recurrence. Hereby, we present a case which histologically exhibited budding of the basal cell layer, which could have been the reason for its recurrence.

  15. Budding Transition of Asymmetric Two-component Lipid Domains

    CERN Document Server

    Wolff, Jean; Andelman, David

    2016-01-01

    We propose a model that accounts for the budding transition of asymmetric two-component lipid domains, where the two monolayers (leaflets) have different average compositions controlled by independent chemical potentials. Assuming a coupling between the local curvature and local lipid composition in each of the leaflets, we discuss the morphology and thermodynamic behavior of asymmetric lipid domains. The membrane free-energy contains three contributions: the bending energy, the line tension, and a Landau free-energy for a lateral phase separation. Within a mean-field treatment, we obtain various phase diagrams containing fully budded, dimpled, and flat states as a function of the two leaflet compositions. The global phase behavior is analyzed, and depending on system parameters, the phase diagrams include one-phase, two-phase and three-phase regions. In particular, we predict various phase coexistence regions between different morphologies of domains, which may be observed in multi-component membranes or ves...

  16. Tumor budding is a strong and reproducible prognostic marker in T3N0 colorectal cancer.

    LENUS (Irish Health Repository)

    Wang, Lai Mun

    2012-02-01

    BACKGROUND: Tumor budding along the advancing front of colorectal adenocarcinoma is an early event in the metastatic process. A reproducible, prognostic budding scoring system based on outcomes in early stage colorectal cancer has not been established. DESIGN: One hundred twenty-eight T3N0M0 colorectal carcinoma patients with known outcome were identified. Tumor budding was defined as isolated tumor cells or clusters of <5 cells at the invasive tumor front. Tumor bud counts were generated in 5 regions at 200x by 2 pathologists (conventional bud count method). The median bud count per case was used to divide cases into low (median=0) and high budding (median > or =1) groups. Forty cases were reevaluated to assess reproducibility using the conventional and a novel rapid bud count method. RESULTS: Fifty-seven (45%) carcinomas had high and 71 (55%) had low budding scores. High budding was associated with an infiltrative growth pattern (P<0.0001) and lymphovascular invasion (P=0.005). Five-year cancer-specific survival was significantly poorer in high compared with low budding groups: 63% versus 91%, respectively, P<0.0001. Multivariate analysis demonstrated tumor budding to be independently prognostic (hazard ratio=4.76, P<0.001). Interobserver agreement was at least equivalent comparing the conventional to the rapid bud count methods: 87.5% agreement (kappa=0.75) versus 92.5% agreement (kappa=0.85), respectively. CONCLUSIONS: Tumor budding is a strong, reproducible, and independent prognostic marker of outcome that is easily assessed on hematoxylin and eosin slides. This may be useful for identifying the subset of T3N0M0 patients at high risk of recurrence who may benefit from adjuvant therapy.

  17. Newly identified prions in budding yeast, and their possible functions

    OpenAIRE

    Crow, Emily T.; Li, Liming

    2011-01-01

    Yeast prions are atypical genetic elements that are transmitted as heritable protein conformations. [PSI+], [URE3], and [PIN+] are three well-studied prions in the budding yeast, Saccharomyces cerevisiae. In the last three years, several additional prions have been reported in yeast, including [SWI+], [OCT+], [MCA], [GAR+], [MOT3+], [ISP+], and [NSI+]. The growing number of yeast prions suggests that protein-based inheritance might be a widespread biological phenomenon. In this review, we sum...

  18. Measuring Replicative Life Span in the Budding Yeast

    OpenAIRE

    Steffen, Kristan K.; Kennedy, Brian K.; Kaeberlein, Matt

    2009-01-01

    Aging is a degenerative process characterized by a progressive deterioration of cellular components and organelles resulting in mortality. The budding yeast Saccharomyces cerevisiae has been used extensively to study the biology of aging, and several determinants of yeast longevity have been shown to be conserved in multicellular eukaryotes, including worms, flies, and mice 1. Due to the lack of easily quantified age-associated phenotypes, aging in yeast has been assayed almost exclusively by...

  19. Evaluation and Properties of the Budding Yeast Phosphoproteome

    OpenAIRE

    Amoutzias, G. D.; He, Y.; Lilley, K. S.; Van de Peer, Y.; Oliver, S G

    2012-01-01

    We have assembled a reliable phosphoproteomic data set for budding yeast Saccharomyces cerevisiae and have investigated its properties. Twelve publicly available phosphoproteome data sets were triaged to obtain a subset of high-confidence phosphorylation sites (p-sites), free of "noisy" phosphorylations. Analysis of this combined data set suggests that the inventory of phosphoproteins in yeast is close to completion, but that these proteins may have many undiscovered p-sites. Proteins involve...

  20. The protein machinery of vesicle budding and fusion.

    OpenAIRE

    Rothman, J E

    1996-01-01

    A general protein machinery that buds and fuses transport vesicles is harnessed to generate the complex web of intracellular transport pathways critical for such diverse processes as cell growth, endocytosis, hormone release, and neurotransmission. With this appreciation, the challenge of understanding the precise molecular mechanisms of these many facets of cell biology has been reduced to a series of problems in protein structure and chemistry.

  1. Signal transduction and information processing in mammalian taste buds

    OpenAIRE

    Roper, Stephen D.

    2007-01-01

    The molecular machinery for chemosensory transduction in taste buds has received considerable attention within the last decade. Consequently, we now know a great deal about sweet, bitter, and umami taste mechanisms and are gaining ground rapidly on salty and sour transduction. Sweet, bitter, and umami tastes are transduced by G-protein-coupled receptors. Salty taste may be transduced by epithelial Na channels similar to those found in renal tissues. Sour transduction appears to be initiated b...

  2. Clonal and bud bank traits: patterns across temperate plant communities

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Herben, Tomáš

    2015-01-01

    Roč. 26, č. 2 (2015), s. 243-253. ISSN 1100-9233 R&D Projects: GA ČR GB14-36079G; GA ČR GA13-17118S; GA ČR GAP505/12/1007 Institutional support: RVO:67985939 Keywords : clonal and bud bank traits * vegetation * central Europe Subject RIV: EH - Ecology, Behaviour Impact factor: 3.709, year: 2014

  3. Pupil Dilation and EEG Alpha Frequency Band Power Reveal Load on Executive Functions for Link-Selection Processes during Text Reading.

    Directory of Open Access Journals (Sweden)

    Christian Scharinger

    Full Text Available Executive working memory functions play a central role in reading comprehension. In the present research we were interested in additional load imposed on executive functions by link-selection processes during computer-based reading. For obtaining process measures, we used a methodology of concurrent electroencephalographic (EEG and eye-tracking data recording that allowed us to compare epochs of pure text reading with epochs of hyperlink-like selection processes in an online reading situation. Furthermore, this methodology allowed us to directly compare the two physiological load-measures EEG alpha frequency band power and pupil dilation. We observed increased load on executive functions during hyperlink-like selection processes on both measures in terms of decreased alpha frequency band power and increased pupil dilation. Surprisingly however, the two measures did not correlate. Two additional experiments were conducted that excluded potential perceptual, motor, or structural confounds. In sum, EEG alpha frequency band power and pupil dilation both turned out to be sensitive measures for increased load during hyperlink-like selection processes in online text reading.

  4. Primary B-cell deficiencies reveal a link between human IL-17-producing CD4 T-cell homeostasis and B-cell differentiation.

    Directory of Open Access Journals (Sweden)

    Rita R Barbosa

    Full Text Available IL-17 is a pro-inflammatory cytokine implicated in autoimmune and inflammatory conditions. The development/survival of IL-17-producing CD4 T cells (Th17 share critical cues with B-cell differentiation and the circulating follicular T helper subset was recently shown to be enriched in Th17 cells able to help B-cell differentiation. We investigated a putative link between Th17-cell homeostasis and B cells by studying the Th17-cell compartment in primary B-cell immunodeficiencies. Common Variable Immunodeficiency Disorders (CVID, defined by defects in B-cell differentiation into plasma and memory B cells, are frequently associated with autoimmune and inflammatory manifestations but we found no relationship between these and Th17-cell frequency. In fact, CVID patients showed a decrease in Th17-cell frequency in parallel with the expansion of activated non-differentiated B cells (CD21(lowCD38(low. Moreover, Congenital Agammaglobulinemia patients, lacking B cells due to impaired early B-cell development, had a severe reduction of circulating Th17 cells. Finally, we found a direct correlation in healthy individuals between circulating Th17-cell frequency and both switched-memory B cells and serum BAFF levels, a crucial cytokine for B-cell survival. Overall, our data support a relationship between Th17-cell homeostasis and B-cell maturation, with implications for the understanding of the pathogenesis of inflammatory/autoimmune diseases and the physiology of B-cell depleting therapies.

  5. Chemically Designed Molecular Interfaces in Cross-Linked Poly(ethylene glycol)/Silica Nanocomposites Reveal Strong Size-Dependent Trends in Gas Permeability

    Science.gov (United States)

    Su, Norman; Urban, Jeffrey

    2015-03-01

    Polymer nanocomposite membranes can exhibit gas separation performance that surpasses conventional polymeric membranes. While promising, the optimization of nanocomposite membranes requires a fundamental understanding of the transport mechanism and interfacial effects between the inorganic and polymer phase that is currently limited to empirical relationships. Synthesized nanocomposites often consist of poorly distributed and polydisperse inorganic nanomaterials. It is known that polymer dynamics can change drastically upon introduction of an inorganic phase, which can dramatically alter molecular transport behavior. Here, we systematically explore the role of nanoparticle sizes from 12 to 130 nm on polymer dynamics and permeability in a series of cross-linked poly(ethylene glycol)/silica nanocomposite membranes. The nanocomposites are well-dispersed and display excellent homogeneity throughout. Size-dependent broadening of the Tg indicates strong attractive interactions especially at high surface area loadings, which lead to deviations in permeability not captured by Maxwell's model. Chemical modifications of silica at this interface can yield significantly different polymer dynamics than previously observed with enhanced transport and mechanical properties.

  6. Pupil Dilation and EEG Alpha Frequency Band Power Reveal Load on Executive Functions for Link-Selection Processes during Text Reading.

    Science.gov (United States)

    Scharinger, Christian; Kammerer, Yvonne; Gerjets, Peter

    2015-01-01

    Executive working memory functions play a central role in reading comprehension. In the present research we were interested in additional load imposed on executive functions by link-selection processes during computer-based reading. For obtaining process measures, we used a methodology of concurrent electroencephalographic (EEG) and eye-tracking data recording that allowed us to compare epochs of pure text reading with epochs of hyperlink-like selection processes in an online reading situation. Furthermore, this methodology allowed us to directly compare the two physiological load-measures EEG alpha frequency band power and pupil dilation. We observed increased load on executive functions during hyperlink-like selection processes on both measures in terms of decreased alpha frequency band power and increased pupil dilation. Surprisingly however, the two measures did not correlate. Two additional experiments were conducted that excluded potential perceptual, motor, or structural confounds. In sum, EEG alpha frequency band power and pupil dilation both turned out to be sensitive measures for increased load during hyperlink-like selection processes in online text reading. PMID:26076026

  7. Mutation analysis of the gene encoding Bruton`s tyrosine kinase in a family with a sporadic case of X-linked agammaglobulinemia reveals three female carriers

    Energy Technology Data Exchange (ETDEWEB)

    Hagemann, T.L.; Kwan, Sau-Ping [Rush Medical School, Chicago, IL (United States); Assa`ad, A.H. [Children`s Hospital Medical Center, Cincinnati, OH (United States)

    1995-11-06

    Bruton`s tyrosine kinase (Btk) has been identified as the protein responsible for the primary immunodeficiency X-linked agammaglobulinemia (XLA). We and others have cloned the gene for Btk and recently reported the genomic organization. Nineteen exons were positioned within the 37 kb gene. With the sequence data derived from our genomic map, we have designed a PCR based assay to directly identify mutations of the Btk gene in germline DNA of patients with XLA. In this report, the assay was used to analyze a family with a sporadic case of XLA to determine if other female relatives carry the disease. A four base-pair deletion was found in the DNA of the affected boy and was further traced through three generations. With the direct identification of the mutations responsible for XLA, we can now diagnose conclusively the disease and identify the immunologically normal female carriers. This same technique can easily be applied to prenatal diagnosis in families where the mutation can be identified. 34 refs., 3 figs.

  8. Ecological conditions favoring budding in colonial organisms under environmental disturbance.

    Directory of Open Access Journals (Sweden)

    Mayuko Nakamaru

    Full Text Available Dispersal is a topic of great interest in ecology. Many organisms adopt one of two distinct dispersal tactics at reproduction: the production of small offspring that can disperse over long distances (such as seeds and spawned eggs, or budding. The latter is observed in some colonial organisms, such as clonal plants, corals and ants, in which (superorganisms split their body into components of relatively large size that disperse to a short distance. Contrary to the common dispersal viewpoint, short-dispersal colonial organisms often flourish even in environments with frequent disturbances. In this paper, we investigate the conditions that favor budding over long-distance dispersal of small offspring, focusing on the life history of the colony growth and the colony division ratio. These conditions are the relatively high mortality of very small colonies, logistic growth, the ability of dispersers to peacefully seek and settle unoccupied spaces, and small spatial scale of environmental disturbance. If these conditions hold, budding is advantageous even when environmental disturbance is frequent. These results suggest that the demography or life history of the colony underlies the behaviors of the colonial organisms.

  9. Bud dormancy in apple trees after thermal fluctuations

    Directory of Open Access Journals (Sweden)

    Rafael Anzanello

    2014-06-01

    Full Text Available The objective of this work was to evaluate the effect of heat waves on the evolution of bud dormancy, in apple trees with contrasting chilling requirements. Twigs of 'Castel Gala' and 'Royal Gala' were collected in orchards in Papanduva, state of Santa Catarina, Brazil, and were exposed to constant (3°C or alternating (3 and 15°C for 12/12 hours temperature, combined with zero, one or two days a week at 25°C. Two additional treatments were evaluated: constant temperature (3°C, with a heat wave of seven days at 25°C, in the beginning or in the middle of the experimental period. Periodically, part of the twigs was transferred to 25°C for daily budburst evaluation of apical and lateral buds. Endodormancy (dormancy induced by cold was overcome with less than 330 chilling hours (CH of constant cold in 'Castel Gala' and less than 618 CH in 'Royal Gala'. A daily 15°C-temperature cycle did not affect the endodormancy process. Heat waves during endodormancy resulted in an increased CH to achieve bud requirements. The negative effect of high temperature depended on the lasting of this condition. Chilling was partly cancelled during dormancy when the heat wave lasted 36 continuous hours or more. Therefore, budburst prediction models need adjustments, mainly for regions with mild and irregular winters, such as those of Southern Brazil.

  10. Removal of deciduous canine tooth buds in Kenyan rural Maasai.

    Science.gov (United States)

    Hassanali, J; Amwayi, P; Muriithi, A

    1995-04-01

    The removal of deciduous canine tooth buds in early childhood is a practice that has been documented in Kenya and in neighboring countries. This paper describes the occurrence, rationale and method of this practice amongst rural Kenyan Maasai. In a group of 95 children aged between six months and two years, who were examined in 1991/92, 87% were found to have undergone the removal of one or more deciduous canine tooth buds. In an older age group (3-7 years of age), 72% of the 111 children examined exhibited missing mandibular or maxillary deciduous canines. It was found that the actual removal of a deciduous tooth bud is often performed by middle-aged Maasai women who enucleate the developing tooth using a pointed pen-knife. There exists a strong belief among the Maasai that diarrhoea, vomiting and other febrile illnesses of early childhood are caused by the gingival swelling over the canine region, and which is thought to contain 'worms' or 'nylon' teeth. The immediate and long-term hazards of this practice include profuse bleeding, infection and damage to the developing permanent canines. A multi-disciplinary approach involving social anthropologists in addition to dental and medical personnel, is recommend in order to discourage this harmful operation that appears to be on the increase. PMID:7621751

  11. A Comparative Proteomic Analysis of the Buds and the Young Expanding Leaves of the Tea Plant (Camellia sinensis L.

    Directory of Open Access Journals (Sweden)

    Qin Li

    2015-06-01

    Full Text Available Tea (Camellia sinensis L. is a perennial woody plant that is widely cultivated to produce a popular non-alcoholic beverage; this beverage has received much attention due to its pleasant flavor and bioactive ingredients, particularly several important secondary metabolites. Due to the significant changes in the metabolite contents of the buds and the young expanding leaves of tea plants, high-performance liquid chromatography (HPLC analysis and isobaric tags for relative and absolute quantitation (iTRAQ analysis were performed. A total of 233 differentially expressed proteins were identified. Among these, 116 proteins were up-regulated and 117 proteins were down-regulated in the young expanding leaves compared with the buds. A large array of diverse functions was revealed, including roles in energy and carbohydrate metabolism, secondary metabolite metabolism, nucleic acid and protein metabolism, and photosynthesis- and defense-related processes. These results suggest that polyphenol biosynthesis- and photosynthesis-related proteins regulate the secondary metabolite content of tea plants. The energy and antioxidant metabolism-related proteins may promote tea leaf development. However, reverse transcription quantitative real-time PCR (RT-qPCR showed that the protein expression levels were not well correlated with the gene expression levels. These findings improve our understanding of the molecular mechanism of the changes in the metabolite content of the buds and the young expanding leaves of tea plants.

  12. Combined probes of X-ray scattering and optical spectroscopy reveal how global conformational change is temporally and spatially linked to local structural perturbation in photoactive yellow protein.

    Science.gov (United States)

    Kim, Tae Wu; Yang, Cheolhee; Kim, Youngmin; Kim, Jong Goo; Kim, Jeongho; Jung, Yang Ouk; Jun, Sunhong; Lee, Sang Jin; Park, Sungjun; Kosheleva, Irina; Henning, Robert; van Thor, Jasper J; Ihee, Hyotcherl

    2016-03-23

    Real-time probing of structural transitions of a photoactive protein is challenging owing to the lack of a universal time-resolved technique that can probe the changes in both global conformation and light-absorbing chromophores of the protein. In this work, we combine time-resolved X-ray solution scattering (TRXSS) and transient absorption (TA) spectroscopy to investigate how the global conformational changes involved in the photoinduced signal transduction of photoactive yellow protein (PYP) is temporally and spatially related to the local structural change around the light-absorbing chromophore. In particular, we examine the role of internal proton transfer in developing a signaling state of PYP by employing its E46Q mutant (E46Q-PYP), where the internal proton transfer is inhibited by the replacement of a proton donor. The comparison of TRXSS and TA spectroscopy data directly reveals that the global conformational change of the protein, which is probed by TRXSS, is temporally delayed by tens of microseconds from the local structural change of the chromophore, which is probed by TA spectroscopy. The molecular shape of the signaling state reconstructed from the TRXSS curves directly visualizes the three-dimensional conformations of protein intermediates and reveals that the smaller structural change in E46Q-PYP than in wild-type PYP suggested by previous studies is manifested in terms of much smaller protrusion, confirming that the signaling state of E46Q-PYP is only partially developed compared with that of wild-type PYP. This finding provides direct evidence of how the environmental change in the vicinity of the chromophore alters the conformational change of the entire protein matrix. PMID:26960811

  13. Improved Enzyme-Linked Immunosorbent Assay To Reveal Mycoplasma agassizii Exposure: a Valuable Tool in the Management of Environmentally Sensitive Tortoise Populations▿

    Science.gov (United States)

    Wendland, Lori D.; Zacher, Laurie A.; Klein, Paul A.; Brown, Daniel R.; Demcovitz, Dina; Littell, Ramon; Brown, Mary B.

    2007-01-01

    The precarious status of desert (Gopherus agassizii) and gopher (Gopherus polyphemus) tortoises has resulted in research and conservation efforts that include health assessments as a substantial component of management decision-making. Therefore, it is critical that available diagnostic tests for diseases impacting these species undergo rigorous standardization and validation. Since 1992, analysis of exposure of tortoises to Mycoplasma agassizii, an etiological agent of upper respiratory tract disease, has relied on the detection of specific M. agassizii antibody by enzyme-linked immunosorbent assay (ELISA). We report here substantive refinements in the diagnostic assay and discuss the implications of its use in wildlife conservation and management. The ELISA has been refined to include more stringent quality control measures and has been converted to a clinically more meaningful titer reporting system, consistent with other diagnostic serologic tests. The ELISA results for 5,954 desert and gopher tortoises were plotted, and a subset of these serum samples (n = 90) was used to determine end-point titers, to establish an optimum serum dilution for analyzing samples, and to construct a standard curve. The relationship between titer and A405 was validated using 77 serum samples from known positive (n = 48) and negative (n = 29) control tortoises from prior transmission studies. The Youden index, J, and the optimal cut point, c, were estimated using ELISA results from the 77 control sera. Based on this evaluation, the refinement has substantially improved the performance of the assay (sensitivity of 0.98, specificity of 0.99, and J of 0.98), thus providing a clinically more reliable diagnostic test for this important infection of tortoises. PMID:17626160

  14. Improved enzyme-linked immunosorbent assay to reveal Mycoplasma agassizii exposure: a valuable tool in the management of environmentally sensitive tortoise populations.

    Science.gov (United States)

    Wendland, Lori D; Zacher, Laurie A; Klein, Paul A; Brown, Daniel R; Demcovitz, Dina; Littell, Ramon; Brown, Mary B

    2007-09-01

    The precarious status of desert (Gopherus agassizii) and gopher (Gopherus polyphemus) tortoises has resulted in research and conservation efforts that include health assessments as a substantial component of management decision-making. Therefore, it is critical that available diagnostic tests for diseases impacting these species undergo rigorous standardization and validation. Since 1992, analysis of exposure of tortoises to Mycoplasma agassizii, an etiological agent of upper respiratory tract disease, has relied on the detection of specific M. agassizii antibody by enzyme-linked immunosorbent assay (ELISA). We report here substantive refinements in the diagnostic assay and discuss the implications of its use in wildlife conservation and management. The ELISA has been refined to include more stringent quality control measures and has been converted to a clinically more meaningful titer reporting system, consistent with other diagnostic serologic tests. The ELISA results for 5,954 desert and gopher tortoises were plotted, and a subset of these serum samples (n = 90) was used to determine end-point titers, to establish an optimum serum dilution for analyzing samples, and to construct a standard curve. The relationship between titer and A405 was validated using 77 serum samples from known positive (n = 48) and negative (n = 29) control tortoises from prior transmission studies. The Youden index, J, and the optimal cut point, c, were estimated using ELISA results from the 77 control sera. Based on this evaluation, the refinement has substantially improved the performance of the assay (sensitivity of 0.98, specificity of 0.99, and J of 0.98), thus providing a clinically more reliable diagnostic test for this important infection of tortoises. PMID:17626160

  15. Differentiation of Apical Bud Cells in a Newly Developed Apical Bud Transplantation Model Using GFP Transgenic Mice as Donor.

    Directory of Open Access Journals (Sweden)

    Naoki Maruo

    Full Text Available Rodent mandibular incisors have a unique anatomical structure that allows teeth to grow throughout the lifetime of the rodent. This report presents a novel transplantation technique for studying the apical bud differentiation of rodent mandibular incisors. Incisal apical end tissue with green fluorescent protein from transgenic mouse was transplanted to wild type mice, and the development of the transplanted cells were immunohistologically observed for 12 weeks after the transplantation. Results indicate that the green fluorescent apical end tissue replaced the original tissue, and cells from the apical bud differentiated and extended toward the incisal edge direction. The immunostaining with podoplanin also showed that the characteristics of the green fluorescent tissue were identical to those of the original. The green fluorescent cells were only found in the labial side of the incisor up to 4 weeks. After 12 weeks, however, they were also found in the lingual side. Here the green fluorescent cementocyte-like cells were only present in the cementum close to the dentin surface. This study suggests that some of the cells that form the cellular cementum come from the apical tissue including the apical bud in rodent incisors.

  16. Differentiation of Apical Bud Cells in a Newly Developed Apical Bud Transplantation Model Using GFP Transgenic Mice as Donor

    Science.gov (United States)

    Sakagami, Ryuji; Yoshinaga, Yasunori; Okamura, Kazuhiko

    2016-01-01

    Rodent mandibular incisors have a unique anatomical structure that allows teeth to grow throughout the lifetime of the rodent. This report presents a novel transplantation technique for studying the apical bud differentiation of rodent mandibular incisors. Incisal apical end tissue with green fluorescent protein from transgenic mouse was transplanted to wild type mice, and the development of the transplanted cells were immunohistologically observed for 12 weeks after the transplantation. Results indicate that the green fluorescent apical end tissue replaced the original tissue, and cells from the apical bud differentiated and extended toward the incisal edge direction. The immunostaining with podoplanin also showed that the characteristics of the green fluorescent tissue were identical to those of the original. The green fluorescent cells were only found in the labial side of the incisor up to 4 weeks. After 12 weeks, however, they were also found in the lingual side. Here the green fluorescent cementocyte-like cells were only present in the cementum close to the dentin surface. This study suggests that some of the cells that form the cellular cementum come from the apical tissue including the apical bud in rodent incisors. PMID:26978064

  17. Strigolactone acts downstream of auxin to regulate bud outgrowth in pea and Arabidopsis.

    Science.gov (United States)

    Brewer, Philip B; Dun, Elizabeth A; Ferguson, Brett J; Rameau, Catherine; Beveridge, Christine A

    2009-05-01

    During the last century, two key hypotheses have been proposed to explain apical dominance in plants: auxin promotes the production of a second messenger that moves up into buds to repress their outgrowth, and auxin saturation in the stem inhibits auxin transport from buds, thereby inhibiting bud outgrowth. The recent discovery of strigolactone as the novel shoot-branching inhibitor allowed us to test its mode of action in relation to these hypotheses. We found that exogenously applied strigolactone inhibited bud outgrowth in pea (Pisum sativum) even when auxin was depleted after decapitation. We also found that strigolactone application reduced branching in Arabidopsis (Arabidopsis thaliana) auxin response mutants, suggesting that auxin may act through strigolactones to facilitate apical dominance. Moreover, strigolactone application to tiny buds of mutant or decapitated pea plants rapidly stopped outgrowth, in contrast to applying N-1-naphthylphthalamic acid (NPA), an auxin transport inhibitor, which significantly slowed growth only after several days. Whereas strigolactone or NPA applied to growing buds reduced bud length, only NPA blocked auxin transport in the bud. Wild-type and strigolactone biosynthesis mutant pea and Arabidopsis shoots were capable of instantly transporting additional amounts of auxin in excess of endogenous levels, contrary to predictions of auxin transport models. These data suggest that strigolactone does not act primarily by affecting auxin transport from buds. Rather, the primary repressor of bud outgrowth appears to be the auxin-dependent production of strigolactones. PMID:19321710

  18. Langerin-heparin interaction: two binding sites for small and large ligands as revealed by a combination of NMR spectroscopy and cross-linking mapping experiments.

    Science.gov (United States)

    Muñoz-García, Juan C; Chabrol, Eric; Vivès, Romain R; Thomas, Aline; de Paz, José L; Rojo, Javier; Imberty, Anne; Fieschi, Franck; Nieto, Pedro M; Angulo, Jesús

    2015-04-01

    Langerin is a C-type lectin present on Langerhans cells that mediates capture of pathogens in a carbohydrate-dependent manner, leading to subsequent internalization and elimination in the cellular organelles called Birbeck granules. This mechanism mediated by langerin was shown to constitute a natural barrier for HIV-1 particle transmission. Besides interacting specifically with high mannose and fucosylated neutral carbohydrate structures, langerin has the ability to bind sulfated carbohydrate ligands as 6-sulfated galactosides in the Ca(2+)-dependent binding site. Very recently langerin was demonstrated to interact with sulfated glycosaminoglycans (GAGs), in a Ca(2+)-independent way, resulting in the proposal of a new binding site for GAGs. On the basis of those results, we have conducted a structural study of the interactions of small heparin (HEP)-like oligosaccharides with langerin in solution. Heparin bead cross-linking experiments, an approach specifically designed to identify HEP/heparan sulfate binding sites in proteins were first carried out and experimentally validated the previously proposed model for the interaction of langerin extracellular domain with 6 kDa HEP. High-resolution NMR studies of a set of eight synthetic HEP-like trisaccharides harboring different sulfation patterns demonstrated that all of them bound to langerin in a Ca(2+)-dependent way. The binding epitopes were determined by saturation transfer difference NMR and the bound conformations by transferred NOESY experiments. These experimental data were combined with docking and molecular dynamics and resulted in the proposal of a binding mode characterized by the coordination of calcium by the two equatorial hydroxyl groups, OH3 and OH4, at the non-reducing end. The binding also includes the carboxylate group at the adjacent iduronate residue. This epitope is shared by all eight ligands, explaining the absence of any impact on binding from differences in their substitution patterns

  19. Cooperative protein structural dynamics of homodimeric hemoglobin linked to water cluster at subunit interface revealed by time-resolved X-ray solution scattering

    Directory of Open Access Journals (Sweden)

    Jong Goo Kim

    2016-03-01

    Full Text Available Homodimeric hemoglobin (HbI consisting of two subunits is a good model system for investigating the allosteric structural transition as it exhibits cooperativity in ligand binding. In this work, as an effort to extend our previous study on wild-type and F97Y mutant HbI, we investigate structural dynamics of a mutant HbI in solution to examine the role of well-organized interfacial water cluster, which has been known to mediate intersubunit communication in HbI. In the T72V mutant of HbI, the interfacial water cluster in the T state is perturbed due to the lack of Thr72, resulting in two less interfacial water molecules than in wild-type HbI. By performing picosecond time-resolved X-ray solution scattering experiment and kinetic analysis on the T72V mutant, we identify three structurally distinct intermediates (I1, I2, and I3 and show that the kinetics of the T72V mutant are well described by the same kinetic model used for wild-type and F97Y HbI, which involves biphasic kinetics, geminate recombination, and bimolecular CO recombination. The optimized kinetic model shows that the R-T transition and bimolecular CO recombination are faster in the T72V mutant than in the wild type. From structural analysis using species-associated difference scattering curves for the intermediates, we find that the T-like deoxy I3 intermediate in solution has a different structure from deoxy HbI in crystal. In addition, we extract detailed structural parameters of the intermediates such as E-F distance, intersubunit rotation angle, and heme-heme distance. By comparing the structures of protein intermediates in wild-type HbI and the T72V mutant, we reveal how the perturbation in the interfacial water cluster affects the kinetics and structures of reaction intermediates of HbI.

  20. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    Directory of Open Access Journals (Sweden)

    Steelman Samantha M

    2012-11-01

    Full Text Available Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to characterize hindgut bacterial communities in healthy horses and those with chronic laminitis. Results Fecal samples were collected from 10 normal horses and 8 horses with chronic laminitis. Genomic DNA was extracted and the V4-V5 segment of the 16S rRNA gene was PCR amplified and sequenced on the 454 platform generating a mean of 2,425 reads per sample after quality trimming. The bacterial communities were dominated by Firmicutes (69.21% control, 56.72% laminitis and Verrucomicrobia (18.13% control, 27.63% laminitis, followed by Bacteroidetes, Proteobacteria, and Spirochaetes. We observed more OTUs per individual in the laminitis group than the control group (419.6 and 355.2, respectively, P = 0.019 along with a difference in the abundance of two unassigned Clostridiales genera (P = 0.03 and P = 0.01. The most abundant bacteria were Streptococcus spp., Clostridium spp., and Treponema spp.; along with unassigned genera from Subdivision 5 of Verrucomicrobia, Ruminococcaceae, and Clostridiaceae, which together constituted ~ 80% of all OTUs. There was a high level of individual variation across all taxonomic ranks. Conclusions Our exploration of the equine fecal microflora revealed higher bacterial diversity in horses with chronic laminitis and identification of two Clostridiales genera that differed in abundance from control horses. There was large individual variation in bacterial communities that was not explained in our study. The core hindgut microflora was

  1. Membrane tension is a key determinant of bud morphology in clathrin-mediated endocytosis

    CERN Document Server

    Hassinger, Julian E; Drubin, David G; Rangamani, Padmini

    2016-01-01

    In clathrin-mediated endocytosis (CME), clathrin and various adaptor proteins coat a patch of the plasma membrane, which is reshaped to form a budded vesicle. Experimental studies have demonstrated that elevated membrane tension can inhibit bud formation by a clathrin coat. In this study, we investigate the impact of membrane tension on the mechanics of membrane budding by simulating clathrin coats that either grow in area or progressively induce greater curvature. At low membrane tension, progressively increasing the area of a curvature-generating coat causes the membrane to smoothly evolve from a flat to budded morphology, whereas the membrane remains essentially flat at high membrane tensions. Interestingly, at physiologically relevant, intermediate membrane tensions, the shape evolution of the membrane undergoes a snapthrough instability in which increasing coat area causes the membrane to "snap" from an open, U-shaped bud to a closed, $\\Omega$-shaped bud. This instability is accompanied by a large energy...

  2. Relationship between formation of gametophore buds in the protonema of mosses and increase in ribonuclease activity

    Directory of Open Access Journals (Sweden)

    M. Spychała

    2015-05-01

    Full Text Available Changes in RNase activity similar to those accompanying cytokinin-induced formation of gametophore buds in mosses (a decrease in the early phase of bud formation and later an increase in enzyme activity have also been found during spontaneous formation of gametophores in moss ontogenesis. Using various factors affecting the cytokinin-induced process of bud formation a correlation has been found between this process and the increase in RNase activity.

  3. Model of human immunodeficiency virus budding and self-assembly: Role of the cell membrane

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan T.

    2008-11-01

    Budding from the plasma membrane of the host cell is an indispensable step in the life cycle of the human immunodeficiency virus (HIV), which belongs to a large family of enveloped RNA viruses, retroviruses. Unlike regular enveloped viruses, retrovirus budding happens concurrently with the self-assembly of the main retrovirus protein subunits (called Gag protein after the name of the genetic material that codes for this protein: Group-specific AntiGen) into spherical virus capsids on the cell membrane. Led by this unique budding and assembly mechanism, we study the free energy profile of retrovirus budding, taking into account the Gag-Gag attraction energy and the membrane elastic energy. We find that if the Gag-Gag attraction is strong, budding always proceeds to completion. During early stage of budding, the zenith angle of partial budded capsids, α , increases with time as α∝t1/2 . However, if the Gag-Gag attraction is weak, a metastable state of partial budding appears. The zenith angle of these partially spherical capsids is given by α0≃(τ2/κσ)1/4 in a linear approximation, where κ and σ are the bending modulus and the surface tension of the membrane, and τ is a line tension of the capsid proportional to the strength of Gag-Gag attraction. Numerically, we find α0<0.3π without any approximations. Using experimental parameters, we show that HIV budding and assembly always proceed to completion in normal biological conditions. On the other hand, by changing Gag-Gag interaction strength or membrane rigidity, it is relatively easy to tune it back and forth between complete budding and partial budding. Our model agrees reasonably well with experiments observing partial budding of retroviruses including HIV.

  4. Breast bud detection: a validation study in the Chilean Growth Obesity Cohort Study

    OpenAIRE

    Pereira, Ana; Garmendia, María Luisa; González, Daniela; Kain, Juliana; Mericq, Verónica; Uauy, Ricardo; Corvalán, Camila

    2014-01-01

    Background Early puberty onset has been related to future chronic disease; however breast bud assessment in large scale population studies is difficult because it requires trained personnel. Thus our aim is to assess the validity of self and maternal breast bud detection, considering girl’s body mass index (BMI) and maternal education. Methods In 2010, 481 girls (mean age = 7.8) from the Growth and Obesity Chilean Cohort Study were evaluated by a nutritionist trained in breast bud detection. ...

  5. Sucrose is an early modulator of the key hormonal mechanisms controlling bud outgrowth in Rosa hybrida.

    Science.gov (United States)

    Barbier, François; Péron, Thomas; Lecerf, Marion; Perez-Garcia, Maria-Dolores; Barrière, Quentin; Rolčík, Jakub; Boutet-Mercey, Stéphanie; Citerne, Sylvie; Lemoine, Remi; Porcheron, Benoît; Roman, Hanaé; Leduc, Nathalie; Le Gourrierec, José; Bertheloot, Jessica; Sakr, Soulaiman

    2015-05-01

    Sugar has only recently been identified as a key player in triggering bud outgrowth, while hormonal control of bud outgrowth is already well established. To get a better understanding of sugar control, the present study investigated how sugar availability modulates the hormonal network during bud outgrowth in Rosa hybrida. Other plant models, for which mutants are available, were used when necessary. Buds were grown in vitro to manipulate available sugars. The temporal patterns of the hormonal regulatory network were assessed in parallel with bud outgrowth dynamics. Sucrose determined bud entrance into sustained growth in a concentration-dependent manner. Sustained growth was accompanied by sustained auxin production in buds, and sustained auxin export in a DR5::GUS-expressing pea line. Several events occurred ahead of sucrose-stimulated bud outgrowth. Sucrose upregulated early auxin synthesis genes (RhTAR1, RhYUC1) and the auxin efflux carrier gene RhPIN1, and promoted PIN1 abundance at the plasma membrane in a pPIN1::PIN1-GFP-expressing tomato line. Sucrose downregulated both RwMAX2, involved in the strigolactone-transduction pathway, and RhBRC1, a repressor of branching, at an early stage. The presence of sucrose also increased stem cytokinin content, but sucrose-promoted bud outgrowth was not related to that pathway. In these processes, several non-metabolizable sucrose analogues induced sustained bud outgrowth in R. hybrida, Pisum sativum, and Arabidopsis thaliana, suggesting that sucrose was involved in a signalling pathway. In conclusion, we identified potential hormonal candidates for bud outgrowth control by sugar. They are central to future investigations aimed at disentangling the processes that underlie regulation of bud outgrowth by sugar. PMID:25873679

  6. Green Synthesis of Novel Jasmine Bud-Shaped Copper Nanoparticles

    OpenAIRE

    Malathi Sampath; Ramya Vijayan; Ezhilarasu Tamilarasu; Abiraman Tamilselvan; Balasubramanian Sengottuvelan

    2014-01-01

    Novel jasmine bud-shaped copper nanoparticles were synthesized by a green chemical reduction method using polyvinylpyrrolidone (PVP) as a capping agent, L-ascorbic acid (AA) as a reducing agent as well as antioxidant agent, isonicotinic acid hydrazide (INH) as a reducing agent, and water as a solvent at 60–70°C (pH-7) in the presence of air. The UV-Vis absorption maximum obtained is 573 nm. The crystal lattice (fcc) structure of Cu Nps was confirmed by X-ray diffraction (XRD). The novel jasm...

  7. Reconstitution of hemisomes on budding yeast centromeric DNA

    OpenAIRE

    Furuyama, Takehito; Codomo, Christine A.; Henikoff, Steven

    2013-01-01

    The structure of nucleosomes that contain the cenH3 histone variant has been controversial. In budding yeast, a single right-handed cenH3/H4/H2A/H2B tetramer wraps the ∼80-bp Centromere DNA Element II (CDE II) sequence of each centromere into a ‘hemisome’. However, attempts to reconstitute cenH3 particles in vitro have yielded exclusively ‘octasomes’, which are observed in vivo on chromosome arms only when Cse4 (yeast cenH3) is overproduced. Here, we show that Cse4 octamers remain intact unde...

  8. Tripartite organization of centromeric chromatin in budding yeast

    OpenAIRE

    Krassovsky, Kristina; Henikoff, Jorja G.; Henikoff, Steven

    2011-01-01

    The centromere is the genetic locus that organizes the proteinaceous kinetochore and is responsible for attachment of the chromosome to the spindle at mitosis and meiosis. In most eukaryotes, the centromere consists of highly repetitive DNA sequences that are occupied by nucleosomes containing the CenH3 histone variant, whereas in budding yeast, a ∼120-bp centromere DNA element (CDE) that is sufficient for centromere function is occupied by a single right-handed histone variant CenH3 (Cse4) n...

  9. Reconstitution of clathrin-coated pit budding from plasma membranes

    OpenAIRE

    1991-01-01

    Receptor-mediated endocytosis begins with the binding of ligand to receptors in clathrin-coated pits followed by the budding of the pits away from the membrane. We have successfully reconstituted this sequence in vitro. Highly purified plasma membranes labeled with gold were obtained by incubating cells in the presence of anti-LDL receptor IgG-gold at 4 degrees C, attaching the labeled cells to a poly-L-lysine- coated substratum at 4 degrees C and then gently sonicating them to remove everyth...

  10. Mechanical damage in cotton buds caused by the boll weevil

    Directory of Open Access Journals (Sweden)

    Santos Roseane Cavalcanti

    2003-01-01

    Full Text Available The boll weevil (Anthonomus grandis Boheman causes high levels of bud abscission in cotton plants due to feeding or oviposition punctures. It has been reported that abscission is mainly due to enzymes present in the insect's saliva, but mechanical damage could also contribute to square abscission. The objective of this paper was to undertake an analysis of the morphological damages caused by the insect in cotton squares using microscopy. Anthers and ovules are the main target of boll weevil feeding. The process initiates by perforation of young sepal and petal tissues and proceeds with subsequent alimentation on stamen and ovary leading to abscission of floral structures.

  11. Qualitative and quantitative differences between taste buds of the rat and mouse

    Directory of Open Access Journals (Sweden)

    Ma Huazhi

    2007-01-01

    Full Text Available Abstract Background Numerous electrophysiological, ultrastructural, and immunocytochemical studies on rodent taste buds have been carried out on rat taste buds. In recent years, however, the mouse has become the species of choice for molecular and other studies on sensory transduction in taste buds. Do rat and mouse taste buds have the same cell types, sensory transduction markers and synaptic proteins? In the present study we have used antisera directed against PLCβ2, α-gustducin, serotonin (5-HT, PGP 9.5 and synaptobrevin-2 to determine the percentages of taste cells expressing these markers in taste buds in both rodent species. We also determined the numbers of taste cells in the taste buds as well as taste bud volume. Results There are significant differences (p 3 is smaller than a rat taste bud (64,200 μm3. The numerical density of taste cells in mouse circumvallate taste buds (2.1 cells/1000 μm3 is significantly higher than that in the rat (1.2 cells/1000 μm3. Conclusion These results suggest that rats and mice differ significantly in the percentages of taste cells expressing signaling molecules. We speculate that these observed dissimilarities may reflect differences in their gustatory processing.

  12. Analysis of Essential Oils from Flower-buds, Leaves and Stems of Filipendula palmata (Pall.) Maxim.

    Institute of Scientific and Technical Information of China (English)

    WU Yin; MENG Xiang-ying; LIU Xiao-hua; BAO Yong-li; WANG Shu-ping; LI Yu-xin

    2005-01-01

    The essential oils of the flower-buds, leaves and stems of Filipendula palmata (Pall.) Maxim. were analyzed by GC and GC-MS. Thirty-three, forty-seven and forty-seven compounds in the flower-buds, leaves and stems were identified, respectively. Methyl salicylate exists in a great amount which is up to 70. 10% in the flower-buds. Its amount is also high in other two parts. The data obtained show that it may be one of the main natural mosquito-expelling and pain-alleviating components in the three parts. The flower-buds are the main active part with the mosquito-expelling function.

  13. The Race against Protease Activation Defines the Role of ESCRTs in HIV Budding

    Science.gov (United States)

    Bendjennat, Mourad; Saffarian, Saveez

    2016-01-01

    HIV virions assemble on the plasma membrane and bud out of infected cells using interactions with endosomal sorting complexes required for transport (ESCRTs). HIV protease activation is essential for maturation and infectivity of progeny virions, however, the precise timing of protease activation and its relationship to budding has not been well defined. We show that compromised interactions with ESCRTs result in delayed budding of virions from host cells. Specifically, we show that Gag mutants with compromised interactions with ALIX and Tsg101, two early ESCRT factors, have an average budding delay of ~75 minutes and ~10 hours, respectively. Virions with inactive proteases incorporated the full Gag-Pol and had ~60 minutes delay in budding. We demonstrate that during budding delay, activated proteases release critical HIV enzymes back to host cytosol leading to production of non-infectious progeny virions. To explain the molecular mechanism of the observed budding delay, we modulated the Pol size artificially and show that virion release delays are size-dependent and also show size-dependency in requirements for Tsg101 and ALIX. We highlight the sensitivity of HIV to budding “on-time” and suggest that budding delay is a potent mechanism for inhibition of infectious retroviral release. PMID:27280284

  14. Gamma-ray effect on the leaf bud growth in peach

    International Nuclear Information System (INIS)

    The semilethal and lethal gamma-ray doses in irradiating peach leaf buds with regard to the application of experimental mutagenesis in peach tree have been determined. Peach scions have been gamma-irradiated in July, August and September at 1, 2, 3, 4. 5 and 6 kR. It is established that the amount of survived leaf bud grafts linearly declines as the irradiation dose rises. The semilethal dose LD50 for leaf buds varies in different years within the 2.7 to 4 kR range. The lethal dose in irradiated with 60Co gamma-rays peach leaf buds - is about 6 kR. (author)

  15. ESCRT-III CHMP2A and CHMP3 form variable helical polymers in vitro and act synergistically during HIV-1 budding.

    Science.gov (United States)

    Effantin, Grégory; Dordor, Aurélien; Sandrin, Virginie; Martinelli, Nicolas; Sundquist, Wesley I; Schoehn, Guy; Weissenhorn, Winfried

    2013-02-01

    The endosomal sorting complex required for transport-III (ESCRT-III) proteins are essential for budding of some enveloped viruses, for the formation of intraluminal vesicles at the endosome and for the abscission step of cytokinesis. ESCRT-III proteins form polymers that constrict membrane tubes, leading to fission. We have used electron cryomicroscopy to determine the molecular organization of pleiomorphic ESCRT-III CHMP2A-CHMP3 polymers. The three-dimensional reconstruction at 22 Å resolution reveals a helical organization of filaments of CHMP molecules organized in a head-to-tail fashion. Protease susceptibility experiments indicate that polymerization is achieved via conformational changes that increase the protomer stability. Combinatorial siRNA knockdown experiments indicate that CHMP3 contributes synergistically to HIV-1 budding, and the CHMP3 contribution is ~ 10-fold more pronounced in concert with CHMP2A than with CHMP2B. This is consistent with surface plasmon resonance affinity measurements that suggest sequential CHMP4B-CHMP3-CHMP2A recruitment while showing that both CHMP2A and CHMP2B interact with CHMP4B, in agreement with their redundant functions in HIV-1 budding. Our data thus indicate that the CHMP2A-CHMP3 polymer observed in vitro contributes to HIV-1 budding by assembling on CHMP4B polymers. PMID:23051622

  16. Alteration of starch hydrolyzing enzyme inhibitory properties, antioxidant activities, and phenolic profile of clove buds (Syzygium aromaticum L.) by cooking duration.

    Science.gov (United States)

    Adefegha, Stephen A; Oboh, Ganiyu; Oyeleye, Sunday I; Osunmo, Kolawole

    2016-03-01

    This study assessed the effect of cooking duration on starch hydrolyzing enzyme (α-amylase and α-glucosidase) activities, antioxidant (1,1-diphenyl-2 picrylhydrazyl [DPPH*], hydroxyl [OH*] radicals scavenging abilities and reducing power) properties, and phenolic profile of clove buds. Clove buds (raw) were cooked for 10 (SC 10) and 20 min (SC 20) and subsequently, their effects were assessed on enzyme activities, antioxidant properties, and phenolic profile. Inhibition of α-amylase and α-glucosidase activities and radicals scavenging abilities were altered by cooking in the trend; raw SC 20, with IC 50 values ranging from 0.25 to 0.52 mg/mL and 0.10 to 1.50 mg/mL respectively. HPLC phenolic profile of the clove buds revealed significant (P < 0.05) changes in the amount of chlorogenic acid, quercitrin, quercetin, and kaempferol at different cooking duration. Thus, cooking duration may alter the phenolic compositions and nutraceutical potentials of clove bud by activation and/or deactivation of redox-active metabolites. PMID:27004114

  17. Green Synthesis of Novel Jasmine Bud-Shaped Copper Nanoparticles

    Directory of Open Access Journals (Sweden)

    Malathi Sampath

    2014-01-01

    Full Text Available Novel jasmine bud-shaped copper nanoparticles were synthesized by a green chemical reduction method using polyvinylpyrrolidone (PVP as a capping agent, L-ascorbic acid (AA as a reducing agent as well as antioxidant agent, isonicotinic acid hydrazide (INH as a reducing agent, and water as a solvent at 60–70°C (pH-7 in the presence of air. The UV-Vis absorption maximum obtained is 573 nm. The crystal lattice (fcc structure of Cu Nps was confirmed by X-ray diffraction (XRD. The novel jasmine bud shape was visualized in a transmission electron microscope (TEM. The height of single copper nanobud was 6.41 nm as measured by atomic force microscope (AFM. The average particle size 6.95 nm is obtained by XRD results. Antibacterial activity of the Cu nanobuds was evaluated by testing against Gram-negative (Escherichia coli and Gram-positive (Staphylococcus aureus bacteria.

  18. BuD, a helix–loop–helix DNA-binding domain for genome modification

    International Nuclear Information System (INIS)

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing

  19. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  20. BudBurst Buddies: Introducing Young Citizen Scientists to Plants and Environmental Change

    Science.gov (United States)

    Ward, D.; Gardiner, L. S.; Henderson, S.

    2011-12-01

    As part of Project BudBurst, the BudBurst Buddies recently moved to the National Ecological Network (NEON) as part of its Education and Public Engagement efforts. The BudBurst Buddies (www.budburstbuddies.org) were created to engage elementary school age children in the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Hundreds of young students have participated in the inaugural year of BudBurst Buddies. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. The program was recently highlighted by education staff at the New York Hall of Science and numerous classrooms have been implementing this resource as part of their curriculum. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies resources including a new implementation guide and will also share feedback from the first year of implementation.

  1. Link: Winning Configurations Revealed by Settheoretic Methods

    Directory of Open Access Journals (Sweden)

    Roberto Garcia Castro

    2011-01-01

    Full Text Available Diversos estudios empíricos han encontrado una relación positiva, negativa y neutra entre la implicación familiar en la empresa y la rentabilidad de la compañía. La inconsistencia de los resultados obtenidos puede estar motivada por los diferentes niveles de implicación familiar. Las empresas familiares no son entidades homogéneas sino que, en realidad, hay empresas propiedad de la familia, gobernadas por la familia o gestionadas por ella. Todas estas variaciones dan lugar a diferentes configuraciones basadas en los componentes de implicación familiar y que pueden ser estudiadas empíricamente empleando métodos basados en la teoría de conjuntos (fs/QCA. Utilizando esta metodología con una muestra internacional de 6.611 empresas identificamos siete configuraciones que conducen a una rentabilidad superior.

  2. The Missing Link Revealed in Ginkgo Evolution

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    @@ Ginkgo, or the maidenhair tree, is considered a living fossil, as it was found to have existed early in the Jurassic period about 170 million years ago.However, a more than 100 million-year gap in the fossil record since the Jurassic period has hindered a full understanding of its evolution.

  3. Simulation of forest tree species' bud burst dates for different climate scenarios: chilling requirements and photo-period may limit bud burst advancement

    Science.gov (United States)

    Lange, Maximilian; Schaber, Jörg; Marx, Andreas; Jäckel, Greta; Badeck, Franz-Werner; Seppelt, Ralf; Doktor, Daniel

    2016-04-01

    This study investigates whether the assumed increase of winter and spring temperatures is depicted by phenological models in correspondingly earlier bud burst (BB) dates. Some studies assume that rising temperatures lead to an earlier BB, but even later BB has been detected. The phenological model PIM (promoter-inhibitor-model) fitted to the extensive phenological database of the German Weather Service was driven by several climate scenarios. This model accounts for the complicated mechanistic interactions between chilling requirements, temperature and photo-period. It predicts BB with a r 2 between 0.41 and 0.62 and a RMSE of around 1 week, depending on species. Parameter sensitivities depict species dependent interactions between growth and chilling requirements as well as photo-period. A mean trend to earlier BB was revealed for the period 2002- 2100, varying between -0.05 and -0.11 days per year, depending on species. These trends are lower than for the period 1951- 2009. Within climate scenario period, trends are decreasing for beech and chestnut, stagnating for birch and increasing for oak. Results suggest that not fulfilled chilling requirements accompanied by an increasing dependency on photo-period potentially limit future BB advancement. The combination of a powerful phenological model, a large scale phenological database and several climate scenarios, offers new insights into the mechanistic comprehension of spring phenology.

  4. Vector sequences - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project Vector sequences Data detail Data name Vector sequences Description of data contents Vector seq...wnload License Update History of This Database Site Policy | Contact Us Vector sequences - Budding yeast cDNA sequencing project | LSDB Archive ... ...uences used for sequencing. Multi FASTA format. 7 entries. Data file File name: vec

  5. Genetic control of x-ray resistance in budding yeast cells

    International Nuclear Information System (INIS)

    Five x-ray-sensitive mutants were selected from 10,000 colonies arising from survivors of ultraviolet light. These were named XS5, XS6, XS7, XS8, and XS9. Mutant XS1 was donated by Nakai. These mutations affect the resistant budding cell survival component of the survival curve and, in diploids, the low-dose interdivisional cell shoulder. They are of two types: Class I, in which budding cells lack resistance; and Class II, in which budding cells show reduced resistance. When crossed with one another, they show a complex complementation pattern. Gene dosage effects are seen in XS1 heterozygotes, while budding but not between divisions. No direct correlation between radiation sensitivity, meiosis, and sporulation is observed; genes which influence radiation sensitivity do not affect meiotic recombination. A single mutation (XS1 or XS5) suppresses the shoulders of the survival curves of both budding haploid cells and diploid nonbudding cells

  6. Uptake and distribution of 32P in the budded and self-rooted grape varieties

    International Nuclear Information System (INIS)

    In the self-rooted and budded varieties of grape (Vitis vinifera L.), the total P and 32P contents were high in 'Anabee-Shahi', but low in in 'Muscat'. The growing shoots contained more P than old stems and roots in all the varieties. In the budded plants, 'Kali Sahebi' scion budded on 'Anab-e-Shani showed the maximum 32P and total P in the shoots, but 'Muscat' scion budded on 'Anab-e-Shahi' accumulated more P in the roots and very low 32P in the growing shoots. Auto-radiographs of shoots also showed that 'Kali Sahebi' budded on 'Anab-e-Shani' rootstock accumulated more 32P in the shoots. (author)

  7. Cell kinetic study on the relation between irradiation hypogeusia and taste buds in rats

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Hideharu; Furumoto, Keiichi [Nippon Dental Univ., Tokyo (Japan)

    1998-12-01

    The present study was designed to elucidate the mechanism of hypogeusia caused by irradiation. X-ray treatment at 10 Gy or 20 Gy was given to the maxillofacial region including the tongue in rats, and the involvement of taste bud for hypogeusia was investigated. In addition, cytological kinetics were immunohistologically studied using bromodeoxyuridine in the taste bud and in the lingual mucosal epithelium. The following results were obtained: In the 10 Gy group, the number of taste bud become less after the exposure, but no hypogeusia was observed during the experimental period. In the 20 Gy group, any labeled taste bud was not observed on the 7th day, and all taste buds disappeared by the 10th day. In the lingual mucosal epithelium, the number of basal cells decreased to the minimum, and the body weight and total water intake decreased coincidently in the 20 Gy group, which were few in the 10 Gy group. (author)

  8. Tannin vacuoles and starch in the development of Scots pine (Pinus sihestris vegetative buds

    Directory of Open Access Journals (Sweden)

    Alina Hejnowicz

    2015-05-01

    Full Text Available Tannin cells occur throughout the bud except the distal and peripheral meristem zones of the apical meristem, and the youngest cataphyll primordia. Starch is absent in winter buds. The earliest structural manifestation of spring awakening in the bud are fragmentation of tannin vacuoles and synthesis of starch in the green cells of the bud. The tannins occurring in the vacuoles are hydrolysable giving a positive reaction for sugars (PAS. During their spring hydrolysis glucose is released. It is probably one of the sources of sugars for the synthesis of starch. During extension growth of the bud there occurs a degradation of tannin cells in the pith, which consist in the precipitation of tannins to a condensed form.

  9. BudBurst Buddies: A New Tool for Engaging the Youngest Citizen Scientists

    Science.gov (United States)

    Gardiner, L. S.; Henderson, S.; Ward, D.

    2010-12-01

    BudBurst Buddies (www.budburstbuddies.org) introduces elementary school age children to the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a new part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies newly developed resources. BudBurst Buddies is a part of Project BudBurst, a national citizen science program coordinated by the National Ecological Observatory Network (NEON) and the Chicago Botanic Garden. Funding for this resource was provided by NEON, NSF, NASA, and the National Geographic Education Foundation.

  10. Novel Features of the Prenatal Horn Bud Development in Cattle (Bos taurus.

    Directory of Open Access Journals (Sweden)

    Dominique Judith Wiener

    Full Text Available Whereas the genetic background of horn growth in cattle has been studied extensively, little is known about the morphological changes in the developing fetal horn bud. In this study we histologically analyzed the development of horn buds of bovine fetuses between ~70 and ~268 days of pregnancy and compared them with biopsies taken from the frontal skin of the same fetuses. In addition we compared the samples from the wild type (horned fetuses with samples taken from the horn bud region of age-matched genetically hornless (polled fetuses. In summary, the horn bud with multiple layers of vacuolated keratinocytes is histologically visible early in fetal life already at around day 70 of gestation and can be easily differentiated from the much thinner epidermis of the frontal skin. However, at the gestation day (gd 212 the epidermis above the horn bud shows a similar morphology to the epidermis of the frontal skin and the outstanding layers of vacuolated keratinocytes have disappeared. Immature hair follicles are seen in the frontal skin at gd 115 whereas hair follicles below the horn bud are not present until gd 155. Interestingly, thick nerve bundles appear in the dermis below the horn bud at gd 115. These nerve fibers grow in size over time and are prominent shortly before birth. Prominent nerve bundles are not present in the frontal skin of wild type or in polled fetuses at any time, indicating that the horn bud is a very sensitive area. The samples from the horn bud region from polled fetuses are histologically equivalent to samples taken from the frontal skin in horned species. This is the first study that presents unique histological data on bovine prenatal horn bud differentiation at different developmental stages which creates knowledge for a better understanding of recent molecular findings.

  11. Origin of nuclear buds and micronuclei in normal and folate-deprived human lymphocytes

    International Nuclear Information System (INIS)

    Micronuclei are formed from chromosomes and chromosomal fragments that lag behind in anaphase and are left outside daughter nuclei in telophase. They may also be derived from broken anaphase bridges. Nuclear buds, micronucleus-like bodies attached to the nucleus by a thin nucleoplasmic connection, have been proposed to be generated similarly to micronuclei during nuclear division or in S-phase as a stage in the extrusion of extra DNA, possibly giving rise to micronuclei. To better understand these phenomena, we have characterized the contents of 894 nuclear buds and 1392 micronuclei in normal and folate-deprived 9-day cultures of human lymphocytes using fluorescence in situ hybridization with pancentromeric and pantelomeric DNA probes. Such information has not earlier been available for human primary cells. Surprisingly, there appears to be no previous data on the occurrence of telomeres in micronuclei (or buds) of normal human cells in general. Our results suggest that nuclear buds and micronuclei have partly different mechanistic origin. Interstitial DNA without centromere or telomere label was clearly more prevalent in nuclear buds (43%) than in micronuclei (13%). DNA with only telomere label or with both centromere and telomere label was more frequent in micronuclei (62% and 22%, respectively) than in nuclear buds (44% and 10%, respectively). Folate deprivation especially increased the frequency of nuclear buds and micronuclei harboring telomeric DNA and nuclear buds harboring interstitial DNA but also buds and micronuclei with both centromeric and telomeric DNA. According to the model we propose, that micronuclei in binucleate lymphocytes primarily derive from lagging chromosomes and terminal acentric fragments during mitosis. Most nuclear buds, however, are suggested to originate from interstitial or terminal acentric fragments, possibly representing nuclear membrane entrapment of DNA that has been left in cytoplasm after nuclear division or excess DNA that

  12. Dynamical Analysis of Protein Regulatory Network in Budding Yeast Nucleus

    Institute of Scientific and Technical Information of China (English)

    LI Fang-Ting; JIA Xun

    2006-01-01

    @@ Recent progresses in the protein regulatory network of budding yeast Saccharomyces cerevisiae have provided a global picture of its protein network for further dynamical research. We simplify and modularize the protein regulatory networks in yeast nucleus, and study the dynamical properties of the core 37-node network by a Boolean network model, especially the evolution steps and final fixed points. Our simulation results show that the number of fixed points N(k) for a given size of the attraction basin k obeys a power-law distribution N(k)∝k-2.024. The yeast network is more similar to a scale-free network than a random network in the above dynamical properties.

  13. Guillaume Budé, l’humaniste et le prince

    Directory of Open Access Journals (Sweden)

    Sylvie Le Clech-Charton

    2009-09-01

    Full Text Available Grande figure de la Renaissance des lettres et des arts en France, tout à la fois écrivain, traducteur, ambassadeur, créateur du dépôt légal et fondateur du Collège de France, maître de la librairie du roi à Fontainebleau, Guillaume Budé (1468-1540 est essentiellement connu pour le rôle de conseiller politique et culturel qu’il joua auprès de François Ier, dont il fut le secrétaire. Il a été surtout étudié du point de vue de sa production littéraire savante, mais non sous l’angle de son mili...

  14. The physics of lipid droplet nucleation, growth and budding.

    Science.gov (United States)

    Thiam, Abdou Rachid; Forêt, Lionel

    2016-08-01

    Lipid droplets (LDs) are intracellular oil-in-water emulsion droplets, covered by a phospholipid monolayer and mainly present in the cytosol. Despite their important role in cellular metabolism and growing number of newly identified functions, LD formation mechanism from the endoplasmic reticulum remains poorly understood. To form a LD, the oil molecules synthesized in the ER accumulate between the monolayer leaflets and induce deformation of the membrane. This formation process works through three steps: nucleation, growth and budding, exactly as in phase separation and dewetting phenomena. These steps involve sequential biophysical membrane remodeling mechanisms for which we present basic tools of statistical physics, membrane biophysics, and soft matter science underlying them. We aim to highlight relevant factors that could control LD formation size, site and number through this physics description. An emphasis will be given to a currently underestimated contribution of the molecular interactions between lipids to favor an energetically costless mechanism of LD formation. PMID:27131867

  15. Scandinavian links

    DEFF Research Database (Denmark)

    Matthiessen, Christian Wichmann; Knowles, Richard D.

    The European Round Table of Industrialists identified in the 1980ies 14 missing links in the transportation network of the continent. Three of them were found around the Danish island of Zealand. One link is within the nation, the other two are between nations. One link connects heavy economic ce...

  16. Changes in well-defined phases of bud dormancy associated with shifts in carbohydrate metabolism may involve beta-amylases

    Science.gov (United States)

    Leafy spurge is a noxious perennial weed that infests range lands in the Northern Great Plains. It is being used as a model to investigate dormancy in underground adventitious buds, i.e., root and crown buds. Underground adventitious buds of leafy spurge (Euphorbia esula) are 1) maintained in a quie...

  17. Ndc10 is a platform for inner kinetochore assembly in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Uhn-Soo; Harrison, Stephen C. (Harvard-Med)

    2012-01-10

    Kinetochores link centromeric DNA to spindle microtubules and ensure faithful chromosome segregation during mitosis. In point-centromere yeasts, the CBF3 complex Skp1-Ctf13-(Cep3){sub 2}-(Ndc10){sub 2} recognizes a conserved centromeric DNA element through contacts made by Cep3 and Ndc10. We describe here the five-domain organization of Kluyveromyces lactis Ndc10 and the structure at 2.8 {angstrom} resolution of domains I-II (residues 1-402) bound to DNA. The structure resembles tyrosine DNA recombinases, although it lacks both endonuclease and ligase activities. Structural and biochemical data demonstrate that each subunit of the Ndc10 dimer binds a separate fragment of DNA, suggesting that Ndc10 stabilizes a DNA loop at the centromere. We describe in vitro association experiments showing that specific domains of Ndc10 interact with each of the known inner-kinetochore proteins or protein complexes in budding yeast. We propose that Ndc10 provides a central platform for inner-kinetochore assembly.

  18. [Relationships between reactive oxygen metabolism and endodormancy release of peach bud under short-term heating].

    Science.gov (United States)

    Wang, Xiao-di; Wang, Hai-bo; Gao, Dong-sheng; Li, Jiang; Wang, Bao-liang; Liu, Feng-zhi

    2010-11-01

    Taking the 6-year-old peach "Shuguang" as test object, this paper studied the effects of short-term heating at 40 degrees C, 45 degrees C, and 50 degrees C on the bud livability, bud burst, reactive oxygen content, and activities of related enzymes in peach bud, aimed to investigate the regulation effect of short-term heating on the endodormancy release of peach bud. The results indicated that the effects of short-tern heating on the endodormancy release of peach bud were advanced by the postponement of treatment date, the increase of treatment temperature, and the prolonging of treatment time. On November 30, the regulation effect of heating at 40 degrees C was negative. Comparing with those under no-heating (CK), the date of endodormancy release was postponed, the bud burst, the O2-* and * OH production rates, the H2O2 content, and the activities of CAT and POD were lowered, and the SOD activity was improved. It was adverse under heating at 45 degrees C and 50 degrees C. On December 10, heating at 40 degrees C nearly had no obvious effect on the endodormancy release, while heating at 45 degrees C and 50 degrees C had the same effect as that on November 30, with the former being more superior to the latter. Correlation analysis indicated that the rapid increase of reactive oxygen might be the critical reason for the endodormancy release of peach bud. PMID:21360995

  19. Auxin dynamics after decapitation are not correlated with the initial growth of axillary buds.

    Science.gov (United States)

    Morris, Suzanne E; Cox, Marjolein C H; Ross, John J; Krisantini, Santi; Beveridge, Christine A

    2005-07-01

    One of the first and most enduring roles identified for the plant hormone auxin is the mediation of apical dominance. Many reports have claimed that reduced stem indole-3-acetic acid (IAA) levels and/or reduced basipetal IAA transport directly or indirectly initiate bud growth in decapitated plants. We have tested whether auxin inhibits the initial stage of bud release, or subsequent stages, in garden pea (Pisum sativum) by providing a rigorous examination of the dynamics of auxin level, auxin transport, and axillary bud growth. We demonstrate that after decapitation, initial bud growth occurs prior to changes in IAA level or transport in surrounding stem tissue and is not prevented by an acropetal supply of exogenous auxin. We also show that auxin transport inhibitors cause a similar auxin depletion as decapitation, but do not stimulate bud growth within our experimental time-frame. These results indicate that decapitation may trigger initial bud growth via an auxin-independent mechanism. We propose that auxin operates after this initial stage, mediating apical dominance via autoregulation of buds that are already in transition toward sustained growth. PMID:15965021

  20. MLST and Whole-Genome-Based Population Analysis of Cryptococcus gattii VGIII Links Clinical, Veterinary and Environmental Strains, and Reveals Divergent Serotype Specific Sub-populations and Distant Ancestors

    Science.gov (United States)

    Firacative, Carolina; Roe, Chandler C.; Malik, Richard; Ferreira-Paim, Kennio; Escandón, Patricia; Sykes, Jane E.; Castañón-Olivares, Laura Rocío; Contreras-Peres, Cudberto; Samayoa, Blanca; Sorrell, Tania C.; Castañeda, Elizabeth; Lockhart, Shawn R.; Engelthaler, David M.; Meyer, Wieland

    2016-01-01

    The emerging pathogen Cryptococcus gattii causes life-threatening disease in immunocompetent and immunocompromised hosts. Of the four major molecular types (VGI-VGIV), the molecular type VGIII has recently emerged as cause of disease in otherwise healthy individuals, prompting a need to investigate its population genetic structure to understand if there are potential genotype-dependent characteristics in its epidemiology, environmental niche(s), host range and clinical features of disease. Multilocus sequence typing (MLST) of 122 clinical, environmental and veterinary C. gattii VGIII isolates from Australia, Colombia, Guatemala, Mexico, New Zealand, Paraguay, USA and Venezuela, and whole genome sequencing (WGS) of 60 isolates representing all established MLST types identified four divergent sub-populations. The majority of the isolates belong to two main clades, corresponding either to serotype B or C, indicating an ongoing species evolution. Both major clades included clinical, environmental and veterinary isolates. The C. gattii VGIII population was genetically highly diverse, with minor differences between countries, isolation source, serotype and mating type. Little to no recombination was found between the two major groups, serotype B and C, at the whole and mitochondrial genome level. C. gattii VGIII is widespread in the Americas, with sporadic cases occurring elsewhere, WGS revealed Mexico and USA as a likely origin of the serotype B VGIII population and Colombia as a possible origin of the serotype C VGIII population. Serotype B isolates are more virulent than serotype C isolates in a murine model of infection, causing predominantly pulmonary cryptococcosis. No specific link between genotype and virulence was observed. Antifungal susceptibility testing against six antifungal drugs revealed that serotype B isolates are more susceptible to azoles than serotype C isolates, highlighting the importance of strain typing to guide effective treatment to improve the

  1. Contribution of Underlying Connective Tissue Cells to Taste Buds in Mouse Tongue and Soft Palate

    Science.gov (United States)

    Mederacke, Ingmar; Komatsu, Yoshihiro; Stice, Steve; Schwabe, Robert F.; Mistretta, Charlotte M.; Mishina, Yuji; Liu, Hong-Xiang

    2016-01-01

    Taste buds, the sensory organs for taste, have been described as arising solely from the surrounding epithelium, which is in distinction from other sensory receptors that are known to originate from neural precursors, i.e., neural ectoderm that includes neural crest (NC). Our previous study suggested a potential contribution of NC derived cells to early immature fungiform taste buds in late embryonic (E18.5) and young postnatal (P1-10) mice. In the present study we demonstrated the contribution of the underlying connective tissue (CT) to mature taste buds in mouse tongue and soft palate. Three independent mouse models were used for fate mapping of NC and NC derived connective tissue cells: (1) P0-Cre/R26-tdTomato (RFP) to label NC, NC derived Schwann cells and derivatives; (2) Dermo1-Cre/RFP to label mesenchymal cells and derivatives; and (3) Vimentin-CreER/mGFP to label Vimentin-expressing CT cells and derivatives upon tamoxifen treatment. Both P0-Cre/RFP and Dermo1-Cre/RFP labeled cells were abundant in mature taste buds in lingual taste papillae and soft palate, but not in the surrounding epithelial cells. Concurrently, labeled cells were extensively distributed in the underlying CT. RFP signals were seen in the majority of taste buds and all three types (I, II, III) of differentiated taste bud cells, with the neuronal-like type III cells labeled at a greater proportion. Further, Vimentin-CreER labeled cells were found in the taste buds of 3-month-old mice whereas Vimentin immunoreactivity was only seen in the CT. Taken together, our data demonstrate a previously unrecognized origin of taste bud cells from the underlying CT, a conceptually new finding in our knowledge of taste bud cell derivation, i.e., from both the surrounding epithelium and the underlying CT that is primarily derived from NC. PMID:26741369

  2. Project BudBurst: Continental-scale citizen science for all seasons

    Science.gov (United States)

    Henderson, S.; Newman, S. J.; Ward, D.; Havens-Young, K.; Alaback, P.; Meymaris, K.

    2011-12-01

    Project BudBurst's (budburst.org) recent move to the National Ecological Observatory Network (NEON) has benefitted both programs. NEON has been able to use Project BudBurst as a testbed to learn best practices, network with experts in the field, and prototype potential tools for engaging people in continental-scale ecology as NEON develops its citizen science program. Participation in Project BudBurst has grown significantly since the move to NEON. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, thousands of participants from all 50 states have submitted data. This presentation will provide an overview of Project BudBurst and will report on the results of the 2010 field campaign and discuss plans to expand Project BudBurst in 2012 including the use of mobile phones applications for data collection and reporting from the field. Project BudBurst is co-managed by the National Ecological Observatory Network and the Chicago

  3. Thyroid bud morphogenesis requires CDC42- and SHROOM3-dependent apical constriction

    Science.gov (United States)

    Loebel, David A. F.; Plageman, Timothy F.; Tang, Theresa L.; Jones, Vanessa J.; Muccioli, Maria; Tam, Patrick P. L.

    2016-01-01

    ABSTRACT Early development of the gut endoderm and its subsequent remodeling for the formation of organ buds are accompanied by changes to epithelial cell shape and polarity. Members of the Rho-related family of small GTPases and their interacting proteins play multiple roles in regulating epithelial morphogenesis. In this study we examined the role of Cdc42 in foregut development and organ bud formation. Ablation of Cdc42 in post-gastrulation mouse embryos resulted in a loss of apical-basal cell polarity and columnar epithelial morphology in the ventral pharyngeal endoderm, in conjunction with a loss of apical localization of the known CDC42 effector protein PARD6B. Cell viability but not proliferation in the foregut endoderm was impaired. Outgrowth of the liver, lung and thyroid buds was severely curtailed in Cdc42-deficient embryos. In particular, the thyroid bud epithelium did not display the apical constriction that normally occurs concurrently with the outgrowth of the bud into the underlying mesenchyme. SHROOM3, a protein that interacts with Rho GTPases and promotes apical constriction, was strongly expressed in the thyroid bud and its sub-cellular localization was disrupted in Cdc42-deficient embryos. In Shroom3 gene trap mutant embryos, the thyroid bud epithelium showed no apical constriction, while the bud continued to grow and protruded into the foregut lumen. Our findings indicate that Cdc42 is required for epithelial polarity and organization in the endoderm and for apical constriction in the thyroid bud. It is possible that the function of CDC42 is partly mediated by SHROOM3. PMID:26772200

  4. Phenotypic plasticity, QTL mapping and genomic characterization of bud set in black poplar

    Directory of Open Access Journals (Sweden)

    Fabbrini Francesco

    2012-04-01

    Full Text Available Abstract Background The genetic control of important adaptive traits, such as bud set, is still poorly understood in most forest trees species. Poplar is an ideal model tree to study bud set because of its indeterminate shoot growth. Thus, a full-sib family derived from an intraspecific cross of P. nigra with 162 clonally replicated progeny was used to assess the phenotypic plasticity and genetic variation of bud set in two sites of contrasting environmental conditions. Results Six crucial phenological stages of bud set were scored. Night length appeared to be the most important signal triggering the onset of growth cessation. Nevertheless, the effect of other environmental factors, such as temperature, increased during the process. Moreover, a considerable role of genotype × environment (G × E interaction was found in all phenological stages with the lowest temperature appearing to influence the sensitivity of the most plastic genotypes. Descriptors of growth cessation and bud onset explained the largest part of phenotypic variation of the entire process. Quantitative trait loci (QTL for these traits were detected. For the four selected traits (the onset of growth cessation (date2.5, the transition from shoot to bud (date1.5, the duration of bud formation (subproc1 and bud maturation (subproc2 eight and sixteen QTL were mapped on the maternal and paternal map, respectively. The identified QTL, each one characterized by small or modest effect, highlighted the complex nature of traits involved in bud set process. Comparison between map location of QTL and P. trichocarpa genome sequence allowed the identification of 13 gene models, 67 bud set-related expressional and six functional candidate genes (CGs. These CGs are functionally related to relevant biological processes, environmental sensing, signaling, and cell growth and development. Some strong QTL had no obvious CGs, and hold great promise to identify unknown genes that affect bud set

  5. Ultraviolet patterns on rear of flowers: basis of disparity of buds and blossoms.

    Science.gov (United States)

    Eisner, T; Eisner, M; Aneshansley, D

    1973-04-01

    Flowers of Jasminium primulinum and Hypericum spp. have ultraviolet patterns on the reverse surface of the corolla. Those areas of the surface that are exposed to the outside in the bud are ultraviolet absorbent, whereas the portions that come into view at maturity in the open blossom are ultraviolet reflectant. Buds and blossoms, as a result, appear different in color to insects sensitive to ultraviolet light. Experimental evidence indicates that the ultraviolet-absorbent quality of the outer surface of the bud is a consequence of exposure itself, attributable possibly to a "sun tanning" effect. PMID:16592074

  6. Propolis allergy (IV). Studies with further sensitizers from propolis and constituents common to propolis, poplar buds and balsam of Peru.

    Science.gov (United States)

    Hausen, B M; Evers, P; Stüwe, H T; König, W A; Wollenweber, E

    1992-01-01

    26 different compounds have been investigated experimentally for their sensitizing capacity in guinea pigs. 19 of these occur in propolis as well as in poplar bud exudates, and 14 of them are also found in balsam of Peru. 4 caffeates and benzyl isoferulate were found to be strong sensitizers. 7 compounds were moderate, and 13 compounds showed only weak sensitizing potency. Methyl cinnamate was negative. Patch tests in 11 propolis-sensitive patients once more revealed 3-methyl-2-butenyl caffeate and phenylethyl caffeate as the major sensitizers. In addition to the 8 compounds already known to occur in propolis as well as in balsam of Peru, we detected 5 further substances that both materials have in common. Among these, benzyl isoferulate is considered a noteworthy sensitizer. Coniferyl benzoate, which was shown to be a moderate sensitizer, is present in fresh samples of balsam of Peru, while in propolis it has been detected only once so far. The flavonoid aglycones occurring in poplar bud exudates, and hence also in propolis, are weak sensitizers which play only a minor role in propolis hypersensitivity. PMID:1600736

  7. Voltage-gated sodium channels in taste bud cells

    Directory of Open Access Journals (Sweden)

    Williams Mark E

    2009-03-01

    Full Text Available Abstract Background Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. Results We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. Conclusion SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.

  8. Dissecting ribosome assembly and transport in budding yeast.

    Science.gov (United States)

    Altvater, Martin; Schütz, Sabina; Chang, Yiming; Panse, Vikram Govind

    2014-01-01

    Construction of the eukaryotic ribosome begins in the nucleolus and requires >300 evolutionarily conserved nonribosomal trans-acting factors, which transiently associate with preribosomal subunits at distinct assembly stages. A subset of trans-acting and transport factors passage assembled preribosomal subunits in a functionally inactive state through the nuclear pore complexes (NPC) into the cytoplasm, where they undergo final maturation before initiating translation. Here, we summarize the repertoire of tools developed in the model organism budding yeast that are spearheading the functional analyses of trans-acting factors involved in the assembly and intracellular transport of preribosomal subunits. We elaborate on different GFP-tagged ribosomal protein reporters and a pre-rRNA reporter that reliably monitors the movement of preribosomal particles from the nucleolus to cytoplasm. We discuss the powerful yeast heterokaryon assay, which can be employed to uncover shuttling trans-acting factors that need to accompany preribosomal subunits to the cytoplasm to be released prior to initiating translation. Moreover, we present two biochemical approaches, namely sucrose gradient analyses and tandem affinity purification, that are rapidly facilitating the uncovering of regulatory processes that control the compositional dynamics of trans-acting factors on maturing preribosomal particles. Altogether, these approaches when combined with traditional analytical biochemistry, targeted proteomics and structural methodologies, will contribute to the dissection of the assembly and intracellular transport of preribosomal subunits, as well as other macromolecular assemblies that influence diverse biological pathways. PMID:24857742

  9. Integrative analysis of cell cycle control in budding yeast.

    Science.gov (United States)

    Chen, Katherine C; Calzone, Laurence; Csikasz-Nagy, Attila; Cross, Frederick R; Novak, Bela; Tyson, John J

    2004-08-01

    The adaptive responses of a living cell to internal and external signals are controlled by networks of proteins whose interactions are so complex that the functional integration of the network cannot be comprehended by intuitive reasoning alone. Mathematical modeling, based on biochemical rate equations, provides a rigorous and reliable tool for unraveling the complexities of molecular regulatory networks. The budding yeast cell cycle is a challenging test case for this approach, because the control system is known in exquisite detail and its function is constrained by the phenotypic properties of >100 genetically engineered strains. We show that a mathematical model built on a consensus picture of this control system is largely successful in explaining the phenotypes of mutants described so far. A few inconsistencies between the model and experiments indicate aspects of the mechanism that require revision. In addition, the model allows one to frame and critique hypotheses about how the division cycle is regulated in wild-type and mutant cells, to predict the phenotypes of new mutant combinations, and to estimate the effective values of biochemical rate constants that are difficult to measure directly in vivo. PMID:15169868

  10. Timing robustness in the budding and fission yeast cell cycles.

    KAUST Repository

    Mangla, Karan

    2010-02-01

    Robustness of biological models has emerged as an important principle in systems biology. Many past analyses of Boolean models update all pending changes in signals simultaneously (i.e., synchronously), making it impossible to consider robustness to variations in timing that result from noise and different environmental conditions. We checked previously published mathematical models of the cell cycles of budding and fission yeast for robustness to timing variations by constructing Boolean models and analyzing them using model-checking software for the property of speed independence. Surprisingly, the models are nearly, but not totally, speed-independent. In some cases, examination of timing problems discovered in the analysis exposes apparent inaccuracies in the model. Biologically justified revisions to the model eliminate the timing problems. Furthermore, in silico random mutations in the regulatory interactions of a speed-independent Boolean model are shown to be unlikely to preserve speed independence, even in models that are otherwise functional, providing evidence for selection pressure to maintain timing robustness. Multiple cell cycle models exhibit strong robustness to timing variation, apparently due to evolutionary pressure. Thus, timing robustness can be a basis for generating testable hypotheses and can focus attention on aspects of a model that may need refinement.

  11. Gibberellins and the break of bud dormancy in virus-infected stem cuttings of Euphorbia pulcherrima.

    Science.gov (United States)

    Nath, S; Mandahar, C L; Gulati, A

    1979-10-15

    Break in bud dormancy in virus-infected stem cuttings of Euphorbia pulcherrima occurs because of the higher quantity of gibberellins present in them than in healthy cuttings in the dormant period of the plant. PMID:499409

  12. A physiologic role for serotonergic transmission in adult rat taste buds.

    Directory of Open Access Journals (Sweden)

    Luc Jaber

    Full Text Available Of the multiple neurotransmitters and neuropeptides expressed in the mammalian taste bud, serotonin remains both the most studied and least understood. Serotonin is expressed in a subset of taste receptor cells that form synapses with afferent nerve fibers (type III cells and was once thought to be essential to neurotransmission (now understood as purinergic. However, the discovery of the 5-HT1A serotonin receptor in a subset of taste receptor cells paracrine to type III cell suggested a role in cell-to-cell communication during the processing of taste information. Functional data describing this role are lacking. Using anatomical and neurophysiological techniques, this study proposes a modulatory role for serotonin during the processing of taste information. Double labeling immunocytochemical and single cell RT-PCR technique experiments documented that 5-HT1A-expressing cells co-expressed markers for type II cells, cells which express T1R or T2R receptors and release ATP. These cells did not co-express type III cells markers. Neurophysiological recordings from the chorda tympani nerve, which innervates anterior taste buds, were performed prior to and during intravenous injection of a 5-HT1A receptor antagonist. These experiments revealed that serotonin facilitates processing of taste information for tastants representing sweet, sour, salty, and bitter taste qualities. On the other hand, injection of ondansetron, a 5-HT3 receptor antagonist, was without effect. Collectively, these data support the hypothesis that serotonin is a crucial element in a finely-tuned feedback loop involving the 5-HT1A receptor, ATP, and purinoceptors. It is hypothesized that serotonin facilitates gustatory signals by regulating the release of ATP through ATP-release channels possibly through phosphatidylinositol 4,5-bisphosphate resynthesis. By doing so, 5-HT1A activation prevents desensitization of post-synaptic purinergic receptors expressed on afferent nerve fibers

  13. Budding yeast cDNA sequencing project: S03036-24_C13 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03036-24_C 13 - - - Show S03036-24_C 13 Seqid S03036-24_C 13 Link to SGD - Link to dbEST - Link to ... UC SC ... Genome Browser - Sequenc e >S03036-24_C 13.phd NNN ... NNNNNNNNNNNNNNANNNNNNNNTGNNGGNNNNNTNNNNNN ANTTGNTATC GAC TTNNTTCC NNNNGAGANNNNNNTGGANAANGANGAGNNNNNGNANAC ... TTNNGANAAANANNC NNANGGTGAGAGCC AGATCC NNNNNNGC GGATTGNGAGC AAATC G TTAAG ... TTC AGGTC AAGTAAAAATTGATTTC NAAAAC TAATTTC TC TTATAC NANNNTTT ...

  14. Field and laboratory investigations of budding in the tetillid sponge Cinachyrella cavernosa

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, A; Thakur, N.L.

    when the average water temperature of intertidal rock pools was 32.4±0.23°C (February–March), followed by a significant decrease in budding frequency at 28.2±0.12°C (April–July), and no budding at

  15. Isolation and Properties of Ferromanganese-Depositing Budding Bacteria from Baltic Sea Ferromanganese Concretions

    OpenAIRE

    Ghiorse, William C.; Hirsch, Peter

    1982-01-01

    Hyphal budding bacteria were observed by electron microscopy in thin sections of surface material from Baltic Sea ferromanganese concretions. Similar bacteria were also observed in and isolated from enrichment cultures prepared from the same concretion material. Three morphologically similar strains of Mn-Fe-depositing budding bacteria were isolated from the enrichment cultures. Strain B-4 possessed extracellular anionic polymers that accumulated Mn oxides. Mn deposition by B-4 was inhibited ...

  16. Electron microscopic observation of hepatitis B virus budding from hepatocytes into bile canaliculi.

    OpenAIRE

    Ymadada, Gotaro; Sakamoto,Yuji; Mizuno, Motowo; Kobayashi, Toshinari; Nagashima,Hideo

    1980-01-01

    In electron microscopic observation of a liver biopsy obtained from a hepatitis B surface antigen-positive patient, noncoated core particles were occasionally seen budding into the hepatocytic cisterni and many Dane particles were found in the pericanalicular vesicles of hepatocytes. Noncoated core particles were also localized in clusters within the bleb of microvilli. There were some core particles being protruded from microvilli into the lumen of bile canaliculi by budding. These findings ...

  17. In vitro development of buds from tubers of (Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    The present work studies the in vitro development of buds from potato tubers subjected to gamma radiation at doses of 3, 6, 9 and 12 Krad. Ths effect of radiation was dependent on the dormant stage of the buds. Intermediate doses (6-9 Krad) did inhibit mitotic division but not cellular elongation. When irradiation is carried out at the end of the resting period, there is an apparent sprouting due to the elongation of previously formed cells. (Author) 17 refs

  18. Marketingová komunikace destinace České Budějovice

    OpenAIRE

    MASARYKOVÁ, Lenka

    2013-01-01

    The thesis deals with an analysis of marketing communication instruments in the destination of České Budějovice. Pursuant of an analysis the current instruments of marketing communication are identified and the efficiency is evaluated. The one part of the thesis is also the suggestion of on optimal communication mix and the measures with contribute to the next development of marketing communication of the destination České Budějovice.

  19. Gustatory stimuli representing different perceptual qualities elicit distinct patterns of neuropeptide secretion from taste buds

    OpenAIRE

    Geraedts, Maartje C. P.; Munger, Steven D.

    2013-01-01

    Taste stimuli that evoke different perceptual qualities (e.g., sweet, umami, bitter, sour, salty) are detected by dedicated subpopulations of taste bud cells that employ distinct combinations of sensory receptors and transduction molecules. Here, we report that taste stimuli also elicit unique patterns of neuropeptide secretion from taste buds that are correlated with those perceptual qualities. We measured tastant-dependent secretion of glucagon-like peptide-1 (GLP-1), glucagon and neuropept...

  20. Identification of genes related to the development of bamboo rhizome bud

    OpenAIRE

    Wang, Kuihong; Peng, Huazheng; Lin, Erpei; Jin, Qunying; Hua, Xiqi; YAO, SHENG; Bian, Hongwu; Han, Ning; Pan, Jianwei; Wang, Junhui; Deng, Mingjuan; Zhu, Muyuan

    2009-01-01

    Bamboo (Phyllostachys praecox) is one of the largest members of the grass family Poaceae, and is one of the most economically important crops in Asia. However, complete knowledge of bamboo development and its molecular mechanisms is still lacking. In the present study, the differences in anatomical structure among rhizome buds, rhizome shoots, and bamboo shoots were compared, and several genes related to the development of the bamboo rhizome bud were identified. The rice cross-species microar...

  1. Partial repair of salinity-induced damage to sprouting sugarcane buds by proline and glycinebetaine pretreatment.

    Science.gov (United States)

    Rasheed, Rizwan; Wahid, Abdul; Hussain, Iqbal; Mahmood, Saqib; Parveen, Abida

    2016-05-01

    Sugarcane shows reduced crop stand under relatively suboptimal conditions; the main reason for this is its sensitivity to ionic stress in the soil solution. This research was performed to explore some physiological and developmental changes in the immature sugarcane buds submitted to salt stress and possible role of glycinebetaine (GB) and proline (Pro) in mitigating the ion toxicity in a time course manner. Salinity stress reduced fresh and dry weight, induced the generation of hydrogen peroxide, increased tissue levels of Na(+) sand Cl(-), reduced K(+) and Ca(2+), and K(+):Na(+) and Ca(2+):Na(+) ratios, while increasing the osmolyte synthesis in expanding sugarcane buds. Salinity stress reduced and delayed the formation of new bud leaves and their expansion, which was mainly because of reduction in the number and area of mesophyll cells and poor development of vascular bundles. The pretreatment of bud chips with 20 mM each of GB and Pro decreased tissue levels of Na(+) and Cl(-), reduced the generation of H2O2, improved K(+) and Ca(2+), K(+):Na(+) and Ca(2+):Na(+) ratios, and further increased the levels of GB, free proline (FP), and soluble sugars in the buds. The pretreatment increased mesophyll cell number and expansion of bud leaves and formation of elaborated vascular tissues, which apparently enabled the sprouting buds to adapt to salinity stress. Of the two osmolytes, GB was a relatively better inducer of salinity tolerance than Pro. In short, salinity-induced oxidative stress was the main cause for altered tissue development, the production of which was offset by pretreatment of bud tissues with Pro and GB. PMID:26043840

  2. Changes of Morphogenic Competence in Mature Pinus sylvestris L. Buds in vitro

    OpenAIRE

    ANDERSONE, UNA; IEVINSH, GEDERTS

    2002-01-01

    The effects of season and cold storage on morphogenic competence in mature Pinus sylvestris buds were investigated. Peroxidase and polyphenol oxidase activity were measured as markers of oxidative metabolism. No growth in vitro was observed on explants detached from the end of January until the beginning of March. Brachioblasts, each with a couple of needles, formed on 11 % of the buds without macrostrobili that were detached in early April and introduced immediately into culture. Of the expl...

  3. Ucelená rehabilitace klientů na Oddělení následné péče v Nemocnici České Budějovice a.s.

    OpenAIRE

    PLACER, Jiří

    2010-01-01

    The submitted bachelor thesis seeks to analyze the issue of comprehensive rehabilitation as a significant part of the therapy of clients at the department of follow-up care (hereinafter DFC) in České Budějovice. The comprehensive rehabilitation is becoming an indispensable component of the care provided by our company. The comprehensiveness in rehabilitation means primarily timeliness, mutual links between it individual components and also completeness of the provided care. The purpose and th...

  4. Structural Characterization of Ginsenosides from Flower Buds of Panax ginseng by RRLC-Q-TOF MS.

    Science.gov (United States)

    Wu, Wei; Lu, Ziyan; Teng, Yaran; Guo, Yingying; Liu, Shuying

    2016-02-01

    Ginseng flower bud as a part of Panax ginseng has received much attention as a valuable functional food with medicinal potential. A few studies focused on systematic and comprehensive studies on its major ingredients. This study aims to rapidly characterize ginsenosides in ginseng flower buds and provide scientific basis for developing functional food, exploiting pharmaceutical effects and making full use of ginseng resources. A rapid resolution liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (RRLC-Q-TOF-MS) method was developed for rapid qualitative and quantitative analysis of ginsenosides in ginseng flower buds. The compounds were identified by comparing retention time of the reference standards, accurate mass measurement and the fragment ions obtained from RRLC-Q-TOF-MS/MS analyses. A total of 14 kinds of ginsenosides were identified and 5 kinds of malonyl-ginsenosides were first tentatively identified in ginseng flower buds. Ten kinds of main ginsenosides were quantitatively analyzed. The developed RRLC-Q-TOF-MS method was demonstrated as an effective analytical means for rapid characterization of the ginsenosides in flower buds of P. ginseng. The research result is valuable for quality control, assessment of authenticity and stability evaluation of ginseng flower buds. PMID:26270079

  5. Association of Dermatological Conditions of External Ear with the Use of Cotton Buds

    Directory of Open Access Journals (Sweden)

    Salahuddin Ahmed

    2014-09-01

    Full Text Available Background: The habit of cleaning the external auditory canal with cotton buds is a common practice of the masses. It has strong association with neurodermatitis and contact dermatitis of the external ear. It is also associated with acute otitis externa, rupture of tympanic membrane causing bleeding and temporary hearing loss in some cases. In many cases the injury will heal but damage to minuscule bones deep inside the ear can cause permanent deafness. Objective: The objective of this study was to determine the association of dermatological condition of external ear with the use of cotton buds. Materials and Methods: This case control study was done from January to October 2012 in the Ear Nose Throat Department of Pakistan Level III Hospital, Darfur, Sudan. Sixty seven patients with dermatological diseases of external ear were cases and 83 subjects without dermatological diseases of external ear were selected as controls. Results: Among 67 cases, 58 were cotton bud users and among 83 controls only 29 were cotton bud users. Different types of dermatological diseases were neurodermatitis (34.32%, otitis externa (28.36%, contact dermatitis (26.87% and wax impaction (8.95%. Ninety three percent of cotton bud users were ignorant of harmful effects of this bad habit. Conclusion: There is a strong association of dermatological diseases of external ear with the use of cotton bud which should be discouraged by fortifying the warning by manufacturers and health education at various educational levels.

  6. Taste Bud Labeling in Whole Tongue Epithelial Sheet in Adult Mice.

    Science.gov (United States)

    Venkatesan, Nandakumar; Boggs, Kristin; Liu, Hong-Xiang

    2016-04-01

    Molecular labeling in whole-mount tissues provides an efficient way to obtain general information about the formation, maintenance, degeneration, and regeneration of many organs and tissues. However, labeling of lingual taste buds in whole tongue tissues in adult mice has been problematic because of the strong permeability barrier of the tongue epithelium. In this study, we present a simple method for labeling taste buds in the intact tongue epithelial sheet of an adult mouse. Following intralingual protease injection and incubation, immediate fixation of the tongue on mandible in 4% paraformaldehyde enabled the in situ shape of the tongue epithelium to be well maintained after peeling. The peeled epithelium was accessible to taste bud labeling with a pan-taste cell marker, keratin 8, and a type II taste cell marker, α-gustducin, in all three types of taste papillae, that is, fungiform, foliate, and circumvallate. Overnight incubation of tongue epithelial sheets with primary and secondary antibodies was sufficient for intense labeling of taste buds with both fluorescent and DAB visualizations. Labeled individual taste buds were easy to identify and quantify. This protocol provides an efficient way for phenotypic analyses of taste buds, especially regarding distribution pattern and number. PMID:26701416

  7. The final cut: cell polarity meets cytokinesis at the bud neck in S. cerevisiae.

    Science.gov (United States)

    Juanes, Maria Angeles; Piatti, Simonetta

    2016-08-01

    Cell division is a fundamental but complex process that gives rise to two daughter cells. It includes an ordered set of events, altogether called "the cell cycle", that culminate with cytokinesis, the final stage of mitosis leading to the physical separation of the two daughter cells. Symmetric cell division equally partitions cellular components between the two daughter cells, which are therefore identical to one another and often share the same fate. In many cases, however, cell division is asymmetrical and generates two daughter cells that differ in specific protein inheritance, cell size, or developmental potential. The budding yeast Saccharomyces cerevisiae has proven to be an excellent system to investigate the molecular mechanisms governing asymmetric cell division and cytokinesis. Budding yeast is highly polarized during the cell cycle and divides asymmetrically, producing two cells with distinct sizes and fates. Many components of the machinery establishing cell polarization during budding are relocalized to the division site (i.e., the bud neck) for cytokinesis. In this review we recapitulate how budding yeast cells undergo polarized processes at the bud neck for cell division. PMID:27085703

  8. Glutamate may be an efferent transmitter that elicits inhibition in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Yijen A Huang

    Full Text Available Recent studies suggest that l-glutamate may be an efferent transmitter released from axons innervating taste buds. In this report, we determined the types of ionotropic synaptic glutamate receptors present on taste cells and that underlie this postulated efferent transmission. We also studied what effect glutamate exerts on taste bud function. We isolated mouse taste buds and taste cells, conducted functional imaging using Fura 2, and used cellular biosensors to monitor taste-evoked transmitter release. The findings show that a large fraction of Presynaptic (Type III taste bud cells (∼50% respond to 100 µM glutamate, NMDA, or kainic acid (KA with an increase in intracellular Ca(2+. In contrast, Receptor (Type II taste cells rarely (4% responded to 100 µM glutamate. At this concentration and with these compounds, these agonists activate glutamatergic synaptic receptors, not glutamate taste (umami receptors. Moreover, applying glutamate, NMDA, or KA caused taste buds to secrete 5-HT, a Presynaptic taste cell transmitter, but not ATP, a Receptor cell transmitter. Indeed, glutamate-evoked 5-HT release inhibited taste-evoked ATP secretion. The findings are consistent with a role for glutamate in taste buds as an inhibitory efferent transmitter that acts via ionotropic synaptic glutamate receptors.

  9. Consequences of Repeated Defoliation on Belowground Bud Banks of Carex brevicuspis (Cyperaceae) in the Dongting Lake Wetlands, China

    Science.gov (United States)

    Chen, Xin-Sheng; Deng, Zheng-Miao; Xie, Yong-Hong; Li, Feng; Hou, Zhi-Yong; Wu, Chao

    2016-01-01

    Despite the predominant role of bud banks in the regeneration of clonal macrophyte populations, few studies have examined the way in which clonal macrophytes adjust the demographic features of bud banks to regulate population dynamics in response to defoliation in wetlands. We investigated the density and composition of bud banks under repeated defoliation in the wetland sedge Carex brevicuspis C. B. Clarke in the Dongting Lake wetlands, China. The density and biomass of rhizome buds and shoots did not decrease significantly in response to repeated defoliation over two consecutive years. The composition of bud banks, which consisted of long and short rhizome buds, also did not change significantly in response to repeated defoliation. Nevertheless, the ramet height and the shoot, root, and rhizome mass of C. brevicuspis declined significantly under repeated defoliation. Our findings suggest that bud banks are a conservative reproductive strategy that enables C. brevicuspis to tolerate a certain amount of defoliation. The maintenance of large bud banks after repeated defoliation may enable C. brevicuspis populations to regenerate and persist in disturbed habitats. However, bud bank density of C. brevicuspis might decline in the long term because the amount of carbon stored in rhizome buds and plants is reduced by frequent defoliation. PMID:27524993

  10. Link Analysis

    Science.gov (United States)

    Donoho, Steve

    Link analysis is a collection of techniques that operate on data that can be represented as nodes and links. This chapter surveys a variety of techniques including subgraph matching, finding cliques and K-plexes, maximizing spread of influence, visualization, finding hubs and authorities, and combining with traditional techniques (classification, clustering, etc). It also surveys applications including social network analysis, viral marketing, Internet search, fraud detection, and crime prevention.

  11. Systems Level Modeling of the Cell Cycle Using Budding Yeast

    Directory of Open Access Journals (Sweden)

    D.R. Kim

    2007-01-01

    Full Text Available Proteins involved in the regulation of the cell cycle are highly conserved across all eukaryotes, and so a relatively simple eukaryote such as yeast can provide insight into a variety of cell cycle perturbations including those that occur in human cancer. To date, the budding yeast Saccharomyces cerevisiae has provided the largest amount of experimental and modeling data on the progression of the cell cycle, making it a logical choice for in-depth studies of this process. Moreover, the advent of methods for collection of high-throughput genome, transcriptome, and proteome data has provided a means to collect and precisely quantify simultaneous cell cycle gene transcript and protein levels, permitting modeling of the cell cycle on the systems level. With the appropriate mathematical framework and suffi cient and accurate data on cell cycle components, it should be possible to create a model of the cell cycle that not only effectively describes its operation, but can also predict responses to perturbations such as variation in protein levels and responses to external stimuli including targeted inhibition by drugs. In this review, we summarize existing data on the yeast cell cycle, proteomics technologies for quantifying cell cycle proteins, and the mathematical frameworks that can integrate this data into representative and effective models. Systems level modeling of the cell cycle will require the integration of high-quality data with the appropriate mathematical framework, which can currently be attained through the combination of dynamic modeling based on proteomics data and using yeast as a model organism.

  12. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones and quality ...scores Data detail Data name 5'-end sequences of budding yeast full-length cDNA clones and quality scores De...from the budding yeast full-length cDNA library by the vector-capping method, the sequence quality score gen...s accession only. Sequence 5'-end sequence data of budding yeast full-length cDNA clones. FASTA format. Quality Phred's quality... Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones and quality

  13. High biological variability of plastids, photosynthetic pigments and pigment forms of leaf primordia in buds.

    Science.gov (United States)

    Solymosi, Katalin; Morandi, Dominique; Bóka, Károly; Böddi, Béla; Schoefs, Benoît

    2012-05-01

    To study the formation of the photosynthetic apparatus in nature, the carotenoid and chlorophyllous pigment compositions of differently developed leaf primordia in closed and opening buds of common ash (Fraxinus excelsior L.) and horse chestnut (Aesculus hippocastanum L.) as well as in closed buds of tree of heaven (Ailanthus altissima P. Mill.) were analyzed with HPLC. The native organization of the chlorophyllous pigments was studied using 77 K fluorescence spectroscopy, and plastid ultrastructure was investigated with electron microscopy. Complete etiolation, i.e., accumulation of protochlorophyllide, and absence of chlorophylls occurred in the innermost leaf primordia of common ash buds. The other leaf primordia were partially etiolated in the buds and contained protochlorophyllide (0.5-1 μg g(-1) fresh mass), chlorophyllides (0.2-27 μg g(-1) fresh mass) and chlorophylls (0.9-643 μg g(-1) fresh mass). Etio-chloroplasts with prolamellar bodies and either regular or only low grana were found in leaves having high or low amounts of chlorophyll a and b, respectively. After bud break, etioplast-chloroplast conversion proceeded and the pigment contents increased in the leaves, similarly to the greening processes observed in illuminated etiolated seedlings under laboratory conditions. The pigment contents and the ratio of the different spectral forms had a high biological variability that could be attributed to (i) various light conditions due to light filtering in the buds resulting in differently etiolated leaf primordia, (ii) to differences in the light-exposed and inner regions of the same primordia in opening buds due to various leaf folding, and (iii) to tissue-specific slight variations of plastid ultrastructure. PMID:22160501

  14. Bud development in corydalis (Corydalis bracteata) requires low temperature: a study of developmental and carbohydrate changes

    Science.gov (United States)

    Khodorova, Nadejda V.; Miroslavov, Evgeniy A.; Shavarda, Alexey L.; Laberche, Jean-Claude; Boitel-Conti, Michèle

    2010-01-01

    Background and Aims Spring geophytes require a period of low temperature for proper flower development but the mechanism that underlies the relationship between cold treatment and flowering remains unknown. The present study aims to compare the developmental anatomy and carbohydrate content of the tuberous geophyte Corydalis bracteata growing under natural winter conditions from 10 to −10 °C (field-grown) and under a mild temperature regime of 18 °C (indoor-grown plants). Methods Samples were studied under light and electron microscopy. A histochemical test (periodic acid – Schiff's) was employed to identify starch in sectioned material. Sugars were analysed by capillary gas chromatography. Apoplastic wash fluid was prepared. Key Results Under natural conditions, shoots were elongated, and buds gained in dry mass and developed normally. For indoor-grown plants, these parameters were lower in value and, from December, a progressive necrosis of flower buds was observed. The tuber consisted of the new developing one, which was connected to the bud, and the old tuber with its starch reserve. Due to the absence of plasmodesmata between new and old tuber cells, sugar transport cannot be through the symplast. Thus, a potential apoplastic route is proposed from old tuber phloem parenchyma cells to the adjacent new tuber cells. Sugar content in buds during the autumn months (September–November) was lower for indoor-grown plants than control plants, whereas the sugar content in tubers during the same period was similar for plants from both temperature treatments. However, the amount of apoplastic sugars in tubers of field-grown plants was almost 15-fold higher than in indoor-grown tubers. Conclusions The results suggest that low temperature activates the apoplastic route of sugar transport in C. bracteata tubers and a consequent carbohydrate delivery to the bud. In the absence of cold treatment, the carbohydrate reserve is locked in old tuber cells so the nutrient

  15. Local adaptations and climate change: converging sensitivity of bud break in black spruce provenances

    Science.gov (United States)

    Rossi, Sergio

    2015-07-01

    Species with transcontinental distribution or spread over wide geographical regions develop populations with growth traits genetically adapted to the local climate. The aim of this study was to investigate the ecotypic sensitivity of bud break, a strong adaptive trait, to a changing environment. Six phenological phases of bud break were monitored daily on black spruce [ Picea mariana (Mill.) BSP] seedlings submitted to different temperatures (12, 16 and 20 °C) and photoperiods (14, 18 and 22 h). Six provenances were tested in growth chambers, produced from seeds collected along the whole latitudinal range of the closed boreal forest in Quebec, Canada. Bud break lasted 13.3 days on average and occurred earlier in seedlings from colder sites. The annual temperature of the sites suitably tracked the clinal variation among ecotypes, providing a clear biological explanation for the environmental signal driving the adaptive divergence of populations to the local climate. Increasing temperature induced an earlier bud break according to a non-linear pattern with greater advancements observed between 12 and 16 °C. Photoperiod was significant, but sensitivity analysis indicated that its effect on bud break was marginal with respect to temperature. No interaction of provenance × treatment was observed, demonstrating an ecotypic convergence of the responses to both factors. Changes in the growing conditions could substantially modify the synchronization between bud phenology and climate, thus exposing the developing meristems of black spruce to frost damage. However, similar advancements of bud break could be expected in the different ecotypes subjected to warmer temperatures or longer day lengths.

  16. Operative links

    DEFF Research Database (Denmark)

    Wistoft, Karen

    2010-01-01

    as networks: second, a semantic perspective on discourses and concepts of health, and, third, a health pedagogical perspective on participation, intervention, and roles. This paper argues for the importance of 'operative links' between different levels in health strategies. It is proposed that such......The article combines a public management perspective with a pedagogical perspective on health promotion. Our aim is to look into recent reforms in Denmark on health promotion in order to see how managerial ideas have been combined with welfare professional ideals concerning broad, positive and...... links are supported by network structures, shared semantics and situated pedagogical means of intervention....

  17. Relationship between sensitivity to ultraviolet light and budding in yeast cells of different culture ages

    International Nuclear Information System (INIS)

    Subpopulations of yeast cells, consisting of cells of different sizes and different percentages of budding cells, were prepared by centrifugation through sucrose solutions with linear density gradients of cultures at different phases of the growth cycle. Ultraviolet survival of these cells was determined by colony counting, and the survival rate was compared with the cells' respiratory rates. Individual budding cells and interdivisional cells, and also mother cells and daughter cells derived from irradiated budding cells, were isolated by the micromanipulation technique. The number of divisions in each cell was measured during a 21-hr incubation period immediately after irradiation. In the population in the logarithmic phase consisting of homogeneous cells of middle size, no difference in uv sensitivity was observed between mother cells and daughter cells, irrespective of mutual adhesion. Budding cell resistance was observed in the population in the transitional phase; this was due to the lesser uv sensitivity of daughter cells in the fresh medium. In the stationary phase, daughter cells were rather more sensitive than mother cells or interdivisional cells, so there was little difference in uv sensitivity between budding cells and interdivisional cells

  18. Study of disbudding goat kids following injection of clove oil essence in horn bud region.

    Science.gov (United States)

    Molaei, Mohammad Mahdi; Mostafavi, Ali; Kheirandish, Reza; Azari, Omid; Shaddel, Mohsen

    2015-01-01

    This study was performed to evaluate the efficacy of injection of essential oil of Eugenia caryophyllata in the kid horn buds, as a new chemical technique for disbudding. Five-day-old healthy goat kids from both sexes (n = 16) were divided randomly into 4 equal groups. In groups 1, 2 and 3, 0.2 mL of clove essence and in group 4 (control) 0.2 mL of normal saline was injected into the left horn bud of goat kids. Right horn bud in all kids was considered to ensure that they are horned. During the study, the rate of horn growth were evaluated in determined time intervals between groups 1 and 4. Tissue samples were taken from right and left horn bud in groups 2 and 3, at five and ten days after clove essence injection, for microscopic study. The results of the study showed that the clove essence stopped horn growth, whereas there was no significant difference in horn growth rate between left and right horns after injection of normal saline, in group 4. Histopathological study showed that injection of clove essence caused complete necrosis of epidermis and underlying dermis with collagenolysis in horn bud tissues, 5 days after injection and then progress in healing process was observed after 10 days. According to the results of this study, it can be concluded that the injection of clove essence is an effective method to stop horn growth without any undesirable effects on clinical parameters in goat kids. PMID:25992247

  19. Intracellular assembly and budding of the Murine Leukemia Virus in infected cells

    Directory of Open Access Journals (Sweden)

    Briant Laurence

    2006-02-01

    Full Text Available Abstract Background Murine Leukemia Virus (MLV assembly has been long thought to occur exclusively at the plasma membrane. Current models of retroviral particle assembly describe the recruitment of the host vacuolar protein sorting machinery to the cell surface to induce the budding of new particles. Previous fluorescence microscopy study reported the vesicular traffic of the MLV components (Gag, Env and RNA. Here, electron microscopy (EM associated with immunolabeling approaches were used to go deeply into the assembly of the "prototypic" MLV in chronically infected NIH3T3 cells. Results Beside the virus budding events seen at the cell surface of infected cells, we observed that intracellular budding events could also occur inside the intracellular vacuoles in which many VLPs accumulated. EM in situ hybridization and immunolabeling analyses confirmed that these latter were MLV particles. Similar intracellular particles were detected in cells expressing MLV Gag alone. Compartments containing the MLV particles were identified as late endosomes using Lamp1 endosomal/lysosomal marker and BSA-gold pulse-chase experiments. In addition, infectious activity was detected in lysates of infected cells. Conclusion Altogether, our results showed that assembly of MLV could occur in part in intracellular compartments of infected murine cells and participate in the production of infectious viruses. These observations suggested that MLV budding could present similarities with the particular intracellular budding of HIV in infected macrophages.

  20. Study of budding yeast colony formation and its characterizations by using circular granular cell

    Science.gov (United States)

    Aprianti, D.; Haryanto, F.; Purqon, A.; Khotimah, S. N.; Viridi, S.

    2016-03-01

    Budding yeast can exhibit colony formation in solid substrate. The colony of pathogenic budding yeast can colonize various surfaces of the human body and medical devices. Furthermore, it can form biofilm that resists drug effective therapy. The formation of the colony is affected by the interaction between cells and with its growth media. The cell budding pattern holds an important role in colony expansion. To study this colony growth, the molecular dynamic method was chosen to simulate the interaction between budding yeast cells. Every cell was modelled by circular granular cells, which can grow and produce buds. Cohesion force, contact force, and Stokes force govern this model to mimic the interaction between cells and with the growth substrate. Characterization was determined by the maximum (L max) and minimum (L min) distances between two cells within the colony and whether two lines that connect the two cells in the maximum and minimum distances intersect each other. Therefore, it can be recognized the colony shape in circular, oval, and irregular shapes. Simulation resulted that colony formation are mostly in oval shape with little branch. It also shows that greater cohesion strength obtains more compact colony formation.

  1. Making continental-scale environmental programs relevant locally for educators with Project BudBurst

    Science.gov (United States)

    Goehring, L.; Henderson, S.; Wasser, L.; Newman, S. J.; Ward, D.

    2012-12-01

    Project BudBurst is a national citizen science initiative designed to engage non professionals in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide excellent opportunities for educators and their students to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch, this on-line program has engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent, and in contemplating the meaning of such data in their local environments. Thus far, thousands of participants from all 50 states have submitted data. This presentation will provide an overview of Project BudBurst educational resources and share lessons learned from educators in implementing the program in formal and informal education settings. Lesson plans and tips from educators will be highlighted. Project BudBurst is co-managed by the National Ecological Observatory Network and the Chicago Botanic Garden.

  2. Respiratory Response of Dormant Nectarine Vegetative Buds to High Temperature Stress

    Institute of Scientific and Technical Information of China (English)

    TAN Yue; LI Ling; LENG Chuan-yuan; LI Dong-mei; CHEN Xiu-de; GAO Dong-sheng

    2013-01-01

    High temperature stress (HT) is efficient in breaking endo-dormancy of perennial trees. The effects of HT (50°C) on the respiration of dormant nectarine (Prunus persica var. nectariana cv. Shuguang) vegetative buds were evaluated in the research. We found that bud respiration was transiently inhibited by HT and the pentose phosphate pathway (PPP) and the cytochrome C pathway (CYT) were significantly affected. On the substrate level, PPP was activated in the HT-treated buds compared with the control group. However, the activation did mot occur until hours after HT treatment. The tricarboxylic acid cycle (TCA) in both the HT-treated buds and in the control group proceeded at a low level most of the time compared with total respiration. On the electron transfer level, CYT was transiently inhibited by HT but became significantly active in the later stage. CYT operation in the control group exhibited an attenuation process. The alternative pathway (ALT) fluctuated both in the HT-treated samples and in the control. The results suggest that the temporary CYT inhibition and the following PPP activation may be involved in HT-induced bud dormancy release and budburst mechanisms.

  3. A2BR adenosine receptor modulates sweet taste in circumvallate taste buds.

    Directory of Open Access Journals (Sweden)

    Shinji Kataoka

    Full Text Available In response to taste stimulation, taste buds release ATP, which activates ionotropic ATP receptors (P2X2/P2X3 on taste nerves as well as metabotropic (P2Y purinergic receptors on taste bud cells. The action of the extracellular ATP is terminated by ectonucleotidases, ultimately generating adenosine, which itself can activate one or more G-protein coupled adenosine receptors: A1, A2A, A2B, and A3. Here we investigated the expression of adenosine receptors in mouse taste buds at both the nucleotide and protein expression levels. Of the adenosine receptors, only A2B receptor (A2BR is expressed specifically in taste epithelia. Further, A2BR is expressed abundantly only in a subset of taste bud cells of posterior (circumvallate, foliate, but not anterior (fungiform, palate taste fields in mice. Analysis of double-labeled tissue indicates that A2BR occurs on Type II taste bud cells that also express Gα14, which is present only in sweet-sensitive taste cells of the foliate and circumvallate papillae. Glossopharyngeal nerve recordings from A2BR knockout mice show significantly reduced responses to both sucrose and synthetic sweeteners, but normal responses to tastants representing other qualities. Thus, our study identified a novel regulator of sweet taste, the A2BR, which functions to potentiate sweet responses in posterior lingual taste fields.

  4. Clove bud oil reduces kynurenine and inhibits pqs A gene expression in P. aeruginosa.

    Science.gov (United States)

    H, Jayalekshmi; Omanakuttan, Athira; Pandurangan, N; S Vargis, Vidhu; Maneesh, M; G Nair, Bipin; B Kumar, Geetha

    2016-04-01

    Quorum sensing (QS), a communication system involved in virulence of pathogenic bacteria like Pseudomonas aeruginosa is a promising target to combat multiple drug resistance. In vitro studies using clove bud oil (CBO) in P. aeruginosa revealed a concentration dependent attenuation of a variety of virulence factors including motility, extracellular DNA, exopolysaccharides and pigment production. Furthermore, treatment with CBO demonstrated a distinct dose-dependent reduction in biofilm formation as well as promoting dispersion of already formed biofilm, observations that were also supported by porcine skin ex vivo studies. Expression studies of genes involved in signalling systems of P. aeruginosa indicated a specific decrease in transcription of pqsA, but not in the lasI or rhlI levels. Additionally, the expression of vfr and gacA genes, involved in regulation, was also not affected by CBO treatment. CBO also influenced the PQS signalling pathway by decreasing the levels of kynurenine, an effect which was reversed by the addition of exogenous kynurenine. Though the synthesis of the signalling molecules of the Las and Rhl pathways was not affected by CBO, their activity was significantly affected, as observed by decrease in levels of their various effectors. Molecular modelling studies demonstrated that eugenol, the major component of CBO, favourably binds to the QS receptor by hydrophobic interactions as well as by hydrogen bonding with Arg61 and Tyr41 which are key amino acid residues of the LasR receptor. These results thus elucidate the molecular mechanism underlying the action of CBO and provide the basis for the identification of an attractive QS inhibitor. PMID:26821927

  5. Renin-angiotensin system in ureteric bud branching morphogenesis: implications for kidney disease.

    Science.gov (United States)

    Yosypiv, Ihor V

    2014-04-01

    Failure of normal branching morphogenesis of the ureteric bud (UB), a key ontogenic process that controls organogenesis of the metanephric kidney, leads to congenital anomalies of the kidney and urinary tract (CAKUT), the leading cause of end-stage kidney disease in children. Recent studies have revealed a central role of the renin-angiotensin system (RAS), the cardinal regulator of blood pressure and fluid/electrolyte homeostasis, in the control of normal kidney development. Mice or humans with mutations in the RAS genes exhibit a spectrum of CAKUT which includes renal medullary hypoplasia, hydronephrosis, renal hypodysplasia, duplicated renal collecting system and renal tubular dysgenesis. Emerging evidence indicates that severe hypoplasia of the inner medulla and papilla observed in angiotensinogen (Agt)- or angiotensin (Ang) II AT 1 receptor (AT 1 R)-deficient mice is due to aberrant UB branching morphogenesis resulting from disrupted RAS signaling. Lack of the prorenin receptor (PRR) in the UB in mice causes reduced UB branching, resulting in decreased nephron endowment, marked kidney hypoplasia, urinary concentrating and acidification defects. This review provides a mechanistic rational supporting the hypothesis that aberrant signaling of the intrarenal RAS during distinct stages of metanephric kidney development contributes to the pathogenesis of the broad phenotypic spectrum of CAKUT. As aberrant RAS signaling impairs normal renal development, these findings advocate caution for the use of RAS inhibitors in early infancy and further underscore a need to avoid their use during pregnancy and to identify the types of molecular processes that can be targeted for clinical intervention. PMID:24061643

  6. Greenhouse irrigation water depths in relation to rose stem and bud qualities

    Directory of Open Access Journals (Sweden)

    Folegatti Marcos Vinícius

    2001-01-01

    Full Text Available The cultivation of roses occupies a special place in the flower production of Brazil, the concern with the quality of the buds being intimately related with the appropriate supply of water and nutrients to the plant. With the objective of evaluating stem and bud quality the rose variety 'Osiana' was cultivated in a greenhouse using different irrigation water depths based on fractions of pan evaporation (0.25, 0.50, 0.75, 1.00 and 1.25. The experimental design consisted of total randomized blocks with five replications and five treatments. There is a linear tendency of increasing the length and diameter of the stems and the length and diameter of the buds with increasing irrigation water depths.

  7. Progress and renewal in gustation: new insights into taste bud development.

    Science.gov (United States)

    Barlow, Linda A

    2015-11-01

    The sense of taste, or gustation, is mediated by taste buds, which are housed in specialized taste papillae found in a stereotyped pattern on the surface of the tongue. Each bud, regardless of its location, is a collection of ∼100 cells that belong to at least five different functional classes, which transduce sweet, bitter, salt, sour and umami (the taste of glutamate) signals. Taste receptor cells harbor functional similarities to neurons but, like epithelial cells, are rapidly and continuously renewed throughout adult life. Here, I review recent advances in our understanding of how the pattern of taste buds is established in embryos and discuss the cellular and molecular mechanisms governing taste cell turnover. I also highlight how these findings aid our understanding of how and why many cancer therapies result in taste dysfunction. PMID:26534983

  8. Safety and anti-ulcerogenic activity of a novel polyphenol-rich extract of clove buds (Syzygium aromaticum L).

    Science.gov (United States)

    Issac, Abin; Gopakumar, G; Kuttan, Ramadasan; Maliakel, Balu; Krishnakumar, I M

    2015-03-01

    Despite the various reports on the pharmacology of Clove bud [Syzygium aromaticum]-derived essential oil and its major component eugenol, systematic information on the bioactivity of clove polyphenols is very limited. Clove buds being one of the richest sources of dietary polyphenols with many traditional medicinal uses, the present contribution attempted to derive their standardized polyphenol-rich extracts as a water soluble free flowing powder (Clovinol) suitable for functional food applications, without the issues of its characteristic pungency and aroma. The extract was characterized by electrospray ionization-time of flight mass spectrometry (ESI-TOF-MS), and investigated for in vivo antioxidant, anti-inflammatory and anti-ulcerogenic activities. Clovinol showed significant antioxidant and anti-inflammatory effects as measured by cellular antioxidant levels, and the ability to inhibit carrageenan-induced paw swelling in mice. Further investigations revealed its significant anti-ulcerogenic activity (>97% inhibition of ethanol-induced stomach ulcers in Wistar rats when orally administered at 100 mg per kg b.w.) and up regulation of in vivo antioxidants such as superoxide dismutase (SOD), glutathione (GSH), and catalase (CAT). Clovinol also reduced the extent of lipid peroxidation among ulcer induced rats, indicating its usefulness in ameliorating oxidative stress and improving gastrointestinal health, especially upon chronic alcohol consumption. The extract was also shown to be safe and suitable for further investigations and development upon acute toxicity studies at 5 g per kg body weight and 28 days of repeated dose toxicity studies at 2.5 g per kg b.w. PMID:25605463

  9. Bud flush phenology and nursery carryover effect of paper birch provenances

    Directory of Open Access Journals (Sweden)

    Dhar A

    2015-12-01

    Full Text Available Paper birch (Betula papyrifera Marsh is an ecologically valuable species with a broad geographic distribution across the North America. Its diversity, versatility and enduring nature make it an ideal candidate for a selective breeding program in this region. However, an understanding of the genecology of this species is fundamental to deploy it successfully. Ten paper birch provenances were collected from British Columbia (BC, Canada and northern Idaho (USA along elevational transects to determine whether observed bud flush phenology was due to genetics and /or environmental variation or their interaction. Seedlings were grown at three different nurseries: University of Idaho (46°44’N, Landing (50°17’N and Little Forestry (54°00’N and planted in a randomized single tree interlocking block design in three common gardens at Sandpoint, ID (48°13’N, Skimikin, BC (50°45’N and Red Rock, BC (53°45’N. Results indicate that variation in the timing of bud flush is a complex interaction among local genetic characteristics and environmental conditions of the growing site. Birch bud flush followed a general geographic trend where provenances at the southern common garden (Sandpoint required less time (Day of Year, DoY and fewer growing degree days (GDD compared to central (Skimikin and northern (Red Rock common gardens. Although there were significant differences in the timing of bud flush among provenances along an elevational gradient, none of the regions showed the expected linear elevational cline, trends were inconsistent. Further, birch bud flush was significantly influenced by nursery displacement effects in the initial year of establishment but disappeared within three years. These results provide an opportunity to characterize bud flush phenology of paper birch and would be useful for improving operational paper birch seed transfer programs in BC.

  10. Noddy, a mouse harboring a missense mutation in protocadherin-15, reveals the impact of disrupting a critical interaction site between tip-link cadherins in inner ear hair cells

    OpenAIRE

    Geng, Ruishuang; Sotomayor, Marcos; Kinder, Kimberly; Gopal, Suhasini R.; Gerka-Stuyt, John; Chen, Daniel H.-C.; Hardisty-Hughes, Rachel E.; Ball, Greg; Parker, Andy; Gaudet, Rachelle; Furness, David; Brown, Steve D.; Corey, David P.; Kumar N Alagramam

    2013-01-01

    In hair cells of the inner ear, sound or head movement increases tension in fine filaments termed tip links, which in turn convey force to mechanosensitive ion channels to open them. Tip links are formed by a tetramer of two cadherin proteins: protocadherin 15 (PCDH15) and cadherin 23 (CDH23), which have 11 and 27 extracellular cadherin (EC) repeats, respectively. Mutations in either protein cause inner ear disorders in mice and humans. We showed recently that these two cadherins bind tip-to-...

  11. Operative Links

    DEFF Research Database (Denmark)

    Wistoft, Karen; Højlund, Holger

    2012-01-01

    The article combines a public management perspective with a pedagogical perspective on health promotion. Our aim is to look into recent reforms in Denmark on health promotion in order to see how managerial ideas have been combined with welfare professional ideals concerning broad, positive and...... framework has three positions: first, a policy perspective on public organisations as networks, second, a semantic perspective on discourses and concepts of health and, third, a health pedagogical perspective on participation, intervention, and roles. Conclusion: it is necessary to establish ‘operative...... links' that indicate cooperative levels which facilitate a creative and innovative effort in disease prevention and health promotion targeted at children and adolescents - across traditional professional boundaries. It is proposed that such links are supported by network structures, shared semantics and...

  12. Operative Links

    DEFF Research Database (Denmark)

    Wistoft, Karen; Højlund, Holger

    2012-01-01

    educational approaches. Methods: Mixed qualitative design: survey based on telephone interviews with health managers (n=72), personal and focus group interviews with health professionals (n=84) and pupils (n=108) from 18 school classes, and comparative case studies in five selected municipalities of various...... educational goals, learning content, or value clarification. Health pedagogy is often a matter of retrospective rationalization rather than the starting point of planning. Health and risk behaviour approaches override health educational approaches. Conclusions: Operational links between health education...

  13. Budding yeast cDNA sequencing project: S03052-35_D14 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03052-35_D14 S03052-35_D14 - - Show S03052-35_D14 Seqid S03052-35_D14 Link to SGD S03052-35_D14 ... AACTGCGGCNCAAATGAGGATCTATTCTCTCTCTATCAGTAT GAATTTACCAT CTGTCCTATTTGCTGCCAGTTAAAAAAGGACTACTTTGGCCCAATTTTC C ... AACGGTGGATCTGCTTCTTCCACCGATGTAGCTTCCTCCTCNTCCAT CTCCACTTCCTC TGGCTCAGTATTTATCACNNCTTCTGAACCTTCAT AAT ...

  14. Pickling process of capers (Capparis spp.) flower buds

    OpenAIRE

    Özcan, Musa; Akgül, Attila

    1999-01-01

    Middle sized (8 < x < 13 mm) buds of Capparis spinosa var. spinosa and C. ovata var. canescens from June in brines containing 5,10,15 and 20% salt and from August in brines of 15% salt, and three different size (x < 8 mm, 8 < x < 13 mm, x > 13 mm) buds of C. . ovata var. canescens from June in brines of 15% salt were pickled for two months fermentation. Some chem...

  15. Budding yeast PAK kinases regulate mitotic exit by two different mechanisms

    OpenAIRE

    Chiroli, Elena; Fraschini, Roberta; Beretta, Alessia; Tonelli, Mariagrazia; Lucchini, Giovanna; Piatti, Simonetta

    2003-01-01

    We report the characterization of the dominant-negative CLA4t allele of the budding yeast CLA4 gene, encoding a member of the p21-activated kinase (PAK) family of protein kinases, which, together with its homologue STE20, plays an essential role in promoting budding and cytokinesis. Overproduction of the Cla4t protein likely inhibits both endogenous Cla4 and Ste20 and causes a delay in the onset of anaphase that correlates with inactivation of Cdc20/anaphase-promoting complex (APC)–dependent ...

  16. Chemical composition and content of essential oil from the bud of cultivated Turkish clove

    Directory of Open Access Journals (Sweden)

    Kollmannsberger, H.

    2007-05-01

    Full Text Available In this study, clove bud oil, which was cultivated in the Mediterranean region of Turkey, was provided from a private essential oil company in Turkey. Essential oil from clove (Syzygium aromaticum L. was obtained from steam-distillation method, and its chemical composition was analyzed by GC and GC-MS. The results showed that the essential oils mainly contained about 87.00% eugenol, 8.01% eugenyl acetate and 3.56% β-Caryophyllene. The chemical composition of the Turkish clove bud oil was comparable to those of trees naturally grown in their native regions.

  17. Chemical Genetics: Budding Yeast as a Platform for Drug Discovery and Mapping of Genetic Pathways

    Directory of Open Access Journals (Sweden)

    Jorrit M. Enserink

    2012-08-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a widely used model organism, and yeast genetic methods are powerful tools for discovery of novel functions of genes. Recent advancements in chemical-genetics and chemical-genomics have opened new avenues for development of clinically relevant drug treatments. Systematic mapping of genetic networks by high-throughput chemical-genetic screens have given extensive insight in connections between genetic pathways. Here, I review some of the recent developments in chemical-genetic techniques in budding yeast.

  18. Chemical composition and content of essential oil from the bud of cultivated Turkish clove

    OpenAIRE

    Kollmannsberger, H.; Nitz, S.; Ertaş, M.; Alma, M. H.

    2007-01-01

    In this study, clove bud oil, which was cultivated in the Mediterranean region of Turkey, was provided from a private essential oil company in Turkey. Essential oil from clove (Syzygium aromaticum L.) was obtained from steam-distillation method, and its chemical composition was analyzed by GC and GC-MS. The results showed that the essential oils mainly contained about 87.00% eugenol, 8.01% eugenyl acetate and 3.56% β-Caryophyllene. The chemical composition of the Turkish clove bud oil was com...

  19. Project BudBurst - Meeting the Needs of Climate Change Educators and Scientists

    Science.gov (United States)

    Henderson, S.

    2015-12-01

    It is challenging for many to get a sense of what climate change means as long periods of time are involved - like decades - which can be difficult to grasp. However, there are a number of citizen science based projects, including NEON's Project BudBurst, that provide the opportunity for both learning about climate change and advancing scientific knowledge. In this presentation, we will share lessons learned from Project BudBurst. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events and to increase climate literacy. Project BudBurst is important from an educational perspective, but also because it enables scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. It was important to better understand if and how Project BudBurst is meeting its goals. Specifically, does participation by non-experts advance scientific knowledge? Does participation advance educational goals and outcomes? Is participation an effective approach to advance/enhance science education in both formal and informal settings? Critical examination of Project BudBurst supports advancement of scientific knowledge and realization of educational objectives. Citizen science collected observations and measurements are being used by scientists as evidenced by the increase of such data in scientific publication. In addition, we found that there is a significant increase in educators utilizing citizen science as part of their instruction. Part of this increase is due to the resources and professional development materials available to educators. Working with partners also demonstrated that the needs of both science and

  20. Megasporocyte formation in Pisum sativum L. against the back ground of bud development

    Directory of Open Access Journals (Sweden)

    Wanda Wojciechowska

    2014-02-01

    Full Text Available Megasporocyte formation in Pisum sativum L. takes place at the stages of bud development, when the vexillum surpasses the lower androecium whorl slightly at the beginning, and markedly in further stages. Under the epidermis of an ovule, a multicellular archesporium is formed. Mitotic division of these cells gives rise to a two-layered parietal tissue and to a group of megaspore mother cells (MMCs. The tetrad is formed from one megasporocyte. In the bud development of Pisum sativum the carpel walls accrete to each other relatively early.

  1. A septin from the filamentous fungus A. nidulans induces atypical pseudohyphae in the budding yeast S. cerevisiae

    Science.gov (United States)

    Septins were first discovered in Saccharomyces cerevisiae where they form a scaffold that organizes the bud site and are a component of the morphogenesis checkpoint that coordinates budding with mitosis. Five of the seven S. cerevisiae septins (Cdc3, Cdc10, Cdc11, Cdc12 and Shs1) colocalize as a rin...

  2. Culture Media Optimization through Response Surface Methodology for in vitro Shoot Bud Development of Solanum melongena L. for Micropropagation

    Directory of Open Access Journals (Sweden)

    Sila Bhattacharya

    2011-11-01

    Full Text Available Response surface methodology was used for the optimization of shoot bud response and shoot bud induction in leaf explants of Solanum melongena cultivar Arka Shirish. Three independent variables were evaluated for shoot bud response and shoot bud induction. The variables include the concentrations of nitrogen (N2, sucrose and growth regulator thidiazuron (TDZ. The shoot bud response for cultured explant was optimized at 4.34 g/l of total nitrogen, 2.65% of sucrose and 0.67 mg/l of TDZ with 95% response. The optimum medium conditions for shoot bud induction was found to be Murashige and Skoog (MS basal medium supplemented with 4.02 g/l of total nitrogen, 2.36% of sucrose and 1.0 mg/l of TDZ with 10 number of bud per explant. The shoot buds so formed were elongated in 0.5 mg/l 2,3,5-Triiodobenzoic acid (TIBA and 0.1 mg/l Gibberellic acid (GA3. The elongated shoots were rooted in MS with 1 mg/l Indole-3-butyric acid (IBA. The rooted plants were transferred to pots with farmyard manure upon hardening. This study has validation value for optimization of micropropagation protocol and is further useful in genetic transformation studies for Solanum melongena variety Arka Shirish to maximize regenerative response for automation.

  3. Budding yeast cDNA sequencing project: S03052-35_P07 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03052-35_P07 S03052-35_P07 - - Show S03052-35_P07 Seqid S03052-35_P07 Link to SGD S03052-35_P07 ... Browser - Sequence >S03052-35_P07.phd CGGNNNNNNNTTTTNT CAGAATCTNNNNNNTNNATACGACTCACTNT AGGGCGAATTGGC GGCCAA ... TCATANCTGTTT CCTGTGTGAAATTGTTATCCGCTNAAAATTCCACACAATNT ACGATCNNNAANCATAAAG TGTAAAGCCTGGGGGTGCCTAATGGAGTGAG ... TCCCTCCCGCANNCCTGAGGAGGGAGAGGGGATTTATGGATCTTCTAAGA TNT ... Quality >S03052-35_P07.phd 9 8 8 5 4 4 5 4 4 5 8 1 ...

  4. Molecular profiling of tumour budding implicates TGFβ-mediated epithelial–mesenchymal transition as a therapeutic target in oral squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jensen, David Hebbelstrup; Dabelsteen, Erik; Specht, Lena;

    2015-01-01

    Although tumour budding is an adverse prognostic factor for many cancer types, the molecular mechanisms governing this phenomenon are incompletely understood. Therefore, understanding the molecular basis of tumour budding may provide new therapeutic and diagnostic options. We employ digital image...

  5. Transcriptome Profiling of Tiller Buds Provides New Insights into PhyB Regulation of Tillering and Indeterminate Growth in Sorghum.

    Science.gov (United States)

    Kebrom, Tesfamichael H; Mullet, John E

    2016-04-01

    Phytochrome B (phyB) enables plants to modify shoot branching or tillering in response to varying light intensities and ratios of red and far-red light caused by shading and neighbor proximity. Tillering is inhibited in sorghum genotypes that lack phytochrome B (58M, phyB-1) until after floral initiation. The growth of tiller buds in the first leaf axil of wild-type (100M, PHYB) and phyB-1 sorghum genotypes is similar until 6 d after planting when buds of phyB-1 arrest growth, while wild-type buds continue growing and develop into tillers. Transcriptome analysis at this early stage of bud development identified numerous genes that were up to 50-fold differentially expressed in wild-type/phyB-1 buds. Up-regulation of terminal flower1, GA2oxidase, and TPPI could protect axillary meristems in phyB-1 from precocious floral induction and decrease bud sensitivity to sugar signals. After bud growth arrest in phyB-1, expression of dormancy-associated genes such as DRM1, GT1, AF1, and CKX1 increased and ENOD93, ACCoxidase, ARR3/6/9, CGA1, and SHY2 decreased. Continued bud outgrowth in wild-type was correlated with increased expression of genes encoding a SWEET transporter and cell wall invertases. The SWEET transporter may facilitate Suc unloading from the phloem to the apoplast where cell wall invertases generate monosaccharides for uptake and utilization to sustain bud outgrowth. Elevated expression of these genes was correlated with higher levels of cytokinin/sugar signaling in growing buds of wild-type plants. PMID:26893475

  6. Genetically based location from triploid populations and gene ontology of a 3.3-mb genome region linked to alternaria brown spot resistance in citrus reveal clusters of resistance genes

    OpenAIRE

    José Cuenca; Pablo Aleza; Antonio Vicent; Dominique Brunel; Patrick Ollitrault; Luis Navarro

    2013-01-01

    Genetic analysis of phenotypical traits and marker-trait association in polyploid species is generally considered as a challenge. In the present work, different approaches were combined taking advantage of the particular genetic structures of 2n gametes resulting from second division restitution (SDR) to map a genome region linked to Alternaria brown spot (ABS) resistance in triploid citrus progeny. ABS in citrus is a serious disease caused by the tangerine pathotype of the fungus Alternaria ...

  7. A novel minimal in vitro system for analyzing HIV-1 Gag mediated budding

    CERN Document Server

    Gui, Dong; Xu, Jun; Zandi, Roya; Gill, Sarjeet; Huang, I-Chueh; Rao, A L N; Mohideen, Umar

    2013-01-01

    A biomimetic minimalist model membrane is used to study the mechanism and kinetics of the in vitro HIV-1 Gag budding from a giant unilamellar vesicle (GUV). The real time interaction of the Gag, RNA and lipid leading to the formation of minivesicles is measured in real time using confocal microscopy. The Gag is found to lead to resolution limited punctae on the lipid membranes of the GUV. The introduction of the Gag to a GUV solution containing RNA led to the budding of minivesicles on the inside surface of the GUV. The diameter of the GUV decreased due to the bud formation. The corresponding rate of decrease of the GUV diameter was found to be linear in time. The bud formation and the decrease in GUV size were found to be proportional to the Gag concentration. The method is promising and will allow the systematic study of the dynamics of assembly of immature HIV and help classify the hierarchy of factors that impact the Gag protein initiated assembly of retroviruses such as HIV. The GUV system might also be ...

  8. Buds of Parenting in Emerging Adult Males: What We Learned from Our Parents

    Science.gov (United States)

    Scharf, Miri; Mayseless, Ofra

    2011-01-01

    The authors examine the precursors of parenting buds (representations regarding parenting before actual parenting) by following 60 men from adolescence to emerging adulthood. Quality of relationships with parents, and attachment representations (state of mind with respect to attachment and attachment styles) assessed in adolescence, contribute to…

  9. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    NARCIS (Netherlands)

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H E W; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field st

  10. Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

    NARCIS (Netherlands)

    Huberts, Daphne H. E. W.; Janssens, Georges E.; Lee, Sung Sik; Vizcarra, Ima Avalos; Heinemann, Matthias

    2013-01-01

    We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath the

  11. Effect of floral bud reduction on flower longevity in Asiatic hybrids lilies.

    NARCIS (Netherlands)

    Meulen-Muisers, van der J.J.M.; Oeveren, van J.C.; Sandbrink, J.M.; Tuyl, van J.M.

    1995-01-01

    Floral bud abortion was found to be an undesirable source of non-genetic variation in breeding trials directed on the improvement of individual flower longevity in Asiatic hybrid lilies. It increased the longevity of the remaining flowers of the inflorescence. A similar response was found after elim

  12. Gall mite inspection on dormant black currant buds using machine vision

    DEFF Research Database (Denmark)

    Nielsen, M. R.; Stigaard Laursen, Morten; Jonassen, M. S.;

    2013-01-01

    This paper presents a novel machine vision-based approach detecting and mapping gall mite infection in dormant buds on black currant bushes. A vehicle was fitted with four cameras and RTK-GPS. Results compared automatic detection to human decisions based on the images, and by mapping the results ...

  13. DNA methylation/demethylation programming during peach flower bud dormancy release, development and blooming

    Science.gov (United States)

    Peach flower bud development undergoes a long, complex and temperature-dependent regulation process with cessation of growth in response to cool temperatures in late fall, a slow but gradual development during the chilling period in winter, and eventually blooming in early spring. It has been demon...

  14. Viral and cellular requirements for the budding of Feline Endogenous Retrovirus RD-114

    Directory of Open Access Journals (Sweden)

    Fukuma Aiko

    2011-12-01

    Full Text Available Abstract Background RD-114 virus is a feline endogenous retrovirus and produced as infectious viruses in some feline cell lines. Recently, we reported the contamination of an infectious RD-114 virus in a proportion of live attenuated vaccines for dogs and cats. It is very difficult to completely knock out the RD-114 proviruses from cells, as endogenous retroviruses are usually integrated multiply into the host genome. However, it may be possible to reduce the risk of contamination of RD-114 virus by regulating the viral release from cells. Results In this study, to understand the molecular mechanism of RD-114 virus budding, we attempted to identify the viral and cellular requirements for RD-114 virus budding. Analyses of RD-114 L-domain mutants showed that the PPPY sequence in the pp15 region of Gag plays a critical role in RD-114 virus release as viral L-domain. Furthermore, we investigated the cellular factors required for RD-114 virus budding. We demonstrated that RD-114 virus release was inhibited by overexpression of dominant negative mutants of Vps4A, Vps4B, and WWP2. Conclusions These results strongly suggest that RD-114 budding utilizes the cellular multivesicular body sorting pathway similar to many other retroviruses.

  15. Potential Bud Bank Responses to Apical Meristem Damage and Environmental Variables: Matching or Complementing Axillary Meristems?

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Malíková, Lenka; Rosenthal, J.; Šmilauer, P.

    2014-01-01

    Roč. 9, č. 2 (2014), e88093. E-ISSN 1932-6203 R&D Projects: GA ČR GPP504/12/P540; GA ČR GA526/09/0963 Institutional support: RVO:67985939 Keywords : bud bank * axillary meristem * disturbance Subject RIV: EH - Ecology, Behaviour Impact factor: 3.234, year: 2014

  16. Mutation breeding in sweet potato with fast neutrons by inducing hypocotyl adventitious buds

    International Nuclear Information System (INIS)

    Hybrid sweet potato seeds were irradiated by fast neutrons. After the irradiation, adventitious buds were induced from the epidermal cells of the hypocotyls of the seedlings. The adventitious buds appeared from the hypocotyls 2 - 3 cm below the cotyledonary node. Detailed observations of cell division and tissue dissection showed that some adventitious buds emerged in 20 - 45 days after seedling emergence. Most of them originated from a single cell. These adventitious bud clones showed a wide mutation spectrum at high frequency, mostly non-chimeric. The mutant characters included the color of leaf, vine, vein, root-tuber skin and the leaf shape, yield, root-tuber dry matter rates, root-tuber numbers, sprouting, early tuber formation, resistance to black rot, root rot, nematodes etc. The results were confirmed in the field; the observed mutant characters were stable and non-chimeric. Such a method of inducing mutations is advantageous for the improvement of economic characters. Actually, there were examples of increasing the dry matter content of the tubers by 1.0 - 5.5%, the yield of tubers increased by 3.6 - 53.8%, and tubers per plant increased by 0.6 - 4.2%. The resistances to black rot, root rot, nematodes etc. were also improved. Three multiple resistance varieties Yanshu 568, Yanshu 571-1, 84-C-2 and two good quality varieties Yanshu 759 and 781 have been selected. (author). 9 refs, 3 tabs

  17. Destinace České Budějovice na trhu cestovního ruchu

    OpenAIRE

    DUŠEK, Pavel

    2013-01-01

    Main target of this bachelor thesis was to evaluate the primary and secondary destination offers of České Budějovice based on situational analysis, identification of competitive destinations and position in the market with tourism. At the same time establishing a competitive advantage of this destination and offering a way of enforcing.

  18. CLO-PLA: the database of clonal and bud bank traits of Central European flora

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; de Bello, F.

    2009-01-01

    Roč. 20, č. 3 (2009), s. 511-516. ISSN 1100-9233 R&D Projects: GA ČR(CZ) GA526/06/0723 Institutional research pla n: CEZ:AV0Z60050516 Keywords : bud bank * clonal traits * database Subject RIV: EF - Botanics Impact factor: 2.376, year: 2009

  19. Dehydration improves cryopreservation of mat rush (Juncus decipiens Nakai) basal stem buds on cryo-plates.

    Science.gov (United States)

    Niino, T; Yamamoto, S I; Fukui, K; Castillo Martinez, C R; Arizaga, M V; Matsumoto, T; Engelmann, F

    2013-01-01

    Two cryopreservation procedures using aluminium cryo-plates, termed V-Cryo-plate and D-Cryo-plate, were successfully developed for in vitro mat rush (Juncus decipiens Nakai) basal stem buds. Multiple stems induced in liquid MS medium containing 8.9 μM BA by roller culture were cut into small clumps, plated on solid MS medium and cultured for 1 week at 25 degree C. Clumps that had produced many buds were cold-hardened at 5 degree C for 1-2 months. The buds with basal stems were dissected from small clumps and precultured overnight at 25 degree C on solid MS medium containing 0.3 M sucrose. Precultured buds were placed on aluminium cryo-plates and embedded in calcium alginate gel. Osmoprotection was performed by immersing the cryo-plates for 30 min at 25 degree C in loading solution (2 M glycerol + 1.0 M sucrose). In the D-Cryo-plate procedure, the buds were dehydrated to 27-25% moisture content (fresh weight) by placing the cryo-plates in the air current of a laminar flow cabinet for 2 to 3 h. In the V-Cryo-plate procedure, buds were dehydrated by immersing the cryo-plates in PVS2 vitrification solution for 40 min at 25 degree C. In both procedures, cooling was performed by placing the cryo-plates in uncapped cryotubes, which were immersed in liquid nitrogen. For rewarming, cryo-plates were immersed in medium with 1.0 M sucrose for 20 min at room temperature. Regrowth of cryopreserved buds of line 'Kitakei 2' using D-Cryo-plate and V-Cryo-plate procedures, was 90% and 80%, respectively. The two procedures were applied to 20 additional mat rush lines. Using the V-Cryo-plate procedure resulted in regrowth ranging between 13.3 and 86.7%, with an average of 52.5%. The D-Cryo-plate led to regrowth ranging between 73.3 and 96.7%, with an average of 86.3%. The D-Cryo-plate procedure will facilitate cryostorage of mat rush germplasm. PMID:24441366

  20. Mapping of Candidate Genes Involved in Bud Dormancy and Flowering Time in Sweet Cherry (Prunus avium.

    Directory of Open Access Journals (Sweden)

    Sophie Castède

    Full Text Available The timing of flowering in perennial plants is crucial for their survival in temperate climates and is regulated by the duration of bud dormancy. Bud dormancy release and bud break depend on the perception of cumulative chilling during endodormancy and heat during the bud development. The objectives of this work were to identify candidate genes involved in dormancy and flowering processes in sweet cherry, their mapping in two mapping progenies 'Regina' × 'Garnet' and 'Regina' × 'Lapins', and to select those candidate genes which co-localized with quantitative trait loci (QTLs associated with temperature requirements for bud dormancy release and flowering. Based on available data on flowering processes in various species, a list of 79 candidate genes was established. The peach and sweet cherry orthologs were identified and primers were designed to amplify sweet cherry candidate gene fragments. Based on the amplified sequences of the three parents of the mapping progenies, SNPs segregations in the progenies were identified. Thirty five candidate genes were genetically mapped in at least one of the two progenies and all were in silico mapped. Co-localization between candidate genes and QTLs associated with temperature requirements and flowering date were identified for the first time in sweet cherry. The allelic composition of the candidate genes located in the major QTL for heat requirements and flowering date located on linkage group 4 have a significant effect on these two traits indicating their potential use for breeding programs in sweet cherry to select new varieties adapted to putative future climatic conditions.

  1. Mapping of Candidate Genes Involved in Bud Dormancy and Flowering Time in Sweet Cherry (Prunus avium).

    Science.gov (United States)

    Castède, Sophie; Campoy, José Antonio; Le Dantec, Loïck; Quero-García, José; Barreneche, Teresa; Wenden, Bénédicte; Dirlewanger, Elisabeth

    2015-01-01

    The timing of flowering in perennial plants is crucial for their survival in temperate climates and is regulated by the duration of bud dormancy. Bud dormancy release and bud break depend on the perception of cumulative chilling during endodormancy and heat during the bud development. The objectives of this work were to identify candidate genes involved in dormancy and flowering processes in sweet cherry, their mapping in two mapping progenies 'Regina' × 'Garnet' and 'Regina' × 'Lapins', and to select those candidate genes which co-localized with quantitative trait loci (QTLs) associated with temperature requirements for bud dormancy release and flowering. Based on available data on flowering processes in various species, a list of 79 candidate genes was established. The peach and sweet cherry orthologs were identified and primers were designed to amplify sweet cherry candidate gene fragments. Based on the amplified sequences of the three parents of the mapping progenies, SNPs segregations in the progenies were identified. Thirty five candidate genes were genetically mapped in at least one of the two progenies and all were in silico mapped. Co-localization between candidate genes and QTLs associated with temperature requirements and flowering date were identified for the first time in sweet cherry. The allelic composition of the candidate genes located in the major QTL for heat requirements and flowering date located on linkage group 4 have a significant effect on these two traits indicating their potential use for breeding programs in sweet cherry to select new varieties adapted to putative future climatic conditions. PMID:26587668

  2. Socio-cultural practices of deciduous canine tooth bud removal among Maasai children.

    Science.gov (United States)

    Mutai, J; Muniu, E; Sawe, J; Hassanali, J; Kibet, P; Wanzala, P

    2010-04-01

    The removal of teeth amongst the Maasai is a traditional practice as part of an initiation or to make space for feeding in an event of diseases locking the jaw. Removal of deciduous canine tooth buds (DCB) among infants below 2 years has been reported in several studies to be common mainly amongst communities in East Africa, Ethiopia and Sudan. The main reason for the practice revolves around the belief that tooth buds or 'maggots' are false teeth, nylon or worms and are responsible for diarrhoea, vomiting, fever and growth retardation in children, amongst other illnesses. The main objective of this study was to assess the socio-cultural factors which contribute to this practice. The main methods of data collected included Focus Group Discussions (FGD) with mothers of children in that age group and Traditional Birth Attendants (TBA). In-depth interviews (IDI)were conducted with key informants versed with Maasai traditions whereas observations were done within the manyattas where participants live. Proceedings at both the FGD and the IDI were recorded on paper and were analysed thematically. The study showed that the removal of canine tooth buds amongst children that started initially with calves--that diseases that cause diarrhoea in calves were brought about by the canine tooth buds that were turning reddish in colour--is deeply rooted and practised in the community despite sensitisation interventions mounted jointly by the University of Nairobi, Kenya Medical Research Institute and the Kenya Medical Training College, among others. This study discovered that canine tooth buds are associated with bad spirits that cause diarrhoea and vomiting and the belief that removing them is a sure way of providing a cure for all children's ailments. PMID:20476714

  3. Monoclonal Antibody-Based Antigen Capture Enzyme-Linked Immunosorbent Assay Reveals High Sensitivity of the Nucleocapsid Protein in Acute-Phase Sera of Severe Acute Respiratory Syndrome Patients

    OpenAIRE

    Di, Biao; Hao, Wei; Gao, Yang; Wang, Ming; Wang, Ya-di; QIU, LI-WEN; Wen, Kun; Zhou, Duan-Hua; Wu, Xin-wei; Lu, En-Jie; Liao, Zhi-yong; Mei, Ya-bo; Zheng, Bo-Jian; Che, Xiao-Yan

    2005-01-01

    Accurate and timely diagnosis of severe acute respiratory syndrome coronavirus (SARS-CoV) infection is a critical step in preventing another global outbreak. In this study, 829 serum specimens were collected from 643 patients initially reported to be infected with SARS-CoV. The sera were tested for the N protein of SARS-CoV by using an antigen capture enzyme-linked immunosorbent assay (ELISA) based on monoclonal antibodies against the N protein of SARS-CoV and compared to 197 control serum sa...

  4. Genetically based location from triploid populations and gene ontology of a 3.3-mb genome region linked to Alternaria brown spot resistance in citrus reveal clusters of resistance genes.

    Directory of Open Access Journals (Sweden)

    José Cuenca

    Full Text Available Genetic analysis of phenotypical traits and marker-trait association in polyploid species is generally considered as a challenge. In the present work, different approaches were combined taking advantage of the particular genetic structures of 2n gametes resulting from second division restitution (SDR to map a genome region linked to Alternaria brown spot (ABS resistance in triploid citrus progeny. ABS in citrus is a serious disease caused by the tangerine pathotype of the fungus Alternaria alternata. This pathogen produces ACT-toxin, which induces necrotic lesions on fruit and young leaves, defoliation and fruit drop in susceptible genotypes. It is a strong concern for triploid breeding programs aiming to produce seedless mandarin cultivars. The monolocus dominant inheritance of susceptibility, proposed on the basis of diploid population studies, was corroborated in triploid progeny. Bulk segregant analysis coupled with genome scan using a large set of genetically mapped SNP markers and targeted genetic mapping by half tetrad analysis, using SSR and SNP markers, allowed locating a 3.3 Mb genomic region linked to ABS resistance near the centromere of chromosome III. Clusters of resistance genes were identified by gene ontology analysis of this genomic region. Some of these genes are good candidates to control the dominant susceptibility to the ACT-toxin. SSR and SNP markers were developed for efficient early marker-assisted selection of ABS resistant hybrids.

  5. Epigenetic drug 5-azacytidine impairs proliferation of rat limb buds in an organotypic model-system in vitro

    Science.gov (United States)

    Mužić, Vedrana; Katušić Bojanac, Ana; Jurić-Lekić, Gordana; Himelreich, Marta; Tupek, Katarina; Šerman, Ljiljana; Marn, Nina; Sinčić, Nino; Vlahović, Maja; Bulić-Jakuš, Floriana

    2013-01-01

    Aim To establish an organotypic in vitro model of limb bud development to verify whether epigenetic drug and teratogen 5-azacytidine (5azaC) has an effect on limb buds independent of its effects on the placenta. Methods Fischer strain rat fore- and hindlimb buds were microsurgically isolated from 13 days old embryos and cultivated in vitro for two weeks at the air-liquid interface in Eagle's minimum essential medium (MEM) with 50% rat serum. 30 µmol of 5azaC was added to the fresh medium. Overall growth was measured by an ocular micrometer. Routine histology, immunohistochemical detection of the proliferating cell nuclear antigen (PCNA), and stereological quantification of PCNA expression were performed. Results At four time points, significantly lower overall growth was detected for fore- and hindlimb bud explants cultivated with 5azaC in comparison to controls. After the culture period, numerical density of the PCNA signal for both types of limb buds was lower than for controls (P < 0.001). Limb buds were initially covered by immature epithelium and contained mesenchyme, myotubes, single hemangioblasts, hemangioblast aggregates, blood islands, and capillaries. Regardless of the treatment, cartilage and epidermis differentiated, but cells and structures typical for vasculogenesis disappeared. Conclusion Our findings, obtained outside of the maternal organism, stress the importance of compromised cell proliferation for 5azaC impact on limb buds. This investigation points to the necessity to establish alternatives to in vivo research on animals using teratogenic agents. PMID:24170728

  6. Dancing links

    CERN Document Server

    Knuth, Donald E

    2009-01-01

    The author presents two tricks to accelerate depth-first search algorithms for a class of combinatorial puzzle problems, such as tiling a tray by a fixed set of polyominoes. The first trick is to implement each assumption of the search with reversible local operations on doubly linked lists. By this trick, every step of the search affects the data incrementally. The second trick is to add a ghost square that represents the identity of each polyomino. Thus puts the rule that each polyomino be used once on the same footing as the rule that each square be covered once. The coding simplifies to a more abstract form which is equivalent to 0-1 integer programming. More significantly for the total computation time, the search can naturally switch between placing a fixed polyomino or covering a fixed square at different stages, according to a combined heuristic. Finally the author reports excellent performance for his algorithm for some familiar puzzles. These include tiling a hexagon by 19 hexiamonds and the N queen...

  7. Synthesis and electrochemical performance of bud-like FeS2 microspheres as anode materials for rechargeable lithium batteries

    International Nuclear Information System (INIS)

    Highlights: ► Bud-like FeS2 microshperes was synthesized through solvothermal reaction with polyvinylpyrrolidone (PVP). ► Bud-like microshperes in the range of 2.0–3.0 μm are built by nanoflakes with the size of 0.5–1 μm in width and length. ► The bud-like FeS2 is investigated by many tests such as CV, GITT and EIS. ► The bud-like powder shows the highest initial specific capacity, coulombic efficiency and lowest polarization. -- Abstract: Bud-like FeS2 powder was synthesized by a solvothermal method with the help of polyvinylpyrrolidone (PVP). The bud-like FeS2 microshperes with the diameters of 2.0–3.0 μm were consisted of the submicro-flakes with 0.5–1μm in width and length, and about 60 nm in thickness. As an anode material for Li-ion batteries, the bud-like FeS2 delivered initial specific discharge capacity of 773 and 749 mAh g−1, and could sustain 387 and 368 mAh g−1 after 30 cycles at current densities of 45 and 89 mA g−1, respectively, much higher than the solid one obtained without PVP. The bud-like FeS2 microshperes also showed large diffusion coefficient of Li-ions (DLi+) calculated by Galvanostatic intermittent titration (GITT). The improved electrochemical performance of bud-like FeS2 was due to the unique structure which provides large contact area between the FeS2 microspheres and electrolyte, decreased polarization and large DLi+, leading to enhanced electrode reaction kinetics

  8. Effects of 6-BA and MET on the induction of adventitious buds from rice seedlings and its application

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@Different levels of 6-BA (6-Benezyla-mino purine) and MET (Paclobutra-zol) were added into MS media to culture the mature seeds of six varieties and two F2 populations of Nanjing11 ( indica ) / Balilla (japoni-ca) and Dular( indica)/Balilla( japonica) . Results were as follows:1) 6-BA was effective in inducing the formation of adventitious buds (Table 1).Only using MET could not induce adventitious buds formation. Compared with the use of 6-BA only, it was more useful for inducing the adventitious buds by using MET and 6-BA together, especially for japonica rice.

  9. Epigenetic drug 5-azacytidine impairs proliferation of rat limb buds in an organotypic model-system in vitro

    OpenAIRE

    Mužić, Vedrana; Katušić Bojanac, Ana; Jurić-Lekić, Gordana; Himelreich, Marta; Tupek, Katarina; Šerman, Ljiljana; Marn, Nina; Sinčić, Nino; Vlahović, Maja; Bulić-Jakuš, Floriana

    2013-01-01

    Aim To establish an organotypic in vitro model of limb bud development to verify whether epigenetic drug and teratogen 5-azacytidine (5azaC) has an effect on limb buds independent of its effects on the placenta. Methods Fischer strain rat fore- and hindlimb buds were microsurgically isolated from 13 days old embryos and cultivated in vitro for two weeks at the air-liquid interface in Eagle’s minimum essential medium (MEM) with 50% rat serum. 30 μmol of 5azaC was added ...

  10. Annexin VI-mediated Loss of Spectrin during Coated Pit Budding Is Coupled to Delivery of LDL to Lysosomes

    OpenAIRE

    Kamal, Adeela; Ying, Yun-shu; Anderson, Richard G. W.

    1998-01-01

    Previously we reported that annexin VI is required for the budding of clathrin-coated pits from human fibroblast plasma membranes in vitro. Here we show that annexin VI bound to the NH2-terminal 28-kD portion of membrane spectrin is as effective as cytosolic annexin VI in supporting coated pit budding. Annexin VI–dependent budding is accompanied by the loss of ∼50% of the spectrin from the membrane and is blocked by the cysteine protease inhibitor N-acetyl-leucyl-leucyl-norleucinal (ALLN). In...

  11. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

    OpenAIRE

    Timothy Hoggard; Ivan Liachko; Cassaundra Burt; Troy Meikle; Katherine Jiang; Gheorghe Craciun; Dunham, Maitreya J.; Fox, Catherine A.

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chrom...

  12. Ubiquitousness of link-density and link-pattern communities in real-world networks

    CERN Document Server

    Šubelj, Lovro

    2011-01-01

    Community structure appears to be an intrinsic property of many complex real-world networks. However, recent work shows that real-world networks reveal even more sophisticated modules than classical cohesive (link-density) communities. In particular, networks can also be naturally partitioned according to similar patterns of connectedness between the nodes, revealing link-pattern communities. We here propose a balanced propagation based algorithm that can extract both link-density and link-pattern communities, without any prior knowledge of the true structure. The algorithm was first validated on different classes of synthetic benchmark networks with community structure, and also on random networks. We have then further applied the algorithm to different social, information, technological and biological networks, where it indeed reveals meaningful (composites of) link-density and link-pattern communities. The results thus seem to imply that, similarly as link-density counterparts, link-pattern communities app...

  13. [Antiradical properties of essential oils and extracts from clove bud and pimento].

    Science.gov (United States)

    Misharina, T A; Alinkina, E S; Medvedeva, I B

    2015-01-01

    The antiradical properties of essential oils and extracts from the clove bud (Eugenia caryophyllata Thumb.) and berries of tree (Pimenta dioica (L.) Meriff) were studied and compared with the properties of synthetic antioxidant ionol (2,6-ditret-butyl-4-hydroxytoluene, BHT) in model reactions with the stable free 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical. The essential oils of clove bud and pimento had qualitatively close composition of the main components but differed by their quantitative content. In the studied samples, eugenol was the main compound with high antiradical activity. The reaction rates of essential oils and extracts with the DPPH radical were practically the same for essential oils and twice the reaction rate of BHT. The values of antiradical efficiency (AE) were also close for essential oils and were twice that for extracts and ionol. A synergetic action of components in the essential oil and extract of pimento on antiradical efficiency values was found. PMID:25842910

  14. ALIX is recruited temporarily into HIV-1 budding sites at the end of gag assembly.

    Directory of Open Access Journals (Sweden)

    Pei-I Ku

    Full Text Available Polymerization of Gag on the inner leaflet of the plasma membrane drives the assembly of Human Immunodeficiency Virus 1 (HIV-1. Gag recruits components of the endosomal sorting complexes required for transport (ESCRT to facilitate membrane fission and virion release. ESCRT assembly is initiated by recruitment of ALIX and TSG101/ESCRT-I, which bind directly to the viral Gag protein and then recruit the downstream ESCRT-III and VPS4 factors to complete the budding process. In contrast to previous models, we show that ALIX is recruited transiently at the end of Gag assembly, and that most ALIX molecules are recycled into the cytosol as the virus buds, although a subset remains within the virion. Our experiments imply that ALIX is recruited to the neck of the assembling virion and is mostly recycled after virion release.

  15. The essential oil of Populus balsamifera buds: its chemical composition and cytotoxic activity.

    Science.gov (United States)

    Piochon-Gauthier, Marianne; Legault, Jean; Sylvestre, Muriel; Pichette, André

    2014-02-01

    The chemical composition of Populus balsamifera essential oils obtained from spring buds, fall buds, and young leaves were determined by GC and GC-MS analyses. The major constituent, (+)-alpha-bisabolol, a rare sesquiterpene, was isolated from spring oil using reverse-phase preparative HPLC. The cytotoxic activity of balsam poplar oils and isolated (+)-alpha-bisabolol was assessed in vitro against human lung carcinoma (A549) and colorectal adenocarcinoma (DLD-1) cell lines. Essential oils were cytotoxic with IC50 ranging from 35 to 50 microg/mL. (+)-alpha-Bisabolol exhibited pronounced activity (IC50 14 microg/mL) against both cancer cell lines. It also exhibited interesting cytotoxic activity (IC50 23 microg/mL) against human glioma (U251), higher than the one observed for (-)-alpha-bisabolol (IC50 34 microg/mL), which is known for its apoptosis-inducing effect against glioma cells. PMID:24689304

  16. Assessment of factors affecting in vitro shoot regeneration from axillary bud explant of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-Mei; ZU Yuan-Gang; DONG Feng-Li; ZHAO Xiao-Ju

    2005-01-01

    Axillary buds from 3-yr.-old seedlings of Camptotheca acuminata in the greenhouse were cultured on the different basal media with different concentrations of growth regulators for shoot regeneration for studying the effects of different basal media, different concentrations of growth regulators (BA or TDZ), sucrose, agar and pH value on shoot regeneration from axillary bud. The results showed that B5 and WPM media were the optimal basal media and the optimal phyotohormone was BA of 1.0 mg/L or TDZ of 0.1mg/L; The concentrations of sucrose of 30g/L and agar of 6g/L were most suitable for the shoot regeneration; pH value from 5.8 to 6.6 were broadly effective, but the best at pH 5.8.

  17. The relationship between differentiation of flower bud and metabolism of phosphate in apple

    International Nuclear Information System (INIS)

    Contents of phosphate both in exposed and in shade branches of the apples were examined. It was found that in the control the glycophosphate was lower but the nucleoprotein was higher than in the shade treatment during the period from the end of shoot growth to the morphological differentiation of flower buds. It has also been shown that in the control the incorporation of 32P was lower in glycophosphate but higher in glycophosphate ester, phospholipid and nucleopretein. The results suggest that the more shortage of nutrient supply, the lower of conversion of glycophosphate and the lower level of synthesis of glycophosphate ester, phospholipid and nucleoprotein in normal metabolic pathway, so that the flower buds under treatment can not be formed

  18. Effects of γ-irradiation on the embryonic bud structure of chestnut

    International Nuclear Information System (INIS)

    Effects of γ-irradiation on the structure of the embryonic bud in chestnut seed were investigated by using electronic transmittance microscope. The results indicated that γ-irradiation had great effects on the starch granules in the embryo of chestnut. No significant effects were found under the irradiation dose of 0.5 kGy; the outside of starch granule began to gelatinize at 1 kGy treatment, while significant gelatinization happened with the dose higher than 6 kGy. Correspondingly, the viscosity of the wholemeal flour of the chestnut seeds decreased with the increasing dose of irradiation. It was also found the thickness of the cell wall in the embryonic bud became thinner with the irradiation

  19. Gravity-dependent regulation of red light induced moss protonemata branching and gametophore bud formation

    Science.gov (United States)

    Ripetskyj, R. T.; Kit, N. A.

    Isolated leafy shoots of the moss Pottia intermedia positioned horizontally on the agar surface in vertically oriented petri dishes regenerate unbranching negatively gravitropic protonemata on upper side of the regenerant. Gravity determines the site of regeneration not the process itself. White light of low intensity unsufficient to induce positive phototropism of dark-grown protonemata can, however, provoke their branching and gametophore bud formation (Ripetskyj et al., 1998; 1999). The presented experiments have been carried out with red light in Biological Research in Canisters/Light Emitting Diode (BRIC/LED) hardware developed at Kennedy Space Center, USA. Seven-day-old dark-grown negatively gravitropic secondary P. intermedia protonemata were positioned differently with respect to gravity vector and to the source of red light of low, 1 or 2 μ mol\\cdot m-2\\cdot s-1, intensities. The light induced intensive branching of the protonemata and gametophore bud formation initiation site of both processes as well as the direction of growth of branches and buds being depent on the position of protonemata with respect to gravity and light vectors. Vertically positioned, i.e. ungravistimulated, dark grown protonemata illuminated from one side with red light of 2 μ mol\\cdot m-2\\cdot s-1 intensity produced 96,9 ± 2,2% of side branches and buds growing directly towards the light source from the lit protonema side. Horizontally disposed protonemata irradiated from below with red light of the same intensity regenerate 31,7 ± 3,9% of branches and buds on the upper, i.e. shaded protonemata side, the upward growth of which should undoubtedly be determined by gravity. In vertically disposed protonemata illuminated with red light of 1 μ mol\\cdot m-2\\cdot s-1 intensity from aside 31,9 ± 5,5% of side branches and buds arised on shaded protonema side and grew away from the light. Illumination of the protonemata in horizontal position from below increased the number of

  20. Sex-linked dominant

    Science.gov (United States)

    Inheritance - sex-linked dominant; Genetics - sex-linked dominant; X-linked dominant; Y-linked dominant ... type of chromosome that is affected (autosomal or sex chromosome). It also depends on whether the trait ...

  1. Sex-linked dominant

    Science.gov (United States)

    Inheritance - sex-linked dominant; Genetics - sex-linked dominant; X-linked dominant; Y-linked dominant ... can be either an autosomal chromosome or a sex chromosome. It also depends on whether the trait ...

  2. Genetic characterization of pathogenic fluorescent pseudomonads isolated from necrotic cherry and plum buds in Serbia

    OpenAIRE

    Gavrilović Veljko; Ivanović Žarko; Popović Tatjana; Živković Svetlana; Stanković Slaviša; Berić Tanja; Fira Đorđe

    2013-01-01

    During past few years a symptoms of plum and cherry bud necrosis were observed in some regions with significant cherry production in Serbia. Gram negative, fluorescent, oxidative bacterial strains were isolated from the margin of necrotic tissue. All investigated strains are levan and HR positive, while negative results are recorded in oxidase, pectinase and arginin dihydrolase tests (LOPAT+---+). Symptoms similar to those observed in natural infection were...

  3. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    OpenAIRE

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H. E. W.; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field still needs to rely on a 50-y-old laborious and time-consuming method to assess the lifespan of yeast cells and to isolate differentially aged cells for microscopic snapshots via manual dissection of...

  4. Expression of Podoplanin in the Mouse Tooth Germ and Apical Bud Cells

    OpenAIRE

    Sawa, Yoshihiko; Iwasawa, Kana; Ishikawa, Hiroyuki

    2008-01-01

    This study was designed to investigate the distribution of cells expressing podoplanin in the mouse tooth bud. Podoplanin expression was detected in enamel epithelia of the cervical loop at cell-cell contacts strongly, and weakly on the loosely aggregated stellate reticulum in the center and the neighboring stratum intermedium. Odontoblasts exhibited intense podoplanin expression at the junction with predentin while no expression was detected in the enamel organ containing ameloblasts. These ...

  5. The conserved protein kinase Ipl1 regulates microtubule binding to kinetochores in budding yeast

    OpenAIRE

    Biggins, Sue; Fedor F. Severin; Bhalla, Needhi; Sassoon, Ingrid; Hyman, Anthony A.; Murray, Andrew W.

    1999-01-01

    Chromosome segregation depends on kinetochores, the structures that mediate chromosome attachment to the mitotic spindle. We isolated mutants in IPL1, which encodes a protein kinase, in a screen for budding yeast mutants that have defects in sister chromatid separation and segregation. Cytological tests show that ipl1 mutants can separate sister chromatids but are defective in chromosome segregation. Kinetochores assembled in extracts from ipl1 mutants show altered binding to microtubules. Ip...

  6. The budding yeast Ipl1/Aurora protein kinase regulates mitotic spindle disassembly

    OpenAIRE

    Buvelot, Stéphanie; Tatsutani, Sean Y.; Vermaak, Danielle; Biggins, Sue

    2003-01-01

    Ipl1p is the budding yeast member of the Aurora family of protein kinases, critical regulators of genomic stability that are required for chromosome segregation, the spindle checkpoint, and cytokinesis. Using time-lapse microscopy, we found that Ipl1p also has a function in mitotic spindle disassembly that is separable from its previously identified roles. Ipl1–GFP localizes to kinetochores from G1 to metaphase, transfers to the spindle after metaphase, and accumulates at the spindle midzone ...

  7. Potential Bud Bank Responses to Apical Meristem Damage and Environmental Variables: Matching or Complementing Axillary Meristems?

    OpenAIRE

    Klimešová, Jitka; Malíková, Lenka; Rosenthal, Jonathan; Šmilauer, Petr

    2014-01-01

    Soil nutrients, dormant axillary meristem availability, and competition can influence plant tolerance to damage. However, the role of potential bud banks (adventitious meristems initiated only after injury) is not known. Examining Central European field populations of 22 species of short-lived monocarpic herbs exposed to various sources of damage, we hypothesized that: (1) with increasing injury severity, the number of axillary branches would decrease, due to axillary meristem limitation, whe...

  8. Effect of gamma rays on vegetative buds of physalis peruviana l

    OpenAIRE

    Caro Melgarejo, Diana Patricia; Estupiñán-Rincón, Sandra Yaneth; Rache Cardenal, Leidy Yanira; Pacheco-Maldonado, José Constantino

    2013-01-01

    In Colombia, studies carried out to establish modern methods for propagation and selection of plant of ribes gooseberry (Physalis peruviana) are scarce so, it is necessary to explore alternative techniques such as the application of ionizing radiation, which enables greater genetic variability and to obtain seedlings with phenotypic characteristics that could be beneficial to contribute to improve productivity. To induce chromosomal alterations, axillary buds of P. peruviana with 50, 100, :00...

  9. Analisis Histologi Embriogenesis Somatik Dari Apikal Bud Kelapa Sawit (Elaeis guineensis Jacq.) var Tenera

    OpenAIRE

    Meilvana, Tengku Nilayanda

    2014-01-01

    A study of Histological Analysis of Somatic Embryogenesis from Apical Bud of Oil Palm (Elaeis guineensis Jacq.) var. Tenera has been conducted at Plant Tissue Culture Laboratory of FMIPA USU. The experimental design was completely randomized with three levels of 2,4-D concentrations: 110; 120; 130 mg/L and three position of explants: apical, median, and basal. The statistical analysis showed that 120 mg/L of 2,4-D significantly affected the primary and embryogenic calluses initiation. Explant...

  10. Biophysical Characterization of the Centromere-specific Nucleosome from Budding Yeast*

    OpenAIRE

    Kingston, Isabel J.; Yung, Jasmine S. Y.; Singleton, Martin R

    2010-01-01

    The centromeric DNA of all eukaryotes is assembled upon a specialized nucleosome containing a histone H3 variant known as CenH3. Despite the importance and conserved nature of this protein, the characteristics of the centromeric nucleosome are still poorly understood. In particular, the stoichiometry and DNA-binding properties of the CenH3 nucleosome have been the subject of some debate. We have characterized the budding yeast centromeric nucleosome by biochemical and biophysical methods and ...

  11. Cse4 is Part of an Octameric Nucleosome in Budding Yeast

    OpenAIRE

    Camahort, Raymond; Shivaraju, Manjunatha; Mattingly, Mark; Li, Bing; Nakanishi, Shima; Zhu, Dongxiao; Shilatifard, Ali; Workman, Jerry L.; Gerton, Jennifer L.

    2009-01-01

    The budding yeast CenH3 histone variant Cse4 localizes to centromeric nucleosomes and is required for kinetochore assembly and chromosome segregation. The exact composition of centromeric Cse4–containing nucleosomes is a subject of debate. ChIP-chip experiments and high resolution quantitative PCR confirm that there is a single Cse4 nucleosome at each centromere, and additional regions of the genome contain Cse4 nucleosomes at low levels. Using unbiased biochemical, cell biological, and genet...

  12. Estimation of the junctional resistance between electrically coupled receptor cells in Necturus taste buds

    OpenAIRE

    1995-01-01

    Junctional resistance between coupled receptor cells in Necturus taste buds was estimated by modeling the results from single patch pipette voltage clamp studies on lingual slices. The membrane capacitance and input resistance of coupled taste receptor cells were measured to monitor electrical coupling and the results compared with those calculated by a simple model of electrically coupled taste cells. Coupled receptor cells were modeled by two identical receptor cells connected via a junctio...

  13. Calcium Regulation of Hemorrhagic Fever Virus Budding: Mechanistic Implications for Host-Oriented Therapeutic Intervention.

    Science.gov (United States)

    Han, Ziying; Madara, Jonathan J; Herbert, Andrew; Prugar, Laura I; Ruthel, Gordon; Lu, Jianhong; Liu, Yuliang; Liu, Wenbo; Liu, Xiaohong; Wrobel, Jay E; Reitz, Allen B; Dye, John M; Harty, Ronald N; Freedman, Bruce D

    2015-10-01

    Hemorrhagic fever viruses, including the filoviruses (Ebola and Marburg) and arenaviruses (Lassa and Junín viruses), are serious human pathogens for which there are currently no FDA approved therapeutics or vaccines. Importantly, transmission of these viruses, and specifically late steps of budding, critically depend upon host cell machinery. Consequently, strategies which target these mechanisms represent potential targets for broad spectrum host oriented therapeutics. An important cellular signal implicated previously in EBOV budding is calcium. Indeed, host cell calcium signals are increasingly being recognized to play a role in steps of entry, replication, and transmission for a range of viruses, but if and how filoviruses and arenaviruses mobilize calcium and the precise stage of virus transmission regulated by calcium have not been defined. Here we demonstrate that expression of matrix proteins from both filoviruses and arenaviruses triggers an increase in host cytoplasmic Ca2+ concentration by a mechanism that requires host Orai1 channels. Furthermore, we demonstrate that Orai1 regulates both VLP and infectious filovirus and arenavirus production and spread. Notably, suppression of the protein that triggers Orai activation (Stromal Interaction Molecule 1, STIM1) and genetic inactivation or pharmacological blockade of Orai1 channels inhibits VLP and infectious virus egress. These findings are highly significant as they expand our understanding of host mechanisms that may broadly control enveloped RNA virus budding, and they establish Orai and STIM1 as novel targets for broad-spectrum host-oriented therapeutics to combat these emerging BSL-4 pathogens and potentially other enveloped RNA viruses that bud via similar mechanisms. PMID:26513362

  14. Calcium Regulation of Hemorrhagic Fever Virus Budding: Mechanistic Implications for Host-Oriented Therapeutic Intervention.

    Directory of Open Access Journals (Sweden)

    Ziying Han

    2015-10-01

    Full Text Available Hemorrhagic fever viruses, including the filoviruses (Ebola and Marburg and arenaviruses (Lassa and Junín viruses, are serious human pathogens for which there are currently no FDA approved therapeutics or vaccines. Importantly, transmission of these viruses, and specifically late steps of budding, critically depend upon host cell machinery. Consequently, strategies which target these mechanisms represent potential targets for broad spectrum host oriented therapeutics. An important cellular signal implicated previously in EBOV budding is calcium. Indeed, host cell calcium signals are increasingly being recognized to play a role in steps of entry, replication, and transmission for a range of viruses, but if and how filoviruses and arenaviruses mobilize calcium and the precise stage of virus transmission regulated by calcium have not been defined. Here we demonstrate that expression of matrix proteins from both filoviruses and arenaviruses triggers an increase in host cytoplasmic Ca2+ concentration by a mechanism that requires host Orai1 channels. Furthermore, we demonstrate that Orai1 regulates both VLP and infectious filovirus and arenavirus production and spread. Notably, suppression of the protein that triggers Orai activation (Stromal Interaction Molecule 1, STIM1 and genetic inactivation or pharmacological blockade of Orai1 channels inhibits VLP and infectious virus egress. These findings are highly significant as they expand our understanding of host mechanisms that may broadly control enveloped RNA virus budding, and they establish Orai and STIM1 as novel targets for broad-spectrum host-oriented therapeutics to combat these emerging BSL-4 pathogens and potentially other enveloped RNA viruses that bud via similar mechanisms.

  15. Calcium Regulation of Hemorrhagic Fever Virus Budding: Mechanistic Implications for Host-Oriented Therapeutic Intervention

    OpenAIRE

    Han, Ziying; Madara, Jonathan J.; Herbert, Andrew; Prugar, Laura I.; Ruthel, Gordon; Lu, Jianhong; Liu, Yuliang; Liu, Wenbo; Liu, Xiaohong; Wrobel, Jay E.; Reitz, Allen B.; Dye, John M.; Harty, Ronald N.; Freedman, Bruce D.

    2015-01-01

    Hemorrhagic fever viruses, including the filoviruses (Ebola and Marburg) and arenaviruses (Lassa and Junín viruses), are serious human pathogens for which there are currently no FDA approved therapeutics or vaccines. Importantly, transmission of these viruses, and specifically late steps of budding, critically depend upon host cell machinery. Consequently, strategies which target these mechanisms represent potential targets for broad spectrum host oriented therapeutics. An important cellular ...

  16. Investigations on The Changes of Phenolic Substances During Flower Bud Development in Strawberries

    OpenAIRE

    ÖZEKER, Elmas; TANRISEVER, Ali

    1998-01-01

    The extracts prepared from the samples which were collected weekly intervals betweeen August and December in 1990 and 1992 were analyzed by thin layer chromatography and the changes in phenolic substances during flower bud developmental stages in strawberries were examined. Some differences were determined in terms of phenolic compositions among the developmental stages in the one dimensional chromatograms of young and mature leaves of Pocahontas, Tioga and Yalova-110 strawberry cultivars and...

  17. Integrace Ukrajinců v Českých Budějovicích

    OpenAIRE

    ŠILLEROVÁ, Veronika

    2015-01-01

    The diploma thesis is named Integration of Ukrainians in České Budějovice. The first chapter explains the basic concepts related to the topic of integration of foreigners, such as migration, immigrant or refugee. The second section refers to the concept of integration, which is defined in detail. The third chapter describes the integration policy in the Czech Republic. The fourth chapter is dedicated to legislation and two basic laws governing this issue. The fifth chapter concerns foreigners...

  18. Modulation of taste sensitivity by GLP-1 signaling in taste buds

    OpenAIRE

    Martin, Bronwen; Dotson, Cedrick D; Shin, Yu-Kyong; Ji, Sunggoan; Drucker, Daniel J.; Maudsley, Stuart; Munger, Steven D.

    2009-01-01

    Modulation of sensory function can help animals adjust to a changing external and internal environment. Even so, mechanisms for modulating taste sensitivity are poorly understood. Using immunohistochemical, biochemical and behavioral approaches, we found that the peptide hormone glucagon-like peptide-1 (GLP-1) and its receptor (GLP-1R) are expressed in mammalian taste buds. Furthermore, we found that GLP-1 signaling plays an important role in the modulation of taste sensitivity: GLP-1R knocko...

  19. CENP-A exceeds microtubule attachment sites in centromere clusters of both budding and fission yeast

    OpenAIRE

    Coffman, Valerie C.; Wu, Pengcheng; Parthun, Mark R.; Wu, Jian-Qiu

    2011-01-01

    The stoichiometries of kinetochores and their constituent proteins in yeast and vertebrate cells were determined using the histone H3 variant CENP-A, known as Cse4 in budding yeast, as a counting standard. One Cse4-containing nucleosome exists in the centromere (CEN) of each chromosome, so it has been assumed that each anaphase CEN/kinetochore cluster contains 32 Cse4 molecules. We report that anaphase CEN clusters instead contained approximately fourfold more Cse4 in Saccharomyces cerevisiae...

  20. Comparative Transcriptome Profile of the Cytoplasmic Male Sterile and Fertile Floral Buds of Radish (Raphanus sativus L.).

    Science.gov (United States)

    Mei, Shiyong; Liu, Touming; Wang, Zhiwei

    2016-01-01

    Radish cytoplasmic male sterility (CMS) has been widely used for breeding in Raphanus and Brassica genera. However, the detailed regulation network of the male sterility remains to be determined. Our previous work has shown that the abnormalities in a CMS radish appeared shortly after the tetrad stage when microspores were malformed and the tapetal cells grew abnormally large. In this work, histological analysis shows that anthers are at the tetrad stage when the radish buds are about 1.5 mm in length. Furthermore, a high throughput RNA sequencing technology was employed to characterize the transcriptome of radish buds with length about 1.5 mm from two CMS lines possessing the CMS-inducing orf138 gene and corresponding near-isogenic maintainer lines. A total of 67,140 unigenes were functionally annotated. Functional terms for these genes are significantly enriched in 55 Gene Ontology (GO) groups and 323 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The transcriptome detected transcripts for 72 out of a total of 79 protein genes encoded in the chloroplast genome from radish. In contrast, the radish mitochondrial genome contains 34 protein genes, but only 16 protein transcripts were detected from the transcriptome. The transcriptome comparison between CMS and near-isogenic maintainer lines revealed 539 differentially expressed genes (DEGs), indicating that the false positive rate for comparative transcriptome profiling was clearly decreased using two groups of CMS/maintainer lines with different nuclear background. The level of 127 transcripts was increased and 412 transcripts were decreased in the CMS lines. No change in levels of transcripts except CMS-inducing orf138 was identified from the mitochondrial and chloroplast genomes. Some DEGs which would be associated with the CMS, encoding MYB and bHLH transcription factors, pentatricopeptide repeat (PPR) proteins, heat shock transcription factors (HSFs) and heat shock proteins (HSPs), are discussed. The

  1. Comparative Transcriptome Profile of the Cytoplasmic Male Sterile and Fertile Floral Buds of Radish (Raphanus sativus L.

    Directory of Open Access Journals (Sweden)

    Shiyong Mei

    2016-01-01

    Full Text Available Radish cytoplasmic male sterility (CMS has been widely used for breeding in Raphanus and Brassica genera. However, the detailed regulation network of the male sterility remains to be determined. Our previous work has shown that the abnormalities in a CMS radish appeared shortly after the tetrad stage when microspores were malformed and the tapetal cells grew abnormally large. In this work, histological analysis shows that anthers are at the tetrad stage when the radish buds are about 1.5 mm in length. Furthermore, a high throughput RNA sequencing technology was employed to characterize the transcriptome of radish buds with length about 1.5 mm from two CMS lines possessing the CMS-inducing orf138 gene and corresponding near-isogenic maintainer lines. A total of 67,140 unigenes were functionally annotated. Functional terms for these genes are significantly enriched in 55 Gene Ontology (GO groups and 323 Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. The transcriptome detected transcripts for 72 out of a total of 79 protein genes encoded in the chloroplast genome from radish. In contrast, the radish mitochondrial genome contains 34 protein genes, but only 16 protein transcripts were detected from the transcriptome. The transcriptome comparison between CMS and near-isogenic maintainer lines revealed 539 differentially expressed genes (DEGs, indicating that the false positive rate for comparative transcriptome profiling was clearly decreased using two groups of CMS/maintainer lines with different nuclear background. The level of 127 transcripts was increased and 412 transcripts were decreased in the CMS lines. No change in levels of transcripts except CMS-inducing orf138 was identified from the mitochondrial and chloroplast genomes. Some DEGs which would be associated with the CMS, encoding MYB and bHLH transcription factors, pentatricopeptide repeat (PPR proteins, heat shock transcription factors (HSFs and heat shock proteins (HSPs, are

  2. The Malleable Nature of the Budding Yeast Nuclear Envelope: Flares, Fusion, and Fenestrations.

    Science.gov (United States)

    Meseroll, Rebecca A; Cohen-Fix, Orna

    2016-11-01

    In eukaryotes, the nuclear envelope (NE) physically separates nuclear components and activities from rest of the cell. The NE also provides rigidity to the nucleus and contributes to chromosome organization. At the same time, the NE is highly dynamic; it must change shape and rearrange its components during development and throughout the cell cycle, and its morphology can be altered in response to mutation and disease. Here we focus on the NE of budding yeast, Saccharomyces cerevisiae, which has several unique features: it remains intact throughout the cell cycle, expands symmetrically during interphase, elongates during mitosis and, expands asymmetrically during mitotic delay. Moreover, its NE is safely breached during mating and when large structures, such as nuclear pore complexes and the spindle pole body, are embedded into its double membrane. The budding yeast NE lacks lamins and yet the nucleus is capable of maintaining a spherical shape throughout interphase. Despite these eccentricities, studies of the budding yeast NE have uncovered interesting, and likely conserved, processes that contribute to NE dynamics. In particular, we discuss the processes that drive and enable NE expansion and the dramatic changes in the NE that lead to extensions and fenestrations. J. Cell. Physiol. 231: 2353-2360, 2016. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. PMID:26909870

  3. Genetic characterization of pathogenic fluorescent pseudomonads isolated from necrotic cherry and plum buds in Serbia

    Directory of Open Access Journals (Sweden)

    Gavrilović Veljko

    2013-01-01

    Full Text Available During past few years a symptoms of plum and cherry bud necrosis were observed in some regions with significant cherry production in Serbia. Gram negative, fluorescent, oxidative bacterial strains were isolated from the margin of necrotic tissue. All investigated strains are levan and HR positive, while negative results are recorded in oxidase, pectinase and arginin dihydrolase tests (LOPAT+---+. Symptoms similar to those observed in natural infection were obtained after artificial inoculation of cherry leaf scares and dormant one year old cherry shoots. Investigated strains as well as reference strain of P. syringae pv. morsprunorum cause the superficial necrosis on artificially inoculated immature cherry fruits, but negative results were recorded in immature pear and lemon fruit tests as well as syringae leaves and bean pods. Gelatin and aesculin tests were negative and tyrosinase and tartrate were positive. Investigated strains isolated from necrotic cherry buds had identical REP-PCR pattern with reference strain of P. syringae pv. morsprunorum. On the basis of obtained results, it was concluded that this bacterium is causal agent of cherry trees bud necrosis in Serbia. [Projekat Ministarstva nauke Republike Srbije, br. 31018 i br. 173026

  4. Roles of the three L-domains in β-retrovirus budding.

    Science.gov (United States)

    Narahara, Chisato; Yasuda, Jiro

    2015-09-01

    Retroviral Gag protein plays a critical role during the late stage of virus budding and possesses a so-called L-domain containing PT/SAP, PPxY, YxxL or FPIV motifs that are critical for efficient budding. Mason-Pfizer monkey virus (M-PMV) contains PSAP, PPPY, and YADL sequences in Gag. This study was performed to investigate the roles of these three L-domain-like sequences in virus replication in three different cell lines, 293T, COS-7 and HeLa cells. It was found that the PPxY motif plays an essential role in progeny virus production as a major L-domain in all three cell lines. The PSAP sequence was shown to function as an additional L-domain in HeLa cells and to promote efficient release of M-PMV; however, this sequence was dispensable for M-PMV production in 293T and COS-7 cells, suggesting that the role of the PSAP motif as an L-domain in M-PMV budding is cell type-dependent. Viruses possessing multiple L-domains appear to change the L-domain usage to replicate in various cells. On the other hand, the YADL motif was required for M-PMV production as a transport signal of Gag to the plasma membrane, but not as an L-domain. PMID:26190584

  5. A mathematical model for the induction of the mammalian ureteric bud.

    Science.gov (United States)

    Lawson, Brodie A J; Flegg, Mark B

    2016-04-01

    Congenital abnormalities of the kidney and urinary tract collectively form the most common type of prenatally diagnosed malformations. Whilst many of the crucial genes that direct the kidney developmental program are known, the mechanisms by which kidney organogenesis is achieved is still largely unclear. In this paper, we propose a mathematical model for the localisation of the ureteric bud, the precursor to the ureter and collecting duct system of the kidney. The mathematical model presented fundamentally implicates Schnakenberg-like ligand-receptor Turing patterning as the mechanism by which the ureteric bud is localised on the Wolfian duct as proposed by Menshykaul and Iber (2013). This model explores the specific roles of regulatory proteins GREM1 and BMP as well as the domain properties of GDNF production. Our model demonstrates that this proposed pattern formation mechanism is capable of naturally predicting the phenotypical outcomes of many genetic experiments from the literature. Furthermore, we conclude that whilst BMP inhibits GDNF away from the budding site and GREM1 permits GDNF to signal, GREM1 also stabilises the effect of BMP on GDNF signalling from fluctuations in BMP sensitivity but not signal strength. PMID:26801874

  6. Potential bud bank responses to apical meristem damage and environmental variables: matching or complementing axillary meristems?

    Directory of Open Access Journals (Sweden)

    Jitka Klimešová

    Full Text Available Soil nutrients, dormant axillary meristem availability, and competition can influence plant tolerance to damage. However, the role of potential bud banks (adventitious meristems initiated only after injury is not known. Examining Central European field populations of 22 species of short-lived monocarpic herbs exposed to various sources of damage, we hypothesized that: (1 with increasing injury severity, the number of axillary branches would decrease, due to axillary meristem limitation, whereas the number of adventitious shoots (typically induced by severe injury would increase; (2 favorable environmental conditions would allow intact plants to branch more, resulting in stronger axillary meristem limitation than in unfavorable conditions; and (3 consequently, adventitious sprouting would be better enabled in favorable than unfavorable conditions. We found strong support for the first hypothesis, only limited support for the second, and none for the third. Our results imply that whereas soil nutrients and competition marginally influence plant tolerance to damage, potential bud banks enable plants to overcome meristem limitation from severe damage, and therefore better tolerate it. All the significant effects were found in intraspecific comparisons, whereas interspecific differences were not found. Monocarpic plants with potential bud banks therefore represent a distinct strategy occupying a narrow environmental niche. The disturbance regime typical for this niche remains to be examined, as do the costs associated with the banks of adventitious and axillary reserve meristems.

  7. Potential bud bank responses to apical meristem damage and environmental variables: matching or complementing axillary meristems?

    Science.gov (United States)

    Klimešová, Jitka; Malíková, Lenka; Rosenthal, Jonathan; Šmilauer, Petr

    2014-01-01

    Soil nutrients, dormant axillary meristem availability, and competition can influence plant tolerance to damage. However, the role of potential bud banks (adventitious meristems initiated only after injury) is not known. Examining Central European field populations of 22 species of short-lived monocarpic herbs exposed to various sources of damage, we hypothesized that: (1) with increasing injury severity, the number of axillary branches would decrease, due to axillary meristem limitation, whereas the number of adventitious shoots (typically induced by severe injury) would increase; (2) favorable environmental conditions would allow intact plants to branch more, resulting in stronger axillary meristem limitation than in unfavorable conditions; and (3) consequently, adventitious sprouting would be better enabled in favorable than unfavorable conditions. We found strong support for the first hypothesis, only limited support for the second, and none for the third. Our results imply that whereas soil nutrients and competition marginally influence plant tolerance to damage, potential bud banks enable plants to overcome meristem limitation from severe damage, and therefore better tolerate it. All the significant effects were found in intraspecific comparisons, whereas interspecific differences were not found. Monocarpic plants with potential bud banks therefore represent a distinct strategy occupying a narrow environmental niche. The disturbance regime typical for this niche remains to be examined, as do the costs associated with the banks of adventitious and axillary reserve meristems. PMID:24516587

  8. Ultraviolet irradiation initiates ectopic foot formation in regenerating hydra and promotes budding

    Indian Academy of Sciences (India)

    Saroj S Ghaskadbi; Leena Shetye; Shashi Chiplonkar; Surendra Ghaskadbi

    2005-03-01

    We have studied the effects of ultraviolet-C (UVC) and Ultraviolet-B (UVB) on growth and pattern formation in Pelmatohydra oligactis. UVC brings about a significant increase in budding in intact hydra while UVB does not exhibit such an effect. Excessive budding could be a response for survival at wavelengths that damage biological tissues. If the head or base piece of a bisected hydra is irradiated and recombined with the unirradiated missing part, regeneration proceeds normally indicating that exposure of a body part with either an intact head or foot to UVC does not influence pattern formation. Most significantly, in the middle piece, but not in the head or the base piece of a trisected hydra, UVC leads to initiation of ectopic feet formation in almost one third of the cases. Thus, UV irradiation interferes with pattern formation in regenerating hydra, possibly by changing positional values, and promotes budding in intact hydra. This is the first report on induction of ectopic feet formation by UV in regenerating hydra and opens up the possibility of using UV irradiation as a tool to understand pattern formation in the enigmatic hydra.

  9. Bud Rot Caused by Phytophthora palmivora: A Destructive Emerging Disease of Oil Palm.

    Science.gov (United States)

    Torres, G A; Sarria, G A; Martinez, G; Varon, F; Drenth, A; Guest, D I

    2016-04-01

    Oomycetes from the genus Phytophthora are among the most important plant pathogens in agriculture. Epidemics caused by P. infestans precipitated the great Irish famine and had a major impact on society and human history. In the tropics, P. palmivora is a pathogen of many plant species including cacao (Theobroma cacao), citrus (Citrus sp.), durian (Durio zibethines), jackfruit (Artrocarpus heterophyllus), rubber (Hevea brasiliensis), and several palm species including coconut (Cocos nucifera), and the African oil palm (Elaeis guineensis) as determined recently. The first localized epidemics of bud rot in oil palm in Colombia were reported in 1964. However, recent epidemics of bud rot have destroyed more than 70,000 ha of oil palm in the Western and Central oil palm growing regions of Colombia. The agricultural, social, and economic implications of these outbreaks have been significant in Colombia. Identification of the pathogen after 100 years of investigating the disease in the world enabled further understanding of infection, expression of a range of symptoms, and epidemiology of the disease. This review examines the identification of P. palmivora as the cause of bud rot in Colombia, its epidemiology, and discusses the importance of P. palmivora as a major threat to oil palm plantings globally. PMID:26714102

  10. Proliferation enhancement of budding yeast and mammalian cells with periodic oxygen radical treatment

    Science.gov (United States)

    Mori, Yosuke; Kobayashi, Jun; Murata, Tomiyasu; Hahizume, Hiroshi; Hori, Masaru; Ito, Masafumi

    2015-09-01

    Recently, nonequilibrium atmospheric-pressure plasmas have been intensively studied for biological applications. However, the each effect of species in plasmas to biological tissue has not been clarified yet because various factors exist in the plasmas. Accordingly, we have studied effects of atomic oxygen dose on cell growth such as budding yeast and mouse NIH3T3 fibroblasts of mammalian cells. Both of cells were suspended with PBS, and treated using oxygen radical source. In order to prevent the radicals from reacting with the ambient air, the treatment region was surrounded by a plastic cover and purged with Ar. The proliferative effect of 15 % was observed at the O3Pj dose of around 1 . 0 ×1017 cm-3 in NIH3T3 cells as well as in yeast cells. Moreover, periodic oxygen treatment enhanced the effect in budding yeast cells. The best interval of periodic oxygen radical treatment was around 2 hours, which is almost the same period as that of their cell cycle. With the optimum interval time, we have investigated the effect of the number of the treatments. As the number of treatments increases, the growth rate of budding yeast cells was gradually enhanced and saturated at thrice treatments. This work was partly supported by JSPS KAKENHI Grant Numbers 26286072 and project for promoting Research Center in Meijo University.

  11. SUBSTRATES UTILIZATION TO ASSESS ROOTEDNESS CAPACITY AND VIABILITY BUDS AT SOME GRAPE VARIETIES

    Directory of Open Access Journals (Sweden)

    Gheorghe Cristian Popescu

    2013-12-01

    Full Text Available The cultivated grapevine (Vitis vinifera L. is a fruit crop of enormous economic importance with over eight million hectares planted in vineyards worldwide. Table grapes and wines represent a considerable share of the economy in many grape and wine-producing countries. During the dormant, due to low temperatures and how to prepare grape for entrance in winter time, wood annual increases and buds may be adversely affected. The way how the vines passed by dormant period can affect the buds and wood viability and rooting ability of vine cuttings. In this study were tested on different culture substrates vine cuttings belonging to a noble variety and a hybrid vines: Merlot and Isabella. Noble grapes are a term used to describe the international variety of grapes that are most recognizable for the top quality wine they produce. In this paper was determinate total dry matter of vine cuttings, humidity of biological material, vine cuttings rooting capacity and viability status buds cuttings placed on three nutritional substrates.

  12. Shoot bending promotes flower bud formation by miRNA‐mediated regulation in apple ( Malus domestica Borkh.)

    OpenAIRE

    Xing, Libo; Zhang, Dong; Zhao, Caiping; LI, YOUMEI; Ma, Juanjuan; An, Na; Han, Mingyu

    2015-01-01

    Summary Flower induction in apple ( Malus domestica Borkh.) trees plays an important life cycle role, but young trees produce fewer and inferior quality flower buds. Therefore, shoot bending has become an important cultural practice, significantly promoting the capacity to develop more flower buds during the growing seasons. Additionally, microRNAs (miRNAs) play essential roles in plant growth, flower induction and stress responses. In this study, we identified miRNAs potentially involved in ...

  13. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data Description of data contents Phred's quality score. PHD format, one file to a single cDNA data, and co...ription Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive ...

  14. The Effect of Water Stress on Some Morphological, Physiological, and Biochemical Characteristics and Bud Success on Apple and Quince Rootstocks

    OpenAIRE

    Ibrahim Bolat; Murat Dikilitas; Sezai Ercisli; Ali Ikinci; Tahsin Tonkaz

    2014-01-01

    The effects of different water stress (control, medium, and severe) on some morphological, physiological, and biochemical characteristics and bud success of M9 apple and MA quince rootstocks were determined. The results showed that water stress significantly affected most morphological, physiological, and biochemical characteristics as well as budding success on the both rootstocks. The increasing water stress decreased the relative shoot length, diameter, and plant total fresh and dry weight...

  15. Mathematics revealed

    CERN Document Server

    Berman, Elizabeth

    1979-01-01

    Mathematics Revealed focuses on the principles, processes, operations, and exercises in mathematics.The book first offers information on whole numbers, fractions, and decimals and percents. Discussions focus on measuring length, percent, decimals, numbers as products, addition and subtraction of fractions, mixed numbers and ratios, division of fractions, addition, subtraction, multiplication, and division. The text then examines positive and negative numbers and powers and computation. Topics include division and averages, multiplication, ratios, and measurements, scientific notation and estim

  16. Revealed Attention

    OpenAIRE

    Masatlioglu, Yusufcan; NAKAJIMA, Daisuke; Ozbay, Erkut Y

    2012-01-01

    The standard revealed preference argument relies on an implicit assumption that a decision maker considers all feasible alternatives. The marketing and psychology literatures, however, provide wellestablished evidence that consumers do not consider all brands in a given market before making a purchase (Limited Attention). In this paper, we illustrate how one can deduce both the decision maker's preference and the alternatives to which she pays attention and inattention from the observed behav...

  17. Revealed Attention

    OpenAIRE

    Yusufcan Masatlioglu; Daisuke Nakajima; Ozbay, Erkut Y

    2012-01-01

    The standard revealed preference argument relies on an implicit assumption that a decision maker considers all feasible alternatives. The marketing and psychology literatures, however, provide well-established evidence that consumers do not consider all brands in a given market before making a purchase (Limited Attention). In this paper, we illustrate how one can deduce both the decision maker's preference and the alternatives to which she pays attention and inattention from the observed beha...

  18. A study of some chemical changes in onion bulbs and their inner buds as affected by gamma radiation and storage

    International Nuclear Information System (INIS)

    With the aim of detecting the break of dormancy and of investigating the effects of gamma irradiation at the 5 krad dose level, the length of inner buds and the content of vitamin C, reducing and total sugars of Mako onion bulbs and their inner buds were determined periodically during storage at 0 to 40C. A temporary increase in vitamin C content was detected shortly before the inner buds started to grow. The vitamin C content was considerably higher in the growing buds than that in the whole bulbs. Both reducing and non-reducing sugars increased gradually during the dormancy period and levelled off after the break in dormancy. Irradiation of onions before the break in dormancy resulted in much stronger sprout inhibition than radiation treatment during the non-dormant stage. Inner buds of onions irradiated after the break of dormancy tended to darken during post-irradiation storage. Bulbs radiation-treated in the dormant stage resulted in an onion powder of a lighter colour on drying than onions untreated or radiation-treated at the non-dormant stage. The vitamin C, reducing and non-reducing sugar contents and the amino acid composition of the onion flesh and the inner buds were investigated in the final stage of storage, 8 to 10 months after harvest. Compositional differences found between irradiated and untreated onions seem to be of no nutritional significance. Free radicals formed in the outer scales of onions by irradiation diminished within 96 hours at room temperature. (author)

  19. Plant regeneration and floral bud formation from intact floral parts of African violet (Saintpaulia ionantha H. Wendl.) cultured in vitro.

    Science.gov (United States)

    Daud, N; Taha, R M

    2008-04-01

    Intact immature flower buds of African violet (Saintpaulia ionantha H. Wendl.) were used as explant sources for in vitro studies. The effect of exogenous hormones, NAA and BAP on the indirect organogenesis of this species was observed. Callus was formed on the cut end (base) of pedicels of floral buds where they were in contact with the medium. When maintained on the same medium, callus was differentiated into adventitious shoots after 10 weeks in culture. MS media supplemented with 2.0 mg L(-1) NAA and 1.0 mg L(-1) BAP gave the highest number of sterile or vegetative floral buds from the surface of callus of the explants, but these buds failed to develop further. The floral buds were expanded as abnormal flowers. The floral structures were smaller in size compared to intact flowers. Petals (corolla) were white to purple in colour but did not form any reproductive organs, i.e., stamens or pistils. All sterile or vegetative floral buds and abnormal flowers survived for 3 months in culture but failed to reach anthesis. PMID:18810979

  20. Distribution of 14C IAA in relation with the inhibited state of lateral buds in an aquatic fern, Marsilea drummondii

    International Nuclear Information System (INIS)

    After an apical, median or basal-6 hours application of IAA-2-14C on intact and decapitated plants of Marsilea, the characteristics of transport in relation to the inhibition of lateral buds were studied by scintillation counting and thin-layer chromatography. It is shown that: 1. Large amounts of the applied IAA are immobilized at the point of application, but radiocarbon could be detected in all parts of the intact plant: the flux of 14C is not strongly polarized basipetally. 2. After 6 hours 35% of the radioactivity are associated to the IAA molecule. A higher percentage is immobilized as IAAsp, specially in the apical bud. 3. An acropetal movement of IAA-14C is also observed. This movement is controlled by the presence of the terminal bud and the young expanding leaves, which act as sinks. 4. The 14C content of the inhibited lateral buds increases a little with time. 5. Decapitulation results in the translocation of very much higher amounts of radiocarbon in the reactivated lateral buds. The same proportion of authentic IAA is found in decapitated plants as in intact ones, but larger quantities of decarboxylation product, IAld are detected, mainly in the rhizome extracts. It is concluded that there is no direct correlation between the radioactive IAA content of the lateral buds and their inhibited state

  1. The effect of the times and the budding methods on the quality of young trees and the nursery efficiency of cherry trees cv. 'Łutówka'

    Directory of Open Access Journals (Sweden)

    Piotr Baryła

    2012-12-01

    Full Text Available The studies concerning the effect of the times and the methods of budding on the growth of young cherry trees were conducted in the years 1997-2000 at Felin Experimental Farm of Lublin Agricultural University. The objects of investigations were the young cherry trees obtained as a result of budding of mahaleb cherry (Prunus mahaleb L. and sweet cherry (Prunus avium L. seedlings in the way by the chip budding-15th July and T-budding-on the 15th July and the 1st September. The used terms and budding methods did not affect the bud taking and the quality of cherry trees during three years studies. Chip budding of the sweet cherry on the 15th July was the most effective way of this seedling budding. Late budding-on the 1st September-did not change the efficiency of the nursery only in case of mahaleb cherry. The highest number-33 000 of the young trees, average per 1 ha was got as a result of the chip and "T" mahaleb cherry budding on the 1st September.

  2. cDNA cloning of a mouse mammary epithelial cell surface protein reveals the existence of epidermal growth factor-like domains linked to factor VIII-like sequences

    International Nuclear Information System (INIS)

    A 2.1-kilobase cDNA coding for a surface protein of mammary epithelial cells has been isolated from a mouse mammary gland λgt11 cDNA library. Sequence analysis of this cDNA reveals an open reading frame of 1,389 base pairs that defines a protein with a molecular mass of 51.5 dKa. Structural analysis of the predicted sequence identifies two putative functional domains of the protein: (i) an N-terminal cysteine-rich region that is similar to epidermal growth factor-like domains of Drosophila Notch-1 protein and (ii) a large segment of the sequence that exhibited 54.5% identify with C-terminal domains of human coagulation factors VIII and V. These similarities in structure are used to predict the possible functions of the protein and its means of interaction with the cell surface. mRNA expression was detectable in mammary tissue from nonpregnant animals but was maximal in the lactating gland. In cultured cells, mRNA levels also correlated with the degree of cellular differentiation

  3. Change in Auxin and Cytokinin Levels Coincides with Altered Expression of Branching Genes during Axillary Bud Outgrowth in Chrysanthemum.

    Science.gov (United States)

    Dierck, Robrecht; De Keyser, Ellen; De Riek, Jan; Dhooghe, Emmy; Van Huylenbroeck, Johan; Prinsen, Els; Van Der Straeten, Dominique

    2016-01-01

    In the production and breeding of Chrysanthemum sp., shoot branching is an important quality aspect as the outgrowth of axillary buds determines the final plant shape. Bud outgrowth is mainly controlled by apical dominance and the crosstalk between the plant hormones auxin, cytokinin and strigolactone. In this work the hormonal and genetic regulation of axillary bud outgrowth was studied in two differently branching cut flower Chrysanthemum morifolium (Ramat) genotypes. C17 is a split-type which forms an inflorescence meristem after a certain vegetative period, while C18 remains vegetative under long day conditions. Plant growth of both genotypes was monitored during 5 subsequent weeks starting one week before flower initiation occurred in C17. Axillary bud outgrowth was measured weekly and samples of shoot apex, stem and axillary buds were taken during the first two weeks. We combined auxin and cytokinin measurements by UPLC-MS/MS with RT-qPCR expression analysis of genes involved in shoot branching regulation pathways in chrysanthemum. These included bud development genes (CmBRC1, CmDRM1, CmSTM, CmLsL), auxin pathway genes (CmPIN1, CmTIR3, CmTIR1, CmAXR1, CmAXR6, CmAXR2, CmIAA16, CmIAA12), cytokinin pathway genes (CmIPT3, CmHK3, CmRR1) and strigolactone genes (CmMAX1 and CmMAX2). Genotype C17 showed a release from apical dominance after floral transition coinciding with decreased auxin and increased cytokinin levels in the subapical axillary buds. As opposed to C17, C18 maintained strong apical dominance with vegetative growth throughout the experiment. Here high auxin levels and decreasing cytokinin levels in axillary buds and stem were measured. A differential expression of several branching genes accompanied the different hormonal change and bud outgrowth in C17 and C18. This was clear for the strigolactone biosynthesis gene CmMAX1, the transcription factor CmBRC1 and the dormancy associated gene CmDRM1, that all showed a decreased expression in C17 at floral

  4. Budding yeast cDNA sequencing project: Y031_N21_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y031_N21_F.ab1 - - - Show Y031_N21_F.ab1 Seqid Y031_N21_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCG GATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT T GATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTAT TTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCA ATAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  5. Budding yeast cDNA sequencing project: Y073_K23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y073_K23_F.ab1 - - - Show Y073_K23_F.ab1 Seqid Y073_K23_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCGG ATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT TG ATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTATT TGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCAA TAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  6. Budding yeast cDNA sequencing project: Y102_E19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_E19_F.ab1 - - - Show Y102_E19_F.ab1 Seqid Y102_E19_F.ab1 Link to SGD - Link to dbEST - Link ... _F.ab1 753 0 753 ABI GCTCTAAGCTGCTCGAGTGTAAACGACGGCCAT TACGTATTTTATACGAC TCACTATAGGGAATTCCTTAAGATTAAATGTGG ... AAACTGGATAAAAACCTTTGAA GAATTTGGAACAACCCCCACCTAAATGGCAT GGAAAAAAAGGCTTTATTT GTAAAATTTGTGAGGCTATTGCTTTATTTGT ...

  7. Budding yeast cDNA sequencing project: Y077_A07_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y077_A07_F.ab1 - - - Show Y077_A07_F.ab1 Seqid Y077_A07_F.ab1 Link to SGD - Link to dbEST - Link ... GGGGGGG GGGGGGGGGGGGGTATTCGTTTTAAAGGAATAAATTCGGGGTTTCC CCTT TCC ... Quality >Y077_A07_F.ab1 203 0 203 ABI 7 7 ...

  8. Budding yeast cDNA sequencing project: Y091_K02_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y091_K02_F.ab1 - - - Show Y091_K02_F.ab1 Seqid Y091_K02_F.ab1 Link to SGD - Link to dbEST - Link ... GNNATATACAGATATAAAAGAAGATAAATAAAATTTTTGT TTATAACCAATCC ACGAGATAAATTATTATTCATAACTTGGTTAAACTTT AAAGTGGGGGTGT ... TGACTAAGAATATATCTTACTATA ATTTATTAAAAAAAAAATAACTACCTTCC AGTATTAATATATTATTTTGT AATATCTAAAACAATATTTTTACGAAATG ... T TTTCTAAGATAAAACAAAAACTAATAATAAAATTTTTTTTTTCTTTTAAT CC AAAATTGGGAGGGGGGTGGATTTAATATCTCTATAAAAGATTTTCTTC C ... ACATACCGCATAACATAATGATTTAAA AGAGTGAGAGTATTTATAAACAATCC ATATTCC TTATATCATAATATATT TACTATACTTACACCTTAAGCTTATT ...

  9. Ubiquitin-regulated nuclear-cytoplasmic trafficking of the Nipah virus matrix protein is important for viral budding.

    Directory of Open Access Journals (Sweden)

    Yao E Wang

    Full Text Available Paramyxoviruses are known to replicate in the cytoplasm and bud from the plasma membrane. Matrix is the major structural protein in paramyxoviruses that mediates viral assembly and budding. Curiously, the matrix proteins of a few paramyxoviruses have been found in the nucleus, although the biological function associated with this nuclear localization remains obscure. We report here that the nuclear-cytoplasmic trafficking of the Nipah virus matrix (NiV-M protein and associated post-translational modification play a critical role in matrix-mediated virus budding. Nipah virus (NiV is a highly pathogenic emerging paramyxovirus that causes fatal encephalitis in humans, and is classified as a Biosafety Level 4 (BSL4 pathogen. During live NiV infection, NiV-M was first detected in the nucleus at early stages of infection before subsequent localization to the cytoplasm and the plasma membrane. Mutations in the putative bipartite nuclear localization signal (NLS and the leucine-rich nuclear export signal (NES found in NiV-M impaired its nuclear-cytoplasmic trafficking and also abolished NiV-M budding. A highly conserved lysine residue in the NLS served dual functions: its positive charge was important for mediating nuclear import, and it was also a potential site for monoubiquitination which regulates nuclear export of the protein. Concordantly, overexpression of ubiquitin enhanced NiV-M budding whereas depletion of free ubiquitin in the cell (via proteasome inhibitors resulted in nuclear retention of NiV-M and blocked viral budding. Live Nipah virus budding was exquisitely sensitive to proteasome inhibitors: bortezomib, an FDA-approved proteasome inhibitor for treating multiple myeloma, reduced viral titers with an IC(50 of 2.7 nM, which is 100-fold less than the peak plasma concentration that can be achieved in humans. This opens up the possibility of using an "off-the-shelf" therapeutic against acute NiV infection.

  10. Revealing Rembrandt

    Directory of Open Access Journals (Sweden)

    Andrew J Parker

    2014-04-01

    Full Text Available The power and significance of artwork in shaping human cognition is self-evident. The starting point for our empirical investigations is the view that the task of neuroscience is to integrate itself with other forms of knowledge, rather than to seek to supplant them. In our recent work, we examined a particular aspect of the appreciation of artwork using present-day functional magnetic resonance imaging (fMRI. Our results emphasised the continuity between viewing artwork and other human cognitive activities. We also showed that appreciation of a particular aspect of artwork, namely authenticity, depends upon the co-ordinated activity between the brain regions involved in multiple decision making and those responsible for processing visual information. The findings about brain function probably have no specific consequences for understanding how people respond to the art of Rembrandt in comparison with their response to other artworks. However, the use of images of Rembrandt’s portraits, his most intimate and personal works, clearly had a significant impact upon our viewers, even though they have been spatially confined to the interior of an MRI scanner at the time of viewing. Neuroscientific studies of humans viewing artwork have the capacity to reveal the diversity of human cognitive responses that may be induced by external advice or context as people view artwork in a variety of frameworks and settings.

  11. Effect of bud loads on mechanical composition of cluster and chemical content of must in Victoria table grape variety (Vitis Vinifera L.)

    OpenAIRE

    Delic, Mersija; Kolic, Agan; Behmen, Fikreta; Dimovska, Violeta; Matijasevic, Sasa; Rankovic-Vasic, Zorica

    2015-01-01

    The two-year experiment (2008 and 2009) on new introduced table grape variety Victoria was carried out in the commercial vineyard in the conditions of Nerezi vine district, Capljina Municipality. This study the influence of different bud load levels was investigate on grape quality of cv. Victoria under given environmental conditions. The experiment was conducted by random selection method in four variants with different bud load levels per grapevine (19, 24, 28 and 33 buds per grapevine),...

  12. Genes in the ureteric budding pathway: association study on vesico-ureteral reflux patients.

    Directory of Open Access Journals (Sweden)

    Albertien M van Eerde

    Full Text Available Vesico-ureteral reflux (VUR is the retrograde passage of urine from the bladder to the urinary tract and causes 8.5% of end-stage renal disease in children. It is a complex genetic developmental disorder, in which ectopic embryonal ureteric budding is implicated in the pathogenesis. VUR is part of the spectrum of Congenital Anomalies of the Kidney and Urinary Tract (CAKUT. We performed an extensive association study for primary VUR using a two-stage, case-control design, investigating 44 candidate genes in the ureteric budding pathway in 409 Dutch VUR patients. The 44 genes were selected from the literature and a set of 567 single nucleotide polymorphisms (SNPs capturing their genetic variation was genotyped in 207 cases and 554 controls. The 14 SNPs with p<0.005 were included in a follow-up study in 202 cases and 892 controls. Of the total cohort, ~50% showed a clear-cut primary VUR phenotype and ~25% had both a duplex collecting system and VUR. We also looked for association in these two extreme phenotype groups. None of the SNPs reached a significant p-value. Common genetic variants in four genes (GREM1, EYA1, ROBO2 and UPK3A show a trend towards association with the development of primary VUR (GREM1, EYA1, ROBO2 or duplex collecting system (EYA1 and UPK3A. SNPs in three genes (TGFB1, GNB3 and VEGFA have been shown to be associated with VUR in other populations. Only the result of rs1800469 in TGFB1 hinted at association in our study. This is the first extensive study of common variants in the genes of the ureteric budding pathway and the genetic susceptibility to primary VUR.

  13. The Relation Between Endogenous Hormones and Late-Germination in Buds of Avrolles Apple

    Institute of Scientific and Technical Information of China (English)

    QIN Dong; WANG Jin-zheng; GUO Jian-min; ZHAI Heng

    2009-01-01

    In order to provide the physiological bases for selecting late-germination cultivars that can avoid late frost damage,the very late-germination variety Avrolles (Malus domestica) was used to study the relation between the dynamic changes and balance of endogenous hormones and germination time.The concentrations of endogenous GA3,ABA,IAA,and ZR were determined in buds of Avrolles and Judeline (Malus domestica) from dormancy releasing to germination by capillary electrophoresis.The dynamic changes of endogenous hormones concentration in buds of Avrolles and Judeline were similar; but the magnitude and time of the change were significantly different between the two varieties,especially for GA3.GA3 concentration increased with dormancy releasing,then decreased,and increased again before germination in the two varieties.GA3 concentration in Avrolles was 1.72 times that in Judeline at the first peak,the gap increased to 2.22 times at germination.ZR concentration exhibited a continuous increase trend,but it decreased sharply before germination.ZR accumulation in Avrolles took 36 days longer than in Judeline,the peak value was 44% higher than in Judeline.Before germination,ZR concentration in Avrolles was 2.12 times that in Judeline.The differences between IAA and ABA concentration were relatively small in the two varieties,while the ratios of GA3/ABA and (GA3 + IAA + ZR)/ABA in Avrolles were 2.08 and 1.58 times those in Judeline,respectively.The germination of apple bud was regulated by the endogenous hormones.For the late-germination apple Avrolles,its germination requires higher concentration of GA3 and ZR,which leads to the high ratios of GA3/ABA and (GA3 + IAA + ZR)/ABA.

  14. Disruption of microtubules uncouples budding and nuclear division in Toxoplasma gondii.

    Science.gov (United States)

    Morrissette, Naomi S; Sibley, L David

    2002-03-01

    The tachyzoite stage of the protozoan parasite Toxoplasma gondii has two populations of microtubules: spindle microtubules and subpellicular microtubules. To determine how these two microtubule populations are regulated, we investigated microtubule behavior during the cell cycle following treatment with microtubule-disrupting drugs. Previous work had established that the microtubule populations are individually nucleated by two distinct microtubule-organizing centers (MTOCs): the apical polar ring for the subpellicular microtubules and spindle pole plaques/centrioles for the spindle microtubules. When replicating tachyzoites were treated with 0.5 microM oryzalin or 1.0 mM colchicine they retained the capacity to form a spindle and undergo nuclear division. Although these parasites could complete budding, they lost the bulk of their subpellicular microtubules and the ability to reinvade host cells. Both nascent spindle and subpellicular microtubules were disrupted in 2.5 microM oryzalin or 5.0 mM colchicine. Under these conditions, parasites grew in size and replicated their genome but were incapable of nuclear division. After removal from 0.5 microM oryzalin, Toxoplasma tachyzoites were able to restore normal subpellicular microtubules and a fully invasive phenotype. When oryzalin was removed from Toxoplasma tachyzoites treated with 2.5 microM drug, the parasites attempted to bud as crescent-shaped tachyzoites. Because the polyploid nuclear mass could not be correctly segregated, many daughter parasites lacked nuclei altogether although budding and scission from the maternal mass was able to be completed. Multiple MTOCs permit Toxoplasma tachyzoites to control nuclear division independently from cell polarity and cytokinesis. This unusual situation grants greater cell cycle flexibility to these parasites but abolishes the checks for coregulation of nuclear division and cytokinesis found in other eukaryotes. PMID:11870220

  15. Immunocytochemical analysis of P2X2 in rat circumvallate taste buds

    Directory of Open Access Journals (Sweden)

    Yang Ruibiao

    2012-05-01

    Full Text Available Abstract Background Our laboratory has shown that classical synapses and synaptic proteins are associated with Type III cells. Yet it is generally accepted that Type II cells transduce bitter, sweet and umami stimuli. No classical synapses, however, have been found associated with Type II cells. Recent studies indicate that the ionotropic purinergic receptors P2X2/P2X3 are present in rodent taste buds. Taste nerve processes express the ionotropic purinergic receptors (P2X2/P2X3. P2X2/P2X3Dbl−/− mice are not responsive to sweet, umami and bitter stimuli, and it has been proposed that ATP acts as a neurotransmitter in taste buds. The goal of the present study is to learn more about the nature of purinergic contacts in rat circumvallate taste buds by examining immunoreactivity to antisera directed against the purinergic receptor P2X2. Results P2X2-like immunoreactivity is present in intragemmal nerve processes in rat circumvallate taste buds. Intense immunoreactivity can also be seen in the subgemmal nerve plexuses located below the basal lamina. The P2X2 immunoreactive nerve processes also display syntaxin-1-LIR. The immunoreactive nerves are in close contact with the IP3R3-LIR Type II cells and syntaxin-1-LIR and/or 5-HT-LIR Type III cells. Taste cell synapses are observed only from Type III taste cells onto P2X2-LIR nerve processes. Unusually large, “atypical” mitochondria in the Type II taste cells are found only at close appositions with P2X2-LIR nerve processes. P2X2 immunogold particles are concentrated at the membranes of nerve processes at close appositions with taste cells. Conclusions Based on our immunofluorescence and immunoelectron microscopical studies we believe that both perigemmal and most all intragemmal nerve processes display P2X2-LIR. Moreover, colloidal gold immunoelectron microscopy indicates that P2X2-LIR in nerve processes is concentrated at sites of close apposition with Type II cells. This supports the hypothesis

  16. Pertumbuhan Bud Chips Tebu (Saccharum Officinarum L.) Pada Berbagai Lama Penyimpanan Dan Konsentrasi Natrium Nitrofenol

    OpenAIRE

    Aldhita R, Dwi

    2015-01-01

    In order to maintain the viability of seeds during bud chips are not yet ready to be planted, or in the delivery process,it is necessary to add natrium nitrophenol concentration before the storage period is expected to increase the percentage of germination and growth of sugarcane. Research conducted in the land area of PTPN II TanjungJati, District of Binjai Barat, Binjai on June to August 2014, using a randomized factorial design with two factors, a variety of storage time (24, 48, 72 h...

  17. Pickling process of capers (Capparis spp. flower buds

    Directory of Open Access Journals (Sweden)

    Özcan, Musa

    1999-04-01

    Full Text Available Middle sized (8 < x < 13 mm buds of Capparis spinosa var. spinosa and C. ovata var. canescens from June in brines containing 5,10,15 and 20% salt and from August in brines of 15% salt, and three different size (x < 8 mm, 8 < x < 13 mm, x > 13 mm buds of C. . ovata var. canescens from June in brines of 15% salt were pickled for two months fermentation. Some chemical and microbiological analyses were done in brines during fermentation. Most suitable salt concentration for lactic acid bacteria (LAB activity were 5% and partly 10%. Acidity, LAB activity, sedimentation and hardness were reduced by increasing bud size in C. ovata. Small buds of C. ovata for pickling product had advantage for colour and flavour, however, more sediment and partly softening showed disadvantage. For both species, pickling time was determined as 40 to 50 days in regard of end-product flavour and odour, brine acidity and pH, and LAB activity.

    Se encurtieron durante dos meses botones florales de tamaño medio (8 < x < 13 mm de Capparis spinosa var. spinosa y C. ovata var. canescens, los recolectados en Junio en salmueras conteniendo 5, 10, 15 y 20% de sal, y los de Agosto en salmueras de 15% de sal; y tres tamaños diferentes (x < 8 mm, 8 < x < 13 mm, X > 13 mm de C. ovata var. canescens de Junio en salmueras de 15% de sal. Se realizaron algunos análisis químicos y microbiológicos durante la fermentación. Las concentraciones de sal más adecuadas para la actividad de las bacterias del ácido láctico (LAB fueron 5% y parcialmente 10%. Acidez, actividad de LAB, sedimentación y firmeza (hardness se redujeron al incrementar el tamaño de las alcaparras de C. ovata. Los tamaños pequeños de C. ovata presentaron en el producto encurtido ventajas en color y sabor, pero desventajas por más sedimento y ablandamiento parcial. El tiempo de encurtido para ambas

  18. Gambler v Českých Budějovicích

    OpenAIRE

    NOVOTNÁ, Václava

    2009-01-01

    My thesis deals with problems of pathology of gambling, both its causes as well as its consequences. Theoretic part describes pathology of gamgling and its impact on family life as well as on whole society. History of gambling machines and gambling club chains are also mentioned. Records of criminality are gained from POLICE of the Czech Republic. Amount of money for town České Budějovice earned in year 2008 by gambling machines is introduced in theoretic part. Further I describe therapy, pre...

  19. In-vitro radiosensitivity and rapid propagation of potato through axillary bud culture

    International Nuclear Information System (INIS)

    The axillary buds of two varieties of potato, Cardinal and Ultimus, were cultured on MS medium supplemented with different concentrations and combinations of cytokinins, auxin and GA3 for their rapid propagation. The results indicated that combination: kinetin 0.5 + NAA 0.1 + GA3 0.5 mg/l proved to be the best for regeneration of maximum number of plantlets. Moreover, the mortality rates at 30 Gray dose in the varieties Cardinal and Ultimus were 41.6 and 58.3 percent respectively and hence this dose was considered to be the optimum for further mutation experiments in potato

  20. Soluble proteins and polyphenoloxidase activity in bud flowers, flowers and leaves of cold stored lisianthus

    DEFF Research Database (Denmark)

    Cavasini, R.; Nunes, K.N.M.; Favero, B.T.;

    This study evaluated the activity of the enzyme polyphenol oxidase (PPO) and the content of soluble protein present in lisianthus bud flowers, flowers and leaves in room temperature (24±2°C) and pre-exposure cold chamber at 9±2°C for 24 h, in order to examine a possible correlation between these...... parameters and postharvest longevity of lisianthus flowers. After treatments, flowers were kept in pots with water, stored at room temperature and evaluated every three days until the end of their decorative life for biochemical analyzes. During the experimental period the enzymatic activity increased with...

  1. MICROPROPAGATION OF BLACK TURMERIC (CURCUMA CAESIA ROXB.) THROUGH IN VITRO CULTURE OF RHIZOME BUD EXPLANTS

    OpenAIRE

    Muhammad Shahinozzaman; Molla Ferdous; Muhammad Faruq; Mustafa Azad; Muhammad Amin

    2013-01-01

    In the present study, preliminary in vitro shoots propagation of Curcuma caesia Roxb. was investigated. Rhizome buds were used as explants and were cultured on Murashige and Skoog MS medium containing 6 Benzyl adenine BA alone or in combination with a Naphthalene acetic acid NAA. The results showed that the optimum shoot proliferation was obtained from MS medium containing 3.0 micro M BA + 0.5 micro M NAA. In this growth regulator combination, maximum 99.97 per cent explants produced 10.38 sh...

  2. Differences between the Bud End and Stem End of Potatoes in Dry Matter Content, Starch Granule Size, and Carbohydrate Metabolic Gene Expression at the Growing and Sprouting Stages.

    Science.gov (United States)

    Liu, Bailin; Zhang, Guodong; Murphy, Agnes; De Koeyer, David; Tai, Helen; Bizimungu, Benoit; Si, Huaijun; Li, Xiu-Qing

    2016-02-10

    Potatoes usually have the tuber bud end dominance in growth during tuber bulking and in tuber sprouting, likely using carbohydrates from the tuber stem end. We hypothesized that the tuber bud end and tuber stem end coordination in carbohydrate metabolism gene expression is different between the bulking dominance and sprouting dominance of the tuber bud end. After comparing the growing tubers at harvest from a green vine and the stage that sprouts just started to emerge after storage of tubers at room temperature, we found the following: (1) Dry matter content was higher in the tuber stem end than the tuber bud end at both stages. (2) The starch granule size was larger in the tuber bud end than in the tuber stem end. (3) The tuber bud end had higher gene expression for starch synthesis but a lower gene expression of sucrose transporters than the tuber stem end during tuber growing. (4) The tuber stem end at the sprouting stage showed more active gene expression in both starch degradation and resynthesis, suggesting more active export of carbohydrates, than the tuber bud end. The results indicate that the starch accumulation mechanism in the tuber bud end was different between field growing and post-harvest sprouting tubers and that tubers already increased dry matter and average starch granule sizes in the tuber bud end prior to the rapid growth of sprouts. PMID:26760673

  3. Bimolecular Complementation to Visualize Filovirus VP40-Host Complexes in Live Mammalian Cells: Toward the Identification of Budding Inhibitors

    Directory of Open Access Journals (Sweden)

    Yuliang Liu

    2011-01-01

    Full Text Available Virus-host interactions play key roles in promoting efficient egress of many RNA viruses, including Ebola virus (EBOV or “e” and Marburg virus (MARV or “m”. Late- (L- domains conserved in viral matrix proteins recruit specific host proteins, such as Tsg101 and Nedd4, to facilitate the budding process. These interactions serve as attractive targets for the development of broad-spectrum budding inhibitors. A major gap still exists in our understanding of the mechanism of filovirus budding due to the difficulty in detecting virus-host complexes and mapping their trafficking patterns in the natural environment of the cell. To address this gap, we used a bimolecular complementation (BiMC approach to detect, localize, and follow the trafficking patterns of eVP40-Tsg101 complexes in live mammalian cells. In addition, we used the BiMC approach along with a VLP budding assay to test small molecule inhibitors identified by in silico screening for their ability to block eVP40 PTAP-mediated interactions with Tsg101 and subsequent budding of eVP40 VLPs. We demonstrated the potential broad spectrum activity of a lead candidate inhibitor by demonstrating its ability to block PTAP-dependent binding of HIV-1 Gag to Tsg101 and subsequent egress of HIV-1 Gag VLPs.

  4. Effect of Photoperiod Treatments on Dormancy Induction and Changes in Correlated Respiratory Rate of Nectarine Peach Bud

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The responses of dormancy induction to illumination and the characteristics of respiratory rate were studied with the nectarine peach bud in this article. The trial was conducted with nectarine (Prunus persica vat. nectariana cv. Shuguang) and involved three treatments: a short day treatment (8 h), a long day treatment (16 h), and the normal condition as the control. The dormancy status was determined with the growth of shoot and the sprouting ability, and the respiratory rate was mensurated with oxygen electrode. Short day treatment could induce the growth stopping of peach shoots ahead, promote the development of dormancy, and induce buds into dormancy with 21 d previous to control. Long day treatment postponed the growth stopping and the induction and development of dormancy. The respiratory rate decreased according to the development of dormancy induction. The minimum respiratory rate appeared about 7 days after the start of dormancy induction. Bud respiratory rate increased during this period and then declined and remained at low level during dormancy period. Long day reduced buds respiratory rate slightly. Short day could induce dormancy obviously, and long day postponed dormancy induction. The changes of respiratory rate were correlated with the development of dormancy induction, and the bud respiratory rate was also affected by photoperiod.

  5. Relation of bud dormancy to carbohydrate metabolism in Cerasus humilis (Bge.) Sok.%休眠期欧李碳水化合物代谢与休眠关系的分析

    Institute of Scientific and Technical Information of China (English)

    李秀珍; 陈苏丹; 李天忠

    2012-01-01

    This paper is concerned on the relation of bud dormancy to carbohydrate metabolism, The annual shoots from underground stem was used as the experimental materials. The components of carbohydrates and the enzymes activities were measured in phloem and bud of dormant Cerasus humilis (Bge.) Sok. The results indicated that soluble sugar content was higher than starch in phloem and bud in dormancy period. The highest ratio of soluble sugar and starch reached to 4.77. Most sugar was sucrose and then fructose, sorbitol and glucose. A few amount of fructose in bud were detected in natural dormancy stage. But its content increased rapidly in enhanced dormancy stage and in germination period,reaching to 2.05% in germination period. The changes in enzyme activities in phloem and bud were in line with that of soluble sugar. The activity of SPS was higher than that of other enzymes, but quickly decreased in natural dormancy stage,and reached to minimum at the end of the natural dormancy. The reduction in bud and phloem was 94. 18% and 84.78% respectively. The activity of p-amylase was higher that of a-amylase. Based on the integrated analyses above,the main accumulated carbohydrate in dormant Chinese dwarf cherry was soluble sugar. The relief of natural dormancy was obviously linked with the change of sucrose and reduction of the SPS activity. Change in the fructose contents was related to the dormancy and germination of bud.%为探讨休眠期欧李碳水化合物代谢与休眠的关系,以休眠期欧李1年生基生枝为试材,采用气相色谱等方法,分析了韧皮部、芽中碳水化合物含量及其相关酶活性变化。结果表明:休眠阶段欧李韧皮部和芽中可溶性糖含量均高于淀粉,二者比值最高可达4.77,其中含量最高的为蔗糖,其次是果糖、山梨醇和葡萄糖;自然休眠期芽中检查不到果糖含量,但在被迫休眠期和芽萌动期迅速增加,至芽萌动期质量分数达2.05%;休眠期韧皮部和芽中

  6. Budding yeast cDNA sequencing project: Y102_P06_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_P06_F.ab1 - - - Show Y102_P06_F.ab1 Seqid Y102_P06_F.ab1 Link to SGD - Link to dbEST - Link ... TTGACTGNNGCGTGTGTT GAGGTGGGGGGGAGGGAAATTATAAAAGAGGATCC GGGGAGAGGGGGGTT TCTCC ANTTNTTNGGNGNNNNNNNNNNNNNNNCNT ... NANNNNNNNTGTTTTAGGGGGGGGGG AGACTTTTTTTTGGGGGGGTTTTTTCC CCCCAAAAAAAAAAATTTTTGTG TGTGGGCCCCCCCCCCACCGGGGGAAA ... AAAAAATTTTTTTTAAAAAAGGG GGGGGTTTTTTTTTTTTCC CCCCGCGGGGAAAAAAAAAAAAAAAAAGCCC TCTTTTTTTTTTTTGGAGG ... TTAAATAAACCCCCCGCCAACCCCCCCCGGGAGGTTTTTGGGCGCCCCTT TCC ... Quality >Y102_P06_F.ab1 653 0 653 ABI 12 12 12 12 ...

  7. New Flavonol Glucuronides from the Flower Buds of Syzygium aromaticum (Clove).

    Science.gov (United States)

    Ryu, Byeol; Kim, Hye Mi; Lee, Jin Su; Lee, Chan Kyu; Sezirahiga, Jurdas; Woo, Jeong-Hwa; Choi, Jung-Hye; Jang, Dae Sik

    2016-04-20

    Repeated chromatography of the EtOAc-soluble fraction from the 70% EtOH extract of the flower buds of Syzygium aromaticum (clove) led to the isolation and characterization of four new flavonol glucuronides, rhamnetin-3-O-β-d-glucuronide (1), rhamnazin-3-O-β-d-glucuronide (2), rhamnazin-3-O-β-d-glucuronide-6″-methyl ester (3), and rhamnocitrin-3-O-β-d-glucuronide-6″-methyl ester (4), together with 15 flavonoids (5-19) having previously known chemical structures. The structures of the new compounds 1-4 were determined by interpretation of spectroscopic data, particularly by 1D- and 2D-NMR studies. Six flavonoids (6, 7, 9, 14, 18, and 19) were isolated from the flower buds of S. aromaticum for the first time in this study. The flavonoids were examined for their cytotoxicity against human ovarian cancer cells (A2780) using MTT assays. Among the isolates, pachypodol (19) showed the most potent cytotoxicity on A2780 cells with an IC50 value of 8.02 μM. PMID:27045836

  8. Misexpression of Pknox2 in mouse limb bud mesenchyme perturbs zeugopod development and deltoid crest formation.

    Science.gov (United States)

    Zhou, Wenrong; Zhu, Huang; Zhao, Jianzhi; Li, Hanjun; Wan, Yong; Cao, Jingjing; Zhao, Haixia; Yu, Jian; Zhou, Rujiang; Yao, Yiyun; Zhang, Lingling; Wang, Lifang; He, Lin; Ma, Gang; Yao, Zhengju; Guo, Xizhi

    2013-01-01

    The TALE (Three Amino acid Loop Extension) family consisting of Meis, Pbx and Pknox proteins is a group of transcriptional co-factors with atypical homeodomains that play pivotal roles in limb development. Compared to the in-depth investigations of Meis and Pbx protein functions, the role of Pknox2 in limb development remains unclear. Here, we showed that Pknox2 was mainly expressed in the zeugopod domain of the murine limb at E10.5 and E11.5. Misexpression of Pknox2 in the limb bud mesenchyme of transgenic mice led to deformities in the zeugopod and forelimb stylopod deltoid crest, but left the autopod and other stylopod skeletons largely intact. These malformations in zeugopod skeletons were recapitulated in mice overexpressing Pknox2 in osteochondroprogenitor cells. Molecular and cellular analyses indicated that the misexpression of Pknox2 in limb bud mesenchyme perturbed the Hox10-11 gene expression profiles, decreased Col2 expression and Bmp/Smad signaling activity in the limb. These results indicated that Pknox2 misexpression affected mesenchymal condensation and early chondrogenic differentiation in the zeugopod skeletons of transgenic embryos, suggesting Pknox2 as a potential regulator of zeugopod and deltoid crest formation. PMID:23717575

  9. Misexpression of Pknox2 in mouse limb bud mesenchyme perturbs zeugopod development and deltoid crest formation.

    Directory of Open Access Journals (Sweden)

    Wenrong Zhou

    Full Text Available The TALE (Three Amino acid Loop Extension family consisting of Meis, Pbx and Pknox proteins is a group of transcriptional co-factors with atypical homeodomains that play pivotal roles in limb development. Compared to the in-depth investigations of Meis and Pbx protein functions, the role of Pknox2 in limb development remains unclear. Here, we showed that Pknox2 was mainly expressed in the zeugopod domain of the murine limb at E10.5 and E11.5. Misexpression of Pknox2 in the limb bud mesenchyme of transgenic mice led to deformities in the zeugopod and forelimb stylopod deltoid crest, but left the autopod and other stylopod skeletons largely intact. These malformations in zeugopod skeletons were recapitulated in mice overexpressing Pknox2 in osteochondroprogenitor cells. Molecular and cellular analyses indicated that the misexpression of Pknox2 in limb bud mesenchyme perturbed the Hox10-11 gene expression profiles, decreased Col2 expression and Bmp/Smad signaling activity in the limb. These results indicated that Pknox2 misexpression affected mesenchymal condensation and early chondrogenic differentiation in the zeugopod skeletons of transgenic embryos, suggesting Pknox2 as a potential regulator of zeugopod and deltoid crest formation.

  10. Trp53 activity is repressed in radio-adapted cultured murine limb bud cells

    International Nuclear Information System (INIS)

    Understanding the effects of ionizing radiation (IR) at low dose in fetal models is of great importance, because the fetus is considered to be at the most radiosensitive stage of the development and prenatal radiation might influence subsequent development. We previously demonstrated the existence of an adaptive response (AR) in murine fetuses after pre-exposure to low doses of X-rays. Trp53-dependent apoptosis was suggested to be responsible for the teratogenic effects of IR; decreased apoptosis was observed in adapted animals. In this study, in order to investigate the role of Trp53 in AR, we developed a new model of irradiated micromass culture of fetal limb bud cells, which replicated proliferation, differentiation and response to IR in murine embryos. Murine fetuses were exposed to whole-body priming irradiation of 0.3 Gy or 0.5 Gy at embryonic day 11 (E11). Limb bud cells (collected from digital ray areas exhibiting radiation-induced apoptosis) were cultured and exposed to a challenging dose of 4 Gy at E12 equivalent. The levels of Trp53 protein and its phosphorylated form at Ser18 were investigated. Our results suggested that the induction of AR in mouse embryos was correlated with a repression of Trp53 activity. (author)

  11. Interactions Between the Bud Rot Disease of Oil Palm and Rhynchophorus palmarum (Coleoptera: Curculionidae).

    Science.gov (United States)

    Plata-Rueda, Angelica; Martínez, Luis Carlos; Fernandes, Flávio Lemes; de Sousa Ramalho, Francisco; Zanuncio, José Cola; Serrão, José Eduardo

    2016-04-01

    Rhynchophorus palmarum (L.) causes great losses to the oil palm plantations, and therefore, the spatial and temporal distribution of this insect should be studied, to manage its populations. Insect sampling was done for 2 yr in an oil palm plantation from Colombia. In total, 60 pheromone traps were used in healthy palm trees and infected ones with the Bud Rot disease. On the other hand, developmental stages of this insect were quantified on healthy and diseased palms for two consecutive years. Number of adult R. palmarum per sampling was higher in the plantation with diseased palm trees, 3.85 and 74.7 insects per trap, than in those with healthy ones, 1.91 and 9.48 insects per trap, in the first and second years, respectively. After the integration of pheromone traps, there was a significant increase in the infestation level at all stages of development of the insect. For the first time, the presence of R. palmarum attracted to diseased palms is reported. The association between R. palmarum and the Bud Rot disease is a cause of death and great loss to the oil palm plantations. PMID:26791821

  12. Identification and analysis of phosphorylation status of proteins in dormant terminal buds of poplar

    Directory of Open Access Journals (Sweden)

    Liu Chang-Cai

    2011-11-01

    Full Text Available Abstract Background Although there has been considerable progress made towards understanding the molecular mechanisms of bud dormancy, the roles of protein phosphorylation in the process of dormancy regulation in woody plants remain unclear. Results We used mass spectrometry combined with TiO2 phosphopeptide-enrichment strategies to investigate the phosphoproteome of dormant terminal buds (DTBs in poplar (Populus simonii × P. nigra. There were 161 unique phosphorylated sites in 161 phosphopeptides from 151 proteins; 141 proteins have orthologs in Arabidopsis, and 10 proteins are unique to poplar. Only 34 sites in proteins in poplar did not match well with the equivalent phosphorylation sites of their orthologs in Arabidopsis, indicating that regulatory mechanisms are well conserved between poplar and Arabidopsis. Further functional classifications showed that most of these phosphoproteins were involved in binding and catalytic activity. Extraction of the phosphorylation motif using Motif-X indicated that proline-directed kinases are a major kinase group involved in protein phosphorylation in dormant poplar tissues. Conclusions This study provides evidence about the significance of protein phosphorylation during dormancy, and will be useful for similar studies on other woody plants.

  13. Astral microtubule pivoting promotes their search for cortical anchor sites during mitosis in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stephan Baumgärtner

    Full Text Available Positioning of the mitotic spindle is crucial for proper cell division. In the budding yeast Saccharomyces cerevisiae, two mechanisms contribute to spindle positioning. In the Kar9 pathway, astral microtubules emanating from the daughter-bound spindle pole body interact via the linker protein Kar9 with the myosin Myo2, which moves the microtubule along the actin cables towards the neck. In the dynein pathway, astral microtubules off-load dynein onto the cortical anchor protein Num1, which is followed by dynein pulling on the spindle. Yet, the mechanism by which microtubules target cortical anchor sites is unknown. Here we quantify the pivoting motion of astral microtubules around the spindle pole bodies, which occurs during spindle translocation towards the neck and through the neck. We show that this pivoting is largely driven by the Kar9 pathway. The microtubules emanating from the daughter-bound spindle pole body pivot faster than those at the mother-bound spindle pole body. The Kar9 pathway reduces the time needed for an astral microtubule inside the daughter cell to start pulling on the spindle. Thus, we propose a new role for microtubule pivoting: By pivoting around the spindle pole body, microtubules explore the space laterally, which helps them search for cortical anchor sites in the context of spindle positioning in budding yeast.

  14. Mutation breeding of Chrysanthemum morifolium Ram. using in vivo and in vitro adventitious bud techniques

    International Nuclear Information System (INIS)

    During experiments, which are being carried out to study the factors which control the process of adventitious bud formation in vivo on detached leaves of Chrysantemum morifolium RAM, adventitious shoots were produced from leaves, irradiated with 500 rad of X-rays. The most important but disadvantageous result was that the majority of the adventitious shoots proved to be of a chimeral nature and obviously developed from more than one cell. An in vitro adventitious bud technique was developed using different types of explants. Pedicel segments regenerated the highest number of adventitious shoots and, moreover, they developed faster as compared to explants of young flower heads or leaves. The mutants produced by irradiating the various explants were almost exclusively of a solid (non-chimeral) nature. In addition, histological observations suggest that single epidermal cells are involved in the initiation of the adventitious shoot apices. The optimum dose for mutant production is approximately 800 rad X-rays. Rather often, more than one phenotypically identical mutant was found, which was always derived from the same explant. They could for instance originate from a multi-apical meristem formed by a single mutated cell

  15. Curcumin inhibits cellular condensation and alters microfilament organization during chondrogenic differentiation of limb bud mesenchymal cells.

    Science.gov (United States)

    Kim, Dong Kyun; Kim, Song Ja; Kang, Shin Sung; Jin, Eun Jung

    2009-09-30

    Curcumin is a well known natural polyphenol product isolated from the rhizome of the plant Curcuma longa, anti-inflammatory agent for arthritis by inhibiting synthesis of inflammatory prostaglandins. However, the mechanisms by which curcumin regulates the functions of chondroprogenitor, such as proliferation, precartilage condensation, cytoskeletal organization or overall chondrogenic behavior, are largely unknown. In the present report, we investigated the effects and signaling mechanism of curcumin on the regulation of chondrogenesis. Treating chick limb bud mesenchymal cells with curcumin suppressed chondrogenesis by stimulating apoptotic cell death. It also inhibited reorganization of the actin cytoskeleton into a cortical pattern concomitant with rounding of chondrogenic competent cells and down-regulation of integrin beta1 and focal adhesion kinase (FAK) phosphorylation. Curcumin suppressed the phosphorylation of Akt leading to Akt inactivation. Activation of Akt by introducing a myristoylated, constitutively active form of Akt reversed the inhibitory actions of curcumin during chondrogenesis. In summary, for the first time, we describe biological properties of curcumin during chondrogenic differentiation of chick limb bud mesenchymal cells. Curcumin suppressed chondrogenesis by stimulating apoptotic cell death and down-regulating integrin-mediated reorganization of actin cytoskeleton via modulation of Akt signaling. PMID:19478554

  16. Ingression Progression Complexes Control Extracellular Matrix Remodelling during Cytokinesis in Budding Yeast

    Science.gov (United States)

    Foltman, Magdalena; Molist, Iago; Arcones, Irene; Sacristan, Carlos; Filali-Mouncef, Yasmina; Roncero, Cesar; Sanchez-Diaz, Alberto

    2016-01-01

    Eukaryotic cells must coordinate contraction of the actomyosin ring at the division site together with ingression of the plasma membrane and remodelling of the extracellular matrix (ECM) to support cytokinesis, but the underlying mechanisms are still poorly understood. In eukaryotes, glycosyltransferases that synthesise ECM polysaccharides are emerging as key factors during cytokinesis. The budding yeast chitin synthase Chs2 makes the primary septum, a special layer of the ECM, which is an essential process during cell division. Here we isolated a group of actomyosin ring components that form complexes together with Chs2 at the cleavage site at the end of the cell cycle, which we named ‘ingression progression complexes’ (IPCs). In addition to type II myosin, the IQGAP protein Iqg1 and Chs2, IPCs contain the F-BAR protein Hof1, and the cytokinesis regulators Inn1 and Cyk3. We describe the molecular mechanism by which chitin synthase is activated by direct association of the C2 domain of Inn1, and the transglutaminase-like domain of Cyk3, with the catalytic domain of Chs2. We used an experimental system to find a previously unanticipated role for the C-terminus of Inn1 in preventing the untimely activation of Chs2 at the cleavage site until Cyk3 releases the block on Chs2 activity during late mitosis. These findings support a model for the co-ordinated regulation of cell division in budding yeast, in which IPCs play a central role. PMID:26891268

  17. Micropropagation of Codiaeum variegatum (L.) Blume and regeneration induction via adventitious buds and somatic embryogenesis.

    Science.gov (United States)

    Radice, Silvia

    2010-01-01

    Codiaeum variegatum (L) Blume cv. "Corazon de oro" and cv. "Norma" are successfully micropropagated when culture are initiated with explants taken from newly sprouted shoots. The establishment and multiplication steps are possible when 1 mg/L BA or 1 mg/L IAA and 3 mg/L 2iP are added to MS medium, according to the cultivar respectively selected.Adventive organogenesis and somatic embryogenesis are induced from leaf explants taken from in vitro buds of croton. On leaf-sectioned of "Corazon de oro" cultured in vitro, 1 mg/L BA stimulates continuous somatic embryos development and induces some shoots too. Replacing BA with 1 mg/L TDZ induces up to 100% bud regeneration in the same explants. On the other hand, leaf-sectioned of C. variegatum cv. Norma does not start somatic embryo differentiation if 1 mg/L TDZ is not added to the MS basal medium. Incipient callus is observed after 30 days of culture, and then, subculture to MS with 1 mg/L BA allows the same process to show on the "Corazon de oro" cultivar. Somatic embryos show growth arrest that is partially overcome by transfer to hormone-free basal medium with activated charcoal. Root induction is possible on basal medium plus 1 mg/L IBA. Plantlets in the greenhouse have variegated leaves true-to-type. PMID:20099102

  18. Polymorphic butterfly reveals the missing link in ecological speciation

    OpenAIRE

    Chamberlain, Nicola L; Hill, Ryan I.; Kapan, Durrell D.; Gilbert, Lawrence E.; Kronforst, Marcus R.

    2009-01-01

    Ecological speciation occurs when ecologically-based divergent selection causes the evolution of reproductive isolation. While there are many empirical examples of this process, there exists a poorly characterized stage during which the traits that distinguish species ecologically and reproductively segregate in a single population. Using a combination of genetic mapping, mate choice experiments, field observations, and population genetics, we studied a butterfly population with a mimetic win...

  19. A Study of Some Chemical Changes in Onion Bulbs and Their Inner Buds as Affected by Gamma Radiation and Storage

    International Nuclear Information System (INIS)

    With the aim of detecting the break of dormancy and of investigating the effects of gamma irradiation at the 5 krad dose level, the length of inner buds and the content of vitamin C, reducing and total sugars of Makó onion bulbs and their inner buds were determined periodically during storage at 0 to 4°C. A temporary increase in vitamin C content was detected shortly before the inner buds started to grow. The vitamin C content was considerably higher in the growing buds than that in the whole bulbs. Both reducing and non-reducing sugars increased gradually during the dormancy period and levelled off after the break in dormancy. Irradiation of onions before the break in dormancy resulted in much stronger sprout inhibition than radiation treatment during the non-dormant stage. Inner buds of onions irradiated after the break of dormancy tended to darken during post-irradiation storage. Bulbs radiation-treated in the dormant stage resulted in an onion powder of a lighter colour on drying than onions untreated or radiation-treated at the non-dormant stage. The vitamin C, reducing and nonreducing sugar contents and the amino acid composition of the onion flesh and the inner buds were investigated in the final stage of storage, 8 to 10 months after harvest. Compositional differences found between irradiated and untreated onions seem to be of no nutritional significance. Free radicals formed in the outer scales of onions by irradiation diminished within 96 hours at room temperature. (author)

  20. Linked data management

    CERN Document Server

    Hose, Katja; Schenkel, Ralf

    2014-01-01

    Linked Data Management presents techniques for querying and managing Linked Data that is available on today’s Web. The book shows how the abundance of Linked Data can serve as fertile ground for research and commercial applications. The text focuses on aspects of managing large-scale collections of Linked Data. It offers a detailed introduction to Linked Data and related standards, including the main principles distinguishing Linked Data from standard database technology. Chapters also describe how to generate links between datasets and explain the overall architecture of data integration systems based on Linked Data. A large part of the text is devoted to query processing in different setups. After presenting methods to publish relational data as Linked Data and efficient centralized processing, the book explores lookup-based, distributed, and parallel solutions. It then addresses advanced topics, such as reasoning, and discusses work related to read-write Linked Data for system interoperation. Desp...

  1. Spamming in Linked Data

    OpenAIRE

    Hasnain, Ali; Al-Bakri, Mustafa; Costabello, Luca; Cong, Zijie; Davis, Ian; Heath, Tom

    2012-01-01

    The rapidly growing commercial interest in Linked Data raises the prospect of "Linked Data spam", which we define as "deliberately misleading information (data and links) published as Linked Data, with the goal of creating financial gain for the publisher". Compared to conventional technologies affected by spamming, e.g. email and blogs, spammers targeting Linked Data may not be able to push information directly towards consumers, but rather may seek to exploit a lack of human involvement in ...

  2. Tissue culture of horse-radish (Cochlearia armoracia L. meristems: sterilization of buds and comparison of media

    Directory of Open Access Journals (Sweden)

    K. Górecka

    2015-06-01

    Full Text Available The attempt was made to cultivate horse-radish meristems taken from buds removed from roots. The lowest per cent of contamination was found after the buds had been soaiked in 80% ethanol for 6 minutes and then in 5%, 7.5% or 10% chloramine for 30, 30 or 15 minutes, respectively. Both agar media: Murashige-Skoog and Linsmaier-Skoog, were equally good, providing a moderate number of developing plants. The Linsmaier-Skoog medium was more satisfactory when solidified with agar; the results with liquid medium and filter-paper bridges were not as good.

  3. Determination of the Effects of Endogenous Plant Hormones on alternate Bearing and Flower Bud Formation in Olives

    OpenAIRE

    ÜLGER, Salih; İbrahim BAKTIR; KAYNAK, Lami

    1998-01-01

    The effect of endogenous plant hormones on alternate-bearing, an important factor in olive growing, was investigated. Memecik and Tavşan Türeği olive cultivars were used. Leaf, bud, shoot tip and fruit samples were taken monthly during fruiting and non-fruiting periods for two years. Changes in ABA, GA3 and IAA were found and the effect of these hormones on the initiation of budding was determined. The results of the experiment showed that there were statistically important significances in ...

  4. Vývoj mapového obrazu města České Budějovice

    OpenAIRE

    Charvát, Josef

    2011-01-01

    This thesis deals with the historical development of the city České Budějovice and some old maps of Bohemia edited in the period of 1518 - 1847. During data processing of these maps I compare the locations of some chosen South Bohemian cities of one old map with another and with their real location. The next part of the thesis is devoted to the way of displaying the city České Budějovice in each map. Used old maps: Claudian map (1518), Münster maps (1550, 1570), Ortelius map (17th century), M...

  5. Consulting Centre for Substance Using Prevention in the Remand Prison in České Budějovice

    OpenAIRE

    ŠPÍRKOVÁ, Martina

    2012-01-01

    The thesis deals with the activities provided by the centre for drug prevention in the Remand Prison in České Budějovice. The theoretical part maps out the current drug issues within the society, the existing Czech prison system and the current drug issues in prisons observed. The practical part is focused on direct investigation of the activities provided by the centre for drug prevention in the Remand Prison in České Budějovice and clarification of what the prisoners have expected from this...

  6. Cestovní ruch a rekreace v Českých Budějovicích

    OpenAIRE

    KOPÁČEK, Milan

    2011-01-01

    The aim of the bachelor thesis is to describe tourim and recreation in České Budějovice and his nearest surroundings. Further work assessment the structure of assumtion for tourism in this area, it was research, what attractiveness offer research area for visitors. This thesis devote problems of the visitor´s relationship to the environment of visited places. Thanks to questionnaire is to evaluate the structure of the present visitors on three research areas in České Budějovice. Last aim of t...

  7. Linking numbers for handlebody-links

    OpenAIRE

    Mizusawa, Atsuhiko

    2013-01-01

    As a generalization of the linking number, we construct a set of invariant numbers for two-component handlebody-links. These numbers are elementary divisors associated with the natural homomorphism from the first homology group of a component to that of the complement of another component.

  8. 低温对芦笋萌芽及其激素含量的影响%Effect of Low Temperature on Bud Break and Changes of Endogenous Hormones of Asparagus

    Institute of Scientific and Technical Information of China (English)

    苗金龙; 乜兰春; 石立哲; 高飞; 贾丽丽

    2011-01-01

    以芦笋'Applo'为试材,在河北保定研究了低温对其萌芽及内源激素含量变化的影响.结果表明:自然条件下,芦笋在10月30日保温,仍可迅速萌芽生长;但11月14日和11月29日保温,萌芽数和采笋数显著减少;而在12月14日或之后保温,萌芽数与10月30日保温无显著差异,采笋数显著多于10月30日保温.说明芦笋在低温作用下一旦进入休眠阶段,需要满足一定的低温积累量,才能在保温后恢复正常生长.不同低温处理表明,2℃30 d或5℃45 d可满足'Applo'对低温的需求.芦笋在经历自然低温和低温处理过程中,鳞芽中GA3、IAA、ZR含量相对稳定,ABA含量先上升后又迅速下降,ABA含量变化与与芦笋休眠及休眠解除有密切关系.%Three-year-old plants of ‘Applo' were used to study the effect of low temperature on bud break and changes of endogenous hormones in bud of asparagus (Asparagus officinalis Linn) . The results showed that asparagus plant showed rapid bud break and spear growth when it was incubated on Oct. 30.But when it was incubated on Nov. 14 or 29, bud break and spear harvest decreased. While when it was incubated on Dec. 14 or later, the bud break had no difference with that incubated on Oct. 30, but spear harvest increased. These results suggested that once asparagus plants underwent the period of dormancy induced by the chilling in winter, they needed sufficient chilling duration to restore the activity of bud break and spear growth. The experiment of different low temperature treatment revealed that 2 ℃ 30 d or 5 ℃ 45 d could sastify the chilling duration of‘Applo'. During natural or treated chilling period, the content of GA3, IAA and ZR in bud of asparagus was relatively stable, but the content of ABA increased during dormancy stage, and then decreased rapidly to a lower level. The changes of ABA content had close relationship with dormancy and dormancy-breaking of asparagus.

  9. Cryptic speciation within Phytoptus avellanae s.l. (Eriophyoidea: Phytoptidae) revealed by molecular data and observations on molting Tegonotus-like nymphs.

    Science.gov (United States)

    Cvrković, Tatjana; Chetverikov, Philipp; Vidović, Biljana; Petanović, Radmila

    2016-01-01

    Hazelnut big bud mite, Phytoptus avellanae Nalepa, is one of the most harmful pests of Corylus spp. (Corylaceae) worldwide. Herein, we show that this species represents a complex of two cryptic species: one that lives and reproduces in buds causing their enlargement ('big buds') and drying, whereas the other is a vagrant living on leaves, under bud scales and in catkins, based on phylogenetic analyzes of mitochondrial cytochrome c oxidase subunit I (COI) DNA and the nuclear D2 region of 28S rDNA sequences. A molecular assessment based on mtCOI DNA and nuclear D2 28S rDNA revealed consistent differences of 16.8 and 3.5% between the two species, respectively. Molecular analysis also revealed that atypical flattened nymphs (Tegonotus-like nymphs sensu Keifer in Mites Injurious to Economic Plants, University of California Press, Berkeley, pp 327-562, 1975) with differently annulated opisthosoma, which appear in the life cycle of P. avellanae s.l., belong to the 'vagrant' lineage, i.e. vagrant cryptic species. Light microscopy images of Tegonotus-like nymphs molting into males and females are presented for the first time. Our results suggest that the name P. avellanae comprise two species. Big bud mite should keep the name P. avellanae, and the vagrant cryptic species should be re-named after a proper morphological description is made. PMID:26530992

  10. High floral bud abscission and lack of open flower abscission in Dendrobium cv. Miss Teen: rapid reduction of ethylene sensitivity in the abscission zone

    NARCIS (Netherlands)

    Bunya-atichart, K.; Ketsa, S.; Doorn, van W.G.

    2006-01-01

    We studied the abscission of floral buds and open flowers in cut Dendrobium inflorescences. Abscission of floral buds was high and sensitive to ethylene in all cultivars studied. Many open flowers abscised in most cultivars, but cv. Willie exhibited only small amount of floral fall and cv. Miss Teen

  11. Effect of gamma irradiated parenchyma on the growth of irradiated potato tuber buds; Efecto del parenquina irradiado sobre el desarrollo de las yemas de tuberculos de patata tratados por radiacion GAMMA

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Gonzalez, J.; Garcia Collantes, M. A.

    1976-07-01

    The development of buds greffed on irradiated potato parenchyma was studied. The irradiated parenchyma does not influence the sprouting capacity of buds, but it affects the way they develop. (Author) 9 refs.

  12. Budding yeast cDNA sequencing project: Y074_N01_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y074_N01_F.ab1 - - - Show Y074_N01_F.ab1 Seqid Y074_N01_F.ab1 Link to SGD - Link to dbEST - Link ... to UC SC ... Genome Browser - Sequenc e >Y074_N01_F.ab1 301 0 ... 301 ABI GAACCCC AACCCCC AAAAAAGGC ATC AGGNATTCC GAAAC AC ACCCCC AA CC AC C AAAC AC ACC AAC ACC AAC AAC AAC AC AC AC AAC AAACCC ACCCCC ... AAAAAAAAC ... AC ACCC AC AC AACCCC AAAC AC AAC AAAC AC AAAAAAAC AA AAAAACC AC AA ...

  13. ultrastructural study of limb bud development in green turtles chelonia mydas

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    morphological changes during the embryonic development of limbs of the green turtle,chelonia mydas,were studied during the entire period of incubation,using transmission and scanning electron microscopy (tem and sem).limb buds were first observed at stage 2.at that stage,the tip was covered with an apical ectodermal ridge (aer) which began to regress at stage 6.associated with aer was the presence of the mesenchymal cells which,consequently,differentiated into muscles,cartilage and bones.the gross features of the skeletal development appeared as a condensation of the cartilaginous structures in the proximal distal region of the limbs.the primordial digits were gradually enclosed by hard keratinized webbed skin.the increase in rate of ossification and skin pigmentation was correlated with the growth of the limbs.the development of the limbs was closely related to the transitional appearance of mucus secretion from the epidermis.

  14. Development of automatic image analysis algorithms for protein localization studies in budding yeast

    Science.gov (United States)

    Logg, Katarina; Kvarnström, Mats; Diez, Alfredo; Bodvard, Kristofer; Käll, Mikael

    2007-02-01

    Microscopy of fluorescently labeled proteins has become a standard technique for live cell imaging. However, it is still a challenge to systematically extract quantitative data from large sets of images in an unbiased fashion, which is particularly important in high-throughput or time-lapse studies. Here we describe the development of a software package aimed at automatic quantification of abundance and spatio-temporal dynamics of fluorescently tagged proteins in vivo in the budding yeast Saccharomyces cerevisiae, one of the most important model organisms in proteomics. The image analysis methodology is based on first identifying cell contours from bright field images, and then use this information to measure and statistically analyse protein abundance in specific cellular domains from the corresponding fluorescence images. The applicability of the procedure is exemplified for two nuclear localized GFP-tagged proteins, Mcm4p and Nrm1p.

  15. Learning Shape and Texture Characteristics of CT Tree-in-Bud Opacities for CAD Systems

    CERN Document Server

    Bagci, Ulas; Caban, Jesus; Suffredini, Anthony F; Palmore, Tara N; Mollura, Daniel J

    2011-01-01

    Although radiologists can employ CAD systems to characterize malignancies, pulmonary fibrosis and other chronic diseases; the design of imaging techniques to quantify infectious diseases continue to lag behind. There exists a need to create more CAD systems capable of detecting and quantifying characteristic patterns often seen in respiratory tract infections such as influenza, bacterial pneumonia, or tuborculosis. One of such patterns is Tree-in-bud (TIB) which presents \\textit{thickened} bronchial structures surrounding by clusters of \\textit{micro-nodules}. Automatic detection of TIB patterns is a challenging task because of their weak boundary, noisy appearance, and small lesion size. In this paper, we present two novel methods for automatically detecting TIB patterns: (1) a fast localization of candidate patterns using information from local scale of the images, and (2) a M\\"{o}bius invariant feature extraction method based on learned local shape and texture properties. A comparative evaluation of the pr...

  16. Use of active extracts of poplar buds against Penicillium italicum and possible modes of action.

    Science.gov (United States)

    Yang, Shuzhen; Liu, Limei; Li, Dongmei; Xia, Huan; Su, Xiaojun; Peng, Litao; Pan, Siyi

    2016-04-01

    Antifungal components, from poplar buds active fraction (PBAF) against Penicillium italicum, the causal agent of blue mold in citrus fruits, were identified and possible action modes were investigated. Pinocembrin, chrysin and galangin were determined as active components in PBAF, using HPLC and HPLC-MS analysis. The antifungal activity is stable at temperatures ranging from 4 °C to 100 °C and pH levels ranging from 4 to 8. In the presence of PBAF, the hyphae become shriveled, wrinkled and the cell membrane became seriously disrupted. Further investigation on cell permeability, nucleic acid content and alkaline phosphatase suggest that the cell membrane might be the target. Mycelial oxygen consumption and the respiration-related enzymatic activity of succinate dehydrogenase, malate dehydrogenase and ATPase were all inhibited by PBAF. We propose that PBAF is a potentially useful alternative for blue mold control and may act against P. italicum by interfering with respiration and disrupting the cell membrane. PMID:26593534

  17. Update History of This Database - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...Budding yeast cDNA sequencing project Update History of This Database Date Update contents 2010/03/29 Buddin...tio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Update History

  18. Identification of the Flavone in the Flower Bud of Panax Quinquefolium and Its Content Determination in the Different Parts

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@Introduction   Panax quinquefolium L. Belongs to the Panax genus of the Araliaceae. It originates in America and Canada. Its roots, a famous and expensive traditional Chinese medicinal material, have been studied continually since its successful cultivation in China in the 1970s. In recent years the development and utilization researches of its aerial part, which was abandoned in the past, have been conducted. The constituent studies on the leaves, stems and fruits have been reported. But no information about the flower buds has been found in literatures. The authors have reported a study about the chemical constituents of the flower buds of the P. Quinquefolium cultivated in China. In the present work two flavonoids(namely kaempferol and panasenoside) in the flower buds of the P. Quinquefulium cultivated in China were extracted, isolated, and identified. Since the medicinal materials were processed with an unusual treatment, the content determination of the monomeric and total flavonoid in the different parts were performed correctly with the methods of dual-wavelength TLC-scan, and UV-absorption, and it was discovered that there were flavonoids in the roots and fruits of the P. Quinquefolium. The scientific basis was provided for the utilization of the flower buds and other parts resources of the P.

  19. Effects of Allspice, Cinnamon, and Clove Bud Essential Oils in Edible Apple Films on Physical Properties and Antimicrobial Activities

    Science.gov (United States)

    The results of the present study show that allspice, cinnamon and clove bud essential oils can be used to prepare apple-based antimicrobial edible films with good physical properties for food applications by both direct contact and indirectly by vapors emanating from the films. Application of the a...

  20. Establishment growth and bud bank formation in Epilobium angustifolium: the effects of nutrient availability, plant injury and environmental heterogeneity

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Pokorná, Adéla; Klimeš, Leoš

    2009-01-01

    Roč. 87, č. 2 (2009), s. 195-201. ISSN 1916-2790 R&D Projects: GA ČR(CZ) GA526/06/0723 Institutional research plan: CEZ:AV0Z60050516 Keywords : potential bud bank * adventitious root-sprouting * juvenile plant Subject RIV: EF - Botanics Impact factor: 0.904, year: 2009

  1. Long-term effects of CO2 enrichment on bud phenology and shoot growth patterns of Norway spruce juvenile trees

    Czech Academy of Sciences Publication Activity Database

    Pokorný, Radek; Tomášková, Ivana; Drápelová, I.; Kulhavý, J.; Marek, Michal V.

    2010-01-01

    Roč. 56, č. 6 (2010), s. 251-257. ISSN 1212-4834 R&D Projects: GA AV ČR IAA600870701 Institutional research plan: CEZ:AV0Z60870520 Keywords : bud * elevated CO2 * Norway spruce Subject RIV: EH - Ecology, Behaviour

  2. Seedling shoot, needle and bud development in three provenances of Pinus sylvestris and Pinus contorta cultivated in northern Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Norgren, O. [Swedish Univ. of Agricultural Sciences, Umeaa (Sweden). Dept. of Silviculture; Little, C.H.A. [Canadian Forest Service, Fredricton, NB (Canada); Sundblad, L.G. [Forestry Research Inst. of Sweden, Saevar (Sweden)

    1996-12-31

    The patterns of current-year shoot, needle and terminal bud elongation in seedlings of three Scots pine (Pinus sylvestris L.) and three lodgepole pine (Pinus contorta Dougl. var. latifolia Engelm.) provenances were compared during the third and fourth growing seasons after planting. Lodgepole pine produced longer shoots and buds than did Scots pine, mainly because lodgepole pine formed more stem units and elongated at a faster rate. Stem unit length and the duration of shoot and bud elongation differed relatively little between species and provenances. Lammas or polycyclic growth occurred in some lodgepole pine provenances, but not in any Scots pine provenance, and was associated with enhanced shoot elongations. Needle elongation commenced earlier, proceeded at a faster rate, and was greater in lodgepole pine than in Scots pine, but ceased about the same time in all species and provenances. The heat sum required to attain 50% of final length was lower for shoots and needles in lodgepole pine than in Scots pine, and for shoots in northern provenances than in southern ones. Mitotic activity in the apical meristem of the terminal bud, which occurred less than one week after the seedlings were free from snow, started and ceased about the same time in each species, but was higher in lodgepole pine than in Scots pine early in the shoot elongation period. 36 refs, 2 figs, 3 tabs

  3. Dormancy of 'Imperial Gala' apple and 'Hosui' pear tree buds in a region of low chill occurrence

    Directory of Open Access Journals (Sweden)

    Ruy Inácio Neiva de Carvalho

    2014-08-01

    Full Text Available The objective of this work was to evaluate the dormancy dynamic of Imperial Gala apple tree buds and Hosui pear tree buds in a region of low chill occurrence. Experiments were conducted between April and August in 2007 and 2008. Branches were collected every two weeks from an orchard at Porto Amazonas (Paraná State, Brazil. On the last sampling day, an additional set of branches was collected and refrigerated between 4°C and 7°C for 1,440 hours. Dormancy was evaluated using a biological test of single node cuttings isolated in growth chambers (GC at 25°C with 16 hours of light exposure. The number of chill hours (CH and chill units (CU for the region were recorded. The two species were evaluated in separate experiments. We used 11 completely randomized treatments with four replicas for each species. The peak of endodormancy for the Imperial Gala apple tree buds occurred in early June 2007 and from middle June to early July in 2008. The endodormancy of the Hosui pear tree buds oscillated between April and August in 2007 and peaked between June and early July in 2008.

  4. Budding of Tiger Frog Virus (an Iridovirus) from HepG2 Cells via Three Ways Recruits the ESCRT Pathway.

    Science.gov (United States)

    Mi, Shu; Qin, Xiao-Wei; Lin, Yi-Fan; He, Jian; Chen, Nan-Nan; Liu, Chang; Weng, Shao-Ping; He, Jian-Guo; Guo, Chang-Jun

    2016-01-01

    The cellular endosomal sorting complex required for transport (ESCRT) pathway is a multifunctional pathway involved in cell physiological activities. While the majority of RNA viruses bearing L-domains are known to hijack the ESCRT pathway to complete the budding process, the budding of large and complex enveloped DNA viruses, especially iridoviruses, has been rarely investigated. In the present study, we use the tiger frog virus (TFV) as a model to investigate whether iridoviruses are released from host cells through the ESCRT pathway. Inhibition of class E proteins and auxiliary proteins (VPS4A, VPS4B, Tsg101, Alix, and Nedd4.1) reduces extracellular virion production, which preliminarily indicates that the ESCRT pathway is involved in TFV release. The respective interactions of TFV VP031L, VP065L, VP093L with Alix, Tsg101, Nedd4 suggest the underlying molecular mechanism by which TFV gets access to the ESCRT pathway. Co-depletion of Alix, Tsg101, and Nedd4.1 induces a significant reduction in extracellular virion production, which implies the functional redundancy of host factors in TFV budding. Those results are first observation that iridovirus gains access to ESCRT pathway through three ways of interactions between viral proteins and host proteins. Our study provides a better understanding of the budding mechanism of enveloped DNA viruses. PMID:27225426

  5. Extended Low Temperature Impacts Dormancy Status, Flowering Competence, and Transcript Profiles in Crown Buds of Leafy Spurge

    Science.gov (United States)

    Leafy spurge (Euphorbia esula) is an herbaceous perennial weed that reproduces vegetatively from an abundance of underground adventitious buds. In this study we report the effects of different growth conditions on vegetative reproduction and flowering competence, and determine molecular mechanisms a...

  6. Measurement of the volume growth rate of single budding yeast with the MOSFET-based microfluidic Coulter counter.

    Science.gov (United States)

    Sun, Jiashu; Stowers, Chris C; Boczko, Erik M; Li, Deyu

    2010-11-01

    We report on measurements of the volume growth rate of ten individual budding yeast cells using a recently developed MOSFET-based microfluidic Coulter counter. The MOSFET-based microfluidic Coulter counter is very sensitive, provides signals that are immune from the baseline drift, and can work with cell culture media of complex composition. These desirable features allow us to directly measure the volume growth rate of single cells of Saccharomyces cerevisiae LYH3865 strain budding yeast in YNB culture media over a whole cell cycle. Results indicate that all budding yeast follow a sigmoid volume growth profile with reduced growth rates at the initial stage before the bud emerges and the final stage after the daughter gets mature. Analysis of the data indicates that even though all piecewise linear, Gomperitz, and Hill's function models can fit the global growth profile equally well, the data strongly support local exponential growth phenomenon. Accurate volume growth measurements are important for applications in systems biology where quantitative parameters are required for modeling and simulation. PMID:20717618

  7. Trace element accumulation and distribution in sunflower plants at the stages of flower bud and maturity

    Directory of Open Access Journals (Sweden)

    Susanna De Maria

    2013-02-01

    Full Text Available The aim of this study was to analyze the accumulation and distribution of cadmium (Cd, zinc (Zn and copper (Cu in different portions of plants of sunflower (Helianthus annuus L., cv. Oleko grown in soil with contaminants (5, 300, 400 mg kg–1 of Cd, Zn and Cu, respectively and without (untreated soil as a control from the emergence of cotyledon leaves until to two phenological stages: flower bud (R-1 and maturity (R- 9. Sunflower accumulated considerable amounts of heavy metals in both phenological stages showing slight reductions of dry matter production. At R-1 stage, Cd, Zn and Cu were accumulated mainly in the roots with concentrations respectively up to 5.4, 233 and 160 mg kg–1 of dry matter with a low translocation from roots to the aerial part. Yet at the R-1 stage, the bioconcentration factor (BCF of Cd showed a significantly higher value in the Cd-Zn-Cu treatment (0.27 with respect to the untreated control (0.02, vice versa was observed for Cu, whereas no significant difference between treatments was observed for Zn (0.12 on average. However among metals, Cd showed the highest value of BCF. Referring only to the epigeous portion, differences in the accumulation and distribution of the three metals in the treated plants were found in both phenological stages; indeed passing from flower bud to the maturity stage, Cd, Zn and Cu concentrations increased in the stems and leaves, particularly in the old ones, whereas decreased in the heads. Metal accumulation in the achenes was very low and never exceed the toxicity threshold value considered for livestock. The high storage of heavy metals in roots and the probable re-translocation of the three metals along the plant during the growing cycle could be considered as a strategy of sunflower to preserve young metabolically-active leaves and reproductive organs from toxic metal concentrations.

  8. Evidence for a role of glutamate as an efferent transmitter in taste buds

    Directory of Open Access Journals (Sweden)

    Anderson Catherine B

    2010-06-01

    Full Text Available Abstract Background Glutamate has been proposed as a transmitter in the peripheral taste system in addition to its well-documented role as an umami taste stimulus. Evidence for a role as a transmitter includes the presence of ionotropic glutamate receptors in nerve fibers and taste cells, as well as the expression of the glutamate transporter GLAST in Type I taste cells. However, the source and targets of glutamate in lingual tissue are unclear. In the present study, we used molecular, physiological and immunohistochemical methods to investigate the origin of glutamate as well as the targeted receptors in taste buds. Results Using molecular and immunohistochemical techniques, we show that the vesicular transporters for glutamate, VGLUT 1 and 2, but not VGLUT3, are expressed in the nerve fibers surrounding taste buds but likely not in taste cells themselves. Further, we show that P2X2, a specific marker for gustatory but not trigeminal fibers, co-localizes with VGLUT2, suggesting the VGLUT-expressing nerve fibers are of gustatory origin. Calcium imaging indicates that GAD67-GFP Type III taste cells, but not T1R3-GFP Type II cells, respond to glutamate at concentrations expected for a glutamate transmitter, and further, that these responses are partially blocked by NBQX, a specific AMPA/Kainate receptor antagonist. RT-PCR and immunohistochemistry confirm the presence of the Kainate receptor GluR7 in Type III taste cells, suggesting it may be a target of glutamate released from gustatory nerve fibers. Conclusions Taken together, the results suggest that glutamate may be released from gustatory nerve fibers using a vesicular mechanism to modulate Type III taste cells via GluR7.

  9. Candidate genes associated with bud dormancy release in blackcurrant (Ribes nigrum L.

    Directory of Open Access Journals (Sweden)

    Hedley Peter E

    2010-09-01

    Full Text Available Abstract Background The detrimental effects of mild winter temperatures on the consistency of cropping of blackcurrant (Ribes nigrum L. in parts of Europe have led to increasing interest in the genetic control of dormancy release in this species. This study examined patterns of gene expression in leaf buds of blackcurrant to identify key differential changes in these profiles around the time of budbreak. Results Using leaf bud tissue of blackcurrant, a cDNA library was generated as a source of blackcurrant ESTs for construction of a custom microarray, which was used to identify differential gene expression during dormancy release. Gene activity was lowest in early stages of dormancy, increasing to reach a maximum around the time of budbreak. Genes with significantly changing expression profiles were clustered and evidence is provided for the transient activity of genes previously associated with dormancy processes in other species. Expression profiling identified candidate genes which were mapped onto a blackcurrant genetic linkage map containing budbreak-related QTL. Three genes, which putatively encode calmodulin-binding protein, beta tubulin and acetyl CoA carboxylase respectively, were found to co-localise with budbreak QTL. Conclusions This study provides insight into the genetic control of dormancy transition in blackcurrant, identifying key changes in gene expression around budbreak. Genetic mapping of ESTs enabled the identification of genes which co-localise with previously-characterised blackcurrant QTL, and it is concluded that these genes have probable roles in release of dormancy and can therefore provide a basis for the development of genetic markers for future breeding deployment.

  10. Daughter-specific transcription factors regulate cell size control in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stefano Di Talia

    2009-10-01

    Full Text Available In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle.

  11. A hybrid agent-based model of the developing mammary terminal end bud.

    Science.gov (United States)

    Butner, Joseph D; Chuang, Yao-Li; Simbawa, Eman; Al-Fhaid, A S; Mahmoud, S R; Cristini, Vittorio; Wang, Zhihui

    2016-10-21

    Mammary gland ductal elongation is spearheaded by terminal end buds (TEBs), where populations of highly proliferative cells are maintained throughout post-pubertal organogenesis in virgin mice until the mammary fat pad is filled by a mature ductal tree. We have developed a hybrid multiscale agent-based model to study how cellular differentiation pathways, cellular proliferation capacity, and endocrine and paracrine signaling play a role during development of the mammary gland. A simplified cellular phenotypic hierarchy that includes stem, progenitor, and fully differentiated cells within the TEB was implemented. Model analysis finds that mammary gland development was highly sensitive to proliferation events within the TEB, with progenitors likely undergoing 2-3 proliferation cycles before transitioning to a non-proliferative phenotype, and this result is in agreement with our previous experimental work. Endocrine and paracrine signaling were found to provide reliable ductal elongation rate regulation, while variations in the probability a new daughter cell will be of a proliferative phenotype were seen to have minimal effects on ductal elongation rates. Moreover, the distribution of cellular phenotypes within the TEB was highly heterogeneous, demonstrating significant allowable plasticity in possible phenotypic distributions while maintaining biologically relevant growth behavior. Finally, simulation results indicate ductal elongation rates due to cellular proliferation within the TEB may have a greater sensitivity to upstream endocrine signaling than endothelial to stromal paracrine signaling within the TEB. This model provides a useful tool to gain quantitative insights into cellular population dynamics and the effects of endocrine and paracrine signaling within the pubertal terminal end bud. PMID:27475843

  12. Weierstrass polynomials for links

    DEFF Research Database (Denmark)

    Hansen, Vagn Lundsgaard

    1997-01-01

    There is a natural way of identifying links in3-space with polynomial covering spaces over thecircle. Thereby any link in 3-space can be definedby a Weierstrass polynomial over the circle. Theequivalence relation for covering spaces over thecircle is, however, completely different from that for...... links in 3-space. This paper initiates a study of the connections between polynomial covering spaces over the circle and links in 3-space....

  13. Ha83, a Chitin Binding Domain Encoding Gene, Is Important to Helicoverpa armigera Nucleopolyhedrovirus Budded Virus Production and Occlusion Body Assembling.

    Science.gov (United States)

    Yu, Huan; Xu, Jian; Liu, Qiang; Liu, Tong-Xian; Wang, Dun

    2015-01-01

    Helicoerpa armigera nucleopolyhedrovirus (HearNPV) ha83 is a late expressed gene that encodes a chitin binding protein. Chitin domain truncation studies revealed that the cysteine at the 128 amino acid position probably played an important role in both chitin binding ability and protein transmission of Ha83. In order to study the function of ha83 in the HearNPV infection cycle, an ha83 knockout HearNPV (Ha83KO) was constructed via homologous recombination. Viral growth and viral DNA replication curves showed that fewer budded virions were produced in Ha83KO transfected cells, while viral DNA replication was increased. Electron microscopy revealed that fewer nucleocapsids were transmitted from virogenic stroma in the Ha83KO transfected cell nucleus, and the morphology of occlusion bodies was prominently larger and cube-shaped. Furthermore, DNA quantity in occlusion bodies of Ha83KO was significantly lower than the occlusion bodies of HaWT. The transcription analysis indicated that these changes may be due to the decreased expression level of viral structural associated genes, such as polyhedrin, p10, pif-2, or cg30 in Ha83KO infected cells. Above results demonstrated that the cysteine at the 128 amino acid position in Ha83 might be the key amino acid, and Ha83 plays an important role in BVs production and OBs assembling. PMID:26057202

  14. Puf3p, a Pumilio family RNA binding protein, localizes to mitochondria and regulates mitochondrial biogenesis and motility in budding yeast

    Science.gov (United States)

    García-Rodríguez, Luis J.; Gay, Anna Card; Pon, Liza A.

    2007-01-01

    Puf3p binds preferentially to messenger RNAs (mRNAs) for nuclear-encoded mitochondrial proteins. We find that Puf3p localizes to the cytosolic face of the mitochondrial outer membrane. Overexpression of PUF3 results in reduced mitochondrial respiratory activity and reduced levels of Pet123p, a protein encoded by a Puf3p-binding mRNA. Puf3p levels are reduced during the diauxic shift and growth on a nonfermentable carbon source, conditions that stimulate mitochondrial biogenesis. These findings support a role for Puf3p in mitochondrial biogenesis through effects on mRNA interactions. In addition, Puf3p links the mitochore, a complex required for mitochondrial–cytoskeletal interactions, to the Arp2/3 complex, the force generator for actin-dependent, bud-directed mitochondrial movement. Puf3p, the mitochore, and the Arp2/3 complex coimmunoprecipitate and have two-hybrid interactions. Moreover, deletion of PUF3 results in reduced interaction between the mitochore and the Arp2/3 complex and defects in mitochondrial morphology and motility similar to those observed in Arp2/3 complex mutants. Thus, Puf3p is a mitochondrial protein that contributes to the biogenesis and motility of the organelle. PMID:17210948

  15. Dynamic link: user's manual

    International Nuclear Information System (INIS)

    The purpose of dynamic link facility is to link a load module dynamically only when it is used in execution time. The facility is very useful for development, execution and maintenance of a large scale computer program which is too big to be saved as one load module in main memory, or it is poor economy to save it due to many unused subroutines depending on an input. It is also useful for standardization and common utilization of programs. Standard usage of dynamic link facility of FACOM M-200 computer system, a software tool which analyzes the effect of dynamic link facility and application of dynamic link to nuclear codes are described. (author)

  16. Radiosensitization of hematopoietic precursor cells (CFU/sub c/) in glioblastoma patients receiving intermittent intravenous infusions of bromodeoxyuridine (BUdR)

    International Nuclear Information System (INIS)

    The potential use of bromodeoxyuridine (BUdR) as a radiosensitizer given by an intermittent intravenous route is being studied in a Phase I/II trial at the Naitonal Cancer Institute. In order to assess the extent of radiosensitization, we have studied the radiation response of human bone marrow cells CFUc taken form 6 patients prior to and after a 14-day infusion of BUdR. Varying concentrations (1000-1500 mg) of BUdR were infused for 12 hours 12 hours every 24 hours for up to 14 consecutive days. Cells survival was determined by colony formation of CFUc in soft agar suspensions. X ray survival curves were generated over a dose range of 0-300 rad and the slopes of the survival curves (D0) before and after BUdR infusion were compared. Radiation enhancement ratios (ER)(D0 per-BUdR/D0 post-BUdR) ranged form 1.0-2.2 and appeared to be BUdR dose dependent. Above 650 mg/m2/12 hours is well tolerated and may result in radiosensitizaiton of CFUc in man

  17. Fruit load induces changes in global gene expression and in abscisic acid (ABA) and indole acetic acid (IAA) homeostasis in citrus buds.

    Science.gov (United States)

    Shalom, Liron; Samuels, Sivan; Zur, Naftali; Shlizerman, Lyudmila; Doron-Faigenboim, Adi; Blumwald, Eduardo; Sadka, Avi

    2014-07-01

    Many fruit trees undergo cycles of heavy fruit load (ON-Crop) in one year, followed by low fruit load (OFF-Crop) the following year, a phenomenon known as alternate bearing (AB). The mechanism by which fruit load affects flowering induction during the following year (return bloom) is still unclear. Although not proven, it is commonly accepted that the fruit or an organ which senses fruit presence generates an inhibitory signal that moves into the bud and inhibits apical meristem transition. Indeed, fruit removal from ON-Crop trees (de-fruiting) induces return bloom. Identification of regulatory or metabolic processes modified in the bud in association with altered fruit load might shed light on the nature of the AB signalling process. The bud transcriptome of de-fruited citrus trees was compared with those of ON- and OFF-Crop trees. Fruit removal resulted in relatively rapid changes in global gene expression, including induction of photosynthetic genes and proteins. Altered regulatory mechanisms included abscisic acid (ABA) metabolism and auxin polar transport. Genes of ABA biosynthesis were induced; however, hormone analyses showed that the ABA level was reduced in OFF-Crop buds and in buds shortly following fruit removal. Additionally, genes associated with Ca(2+)-dependent auxin polar transport were remarkably induced in buds of OFF-Crop and de-fruited trees. Hormone analyses showed that auxin levels were reduced in these buds as compared with ON-Crop buds. In view of the auxin transport autoinhibition theory, the possibility that auxin distribution plays a role in determining bud fate is discussed. PMID:24706719

  18. Cross-modal links in spatial attention.

    OpenAIRE

    Driver, J; Spence, C.

    1998-01-01

    A great deal is now known about the effects of spatial attention within individual sensory modalities, especially for vision and audition. However, there has been little previous study of possible cross-modal links in attention. Here, we review recent findings from our own experiments on this topic, which reveal extensive spatial links between the modalities. An irrelevant but salient event presented within touch, audition, or vision, can attract covert spatial attention in the other modaliti...

  19. Mum, this bud’s for you: where do you want it? Roles for Cdc42 in controlling bud site selection in Saccharomyces cerevisiae

    OpenAIRE

    Nelson, W. James

    2003-01-01

    The generation of asymmetric cell shapes is a recurring theme in biology. In budding yeast, one form of cell asymmetry occurs for division and is generated by anisotropic growth of the mother cell to form a daughter cell bud. Previous genetic studies uncovered key roles for the small GTPase Cdc42 in organizing the actin cytoskeleton and vesicle delivery to the site of bud growth,(1,2) but a recent paper has also raised questions about how control of Cdc42 activity is integrated into a propose...

  20. The effects of bud load and regulated deficit irrigation on sugar, organic acid, phenolic compounds and antioxidant activity of Razakı table grape berries

    OpenAIRE

    Tangolar Semih; Tarım Güzin; Kelebek Haşim; Tangolar Serpil Gök; Topçu Sevilay

    2015-01-01

    This study aims at assessing the effects of increased bud load and irrigation applications on berry quality of the Razakı table grape. Two Regulated Deficit Irrigation (RDI) having different irrigation levels (RDI-I and RDI-II) based on the growth stages, in addition to a non-irrigated control treatment together with two different bud load practices (K-normal and 2K-two-fold buds of the normal) were examined for their effects on quality attributes such as sugar and organic acids contents, phe...

  1. Links and Quantum Entanglement

    CERN Document Server

    Solomon, A I

    2011-01-01

    We discuss the analogy between topological entanglement and quantum entanglement, particularly for tripartite quantum systems. We illustrate our approach by first discussing two clearly (topologically) inequivalent systems of three-ring links: The Borromean rings, in which the removal of any one link leaves the remaining two non-linked (or, by analogy, non-entangled); and an inequivalent system (which we call the NUS link) for which the removal of any one link leaves the remaining two linked (or, entangled in our analogy). We introduce unitary representations for the appropriate Braid Group ($B_3$) which produce the related quantum entangled systems. We finally remark that these two quantum systems, which clearly possess inequivalent entanglement properties, are locally unitarily equivalent.

  2. DEGRADATION OF Bt PROTEIN IN GROUND LEAVES AND BUDS FROM TRANSGENIC Bt COTTON%转Bt基因棉粉碎叶、蕾样Bt蛋白降解

    Institute of Scientific and Technical Information of China (English)

    张美俊; 杨武德

    2011-01-01

    以转Bt基因棉Bt冀668为材料,室内采用ELISA法,测定粉碎叶、蕾样Bt蛋白在土壤、水中不同时间的残留量以及不同环境处理下的残留量,以研究转Bt基因棉粉碎叶、蕾样Bt蛋白在不同基质中的降解动态以及与环境影响因子的关系.结果显示,粉碎叶、蕾样Bt蛋白分别在熟土、生土和水中前40d、48d取样天数间的残留量差异显著,中后期相邻两取样间无显著差异.取样结束时,熟土、生土和水中粉碎叶Bt蛋白残留量分别为初始量的7.4%、2.24%和15.48%,蕾样为初始量的6.22%、4.72%和15.71%,表明Bt蛋白在熟土、生土和水中前期快速降解,中后期进入缓慢稳定降解阶段,水中降解速率最慢,熟土中前期降解快于生土,后期降解反而慢于生土,使得其取样结束时残留量高于生土.75%含水量土壤中,粉碎叶Bt蛋白的降解显著快于25%和50%处理;35℃和25℃下降解显著快于15℃,5℃降解最慢;在有茵土中Bt蛋白的降解显著快于无菌土.上述结果显示一定范围内,高温、高湿可加快Bt蛋白的降解,且土壤微生物是促进Bt蛋白降解的重要因子之一.%The degradation dynamics of Bt protein in ground leaves and buds from transgenic Bt cotton in different substrates and their relation with environmental factors were investigated. Ground powers of BtJi 668 leaves and buds were mixed with soil or water, and residue Bt protein contents during sampling days (0 ~ 88days) and under different environment were determined by using enzyme-linked immunosorbent essay (ELISA) in laboratory. Residue Bt protein contents in ground leaves and buds had significant difference among sampling days at early stages, however, no difference between adjoining sampling days at middle and later stages in three substrates ripened soil, unripened soil and water. At the end of treated time, residue Bt protein contents in ground leaves decreased to 7.4% ,2. 24% and 15.48%, and in buds to

  3. A generalized theory of preferential linking

    CERN Document Server

    Hu, Haibo; Liu, Xuan

    2013-01-01

    There are diverse mechanisms driving the evolution of social networks. A key open question dealing with understanding their evolution is: How various preferential linking mechanisms produce networks with different features? In this paper we first empirically study preferential linking phenomena in an evolving online social network, find and validate the linear preference. We propose an analyzable model which captures the real growth process of the network and reveals the underlying mechanism dominating its evolution. Furthermore based on preferential linking we propose a generalized model reproducing the evolution of online social networks, present unified analytical results describing network characteristics for 27 preference scenarios, and explore the relation between preferential linking mechanism and network features. We find that within the framework of preferential linking analytical degree distributions can only be the combinations of finite kinds of functions which are related to rational, logarithmic...

  4. Osteogenic differentiation of mesenchymal stem cells from dental bud: Role of integrins and cadherins

    Directory of Open Access Journals (Sweden)

    Adriana Di Benedetto

    2015-11-01

    Full Text Available Several studies have reported the beneficial effects of mesenchymal stem cells (MSCs in tissue repair and regeneration. New sources of stem cells in adult organisms are continuously emerging; dental tissues have been identified as a source of postnatal MSCs. Dental bud is the immature precursor of the tooth, is easy to access and we show in this study that it can yield a high number of cells with ≥95% expression of mesenchymal stemness makers and osteogenic capacity. Thus, these cells can be defined as Dental Bud Stem Cells (DBSCs representing a promising source for bone regeneration of stomatognathic as well as other systems. Cell interactions with the extracellular matrix (ECM and neighboring cells are critical for tissue morphogenesis and architecture; such interactions are mediated by integrins and cadherins respectively. We characterized DBSCs for the expression of these adhesion receptors and examined their pattern during osteogenic differentiation. Our data indicate that N-cadherin and cadherin-11 were expressed in undifferentiated DBSCs and their expression underwent changes during the osteogenic process (decreasing and increasing respectively, while expression of E-cadherin and P-cadherin was very low in DBSCs and did not change during the differentiation steps. Such expression pattern reflected the mesenchymal origin of DBSCs and confirmed their osteoblast-like features. On the other hand, osteogenic stimulation induced the upregulation of single subunits, αV, β3, α5, and the formation of integrin receptors α5β1 and αVβ3. DBSCs differentiation toward osteoblastic lineage was enhanced when cells were grown on fibronectin (FN, vitronectin (VTN, and osteopontin (OPN, ECM glycoproteins which contain an integrin-binding sequence, the RGD motif. In addition we established that integrin αVβ3 plays a crucial role during the commitment of MSCs to osteoblast lineage, whereas integrin α5β1 seems to be dispensable. These data suggest

  5. Budding yeast cDNA sequencing project: Y053_E12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y053_E12_F.ab1 Y053_E12_F.ab1 - - Show Y053_E12_F.ab1 Seqid Y053_E12_F.ab1 Link to SGD Y053_E12_ ... 0 753 ABI TCTTCTGCTCTAAGCTGCTCGAGTGTAAACGACTTACACTACAT AGTTAA TACGACTCACTATTTGGCAT TCCTTAAGATTTGATCGAAATAGA ... TATTAA GAAAAACAAACTGTACAATCAATCAATCAATCAT CACAT AAAATGTTCAG CGAATTAATTAACTTCCAAAATGAAGGTCAT GAG ...

  6. Budding yeast cDNA sequencing project: Y004_M09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y004_M09_F.ab1 Y004_M09_F.ab1 DB652777 DB652777 Show Y004_M09_F.ab1 Seqid Y004_M09_F.ab1 Link to ... TAGACGATGAGGTGTTTCCCTTATCTTTTGCCAATTA TCAATTTACCGAGCAT GTGTCACTTGGTGAGCAT TATTCACTCAATACTT CGGAAGATGCCAAATA ... ACTGT GTTCTCGTTAGATAACCCTCAAGAAAACAACTACAAACACCAAGCCAT GA ATAACGTCCAGGATTGTCGCAT GGCCGTCGCGGCCAAAACTACCCAGT ...

  7. Budding yeast cDNA sequencing project: Y045_B09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y045_B09_F.ab1 Y045_B09_F.ab1 - - Show Y045_B09_F.ab1 Seqid Y045_B09_F.ab1 Link to SGD Y045_B09_ ... b1 753 0 753 ABI ATTCTGCTTAAGCTGCTCGAGTGTAAACGACGGCCAT TCCCCAT TAAAGA CGACTCACTATAGGGAATTCCTTAAGATTTGGAGCAC ... TCACAACAAATAGCCAAAAATGCCCGTAAAGCAGGGA ATATTTTGAAAACCAT CTCAAACGAGGGCAGATCAGATATTTTATACAAA ATTCACGATGCCCTGA ...

  8. Budding yeast cDNA sequencing project: Y072_P20_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y072_P20_F.ab1 Y072_P20_F.ab1 DB661654 DB661654 Show Y072_P20_F.ab1 Seqid Y072_P20_F.ab1 Link to ... AATGCTGAGAT CGTTATTGCAAAGCGGCCACCGCAGGGTGGTTGCTTCTTCAT GTGCTACC AT GGTGCGTTGCAGTTCCTCGTCGACCTCCGCGTTGGCGTAC ... TCCCTTGCCCACACTAGACACTCCTTCCT GGAATGCCAACAGTGCCGTTTCAT CCATCAT TTACGAAACACCAGCGCCT TCTCGTCAACCAAGAAAACAGCAT ...

  9. Budding yeast cDNA sequencing project: Y114_D11_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y114_D11_F.ab1 Y114_D11_F.ab1 DB668015 DB668015 Show Y114_D11_F.ab1 Seqid Y114_D11_F.ab1 Link to ... CGAGTGTNNNAAGAGGNCATCTCTNAAATAGGG GANTNANNATAGGGAATTCC TTAAGATTTGGCGAGCAAATTAACAGACCT AATTGAACTGGAAAACATGT ... AAACCCATTGACAACTACATCACGA ACAGTGTTCGCCTTTTTGAGGTGAATCC ATCTCAAACGCTCTTCTCC ATA TCGTATAAACCACCAACACAGAAGACAG ... ACACCAAAGTGTCC TTTAGAAC TCATAACTCGCATTTATCC TTGAACTATAAATTTACTACTAA ... GATGTTTCAAGATTACTTAGTGCATTAGGCCCACGAGGCGTATCTATA ACTCC AGGTAAAATTGAAAAAATAGCACAGTCGAAGAAGAAAAATAACAA AATAA ...

  10. Budding yeast cDNA sequencing project: Y086_E03_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y086_E03_F.ab1 Y086_E03_F.ab1 DB663490 DB663490 Show Y086_E03_F.ab1 Seqid Y086_E03_F.ab1 Link to ... CGAGTGTAAAAGTACGGATACAAAAGAGGGGAC GACTCACTATAGTTACTTCC TTAAGATTTGAGCGATGAGAGCAGCTACAT AACACATAGTAAATCACACA ... TCTACGCAACACACACACACACGCATACAC TCACCCTCATGACAGATCC CCACTTGAACACGCCCCAAGTGAGCACGTCA CCCACATTTGAAAGATCAC ... AGGACTTCC TCAACATCGACGAACCGCCCTG TGCACAGGAAACACCTAGTGTTTCTACA ... TTCAACCTCC CGGGTCC AAGCG CTCC CGCTCAAAGCGTAGACAAGCCAGTCC CCATGATT ...

  11. Budding yeast cDNA sequencing project: Y108_J23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y108_J23_F.ab1 Y108_J23_F.ab1 - - Show Y108_J23_F.ab1 Seqid Y108_J23_F.ab1 Link to SGD Y108_J23_ ... GAGTGTAAACGACGGCCATAACTTATTTAAT ACGACTCACTATAGGGAATTCC TTAAGATTTTAGGGATGCTGTGGAAAAG GCTCTTAAACAGACTAACGGAA ... ATGCAGAATTTGCTGCATCC CTCC TTTT CC AATGAGCAACCACTGATATTGTGATCGGCCTCTACTTATG ... CTGTTAATATATAATATGCA TAGTTGTATTTGTGCCTCAATGTGCGCCATTCC TGTGTTGGACAAAGCCG CAAGGGCCAAGGCAAGATCC CAGTTTGAAAACG ... ACCCCCGGCCGCTAGAT GCTCC CTTTAGTGACGGTAAATTGCATCC GCACTGACAAGATACTTTGAC GAGTT ...

  12. Budding yeast cDNA sequencing project: Y094_K12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y094_K12_F.ab1 Y094_K12_F.ab1 DB664754 DB664754 Show Y094_K12_F.ab1 Seqid Y094_K12_F.ab1 Link to ... GAGTGTAAACGACGGCCAGTACGTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTGAACCACGTCACATTATACT CATAACCATAGAATTCACAGA ... TATATTACACCTTG GTTTTTGCCATTCTAGTGGTGGAGATTTTCATGTTCTCC ATTCTAGCCCT ACCAATCC CTTCTAGATACCGTAGGCCTCTCACCTTACT ... GTTATTAAAGC CGTTCAAATCCTCC ACAGTGCAAGTTGCGATCAAGTGTGTACTTGGGTTC ATTCTTTTGCT ... GGGCTAGTCATAGAACTTTTAACCATGAAAGACATATACAGAGCATCGC CTCC AGTAGCCTCC AGCGATGTCAAGAAGAACGACTCTGTTACTGCCGAA GCTG ...

  13. Budding yeast cDNA sequencing project: Y102_K19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_K19_F.ab1 Y102_K19_F.ab1 - - Show Y102_K19_F.ab1 Seqid Y102_K19_F.ab1 Link to SGD Y102_K19_ ... GAGTGTAAACGACGGCCAGCACGTATTTAATACGA CTCACTATAGGGAATTCC TTAAGATTTATCAAGAACTTGGTTTGATATTT CACCAACACACACAAAAA ... T TGAGATTGGCTTTGCAAAGAAAAGACATTGAGGTTGTTGCTGTCAACGAT CC ATTTATCTCTAACGATTATGCTGCTTACATGGTCAAGTACGATTCTAC T ... CATGGTAGATACAAGGGTACTGTTTCC CATGACGACAAGCACATCATCA TTGATGGTGTCAAGATCGCTACCTACCA ... ACCCAGCTAACTTG CCATGGGGTTCTCTAAAGATCGATGTCGCTGTTGACTCC ACTGGTGTTTT CAAGGAATTGGACACCGCTCAAAAGCACATTGACGCTGG ...

  14. Budding yeast cDNA sequencing project: Y016_M23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y016_M23_F.ab1 Y016_M23_F.ab1 - - Show Y016_M23_F.ab1 Seqid Y016_M23_F.ab1 Link to SGD Y016_M23_ ... GAGTGTAAACGACGGCCAGTATCTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTACTCC TCTCAGCCTCAGTCA TCATCC GCTCAAACCCAGCCG ... TCGTTCC AACCTAAAGAAAACCTTTTCGT ACCACGGGTAAAAATTTTGCATCGTGAT ... TAAAATAATA AGAATTATATATTTTATGATTATATTATTACATAAAGTATTCC CCATTAT AAATTCTGAGTTTCGTAAAAAAAAAAAAAAAAAAAAAAAAAAA ... AAAAAAA AAAAAAAAAAAAAAAAAAGTACCGCGGCCGCGGATCTCC CTTTAGGGAGG GTTAATTGGATCC AAACATGATAAAATACATTGATGAGT ...

  15. Linking open vocabularies

    CERN Document Server

    Greifender, Elke; Seadle, Michael

    2013-01-01

    Linked Data (LD), Linked Open Data (LOD) and generating a web of data, present the new knowledge sharing frontier. In a philosophical context, LD is an evolving environment that reflects humankinds' desire to understand the world by drawing on the latest technologies and capabilities of the time. LD, while seemingly a new phenomenon did not emerge overnight; rather it represents the natural progression by which knowledge structures are developed, used, and shared. Linked Open Vocabularies is a significant trajectory of LD. Linked Open Vocabularies targets vocabularies that have traditionally b

  16. Sexual Differences in Chemical Composition and Aroma-active Compounds of Essential Oil from Flower Buds of Eurya japonica.

    Science.gov (United States)

    Miyazawa, Mitsuo; Usami, Atsushi; Tanaka, Takio; Tsuji, Kaoru; Takehara, Manami; Hori, Yuki

    2016-04-01

    This study was conducted to determine the composition of essential oil from buds of male and female Eurya japonica flowers and to determine the aroma-active compounds of this plant by gas chromatography-mass spectrometry (GC-MS), sensory evaluation, and odor activity values (OAV). The oils contained eighty-five compounds. We identified for the first time forty-four compounds in E. japonica. Through sensory evaluation, nineteen aroma-active compounds were identified by gas chromatography-olfactometry (GC-O). Because the chemical composition can affect the interaction between plants and herbivorous insects, our results suggest that essential oils from male and female flower buds of E. japonica differently affect herbivores. Sexual differences in essential oils deserve further investigations in this plant-insect system. PMID:26972466

  17. Bilans społecznej wyobraźni. Komentarz socjologiczny do Poznańskiego Budżetu Obywatelskiego

    OpenAIRE

    Drozdowski, Rafał; Frąckowiak, Maciej

    2013-01-01

    Przedmiotem artykułu jest krytyczna analiza budżetu obywatelskiego ze szczególnym uwzględnieniem jego poznańskiej odsłony z 2013 r. Autorzy rozważają, jakich informacji o priorytetach inwestycyjnych mieszkańców, a także o preferowanych przez nich typach relacji obywatel–urzędnik, dostarczają wnioski zgłoszone do poznańskiego budżetu obywatelskiego. Rozpatrują i komentują prawdopodobne linie krytyki tej formy partycypacji; zastanawiają się także nad ograniczeniami i potencjalnymi ścieżkami roz...

  18. Characterising Web Site Link Structure

    CERN Document Server

    Zhou, Shi; Petricek, Vaclav

    2007-01-01

    The topological structures of the Internet and the Web have received considerable attention. However, there has been little research on the topological properties of individual web sites. In this paper, we consider whether web sites (as opposed to the entire Web) exhibit structural similarities. To do so, we exhaustively crawled 18 web sites as diverse as governmental departments, commercial companies and university departments in different countries. These web sites consisted of as little as a few thousand pages to millions of pages. Statistical analysis of these 18 sites revealed that the internal link structure of the web sites are significantly different when measured with first and second-order topological properties, i.e. properties based on the connectivity of an individual or a pairs of nodes. However, examination of a third-order topological property that consider the connectivity between three nodes that form a triangle, revealed a strong correspondence across web sites, suggestive of an invariant. ...

  19. FT-IR microscopic mappings of early mineralization in chick limb bud mesenchymal cell cultures

    Science.gov (United States)

    Boskey, A. L.; Camacho, N. P.; Mendelsohn, R.; Doty, S. B.; Binderman, I.

    1992-01-01

    Chick limb bud mesenchymal cells differentiate into chondrocytes and form a cartilaginous matrix in culture. In this study, the mineral formed in different areas within cultures supplemented with 4 mM inorganic phosphate, or 2.5, 5.0, and 10 mM beta-glycerophosphate (beta GP), was characterized by Fourier-transform infrared (FT-IR) microscopy. The relative mineral-to-matrix ratios, and distribution of crystal sizes at specific locations throughout the matrix were measured from day 14 to day 30. The only mineral phase detected was a poorly crystalline apatite. Cultures receiving 4 mM inorganic phosphate had smaller crystals which were less randomly distributed around the cartilage nodules than those in the beta GP-treated cultures. beta GP-induced mineral consisted of larger, more perfect apatite crystals. In cultures receiving 5 or 10 mM beta GP, the relative mineral-to-matrix ratios (calculated from the integrated intensities of the phosphate and amide I bands, respectively) were higher than in the cultures with 4 mM inorganic phosphate or in the in vivo calcified chick cartilage.

  20. The nuclear exosome is active and important during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Stephen Frenk

    Full Text Available Nuclear RNA degradation pathways are highly conserved across eukaryotes and play important roles in RNA quality control. Key substrates for exosomal degradation include aberrant functional RNAs and cryptic unstable transcripts (CUTs. It has recently been reported that the nuclear exosome is inactivated during meiosis in budding yeast through degradation of the subunit Rrp6, leading to the stabilisation of a subset of meiotic unannotated transcripts (MUTs of unknown function. We have analysed the activity of the nuclear exosome during meiosis by deletion of TRF4, which encodes a key component of the exosome targeting complex TRAMP. We find that TRAMP mutants produce high levels of CUTs during meiosis that are undetectable in wild-type cells, showing that the nuclear exosome remains functional for CUT degradation, and we further report that the meiotic exosome complex contains Rrp6. Indeed Rrp6 over-expression is insufficient to suppress MUT transcripts, showing that the reduced amount of Rrp6 in meiotic cells does not directly cause MUT accumulation. Lack of TRAMP activity stabilises ∼ 1600 CUTs in meiotic cells, which occupy 40% of the binding capacity of the nuclear cap binding complex (CBC. CBC mutants display defects in the formation of meiotic double strand breaks (DSBs, and we see similar defects in TRAMP mutants, suggesting that a key function of the nuclear exosome is to prevent saturation of the CBC complex by CUTs. Together, our results show that the nuclear exosome remains active in meiosis and has an important role in facilitating meiotic recombination.

  1. Immunohistochemical expression of budding uninhibited by benzimidazole related 1 in leukoplakia and oral squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Taneeru Sravya

    2016-01-01

    Full Text Available Background: Budding uninhibited by benzimidazole related 1 (BUBR1 is an important protein in the mitotic spindle assembly checkpoint. Alterations in expression of BUBR1 have been reported in many premalignant and malignant lesions. Aim: To compare the expression of BUBR1 with respect to the normal mucosa and degree of dysplasia in oral leukoplakia (OL and also with respect to different histopathological grades of oral squamous cell carcinoma (OSCC. Materials and Methods: Neutral buffered formalin-fixed and paraffin-embedded biopsy specimens 30 each of normal, OL and OSCC tissue were included in this study. The expression of BUBR1 was detected using immunohistochemistry (IHC. The scores obtained were subjected to ANOVA test. Results: Significant correlation was found in immunostaining between normal, dysplasia and OSCC groups with a P value of 0.00001. The expression of BUBR1 was significant when compared with different degrees of dysplasia and in different histopathological grades of OSCC with a P value of 0.00001. Conclusion: Higher IHC scores were obtained with increased histopathological grades of OL and OSCC suggesting its role as a prognostic indicator.

  2. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    International Nuclear Information System (INIS)

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA

  3. Synaptic communication and signal processing among sensory cells in taste buds

    Science.gov (United States)

    Chaudhari, Nirupa

    2014-01-01

    Taste buds (sensory structures embedded in oral epithelium) show a remarkable diversity of transmitters synthesized and secreted locally. The known transmitters accumulate in a cell type selective manner, with 5-HT and noradrenaline being limited to presynaptic cells, GABA being synthesized in both presynaptic and glial-like cells, and acetylcholine and ATP used for signalling by receptor cells. Each of these transmitters participates in local negative or positive feedback circuits that target particular cell types. Overall, the role of ATP is the best elucidated. ATP serves as a principal afferent transmitter, and also is the key trigger for autocrine positive feedback and paracrine circuits that result in potentiation (via adenosine) or inhibition (via GABA or 5-HT). While many of the cellular receptors and mechanisms for these circuits are known, their impact on sensory detection and perception remains to be elaborated in most instances. This brief review examines what is known, and some of the open questions and controversies surrounding the transmitters and circuits of the taste periphery. PMID:24665098

  4. In Vitro Shoot Bud Differentiation from Hypocotyl Explants of Chili Peppers (Capsicum annuum L.

    Directory of Open Access Journals (Sweden)

    Owk ANIEL KUMAR

    2010-03-01

    Full Text Available Chili pepper (Capsicum annuum L. is an economically important spice crop in tropical and subtropical countries. In vitro plant regeneration was obtained from 15th day old hypocotyl explants of three chili pepper cultivars (Capsicum annuum L., var. �X-235�, var. �PC-1� and var. �Pusa Jwala�. Among the genotypes of Capsicum L. var. �X-235� responded better than the var. �PC-1� and var. �Pusa Jwala�. MS medium containing BAP (4.0 mg/l and IAA (0.5 mg/l was found to be the best medium for the production of maximum number of shoot buds in all the genotypes of chili pepper i.e., 6.80�0.16 (var. �X-235�, 5.00�0.19 (var. �PC-1� and 4.80�0.12 (var. �Pusa Jwala�. The shoots were rooted on MS medium fortified with IBA (0.5 mg/l. Rooted plants were hardened and transplanted to the soil. The plants showed 80-90% survival during transplantation.

  5. Position of the axillary bud and mutation induction in Chrysanthemum (Dendranthema grandiflora Tzvelev) plant lets

    International Nuclear Information System (INIS)

    Mutagenic treatment of multicellular meristems from vegetatively propagated plants generally results in the formation of chimeric plants. Mutated sectors can be increased and stabilized through the cutting-back method. The objective of the present research was to study the influence of application of this method in the M1V2 population, originated from six different axillary buds from the M1V1 chrysanthemum branches. For this purpose, rooted plants of the cultivar Ingrid (dark ping) were irradiated with 20 Gy of gamma-rays and the prune was carried out 40 days after planting. Frequency and spectrum of flower color mutants were evaluated. No mutants were observed in the control population. In the M1V1 population, 22.1% of the total plants were mutants (white color, dark bronze, pale pink, yellow, wine, variegated and cream). Among them, 1.8% were periclinal chimeras (with only one different color from the original) and the others showed mutated sectors. No differences were observed in mutation frequency and size of mutated sector among six M1V1 populations. The wine colored mutant was selected, multiplied and evaluated in a yield trial. This mutant named Magali was multiplied and was released as a new cultivar. (author)

  6. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Joon-Seok; Lee, Cheol-Koo, E-mail: cklee2005@korea.ac.kr

    2013-09-13

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA.

  7. CENP-A exceeds microtubule attachment sites in centromere clusters of both budding and fission yeast.

    Science.gov (United States)

    Coffman, Valerie C; Wu, Pengcheng; Parthun, Mark R; Wu, Jian-Qiu

    2011-11-14

    The stoichiometries of kinetochores and their constituent proteins in yeast and vertebrate cells were determined using the histone H3 variant CENP-A, known as Cse4 in budding yeast, as a counting standard. One Cse4-containing nucleosome exists in the centromere (CEN) of each chromosome, so it has been assumed that each anaphase CEN/kinetochore cluster contains 32 Cse4 molecules. We report that anaphase CEN clusters instead contained approximately fourfold more Cse4 in Saccharomyces cerevisiae and ~40-fold more CENP-A (Cnp1) in Schizosaccharomyces pombe than predicted. These results suggest that the number of CENP-A molecules exceeds the number of kinetochore-microtubule (MT) attachment sites on each chromosome and that CENP-A is not the sole determinant of kinetochore assembly sites in either yeast. In addition, we show that fission yeast has enough Dam1-DASH complex for ring formation around attached MTs. The results of this study suggest the need for significant revision of existing CEN/kinetochore architectural models. PMID:22084306

  8. [Neurocristopathies of the human nasofrontal bud. Ethmoidal syndromes (hypo- and hyper-septoethmoidism) (author's transl)].

    Science.gov (United States)

    Couly, G

    1981-01-01

    Knowledge of human brain development biology has increased rapidly over the last decade due to fundamental acquisitions in the fields of organogenesis, fetal development, and post-natal growth. The role of the neural crests during cephalic organogenesis, recently studied by Mme Nicole Le Douarin, has given new biological dimensions to the head : it is an organic complex, globally neural in character, and of encephalofacial territorialization. The cervicocephalic region derives this original segmentation from the migratory property of this contingent of the neural crests. In this perspective, the nasofrontal bud is therefore an embryonic cephalic segment, in which appears the pro-encephalon, the eyes, the olfactory bulb, and the median facial zones (bone, cartilage, teeth). Any morphogenetic anomaly in this original craniofacial segment creates associated malformation of the brain, the base of the skull, and the face (eyes and olfactory bulbs) : the neurocristopathies. In this respect, and from the semiological point of view, the face is the "predicate" of the brain. A new classification of these malformations is proposed, based on the clinical study of the ethmoid, a cartilaginous median organ which is accessible clinically. Epigenesis lasts for 18 months in this organ, which forms a part of the face and the neurocranium, and which is known to play a "motor" morphogenetic role on the osteomembranous face : the ethmoidal syndromes (hypo- and hyper-septoethmoidism). Future reports will discuss the neurocristopathies of the branchial arches. PMID:6944757

  9. Dynamics of DNA methylation and Histone H4 acetylation during floral bud differentiation in azalea

    Directory of Open Access Journals (Sweden)

    Valledor Luis

    2010-01-01

    Full Text Available Abstract Background The ability to control the timing of flowering is a key strategy for planning production in ornamental species such as azalea, however it requires a thorough understanding of floral transition. Floral transition is achieved through a complex genetic network and regulated by multiple environmental and endogenous cues. Dynamic changes between chromatin states facilitating or inhibiting DNA transcription regulate the expression of floral induction pathways in response to environmental and developmental signals. DNA methylation and histone modifications are involved in controlling the functional state of chromatin and gene expression. Results The results of this work indicate that epigenetic mechanisms such as DNA methylation and histone H4 acetylation have opposite and particular dynamics during the transition from vegetative to reproductive development in the apical shoots of azalea. Global levels of DNA methylation and histone H4 acetylation as well as immunodetection of 5-mdC and acetylated H4, in addition to a morphological study have permitted the delimitation of four basic phases in the development of the azalea bud and allowed the identification of a stage of epigenetic reprogramming which showed a sharp decrease of whole DNA methylation similar to that is defined in other developmental processes in plants and in mammals. Conclusion The epigenetic control and reorganization of chromatin seem to be decisive for coordinating floral development in azalea. DNA methylation and H4 deacetylation act simultaneously and co-ordinately, restructuring the chromatin and regulating the gene expression during soot apical meristem development and floral differentiation.

  10. [In vitro propagation of mahogany tree (Swietenia macrophylla King) from axillary buds].

    Science.gov (United States)

    Tacoronte, Melángel; Vielma, María; Mora, Argenis; Valecillos, Carle

    2004-01-01

    The mahogany tree (Swietenia macrophylla King) is a forest tree with a great commercial value mainly due to its wood quality. Unfortunately, this species is being threatened by the effect of intensive timber exploitation, its low capacity to regenerate, and the attack of the Meliaceae shoot borer (Hypsipylla grandella Zeller) (Lepidoptera Pyralidae). To increase population, large-scale propagation of mahogany by in vitro culture was developed. To obtain plantlets, nodal segments were cultured in a half-strength MS medium supplemented with different combinations of naphthaleneacetic acid (NAA) and 6-benzyladenine (BA), specified by the Central Compositional Rotable Statistical Design Method, within a range of 0-3 mg/L for both hormones. Favourable incubation conditions were: 16 h light, and 40-45 micromol x m(-2) x s(-1) at 25 degrees C. The derived response surface showed an optimal axillary bud elongation on a medium containing 1.94 mg BA/L and 0.38 mg NAA/L. No significant differences were found neither applying Orellana Method nor modified Orellana method. Mahogany plantlets obtained were successfully acclimated. PMID:15916160

  11. Refined Hopf Link Revisited

    CERN Document Server

    Iqbal, Amer

    2012-01-01

    We establish a relation between the refined Hopf link invariant and the S-matrix of the refined Chern-Simons theory. We show that the refined open string partition function corresponding to the Hopf link, calculated using the refined topological vertex, when expressed in the basis of Macdonald polynomials gives the S-matrix of the refined Chern-Simons theory.

  12. Scavenger Activity Evaluation of the Clove Bud Essential Oil (Eugenia caryophyllus) and Eugenol Derivatives Employing ABTS+• Decolorization

    OpenAIRE

    Merchán Arenas, Diego R.; Acevedo, Amner Muñoz; Vargas Méndez, Leonor Y.; Kouznetsov, Vladimir V.

    2011-01-01

    The essential oil (EO) of clove bud dried fruits from Eugenia caryophyllus was obtained by a conventional hydrodistillation process in an excellent yield (11.7 %). Its chemical composition was analyzed by GC-MS, identifying eugenol as a main constituent (60.5%). Four eugenol-like molecules, γ-diisoeugenol, hydroxymethyleugenol, dihydroeugenol and 1,3-dioxanylphenol, were synthesized using eugenol or isoeugenol as initial precursors under green chemistry protocols. To evaluate the possible ant...

  13. Marketingový mix multikina Cinestar v Českých Budějovicích

    OpenAIRE

    Kašparová, Barbora

    2010-01-01

    In its theoretic part this bachelor thesis deals with development of multiplexes, describes current state of multiplex market in the Czech republic, specifies the terms marketing and marketing mix and focuses on marketing in the service sector. In the practical part it focuses on marketing mix of a particular multiplex -- CineStar České Budějovice. The aim of this thesis is to analyse each component of marketing mix, evaluate it, eventually suggest possible solutions.

  14. The origin and actual state of Jednota, consumption cooperative in České Budějovice

    OpenAIRE

    Dagmar Parmová; Drahoš Vaněček

    2001-01-01

    Consumption cooperative Jednota České Budějovice is going through a great transformation lo be successful in comparison with other, mostly international food purchasing chains. One way for improving the situation is to look; after some integration forms with other district cooperatives Jednota in the Czech republic, the other way is in restructuring of existing shops into some characteristic, specialized groups with their own different ways of supplying with goods and managing. A very importa...

  15. The budding yeast protein kinase Ipl1/Aurora allows the absence of tension to activate the spindle checkpoint

    OpenAIRE

    Biggins, Sue; Murray, Andrew W.

    2001-01-01

    The spindle checkpoint prevents cell cycle progression in cells that have mitotic spindle defects. Although several spindle defects activate the spindle checkpoint, the exact nature of the primary signal is unknown. We have found that the budding yeast member of the Aurora protein kinase family, Ipl1p, is required to maintain a subset of spindle checkpoint arrests. Ipl1p is required to maintain the spindle checkpoint that is induced by overexpression of the protein kinase Mps1. Inactivating I...

  16. Assessment of sanitary conditions in stands of Norway spruce (Picea abies Karst. damaged by spruce bud scale (Physokermes piceae Schrnk.

    Directory of Open Access Journals (Sweden)

    Miezite O

    2013-02-01

    Full Text Available Spruce bud scale (Physokermes piceae Schrnk. affects tree growth directly and indirectly. Direct injury appears in the form of tissue damage, as insects suck sap from tree phloem. Indirect injury appears as “honeydew”, which results in negative effects on tree growth. Plant sap is saturated with various carbohydrates called photosynthates that are difficult for scaly insects to digest. Therefore it is secreted in excrements, which are subsequently a food source for the black sooty mold (Apiosporium pinophilum Fuckel. The fungus covers needles blocking stomata, causing decreased transpiration and photosynthesis. An inexplicable wither of Norway spruce was reported in Latvia during 2010 due to black sooty mold. However, spruce bud scale was not evident. In 2011, mass propagation of spruce bud scale was observed following the 2010 Norway spruce loss. One objective of this research was to determine if Kraft tree growth classes could be applied to establish the factors responsible for tree foliage damage. Six 21 - 40 year old (second age class Norway spruce stands were evaluated. Two circular sample plots with a 7.98 m radius, and a 200-m2 area were randomly established per each forest stand hectare. Diameter at breast height (dbh, 1.3 m, and height of approximately 30 trees was measured to model a trend. For all trees, Kraft class, and foliage damage level caused by spruce bud scale and black sooty mold were determined. Significant differences were not observed in tree damage levels among stands, however significant differences among damage levels in different Kraft classes were detected (F = 3.45 > Fcrit. = 2.80, α = 0.05 > P = 0.02 found. Overall damage intensity was 29.3 %. Total forestry loss was 1153 LVL (1640 EUR for all surveyed stands (10 ha, and 115 LVL (164 EUR per hectare.

  17. Biomolecules and Natural Medicine Preparations: Analysis of New Sources of Bioactive Compounds from Ribes and Rubus spp. Buds

    Directory of Open Access Journals (Sweden)

    Dario Donno

    2016-02-01

    Full Text Available It is well known that plants are important sources for the preparation of natural remedies as they contain many biologically active compounds. In particular, polyphenols, terpenic compounds, organic acids, and vitamins are the most widely occurring groups of phytochemicals. Some endemic species may be used for the production of herbal preparations containing phytochemicals with significant bioactivity, as antioxidant activity and anti-inflammatory capacities, and health benefits. Blackberry sprouts and blackcurrant buds are known to contain appreciable levels of bioactive compounds, including flavonols, phenolic acids, monoterpenes, vitamin C, and catechins, with several clinical effects. The aim of this research was to perform an analytical study of blackcurrant and blackberry bud-preparations, in order to identify and quantify the main biomarkers, obtaining a specific phytochemical fingerprint to evaluate the single botanical class contribution to total phytocomplex and relative bioactivity, using a High Performance Liquid Chromatograph−Diode Array Detector; the same analyses were performed both on the University laboratory and commercial preparations. Different chromatographic methods were used to determine concentrations of biomolecules in the preparations, allowing for quantification of statistically significant differences in their bioactive compound content both in the case of Ribes nigrum and Rubus cultivated varieties at different harvest stages. In blackcurrant bud-extracts the most important class was organic acids (50.98% followed by monoterpenes (14.05%, while in blackberry preparations the main bioactive classes were catechins (50.06% and organic acids (27.34%. Chemical, pharmaceutical and agronomic-environmental knowledge could be important for obtaining label certifications for the valorization of specific genotypes, with high clinical and pharmaceutical value: this study allowed to develop an effective tool for the natural

  18. The budding yeast protein Chl1p is required to preserve genome integrity upon DNA damage in S-phase

    OpenAIRE

    Laha, Suparna; Das, Shankar Prasad; Hajra, Sujata; Sau, Soumitra; Sinha, Pratima

    2006-01-01

    The budding yeast protein, Chl1p, is required for sister-chromatid cohesion, transcriptional silencing, rDNA recombination and aging. In this work, we show that Chl1p is also required for viability when DNA replication is stressed, either due to mutations or if cells are treated with genotoxic agents like methylmethane sulfonate (MMS) and ultraviolet (UV) rays. The chl1 mutation caused synthetic growth defects with mutations in DNA replication genes. At semi-permissive temperatures, the doubl...

  19. Cell aggregation optimizes the differentiation of human ESCs and iPSCs into pancreatic bud-like progenitor cells

    Directory of Open Access Journals (Sweden)

    Taro Toyoda

    2015-03-01

    Full Text Available Embryonic pancreatic bud cells, the earliest pancreas-committed cells, generated from human embryonic stem cells (hESCs and induced pluripotent stem cells (hiPSCs have been shown to differentiate into mature pancreatic β-cells in vivo, indicating the feasibility of hESC/iPSC-based cell therapy for diabetes. However, the key factors required for the differentiation of these cells into pancreatic bud cells are incompletely understood. The purpose of this study was to establish culture conditions that efficiently induce PDX1+NKX6.1+ pancreatic bud cells from hESCs/iPSCs. We differentiated a hESC line, KhES-3, into pancreatic lineages with a stepwise protocol recapitulating developmental process. The induction rate of PDX1+NKX6.1+ cells was correlated with cell density in adherent cultures, and markedly improved with cell aggregation cultures. The positive effects of cell aggregation cultures on the differentiation of pancreatic bud cells were reproduced in multiple hESC/iPSC lines. The human PDX1+NKX6.1+ cells developed into pancreatic epithelia after implantation into immunocompromised mice. Moreover, human C-peptide secretion into mouse bloodstream was stimulated by glucose challenges after in vivo maturation. Taken together, these results suggest that cultures with high cell density are crucial for the differentiation of pancreas-committed progenitor cells from hESCs/iPSCs. Our findings may be applicable for the development of hESC/iPSC-based cell therapy for diabetes.

  20. Exploring Event and Status Based Phenological Monitoring in Citizen Science Projects: Lessons Learned from Project BudBurst

    Science.gov (United States)

    Ward, D.; Henderson, S.; Newman, S. J.

    2012-12-01

    Citizen science projects in ecology are in a unique position to address the needs of both the science and education communities. Such projects can provide needed data to further understanding of ecological processes at multiple spatial scales while also increasing public understanding of the importance of the ecological sciences. Balancing the needs of both communities, it is important that citizen science programs also provide different 'entry' points to appeal to diverse segments of society. In the case of NEON's Project BudBurst, a national plant phenology citizen science program, two approaches were developed to address the ongoing challenge to recruitment and retention of participants. Initially, Project BudBurst was designed to be an event-based phenology program. Participants were asked to identify a plant and report on the timing of specific phenoevents throughout the year. This approach requires a certain level of participation, which while yielding useful results, is not going to appeal to the broadest audience possible. To broaden participation, in 2011 and 2012, Project BudBurst added campaigns targeted at engaging individuals in making simple status-based reports of a plant they chose. Three targeted field campaigns were identified to take advantage of times when people notice changes to plants in their environment, using simple status-based protocols: Fall Into Phenology, Cherry Blossom Blitz, and Summer Solstice Snapshot. The interest and participation in these single report phenological status-based campaigns exceeded initial expectations. For example, Fall Into Phenology attracted individuals who otherwise had not considered participating in an ongoing field campaign. In the past, observations of fall phenology events submitted to Project BudBurst had been limited. By providing the opportunity for submitting simple, single reports, the number of both new participants and submitted observations increased significantly.

  1. Comparative Transcriptome Profile of the Cytoplasmic Male Sterile and Fertile Floral Buds of Radish (Raphanus sativus L.)

    OpenAIRE

    Shiyong Mei; Touming Liu; Zhiwei Wang

    2016-01-01

    Radish cytoplasmic male sterility (CMS) has been widely used for breeding in Raphanus and Brassica genera. However, the detailed regulation network of the male sterility remains to be determined. Our previous work has shown that the abnormalities in a CMS radish appeared shortly after the tetrad stage when microspores were malformed and the tapetal cells grew abnormally large. In this work, histological analysis shows that anthers are at the tetrad stage when the radish buds are about 1.5 mm ...

  2. Human Mesenchymal Stem Cells Derived From Limb Bud Can Differentiate into All Three Embryonic Germ Layers Lineages

    OpenAIRE

    Jiao, Fei; Wang, Juan; Dong, Zhao-lun; Wu, Min-juan; Zhao, Ting-bao; Li, Dan-Dan; Xin WANG

    2012-01-01

    Mesenchymal stem cells (MSCs) have been isolated from many sources, including adults and fetuses. Previous studies have demonstrated that, compared with their adult counterpart, fetal MSCs with several remarkable advantages may be a better resource for clinical applications. In this study, we successfully isolated a rapidly proliferating cell population from limb bud of aborted fetus and termed them “human limb bud–derived mesenchymal stem cells” (hLB-MSCs). Characteristics of their morpholog...

  3. Effects of allspice, cinnamon, and clove bud essential oils in edible apple films on physical properties and antimicrobial activities.

    Science.gov (United States)

    Du, W-X; Olsen, C W; Avena-Bustillos, R J; McHugh, T H; Levin, C E; Friedman, Mendel

    2009-09-01

    Essential oils (EOs) derived from plants are rich sources of volatile terpenoids and phenolic compounds. Such compounds have the potential to inactivate pathogenic bacteria on contact and in the vapor phase. Edible films made from fruits or vegetables containing EOs can be used commercially to protect food against contamination by pathogenic bacteria. EOs from cinnamon, allspice, and clove bud plants are compatible with the sensory characteristics of apple-based edible films. These films could extend product shelf life and reduce risk of pathogen growth on food surfaces. This study evaluated physical properties (water vapor permeability, color, tensile properties) and antimicrobial activities against Escherichia coli O157:H7, Salmonella enterica, and Listeria monocytogenes of allspice, cinnamon, and clove bud oils in apple puree film-forming solutions formulated into edible films at 0.5% to 3% (w/w) concentrations. Antimicrobial activities were determined by 2 independent methods: overlay of the film on top of the bacteria and vapor phase diffusion of the antimicrobial from the film to the bacteria. The antimicrobial activities against the 3 pathogens were in the following order: cinnamon oil > clove bud oil > allspice oil. The antimicrobial films were more effective against L. monocytogenes than against the S. enterica. The oils reduced the viscosity of the apple solutions and increased elongation and darkened the colors of the films. They did not affect water vapor permeability. The results show that apple-based films with allspice, cinnamon, or clove bud oils were active against 3 foodborne pathogens by both direct contact with the bacteria and indirectly by vapors emanating from the films. PMID:19895483

  4. FLO1 Is a Variable Green Beard Gene that Drives Biofilm-like Cooperation in Budding Yeast

    OpenAIRE

    Smukalla, Scott; Caldara, Marina; Pochet, Nathalie; Beauvais, Anne; Guadagnini, Stephanie; Yan, Chen; Vinces, Marcelo; Jansen, An; Prevost, Marie Christine; Latge, Jean-Paul; Fink, Gerald R.; Foster, Kevin R.; Verstrepen, Kevin

    2008-01-01

    The budding yeast, Saccharomyces cerevisiae, has emerged as an archetype of eukaryotic cell biology. Here we show that S. cerevisiae is also a model for the evolution of cooperative behavior by revisiting flocculation, a self-adherence phenotype lacking in most laboratory strains. Expression of the gene FLO1 in the laboratory strain S288C restores flocculation, an altered physiological state, reminiscent of bacterial biofilms. Flocculation protects the FLO1 expressing cells from multiple stre...

  5. Biomolecules and Natural Medicine Preparations: Analysis of New Sources of Bioactive Compounds from Ribes and Rubus spp. Buds.

    Science.gov (United States)

    Donno, Dario; Mellano, Maria Gabriella; Cerutti, Alessandro Kim; Beccaro, Gabriele Loris

    2016-01-01

    It is well known that plants are important sources for the preparation of natural remedies as they contain many biologically active compounds. In particular, polyphenols, terpenic compounds, organic acids, and vitamins are the most widely occurring groups of phytochemicals. Some endemic species may be used for the production of herbal preparations containing phytochemicals with significant bioactivity, as antioxidant activity and anti-inflammatory capacities, and health benefits. Blackberry sprouts and blackcurrant buds are known to contain appreciable levels of bioactive compounds, including flavonols, phenolic acids, monoterpenes, vitamin C, and catechins, with several clinical effects. The aim of this research was to perform an analytical study of blackcurrant and blackberry bud-preparations, in order to identify and quantify the main biomarkers, obtaining a specific phytochemical fingerprint to evaluate the single botanical class contribution to total phytocomplex and relative bioactivity, using a High Performance Liquid Chromatograph-Diode Array Detector; the same analyses were performed both on the University laboratory and commercial preparations. Different chromatographic methods were used to determine concentrations of biomolecules in the preparations, allowing for quantification of statistically significant differences in their bioactive compound content both in the case of Ribes nigrum and Rubus cultivated varieties at different harvest stages. In blackcurrant bud-extracts the most important class was organic acids (50.98%) followed by monoterpenes (14.05%), while in blackberry preparations the main bioactive classes were catechins (50.06%) and organic acids (27.34%). Chemical, pharmaceutical and agronomic-environmental knowledge could be important for obtaining label certifications for the valorization of specific genotypes, with high clinical and pharmaceutical value: this study allowed to develop an effective tool for the natural preparation quality

  6. Uhlíková stopa města České Budějovice

    OpenAIRE

    FIŠEROVÁ, Michaela

    2013-01-01

    Diploma thesis deals with the carbon footprint´s enumeration of the town České Budějovice. Based on the evaluation of the its particular segments there are the measures for reduction proposed. Furthermore the amount of the carbon footprint is compared with the value of the carbon footprint of the Czech Republic and five other towns. The compared towns are Chrudim, Jilemnice, Krnov, Svitavy a Semily.

  7. Evaluation of growth inhibitory activity of Crataegus monogyna Jacq. flower bud extracts against human tumor cell lines

    OpenAIRE

    Barreira, João C. M.; Abreu, Rui M.V.; Rodrigues, Sandra; Carvalho, Ana Maria; Ferreira, Isabel C. F. R.

    2013-01-01

    The vast structural diversity of natural compounds found in plants provides unique opportunities for discovering new drugs with possible beneficial effects on human health, including regulation of proliferation and cell death pathways leading to cancer [1]. Crataegus monogyna Jacq. has been studied by our research group to confirm its different alleged health benefits [2-4]. Herein, the antiproliferative activity of phenolic extracts from C. monogyna flower buds was evaluated on f...

  8. Effect of light intensity, plant density and flower bud removal on the flower size and number in cut chrysanthemum

    OpenAIRE

    Carvalho, S.M.P.; Heuvelink, E.; Kooten, van, J.

    2002-01-01

    Flower size and number of flowers per plant are important external quality aspects in cut chrysanthemum. The present work is conducted in a glasshouse and aims at investigating how these quality aspects can be predicted. To evaluate individual flower size, different levels of supplementary lighting (control and assimilation light), plant density (32, 48 and 64 plants m-2) and lateral flower bud removal (leaving 1 flower, 4 flowers and control) were applied. To analyse the effect of assimilate...

  9. Clonal growth diversity and bud banks in the Czech flora: an evaluation using the CLO-PLA3 database

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Klimeš, Leoš

    2008-01-01

    Roč. 80, č. 3 (2008), s. 255-275. ISSN 0032-7786 R&D Projects: GA ČR GA206/01/1039; GA ČR(CZ) GA526/06/0723 Grant ostatní: EU(XE) EVR1-CT-2002-40022 Institutional research pla n: CEZ:AV0Z60050516 Keywords : database * clonal traits * bud bank Subject RIV: EF - Botanics Impact factor: 2.396, year: 2008

  10. Isolation of a cdc28 mutation that abrogates the dependence of S phase on completion of M phase of the budding yeast cell cycle

    Indian Academy of Sciences (India)

    Santanu Kumar Ghosh; Pratima Sinha

    2000-01-01

    We have isolated a mutation in the budding yeast Saccharomyces cerevisisae CDC28 gene that allows cdc13 cells, carrying damaged DNA, to continue with the cell division cycle. While cdc13 mutant cells are arrested as large-budded cells at the nonpermissive temperature 37°C, the cdc13 cdc28 double mutant culture showed cells with one or more buds, most of which showed apical growth. The additional buds emerged without the intervening steps of nuclear division and cell separation. We suggest that the cdc28 mutation abrogates a checkpoint function and allows cells with damaged or incompletely replicated DNA an entry to another round of cell cycle and bypasses the mitotic phase of the cell cycle.

  11. The effect of the time and the budding method on the growth of young cherry trees cv. 'Łutówka'

    Directory of Open Access Journals (Sweden)

    Piotr Baryła

    2012-12-01

    Full Text Available The studies concerning the effect of the time and the methods of budding on the growth of young cherry trees were conducted in the years at Felin Experimental Farm of Lublin Agricultural University. The objects of investigations were the young cherry trees obtained as a result of budding of mahaleb cherry (Prunus mahaleb L. and sweet cherry (Prunus avium L. seedlings in the way by the chip budding-15th July and T-graft-15th July and 1st September. The used methods and the times of budding insignificantly affected the growth of young cherry trees cv. «Łutówka» in a nursery. There was showed that quality features of the trees were dependet on stock used type. Cherry trees obtained on mahaleb cherry were thicker, higher and better branched than on sweet cherry.

  12. Identification of irradiated food. I.- A test established on the in vitro culture of potato buds to identified the irradiated tubers

    International Nuclear Information System (INIS)

    A method based upon the in vitro culture of potato buds in a mineral medium is described, by which method tubers irradiated can be distinguished from tubers treated by refrigeration or inhibited by chemical agents. (Author) 9 refs

  13. Analýza cestovního ruchu ve vybraném městě (České Budějovice)

    OpenAIRE

    Tupá, Petra

    2009-01-01

    The analysis is concernd with the tourism industry in České Budějovice. The offer of the tourism industry in the city was described, the SWOT analysis is involved too and the future plans are outlined.

  14. Exposure of ELF-EMF and RF-EMF Increase the Rate of Glucose Transport and TCA Cycle in Budding Yeast

    Science.gov (United States)

    Lin, Kang-Wei; Yang, Chuan-Jun; Lian, Hui-Yong; Cai, Peng

    2016-01-01

    In this study, we investigated the transcriptional response to 50 Hz extremely low frequency electromagnetic field (ELF-EMF) and 2.0 GHz radio frequency electromagnetic field (RF-EMF) exposure by Illumina sequencing technology using budding yeast as the model organism. The transcription levels of 28 genes were upregulated and those of four genes were downregulated under ELF-EMF exposure, while the transcription levels of 29 genes were upregulated and those of 24 genes were downregulated under RF-EMF exposure. After validation by reverse transcription quantitative polymerase chain reaction (RT-qPCR), a concordant direction of change both in differential gene expression (DGE) and RT-qPCR was demonstrated for nine genes under ELF-EMF exposure and for 10 genes under RF-EMF exposure. The RT-qPCR results revealed that ELF-EMF and RF-EMF exposure can upregulate the expression of genes involved in glucose transportation and the tricarboxylic acid (TCA) cycle, but not the glycolysis pathway. Energy metabolism is closely related with the cell response to environmental stress including EMF exposure. Our findings may throw light on the mechanism underlying the biological effects of EMF.

  15. Transient etiolation: protochlorophyll(ide) and chlorophyll forms in differentiating plastids of closed and breaking leaf buds of horse chestnut (Aesculus hippocastanum).

    Science.gov (United States)

    Solymosi, Katalin; Bóka, Károly; Böddi, Béla

    2006-08-01

    An accompanying paper reports the accumulation of photoactive protochlorophyllide (Pchlide) in the innermost leaf primordia of buds of many tree species. In this paper, we describe plastid differentiation, changes in pigment concentrations and spectral properties of bud scales and leaf primordia of horse chestnut (Aesculus hippocastanum L.) from January until the end of bud break in April. The bud scales contained plastids with grana, stroma thylakoids characteristic of chloroplasts and large dense bodies within the stroma. In January, proplastids and young chloroplasts were present in the leaf primordia, and the fluorescence spectra of the primordia were similar to those of green leaves except for a minor band at 630 nm, indicative of a protochlorophyll(ide). During bud break, the pigment concentrations of the green bud scales and the outermost leaf primordia increased, and Pchlide forms with emission maxima at 633, 644 and 655 nm accumulated in the middle and innermost leaf primordia. Depending on the position of the leaf primordia within the bud, their plastids and their pigment concentrations varied. Etio-chloroplasts with prolamellar bodies (PLBs) and prothylakoids with developing grana were observed in the innermost leaves. Besides the above-mentioned Pchlide forms, the middle and innnermost leaf primordia contained only a Chl band with an emission maximum at 686 nm. The outermost leaf primordia contained etio-chloroplasts with well-developed grana and small, narrow-type PLBs. These outermost leaves contained only chlorophyll forms like the mature green leaves. No Pchlide accumulation was observed after bud break, indicating that etiolation of the innermost and middle leaves is transient. The Pchlide forms and the plastid types of the primordia in buds grown in nature were similar to those of leaves of dark-germinated seedlings and to those of the leaf primordia of dark-forced buds. We conclude that transient etiolation occurs under natural conditions. The

  16. Interaction of environment conditions and genotypes on expression of genetic background in micro-phenophases of strawberry mixed flower bud

    Directory of Open Access Journals (Sweden)

    Selamovska Ana

    2013-01-01

    Full Text Available The aim of this research is differentiation or micro-phenophases of reproductive organs on two junebearing strawberry (Fragaria x anannassa varieties senga sengana and pocahontas, depending on climate conditions, rosettes ordering and cultivate manner (orchard mulched on black foil and orchard on bare soil. The beginning of differentiation of flower buds is genetic characteristic depending on climate conditions (insulations, day length, higher midday and night air temperatures from 1.05 till the beginning of differentiation, the sum of rainfalls from the beginning of May until the end of July, order of rosettes and cultivate manner The sum of effective temperatures over 10ºC from 1st of May till the beginning of differentiation has no influence on beginning of flower buds differentiation. First morphological changes of the apical meristem were started in the first decade of August that has coincided with the day length of 14 hours and day insulations of 9.3 hours. Micro-phenophases were undergoing almost at the same time in both varieties, only the beginning at pocahontas was 2-3 days earlier. Primary rosettes differ 10-15 days earlier than the secondary rosettes. Plants that grown on black foil had 7-10 days earlier flower bud differentiation compared to those grown on bare soil.

  17. The Effect of Water Stress on Some Morphological, Physiological, and Biochemical Characteristics and Bud Success on Apple and Quince Rootstocks

    Directory of Open Access Journals (Sweden)

    Ibrahim Bolat

    2014-01-01

    Full Text Available The effects of different water stress (control, medium, and severe on some morphological, physiological, and biochemical characteristics and bud success of M9 apple and MA quince rootstocks were determined. The results showed that water stress significantly affected most morphological, physiological, and biochemical characteristics as well as budding success on the both rootstocks. The increasing water stress decreased the relative shoot length, diameter, and plant total fresh and dry weights. Leaf relative water content and chlorophyll index decreased while electrolyte leakage increased with the increase of water stress in both rootstocks. An increase in water stress also resulted in reduction in budding success in Vista Bella/M9 (79.33% and 46.67% and Santa Maria/MA (70.33% and 15.33% combinations. However, the water stress in Santa Maria/MA was more prominent. The increase in water stress resulted in higher peroxidase activities as well as phenol contents in both rootstocks. Although catalase activity, anthocyanin, and proline contents increased with the impact of stress, this was not statistically significant. The results suggest that the impact of stress increased with the increase of water stress; therefore, growers should be careful when using M9 and MA rootstocks in both nursery and orchards where water scarcity is present.

  18. Vodní hmyz řeky Malše v okolí Českých Budějovic

    Czech Academy of Sciences Publication Activity Database

    Boukal S., David; Klečka, J.; Soldán, Tomáš

    České Budějovice: Jihočeské muzeum, 2006, s. 229-234. ISBN 80-86260-60-7 R&D Projects: GA AV ČR 1QS500070505 Institutional research plan: CEZ:AV0Z50070508 Keywords : aquatic insects * Malše river * České Budějovice Subject RIV: EH - Ecology, Behaviour

  19. The development rhythm of the flower-bud in some Papilionaceae species. III. Macrosporogenesis, microsporogenesis and early gametogenesis in several species of the Vicieae tribe

    Directory of Open Access Journals (Sweden)

    Wanda Wojciechowska

    2014-02-01

    Full Text Available Each of the examined species of the tribe Vicieae (Vicia faba, V. sativa, V, villosa, Lathyrus silvester, L. pratensis and Pisum sativum has its peculiar characteristic development rhythm of the bud. A similarity has been demonstrated between the development rhythms of flower buds of Vicia faba and Pisum sativum. It was found that mature flowers of autogamous species had long calyces, whereas those of the allogamous species were short as compared with the petals of the corolla.

  20. The development rhythm of the flower-bud in some Papilionaceae species. III. Macrosporogenesis, microsporogenesis and early gametogenesis in several species of the Vicieae tribe

    OpenAIRE

    Wanda Wojciechowska

    2014-01-01

    Each of the examined species of the tribe Vicieae (Vicia faba, V. sativa, V, villosa, Lathyrus silvester, L. pratensis and Pisum sativum) has its peculiar characteristic development rhythm of the bud. A similarity has been demonstrated between the development rhythms of flower buds of Vicia faba and Pisum sativum. It was found that mature flowers of autogamous species had long calyces, whereas those of the allogamous species were short as compared with the petals of the corolla.