WorldWideScience

Sample records for brassicaceae

  1. Plastome phylogeny and early diversification of Brassicaceae

    OpenAIRE

    Guo, Xinyi; Liu, Jianquan; Hao, Guoqian; Zhang, Lei; Mao, Kangshan; Wang, Xiaojuan; Zhang, Dan; Ma, Tao; Hu, Quanjun; Al-Shehbaz, Ihsan A.; Koch, Marcus A.

    2017-01-01

    Background The family Brassicaceae encompasses diverse species, many of which have high scientific and economic importance. Early diversifications and phylogenetic relationships between major lineages or clades remain unclear. Here we re-investigate Brassicaceae phylogeny with complete plastomes from 51 species representing all four lineages or 5 of 6 major clades (A, B, C, E and F) as identified in earlier studies. Results Bayesian and maximum likelihood phylogenetic analyses using a partiti...

  2. Biosystematic studies on Brassicaceae (Cruciferae) in Egypt

    NARCIS (Netherlands)

    Abdel Khalik, K.N.E.

    2002-01-01

    The present work deals with a systematic investigation of 45 taxa belonging to 23 genera of the tribes Arabideae, Euclidieae, Hesperideae, Lunarieae, Matthioleae and Sisymbrieae of the family Brassicaceae from Egypt. This work is largely based on herbarium material

  3. Deteksi dan Identifikasi Cendawan Terbawa Benih Brassicaceae

    Directory of Open Access Journals (Sweden)

    Anthoni Sulthan Harahap

    2015-06-01

    Full Text Available Seed quality is very critical in agricultural production, especially to gain high yield and reduce disease problems in the field. New diseases or pathogens is potentially entering a country through seed movement by import activity. This study aimed to detect and identify seed-borne fungi from Brassicaceae seeds imported from the United States and Malaysia. Seeds were incubated on 5 sheets of wet blotting paper at a temperature of 27–30 °C for 14 days following surface sterilization. Each fungus that grows on the seed was isolated on potato dextrose agar and malt extract agar for further morphological identification. The three fungi most commonly found either on the seed with or without surface-sterilization were Aspergillus flavus, Curvularia lunata and A. niger. All of the  fungi were a potential pathogen in the family Brassicaceae seeds and seedlings. Important pathogen in Brassicaceae crops, i.e. Phoma lingam was also found in small amounts and only on white pak choy seeds.

  4. Production of cybrids in Brassicaceae species.

    Science.gov (United States)

    Vasylenko, Maksym; Ovcharenko, Olga; Gleba, Yuri; Kuchuk, Nikolay

    2006-01-01

    This chapter describes a method of cytoplasm transfer within the brassicaceae family through Ca-PEG-mediated protoplast fusion. The method includes a protocol of nonmutagenic albinism induction based on spectinomycin-induced plastid ribosome deficiency (PRD). The proposed application of spectinomycin-mediated albinism allows speeding up creation of albino lines, as well as of hybrid production with substituted cytoplasm. According to described method cybrids between Orychophragmus violaceus and Brassica napus, O. violaceus and Lesquerella fendleri have been produced. Methods of further molecular analysis are also presented. The time-scale and reliability of described methods are indicated.

  5. Evolution of genome size in Brassicaceae.

    Science.gov (United States)

    Johnston, J Spencer; Pepper, Alan E; Hall, Anne E; Chen, Z Jeffrey; Hodnett, George; Drabek, Janice; Lopez, Rebecca; Price, H James

    2005-01-01

    Brassicaceae, with nearly 340 genera and more than 3350 species, anchors the low range of angiosperm genome sizes. The relatively narrow range of DNA content (0.16 pg Lepidium virginicum and Brassica rapa. Branches in the phylogenetic tree that represent probable evolutionary increases in genome size terminate in Arabidopsis halleri, A. lyrata, Arabis hirsuta, Capsella rubella, Caulanthus heterophyllus, Crucihimalaya, Lepidium sativum, Sisymbrium and Thlaspi arvense. Branches within one clade containing Brassica were identified that represent two ancient ploidy events (2x to 4x and 4x to 6x) that were predicted from published comparative mapping studies.

  6. Cytoplasmic male sterility in Brassicaceae crops

    Science.gov (United States)

    Yamagishi, Hiroshi; Bhat, Shripad R.

    2014-01-01

    Brassicaceae crops display strong hybrid vigor, and have long been subject to F1 hybrid breeding. Because the most reliable system of F1 seed production is based on cytoplasmic male sterility (CMS), various types of CMS have been developed and adopted in practice to breed Brassicaceae oil seed and vegetable crops. CMS is a maternally inherited trait encoded in the mitochondrial genome, and the male sterile phenotype arises as a result of interaction of a mitochondrial CMS gene and a nuclear fertility restoring (Rf) gene. Therefore, CMS has been intensively investigated for gaining basic insights into molecular aspects of nuclear-mitochondrial genome interactions and for practical applications in plant breeding. Several CMS genes have been identified by molecular genetic studies, including Ogura CMS from Japanese radish, which is the most extensively studied and most widely used. In this review, we discuss Ogura CMS, and other CMS systems, and the causal mitochondrial genes for CMS. Studies on nuclear Rf genes and the cytoplasmic effects of alien cytoplasm on general crop performance are also reviewed. Finally, some of the unresolved questions about CMS are highlighted. PMID:24987289

  7. Molecular Resources from Transcriptomes in the Brassicaceae Family

    Directory of Open Access Journals (Sweden)

    Lua Lopez

    2017-08-01

    Full Text Available The rapidly falling costs and the increasing availability of large DNA sequence data sets facilitate the fast and affordable mining of large molecular markers data sets for comprehensive evolutionary studies. The Brassicaceae (mustards are an important species-rich family in the plant kingdom with taxa distributed worldwide and a complex evolutionary history. We performed Simple Sequence Repeats (SSRs mining using de novo assembled transcriptomes from 19 species across the Brassicaceae in order to study SSR evolution and provide comprehensive sets of molecular markers for genetic studies within the family. Moreover, we selected the genus Cochlearia to test the transferability and polymorphism of these markers among species. Additionally, we annotated Cochlearia pyrenaica transcriptome in order to identify the position of each of the mined SSRs. While we introduce a new set of tools that will further enable evolutionary studies across the Brassicaceae, we also discuss some broader aspects of SSR evolution. Overall, we developed 2012 ready-to-use SSR markers with their respective primers in 19 Brassicaceae species and a high quality annotated transcriptome for C. pyrenaica. As indicated by our transferability test with the genus Cochlearia these SSRs are transferable to species within the genus increasing exponentially the number of targeted species. Also, our polymorphism results showed substantial levels of variability for these markers. Finally, despite its complex evolutionary history, SSR evolution across the Brassicaceae family is highly conserved and we found no deviation from patterns reported in other Angiosperms.

  8. From species to trait evolution in Aethionema (Brassicaceae)

    NARCIS (Netherlands)

    Mohammadin, Setareh

    2017-01-01

    The plant family Brassicaceae (or crucifers) is an economically important group that includes many food crops (e.g. cabbages and radishes), horticultural species (e.g. Draba, Iberis, Lunaria), and model plant species (particularly Arabidopsis thaliana). Because of the fundamental importance of A.

  9. Signaling pathways regulated by Brassicaceae extract inhibit the ...

    African Journals Online (AJOL)

    Background: The goal of this study was identification signaling molecules mediated the formation of AGEs in brain of rats injected with CdCl2 and the role of camel whey proteins and Brassicaceae extract on formation of AGEs in brain. Methods: Ninety male rats were randomly grouped into five groups; Normal control (GpI) ...

  10. Interspecific and intergeneric hybridization and chromosomal engineering of Brassicaceae crops.

    Science.gov (United States)

    Kaneko, Yukio; Bang, Sang Woo

    2014-05-01

    In Brassicaceae crop breeding programs, wild relatives have been evaluated as genetic resources to develop new cultivars with biotic and abiotic stress resistance. This has become necessary because of the diversification of ecotypes of diseases and pests, changing food preferences, advances in production technology, the use of new approaches such as in vitro breeding programs, and the need for economical production of F1 seed. To produce potential new cultivars, interspecific and intergeneric hybridizations have been performed between cultivated species and between cultivated species and their wild relatives. Furthermore, interspecific and intergeneric hybrids have been successfully produced using embryo rescue techniques. In this paper, we review the interspecific and intergeneric incompatibilities between Brassicaceae crops and their wild relatives, and the production, characterization, and improvement of synthetic amphidiploid lines, alien gene introgression lines, alloplasmic lines, monosomic alien chromosome addition lines, and monosomic alien chromosome substitution lines. The goal is to provide useful materials to support practical breeding strategies and to study the genetic effects of individual chromosomes on plant traits, the number of genes that control a trait, their linkage relationships, and genetic improvement in Brassicaceae crops.

  11. Evolution of TWIN SISTER of FT (TSF Genes in Brassicaceae

    Directory of Open Access Journals (Sweden)

    Yunyan Hu

    2016-01-01

    Full Text Available FT and its homolog, TWIN SISTER OF FT (TSF, act redundantly as integrators in floral transition pathways in Arabidopsis thaliana. The evolution of these key flowering regulatory genes during Brassicaceae speciation has not been well studied; therefore, we investigated their evolution in 13 sequenced Brassicaceae species. While the phylogenetic analysis indicated that FT gene evolution has followed two independent lineage-specific routes, TSF evolution does not appear to have been completely consistent within the Brassicaceae lineage I and lineage II division. The two TSF copies in the Thellungiella genus were divided into A and B groups in the phylogenetic analysis. Examination of conserved non-coding sequences and conserved domains within a 5 kb region upstream of the TSF start codon revealed the same group division inferred by the phylogenetic analysis. In addition, TSF genes retained syntenic relationships among genes in the same group, but not between group A and group B. The two copies of the TSF gene in the Thellungiella species were syntenic to the TSF genes in group A and group B, respectively. We also identified TSF-A gene residues in the syntenic region of group B species, but no TSF-B residues could be found in the group A syntenic region. Therefore, we inferred that the TSF genes in lineage II species experienced a duplication event after diversification from lineage I. Following their split from Thellungiella, Brassica species lost the ancestral TSF gene and retained the duplicated copy.

  12. Control of corolla monosymmetry in the Brassicaceae Iberis amara.

    Science.gov (United States)

    Busch, Andrea; Zachgo, Sabine

    2007-10-16

    Establishment of morphological novelties has contributed to the enormous diversification of floral architecture. One such novelty, flower monosymmetry, is assumed to have evolved several times independently during angiosperm evolution. To date, analysis of monosymmetry regulation has focused on species from taxa where monosymmetry prevails, such as the Lamiales and Fabaceae. In Antirrhinum majus, formation of a monosymmetric corolla is specified by the activity of the TCP transcription factors CYCLOIDEA (CYC) and DICHOTOMA (DICH). It was shown that establishment of monosymmetry likely requires an early asymmetric floral expression of CYC homologs that needs to be maintained until late floral stages. To understand how CYC homologs might have been recruited during evolution to establish monosymmetry, we characterized the likely CYC ortholog IaTCP1 from Iberis amara (Brassicaceae). Species of the genus Iberis form a monosymmetric corolla, whereas the Brassicaceae are otherwise dominated by genera developing a polysymmetric corolla. Instead of four equally sized petals, I. amara produces two small adaxial and two large abaxial petals. The timing of IaTCP1 expression differs from that of its Arabidopsis homolog TCP1 and other CYC homologs. IaTCP1 lacks an asymmetric early expression but displays a very strong differential expression in the corolla at later floral stages, when the strongest unequal petal growth occurs. Analysis of occasionally occurring peloric Iberis flower variants and comparative functional studies of TCP homologs in Arabidopsis demonstrate the importance of an altered temporal IaTCP1 expression within the Brassicaceae to govern the formation of a monosymmetric corolla.

  13. Nasturtium officinale (Brassicaceae: nueva cita para la Flora del Paraguay

    Directory of Open Access Journals (Sweden)

    Rosa Degen Naumann

    2015-01-01

    Full Text Available Se documenta la presencia de Nasturtium officinale W. T. Aiton (Brassicaceae, nuevo género y especie para la Flora del Paraguay. La misma fue encontrada en los arroyos de la ciudad de Areguá, Capital del Departamento Central en la región Oriental del Paraguay. Se incluyen en este trabajo una descripción breve, comentarios sobre su distribución, el hábitat, la fenología, el nombre vernacular y observaciones sobre su uso.

  14. Nasturtium officinale (Brassicaceae): nueva cita para la Flora del Paraguay

    OpenAIRE

    Rosa Degen Naumann; Fátima Mereles Haydar

    2016-01-01

    Se documenta la presencia de Nasturtium officinale W. T. Aiton (Brassicaceae), nuevo género y especie para la Flora del Paraguay. La misma fue encontrada en los arroyos de la ciudad de Areguá, Capital del Departamento Central en la región Oriental del Paraguay. Se incluyen en este trabajo una descripción breve, comentarios sobre su distribución, el hábitat, la fenología, el nombre vernacular y observaciones sobre su uso.

  15. Complex networks of self-incompatibility signaling in the Brassicaceae.

    Science.gov (United States)

    Tantikanjana, Titima; Nasrallah, Mikhail E; Nasrallah, June B

    2010-10-01

    The self-pollination barrier of self-incompatibility in the Brassicaceae is based on the activity of a polymorphic stigma receptor and its pollen ligand, whose allele-specific interaction triggers a signaling cascade within the stigma epidermal cell that culminates in the inhibition of pollen tube development. Recent analyses have identified signaling intermediates and revealed unexpected cross-talk between self-incompatibility signaling and pistil development. The self-incompatibility response is now thought to be based on a phosphorylation and ubiquitin-mediated degradation pathway that inhibits the secretion of factors required for successful pollination. Because manipulation of the identified signaling intermediates results in only partial disruption of the self-incompatibility reaction, this pathway likely functions in conjunction with other as-yet unidentified signaling pathways to effect complete inhibition of self-pollen. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana

    Science.gov (United States)

    2011-01-01

    Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs) in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes) and mitochondrial (28 genes) genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes). Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely related sister species

  17. Predicting the occurrence of alate aphids in Brassicaceae

    Directory of Open Access Journals (Sweden)

    Francisco Jorge Cividanes

    2012-04-01

    Full Text Available The objective of this work was to predict the occurrence of alates of Brevicoryne brassicae, Lipaphis erysimi, and Myzus persicae (Hemiptera, Aphididae in Brassicaceae. The alate aphids were collected in yellow water traps from July 1997 to August 2005. Aphid population peaks were predicted using a degree‑day model. The meteorological factors, temperature, air relative humidity, rainfall, and sunshine hours, were used to provide precision indexes to evaluate the best predictor for the date of the first capture of alate aphids by the traps. The degree‑day model indicated that the peak population of the evaluated aphid species can be predicted using one of the following biofix dates: January 1st, June 1st, and the date of the first capture of the alate aphid species by the yellow water traps. The best predictor of B. brassicae occurrence is the number of days with minimum temperature >15°C, and of L. erysimi and M. persicae, the number of days with rainfall occurrence.

  18. Self-incompatibility in Brassicaceae crops: lessons for interspecific incompatibility.

    Science.gov (United States)

    Kitashiba, Hiroyasu; Nasrallah, June B

    2014-05-01

    Most wild plants and some crops of the Brassicaceae express self-incompatibility, which is a mechanism that allows stigmas to recognize and discriminate against "self" pollen, thus preventing self-fertilization and inbreeding. Self-incompatibility in this family is controlled by a single S locus containing two multiallelic genes that encode the stigma-expressed S-locus receptor kinase and its pollen coat-localized ligand, the S-locus cysteine-rich protein. Physical interaction between receptor and ligand encoded in the same S locus activates the receptor and triggers a signaling cascade that results in inhibition of "self" pollen. Sequence information for many S-locus haplotypes in Brassica species has spurred studies of dominance relationships between S haplotypes and of S-locus structure, as well as the development of methods for S genotyping. Furthermore, molecular genetic studies have begun to identify genes that encode putative components of the self-incompatibility signaling pathway. In parallel, standard genetic analysis and QTL analysis of the poorly understood interspecific incompatibility phenomenon have been initiated to identify genes responsible for the inhibition of pollen from other species by the stigma. Herewith, we review recent studies of self-incompatibility and interspecific incompatibility, and we propose a model in which a universal pollen-inhibition pathway is shared by these two incompatibility systems.

  19. Cytological studies of Brassicaceae burn. (Cruciferae juss.) from Western Himalayas.

    Science.gov (United States)

    Jeelani, S M; Rani, S; Kumar, S; Kumari, S; Gupta, R C

    2013-01-01

    Cytological studies have been carried out on 12 species of Brassicaceae Burn. on population basis from different geographical areas of Kashmir and Himachal Pradesh in the Western Himalayas. Variable chromosome reports for Barbaraea intermedia (n = 16), Cardamine loxostemonoides (n = 8), Nasturtium officinale (n = 8), Sisymbrium orientale (n = 14) on world-wide basis have been added to the previous reports of these species. The chromosome numbers in seven species as Barbaraea intermedia (n = 8), B. vulgaris (n = 8), Capsella bursa-pastoris (n = 8), Descuriania sophia (n = 10), Rorippa islandica (n = 8), Sisymbrium strictum (n = 7) and Thlaspi alpestre (n = 7) have been worked out for the first time from India. The meiotic course in the populations of seven species such as Barbaraea intermedia, Capsella bursa-pastoris, Coronopus didymus, Descuriania sophia, Nasturtium officinale, Sisymbrium orientale and S. strictum varies from normal to abnormal while all the populations of two species Barbaraea vulgaris and Sisymbrium irio show abnormal meiotic course. Meiotic abnormalities are in the form of cytomixis, chromosomal stickiness, unoriented bivalents, inter-bivalent connections, formation of laggards and bridges, all resulting into abnormal microsporogenesis. Heterogenous sized fertile pollen grains and reduced reproductive potentialities have invariably been observed in all the meiotically abnormal populations. However, the meiotic course in all the populations of Cardamine loxostemonoides, Rorippa islandica and Thalspi alpestre is found to be normal with high pollen fertility.

  20. Reproduction on orbit by plants in the Brassicaceae family

    Science.gov (United States)

    Musgrave, Mary E.; Kuang, Anxiu; Xiao, Ying; Matthews, Sharon W.

    1999-01-01

    Previous studies on growth and development during spaceflight had indicated that the transition from vegetative to reproductive growth was particularly difficult for plants. Our objective has been to study how the spaceflight environment impacts the different steps in plant reproduction. This goal has been pursued in two general ways: by using plants that had been pre-grown to the flowering stage on earth, and by using plants that developed completely on orbit. Our objectives have been met by a combination of experiments that required essentially no crew time on orbit, and those that required an extensive commitment of crew time. The plants chosen for the studies were closely related members of the family Brassicaceae: Arabidopsis thaliana and Brassica rapa. In a series of short-duration experiments with Arabidopsis on the space shuttle we found that depletion of carbon dioxide in closed chambers resulted in aborted development of both the male and female reproductive apparatus in microgravity. Normal development was restored by addition of carbon dioxide or by providing air flow. A subsequent shuttle experiment with Brassica utilizing hardware that provides a vigorous air flow confirmed embryo development following pollination on orbit. Brassica plants grown from seed on the Mir space station produced seed that germinated and grew when replanted on orbit. Future experiments will determine effects of multiple generations in space.

  1. Characterization of the lignin polymer in Brassicaceae family

    Directory of Open Access Journals (Sweden)

    S. Hemmati

    2017-04-01

    Full Text Available Background and objectives: Residues of medicinal plants after extraction and weeds are suitable candidates for bioethanol production. Significant barriers exist to make the conversion of lignocellulosic feedstock to biofuel cost effective and environmentally friendly; one of which is the lignin polymer. Brassicaceae family is one of the potential targets for biofuel production. The structural characteristics of lignin from Hirschfeldia incana, Sisymbrium altissimum and Cardaria draba were studied in comparison to that of Brassica napus. Methods: Lignin deposition was observed by phloroglucinol and Mäule staining. The total lignin content was determined by Klason method. Maximum UV absorbance and FT-IR spectra were compared. Ratio of syringyl to guaiacyl lignin (S/G ratio as a metric of lignin digestibility was determined by DFRC followed by GC-MS analysis. 1H-NMR spectra of the total lignin was compared with other spectroscopic methods. Results: Staining of thestem cross sections of C. draba showed higher G units in contrast to the higher S units in S. altissimum which was in agreement with 1H-NMR analysis. Total lignin content for H. incana, C. draba and S. altissimum was 27.10%, 23.8% and 24.5%, respectively. The specific maximum UV absorbance appeared between 230-260 nm. FT-IR analysis confirmed the presence of more aromatic structures in the seed maturation stage than the flowering stage. S/G ratio was 0.26, 0.10 and 0.22 for H. incana, C. draba and S. altissimum, respectively.  Conclusion: Except Cardaria draba with the predominance of G subunits in lignin polymer, Hirschfeldia incana and Sisymbrium altissimum are suitable candidates for bioethanol production.

  2. Effect of sulfur fertilization on the sanitary state of plants of the family Brassicaceae

    Directory of Open Access Journals (Sweden)

    Tomasz P. Kurowski

    2012-12-01

    Full Text Available The experiment was carried out in the years 2006-2008 in Bałcyny (N=53°35'49"; E=19°51'20". The aim of this study was to determine the effect of sulfur fertilization on the sanitary state of spring oilseed rape, winter oilseed rape, white mustard and Chinese mustard as well as on the species composition of fungi colonizing their seeds. Sulfur fertilization had a beneficial effect on the health of Brassicaceae plants infested by Alternaria blight, grey mould, Sclerotinia stem rot, Phoma stem canker and Verticillium wilt, but it had a varying effect on the occurrence of powdery mildew. Alternaria alternata and Penicillium spp. were isolated most frequently from Brassicaceae seeds. In general, more fungi (including pathogenic to Brassicaceae were isolated from the seeds of plants grown in non-sulfur fertilized plots. Pathogens occurred primarily on the seed surface, and their number decreased after surface disinfection of seeds.

  3. Comparison in accumulation of lanthanide elements among three Brassicaceae plant sprouts.

    Science.gov (United States)

    Anan, Yasumi; Awaya, Yumi; Ogihara, Yurie; Yoshida, Miyuki; Yawata, Ayako; Ogra, Yasumitsu

    2012-07-01

    Three kinds of sprouts in the Brassicaceae family of plants, namely, pink kale, radish and mustard were evaluated for the possibility of phytoremediation of lanthanides. The mustard sprout more efficiently accumulated lanthanides (e.g. 0.26 nmol La/g) than other Brassicaceae family plant sprouts (0.16 nmol La/g in the radish), however the radish sprout showed the fastest growth among three sprouts. Faster growth compensated for less efficiency in lanthanide accumulation (28 pmol La in the radish vs. 12 pmol La in the mustard) indicating that the radish is the most preferable sprout for the phytoremediation of lanthanides.

  4. The Brassicaceae family displays divergent, shoot-skewed NLR resistance gene expression

    DEFF Research Database (Denmark)

    Munch, David; Gupta, Vikas; Bachmann, Asger

    2018-01-01

    ,235 NLRs from 9 plant species. We found stable NLR root/shoot expression ratios within species, suggesting organ-specific hardwiring of NLR expression patterns in anticipation of distinct challenges. Most monocot and dicot plant species preferentially expressed NLRs in roots. In contrast, Brassicaceae...... species, including oilseed rape and the model plant Arabidopsis thaliana, were unique in showing NLR expression skewed towards the shoot across multiple phylogenetically distinct groups of NLRs. The Brassicaceae are also outliers in the sense that they have lost the common symbiosis signaling pathway...

  5. A novel indirect defence in Brassicaceae: structure and function of extrafloral nectaries in Brassica juncea.

    NARCIS (Netherlands)

    Mathur, V.; Wagenaar, R.; Caissard, J.C.; Reddy, A.S.; Vet, L.E.M.; Cortesero, A.M.; Dam, van N.M.

    2013-01-01

    While nectaries are commonly found in flowers, some plants also form extrafloral nectaries on stems or leaves. For the first time in the family Brassicaceae, here we report extrafloral nectaries in Brassica juncea. The extrafloral nectar (EFN) was secreted from previously amorphic sites on stems,

  6. A novel indirect defence in Brassicaceae: Structure and function of extrafloral nectaries in Brassica juncea

    NARCIS (Netherlands)

    Mathur, V.; Wagenaar, R.; Caissard, J.C.; Sankara Reddy, A.; Vet, L.E.M.; Cortesero, A.M.; Van Dam, N.M.

    2013-01-01

    While nectaries are commonly found in flowers, some plants also form extrafloral nectaries on stems or leaves. For the first time in the family Brassicaceae, here we report extrafloral nectaries in Brassica juncea. The extrafloral nectar (EFN) was secreted from previously amorphic sites on stems,

  7. Comparison of the emergence of three Brassicaceae species of different origins grown in Spain and USA

    Science.gov (United States)

    Thlaspi arvense, Camelina sativa, C. microcarpa and Neslia paniculata are four Brassicaceae family species that are becoming rare in North-Eastern Spain. Conversely, both T. arvense and C. sativa are being investigated as oilseed crops in North America for industrial/biofuel purposes. C. microcarpa ...

  8. Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

    Science.gov (United States)

    This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

  9. Distinct cell wall architectures in seed endosperms in representatives of the Brassicaceae and Solanaceae.

    Science.gov (United States)

    Lee, Kieran J D; Dekkers, Bas J W; Steinbrecher, Tina; Walsh, Cherie T; Bacic, Antony; Bentsink, Leónie; Leubner-Metzger, Gerhard; Knox, J Paul

    2012-11-01

    In some species, a crucial role has been demonstrated for the seed endosperm during germination. The endosperm has been shown to integrate environmental cues with hormonal networks that underpin dormancy and seed germination, a process that involves the action of cell wall remodeling enzymes (CWREs). Here, we examine the cell wall architectures of the endosperms of two related Brassicaceae, Arabidopsis (Arabidopsis thaliana) and the close relative Lepidium (Lepidium sativum), and that of the Solanaceous species, tobacco (Nicotiana tabacum). The Brassicaceae species have a similar cell wall architecture that is rich in pectic homogalacturonan, arabinan, and xyloglucan. Distinctive features of the tobacco endosperm that are absent in the Brassicaceae representatives are major tissue asymmetries in cell wall structural components that reflect the future site of radicle emergence and abundant heteromannan. Cell wall architecture of the micropylar endosperm of tobacco seeds has structural components similar to those seen in Arabidopsis and Lepidium endosperms. In situ and biomechanical analyses were used to study changes in endosperms during seed germination and suggest a role for mannan degradation in tobacco. In the case of the Brassicaceae representatives, the structurally homogeneous cell walls of the endosperm can be acted on by spatially regulated CWRE expression. Genetic manipulations of cell wall components present in the Arabidopsis seed endosperm demonstrate the impact of cell wall architectural changes on germination kinetics.

  10. Molecular Phylogenetics, Temporal Diversification, and Principles of Evolution in the Mustard Family (Brassicaceae)

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Franzke, A.; Al-Shehbaz, I.A.; Bakker, F.T.; Koch, M.A.; Mummenhoff, K.

    2010-01-01

    Brassicaceae is an important family at both the agronomic and scientific level. The family not only inlcudes several model species, but it is also becoming an evolutionary model at the family level. However, resolving the phylogenetic relationships within the family has been problematic, and a

  11. Evolution and protein interactions of AP2 proteins in Brassicaceae: Evidence linking development and environmental responses.

    Science.gov (United States)

    Zeng, Liping; Yin, Yue; You, Chenjiang; Pan, Qianli; Xu, Duo; Jin, Taijie; Zhang, Bailong; Ma, Hong

    2016-06-01

    Plants have evolved a large number of transcription factors (TF), which are enriched among duplicate genes, highlighting their roles in complex regulatory networks. The APETALA2/EREBP-like genes constitute a large plant TF family and participate in development and stress responses. To probe the conservation and divergence of AP2/EREBP genes, we analyzed the duplication patterns of this family in Brassicaceae and identified interacting proteins of representative Arabidopsis AP2/EREBP proteins. We found that many AP2/EREBP duplicates generated early in Brassicaceae history were quickly lost, but many others were retained in all tested Brassicaceae species, suggesting early functional divergence followed by persistent conservation. In addition, the sequences of the AP2 domain and exon numbers were highly conserved in rosids. Furthermore, we used 16 A. thaliana AP2/EREBP proteins as baits in yeast screens and identified 1,970 potential AP2/EREBP-interacting proteins, with a small subset of interactions verified in planta. Many AP2 genes also exhibit reduced expression in an anther-defective mutant, providing a possible link to developmental regulation. The putative AP2-interacting proteins participate in many functions in development and stress responses, including photomorphogenesis, flower development, pathogenesis, drought and cold responses, abscisic acid and auxin signaling. Our results present the AP2/EREBP evolution patterns in Brassicaceae, and support a proposed interaction network of AP2/EREBP proteins and their putative interacting proteins for further study. © 2015 Institute of Botany, Chinese Academy of Sciences.

  12. Brassica database (BRAD) version 2.0: integrating and mining Brassicaceae species genomic resources.

    Science.gov (United States)

    Wang, Xiaobo; Wu, Jian; Liang, Jianli; Cheng, Feng; Wang, Xiaowu

    2015-01-01

    The Brassica database (BRAD) was built initially to assist users apply Brassica rapa and Arabidopsis thaliana genomic data efficiently to their research. However, many Brassicaceae genomes have been sequenced and released after its construction. These genomes are rich resources for comparative genomics, gene annotation and functional evolutionary studies of Brassica crops. Therefore, we have updated BRAD to version 2.0 (V2.0). In BRAD V2.0, 11 more Brassicaceae genomes have been integrated into the database, namely those of Arabidopsis lyrata, Aethionema arabicum, Brassica oleracea, Brassica napus, Camelina sativa, Capsella rubella, Leavenworthia alabamica, Sisymbrium irio and three extremophiles Schrenkiella parvula, Thellungiella halophila and Thellungiella salsuginea. BRAD V2.0 provides plots of syntenic genomic fragments between pairs of Brassicaceae species, from the level of chromosomes to genomic blocks. The Generic Synteny Browser (GBrowse_syn), a module of the Genome Browser (GBrowse), is used to show syntenic relationships between multiple genomes. Search functions for retrieving syntenic and non-syntenic orthologs, as well as their annotation and sequences are also provided. Furthermore, genome and annotation information have been imported into GBrowse so that all functional elements can be visualized in one frame. We plan to continually update BRAD by integrating more Brassicaceae genomes into the database. Database URL: http://brassicadb.org/brad/. © The Author(s) 2015. Published by Oxford University Press.

  13. Thiouracil-Forming Bacteria Identified and Characterized upon Porcine In Vitro Digestion of Brassicaceae Feed

    Science.gov (United States)

    Kiebooms, Julie A. L.; Wauters, Jella; Vanden Bussche, Julie; Houf, Kurt; De Vos, Paul; Van Trappen, Stefanie; Cleenwerck, Ilse

    2014-01-01

    In recent years, the frequent detection of the banned thyreostat thiouracil (TU) in livestock urine has been related to endogenous TU formation following digestion of glucosinolate-rich Brassicaceae crops. Recently, it was demonstrated that, upon in vitro digestion of Brassicaceae, fecal bacteria induce TU detection in livestock (porcine livestock > bovines). Therefore, the present study was intended to isolate and identify bacteria involved in this intestinal TU formation upon Brassicaceae digestion and to gain more insight into the underlying mechanism in porcine livestock. Twenty porcine fecal inocula (gilts and multiparous sows) were assessed through static in vitro colonic-digestion simulations with rapeseed. After derivatization and extraction of the fecal suspensions, TU was analyzed using liquid chromatography-tandem mass spectrometry (LC-MS2). On average, lower TU concentrations were observed in fecal colonic simulations in gilts (8.35 ng g−1 rapeseed ± 3.42 [mean ± standard deviation]) than in multiparous sows (52.63 ng g−1 ± 16.17), which correlates with maturation of the gut microbial population with age. Further exploration of the mechanism showed cell-dependent activity of the microbial conversion and sustained TU-forming activity after subjection of the fecal inoculum to moderate heat over a time span of up to 30 min. Finally, nine TU-producing bacterial species were successfully isolated and identified by a combination of biochemical and molecular techniques as Escherichia coli (n = 5), Lactobacillus reuteri (n = 2), Enterococcus faecium (n = 1), and Salmonella enterica subsp. arizonae (n = 1). This report demonstrates that endogenous formation of TU is Brassicaceae induced and occurs under colonic conditions most likely through myrosinase-like enzyme activity expressed by different common intestinal bacterial species. PMID:25261511

  14. Brassicaceae Mustards: Traditional and Agronomic Uses in Australia and New Zealand

    Directory of Open Access Journals (Sweden)

    Mahmudur Rahman

    2018-01-01

    Full Text Available Commonly cultivated Brassicaceae mustards, namely garlic mustard (Alliaria petiolata, white mustard (Brassica alba, Ethiopian mustard (B. carinata, Asian mustard (B. juncea, oilseed rape (B. napus, black mustard (B. nigra, rapeseed (B. rapa, white ball mustard (Calepina irregularis, ball mustard (Neslia paniculata, treacle mustard (Erysimum repandum, hedge mustard (Sisymbrium officinale, Asian hedge mustard (S. orientale, smooth mustard (S. erysimoides and canola are the major economically important oilseed crops in many countries. Mustards were naturalized to Australia and New Zealand and Australia is currently the second largest exporter of Brassicaceae oilseeds to meet the global demand for a healthy plant-derived oil, high in polyunsaturated fats. Apart from providing edible oil, various parts of these plants and many of their phytochemicals have been used traditionally for both agronomic as well as medicinal purposes, with evidence of their use by early Australian and New Zealand settlers and also the indigenous population. This review provides an overview of the current knowledge of traditional and agronomic uses of Brassicaceae oilseeds and mustards with a focus on their importance in Australia and New Zealand.

  15. A comparative study of flavonoid compounds, vitamin C, and antioxidant properties of baby leaf Brassicaceae species.

    Science.gov (United States)

    Martínez-Sánchez, Ascensión; Gil-Izquierdo, Angel; Gil, María I; Ferreres, Federico

    2008-04-09

    A comparative study of antioxidant compounds, flavonoids and vitamin C, and also antioxidant activity was carried out in four species of Brassicaceae vegetables used for salads: watercress ( Nasturtium officinale R. Br.), mizuna [ Brassica rapa L. subsp. nipposinica (L.H. Bailey) Haneltand], wild rocket [ Diplotaxis tenuifolia (L.) DC.], and salad rocket [ Eruca vesicaria (L.) Cav.]. The characterization of individual phenolic compounds by HPLC-DAD-MS/MS-ESI in watercress and mizuna completes the polyphenol study previously reported for wild rocket and salad rocket. The qualitative study of flavonoids in watercress leaves showed a characteristic glycosylation pattern with rhamnose at the 7 position. Isorhamnetin 3,7-di- O-glucoside was identified in mizuna leaves and may be considered a chemotaxonomical marker in some B. rapa subspecies. Brassicaceae species showed differences in the quantitative study of flavonoids, and the highest content was detected in watercress leaves. Watercress and wild rocket leaves had the highest content of vitamin C. The antioxidant activity evaluated by different methods (ABTS, DPPH, and FRAP assays) showed a high correlation level with the content of polyphenols and vitamin C. In conclusion, the Brassicaceae leaves studied, watercress, mizuna, wild rocket, and salad rocket, presented a large variability in the composition and content of antioxidant compounds. These baby leaf species are good dietary sources of antioxidants with an important variability of bioactive compounds.

  16. Secondary evolution of a self-incompatibility locus in the Brassicaceae genus Leavenworthia.

    Directory of Open Access Journals (Sweden)

    Sier-Ching Chantha

    Full Text Available Self-incompatibility (SI is the flowering plant reproductive system in which self pollen tube growth is inhibited, thereby preventing self-fertilization. SI has evolved independently in several different flowering plant lineages. In all Brassicaceae species in which the molecular basis of SI has been investigated in detail, the product of the S-locus receptor kinase (SRK gene functions as receptor in the initial step of the self pollen-rejection pathway, while that of the S-locus cysteine-rich (SCR gene functions as ligand. Here we examine the hypothesis that the S locus in the Brassicaceae genus Leavenworthia is paralogous with the S locus previously characterized in other members of the family. We also test the hypothesis that self-compatibility in this group is based on disruption of the pollen ligand-producing gene. Sequence analysis of the S-locus genes in Leavenworthia, phylogeny of S alleles, gene expression patterns, and comparative genomics analyses provide support for both hypotheses. Of special interest are two genes located in a non-S locus genomic region of Arabidopsis lyrata that exhibit domain structures, sequences, and phylogenetic histories similar to those of the S-locus genes in Leavenworthia, and that also share synteny with these genes. These A. lyrata genes resemble those comprising the A. lyrata S locus, but they do not function in self-recognition. Moreover, they appear to belong to a lineage that diverged from the ancestral Brassicaceae S-locus genes before allelic diversification at the S locus. We hypothesize that there has been neo-functionalization of these S-locus-like genes in the Leavenworthia lineage, resulting in evolution of a separate ligand-receptor system of SI. Our results also provide support for theoretical models that predict that the least constrained pathway to the evolution of self-compatibility is one involving loss of pollen gene function.

  17. Verbreitung und Ökologie von Nasturtium x sterile (Airy Shaw) Oef. (Brassicaceae) in Mitteleuropa

    OpenAIRE

    Bleeker, Walter; Hurka, Herbert

    2012-01-01

    Anhand der Ergebnisse von Chromosomenzählungen wird die Verbreitung der Nasturtium- Taxa (Brassicaceae) in Mitteleuropa diskutiert. Nasturtium officina/e R. Br. (2n = 32) und Nasturtium microphyllum (Boenn.) Rchb. (2n = 64) sind primär geographisch isoliert, wobei N. officinale seinen Verbreitungsschwerpunkt im südlichen Mitteleuropa hat, während N. microphyllum im nördlichen Mitteleuropa vorkommt. Die natürlichen Areale der Taxa sind durch den ehemaligen Anbau von Nasturtium als Salatpflanze...

  18. Glucosinolates in members of the family brassicaceae: separation and identification by LC/ESI-MS-MS.

    Science.gov (United States)

    Matthäus, B; Luftmann, H

    2000-06-01

    Seeds of 14 different members of the family Brassicaceae were investigated with regard to their content and composition of glucosinolates by HPLC-UV/ESI-MS-MS coupling. The seeds were extracted with hot methanol/water (70:30 v/v) and the desulfoglucosinolates isolated by anion-exchange chromatography with solid-phase extraction columns. The desulfoglucosinolates were detected by UV and identified by ESI-MS/MS with the neutral loss method. Nineteen different glucosinolates were detected in the seeds with a wide range of contents (10-200 micromol/g) and a great variation in the composition.

  19. KEEFEKTIFAN LIMBAH TANAMAN BRASSICACEAE UNTUK PENGENDALI NEMATODA PURU AKAR (MELOIDOGYNE SPP. PADA MIKROPLOT DI LAPANGAN

    Directory of Open Access Journals (Sweden)

    Muhammad Jabal Nur

    2016-09-01

    Full Text Available Effectivenes of Brassicaceae plant wastes to control the root knot nematodes (Meloidogyne spp. at a field microplot scale. Meloidogyne spp. is a soil borne pathogen that infects plant roots and causes root galls. Root knot nematodes can reduce crop production by 15 to 95%, so that the control measures are needed. One of the control methods is using plants as biofumigant. Plants of the family Brassicaceae were reported contain glucosinolate (GSL. During decomposition, GSL is hydrolized to isothiocyanates (ITS which is a highly toxic compound to soil organisms, including nematodes. The research objective was to determine the effectiveness of five Brassicaceous plant wastes, namely cabbage (B. oleracea var capitata, radish (Raphanus sativus, broccoli (B. oleracea var italica, chinese cabbage (B. chinensis and pakcoy (B. rapa var parachinensis to suppress root knot nematodes (RKN. The experiment was conducted on microplot scale in the field. The experimental design used was a 4x5 factorial CRD. The first factors are waste of Brassica and the second factors are the amount of Brassica wastes per microplot. The experiments were made in 6 replications. Application of 5 Brassica plant wastes at all doses tested effectively reduced the number of root knot by 45.65% to 94.43% and increased the average number of tomato fruits. Tomato plants grew better at microplots when treated with chinese cabbage and pakcoy wastes.

  20. Phytophagy of the predator Podisus nigrispinus (Dallas, 1851 (Hemiptera: Pentatomidae fed on prey and Brassicaceae

    Directory of Open Access Journals (Sweden)

    J. F. J. Grigolli

    2017-03-01

    Full Text Available Abstract The purpose of this study was to investigate the development and reproduction of the zoophytophagous predator Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed kale, broccoli and cabbage affects its. Nymphs and adults of this predator were fed on larvae of Plutella xylostella (L. (Lepidoptera: Plutellidae as prey with kale, cabbage, or broccoli. In the nymph period, the duration and prey consumption were similar with all the Brassicacea cultivar. However, nymph viability was higher for predators with broccoli leaves. The mean weight of 5th-instar nymphs, newly emerged females and the sex ratio were similar among the Brassicacea cultivars, while newly emerged males were heavier with kale and broccoli leaves. The supply of broccoli leaves resulted in greater oviposition, higher number of eggs per egg mass and longer longevity of P. nigrispinus males and females. Furthermore, the consumption of P. xylostella larvae by adult predators was higher with these cultivars. The net reproductive rate (R0 and mean generation time (T were highest for predators with prey and broccoli leaves. The reproductive parameters of P. nigrispinus were enhanced when fed on P. xylostella larvae with and broccoli leaves, which can be an alternative diet in laboratory rearing of this predator.

  1. Understanding of MYB Transcription Factors Involved in Glucosinolate Biosynthesis in Brassicaceae.

    Science.gov (United States)

    Seo, Mi-Suk; Kim, Jung Sun

    2017-09-14

    Glucosinolates (GSLs) are widely known secondary metabolites that have anticarcinogenic and antioxidative activities in humans and defense roles in plants of the Brassicaceae family. Some R2R3-type MYB (myeloblastosis) transcription factors (TFs) control GSL biosynthesis in Arabidopsis. However, studies on the MYB TFs involved in GSL biosynthesis in Brassica species are limited because of the complexity of the genome, which includes an increased number of paralog genes as a result of genome duplication. The recent completion of the genome sequencing of the Brassica species permits the identification of MYB TFs involved in GSL biosynthesis by comparative genome analysis with A. thaliana. In this review, we describe various findings on the regulation of GSL biosynthesis in Brassicaceae. Furthermore, we identify 63 orthologous copies corresponding to five MYB TFs from Arabidopsis, except MYB76 in Brassica species. Fifty-five MYB TFs from the Brassica species possess a conserved amino acid sequence in their R2R3 MYB DNA-binding domain, and share close evolutionary relationships. Our analysis will provide useful information on the 55 MYB TFs involved in the regulation of GSL biosynthesis in Brassica species, which have a polyploid genome.

  2. The extracellular pollen coat in members of the Brassicaceae: composition, biosynthesis, and functions in pollination.

    Science.gov (United States)

    Murphy, D J

    2006-08-01

    I have used cellular and molecular genetic and bioinformatic approaches to characterise the components of the pollen coat in plants of the family Brassicaceae, including Arabidopsis thaliana and several brassicas including Brassica napus, B. oleracea, and B. rapa. The pollen coat in these species is mostly made up of a unique mixture of lipids that is highly enriched in acylated compounds, such as sterol esters and phospholipids. These acyl lipids are characterised by an unusually high degree of saturation. The fatty acids typically contain 70-90% saturated acyl residues such as myristate, palmitate, and stearate. The major sterol components of the pollen coat are saturated fatty acyl esters of stigmasterol, campesterol, and campestdienol. In addition to lipids, the second major component of the pollen coat is a specific group of proteins that is dominated by a family of proteins that we term pollenins. Although pollenins are by far the major protein components of the pollen coat of members of the Brassicaceae, proteomic analysis reveals that there are several additional protein components, including lipases, protein kinases, a pectin esterase, and a caleosin. The biosynthesis of these lipids and proteins and their significance for overall pollen function are reviewed and discussed.

  3. Evolution of CONSTANS Regulation and Function after Gene Duplication Produced a Photoperiodic Flowering Switch in the Brassicaceae.

    Science.gov (United States)

    Simon, Samson; Rühl, Mark; de Montaigu, Amaury; Wötzel, Stefan; Coupland, George

    2015-09-01

    Environmental control of flowering allows plant reproduction to occur under optimal conditions and facilitates adaptation to different locations. At high latitude, flowering of many plants is controlled by seasonal changes in day length. The photoperiodic flowering pathway confers this response in the Brassicaceae, which colonized temperate latitudes after divergence from the Cleomaceae, their subtropical sister family. The CONSTANS (CO) transcription factor of Arabidopsis thaliana, a member of the Brassicaceae, is central to the photoperiodic flowering response and shows characteristic patterns of transcription required for day-length sensing. CO is believed to be widely conserved among flowering plants; however, we show that it arose after gene duplication at the root of the Brassicaceae followed by divergence of transcriptional regulation and protein function. CO has two close homologs, CONSTANS-LIKE1 (COL1) and COL2, which are related to CO by tandem duplication and whole-genome duplication, respectively. The single CO homolog present in the Cleomaceae shows transcriptional and functional features similar to those of COL1 and COL2, suggesting that these were ancestral. We detect cis-regulatory and codon changes characteristic of CO and use transgenic assays to demonstrate their significance in the day-length-dependent activation of the CO target gene FLOWERING LOCUS T. Thus, the function of CO as a potent photoperiodic flowering switch evolved in the Brassicaceae after gene duplication. The origin of CO may have contributed to the range expansion of the Brassicaceae and suggests that in other families CO genes involved in photoperiodic flowering arose by convergent evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Corolla monosymmetry: evolution of a morphological novelty in the Brassicaceae family.

    Science.gov (United States)

    Busch, Andrea; Horn, Stefanie; Mühlhausen, Andreas; Mummenhoff, Klaus; Zachgo, Sabine

    2012-04-01

    Evolution of floral monosymmetry is thought to be a major driving force of angiosperm radiation, making angiosperms the most successful land plant group in terms of species richness. Monosymmetry evolved from a polysymmetric ancestor repeatedly in different angiosperm lineages, where it likely facilitated diversification through the interaction with insects. Most monosymmetric taxa are thus dominated by monosymmetric members. However, in the Brassicaceae, only few members develop a monosymmetric corolla with two petal pairs of unequal size, making them an ideal system to study the evolution of molecular mechanisms enhancing flower complexity. Monosymmetry is controlled by the TCP transcription factors that belong to the CYC2 clade in distantly related taxa. In Iberis amara, the first crucifer analyzed in terms of monosymmetry development, unequal corolla formation is due to a stronger CYC2 clade gene expression in the smaller adaxial petals compared with the larger abaxial ones. Phylogenetic reconstruction of the crucifer family reveals that the monosymmetric genera Iberis, Calepina, and Teesdalia belong to one major crucifer lineage. Monosymmetry is most pronounced in Iberis and less so in Calepina and Teesdalia, with a positive dosage-dependent correlation between the strength of a CYC2 expression difference and the extent of monosymmetry formation. An early adaxial CYC2 expression in floral meristems, observed in many distantly related taxa, might have facilitated the repeated evolution of CYC2-controlled monosymmetry. Comparison of early and late CYC2 expression in monosymmetric and polysymmetric crucifers representative for the four major crucifer lineages reveals that an adaxial CYC2 expression in floral meristems is likely ancestral for the Brassicaceae. However, it got lost in all analyzed monosymmetric members and is, as such, not a prerequisite for the establishment of corolla monosymmetry in crucifers. Here, monosymmetry evolved via a heterochronic CYC2

  5. Variation of antioxidative activity and growth enhancement of Brassicaceae induced by low-pressure oxygen plasma

    Science.gov (United States)

    Ono, Reoto; Hayashi, Nobuya

    2015-06-01

    The mechanism of growth enhancement induced by active oxygen species generated in an oxygen plasma is investigated. The plant growth enhancement induced by the active oxygen species would relate to an antioxidative activity, which is one of the biological responses. The amount of generated active oxygen species is varied by the oxygen gas pressure in a low-pressure RF glow discharge plasma. The antioxidative activity of sprouts of Brassicaceae induced by the oxygen plasma is maximized at pressures between 30 and 40 Pa, whereas the antioxidative activity becomes small at around 60 and 80 Pa. The pressure dependence of the antioxidative activity of sprout stems is opposite to that of the stem length of the sprouts. The growth enhancement would be induced by the increase in the concentration of active oxygen species in plants owing to the decrease in the amount of antioxidative substances.

  6. Biochemical and biological characterization of two Brassicaceae after their commercial expiry date.

    Science.gov (United States)

    Ombra, Maria Neve; Cozzolino, Autilia; Nazzaro, Filomena; d'Acierno, Antonio; Tremonte, Patrizio; Coppola, Raffaele; Fratianni, Florinda

    2017-03-01

    Two Brassicaceae (Eruca sativa, Brassica oleracea var. sabauda) were stored in air and under a modified atmosphere for several days after their expiry date and then analyzed. The polyphenol content and composition, as well as the antioxidant activity of the extracts, were assessed, compared to the fresh products. Antimicrobial properties on tester strains (Bacillus cereus, Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa) and in vitro anti-proliferative activity were evaluated. The cabbage extracts exhibited antimicrobial activity mainly on the ninth day after the expiry date and retained significant inhibitory effects against colon carcinoma (CaCo-2) cells. The rocket salad extract exhibited antiproliferative but not antimicrobial activity. Overall, our results indicated that they might represent a good source of natural antioxidants with antimicrobial and anti-proliferative activity, also after their expiry date, suggesting their exploitation for the recovery of important biomolecules used in the food and health industry. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Phylogenetic relationships in Brassicaceae tribe Alysseae inferred from nuclear ribosomal and chloroplast DNA sequence data.

    Science.gov (United States)

    Rešetnik, Ivana; Satovic, Zlatko; Schneeweiss, Gerald M; Liber, Zlatko

    2013-12-01

    Numerous molecular systematic studies within Brassicaceae have resulted in a strongly improved classification of the family, as morphologically defined units at and above the generic level were often found to poorly reflect phylogenetic relationships. Here, we focus on tribe Alysseae, which despite its size (accounting for about 7% of all species) has only received limited coverage in previous phylogenetic studies. Specifically, we want to test phylogenetic hypotheses implied by current tribal and generic circumscriptions and to put diversification within tribe Alysseae into a temporal context. To this end, sequence data from the nrDNA ITS and two plastid regions (ndhF gene, trnL-F intergenic spacer) were obtained for 176 accessions, representing 16 out of 17 currently recognized genera of the tribe, and were phylogenetically analysed, among others, using a relaxed molecular clock. Due to large discrepancies with respect to published ages of Brassicaceae, age estimates concerning Alysseae are, however, burdened with considerable uncertainty. The tribe is monophyletic and contains four strongly supported major clades and Alyssum homalocarpum, whose relationships among each other remain uncertain due to incongruences between nuclear and plastid DNA markers. The largest genus of the tribe, Alyssum, is not monophyletic and contains, apart from A. homalocarpum, two distinct lineages, corresponding to sections Alyssum, Psilonema, Gamosepalum and to sections Odontarrhena and Meniocus, respectively. Clypeola, whose monophyly is supported only by the plastid data, is very closely related to and possibly nested within the second Alyssum lineage. Species of the genus Fibigia intermingle with those of Alyssoides, Clastopus, Degenia, and Physoptychis, rendering Fibigia polyphyletic. The monotypic genera Leptoplax and Physocardamum are embedded in Bornmuellera. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Underexplored biodiversity of Eastern Mediterranean biota: systematics and evolutionary history of the genus Aubrieta (Brassicaceae).

    Science.gov (United States)

    Koch, Marcus A; Karl, Robert; German, Dmitry A

    2017-01-01

    Aubrieta is a taxonomically difficult genus from the Brassicaceae family with approximately 20 species centred in Turkey and Greece. Species boundaries and their evolutionary history are poorly understood. Therefore, we analysed bio- and phylogeographic relationships and evaluated morphological variation to study the evolution of this genus. Phylogenetic analyses of DNA sequence variation of nuclear-encoded loci and plastid DNA were used to unravel phylogeographic patterns. Morphometric analyses were conducted to study species delimitation. DNA sequence-based mismatch distribution and climate-niche analyses were performed to explain various radiations in space and time during the last 2·5 million years. Species groups largely show non-overlapping distribution patterns in the eastern Mediterranean and Asia Minor. We recognized 20 species and provide evidence for overlooked species, thereby highlighting taxonomical difficulties but also demonstrating underexplored species diversity. The centre of origin of Aubrieta is probably Turkey, from which various clades expanded independently towards Asia Minor, south to Lebanon and west to Greece and the Balkans during the Pleistocene. Pleistocene climatic fluctuations had a pronounced effect on Aubrieta speciation and radiation during the last 1·1 million years in the Eastern Mediterranean and Asia Minor. In contrast to many other Brassicaceae, speciation processes did not involve excessive formation of polyploids, but displayed formation of diploids with non-overlapping present-day distribution areas. Expansions from the Aubrieta centre of origin and primary centre of species diversity showed adaptation trends towards higher temperature and drier conditions. However, later expansion and diversification of taxa from within the second centre of species diversity in Greece started ∼0·19 Mya and were associated with a general transition of species adaptation towards milder temperatures and less dry conditions. © The

  9. Species-specific and leaf-age dependent effects of ultraviolet radiation on two Brassicaceae.

    Science.gov (United States)

    Reifenrath, Kerstin; Müller, Caroline

    2007-03-01

    Ultraviolet (UV) radiation affects the chemical composition of a plant. Since young leaves are of higher value due to their increased photosynthetic activity, for these a more efficient protection and thus stronger responses to a short-term exposure to natural radiation including or excluding UV-A plus UV-B radiation ("+UV" vs. "-UV") were expected than for old leaves. Nutrients and characteristic secondary metabolites of two species of Brassicaceae were analysed after two days exposure in foil-tents with different UV filtering qualities. Contents of water, carbon, nitrogen and soluble protein were found to be affected by both UV and leaf-age in Sinapis alba L. but mainly by leaf-age in Nasturtium officinale L. Glucosinolates and myrosinases, both partners of the defence system of Brassicaceae, responded highly species-specific to UV exposure. Moreover, leaf-age mainly affected total glucosinolate concentrations in S. alba, but myrosinase activities in N. officinale. The most pronounced response to UV was found in the accumulation of flavonoids which are needed to shield the leaf interior against UV. In S. alba, relative contents of quercetin flavonols increased at the expense of kaempferols in +UV exposed leaves. In N. officinale, total flavonoid quantities were 10-fold lower in -UV exposed young leaves compared to S. alba, and flavonoid accumulation was induced by UV specifically in old leaves. Hydroxycinnamic acid concentrations were not affected in both species. In total, these herbaceous species showed a highly species-specific and age-dependent plasticity in response to short-term exposure to UV which is discussed with respect to their defence strategies.

  10. Progesterone 5β-reductase genes of the Brassicaceae family as function-associated molecular markers.

    Science.gov (United States)

    Munkert, J; Costa, C; Budeanu, O; Petersen, J; Bertolucci, S; Fischer, G; Müller-Uri, F; Kreis, W

    2015-11-01

    This study aimed to define progesterone 5β-reductases (P5βR, EC 1.3.99.6, enone 1,4-reductases) as function-associated molecular markers at the plant family level. Therefore cDNAs were isolated from 25 Brassicaceae species, including two species, Erysimum crepidifolium and Draba aizoides, known to produce cardiac glycosides. The sequences were used in a molecular phylogeny study. The cladogram created is congruent to the existing molecular analyses. Recombinant His-tagged forms of the P5βR cDNAs from Aethionema grandiflorum, Draba aizoides, Nasturtium officinale, Raphanus sativus and Sisymbrium officinale were expressed in E. coli. Enone 1,4-reductase activity was demonstrated in vitro using progesterone and 2-cyclohexen-1-one as substrates. Evidence is provided that functional P5βRs are ubiquitous in the Brassicaceae. The recombinant P5βR enzymes showed different substrate preferences towards progesterone and 2-cyclohexen-1-one. Sequence comparison of the catalytic pocket of the P5βR enzymes and homology modelling using Digitalis lanata P5βR (PDB ID: 2V6G) as template highlighted the importance of the hydrophobicity of the binding pocket for substrate discrimination. It is concluded that P5βR genes or P5βR proteins can be used as valuable function-associated molecular markers to infer taxonomic relationship and evolutionary diversification from a metabolic/catalytic perspective. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

  11. Isolation and sequence analysis of a chalcone synthase cDNA of Matthiola incana R. Br. (Brassicaceae).

    Science.gov (United States)

    Epping, B; Kittel, M; Ruhnau, B; Hemleben, V

    1990-06-01

    A cDNA clone (pcM12) of the chalcone synthase (CHS) of Matthiola incana R. Br. (Brassicaceae) was isolated from a cDNA library, sequenced and analysed. It comprises the complete coding sequence for the CHS and 5' and 3' untranslated regions. The deduced amino acid sequence shows that the Matthiola incana CHS consists of 394 amino acid residues. Comparison with CHS amino acid sequences of other plants indicates more than 82% homology.

  12. Inheritance and expression patterns of BN28, a low temperature induced gene in Brassica napus, throughout the Brassicaceae.

    Science.gov (United States)

    Hawkins, G P; Nykiforuk, C L; Johnson-Flanagan, A M; Boothe, J G

    1996-08-01

    Molecular genetics is becoming an important tool in the breeding and selection of agronomically important traits. BN28 is a low temperature induced gene in Brassicaceae species. PCR and Southern blot analysis indicate that BN28 is polymorphic in the three diploid genomes: Brassica rapa (AA), Brassica nigra (BB), and Brassica oleracea (CC). Of the allotetraploids, Brassica napus (AACC) is the only species to have inherited homologous genes from both parental genomes. Brassica juncea (AABB) and Brassica carinata (BBCC) have inherited homologues from the AA and CC genomes, respectively, while Sinapsis arvensis (SS) contains a single homologue from the BB genome and Sinapsis alba (dd) appears to be different from all the diploid parents. All species show message induction when exposed to low temperature. However, differences in expression were noticed at the protein level, with silencing occurring in the BB genome at the level of translation. Results suggest that silencing is occurring in diploid species where duplication may not have occurred. Molecular characterization and inheritance of BN28 homologues in the Brassicaceae may play an important role in determining their quantitative function during exposure to low temperature. Key words : Brassicaceae, BN28, inheritance, polymorphism.

  13. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  14. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  15. Dynamic Subcellular Localization of Iron during Embryo Development in Brassicaceae Seeds

    Directory of Open Access Journals (Sweden)

    Miguel A. Ibeas

    2017-12-01

    Full Text Available Iron is an essential micronutrient for plants. Little is know about how iron is loaded in embryo during seed development. In this article we used Perls/DAB staining in order to reveal iron localization at the cellular and subcellular levels in different Brassicaceae seed species. In dry seeds of Brassica napus, Nasturtium officinale, Lepidium sativum, Camelina sativa, and Brassica oleracea iron localizes in vacuoles of cells surrounding provasculature in cotyledons and hypocotyl. Using B. napus and N. officinale as model plants we determined where iron localizes during seed development. Our results indicate that iron is not detectable by Perls/DAB staining in heart stage embryo cells. Interestingly, at torpedo development stage iron localizes in nuclei of different cells type, including integument, free cell endosperm and almost all embryo cells. Later, iron is detected in cytoplasmic structures in different embryo cell types. Our results indicate that iron accumulates in nuclei in specific stages of embryo maturation before to be localized in vacuoles of cells surrounding provasculature in mature seeds.

  16. Relaxed pollinator-mediated selection weakens floral integration in self-compatible taxa of Leavenworthia (Brassicaceae).

    Science.gov (United States)

    Anderson, Ingrid A; Busch, Jeremiah W

    2006-06-01

    Natural selection should favor the integration of floral traits that enhance pollen export and import in plant populations that rely upon pollinators. If this is true, then phenotypic correlations between floral traits should weaken in self-fertilizing groups that do not require pollinator visitation to produce seed. We tested this hypothesis in Leavenworthia, a plant genus in which there have been multiple independent losses of the sporophytic self-incompatibility system found throughout the Brassicaceae. In particular, we conducted phylogenetically independent contrasts of floral trait correlations between two pairs of self-incompatible (SI) and self-compatible (SC) sister taxa. In support of the hypothesis that pollinator-mediated selection integrates floral traits, we found that both SC Leavenworthia taxa have weaker overall floral correlations in comparison to sister taxa that rely upon pollinators. The two independently derived SC Leavenworthia flowers have significantly weaker stamen-petal or pistil-petal correlations, respectively, whereas the stamen-pistil correlation remains constant. These patterns suggest that relaxation of pollinator-mediated selection weakens the integration of traits associated with pollen export and import. The retention of high stamen-pistil correlations in the SC taxa of Leavenworthia further implies that the integration of these traits is either constrained or maintained by selection favoring the successful transfer of pollen within flowers to secure self-pollination.

  17. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  18. Species Delimitation and Interspecific Relationships of the Genus Orychophragmus (Brassicaceae) Inferred from Whole Chloroplast Genomes.

    Science.gov (United States)

    Hu, Huan; Hu, Quanjun; Al-Shehbaz, Ihsan A; Luo, Xin; Zeng, Tingting; Guo, Xinyi; Liu, Jianquan

    2016-01-01

    Genetic variations from few chloroplast DNA fragments show lower discriminatory power in the delimitation of closely related species and less resolution ability in discerning interspecific relationships than from nrITS. Here we use Orychophragmus (Brassicaceae) as a model system to test the hypothesis that the whole chloroplast genomes (plastomes), with accumulation of more variations despite the slow evolution, can overcome these weaknesses. We used Illumina sequencing technology via a reference-guided assembly to construct complete plastomes of 17 individuals from six putatively assumed species in the genus. All plastomes are highly conserved in genome structure, gene order, and orientation, and they are around 153 kb in length and contain 113 unique genes. However, nucleotide variations are quite substantial to support the delimitation of all sampled species and to resolve interspecific relationships with high statistical supports. As expected, the estimated divergences between major clades and species are lower than those estimated from nrITS probably due to the slow substitution rate of the plastomes. However, the plastome and nrITS phylogenies were contradictory in the placements of most species, thus suggesting that these species may have experienced complex non-bifurcating evolutions with incomplete lineage sorting and/or hybrid introgressions. Overall, our case study highlights the importance of using plastomes to examine species boundaries and establish an independent phylogeny to infer the speciation history of plants.

  19. Dynamic Subcellular Localization of Iron during Embryo Development in Brassicaceae Seeds.

    Science.gov (United States)

    Ibeas, Miguel A; Grant-Grant, Susana; Navarro, Nathalia; Perez, M F; Roschzttardtz, Hannetz

    2017-01-01

    Iron is an essential micronutrient for plants. Little is know about how iron is loaded in embryo during seed development. In this article we used Perls/DAB staining in order to reveal iron localization at the cellular and subcellular levels in different Brassicaceae seed species. In dry seeds of Brassica napus, Nasturtium officinale, Lepidium sativum, Camelina sativa, and Brassica oleracea iron localizes in vacuoles of cells surrounding provasculature in cotyledons and hypocotyl. Using B. napus and N. officinale as model plants we determined where iron localizes during seed development. Our results indicate that iron is not detectable by Perls/DAB staining in heart stage embryo cells. Interestingly, at torpedo development stage iron localizes in nuclei of different cells type, including integument, free cell endosperm and almost all embryo cells. Later, iron is detected in cytoplasmic structures in different embryo cell types. Our results indicate that iron accumulates in nuclei in specific stages of embryo maturation before to be localized in vacuoles of cells surrounding provasculature in mature seeds.

  20. Evolution of DNA methylation patterns in the Brassicaceae is driven by differences in genome organization.

    Directory of Open Access Journals (Sweden)

    Danelle K Seymour

    2014-11-01

    Full Text Available DNA methylation is an ancient molecular modification found in most eukaryotes. In plants, DNA methylation is not only critical for transcriptionally silencing transposons, but can also affect phenotype by altering expression of protein coding genes. The extent of its contribution to phenotypic diversity over evolutionary time is, however, unclear, because of limited stability of epialleles that are not linked to DNA mutations. To dissect the relative contribution of DNA methylation to transposon surveillance and host gene regulation, we leveraged information from three species in the Brassicaceae that vary in genome architecture, Capsella rubella, Arabidopsis lyrata, and Arabidopsis thaliana. We found that the lineage-specific expansion and contraction of transposon and repeat sequences is the main driver of interspecific differences in DNA methylation. The most heavily methylated portions of the genome are thus not conserved at the sequence level. Outside of repeat-associated methylation, there is a surprising degree of conservation in methylation at single nucleotides located in gene bodies. Finally, dynamic DNA methylation is affected more by tissue type than by environmental differences in all species, but these responses are not conserved. The majority of DNA methylation variation between species resides in hypervariable genomic regions, and thus, in the context of macroevolution, is of limited phenotypic consequence.

  1. Numerical taxonomy of the genus Matthiola (Brassicaceae in Northeast of Iran based on morphological traits

    Directory of Open Access Journals (Sweden)

    Mozhgan Rashid Taranloo

    2014-01-01

    Full Text Available The genus Matthiola R. BR. (Brassicaceae consists of 48 species in the Iranian plateau, of which only seven species are distributed in northeast of Iran. Six species erre collected from the region under study including M. afghanica, M. alyssifolia, M. chenopodiifolia, M. chorassanica, M. dumulosa and M. farinose. Two species, M. flavida and M. revoluta were recorded for the first time in this study. Some specimens of an unknown taxon entitled Matthiola sp. are also collected in the region and included in the present study. In this study, we tried to use a set of morphologically informative characters which could determine species boundaries and also provide appropriate identification key to the genus in the northeast of Iran. 71 morphological features including quantitative and qualitative were examined on 68 herbarium and field-collected accessions followed by statistical analyses. The results of the univariate analysis indicated that "presence/absence of trichome on the stem and leaf" and "presence/absence of glandular trichomes on the sepal and pedicel" did not significantly differentiate the species and they were excluded from the subsequent analysis. The results of multivariate analysis showed that the species under study were grouped within three groups. First group included specimens of the species M. alyssifolia, the species M. afghanica, M. chenopodiifolia, M. dumulosa, M. farinosa, M. flavida and Matthiola sp. were placed in second group and third group included specimens of the two species M. chorassanica and M. revoluta.

  2. Effect of biofumigation with brassica pellets combined with Brassicaceae cover crops and plastic cover on the survival and infectivity of inoculum of Phytophthora nicotianae Breda de Haan.

    Science.gov (United States)

    Rodríguez-Molina, M Carmen; Serrano-Pérez, Paula; Palo, Carolina

    2016-07-01

    Biofumigation with defatted seed meal of Brassicaceae in the form of pellets has several advantages over the incorporation of fresh Brassicaceae crops to control soil-borne diseases. Two field experiments were established to evaluate the effect of biofumigation with brassica pellets on the survival and infectivity of Phytophthora nicotianae Breda de Haan inoculum introduced before treatments. In the spring experiment the incorporation of additional Brassicaceae cover crop (Brassica nigra L. and Sinapis alba L.) was tested, and in the summer experiment two brassica pellet doses were applied. Biofumigation with brassica pellets in spring (3000 kg ha(-1) with and without plastic) or in summer (3000 kg ha(-1) with or without plastic; 6000 kg ha(-1) without plastic) had no significant effect on the survival of P. nicotianae, regardless of the incorporation of additional Brassicaceae cover crop in spring. Reduction in infectivity in spring was related to the application of plastic, especially when combined with brassica pellets and Brassicaceae crop. In summer, soil temperature was the main factor in the inactivation of the inoculum, especially when plastic was applied, and no additional inactivation was achieved with brassica pellets. In spring and summer, biofumigation with brassica pellets had no effect on the survival of P. nicotianae. Application of plastic in spring may reduce infectivity. Soil temperature is the main factor in the inactivation of inoculum in summer, especially when plastic is applied. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  3. Diversification and the evolution of dispersal ability in the tribe Brassiceae (Brassicaceae).

    Science.gov (United States)

    Willis, C G; Hall, J C; Rubio de Casas, R; Wang, T Y; Donohue, K

    2014-12-01

    Dispersal and establishment ability can influence evolutionary processes such as geographic isolation, adaptive divergence and extinction probability. Through these population-level dynamics, dispersal ability may also influence macro-evolutionary processes such as species distributions and diversification. This study examined patterns of evolution of dispersal-related fruit traits, and how the evolution of these traits is correlated with shifts in geographic range size, habitat and diversification rates in the tribe Brassiceae (Brassicaceae). The phylogenetic analysis included 72 taxa sampled from across the Brassiceae and included both nuclear and chloroplast markers. Dispersal-related fruit characters were scored and climate information for each taxon was retrieved from a database. Correlations between fruit traits, seed characters, habitat, range and climate were determined, together with trait-dependent diversification rates. It was found that the evolution of traits associated with limited dispersal evolved only in association with compensatory traits that increase dispersal ability. The evolution of increased dispersal ability occurred in multiple ways through the correlated evolution of different combinations of fruit traits. The evolution of traits that increase dispersal ability was in turn associated with larger seed size, increased geographic range size and higher diversification rates. This study provides evidence that the evolution of increased dispersal ability and larger seed size, which may increase establishment ability, can also influence macro-evolutionary processes, possibly by increasing the propensity for long-distance dispersal. In particular, it may increase speciation and consequent diversification rates by increasing the likelihood of geographic and thereby reproductive isolation. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. One or three species in Megadenia (Brassicaceae): insight from molecular studies.

    Science.gov (United States)

    Artyukova, E V; Kozyrenko, M M; Boltenkov, E V; Gorovoy, P G

    2014-08-01

    Megadenia Maxim. is a small genus of the Brassicaceae endemic to East Asia with three disjunct areas of distribution: the eastern edge of the Qinghai-Tibetan Plateau, the Eastern Sayan Mountains in southern Siberia, and Chandalaz Ridge in the southern Sikhote-Alin Mountains. Although distinct species (M. pygmaea Maxim., M. bardunovii Popov, and M. speluncarum Vorob., Vorosch. and Gorovoj) have been described from each area, they have lately been reduced to synonymy with M. pygmaea due to high morphological similarity. Here, we present the first molecular study of Megadenia. Using the sequences of 11 noncoding regions from the cytoplasmic (chloroplast and mitochondrial) and nuclear genomes, we assessed divergence within the genus and explored the relationships between Megadenia and Biscutella L. Although M. bardunovii, M. speluncarum, and M. pygmaea were found to be indiscernible with regard to the nuclear and mitochondrial markers studied, our data on the plastid genome revealed their distinctness and a clear subdivision of the genus into three lineages matching the three described species. All of the phylogenetic analyses of the chloroplast DNA sequences provide strong support for the inclusion of Megadenia and Biscutella in the tribe Biscutelleae. A dating analysis shows that the genus Megadenia is of Miocene origin and diversification within the genus, which has led to the three extant lineages, most likely occurred during the Early-Middle Pleistocene, in agreement with the vicariance pattern. Given the present-day distribution, differences in habitat preferences and in some anatomical traits, and lack of a direct genealogical relationship, M. pygmaea, M. bardunovii, and M. speluncarum should be treated as distinct species or at least subspecies.

  5. Review on Cardamine diphylla (Michx.) A. wood (Brassicaceae): ethnobotany and glucosinolate chemistry.

    Science.gov (United States)

    Montaut, Sabine; Bleeker, René S

    2013-09-16

    Cardamine diphylla (Michx.) A. Wood, commonly called toothwort, is a spring perennial herb belonging to the Brassicaceae family. This endemic plant of Eastern North America has been widely used by multiple American First Nations (i.e. indigenous people of North America) for food and medicine for centuries. The aim of the review is to describe the botany, ethnopharmacology, phytochemistry, and bioactivity of Cardamine diphylla. The review covers literature on Cardamine diphylla, and the alternative name Dentaria diphylla, from English and French language sources. Multiple traditional uses of Cardamine diphylla by American First Nations are well documented. Initial health studies showed that the tested concentrations of the extract were not toxic against brine shrimp larvae and the same extract had a weak free-radical scavenging activity. However, bioactive compounds in the form of aliphatic and indole glucosinolates and some indole alkaloids have been isolated from this plant. Ecological research regarding Cardamine diphylla-insect interactions (such as feeding and oviposition) is also available in the literature. The wide range of traditional uses by multiple American First Nations suggests that the antibacterial, antiviral, immunostimulant, analgesic, antipyretic, and anti-inflammatory activities of this plant should be explored in in vitro and in vivo tests. Traditional modes of preparation of the plant suggest that some of the medicinal properties could certainly be attributed to glucosinolate degradation products (i.e. isothiocyanates), but a clear assignment of active molecules and mechanisms of action remain to be elucidated. The presence of glucosinolates indicates that the plant could be probed for cancer chemopreventive properties. Overall, the review shows that more investigation is necessary to determine the possible benefits of Cardamine diphylla extracts to pharmaceutical companies as a nutraceutic specialty phytotherapeutic agent against respiratory

  6. Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

    Science.gov (United States)

    Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

    2014-01-01

    Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

  7. Comparison of five major trichome regulatory genes in Brassica villosa with orthologues within the Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Naghabushana K Nayidu

    Full Text Available Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1, GLABRA 2 (GL2, ENHANCER OF GLABRA 3 (EGL3, and TRANSPARENT TESTA GLABRA 1 (TTG1 and the negative regulator TRIPTYCHON (TRY, were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae.

  8. Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species.

    Science.gov (United States)

    Mateos, Julieta L; Tilmes, Vicky; Madrigal, Pedro; Severing, Edouard; Richter, René; Rijkenberg, Colin W M; Krajewski, Paweł; Coupland, George

    2017-12-19

    Genome-wide landscapes of transcription factor (TF) binding sites (BSs) diverge during evolution, conferring species-specific transcriptional patterns. The rate of divergence varies in different metazoan lineages but has not been widely studied in plants. We identified the BSs and assessed the effects on transcription of FLOWERING LOCUS C (FLC) and PERPETUAL FLOWERING 1 (PEP1), two orthologous MADS-box TFs that repress flowering and confer vernalization requirement in the Brassicaceae species Arabidopsis thaliana and Arabis alpina, respectively. We found that only 14% of their BSs were conserved in both species and that these contained a CArG-box that is recognized by MADS-box TFs. The CArG-box consensus at conserved BSs was extended compared with the core motif. By contrast, species-specific BSs usually lacked the CArG-box in the other species. Flowering-time genes were highly overrepresented among conserved targets, and their CArG-boxes were widely conserved among Brassicaceae species. Cold-regulated (COR) genes were also overrepresented among targets, but the cognate BSs and the identity of the regulated genes were usually different in each species. In cold, COR gene transcript levels were increased in flc and pep1-1 mutants compared with WT, and this correlated with reduced growth in pep1-1 Therefore, FLC orthologs regulate a set of conserved target genes mainly involved in reproductive development and were later independently recruited to modulate stress responses in different Brassicaceae lineages. Analysis of TF BSs in these lineages thus distinguishes widely conserved targets representing the core function of the TF from those that were recruited later in evolution. Copyright © 2017 the Author(s). Published by PNAS.

  9. Species delimitation and interspecific relationships of the genus Orychophragmus (Brassicaceae inferred from whole chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Huan Hu

    2016-12-01

    Full Text Available IntroductionIt is rather difficult to delimit recently diverged species and construct their interspecific relationships because of insufficient informative variations of sampled DNA fragments (Schluter, 2000; Arnold, 2006. The genome-scale sequence variations were found to increase the phylogenetic resolutions of both high- and low-taxonomic groups (e.g., Yoder et al., 2013; Lamichhaney et al., 2015. It is still expensive to collect nuclear genome variations between species for most none-model genera without the reference genome. However, chloroplast genomes (plastome are relatively easy to be assembled to examine interspecific relationships for phylogenetic analyses, especially in addressing unresolved relationship at low taxonomic levels (Wu et al., 2010; Nock et al., 2011; Yang et al., 2013; Huang et al., 2014; Carbonell-Caballero et al., 2015. Plastomes are haploid with maternal inheritance in most angiosperms (Corriveau and Coleman, 1988; Zhang and Liu, 2003; Hagemann, 2004 and are highly conservative in gene order and genome structure with rare recombinations (Jansen et al., 2007; Moore et al., 2010. In this study, we aimed to examine species delimitation and interspecific relationships in Orychophragmus through assembling chloroplast genomes of multiple individuals of tentatively delimited species (Hu et al., 2015a. Orychophragmus is a small genus in the mustard family (Brassicaceae, Cruciferae distributed in northern, central, and southeastern China (Zhou et al., 2001. Its plants have been widely cultivated as ornamentals, vegetables, or source of seed oil (Sun et al., 2011. Despite controversial species delimitations in the genus (Zhou et al., 1987; Tan et al., 1998; Wu and Zhao, 2003; Al-Shehbaz and Yang, 2000; Zhou et al., 2001; Sun et al., 2012, our recent study based on nuclear (nr ITS sequence variations suggested the recognition of seven species (Hu et al., 2015a. Orychophragmus is sister to Sinalliaria, which is a genus endemic

  10. Assessment of cadmium accumulation, toxicity, and tolerance in Brassicaceae and Fabaceae plants--implications for phytoremediation.

    Science.gov (United States)

    Anjum, Naser A; Umar, Shahid; Iqbal, Muhammad

    2014-09-01

    This study, based on a greenhouse pot culture experiment conducted with 15-day-old rapeseed (Brassica campestris L. cv. Pusa Gold; family Brassicaceae) and moong bean (Vigna radiata L. Wilczek cv. Pusa Ratna; family Fabaceae) plants treated with cadmium (Cd) concentrations (0, 50, and 100 mg kg(-1) soil), investigates their potential for Cd accumulation and tolerance, and dissects the underlying basic physiological/biochemical mechanisms. In both species, plant dry mass decreased, while Cd concentration of both root and shoot increased with increase in soil Cd. Roots harbored a higher amount of Cd (vs. shoot) in B. campestris, while the reverse applied to V. radiata. By comparison, root Cd concentration was higher in B. campestris than in V. radiata. The high Cd concentrations in B. campestris roots and V. radiata shoots led to significant elevation in oxidative indices, as measured in terms of electrolyte leakage, H2O2 content, and lipid peroxidation. Both plants displayed differential adaptation strategies to counteract the Cd burden-caused anomalies in their roots and shoots. In B. campestris, increasing Cd burden led to a significantly decreased reduced glutathione (GSH) content but a significant increase in activities of GSH reductase (GR), GSH peroxidase (GPX), and GSH sulfotransferase (GST). However, in V. radiata, increasing Cd burden caused significant increase in GSH content and GR activity, but a significant decline in activities of GPX and GST. Cross talks on Cd burden of tissues and the adapted Cd tolerance strategies against Cd burden-accrued toxicity indicated that B. campestris and V. radiata are good Cd stabilizer and Cd extractor, respectively, wherein a fine tuning among the major components (GR, GPX, GST, GSH) of the GSH redox system helped the plants to counteract differentially the Cd load-induced anomalies in tissues. On the whole, the physiological/biochemical characterization of the B. campestris and V. radiata responses to varying Cd

  11. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  12. ADICIONES A LA FLORA DE COLOMBIA: NOVEDADES TAXONÓMICAS, COROLÓGICAS Y SINOPSIS DE LA TRIBU ARABIDEAE (BRASSICACEAE

    Directory of Open Access Journals (Sweden)

    PARRA-O. CARLOS

    2002-12-01

    Full Text Available Se presentan novedades taxonómicas, corológicas y una sinopsis de la tribuArabideae (Brassicaceae en Colombia. Se incluye una clave para diferenciar losgéneros de la tribu presentes en el país, y claves adicionales para diferenciar lasespecies dentro de Cardamine y Rorippa. Se enumeran las especies encontradas ypara cada una se incluye información sobre su distribución geográfica y altitudinal.Se presentan ocho nuevos registros de Arabideae para Colombia, tres en Cardaminey cinco en Rorippa. Nueve taxones, descritos con base en material recolectado enColombia dentro de Cardamine, son reducidos a la sinonimia de algunas de lasespecies aquí presentadas, y se incluyen comentarios que justifican tales decisiones.

  13. Arsenic absorption by members of the Brassicacea family, analysed by neutron activation, k{sub 0}-method - preliminary results

    Energy Technology Data Exchange (ETDEWEB)

    Uemura, George; Matos, Ludmila Vieira da Silva; Silva, Maria Aparecida da; Ferreira, Alexandre Santos Martorano; Menezes, Maria Angela de Barros Correia [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN/MG), Belo Horizonte, MG (Brazil)], e-mail: george@cdtn.br, e-mail: menezes@cdtn.br

    2009-07-01

    Natural arsenic contamination is a cause for concern in many countries of the world including Argentina, Bangladesh, Chile, China, India, Mexico, Thailand and the United States of America and also in Brazil, specially in the Iron Quadrangle area, where mining activities has been contributing to aggravate natural contamination. Brassicacea is a plant family with edible species (arugula, cabbage, cauliflower, cress, kale, mustard, radish), ornamental ones (alysssum, field pennycress, ornamental cabbages and kales) and some species are known as metal and metalloid accumulators (Indian mustard, field pennycress), like chromium, nickel, and arsenic. The present work aimed at studying other taxa of the Brassicaceae family to verify their capability in absorbing arsenic, under controlled conditions, for possible utilisation in remediation activities. The analytical method chosen was neutron activation analysis, k{sub 0} method, a routine technique at CDTN, and also very appropriate for arsenic studies. To avoid possible interference from solid substrates, like sand or vermiculite, attempts were carried out to keep the specimens in 1/4 Murashige and Skoog basal salt solution (M and S). Growth was stumped, plants withered and perished, showing that modifications in M and S had to be done. The addition of nickel and silicon allowed normal growth of the plant specimens, for periods longer than usually achieved (more than two months); yielding samples large enough for further studies with other techniques, like ICP-MS, and other targets, like speciation studies. The results of arsenic absorption are presented here and the need of nickel and silicon in the composition of M and S is discussed. (author)

  14. Targeting Colorectal Cancer Proliferation, Stemness and Metastatic Potential Using Brassicaceae Extracts Enriched in Isothiocyanates: A 3D Cell Model-Based Study

    Directory of Open Access Journals (Sweden)

    Lucília P. Pereira

    2017-04-01

    Full Text Available Colorectal cancer (CRC recurrence is often attributable to circulating tumor cells and/or cancer stem cells (CSCs that resist to conventional therapies and foster tumor progression. Isothiocyanates (ITCs derived from Brassicaceae vegetables have demonstrated anticancer effects in CRC, however little is known about their effect in CSCs and tumor initiation properties. Here we examined the effect of ITCs-enriched Brassicaceae extracts derived from watercress and broccoli in cell proliferation, CSC phenotype and metastasis using a previously developed three-dimensional HT29 cell model with CSC-like traits. Both extracts were phytochemically characterized and their antiproliferative effect in HT29 monolayers was explored. Next, we performed cell proliferation assays and flow cytometry analysis in HT29 spheroids treated with watercress and broccoli extracts and respective main ITCs, phenethyl isothiocyanate (PEITC and sulforaphane (SFN. Soft agar assays and relative quantitative expression analysis of stemness markers and Wnt/β-catenin signaling players were performed to evaluate the effect of these phytochemicals in stemness and metastasis. Our results showed that both Brassicaceae extracts and ITCs exert antiproliferative effects in HT29 spheroids, arresting cell cycle at G2/M, possibly due to ITC-induced DNA damage. Colony formation and expression of LGR5 and CD133 cancer stemness markers were significantly reduced. Only watercress extract and PEITC decreased ALDH1 activity in a dose-dependent manner, as well as β-catenin expression. Our research provides new insights on CRC therapy using ITC-enriched Brassicaceae extracts, specially watercress extract, to target CSCs and circulating tumor cells by impairing cell proliferation, ALDH1-mediated chemo-resistance, anoikis evasion, self-renewal and metastatic potential.

  15. Additions to the type collection of Cruciferae Juss. (Brassicaceae Burnett) of Siberia and Russian Far East kept in Herbarium of V. L. Komarov Botanical Institute (LE)

    OpenAIRE

    V. I. Dorofeyev

    2017-01-01

    A complete set of the type specimens of Cruciferae (Brassicaceae) of Siberia and Far East stored in the Komarov Botanical Institute of Russian Academy of Sciences was investigated. Previously uncounted samples of 130 taxa from 23 genera have been identified. Lectotypification of 119 taxa is done in the paper. Most valuable contribution into the study of Siberian and the Far Eastern Cruciferae biodiversity was made by the works of N. A. Busch (genera Arabis, Draba, Erysimum, Nasturtium), E. Re...

  16. Possibilities of direct introgression from Brassica napus to B. juncea and indirect introgression from B. napus to related Brassicaceae through B. juncea

    Science.gov (United States)

    Tsuda, Mai; Ohsawa, Ryo; Tabei, Yutaka

    2014-01-01

    The impact of genetically modified canola (Brassica napus) on biodiversity has been examined since its initial stage of commercialization. Various research groups have extensively investigated crossability and introgression among species of Brassicaceae. B. rapa and B. juncea are ranked first and second as the recipients of cross-pollination and introgression from B. napus, respectively. Crossability between B. napus and B. rapa has been examined, specifically in terms of introgression from B. napus to B. rapa, which is mainly considered a weed in America and European countries. On the other hand, knowledge on introgression from B. napus to B. juncea is insufficient, although B. juncea is recognized as the main Brassicaceae weed species in Asia. It is therefore essential to gather information regarding the direct introgression of B. napus into B. juncea and indirect introgression of B. napus into other species of Brassicaceae through B. juncea to evaluate the influence of genetically modified canola on biodiversity. We review information on crossability and introgression between B. juncea and other related Brassicaseae in this report. PMID:24987292

  17. Duplication and adaptive evolution of the COR15 genes within the highly cold-tolerant Draba lineage (Brassicaceae).

    Science.gov (United States)

    Zhou, Dangwei; Zhou, Jie; Meng, Lihua; Wang, Qingbiao; Xie, He; Guan, Yucheng; Ma, Zeyang; Zhong, Yang; Chen, Fan; Liu, Jianquan

    2009-07-15

    Plants have evolved diverse adaptive mechanisms that enable them to tolerate abiotic stresses, to varying degrees, and such stresses may have strongly influenced evolutionary changes at levels ranging from molecular to morphological. Previous studies on these phenomena have focused on the adaptive evolution of stress-related orthologous genes in specific lineages. However, heterogenetic evolution of the paralogous genes following duplication has only been examined in a very limited number of stress-response gene families. The COR15 gene encodes a low molecular weight protein that plays an important role in protecting plants from cold stresses. Although two different copies of this gene have been found in the model species, Arabidopsis thaliana, evolutionary patterns of this small gene family in plants have not been previously explored. In this study, we cloned COR15-like sequences and performed evolutionary analyses of these sequences (including those previously reported) in the highly cold-tolerant Draba lineage and related lineages of Brassicaceae. Our phylogenetic analyses indicate that all COR15-like sequences clustered into four clades that corresponded well to the morphological lineages. Gene conversions were found to have probably occurred before/during the divergence of Brassica and Draba lineage. However, repeated, independent duplications of this gene have occurred in different lineages of Brassicaceae. Further comparisons of all sequences suggest that there have been significant inter-lineage differences in evolutionary rates between the duplicated and original genes. We assessed the likelihood that the differences between two well-supported gene subfamilies that appear to have originated from a single duplication, COR15a and COR15b, within the Draba lineage have been driven by adaptive evolution. Comparisons of their non-synonymous/synonymous substitution ratios and rates of predicted amino acid changes indicate that these two gene groups are evolving

  18. The molecular phylogeny of Matthiola R. Br. (Brassicaceae) inferred from ITS sequences, with special emphasis on the Macaronesian endemics.

    Science.gov (United States)

    Jaén-Molina, Ruth; Caujapé-Castells, Juli; Reyes-Betancort, Jorge Alfredo; Akhani, Hossein; Fernández-Palacios, Olga; de Paz, Julia Pérez; Febles-Hernández, Rosa; Marrero-Rodríguez, Aguedo

    2009-12-01

    Matthiola (Brassicaceae) is a genus that is widespread in the Mediterranean and Irano-Turanian regions and includes two species that are endemic to the archipelagos of Madeira and the Canaries in Macaronesia, which is an insular oceanic hotspot of biodiversity harboring many radiating endemic plant lineages. Sequence analyses of the nuclear ITS-1 and ITS-2 regions in a comprehensive geographical sample of Matthiola, encompassing all the endemic Macaronesian populations known to date, suggest independent Mediterranean and NW African origins of the taxa in Madeira and the Canaries, respectively. These molecular data reveal a complex evolutionary landscape that converges with morphological analyses in the recognition of two new Madeiran species. The data also suggest that the Canarian infra-specific endemic taxa described thus far have high (but non-diagnostic) levels of morphological and genetic diversity, and should be included in the single endemic Matthiola bolleana. In agreement with earlier investigations that revealed a high genetic differentiation between the populations of Matthiola in Fuerteventura and Lanzarote, our phylogeny supports independent founder events from the same mainland congener to either island. The consistently derived position of the Moroccan populations within a mostly Canarian clade suggests a further back-colonization of the continent. Notably, the ITS sequence resolution offered by Matthiola is higher than that found in many of the radiating Canarian endemic lineages for which molecular phylogenetic studies abound. Hence, our research discovers largely unexplored pathways to understand plant diversification in this oceanic insular hotspot through the investigation of non-speciose endemics.

  19. Dendrochronological study of the endangered shrub Vella pseudocytisus subsp. paui (Brassicaceae: implications for its recovery and conservation

    Directory of Open Access Journals (Sweden)

    Génova, Mar

    2013-12-01

    Full Text Available Dendrochronology is useful to determine plant longevity, to provide insights into the structure and dynamics of plant populations and to study the relationships between growth and environmental determinants. The dendrochronology of endangered shrubs is unexplored, although their use represents an opportunity to produce better conservation guidelines. We collected for this study 63 samples from already dead specimens of Vella pseudocytisus subsp. paui (Brassicaceae, an endangered Spanish endemism from three localities. We analyzed the relationship between ring data and plant size to determine the accuracy of using size as a proxy for plant age. We also explored the relationships between ring data and environmental variables to detect growth determinants. This shrub showed a high longevity as older individuals presented nearly 50 growth rings. The relationship between age and size is weak although it could be established based on the logarithmic function of plant biovolume. Significant relationships were found between rainfall and ring widths, showing that water limited annual growth. Finally, age structure characterized differences among populations, highlighting the effects of disturbance and land use. These results provided new opportunities for management within the ongoing recovery plan for the species.La dendrocronología es útil para determinar la longevidad de la planta, proporcionar información sobre la estructura y dinámica de las poblaciones vegetales y estudiar las relaciones entre el crecimiento y las variables ambientales. Hasta ahora no se había hecho uso de la dendrocronología en arbustos en peligro de extinción, aunque su empleo puede mejorar las directrices de conservación. En este estudio se han recolectado 63 especímenes ya muertos de tres localidades de Vella pseudocytisus subsp. paui (Brassicaceae, un endemismo español en peligro de extinción. Se han analizado las relaciones entre los grosores del anillo de

  20. Plant Size as Determinant of Species Richness of Herbivores, Natural Enemies and Pollinators across 21 Brassicaceae Species.

    Directory of Open Access Journals (Sweden)

    Hella Schlinkert

    Full Text Available Large plants are often more conspicuous and more attractive for associated animals than small plants, e.g. due to their wider range of resources. Therefore, plant size can positively affect species richness of associated animals, as shown for single groups of herbivores, but studies usually consider intraspecific size differences of plants in unstandardised environments. As comprehensive tests of interspecific plant size differences under standardised conditions are missing so far, we investigated effects of plant size on species richness of all associated arthropods using a common garden experiment with 21 Brassicaceae species covering a broad interspecific plant size gradient from 10 to 130 cm height. We recorded plant associated ecto- and endophagous herbivores, their natural enemies and pollinators on and in each aboveground plant organ, i.e. flowers, fruits, leaves and stems. Plant size (measured as height from the ground, the number of different plant organ entities and their biomass were assessed. Increasing plant size led to increased species richness of associated herbivores, natural enemies and pollinating insects. This pattern was found for ectophagous and endophagous herbivores, their natural enemies, as well as for herbivores associated with leaves and fruits and their natural enemies, independently of the additional positive effects of resource availability (i.e. organ biomass or number of entities and, regarding natural enemies, herbivore species richness. We found a lower R2 for pollinators compared to herbivores and natural enemies, probably caused by the high importance of flower characteristics for pollinator species richness besides plant size. Overall, the increase in plant height from 10 to 130 cm led to a 2.7-fold increase in predicted total arthropod species richness. In conclusion, plant size is a comprehensive driver of species richness of the plant associated arthropods, including pollinators, herbivores and their

  1. Flowering Locus C (FLC) Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae).

    Science.gov (United States)

    Mohammadin, Setareh; Nguyen, Thu-Phuong; van Weij, Marco S; Reichelt, Michael; Schranz, Michael E

    2017-01-01

    The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS) are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP) we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits) that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C. Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema. Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction.

  2. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    Science.gov (United States)

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  3. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  4. SEM observations of pollen grains, fruits and seeds of the Pieniny Mountains (South Poland endemic species Erysimum pieninicum (Zapał. Pawł. (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Irmina Maciejewska

    2011-01-01

    Full Text Available Erysimum pieninicum (Zapał. Pawł. (Brassicaceae is an endemic species, growing only in Pieniny Mts. The aim of the presented work was to investigate its pollen morphology as well as its ultrastructural traits of pericarp and seed-coat. Pollen grains of this species were of small size, 3-zonocolpate with reticulate ornamentation. The external siliqua surface was of rugose sculpture, covered by numerous, stellate hairs. The internal surface of the fruit was naked and characterized by striate sculpture. The seed-coat ornamentation of E. pieninicum was of blister type.

  5. Determination of S-methyl-L-methionine (SMM) from Brassicaceae Family Vegetables and Characterization of the Intestinal Transport of SMM by Caco-2 Cells.

    Science.gov (United States)

    Song, Ji-Hoon; Lee, Hae-Rim; Shim, Soon-Mi

    2017-01-01

    The objectives of the current study were to determine S-methyl-L-methionine (SMM) from various Brassicaceae family vegetables by using validated analytical method and to characterize the intestinal transport mechanism of SMM by the Caco-2 cells. The SMM is well known to provide therapeutic activity in peptic ulcers. The amount of SMM from various Brassicaceae family vegetables ranged from 89.08 ± 1.68 μg/g to 535.98 ± 4.85 μg/g of dry weight by using validated ultra-performance liquid chromatography-electrospray ionization-mass spectrometry method. For elucidating intestinal transport mechanism, the cells were incubated with or without transport inhibitors, energy source, or a metabolic inhibitor. Phloridzin and verapamil as inhibitors of sodium glucose transport protein (SGLT1) and P-glycoprotein, respectively, were not responsible for cellular uptake of SMM. Glucose and sodium azide were not affected by the cellular accumulation of SMM. The efflux ratio of SMM was 0.26, implying that it is not effluxed through Caco-2 cells. The apparent coefficient permeability (Papp ) of SMM was 4.69 × 10(-5) cm/s, indicating that it will show good oral absorption in in vivo. © 2016 Institute of Food Technologists®.

  6. Four plant defensins from an indigenous South African Brassicaceae species display divergent activities against two test pathogens despite high sequence similarity in the encoding genes

    Directory of Open Access Journals (Sweden)

    de Beer Abré

    2011-10-01

    Full Text Available Abstract Background Plant defensins are an important component of the innate defence system of plants where they form protective antimicrobial barriers between tissue types of plant organs as well as around seeds. These peptides also have other activities that are important for agricultural applications as well as the medical sector. Amongst the numerous plant peptides isolated from a variety of plant species, a significant number of promising defensins have been isolated from Brassicaceae species. Here we report on the isolation and characterization of four defensins from Heliophila coronopifolia, a native South African Brassicaceae species. Results Four defensin genes (Hc-AFP1-4 were isolated with a homology based PCR strategy. Analysis of the deduced amino acid sequences showed that the peptides were 72% similar and grouped closest to defensins isolated from other Brassicaceae species. The Hc-AFP1 and 3 peptides shared high homology (94% and formed a unique grouping in the Brassicaceae defensins, whereas Hc-AFP2 and 4 formed a second homology grouping with defensins from Arabidopsis and Raphanus. Homology modelling showed that the few amino acids that differed between the four peptides had an effect on the surface properties of the defensins, specifically in the alpha-helix and the loop connecting the second and third beta-strands. These areas are implicated in determining differential activities of defensins. Comparing the activities after recombinant production of the peptides, Hc-AFP2 and 4 had IC50 values of 5-20 μg ml-1 against two test pathogens, whereas Hc-AFP1 and 3 were less active. The activity against Botrytis cinerea was associated with membrane permeabilization, hyper-branching, biomass reduction and even lytic activity. In contrast, only Hc-AFP2 and 4 caused membrane permeabilization and severe hyper-branching against the wilting pathogen Fusarium solani, while Hc-AFP1 and 3 had a mild morphogenetic effect on the fungus

  7. Seed Germination Ecology of the Cold Desert Annual Isatis violascens (Brassicaceae): Two Levels of Physiological Dormancy and Role of the Pericarp.

    Science.gov (United States)

    Zhou, Yuan M; Lu, Juan J; Tan, Dun Y; Baskin, Carol C; Baskin, Jerry M

    2015-01-01

    The occurrence of various species of Brassicaceae with indehiscent fruits in the cold deserts of NW China suggests that there are adaptive advantages of this trait. We hypothesized that the pericarp of the single-seeded silicles of Isatis violascens restricts embryo expansion and thus prevents germination for 1 or more years. Thus, our aim was to investigate the role of the pericarp in seed dormancy and germination of this species. The effects of afterripening, treatment with gibberellic acid (GA3) and cold stratification on seed dormancy-break were tested using intact silicles and isolated seeds, and germination phenology was monitored in an experimental garden. The pericarp has a role in mechanically inhibiting germination of fresh seeds and promotes germination of nondormant seeds, but it does not facilitate formation of a persistent seed bank. Seeds in silicles in watered soil began to germinate earlier in autumn and germinated to higher percentages than isolated seeds. Sixty-two percent of seeds in the buried silicles germinated by the end of the first spring, and only 3% remained nongerminated and viable. Twenty to twenty-five percent of the seeds have nondeep physiological dormancy (PD) and 75-80% intermediate PD. Seeds with nondeep PD afterripen in summer and germinate inside the silicles in autumn if the soil is moist. Afterripening during summer significantly decreased the amount of cold stratification required to break intermediate PD. The presence of both nondeep and intermediate PD in the seed cohort may be a bet-hedging strategy.

  8. Seed Germination Ecology of the Cold Desert Annual Isatis violascens (Brassicaceae: Two Levels of Physiological Dormancy and Role of the Pericarp.

    Directory of Open Access Journals (Sweden)

    Yuan M Zhou

    Full Text Available The occurrence of various species of Brassicaceae with indehiscent fruits in the cold deserts of NW China suggests that there are adaptive advantages of this trait. We hypothesized that the pericarp of the single-seeded silicles of Isatis violascens restricts embryo expansion and thus prevents germination for 1 or more years. Thus, our aim was to investigate the role of the pericarp in seed dormancy and germination of this species. The effects of afterripening, treatment with gibberellic acid (GA3 and cold stratification on seed dormancy-break were tested using intact silicles and isolated seeds, and germination phenology was monitored in an experimental garden. The pericarp has a role in mechanically inhibiting germination of fresh seeds and promotes germination of nondormant seeds, but it does not facilitate formation of a persistent seed bank. Seeds in silicles in watered soil began to germinate earlier in autumn and germinated to higher percentages than isolated seeds. Sixty-two percent of seeds in the buried silicles germinated by the end of the first spring, and only 3% remained nongerminated and viable. Twenty to twenty-five percent of the seeds have nondeep physiological dormancy (PD and 75-80% intermediate PD. Seeds with nondeep PD afterripen in summer and germinate inside the silicles in autumn if the soil is moist. Afterripening during summer significantly decreased the amount of cold stratification required to break intermediate PD. The presence of both nondeep and intermediate PD in the seed cohort may be a bet-hedging strategy.

  9. Delayed dehiscence of the pericarp: role in germination and retention of viability of seeds of two cold desert annual Brassicaceae species.

    Science.gov (United States)

    Lu, J J; Tan, D Y; Baskin, C C; Baskin, J M

    2017-01-01

    Considerable variation occurs in post-maturity timing of dehiscence in fruits of Brassicaceae species, and several studies have shown that the pericarp plays an important role in seed germination and retention of viability in species with indehiscent fruits. However, little is known about the significance to seed biology of delay in pericarp dehiscence for seed germination and retention of seed viability. We compared dormancy-break via after-ripening in the laboratory and germination phenology and retention of seed viability in intact siliques and isolated seeds buried in an experimental garden. Seeds of both species have Type 6 non-deep physiological dormancy, which is enhanced by the pericarp. Seeds of both species after-ripened during summer 2013, and some of them germinated in autumn and some in the following spring in watered and non-watered soil. Germination percentages of seeds in siliques increased in soil in spring 2014, after the pericarps had opened. Most isolated seeds of L. filifolium and N. korolkovii had germinated or were dead by spring 2014 and summer 2015, respectively, whereas 60% of the seeds of both species in the (opened) pericarps were viable after 24 months. Thus, although the pericarp opened 9-10 months after burial, its presence had a significant effect on seed dormancy, germination phenology and retention of viability of seeds of L. filifolium and N. korolkovii. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  10. Consequences of Whole-Genome Triplication as Revealed by Comparative Genomic Analyses of the Wild Radish Raphanus raphanistrum and Three Other Brassicaceae Species[W][OPEN

    Science.gov (United States)

    Moghe, Gaurav D.; Hufnagel, David E.; Tang, Haibao; Xiao, Yongli; Dworkin, Ian; Town, Christopher D.; Conner, Jeffrey K.; Shiu, Shin-Han

    2014-01-01

    Polyploidization events are frequent among flowering plants, and the duplicate genes produced via such events contribute significantly to plant evolution. We sequenced the genome of wild radish (Raphanus raphanistrum), a Brassicaceae species that experienced a whole-genome triplication event prior to diverging from Brassica rapa. Despite substantial gene gains in these two species compared with Arabidopsis thaliana and Arabidopsis lyrata, ∼70% of the orthologous groups experienced gene losses in R. raphanistrum and B. rapa, with most of the losses occurring prior to their divergence. The retained duplicates show substantial divergence in sequence and expression. Based on comparison of A. thaliana and R. raphanistrum ortholog floral expression levels, retained radish duplicates diverged primarily via maintenance of ancestral expression level in one copy and reduction of expression level in others. In addition, retained duplicates differed significantly from genes that reverted to singleton state in function, sequence composition, expression patterns, network connectivity, and rates of evolution. Using these properties, we established a statistical learning model for predicting whether a duplicate would be retained postpolyploidization. Overall, our study provides new insights into the processes of plant duplicate loss, retention, and functional divergence and highlights the need for further understanding factors controlling duplicate gene fate. PMID:24876251

  11. Characterization and structural features of a chalcone synthase mutation in a white-flowering line of Matthiola incana R. Br. (Brassicaceae).

    Science.gov (United States)

    Hemleben, Vera; Dressel, Angela; Epping, Bernhard; Lukacin, Richard; Martens, Stefan; Austin, Michael

    2004-05-01

    For Matthiola incana (Brassicaceae), used as a model system to study biochemical and genetical aspects of anthocyanin biosynthesis, several nearly isogenic colored wild type lines and white-flowering mutant lines are available, each with a specific defect in the genes responsible for anthocyanin production (genes e, f, and g). For gene f supposed to code for chalcone synthase (CHS; EC 2.3.1.74), the key enzyme of the flavonoid/anthocyanin biosynthesis pathway belonging to the group of type III polyketide synthases (PKS), the wild type genomic sequence of M. incana line 04 was determined in comparison to the white-flowering CHS mutant line 18. The type of mutation in the chs gene was characterized as a single nucleotide substitution in a triplet AGG coding for an evolutionary conserved arginine into AGT coding for serine (R72S). Northern blots and RT-PCR demonstrated that the mutated gene is expressed in flower petals. Heterologous expression of the wild type and mutated CHS cDNA in E. Scherichia coli, verified by Western blotting and enzyme assays with various starter molecules, revealed that the mutant protein had no detectable activity, indicating that the strictly conserved arginine residue is essential for the enzymatic reaction. This mutation, which previously was not detected by mutagenic screening, is discussed in the light of structural and functional information on alfalfa CHS and related type III PKS enzymes.

  12. Zn, Cd and Pb accumulation and arbuscular mycorrhizal colonisation of pennycress Thlaspi praecox Wulf. (Brassicaceae) from the vicinity of a lead mine and smelter in Slovenia

    Energy Technology Data Exchange (ETDEWEB)

    Vogel-Mikus, Katarina [Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot 111, SI-1000 Ljubljana (Slovenia)]. E-mail: katarina.vogel@uni-lj.si; Drobne, Damjana [Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot 111, SI-1000 Ljubljana (Slovenia); Regvar, Marjana [Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot 111, SI-1000 Ljubljana (Slovenia)

    2005-01-01

    Significant hyperaccumulation of Zn, Cd and Pb in field samples of Thlaspi praecox Wulf. collected from a heavy metal polluted area in Slovenia was found, with maximal shoot concentrations of 14590 mg kg{sup -1} Zn, 5960 mg kg{sup -1} Cd and 3500 mg kg{sup -1} Pb. Shoot/root ratios of 9.6 for Zn and 5.6 for Cd show that the metals were preferentially transported to the shoots. Shoot bioaccumulation factors exceeded total soil Cd levels 75-fold and total soil Zn levels 20-fold, further supporting the hyperaccumulation of Cd and Zn. Eighty percent of Pb was retained in roots, thus indicating exclusion as a tolerance strategy for Pb. Low level colonisation with arbuscular mycorrhizal fungi (AMF) of a Paris type was observed at the polluted site, whereas at the non-polluted site Arum type colonisation was more common. To our knowledge this is the first report of Cd hyperaccumulation and AMF colonisation in metal hyperaccumulating T. praecox. - Thlaspi praecox Wulf. (Brassicaceae) is a newly discovered Cd, Zn and Pb hyperaccumulator able to form symbiosis with arbuscular mycorrhizal fungi.

  13. Role of cadmium and ultraviolet-B radiation in plants. Influence on photosynthesis and element content in two species of Brassicaceae

    Energy Technology Data Exchange (ETDEWEB)

    Larsson Joensson, Helene

    2001-02-01

    Plants are exposed to many different stress factors during their lifetime. often more than one factor at a time. which highlights the importance of research regarding interaction among stress factors. Cadmium and ultraviolet-B radiation (MB, 280-315 mm) are two potential stress factors in the environment, which have gained increased interest due to atmospheric pollution. In this work the interaction between Cd and UV-B radiation was investigated in two species of Brassicaceae; Brassica napus and Arabidopsis thaliana, the latter including the wild type and phytochelatin-deficient cad1-3. In both species photosynthetic parameters and element content were studied after the plants were exposed to Cd and supplemental UV-B radiation for 14 days. A separate Cd uptake study was carried out on Arabidopsis thaliana to investigate the effect of different Cd pretreatments on Cd uptake. The experiments showed that Cd was the dominant factor, but in Brassica napus, Cd+UV-B showed some interaction effects on energy dissipation and chlorophyll ratios. Generally, Cd decreased the chlorophyll content and influenced photosynthesis by altering oxygen evolution, non-photochemical quenching and the quantum yield. Cadmium had large effects on the content of essential elements, particularly in roots, that may be due to competition during uptake. The Cd uptake study showed that the wild type contained much higher amounts of Cd than the phytochelatin-deficient cad1-3, although Cd uptake is expected to be independent of phytochelatin content. Phytochelatins chelate and transport Cd to the vacuole, thus removing Cd from the cytosol. This compartmentation may disrupt a possible feedback mechanism in the cytosol.

  14. Polymorphism of the S-locus glycoprotein gene (SLG) and the S-locus related gene (SLR1) in Raphanus sativus L. and self-incompatible ornamental plants in the Brassicaceae.

    Science.gov (United States)

    Sakamoto, K; Kusaba, M; Nishio, T

    1998-05-01

    The S-locus glycoprotein gene, SLG, which participates in the pollen-stigma interaction of self-incompatibility, and its unlinked homologue, SLR1, were analyzed in Raphanus sativus and three self-incompatible ornamental plants in the Brassicaceae. Among twenty-nine inbred lines of R. sativus, eighteen S haplotypes were identified on the basis of DNA polymorphisms detected by genomic Southern analysis using Brassica SLG probes. DNA fragments of SLG alleles specifically amplified from eight S haplotypes by PCR with class I SLG-specific primers showed different profiles following polyacrylamide gel electrophoresis, after digestion with a restriction endonuclease. The nucleotide sequences of the DNA fragments of these eight R. sativus SLG alleles were determined. Degrees of similarity of the nucleotide sequences to a Brassica SLG (S6SLG) ranged from 85.6% to 91.9%. Amino acid sequences deduced from these had the twelve conserved cysteine residues and the three hypervariable regions characteristic of Brassica SLGs. Phylogenetic analysis of the SLG sequences from Raphanus and Brassica revealed that the Raphanus SLGs did not form an independent cluster, but were dispersed in the tree, clustering together with Brassica SLGs. These results suggest that diversification of the SLG alleles of Raphanus and Brassica occurred before differentiation of these genera. Although SLR1 sequences from Orychophragmus violaceus were shown to be relatively closely related to Brassica and Raphanus SLR1 sequences, DNA fragments that are highly homologous to the Brassica SLG were not detected in this species. Two other ornamental plants in the Brassicaceae, which are related more distantly to Brassica than Orychophragmus, also lacked sequences highly homologous to Brassica SLG genes. The evolution of self-incompatibility in the Brassicaceae is discussed.

  15. Nectar-carbohydrate production and composition vary in relation to nectary anatomy and location within individual flowers of several species of Brassicaceae.

    Science.gov (United States)

    Davis, A R; Pylatuik, J D; Paradis, J C; Low, N H

    1998-06-01

    Nectar-carbohydrate production and composition were investigated by high-performance liquid chromatography and enzymology in nine species from five tribes of the Brassicaceae. In six species (Arabidopsis thaliana (L.) Heynh., Brassica napus L., B. rapa L., Lobularia maritima (L.) Desv., Raphanus sativus L., Sinapis arvensis L.) that produced nectar from both lateral nectaries (associated with the short stamens) and median nectaries (outside the long stamens), on average 95% of the total nectar carbohydrate was collected from the lateral ones. Nectar from these glands possessed a higher glucose/fructose ratio (usually 1.0-1.2) than that from the median nectaries (0.2-0.9) within the same flower. Comparatively little sucrose was detected in any nectar samples except from Matthiola bicornus (Sibth. et Sm.) DC., which possessed lateral nectaries only and produced a sucrose-dominant exudate. The anatomy of the nectarial tissue in nectar-secreting flowers of six species, Hesperis matronalis L., L. maritima, M. bicornus, R. sativus, S. arvensis, and Sisymbrium loeselii L., was studied by light and scanning-electron microscopy. Phloem alone supplied the nectaries. However, in accordance with their overall nectar-carbohydrate production, the lateral glands received relatively rich quantities of phloem that penetrated far into the glandular tissue, whereas median glands were supplied with phloem that often barely innervated them. All nectarial tissue possessed modified stomata (with the exception of the median glands of S. loeselii, which did not produce nectar); further evidence was gathered to indicate that these structures do not regulate nectar flow by guard-cell movements. The numbers of modified stomata per gland showed no relation to nectar-carbohydrate production. Taken together, the data on nectar biochemistry and nectary anatomy indicate the existence of two distinct nectary types in those Brassicacean species that possess both lateral and median nectaries

  16. Sub-proteome S-nitrosylation analysis in Brassica juncea hints at the regulation of Brassicaceae specific as well as other vital metabolic pathway(s) by nitric oxide and suggests post-translational modifications cross-talk.

    Science.gov (United States)

    Sehrawat, Ankita; Deswal, Renu

    2014-12-01

    Abiotic stress affects the normal physiology of the plants and results in crop loss. Brassica juncea is an oil yielding crop affected by abiotic stress. In future, over 30% yield loss by abiotic stress is predicted in India. Understanding the mechanism of plant response to stress would help in developing stress tolerant crops. Nitric oxide (NO) is now viewed as a remarkably important signaling molecule, involved in regulating stress responses. S-Nitrosylation is a NO based post-translational modification (PTM), linked with the regulation of many physiologically relevant targets. In the last decade, over 700 functionally varied S-nitrosylated proteins were identified, which suggested broad-spectrum regulation. To understand the physiological significance of S-nitrosylation, it was analyzed in cold stress. Functional categorization and validation of some of the B. juncea S-nitrosylated targets, suggested that NO produced during stress regulates cellular detoxification by modulating enzymes of ascorbate glutathione cycle, superoxide dismutase, glutathione S-transferase and glyoxalase I by S-nitrosylation in crude, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) depleted and apoplastic fractions. Interestingly, S-nitrosylation of enzymes associated with glucosinolate hydrolysis pathway, suggests a novel regulation of this Brassicaceae specific pathway by NO. Moreover, identification of enzymes of Glycolysis and Calvin cycle in crude and RuBisCO depleted fractions showed the regulation of metabolic as well as photosynthetic pathways by S-nitrosylation. S-Nitrosylation of cell wall modifying and proteolytic enzymes in the apoplast suggested differential and spatial regulation by S-nitrosylation. To have an overview of physiological role(s) of NO, collective information on NO based signaling (mainly by S-nitrosylation) is presented in this review. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. A new case of late-acting self-incompatibility in Capparis L. (Brassicaceae: C. jacobinae Moric. ex Eichler, an endemic andromonoecious species of the Caatinga, Pernambuco State, Brazil Novo registro de auto-incompatibilidade de ação tardia em Capparis (Brassicaceae: C. jacobinae Moric. ex Eichler, uma espécie andromonóica endêmica da Caatinga, PE, Brasil

    Directory of Open Access Journals (Sweden)

    Luis Miguel Primo

    2009-09-01

    Full Text Available We studied the reproductive system of Capparis jacobinae Moric ex Eichler (Brassicaceae, based on controlled hand-pollination and observation of pollen tube growth made in a fluorescence microscope. Of 105 self-pollinated flowers only one produced fruits (success = 0.95%, all the other flowers abscised at the same time, between the eighth and tenth day after anthesis. Nevertheless, self- and cross-pollinated pollen tubes reached the micropyle. The rate of penetrated ovules in self-pollinated flowers was lower during the first 24 h after pollination; thereafter this rate was similar between self- and cross-pollinated flowers for treatments of 48 h, 72 h and 96 h after pollination. In addition, we carried out two indirect estimates of the reproductive system, based on pollen/ovule and seed/ovule ratios, which resulted in typical features of xenogamous species. We concluded that C. jacobinae has a late-acting self-incompatibility system. This is the third record of this mechanism for the genus and the first for a species of Capparis endemic to the Caatinga. We suggest that this self-incompatibility system may occur in other species of the same genus and family.O sistema reprodutivo de Capparis jacobinae Moric. ex Eichler (Brassicaceae, uma espécie endêmica da Caatinga no Brasil, foi analisado através de polinizações controladas e observações do desenvolvimento dos tubos polínicos por meio de microscopia de fluorescência. De 105 flores autopolinizadas, apenas uma formou fruto (sucesso= 0,95%, ocorrendo a abscisão das demais em um intervalo de tempo uniforme, entre o oitavo e o décimo dia após a antese. Entretanto, tanto tubos polínicos procedentes de autopolinização quanto de polinização cruzada penetraram na micrópila, sendo a taxa de óvulos penetrados menor em flores autopolinizadas durante as 24 horas posteriores à polinização, igualando-se entre os dois tratamentos para 48, 72 e 96 horas posteriores à polinização. Al

  18. Revizija rodu diplotaxis (Brassicaceae) v Sloveniji

    OpenAIRE

    Fabijan, Tina

    2017-01-01

    V Sloveniji po podatkih Male flore Slovenije (Wraber, 2007) uspevajo štiri vrste rodu Diplotaxis, in sicer D. muralis, D. tenuifolia, D. erucoides in D. viminea. Njihovo razlikovanje je zahtevno, v določevalnem ključu pa ni dovolj zanesljivih določevalnih znakov. Iz literature, ki obravnava floro sosednjih držav, sem zbrala znake, po katerih omenjene vrste ločijo v tujini, in te znake preverila na herbarijskih polah herbarija LJU. V zbirki je bilo 48 herbarijskih pol. Ker je bil v nekaterih p...

  19. New Lepidium (Brassicaceae) from New Zealand

    Science.gov (United States)

    de Lange, P. J.; Heenan, P. B.; Houliston, G. J.; Rolfe, J. R.; Mitchell, A. D.

    2013-01-01

    Abstract A revision of the New Zealand endemic Lepidium oleraceum and allied species is presented. Sixteen species are recognised, 10 of these are new. The new species are segregated on the basis of morphological characters supported by molecular data obtained from three DNA markers (two rDNA and one cpDNA). One species, Lepidium castellanum sp. nov., is endemic to the Kermadec Islands where it is sympatric with Lepidium oleraceum. The North Island of New Zealand supports four species, with two of them, Lepidium amissum sp. nov. and Lepidium obtusatum, now extinct. The South Island supports six species, that, aside from Lepidium banksii, Lepidium flexicaule and Lepidium oleraceum, are all confined to the south-eastern half of the island (Lepidium aegrum sp. nov., Lepidium crassum sp. nov. and Lepidium juvencum sp. nov.). One of these, Lepidium juvencum sp. nov., extends to Stewart Island. The Chatham Islands support six species (Lepidium flexicaule, Lepidium oblitum sp. nov., Lepidium oleraceum, Lepidium oligodontum sp. nov., Lepidium panniforme sp. nov., and Lepidium rekohuense sp. nov.), one of which, Lepidium oligodontum sp. nov., extends to the Antipodes Islands group. The remote, subantarctic Bounty Islands group supports one endemic, Lepidium seditiosum sp. nov., which is the only vascular plant to be recorded from there. Lepidium limenophylax sp. nov. is known from islands off the south-western side of Stewart Island/Rakiura, The Snares and Auckland islands. Lepidium naufragorum, although not related to Lepidium oleraceum and its allies, is also treated because populations with entire leaves are now known. Typification is undertaken for Lepidium banksii, Lepidium oleraceum, Lepidium oleraceum var. acutidentatum, var. frondosum and var. serrulatum. PMID:23794938

  20. Genetic relationships among some Hesperis L. (Brassicaceae ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-07-20

    Jul 20, 2009 ... In this study the phylogenetic relations among infraspecific, specific and supraspecific categories of 6 taxa of the genus Hesperis collected from different parts of Turkey were investigated by RAPD analysis. The results of the RAPD analysis support the idea that H. bicuspidata (Sect. Hesperis), H. schischkinii.

  1. A new species of Hesperis (Brassicaceae) from SW Anatolia, Turkey

    DEFF Research Database (Denmark)

    Parolly, G.; Tan, Kit

    2006-01-01

    Hesperis kuerschneri, from the vilayet of Denizli in the Western Taurus is described as a species new to science and illustrated. Its affinities are with H. theophrasti, which has several infraspecific taxa in the Balkans and Anatolia. The new species occurs on steep serpentine scree slopes toget...

  2. Quantitative variation for apomictic reproduction in the genus Boechera (Brassicaceae)

    NARCIS (Netherlands)

    Aliyu, O.M.; Schranz, M.E.; Sharbel, T.F.

    2010-01-01

    • Premise of the study: The evolution of asexual seed production (apomixis) from sexual relatives is a great enigma of plant biology. The genus Boechera is ideal for studying apomixis because of its close relation to Arabidopsis and the occurrence of sexual and apomictic species at low ploidy levels

  3. Seed image analysis and taxonomy of Diplotaxis DC. (Brassicaceae, Brassiceae)

    OpenAIRE

    Grillo, Oscar; Draper, David; Venora, Gianfranco; Martinez Laborde, Juan Bautista

    2012-01-01

    The genus Diplotaxis, comprising 32 or 34 species, plus several additional infraspecific taxa, displays a considerable degree of heterogeneity in the morphology, molecular markers, chromosome numbers and geographical amplitude of the species. The taxonomic relationships within the genus Diplotaxis were investigated by phenetic characterisation of germplasm belonging to 27 taxa of the genus, because there is an increasing interest in Diplotaxis, since some of its species (D. tenuifolia, D. mur...

  4. Revision of the genus diplotaxis (Brassicaceae) in Slovenia

    OpenAIRE

    Fabijan, Tina

    2017-01-01

    According to the data in Mala flora Slovenije (Wraber, 2007) four species of the genus Diplotaxis named D. muralis, D. tenuifolia, D. erucoides and D. viminea grow in Slovenia. The determination of the specimen is often difficult due to the lack of reliable determination characters. I have gathered the discriminative characters from floras and determination keys from neighbouring countries and checked them on the herbarium material from Herbarium LJU. I have examined 53 herbarium sheets, two ...

  5. The Role of ER Bodies in Brassicaceae Resistance under Clinorotation

    Science.gov (United States)

    Romanchuk, S. M.; Kordyum, E. L.

    2013-02-01

    Results of the electron-microscopic investigation of root apices of Arabidopsis thaliana 3- and 7-day old seedlings grown in the stationary conditions and under clinorotation are presented. It was shown the similarity in the root apex cell ultrastructure in control and under clinorotation. In the same time there were some differences in the ultrustructure of statocytes and the distal elongation zone under clinorotation. For the first time, the sensitivity of ER-bodies, which are derivative of granular endoplasmic reticulum and contain a β-glucosidase enzyme, to the influence of simulated microgravity that was demonstrated by increasing quantity and area of ER-bodies per cell section, as well as by higher variability of their shape under clinorotation. A degree of these changes correlated with the duration of clinorotation. On the basis of obtained data, a protective role of ER-bodies in adaptation of plants to microgravity is discussed.

  6. Stress response and health affecting compounds in Brassicaceae

    NARCIS (Netherlands)

    Jahangir, Muhammad

    2010-01-01

    Summary of the Thesis: Vegetables have always been considered as healthy food. So also Brassica vegetables are well known all over the world as a common food due to the presence of health affecting compounds (Chapter 2). A vast amount of data is available for health promoting compounds in

  7. Phylogeny and biogeography of Alyssum (Brassicaceae) based on ...

    Indian Academy of Sciences (India)

    Turkey. Odontarrhena. AY237952.1. A. chalcidicum. Elbasan Perrenjas, Albania. Odontarrhena. GQ284869.1. Macedonia Drosia. A. chalcidicum. Central, Greece. Odontarrhena. GQ284876.1. A. condensatum. Syria. Odontarrhena. AY237951.1. A. corsicum. Corsica, France. Odontarrhena. AY237949.1. A. corymbosoides.

  8. Phylogeny and biogeography of Alyssum (Brassicaceae) based on ...

    Indian Academy of Sciences (India)

    Molecular data suggested the diversification of Alyssum in Mediterranean areas and wide-ranging distribution such as North Africa, eastward into Central Asia and immigration into North America. Climatic aridification and arid/semiarid areas established in the Pliocene/Pleistocene could have provided favourable conditions ...

  9. Lepidium s. str. (Brassicaceae in the flora of Ukraine

    Directory of Open Access Journals (Sweden)

    Ilyinska Antonina P.

    2014-09-01

    Full Text Available The key to the 14 species of Lepidium occurring in the Ukraine, including basionyms and the most important synonyms, and distribution of these species within the floristic regions, especially in Ukraine, are presented

  10. 7 CFR 201.56-3 - Mustard family, Brassicaceae (Cruciferae).

    Science.gov (United States)

    2010-01-01

    ..., Chinese cabbage, cauliflower, collards, garden cress, upland cress, water cress, kale, Chinese kale, Siberian kale, kohlrabi, mustard, pakchoi, radish, rape, rutabaga, and turnip. (a) General description. (1...

  11. A synopsis of the South American Lepidium (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Ihsan A. Al-Shehbaz

    2010-01-01

    Full Text Available Cincuenta especies nativas y 12 naturalizadas de Lepidium crecen en América del Sur, se presenta una clave para las 62 especies. Se describen e ilustran tres nuevas especies de Argentina (L. hickenii, L. pedersenii y L. santacruzensis y dos para Perú (L. cuzcoensis y L. werffii, y se discuten sus relaciones con sus especies más afines. Se propone Lepidium crassius comb. nov., se designa lectotipo para 19 binomios (Coronopus didymus var. macrocarpus, C. didymus var. procumbens, L. abrotanifolium var. steinmannii, L. affine, L. argentinum, L. auriculatum, L. bonariense var. pseudovirginicum, L. calycinum var. integrifolium, L. costaricense, L. cumingianum var. orbiculatum, L. cumingianum subsp. berteroanum, L. depressum, L. myrianthum, L. neglectum, L. parodii, L. pubescens var. fallax, L. subvaginatum, L. virginicum subsp. centrali-americanum, Thlaspi campestre, y se reducen a sinónimos otros 17 nombres (Coronopus leptocarpus, C. leptocarpus var. microcarpus, L. boelckii, L. bonariense var. gayi, L. bonariense var. pseudovirginicum, L. brevicaule, L. calycinum, L. danielsii, L. demissum, L. kalenbornii, L. morrisonii, L. peruvianum, L. philippianum var. boliviense, L. raimondii, L. scabrifructum, L. spicatum var. caylx-persistente, L. subvaginatum. L. depressum y L. rahmeri son nuevos registros para la Argentina.

  12. A synopsis of the South American Lepidium (Brassicaceae)

    OpenAIRE

    Ihsan A. Al-Shehbaz

    2010-01-01

    Cincuenta especies nativas y 12 naturalizadas de Lepidium crecen en América del Sur, se presenta una clave para las 62 especies. Se describen e ilustran tres nuevas especies de Argentina (L. hickenii, L. pedersenii y L. santacruzensis) y dos para Perú (L. cuzcoensis y L. werffii), y se discuten sus relaciones con sus especies más afines. Se propone Lepidium crassius comb. nov., se designa lectotipo para 19 binomios (Coronopus didymus var. macrocarpus, C. didymus var. procumbens, L. abrotanifo...

  13. Control of corolla monosymmetry in the Brassicaceae Iberis amara

    OpenAIRE

    Busch, Andrea; Zachgo, Sabine

    2007-01-01

    Establishment of morphological novelties has contributed to the enormous diversification of floral architecture. One such novelty, flower monosymmetry, is assumed to have evolved several times independently during angiosperm evolution. To date, analysis of monosymmetry regulation has focused on species from taxa where monosymmetry prevails, such as the Lamiales and Fabaceae. In Antirrhinum majus, formation of a monosymmetric corolla is specified by the activity of the TCP transcription factor...

  14. Glucosinolate profiling and antimicrobial screening of Aurinia leucadea (Brassicaceae).

    Science.gov (United States)

    Blažević, Ivica; Radonić, Ani; Skočibušić, Mirjana; De Nicola, Gina R; Montaut, Sabine; Iori, Renato; Rollin, Patrick; Mastelić, Josip; Zekić, Marina; Maravić, Ana

    2011-12-01

    Glucosinolates (GLs) were characterized in various aerial parts (stems, leaves, and flowers) of Aurinia leucadea (Guss.) C. Koch and quantified according to the ISO 9167-1 official method based on the HPLC analysis of desulfoglucosinolates. Eight GLs, i.e., glucoraphanin (GRA), glucoalyssin (GAL; 1), gluconapin (GNA; 2), glucocochlearin (GCC), glucobrassicanapin (GBN; 3), glucotropaeolin (GTL), glucoerucin (GER), and glucoberteroin (GBE) were identified. The total GL contents were 57.1, 37.8, and 81.3 μmol/g dry weight in the stems, leaves, and flowers, respectively. The major GL detected in all parts of the plant was 2, followed by 1 and 3. GC/MS Analysis of the volatile fractions extracted from the aerial parts of fresh plant material either by hydrodistillation or CH(2) Cl(2) extraction showed that these fractions mostly contained isothiocyanates (ITCs). The main ITCs were but-3-enyl- (55.6-71.8%), pent-4-enyl- (7.6-15.3%), and 5-(methylsulfinyl)pentyl ITC (0-9.5%), originating from the corresponding GLs 2, 3, and 1, respectively. The antimicrobial activity of the volatile samples was investigated by determining inhibition zones with the disk-diffusion method and minimal inhibitory concentrations (MIC) with the microdilution method. They were found to inhibit a wide range of bacteria and fungi, with MIC values of 2.0-32.0 μg/ml, indicating their promising antimicrobial potential, especially against the fungi Candida albicans and Rhizopus stolonifer as well as against the clinically important pathogen Pseudomonas aeruginosa. Copyright © 2011 Verlag Helvetica Chimica Acta AG, Zürich.

  15. Nickel accumulation by Streptanthus polygaloides (Brassicaceae) reduces floral visitation rate.

    Science.gov (United States)

    Meindl, George A; Ashman, Tia-Lynn

    2014-02-01

    Hyperaccumulation is the phenomenon whereby plants take up and sequester in high concentrations elements that generally are excluded from above-ground tissues. It largely is unknown whether the metals taken up by these plants are transferred to floral rewards (i.e., nectar and pollen) and, if so, whether floral visitation is affected. We grew Streptanthus polygaloides, a nickel (Ni) hyperaccumulator, in short-term Ni supplemented soils and control soils to determine whether Ni is accumulated in floral rewards and whether floral visitation is affected by growth in Ni-rich soils. We found that while supplementation of soils with Ni did not alter floral morphology or reward quantity (i.e., anther size or nectar volume), Ni did accumulate in the nectar and pollen-filled anthers-providing the first demonstration that Ni is accumulated in pollinator rewards. Further, S. polygaloides grown in Ni-supplemented soils received fewer visits per flower per hour from both bees and flies (both naïve to Ni-rich floral resources in the study area) relative to plants grown in control soils, although the probability a plant was visited initially was unaffected by Ni treatment. Our findings show that while Ni-rich floral rewards decrease floral visitation, floral visitors are not completely deterred, so some floral visitors may collect and ingest potentially toxic resources from metal-hyperaccumulating plants. In addition to broadening our understanding of the effects of metal accumulation on ecological interactions in natural populations, these results have implications for the use of insect-pollinated plants in phytoremediation.

  16. The significance of glucosinolates for sulfur storage in Brassicaceae seedlings

    Directory of Open Access Journals (Sweden)

    Luit J. eDe Kok

    2014-12-01

    Full Text Available Brassica juncea seedlings contained a two-fold higher glucosinolate content than Brassica rapa and these secondary sulfur compounds accounted for up to 30 % of the organic sulfur fraction. The glucosinolate content was not affected by H2S and SO2 exposure, demonstrating that these sulfur compounds did not form a sink for excessive atmospheric supplied sulfur. Upon sulfate deprivation, the foliarly absorbed H2S and SO2 replaced sulfate as the sulfur source for growth of B. juncea and B. rapa seedlings. The glucosinolate content was decreased in sulfate-deprived plants, though its proportion of organic sulfur fraction was higher than that of sulfate-sufficient plants, both in absence and presence of H2S and SO2. The significance of myrosinase in the in situ turnover in these secondary sulfur compounds needs to be questioned, since there was no direct co-regulation between the content of glucosinolates and the transcript level and activity of myrosinase. Evidently, glucosinolates cannot be considered as sulfur storage compounds upon exposure to excessive atmospheric sulfur and are unlikely to be involved in the re-distribution of sulfur in B. juncea and B. rapa seedlings upon sulfate deprivation.

  17. Cruciferae (Brassicaceae: альтернативная обработка для «Конспекта сосудистых растений Монголии» (2014

    Directory of Open Access Journals (Sweden)

    D. A. German

    2015-07-01

    Full Text Available Представлен конспект крестоцветных (Cruciferae, или Brassicaceae Монголии, основанный на критической ревизии гербарных сборов, интернет-ресурсов и литературы, в том числе новейших работ по систематике семейства. Для всех 141 видов и 7 подвидов из 59 родов, отмеченных на данный момент во флоре страны, приведена краткая синонимика и данные по распространению (наличию или отсутствию в каждом из 16-ти ботанико-географических регионов в Монголии. Впервые для страны указан род левкой – Matthiola W. T. Aiton, представленный естественно произрастающим здесь M. superba Conti; некоторые виды отмечены в качестве новинок для отдельных районов. В то же время, перечислены и прокомментированы ошибочные указания представителей семейства для Монголии или определенных ее районов, обнародованные в основном после выхода «Конспекта …» И.А. Губанова (1996. Валидизированы новые комбинации в родах Guenthera Andrz. и Stevenia Fisch. Сообщение может считатья альтернативной обработкой крестоцветных для недавно вышедшего «Конспекта сосудистых растений Монголии» (2014.

  18. Arabis soyeri Reuter ex Huet subsp. soyeri (Brassicaceae en el Pirineo aragonés [Arabis soyeri Reuter & Huet subsp. soyeri (Brassicaceae, in the Aragonese Pyrenees

    Directory of Open Access Journals (Sweden)

    José Vicente FERRÁNDEZ PALACIO

    2012-12-01

    Full Text Available RESUMEN: En esta nota confirmamos la presencia de Arabis soyeri subsp. soyeri en el Pirineo aragonés (provincia de Huesca. Esta cita oscense se sitúa en el límite SW de su área de distribución endémica. Además, comentamos algunos aspectos sobre su autoecología y conservación.SUMMARY: Arabis soyeri Reuter & Huet subsp. soyeri is confirmed for the flora of the Aragonese Pyrenees (Huesca province, Spain. Moreower, this new station is located on the south-western border of its endemic range. Some aspects on its autecology and conservation are discussed as well.

  19. Models of the fate of glucosinolates in Brassicaceae from processing to digestion

    NARCIS (Netherlands)

    Kruse, I.

    2015-01-01

    Abstract Glucosinolates are secondary metabolites of Brassica vegetables. Glucosinolates are not bioactive themselves, but their hydrolysis products isothiocyanates have been associated with health benefits. The concentrations of glucosinolates and their break down products are strongly affected by

  20. Chemosystematic significance of flavonoids isolated from Diplotaxis acris (Brassicaceae) and related taxa.

    Science.gov (United States)

    Hussein, Sameh R; Marzouk, Mona M; Kassem, Mona E S; Abdel Latif, Rasha R; Mohammed, Reda S

    2017-02-01

    The chemosystematic relationship of four Diplotaxis species; Diplotaxis acris, Diplotaxis erucoides, Diplotaxis harra and Diplotaxis muralis were surveyed from the flavonoids point of view. These species were found to produce 33 flavonoids (7 flavones and 26 flavonols), including 11 compounds were isolated in the present study from D. acris. Among them, seven flavonoids were identified for the first time; luteolin (4), kaempferol (8), kaempferol 3-O-β-glucopyranoside-7-O-α-rhamnopyranoside (13), quercetin 3-O-β-glucopyranoside (16), quercetin 7-O-β-glucopyranoside (20), isorhamnetin (22) and isorhamnetin 3-O-β-glucopyranoside-7-O-α-rhamnopyranoside (32). Their structures were recognized on the basis of chemical and spectroscopic techniques (1D & 2D NMR, UV, EI & ESI/MS). The isolated flavonoids may provide useful taxonomic characters at the infraspecific levels of classification where the flavonoid profile of D. acris and D. harra is similar and different from the other species.

  1. Histología de la Maca, Lepidium meyenii Walpers (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Manuel Marín-Bravo

    2013-06-01

    Full Text Available Se presenta el estudio histológico de Lepidium meyenii Walpers "maca", enfocado principalmente en la caracterización del órgano reservante. El estudio se realizó en macas de color amarillo, procedentes de Junín, y comprendió la caracterización histológica del órgano reservante subterráneo y detalles adicionales de la estructura interna foliar, a partir de muestras fijadas en FAA y empleando la técnica de inclusión en parafina. Los resultados muestran en el órgano reservante las características de una región de transición entre la raíz, de estructura secundaria lignificada, y el tallo primario reducido, con el desarrollo de una amplia zona medular. Presenta además un tipo peculiar de actividad cambial secundaria en la forma de haces conductores corticales. Entre los detalles histológicos adicionales está el desarrollo de una cubierta suberificada de células corticales en el órgano reservante y la presencia de tricomas cónicos unicelulares en las hojas.

  2. Stem base diseases of winter wheat grown after forecrops of the family Brassicaceae

    Directory of Open Access Journals (Sweden)

    Barbara Majchrzak

    2012-12-01

    Full Text Available A study into the sanitary state of roots and culm base of winter wheat was carried out in 1999-2002 in the Production and Experimental Station in Bałcyny near Ostróda. Experimental wheat was cultivated after spring cross plants such as spring oilseed rape (Brassica napus ssp. oleiferus Metz., white mustard (Sinapis alba L, chinese mustard (Brassica juncea L., oleiferous radish (Raphanus sativus var. oleiferus L., false flax (Camelina sativa L., crambe (Crambe abbysinica Hoechst. and after oats (Avena sativa L. as a control. The other experimental factor was the method of after-harvest residue management, i.e. ploughing in the stubble, ploughing in the stubble and straw, ploughing in the stubble and straw with nitrogen added. The occurrence of root rot and stem base diseases was affected by weather conditions and forecrop species. Winter wheat roots were attacked to the lowest degree when spring rape and radish were used as forecrops, and to the highest degree - when grown after oat. The culm base was most intensely infected with fusarium foot rot (Fusarium spp.. The remaining root-rot diseases occurred every year but with different intensity. The method of utilization of after-harvest residues did not have a clear effect on the intensity of infection of the roots and culm base of winter wheat.

  3. Lectotypification of names of Himalayan Brassicaceae taxa currently placed in the genus Cardamine

    Science.gov (United States)

    Marhold, Karol; Kempa, Matúš; Al-Shehbaz, Ihsan A.

    2015-01-01

    Abstract Lectotypes of twenty-eight names of taxa currently recognized or synonymized in Cardamine are designated as part of the work on the account of the genus for the Pan-Himalayan Flora. Among them, the previous first-step lectotypification of the name Cardamine calthifolia is finalized. In cases when specimen images are available online, stable identifiers for specimens, other permanent links, or links via JSTOR Global Plants are provided. PMID:26140016

  4. Cardamine hamiltonii G.Don – Aziatische veldkers (Brassicaceae) in Nederland

    NARCIS (Netherlands)

    Dirkse, Gerard M.; Zonneveld, Ben J.M.; Duistermaat, Leni H.

    2015-01-01

    Sinds een paar jaar wordt een winterbloeiende, nagenoeg kale en kleinbloemige Cardamine waargenomen die niet met regionale Flora’s gedetermineerd kan worden. Deze vorm heeft geen bladrozet, bloemen met 6 meeldraden, en bladen zonder oortjes. Uit metingen van het genoomgewicht blijkt, dat het geen

  5. Novel seed protection in the recently evolved invasive, California wild radish, a hybrid Raphanus sp. (Brassicaceae).

    Science.gov (United States)

    Heredia, Sylvia M; Ellstrand, Norman C

    2014-12-01

    • Interspecific hybridization may have considerable effects on plant structural defenses that can contribute to the success of invasive hybrid lineages. Changes in fruit structural and material properties are predicted to have key effects on predispersal granivory.• Here, we asked whether plant structure can increase the fitness of a hybrid invasive relative to its progenitors. We compared fruit traits of the hybrid-derived lineage, California wild radish, with its progenitors, cultivated radish and jointed charlock.• The hybrid lineage is significantly different from one or both ancestors in fruit length, mass, diameter, volume, shape, wall strength, and internal seed distribution. We experimentally exposed the fruits of both hybrid and wild progenitor to avian granivores and found (1) different types and degrees of damage at the different fruit sections and (2) significant differences in the inflicted damage at different sections of the fruit.• Combining our descriptive and experimental data, we conclude that the novel seed protection of the hybrid California wild radish is an important defense mechanism. It offers differential protection to its seeds and according to our findings, better protection of seeds that have been found to be better competitors. We suggest then that the fruit has enabled, at least in part, the successful replacement of the parental species by the hybrid lineage. © 2014 Botanical Society of America, Inc.

  6. DYNAMICS OF POLLEN TUBE GROWTH IN THE WILD RADISH, RAPHANUS RAPHANISTRUM (BRASSICACEAE). I. ORDER OF FERTILIZATION.

    Science.gov (United States)

    Hill, Jeffrey P; Lord, Elizabeth M

    1986-11-01

    Gametophytic competition and selection have important effects on patterns of mating in plant populations. However, the relative importance of prezygotic mechanisms is often unclear due to a paucity of observations on pollen tube growth in vivo. In this study, we present observations on pollen tube behavior in the gynoecium of wild radish. Significant variation in the order of fertilization of the linearly arranged ovules occurred within the radish ovary. This variation is evidence that prezygotic mechanisms of gamete selection operate to sort pollen tubes nonrandomly to different ovule positions in the ovary. We propose that the variation in fertilization patterns can be attributed to variance in pollen tube growth rates in the central septum of the radish gynoecium. The path of pollen tube growth and gynoecial structure deserve greater attention in future studies of gamete competition. © 1986 The Society for the Study of Evolution.

  7. Mechanisms of differential pollen donor performance in wild radish, Raphanus sativus (Brassicaceae).

    Science.gov (United States)

    Marshall, D L; Diggle, P K

    2001-02-01

    In order to understand the characters on which sexual selection might operate in plants, it is critical to assess the mechanisms by which pollen competition and mate choice occur. To address this issue we measured a number of postpollination characters, ranging from pollen germination and pollen tube growth to final seed paternity, in wild radish. Crosses were performed using four pollen donors on a total of 16 maternal plants (four each from four families). Maternal plants were grown under two watering treatments to evaluate the effects of maternal tissue on the process of mating. The four pollen donors differed significantly in number of seeds sired and differed overall in the mating characters measured. However, it was difficult to associate particular mechanistic characters with ability to sire seeds, perhaps because of interactions among pollen donors within styles or among pollen donors and maternal plants. The process of pollen tube growth and fertilization differed substantially among maternal watering treatments, with many early events occurring more quickly in stressed plants. Seed paternity, however, was somewhat more even among pollen donors used on stressed maternal plants, suggesting that when maternal tissue is more competent, mating is slowed and is more selective.

  8. DNA barcoding of western North American taxa: Leymus (Poaceae) and Lepidium (Brassicaceae)

    Science.gov (United States)

    Catherine Mae Culumber

    2007-01-01

    My objective was to determine if polymorphic information from the 18S-5.8S-26S nuclear ribosomal DNA internal transcribed spacer regions and the trnK-psbA, trnK-rps16 chloroplast DNA spacer regions is sufficient 1) to identify a plant specimen to the species level, and 2) to establish the phylogenetic relationship between species. The first study examined the...

  9. Root transcript profiling of two Rorippa (brassicaceae) species reveals gene clusters associated with extreme submergence tolerance.

    NARCIS (Netherlands)

    Sasidharan, R.; Mustroph, A.; Boonman, A.; Akman, M.; Ammerlaan, A.M.H.; Breit, T.M.; Schranz, M.E.; Voesenek, L.A.C.J.; Tienderen, van P.H.

    2013-01-01

    Complete submergence represses photosynthesis and aerobic respiration, causing rapid mortality in most terrestrial plants. However, some plants have evolved traits allowing them to survive prolonged flooding, such as species of the genus Rorippa, close relatives of Arabidopsis (Arabidopsis

  10. Lectotypification of names of Himalayan Brassicaceae taxa currently placed in the genus Cardamine

    Directory of Open Access Journals (Sweden)

    Karol Marhold

    2015-05-01

    Full Text Available Lectotypes of twenty-eight names of taxa currently recognized or synonymized in Cardamine are designated as part of the work on the account of the genus for the Pan-Himalayan Flora. Among them, the previous first-step lectotypification of the name C. calthifolia is finalized. In cases when specimen images are available online, stable identifiers for specimens, other permanent links, or links via JSTOR Global Plants are provided.

  11. Lectotypification of names of Himalayan Brassicaceae taxa currently placed in the genus Cardamine.

    Science.gov (United States)

    Marhold, Karol; Kempa, Matúš; Al-Shehbaz, Ihsan A

    2015-01-01

    Lectotypes of twenty-eight names of taxa currently recognized or synonymized in Cardamine are designated as part of the work on the account of the genus for the Pan-Himalayan Flora. Among them, the previous first-step lectotypification of the name Cardaminecalthifolia is finalized. In cases when specimen images are available online, stable identifiers for specimens, other permanent links, or links via JSTOR Global Plants are provided.

  12. Asexual reproduction in a close relative of Arabidopsis: a genetic investigation of apomixis in Boechera ( Brassicaceae).

    NARCIS (Netherlands)

    Schranz, M.E.; Kantama, L.; Jong, de J.H.S.G.M.; Mitchell-Olds, T.

    2006-01-01

    Understanding apomixis (asexual reproduction through seeds) is of great interest to both plant breeders and evolutionary biologists. The genus Boechera is an excellent system for studying apomixis because of its close relationship to Arabidopsis, the occurrence of apomixis at the diploid level, and

  13. Bidirectional but asymmetrical sexual hybridization between Brassica carinata and Sinapis arvensis (Brassicaceae).

    Science.gov (United States)

    Cheung, Kyle W; Razeq, Fakhria M; Sauder, Connie A; James, Tracey; Martin, Sara L

    2015-05-01

    With transgenic crop development it is important to evaluate the potential for transgenes to escape into populations of wild, weedy relatives. Ethiopian mustard (Brassica carinata, BBCC) is easily transformed and is being investigated for uses from biodiesel fuels to biopharmaceuticals. However, little work has been done evaluating its ability to cross with relatives such as wild mustard (Sinapsis arvensis, SrSr), an abundant, cosmopolitan weedy relative. Here we conducted bidirectional crosses with Ethiopian mustard as a maternal parent in 997 crosses and paternal parent in 1,109 crosses. Hybrids were confirmed using flow cytometry and species-specific ITS molecular markers and indicate a high hybridization rate of 6.43 % between Ethiopian mustard (♀) and wild mustard (♂) and a lower, but not insignificant, hybridization rate of 0.01 % in the reverse direction. The majority of the hybrids were homoploid (BCSr) with less than 1 % of pollen production of their parents and low seed production (0.26 seeds/pollination) in crosses and backcrosses indicating a potential for advanced generation hybrids. The accession used had a significant effect on hybrid seed production with different accessions of Ethopian mustard varying in their production of hybrid offspring from 2.69 to 16.34 % and one accession of wild mustard siring almost twice as many hybrid offspring per flower as the other. One pentaploid (BBCCSr) and one hexaploid (BBCCSrSr) hybrid were produced and had higher pollen viability, though no and low seed production, respectively. As wild mustard is self-incompatible and the outcrossing rate of Ethiopian mustard has been estimated as 30 % potential for hybrid production in the wild appears to be high, though the hybridization rate found here represents a worst case scenario as it does not incorporate pre-pollination barriers. Hybridization in the wild needs to be directly evaluated as does the propensity of Ethiopian mustard to volunteer.

  14. Morphological, Anatomical and Palynological Studies on Endemic Matthiola anchoniifolia Hub. -Mor. (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Mehmet TEKIN

    2013-05-01

    Full Text Available In this paper, anatomical, palynological and seed micromorphological properties of an endemic plant Matthiola anchoniifolia Hub.-Mor. are recorded for the first time. A description and descriptive illustrations of the species are given based on the collected specimens for morphological study. Seed surface of M. anchoniifolia is examined by scanning electron microscope. The seed of M. anchoniifolia was compressed, brownish in colour and the cells of testa were nearly 60-80 μm in diameter and ranged from isodiametric, tetragonal or pentagonal. The anticlinal walls were straight or weakly curved while the outer periclinal walls were concave to flat with smooth surface. In anatomical study, cross sections of root, stem and stem leaf are examined. The root had secondary structure. Periderm consists of 5-8 layers of cells for phellem. Cortex consists of 9-12 layered parenchymatic tissue under the periderm. Secondary phloem ring-shaped, 6-9 layered and consists of companion cells and grouped sieve tubes. Stem had primary structure when analyzed. It is circular with a few irregular ribs in cross section. Cortex is 8-12 layered and parenchymatous. Stoma cells are present on both epidermis. Leaf is isobilateral. There are unicellular and ramified hairs on both surface. Palisade parenchyma cells are 1-2 layered and spongy parenchyma cells are 5-12 layered. M. anchoniifolia has tricolpate pollen type, prolate pollen shape and reticulate exine ornamentation.

  15. The Brassicaceae-Specific EWR1 Gene Provides Resistance to Vascular Wilt Pathogens

    OpenAIRE

    Yadeta, Koste A.; Dirk-Jan Valkenburg; Mathieu Hanemian; Yves Marco; Thomma, Bart P. H. J.

    2014-01-01

    Soil-borne vascular wilt diseases caused by Verticillium spp. are among the most destructive diseases worldwide in a wide range of plant species. The most effective means of controlling Verticillium wilt diseases is the use of genetic resistance. We have previously reported the identification of four activation-tagged Arabidopsis mutants which showed enhanced resistance to Verticillium wilt. Among these, one mutant also showed enhanced resistance to Ralstonia solanacearum, a bacterial vascula...

  16. Ultrastructural study of maturing pollen in Arabidopsis thaliana (L. Heynh. (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Krystyna Zając

    2014-01-01

    Full Text Available Ultrastructural changes in Arabidopsis thaliana pollen, between late microspore stage and mature pollen stage were described. When the generative cell was peeled off from the intine, it was of spherical shape and had all usual organelles with the exception of plastids. The cytoplasm transformation of the vegetative cell included an increase in the number of mitochondria and changes in the accumulation of starch and lipid bodies. The starch plastids were observed at the bicellular and early tricellular pollen stages and next starch was utilized during the maturation procces. The lipid bodies of the vegetative cell form a very regular sheath around the generative cell and then, around the sperm cells. Before anthesis the lipid bodies were dispersed within the whole vegetative cell cytoplasm.

  17. Reproductive ecology and severe pollen limitation in the polychromic tundra plant, Parrya nudicaulis (Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Justin R Fulkerson

    Full Text Available Pollen limitation is predicted to be particularly severe in tundra habitats. Numerous reproductive patterns associated with alpine and arctic species, particularly mechanisms associated with reproductive assurance, are suggested to be driven by high levels of pollen limitation. We studied the reproductive ecology of Parrya nudicaulis, a species with relatively large sexual reproductive investment and a wide range of floral pigmentation, in tundra habitats in interior montane Alaska to estimate the degree of pollen limitation. The plants are self-compatible and strongly protandrous, setting almost no seed in the absence of pollinators. Supplemental hand pollinations within pollinator exclusion cages indicated no cage effect on seed production. Floral visitation rates were low in both years of study and particularly infrequent in 2010. A diversity of insects visited P. nudicaulis, though syrphid and muscid flies composed the majority of all visits. Pollen-ovule ratios and levels of heterozygosity are consistent with a mixed mating system. Pollen limitation was severe; hand pollinations increased seed production per plant five-fold. Seed-to-ovule ratios remained low following hand pollinations, indicating resource limitation is likely to also be responsible for curtailing seed set. We suggest that pollen limitation in P. nudicaulis may be the result of selection favoring an overproduction of ovules as a bet-hedging strategy in this environmental context of highly variable pollen receipt.

  18. Species radiation by niche shifts in New Zealand's rockcresses (Pachycladon, Brassicaceae).

    Science.gov (United States)

    Joly, Simon; Heenan, Peter B; Lockhart, Peter J

    2014-03-01

    Adaptive radiations such as the Darwin finches in the Galapagos or the cichlid fishes from the Eastern African Great Lakes have been a constant source of inspiration for biologists and a stimulus for evolutionary thinking. A central concept behind adaptive radiation is that of evolution by niche shifts, or ecological speciation. Evidence for adaptive radiations generally requires a strong correlation between phenotypic traits and the environment. But adaptive traits are often cryptic, hence making this phenotype-environment approach difficult to implement. Here we propose a procedure for detecting adaptive radiation that focuses on species' ecological niche comparisons. It evaluates whether past ecological disparity in a group fits better a neutral Brownian motion model of ecological divergence or a niche shift model. We have evaluated this approach on New Zealand rockcresses (Pachycladon) that recently radiated in the New Zealand Alps. We show that the pattern of ecological divergence rejects the neutral model and is consistent with that of a niche shift model. Our approach to detect adaptive radiation has the advantage over alternative approaches that it focuses on ecological niches, a key concept behind adaptive radiation. It also provides a way to evaluate the importance of ecological speciation in adaptive radiations and will have general application in evolutionary studies. In the case of Pachycladon, the high estimated diversification rate, the distinctive ecological niches of species, and the evidence for ecological speciation suggest a remarkable example of adaptive radiation.

  19. Cytotype diversity and genome size variation in eastern Asian polyploid Cardamine (Brassicaceae) species.

    Science.gov (United States)

    Marhold, Karol; Kudoh, Hiroshi; Pak, Jae-Hong; Watanabe, Kuniaki; Spaniel, Stanislav; Lihová, Judita

    2010-02-01

    Intraspecific ploidy-level variation is an important aspect of a species' genetic make-up, which may lend insight into its evolutionary history and future potential. The present study explores this phenomenon in a group of eastern Asian Cardamine species. Plant material was sampled from 59 localities in Japan and Korea, which were used in karyological (chromosome counting) and flow cytometric analyses. The absolute nuclear DNA content (in pg) was measured using propidium iodide and the relative nuclear DNA content (in arbitrary units) was measured using 4,6-diamidino-2-phenylindole fluorochrome. Substantial cytotype diversity was found, with strikingly different distribution patterns between the species. Two cytotypes were found in C. torrentis sensu lato (4x and 8x, in C. valida and C. torrentis sensu stricto, respectively), which displays a north-south geographical pattern in Japan. Hypotheses regarding their origin and colonization history in the Japanese archipelago are discussed. In Korean C. amaraeiformis, only tetraploids were found, and these populations may in fact belong to C. valida. C. yezoensis was found to harbour as many as six cytotypes in Japan, ranging from hexa- to dodecaploids. Ploidy levels do not show any obvious geographical pattern; populations with mixed ploidy levels, containing two to four cytotypes, are frequently observed throughout the range. C. schinziana, an endemic of Hokkaido, has hexa- and octoploid populations. Previous chromosome records are also revised, showing that they are largely based on misidentified material or misinterpreted names. Sampling of multiple populations and utilization of the efficient flow cytometric approach allowed the detection of large-scale variation in ploidy levels and genome size variation attributable to aneuploidy. These data will be essential in further phylogenetic and evolutionary studies.

  20. Term-stability of extractive processes from Nasturtium officinale R. Br., brassicaceae for soxhlet modified system

    OpenAIRE

    Carvalho, João Luiz de Souza; Cunico, Miriam Machado; Dias, Josiane de Fátima Gaspari; Miguel, Marilis Dallarmi; Miguel, Obdulio Gomes

    2009-01-01

    This work had as objective verified the term-stability of the Soxhlet modified system with analytical and pharmacothecnical application in extractive processes of Nasturtium officinale. It has proven that the process is thermo-stable. The analysis with analytical have determined 3.606 mg g-1 in chlorogenic acid and 11.813 mg g-1 in rutin (extract 1:20 w/v) and with pharmacotecnical 3.427 mg g-1 in chlorogenic acid and 11.278 mg g-1 in rutin (extract 1:6 w/v). The income of the pharmacothecnic...

  1. Evolutionary History of the Genus Capsella (Brassicaceae - Capsella orientalis , New for Mongolia

    Directory of Open Access Journals (Sweden)

    Barbara Neuffer

    2014-12-01

    Full Text Available To elucidate the evolutionary history of the genus Capsella , we included the hitherto poorly known species C. orientalis and C. thracica into our studies together with C. grandifl ora , C. rubella , and C. bursa-pastoris . We sequenced the ITS, and four loci of noncoding cpDNA regions (trnL – F, rps16, trnH – psbA, trnQ – rps16. In common garden fi eld experiments C. orientalis turned out as early fl owering with a specifi c leaf type. The crossing ability of the species was tested in pollen germination experiments. Capsella orientalis (self-compatible, SC; 2n = 16 forms a clade (eastern lineage with C . bursa-pastoris (SC; 2n = 32, which is a sister clade (western lineage to C. grandifl ora (self-incompatible, SI; 2n = 16 and C. rubella (SC; 2n = 16. Capsella bursa-pastoris is an autopolyploid species of multiple origin, whereas the Bulgarian endemic C. thracica (SC; 2n = 32 is allopolyploid and emerged from interspecifi c hybridisation between C. bursa-pastoris and C. grandifl ora . The common ancestor of the two lineages was diploid and SI, and its distribution ranged from eastern Europe to central Asia, predominantly confi ned to steppe like habitats. Biogeographic dynamics during the Pleistocene caused geographic and genetic subdivisions within the common ancestor giving rise to the two extant lineages. Capsella orientalis is verifi ed at several positions in western Mongolia.

  2. Distribution of the species Matthiola fruticulosa (L.) Maire (Brassicaceae) in Croatia

    OpenAIRE

    Šegota, Vedran; Jasprica, Nenad; Bogdanović, Sandro; Pandža, Marija; Milović, Milenko; Alegro, Antun

    2016-01-01

    This paper presents the distribution of the rare plant species Matthiola fruticulosa (L.) Maire in Croatia. During our study, previous records on the Pelješac peninsula were confirmed, and new records were found, extending the Croatian areal to the southern U radu se analizira rasprostranjenost rijetke biljne vrste Matthiola fruticulosa (L.) Maire u Hrvatskoj. Tijekom našeg istraživanja potvrđena su prethodna nalazišta vrste na Pelješcu, a nova nalazišta su proširila areal vrste u Hrvatskoj s...

  3. Study of phylogenetic relationship of Turkish species ofMatthiola (Brassicaceae) based on ISSR amplification

    OpenAIRE

    DOĞAN, BEKİR; ÇELİK, MUSTAFA; ÜNAL, MURAT; SEFALI, ABDURRAHMAN; MARTİN, ESRA; KAYA, AYLA

    2016-01-01

    Matthiola W.T.Aiton is a taxonomically complex genus in which there are many problems, mostly with Matthiola longipetala and M. Odoratissima. Matthiola species native to Turkey were collected from various locations in Anatolia, and their DNA was isolated. Revision studies performed on the basis of molecular data obtained from studies conducted in recent years have made the phylogenetic relationships and systematic positions of the taxa more apparent and reliable. Consequently, the remaining t...

  4. Efeitos da radiação ultravioleta-B sobre a morfologia foliar de Arabidopsis thaliana (L. Heynh. (Brassicaceae Effects of ultraviolet-B radiation on leaf morphology of Arabidopsis thaliana (L. Heynh. (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Maria Regina Torres Boeger

    2006-06-01

    Full Text Available A redução da camada de ozônio resulta no aumento da radiação ultravioleta que atinge a superfície terrestre, especialmente a radiação ultravioletaB (UV-B. O aumento da radiação poderá induzir a mudanças estruturais e fisiológicas nas plantas, influenciando no seu crescimento e desenvolvimento. O objetivo deste trabalho foi determinar os efeitos da radiação UV-B ambiente sobre a morfologia das folhas de Arabidopsis thaliana desenvolvidas em condições controladas. As sementes de A. thaliana cresceram em câmaras de crescimento, com 300 µmol m-2s-1 de radiação fotossinteticamente ativa (PAR com ou sem 6 kJ m-2 s-1 de radiação UV-Bbe (UV-Bbe; UV-B biologicamente efetiva. Após 21 dias, 10 folhas de cada tratamento (com e sem radiação UV-B foram coletadas para avaliar área foliar, massa fresca e seca, AEF, densidades estomáticas e de tricomas de ambas as faces da folha, espessura da lâmina foliar e concentração de compostos fenólicos e de clorofila total, a e b. As folhas tratadas com radiação UV-B apresentaram menor área foliar, massa fresca e seca, densidade de tricomas na face adaxial e densidade de estômatos na face abaxial da folha. Entretanto, apresentaram os maiores valores médios de espessura total da lâmina e do mesofilo, maior concentração de clorofila total, clorofila a e clorofila b e compostos fenólicos foliares do que as folhas não tratadas com radiação UV-B. Essas diferenças morfológicas significativas (p Reduction of the ozone layer results in the increase in ultraviolet radiation reaching the earth's surface, especially the ultraviolet-B (UV-B. The increase of radiation may induce structural and physiological changes in plants, influencing their growth and development. This paper evaluates the effects of ambient UV-B radiation upon to the leaf morphology of Arabidopsis thaliana developed under controlled conditions. The seeds of A. thaliana grown in environmental chamber, with 300 µmol m-2s-1 de photosynthetically active radiation (PAR with and without 6 kJ m-2 s-1 of radiation UV-Bbe (UV-Bbe; UV-B biologically effective. After 21 days, ten leaves of each treatment (with and without UV-B radiation were collected to measure leaf area, fresh and dry mass, AEF, stomata and trichome densities of both leaf surfaces, leaf thickness and concentration of phenolic compounds and total chlorophyll, and chlorophyll a and b. Leaves treated with UV-B radiation presented smaller leaf area, fresh and dry weight, hair density, and stomata density on the adaxial epidermis. However, leaves treated with UV-B presented higher mean values for total thickness, mesophyll thickness, higher concentration of total chlorophyll, chlorophyll a and b, and phenolic compounds when compared to leaves without UV-B radiation. These significant morphological differences (p < 0.05 between leaves treated with and without UV-B radiation indicate that A. thaliana is not insensible to UV-B radiation and possess mechanisms that minimize the negative effects on leaf development and growth. Although, the plant responses to UV-B radiation involves several physiological mechanisms, that need more detailed investigation.

  5. Termoestabilidade de processos extrativos de Nasturtium officinale R. Br., brassicaceae por sistema Soxhlet modificado Term-stability of extractive processes from Nasturtium officinale R. Br., brassicaceae for soxhlet modified system

    Directory of Open Access Journals (Sweden)

    João Luiz de Souza Carvalho

    2009-01-01

    Full Text Available This work had as objective verified the term-stability of the Soxhlet modified system with analytical and pharmacothecnical application in extractive processes of Nasturtium officinale. It has proven that the process is thermo-stable. The analysis with analytical have determined 3.606 mg g-1 in chlorogenic acid and 11.813 mg g-1 in rutin (extract 1:20 w/v and with pharmacotecnical 3.427 mg g-1 in chlorogenic acid and 11.278 mg g-1 in rutin (extract 1:6 w/v. The income of the pharmacothecnical process was inferior to the analytical, suggesting that the pharmacothecnical process would need of at least the double of time in each extraction system.

  6. A stochastic population model for Lepidium papilliferum (Brassicaceae), a rare desert ephemeral with a persistent seed bank

    Science.gov (United States)

    Susan E. Meyer; Dana Quinney; Jay Weaver

    2006-01-01

    Population viability analysis (PVA) is a valuable tool for rare plant conservation, but PVA for plants with persistent seed banks is difficult without reliable information on seed bank processes. We modeled the population dynamics of the Snake River Plains ephemeral Lepidium papilliferum using data from an 11-yr artificial seed bank experiment to estimate age-specific...

  7. Phylogeography of Thlaspi arvense (Brassicaceae in China Inferred from Chloroplast and Nuclear DNA Sequences and Ecological Niche Modeling

    Directory of Open Access Journals (Sweden)

    Miao An

    2015-06-01

    Full Text Available Thlaspi arvense is a well-known annual farmland weed with worldwide distribution, which can be found from sea level to above 4000 m high on the Qinghai-Tibetan Plateau (QTP. In this paper, a phylogeographic history of T. arvense including 19 populations from China was inferred by using three chloroplast (cp DNA segments (trnL-trnF, rpl32-trnL and rps16 and one nuclear (n DNA segment (Fe-regulated transporter-like protein, ZIP. A total of 11 chloroplast haplotypes and six nuclear alleles were identified, and haplotypes unique to the QTP were recognized (C4, C5, C7 and N4. On the basis of molecular dating, haplotypes C4, C5 and C7 have separated from others around 1.58 Ma for cpDNA, which corresponds to the QTP uplift. In addition, this article suggests that the T. arvense populations in China are a mixture of diverged subpopulations as inferred by hT/vT test (hT ≤ vT, cpDNA and positive Tajima’s D values (1.87, 0.05 < p < 0.10 for cpDNA and 3.37, p < 0.01 for nDNA. Multimodality mismatch distribution curves and a relatively large shared area of suitable environmental conditions between the Last Glacial Maximum (LGM as well as the present time recognized by MaxEnt software reject the sudden expansion population model.

  8. Preferential exclusion of hybrids in mixed pollinations between oilseed rape (Brassica napus) and weedy B. campestris (Brassicaceae)

    DEFF Research Database (Denmark)

    Hauser, T.P.; Bagger Jørgensen, Rikke; Østergård, Hanne

    1997-01-01

    In most experimental hybridizations between oilseed rape (Brassica napus) and weedy B. campestris, either intra- or interspecific pollen has been applied to individual flowers. Under field conditions, however, stigmas will often receive a mixture of the two types of pollen, thereby allowing...... for competition between male gametophytes and/or seeds within pods. To test whether competition influences the success of hybridization, pollen from the two species was mixed in different proportions and applied to stigmas of both species. The resulting seeds were scored for paternity by isozyme and randomly...... survival of hybrid zygotes in B. napus pods. This is in contrast to the higher survival of hybrid seeds in B. napus than in B. campestris pods when pollinations are made with pure pollen. Altogether, the likelihood of a foreign pollen grain producing a seed was much lower on B. napus than on B. campestris...

  9. Plant-mediated effects of butterfly egg deposition on subsequent caterpillar and pupal development, across different species of wild Brassicaceae

    NARCIS (Netherlands)

    Pashalidou, F.G.; Fatouros, N.E.; Loon, van J.J.A.; Dicke, M.; Gols, R.

    2015-01-01

    1. Herbivory can change plant quality, which may have consequences for interactions between the inducing herbivore and other insect community members. 2. Studies investigating the effects of plant quality on herbivore performance often have neglected the egg stage, and instead introduced larvae onto

  10. Fruit and seed heteromorphism in the cold desert annual ephemeral Diptychocarpus strictus (Brassicaceae) and possible adaptive significance

    Science.gov (United States)

    Lu, Juanjuan; Tan, Dunyan; Baskin, Jerry M.; Baskin, Carol C.

    2010-01-01

    Background and Aims Diptychocarpus strictus is an annual ephemeral in the cold desert of northwest China that produces heteromorphic fruits and seeds. The primary aims of this study were to characterize the morphology and anatomy of fruits and seeds of this species and compare the role of fruit and seed hetermorphism in dispersal and germination. Methods Shape, size, mass and dispersal of siliques and seeds and the thickness of the mucilage layer on seeds were measured, and the anatomy of siliques and seeds, the role of seed mucilage in water absorption/dehydration, germination and adherence of seeds to soil particles, the role of pericarp of lower siliques in seed dormancy and seed after-ripening and germination phenology were studied using standard procedures. Key Results Plants produce dehiscent upper siliques with a thin pericarp containing seeds with large wings and a thick mucilage layer and indehiscent lower siliques with a thick pericarp containing nearly wingless seeds with a thin mucilage layer. The dispersal ability of seeds from the upper siliques was much greater than that of intact lower siliques. Mucilage increased the amount of water absorbed by seeds and decreased the rate of dehydration. Seeds with a thick mucilage layer adhered to soil particles much better than those with a thin mucilage layer or those from which mucilage had been removed. Fresh seeds were physiologically dormant and after-ripened during summer. Non-dormant seeds germinated to high percentages in light and in darkness. Germination of seeds from upper siliques is delayed until spring primarily by drought in summer and autumn, whereas the thick, indehiscent pericarp prevents germination for >1 year of seeds retained in lower siliques. Conclusions The life cycle of D. strictus is morphologically and physiologically adapted to the cold desert environment in time and space via a combination of characters associated with fruit and seed heteromorphism. PMID:20348559

  11. Multiple hybridization events in Cardamine (Brassicaceae) during the last 150 years: revisiting a textbook example of neoallopolyploidy.

    Science.gov (United States)

    Zozomová-Lihová, Judita; Krak, Karol; Mandáková, Terezie; Shimizu, Kentaro K; Spaniel, Stanislav; Vít, Petr; Lysak, Martin A

    2014-04-01

    Recently formed allopolyploid species represent excellent subjects for exploring early stages of polyploid evolution. The hexaploid Cardamine schulzii was regarded as one of the few nascent allopolyploid species formed within the past ∼150 years that presumably arose by autopolyploidization of a triploid hybrid, C. × insueta; however, the most recent investigations have shown that it is a trigenomic hybrid. The aims of this study were to explore the efficiency of progenitor-specific microsatellite markers in detecting the hybrid origins and genome composition of these two allopolyploids, to estimate the frequency of polyploid formation events, and to outline their evolutionary potential for long-term persistence and speciation. Flow-cytometric ploidy-level screening and genotyping by progenitor-specific microsatellite markers (20 microsatellite loci) were carried out on samples focused on hybridizing populations at Urnerboden, Switzerland, but also including comparative material of the parental species from other sites in the Alps and more distant areas. It was confirmed that hybridization between the diploids C. amara and C. rivularis auct. gave rise to triploid C. × insueta, and it is inferred that this has occurred repeatedly. Evidence is provided that C. schulzii comprises three parental genomes and supports its origin from hybridization events between C. × insueta and the locally co-occurring hypotetraploid C. pratensis, leading to two cytotypes of C. schulzii: hypopentaploid and hypohexaploid. Each cytotype of C. schulzii is genetically uniform, suggesting their single origins. Persistence of C. schulzii has presumably been achieved only by perennial growth and clonal reproduction. This contrasts with C. × insueta, in which multiple origins and occasional sexual reproduction have generated sufficient genetic variation for long-term survival and evolutionary success. This study illustrates a complex case of recurrent hybridization and polyploidization events, and highlights the role of triploids that promoted the origin of trigenomic hybrids.

  12. Using fitness parameters to evaluate three oilseed Brassicaceae species as potential oil crops in two contrasting environments

    Science.gov (United States)

    Thlaspi arvense and Camelina sativa have gained considerable attention as biofuel crops. But in some areas, these species, including C. microcarpa, are becoming rare weeds because of agriculture intensification. Including them as crops could guarantee their conservation in agricultural systems. The ...

  13. Allelopathy of Camelina sativa Boiss. (Brassicaceae on germination and early development of Bidens pilosa (L. and Glycine max (L. Merr

    Directory of Open Access Journals (Sweden)

    Jéssica da Silva

    2011-12-01

    Full Text Available This study evaluated the possible presence of allelopathic potential in camelina, as well as its effect on germination and early growth of soybean seedlings and beggarticks, in order, to verify the possibility of cultivating it with soybeans in a culture rotation system and its use as a herbicide. The experiments were carried out at the Laboratory of Plant Physiology of Universidade Estadual do Oeste do Paraná, Cascavel, Paraná, Brazil. The design was completely randomized and the evaluations were held daily. The parameters under analysis were: germination percentage, time and average speed of germination, and average root lenght. The data obtained underwent the F-Test and the mean values were compared through Tukey’s test, at a 5% probability level. The results confi rm the presence of allelopathic potential in camelina. It was found that this species can be considered an option for cultivating with soybean, due to the positive allelophatic interference caused in the culture and because it can be used in the control of weeds such as beggartick, having in mind that that it has delayed the development of the seedlings tested.

  14. 3D Plant Cell Architecture of Arabidopsis thaliana (Brassicaceae Using Focused Ion Beam–Scanning Electron Microscopy

    Directory of Open Access Journals (Sweden)

    Bhawana

    2014-06-01

    Full Text Available Premise of the study: Focused ion beam–scanning electron microscopy (FIB-SEM combines the ability to sequentially mill the sample surface and obtain SEM images that can be used to create 3D renderings with micron-level resolution. We have applied FIB-SEM to study Arabidopsis cell architecture. The goal was to determine the efficacy of this technique in plant tissue and cellular studies and to demonstrate its usefulness in studying cell and organelle architecture and distribution. Methods: Seed aleurone, leaf mesophyll, stem cortex, root cortex, and petal lamina from Arabidopsis were fixed and embedded for electron microscopy using protocols developed for animal tissues and modified for use with plant cells. Each sample was sectioned using the FIB and imaged with SEM. These serial images were assembled to produce 3D renderings of each cell type. Results: Organelles such as nuclei and chloroplasts were easily identifiable, and other structures such as endoplasmic reticula, lipid bodies, and starch grains were distinguishable in each tissue. Discussion: The application of FIB-SEM produced 3D renderings of five plant cell types and offered unique views of their shapes and internal content. These results demonstrate the usefulness of FIB-SEM for organelle distribution and cell architecture studies.

  15. Taxonomy and systematics are key to biological information: Arabidopsis, Eutrema (Thellungiella), Noccaea and Schrenkiella (Brassicaceae) as examples

    Science.gov (United States)

    Koch, Marcus A.; German, Dmitry A.

    2013-01-01

    Taxonomy and systematics provide the names and evolutionary framework for any biological study. Without these names there is no access to a biological context of the evolutionary processes which gave rise to a given taxon: close relatives and sister species (hybridization), more distantly related taxa (ancestral states), for example. This is not only true for the single species a research project is focusing on, but also for its relatives, which might be selected for comparative approaches and future research. Nevertheless, taxonomical and systematic knowledge is rarely fully explored and considered across biological disciplines. One would expect the situation to be more developed with model organisms such as Noccaea, Arabidopsis, Schrenkiella and Eutrema (Thellungiella). However, we show the reverse. Using Arabidopsis halleri and Noccaea caerulescens, two model species among metal accumulating taxa, we summarize and reflect past taxonomy and systematics of Arabidopsis and Noccaea and provide a modern synthesis of taxonomic, systematic and evolutionary perspectives. The same is presented for several species of Eutrema s. l. and Schrenkiella recently appeared as models for studying stress tolerance in plants and widely known under the name Thellungiella. PMID:23914192

  16. Characterization of Zinc and Cadmium Hyperaccumulation in Three Noccaea (Brassicaceae) Populations from Non-metalliferous Sites in the Eastern Pyrenees

    Science.gov (United States)

    Martos, Soledad; Gallego, Berta; Sáez, Llorenç; López-Alvarado, Javier; Cabot, Catalina; Poschenrieder, Charlotte

    2016-01-01

    The Southern slope of the Pyrenees is the meridional limit for the distribution of several Noccaea populations. However, the systematic description of these populations and their hyperaccumulation mechanisms are not well established. Morphological and genetic analysis (ITS and 3 chloroplast regions) were used to identify Noccaea populations localized on non-metallicolous soils during a survey in the Catalonian Pyrenees. Cd and Zn concentrations were analyzed in soils and plants both sampled in the field and grown hydroponically. The expression of selected metal transporter genes was assessed by quantitative PCR. The populations were identified as Noccaea brachypetala (Jord.) F.K. Mey by conspicuous morphological traits. Principal component analysis provided a clear separation among N. brachypetala, Noccaea caerulescens J. Presl & C. Presl and Noccaea occitanica (Jord.) F.K. Mey., three Noccaea species reported in the Pyrenees. Contrastingly, ITS and cpDNA analyses were unable to clearly differentiate these taxa. Differences in the expression of the metal transporter genes HMA3, HMA4, and MTP1 between N. caerulescens and N. brachypetala, and those amongst the N. brachypetala populations suggest differences in the strategies for handling enhanced Cd and Zn availability. This is the first report demonstrating Cd and Zn hyperaccumulation by N. brachypetala both in the field and in hydroponics. This comprehensive study based on taxonomic, molecular, and physiological data allows both the correct identification of this species and the characterization of population differences in hyperaccumulation and tolerance of Zn and Cd. PMID:26904085

  17. Actividad leishmanicida de los extractos metanólicos de cuatro ecotipos de Lepidium peruvianum, Chacón (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Libertad Alzamora

    2013-05-01

    Full Text Available El tratamiento clásico de la leishmaniosis cutánea consiste en la inyección de 15-20 ampollas de Glucantine lo que ocasiona efectos secundarios, este hecho justifica la búsqueda de nuevos medicamentos motivando la presente investigación. El objetivo fue evaluar in vitro la actividad leishmanicida de los extractos metanólicos (EM de los ecotipos blanco, rojo, morado y negro de Lepidium peruvianum, Chacón (también conocida como Lepidium meyenii Walp., sobre el crecimiento de Leishmania braziliensis peruviana. Los promastigotes alcanzaron la fase de crecimiento exponencial al quinto día de cultivo a 27 ºC en el medio bifásico Columbia, suplementado con 15% de sangre desfibrinada de carnero, en ese momento se enfrentaron, por separado, con los EM a concentraciones de 50, 100, 200 y 400 μg/ml. Los recuentos se hicieron diariamente con cámara Neubauer. La máxima disminución de promastigotes se produjo al segundo día de enfrentamiento para el ecotipo morado (17,41% de viabilidad empleando 400 μg/ml. El efecto leishmanicida estaría relacionado con los alcaloides imidazólicos presentes en el EM. Se concluye que al segundo día de enfrentamiento con el EM, el ecotipo morado presenta la mayor actividad leishmanicida seguido del ecotipo blanco.

  18. Actividad leishmanicida de los extractos metanólicos de cuatro ecotipos de Lepidium peruvianum, Chacón (Brassicaceae)

    OpenAIRE

    Alzamora, Libertad; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Solís, Hilda; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Rojas, Marisol; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Calderón, Marisela; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Fajardo, Narda; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Quispe, Jenny; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Alvarez, Evelyn; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Colona, Erasmo; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Torres, Dina; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología

    2013-01-01

    The classic treatment of the cutaneous leishmaniosis consists on the injection of 15-20 ampoule of Glucantine what causes serious secondary effects. This fact justifies the search of new medications what motivated the present investigation. The objective was to evaluate the leishmanicidal activity of the methanolic extracts (ME) of the white, red, purple and black ecotypes of Lepidium peruvianum Chacón (at present Lepidium meyenii Walp.) about the growth of Leishmania braziliensis peruviana i...

  19. Magnitude and timing of leaf damage affect seed production in a natural population of Arabidopsis thaliana (Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Reiko Akiyama

    Full Text Available BACKGROUND: The effect of herbivory on plant fitness varies widely. Understanding the causes of this variation is of considerable interest because of its implications for plant population dynamics and trait evolution. We experimentally defoliated the annual herb Arabidopsis thaliana in a natural population in Sweden to test the hypotheses that (a plant fitness decreases with increasing damage, (b tolerance to defoliation is lower before flowering than during flowering, and (c defoliation before flowering reduces number of seeds more strongly than defoliation during flowering, but the opposite is true for effects on seed size. METHODOLOGY/PRINCIPAL FINDINGS: In a first experiment, between 0 and 75% of the leaf area was removed in May from plants that flowered or were about to start flowering. In a second experiment, 0, 25%, or 50% of the leaf area was removed from plants on one of two occasions, in mid April when plants were either in the vegetative rosette or bolting stage, or in mid May when plants were flowering. In the first experiment, seed production was negatively related to leaf area removed, and at the highest damage level, also mean seed size was reduced. In the second experiment, removal of 50% of the leaf area reduced seed production by 60% among plants defoliated early in the season at the vegetative rosettes, and by 22% among plants defoliated early in the season at the bolting stage, but did not reduce seed output of plants defoliated one month later. No seasonal shift in the effect of defoliation on seed size was detected. CONCLUSIONS/SIGNIFICANCE: The results show that leaf damage may reduce the fitness of A. thaliana, and suggest that in this population leaf herbivores feeding on plants before flowering should exert stronger selection on defence traits than those feeding on plants during flowering, given similar damage levels.

  20. 3D Plant cell architecture of Arabidopsis thaliana (Brassicaceae) using focused ion beam-scanning electron microscopy.

    Science.gov (United States)

    Bhawana; Miller, Joyce L; Cahoon, A Bruce

    2014-06-01

    Focused ion beam-scanning electron microscopy (FIB-SEM) combines the ability to sequentially mill the sample surface and obtain SEM images that can be used to create 3D renderings with micron-level resolution. We have applied FIB-SEM to study Arabidopsis cell architecture. The goal was to determine the efficacy of this technique in plant tissue and cellular studies and to demonstrate its usefulness in studying cell and organelle architecture and distribution. • Seed aleurone, leaf mesophyll, stem cortex, root cortex, and petal lamina from Arabidopsis were fixed and embedded for electron microscopy using protocols developed for animal tissues and modified for use with plant cells. Each sample was sectioned using the FIB and imaged with SEM. These serial images were assembled to produce 3D renderings of each cell type. • Organelles such as nuclei and chloroplasts were easily identifiable, and other structures such as endoplasmic reticula, lipid bodies, and starch grains were distinguishable in each tissue. • The application of FIB-SEM produced 3D renderings of five plant cell types and offered unique views of their shapes and internal content. These results demonstrate the usefulness of FIB-SEM for organelle distribution and cell architecture studies.

  1. Structure of a Berberine Bridge Enzyme-Like Enzyme with an Active Site Specific to the Plant Family Brassicaceae

    DEFF Research Database (Denmark)

    Daniel, Bastian; Wallner, Silvia; Steiner, Barbara

    2016-01-01

    to the replacement of a cysteine with a histidine. In addition, the structure reveals the interaction of a glutamic acid (Glu426) with an aspartic acid (Asp369) at the active site, which appear to share a proton. This arrangement leads to the delocalization of a negative charge at the active site that may...

  2. Patterns of Substitution Rate Variation at Many Nuclear Loci in Two Species Trios in the Brassicaceae Partitioned with ANOVA.

    Science.gov (United States)

    Braverman, John M; Hamilton, Matthew B; Johnson, Brent A

    2016-10-01

    There are marked variations among loci and among lineages in rates of nucleotide substitution. The generation time hypothesis (GTH) is a neutral explanation for substitution rate heterogeneity that has genomewide application, predicting that species with shorter generation times accumulate DNA sequence substitutions faster than species with longer generation times do since faster genome replication provides more opportunities for mutations to occur and reach fixation by genetic drift. Relatively few studies have rigorously evaluated the GTH in plants, and there are numerous alternative hypotheses for plant substitution rate variation. One major challenge has been finding pairs of closely related plant species with contrasting generation times and appropriate outgroup taxa that all also have DNA sequence data for numerous loci. To test for causes of rate variation, we obtained sequence data for 256 genes for Arabidopsis thaliana, normally reproducing every year, and the biennial Arabidopsis lyrata with three closely related outgroup taxa (Brassica rapa, Capsella grandiflora, and Neslia paniculata) as well as the biennial Brassica oleracea and the annual B. rapa lineage with the outgroup N. paniculata. A sign test indicated that more loci than expected by chance have faster rates of substitution on the branch leading to the annual than to the perennial for one three-species trio but not another. Tajima's 1D and 2D tests, and a likelihood ratio test that incorporated saturation correction, rejected rate homogeneity for up to 26 genes (up to 14 genes when correcting for multiple tests), consistently showing faster rates for the annual lineage in the Arabidopsis species trio. ANOVA showed significant rate heterogeneity between the Arabidopsis and Brassica species trios (about 6 % of rate variation) and among loci (about 26-32 % of rate variation). The lineage-by-locus interaction which would be caused by locus- and lineage-specific natural selection explained about 13 % of substitution rate variation in one ANOVA model using substitution rates from genes partitioned into odd and even codons but was not a significant effect without partitioned genes. Annual/perennial lineage and species trio by annual/perennial lineage each explained about 1 % of substitution rate variation.

  3. Interactive impacts of a herbivore and a pathogen on two resistance types of Barbarea vulgaris (Brassicaceae)

    DEFF Research Database (Denmark)

    Heimes, Christine; Thiele, Jan; van Mölken, Tamara

    2015-01-01

    by interactive impacts of the antagonists. Most of the insect-resistant G-plants were severely affected by white rust, which reduced biomass and reproductive potential compared to the controls. However, when also exposed to flea beetles, biomass loss was mitigated in G-plants, even though apparent disease...... the pathogen Albugo sp. (white blister rust) and the herbivorous flea beetle Phyllotreta nemorum affected each other's performance on two resistance types (G-type and P-type) of the crucifer Barbarea vulgaris ssp. arcuata, and whether biomass, reproduction and survival of the plants were affected...... symptoms were not reduced. Most of the insect-susceptible P-plants were resistant to white rust; however, the number of flea beetle mines tended to increase in plants also exposed to Albugo, and biomass at the last harvest was slightly lower in the combined treatment. Thus, interactive impacts...

  4. Dormancy breaking and seed germination of the annual weeds Thlaspi arvense, Descurainia sophia and Malcolmia africana (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Karimmojeni Hassan

    2014-07-01

    Full Text Available In Iran, Descurainia sophia, Malcolmia africana, and Thlaspi arvense are abundantly found as importunate weeds in winter cereal. Understanding the timing of seed germination under natural conditions is crucial for learning how to manage these annual weeds. Therefore, this study was conducted to evaluate the effect of soil burial, dry storage, cold stratification, KNO3, GA3, and scarification on the seed dormancy and germination of these three species. Species had significantly different responses to the treatment. In D. sophia, seeds buried at a depth of 10 cm for 60 days (55%, and seeds dry stored at 20°C for 180 days (45% showed the highest level of germination. In M. africana, the germination percentage reached 95% when seeds buried at a depth of 1 cm were soaked in a GA3 concentration of 150 ppm. T. arvense had the lowest level of germination compared to the other species. The highest percentage of T. arvense germination was obtained in seeds treated with 150 ppm GA3. Potassium nitrate partly increased germinability in seeds of M. africana, which initially were less dormant than those of T. arvense and D. sophia.

  5. Effect of enhanced UV-B radiation on pollen quantity, quality, and seed yield in Brassica rapa (Brassicaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Demchik, S.M.; Day, T.A. [West Virginia Univ., Morgantown, WV (United States)

    1996-05-01

    Three experiments examined the influence of ultraviolet-B radiation (UV-B; 280-320 nm) exposure on reproduction in Brassica rapa (Brassicacaeae). Plants were grown in a greenhouse under three biologically effective UV-B levels that stimulated either an ambient stratospheric ozone level (control), 16% ({open_quotes}low enhanced{close_quotes}), or 32% ({open_quotes}high enhanced{close_quotes}) ozone depletion levels at Morgantown, WV, USA in mid-March. In the first experiment,pollen production and viability per flower were reduced by {approx}50% under both enhanced UV-B levels relative to ambient controls. While plants under high-enhanced UV-B produced over 40% more flowers than plants under the two lower UV-B treatments, whole-plant production of viable pollen was reduced under low-enhanced UV-B to 34% of ambient controls. In the second experiment, the influence of source-plant UV-B exposure on in vitro pollen from plants was examined and whether source-plant UV-B exposure influenced in vitro pollen germination and viability. Pollen from plants under both enhanced-UV-B was reduced from 65 to 18%. Viability of the pollen from plants grown under both enhanced UV-B treatments was reduced to a much lesser extent: only from {approx}43 to 22%. Thus, ambient source-plant pollen was more sensitive to enhanced UV-B levels to fertilize plants growing under ambient-UV-B levels, and assessed subsequent seed production and germination. Seed abortion rates were higher in plants pollinated with pollen from the enhanced UV-B treatments, than from ambient UV-B. Despite this, seed yield (number and mass) per plant was similar, regardless of the UV-B exposure of their pollen source. Our findings demonstrate that enhanced UV-B levels associated with springtime ozone depletion events have the capacity to substantially reduce viable pollen production, and could ultimately reduce reproductive success of B. rapa. 37 refs., 4 figs., 2 tabs.

  6. Comparison of growth inhibition profiles and mechanisms of apoptosis induction in human colon cancer cell lines by isothiocyanates and indoles from Brassicaceae

    Energy Technology Data Exchange (ETDEWEB)

    Pappa, Gerlinde [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Lichtenberg, Maike [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Iori, Renato [Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Istituto Sperimentale Colture Industriali, 40129 Bologna (Italy); Barillari, Jessica [Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Istituto Sperimentale Colture Industriali, 40129 Bologna (Italy); Bartsch, Helmut [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Gerhaeuser, Clarissa [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany)]. E-mail: c.gerhauser@dkfz.de

    2006-07-25

    The isothiocyanates sulforaphane and PEITC ({beta}-phenethyl isothiocyanate) as well as the indoles indole-3-carbinol and its condensation product 3,3'-diindolylmethane are known to inhibit cancer cell proliferation and induce apoptosis. In this study, we compared the cell growth inhibitory potential of the four compounds on the p53 wild type human colon cancer cell line 40-16 (p53{sup +/+}) and its p53 knockout derivative 379.2 (p53{sup -/-}) (both derived from HCT116). Using sulforhodamin B staining to assess cell proliferation, we found that the isothiocyanates were strongly cytotoxic, whereas the indoles inhibited cell growth in a cytostatic manner. Half-maximal inhibitory concentrations of all four compounds in both cell lines ranged from 5-15 {mu}M after 24, 48 and 72 h of treatment. Apoptosis induction was analyzed by immunoblotting of poly(ADP-ribose)polymerase (PARP). Treatment with sulforaphane (15 {mu}M), PEITC (10 {mu}M), indole-3-carbinol (10 {mu}M) and 3,3'-diindolylmethane (10 {mu}M) induced PARP cleavage after 24 and 48 h in both 40-16 and the 379.2 cell lines, suggestive of a p53-independent mechanism of apoptosis induction. In cultured 40-16 cells, activation of caspase-9 and -7 detected by Western blotting indicated involvement of the mitochondrial pathway. We detected time- and concentration-dependent changes in protein expression of anti-apoptotic Bcl-x{sub L} as well as pro-apoptotic Bax and Bak proteins. Of note is that for sulforaphane only, ratios of pro- to anti-apoptotic Bcl-2 family protein levels directly correlated with apoptosis induction measured by PARP cleavage. Taken together, we demonstrated that the glucosinolate breakdown products investigated in this study have distinct profiles of cell growth inhibition, potential to induce p53-independent apoptosis and to modulate Bcl-2 family protein expression in human colon cancer cell lines.

  7. Nuclear and chloroplast DNA phylogeography reveals vicariance among European populations of the model species for the study of metal tolerance, Arabidopsis halleri (Brassicaceae).

    Science.gov (United States)

    Pauwels, Maxime; Vekemans, Xavier; Godé, Cécile; Frérot, Hélène; Castric, Vincent; Saumitou-Laprade, Pierre

    2012-03-01

    Arabidopsis halleri is a pseudometallophyte involved in numerous molecular studies of the adaptation to anthropogenic metal stress. In order to test the representativeness of genetic accessions commonly used in these studies, we investigated the A. halleri population genetic structure in Europe. Microsatellite and nucleotide polymorphisms from the nuclear and chloroplast genomes, respectively, were used to genotype 65 populations scattered over Europe. The large-scale population structure was characterized by a significant phylogeographic signal between two major genetic units. The localization of the phylogeographic break was assumed to result from vicariance between large populations isolated in southern and central Europe, on either side of ice sheets covering the Alps during the Quaternary ice ages. Genetic isolation was shown to be maintained in western Europe by the high summits of the Alps, whereas admixture was detected in the Carpathians. Considering the phylogeographic literature, our results suggest a distinct phylogeographic pattern for European species occurring in both mountain and lowland habitats. Considering the evolution of metal adaptation in A. halleri, it appears that recent adaptations to anthropogenic metal stress that have occurred within either phylogeographic unit should be regarded as independent events that potentially have involved the evolution of a variety of genetic mechanisms. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  8. Climatic adaptability of populations of Diplotaxis erucoides D.C. (Brassicaceae) from Sicily, based on leaf morphology, leaf anatomy and δ13 C studies

    Science.gov (United States)

    Schleser, G. H.; Bernhardt, K.-G.; Hurka, H.

    1989-06-01

    The morphological and anatomical variability of Diplotaxis erucoides populations from Sicily was investigated. Populations growing during the summer months exhibit distinct xeromorphic features. Leaf area is strongly reduced and leaf thickness is increased when compared with winter populations. Cell size, as well as cell arrangement and mesophyll cell surface area differ significantly between summer and winter populations. Leaf thickness is almost three times higher in summer populations and A (cell)/ A, i.e. the mesophyll cell surface area per unit leaf area changes from about 16 for winter populations to almost 52 for summer populations. These differences are partly due to differences in intercellular volume and partly due to alterations in mesophyll cell sizes. The organic materal of the summer populations exhibits δ13C values in the order of -27%. to -28%., while the corresponding values for the winter populations are in the order of -31%. to -33%.. Analysis of D. erucoides populations from the transition period revealed intermediate δ13C values. Anatomical variations such as reductions or increases of A (cells)/ A and changes of intercellular volume correlate with the corresponding δ13C data. The δ13C data are discussed in conjunction with the differences in leaf anatomy.

  9. Frequency-dependent fitness of hybrids between oilseed rape (¤Brassica napus¤) and weedy ¤B. rapa¤ (Brassicaceae)

    DEFF Research Database (Denmark)

    Hauser, T.P.; Damgaard, C.; Bagger Jørgensen, Rikke

    2003-01-01

    Fitness of interspecific hybrids is sometimes high relative to their parents, despite the conventional belief that they are mostly unfit. F-1 hybrids between oilseed rape (Brassica napus) and weedy B. rapa can be significantly more fit than their weedy parents under some conditions; however, under...... other conditions they are less fit. To understand the reasons, we measured the seed production of B. napus, B. rapa, and different generations of hybrid plants at three different densities and in mixtures of different frequencies (including pure stands). Brassica napus, B. rapa, and backcross plants (F...... and reproductive interactions may be responsible for these effects. Our results show that the fitness of both parents and hybrids is strongly frequency-dependent and that the likelihood of introgression of genes between the species thus may depend on the numbers and densities of parents and their various hybrid...

  10. Molecular cloning and functional characterization of a glutathione S-transferase involved in both anthocyanin and proanthocyanidin accumulation in Camelina sativa (Brassicaceae).

    Science.gov (United States)

    Wang, Y; Tang, Y; Zhang, M; Cai, F; Qin, J; Wang, Q; Liu, C; Wang, G; Xu, L; Yang, L; Li, J; Wang, Z; Li, X

    2012-12-21

    Recently, we found that the Arabidopsis TT19 protein, a glutathione S-transferase, has two functional domains that influence both anthocyanin and proanthocyanidin accumulation. To further understand the function of this protein in the other species, we cloned a cDNA encoding a glutathione S-transferase (namely CMGSTF12) from Camelina sativa, an oil crop that has received renewed interest due to its biofuel value and high omega-3 levels. Southern blot analysis demonstrated one copy of CMGSTF12 in C. sativa. Transformation of the Arabidopsis loss-of-function tt19-1 mutant with CMGSTF12 cDNA complemented accumulation of anthocyanin in vegetative tissues and resulted in the wild-type level of proanthocyanidin (both extractable and unextractable) in seeds. No obvious flavonoid accumulation changes were detected in the transgenic seeds, indicating that CMGSTF12 may only involve the lower flavonoid pathway, further proving that the TT19 protein controls accumulation of unextractable proanthocyanidin.

  11. Evaluation of the potential for interspecific hybridization between Camelina sativa and related wild Brassicaceae in anticipation of field trials of GM camelina.

    Science.gov (United States)

    Julié-Galau, Stéphane; Bellec, Yannick; Faure, Jean-Denis; Tepfer, Mark

    2014-02-01

    Camelina (Camelina sativa (L.) Crantz) is a re-emergent oilseed crop that is also becoming important as a model for applied projects based on studies in Arabidopsis thaliana, since the two species are closely related members of the tribe Camelineae of the Brassicaeae. Since camelina can be transformed genetically by floral dip, genetically modified (GM) camelina is being created in many laboratories, and small-scale field trials are already being conducted in the US and Canada. Although camelina does not cross-fertilize Brassica crop species, such as oilseed rape, nothing was known about its ability to cross with other members of the tribe Camelineae, which in addition to arabidopsis includes the widespread weed, shepherd's purse (Capsella bursa-pastoris). We have tested the ability of camelina to cross with arabidopsis and C. bursa-pastoris, as well as with the more distantly related Cardamine hirsuta, tribe cardamineae. No seeds were produced in crosses with arabidopsis, and a few seeds were obtained in crosses with C. hirsuta, but the embryos aborted at an early stage of development. A few seeds were also obtained in crosses with C. bursa-pastoris, which germinated to produce plants of a phenotype intermediate to that of the parents, but the hybrids were both male and female sterile. Therefore, the likelihood of pollen-mediated gene flow from camelina to these related species is low.

  12. Alelopatia de Camelina sativa Boiss. (Brassicaceae sobre a germinação e desenvolvimento inicial de Bidens pilosa (L. e Glycine max (L. Merr

    Directory of Open Access Journals (Sweden)

    Jéssica da Silva

    2011-09-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2011v24n4p17 O presente trabalho buscou avaliar a possível presença de potencial alelopático na camelina, bem como o seu efeito sobre a germinação e o desenvolvimento inicial de plântulas de soja e picão-preto, a fim de verificar a possibilidade do cultivo dela com a soja no sistema de rotação de culturas e de seu uso como herbicida. Os experimentos foram realizados no Laboratório de Fisiologia Vegetal da Universidade Estadual do Oeste do Paraná, Cascavel, Paraná. O delineamento foi inteiramente casualizado e as avaliações realizadas diariamente. Os parâmetros avaliados foram: porcentagem de germinação, tempo e velocidade média de germinação e comprimento médio de raiz. Os dados obtidos foram submetidos ao Teste F e as médias comparadas pelo Teste de Tukey, a 5% de probabilidade. Os resultados obtidos comprovam a presença de potencial alelopático na camelina. Foi verificado que esta espécie pode ser considerada uma opção para o cultivo com a soja devido à interferência alelopática positiva provocada na cultura e ainda, que ela apresenta capacidade para utilização no controle de plantas invasoras como o picão-preto, já que atuou atrasando o desenvolvimento das plântulas testadas.

  13. Influência de temperatura, luz e giberelina na germinação de sementes de Thlaspi caerulescens J. Presl & C. Presl (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Marcelo de Almeida Guimarães

    2010-06-01

    Full Text Available Thlaspi caerulescens é espécie hiperacumuladora de metais como Cd2+, Ni2+ e Zn2+, considerada como uma plantamodelo para estudar a acumulação e tolerância a metais pesados. No entanto, a baixa produção de sementes em nossas condições climáticas tornam necessária a determinação de condições que possam maximizar a germinação e o vigor de suas sementes. Para identificar as melhores condições para a germinação, sementes de T. caerulescens foram colocadas na presença (15 mmol.m-2.s-1, 8 h luz/16 h escuro ou ausência de luz nas temperaturas de 10, 15, 20 e 25 ºC, em papel germitest previamente umedecido com solução de ácido giberélico (GA3 a 0,05% ou água destilada. Foram avaliados a porcentagem de germinação (%G e o índice de velocidade de germinação (IVG. Maior porcentagem de germinação (66% foi observada nos tratamentos com GA3 e temperaturas de 15 e 20 ºC, na presença de luz. Maiores valores do IVG foram obtidos com a utilização de GA3 nas temperaturas de 15 e 20 ºC, tanto na presença quanto na ausência de luz. Maiores germinação e IVG de T. caerulescens foram observados com uso de GA3 na presença de luz nas temperaturas de 15 e 20 ºC.

  14. Rice-straw mulch reduces the green peach aphid, Myzus persicae (Hemiptera: Aphididae) populations on kale, Brassica oleracea var. acephala (Brassicaceae) plants.

    Science.gov (United States)

    Silva-Filho, Reinildes; Santos, Ricardo Henrique Silva; Tavares, Wagner de Souza; Leite, Germano Leão Demolin; Wilcken, Carlos Frederico; Serrão, José Eduardo; Zanuncio, José Cola

    2014-01-01

    Organic mulches, like peel and rice-straw, besides other materials affect the UV and temperature, which cause a reduction in the aphid arrival. The aim was to evaluate the effect of covering the soil with straw on the populations of the green peach aphid, Myzus persicae on the kale, Brassica oleracea var. acephala plants. The first experiment evaluated the direct effect of the rice-straw mulch and the second its indirect effect on aphid immigration, testing the plant characteristics that could lead to the landing preference of this insect. The third experiment evaluated the direct effect of the mulch on the aphid population. In the second and third experiments, four plants, each in a 14 L polyethylene pot with holes at the bottom, were used in areas with and without soil mulching. These pots were changed between areas, after seven days, to evaluate the effects of this change on the arrival of the winged aphids to the plants. Each plant was covered with anti-aphid gauze and inoculated with one winged M. persicae. Winged and apterous adults of this insect were counted per plant after 15 days. The temperature increased in the mulched plots to a maximum of 21-36°C and to 18-32°C in the plots with or without soil covering, respectively. Plant growth reduced the numbers of the winged aphids landing before and after they were moved to the bare soil plots. The nutrient content was similar in plants in both the mulched and no mulched plots. The population growth of M. persicae was higher in the control than in the mulched plots. This was partially due to temperatures close to 30°C in these plots and changes in the plant physiology. The soil mulching with rice-straw decreased the M. persicae landing, increased the plot temperatures and improved the vegetative growth of the kale plants.

  15. Rice-straw mulch reduces the green peach aphid, Myzus persicae (Hemiptera: Aphididae populations on kale, Brassica oleracea var. acephala (Brassicaceae plants.

    Directory of Open Access Journals (Sweden)

    Reinildes Silva-Filho

    Full Text Available Organic mulches, like peel and rice-straw, besides other materials affect the UV and temperature, which cause a reduction in the aphid arrival. The aim was to evaluate the effect of covering the soil with straw on the populations of the green peach aphid, Myzus persicae on the kale, Brassica oleracea var. acephala plants. The first experiment evaluated the direct effect of the rice-straw mulch and the second its indirect effect on aphid immigration, testing the plant characteristics that could lead to the landing preference of this insect. The third experiment evaluated the direct effect of the mulch on the aphid population. In the second and third experiments, four plants, each in a 14 L polyethylene pot with holes at the bottom, were used in areas with and without soil mulching. These pots were changed between areas, after seven days, to evaluate the effects of this change on the arrival of the winged aphids to the plants. Each plant was covered with anti-aphid gauze and inoculated with one winged M. persicae. Winged and apterous adults of this insect were counted per plant after 15 days. The temperature increased in the mulched plots to a maximum of 21-36°C and to 18-32°C in the plots with or without soil covering, respectively. Plant growth reduced the numbers of the winged aphids landing before and after they were moved to the bare soil plots. The nutrient content was similar in plants in both the mulched and no mulched plots. The population growth of M. persicae was higher in the control than in the mulched plots. This was partially due to temperatures close to 30°C in these plots and changes in the plant physiology. The soil mulching with rice-straw decreased the M. persicae landing, increased the plot temperatures and improved the vegetative growth of the kale plants.

  16. Phylogeography of Arabidopsis halleri (Brassicaceae in mountain regions of Central Europe inferred from cpDNA variation and ecological niche modelling

    Directory of Open Access Journals (Sweden)

    Pawel Wasowicz

    2016-01-01

    Full Text Available The present study aimed to investigate phylogeographical patterns present within A. halleri in Central Europe. 1,281 accessions sampled from 52 populations within the investigated area were used in the study of genetic variation based on chloroplast DNA. Over 500 high-quality species occurrence records were used in ecological niche modelling experiments. We evidenced the presence of a clear phylogeographic structure within A. halleri in Central Europe. Our results showed that two genetically different groups of populations are present in western and eastern part of the Carpathians. The hypothesis of the existence of a glacial refugium in the Western Carpathians adn the Bohemian Forest cannot be rejected from our data. It seems, however, that the evidence collected during the present study is not conclusive. The area of Sudetes was colonised after LGM probably by migrants from the Bohemian Forest.

  17. Phylogeography of Arabidopsis halleri (Brassicaceae) in mountain regions of Central Europe inferred from cpDNA variation and ecological niche modelling.

    Science.gov (United States)

    Wasowicz, Pawel; Pauwels, Maxime; Pasierbinski, Andrzej; Przedpelska-Wasowicz, Ewa M; Babst-Kostecka, Alicja A; Saumitou-Laprade, Pierre; Rostanski, Adam

    2016-01-01

    The present study aimed to investigate phylogeographical patterns present within A. halleri in Central Europe. 1,281 accessions sampled from 52 populations within the investigated area were used in the study of genetic variation based on chloroplast DNA. Over 500 high-quality species occurrence records were used in ecological niche modelling experiments. We evidenced the presence of a clear phylogeographic structure within A. halleri in Central Europe. Our results showed that two genetically different groups of populations are present in western and eastern part of the Carpathians. The hypothesis of the existence of a glacial refugium in the Western Carpathians adn the Bohemian Forest cannot be rejected from our data. It seems, however, that the evidence collected during the present study is not conclusive. The area of Sudetes was colonised after LGM probably by migrants from the Bohemian Forest.

  18. Characterization of the watercress (Nasturtium officinale R. Br.; Brassicaceae) transcriptome using RNASeq and identification of candidate genes for important phytonutrient traits linked to human health.

    Science.gov (United States)

    Voutsina, Nikol; Payne, Adrienne C; Hancock, Robert D; Clarkson, Graham J J; Rothwell, Steve D; Chapman, Mark A; Taylor, Gail

    2016-05-20

    Consuming watercress is thought to provide health benefits as a consequence of its phytonutrient composition. However, for watercress there are currently limited genetic resources underpinning breeding efforts for either yield or phytonutritional traits. In this paper, we use RNASeq data from twelve watercress accessions to characterize the transcriptome, perform candidate gene mining and conduct differential expression analysis for two key phytonutritional traits: antioxidant (AO) capacity and glucosinolate (GLS) content. The watercress transcriptome was assembled to 80,800 transcripts (48,732 unigenes); 71 % of which were annotated based on orthology to Arabidopsis. Differential expression analysis comparing watercress accessions with 'high' and 'low' AO and GLS resulted in 145 and 94 differentially expressed loci for AO capacity and GLS respectively. Differentially expressed loci between high and low AO watercress were significantly enriched for genes involved in plant defence and response to stimuli, in line with the observation that AO are involved in plant stress-response. Differential expression between the high and low GLS watercress identified links to GLS regulation and also novel transcripts warranting further investigation. Additionally, we successfully identified watercress orthologs for Arabidopsis phenylpropanoid, GLS and shikimate biosynthesis pathway genes, and compiled a catalogue of polymorphic markers for future applications. Our work describes the first transcriptome of watercress and establishes the foundation for further molecular study by providing valuable resources, including sequence data, annotated transcripts, candidate genes and markers.

  19. Development of a liquid chromatography-electrospray ionization-tandem mass spectrometry method for the simultaneous analysis of intact glucosinolates and isothiocyanates in Brassicaceae seeds and functional foods.

    Science.gov (United States)

    Franco, P; Spinozzi, S; Pagnotta, E; Lazzeri, L; Ugolini, L; Camborata, C; Roda, A

    2016-01-08

    A new high pressure liquid chromatography-electrospray ionization-tandem mass spectrometry method for the simultaneous determination of glucosinolates, as glucoraphanin and glucoerucin, and the corresponding isothiocyanates, as sulforaphane and erucin, was developed and applied to quantify these compounds in Eruca sativa defatted seed meals and enriched functional foods. The method involved solvent extraction, separation was achieved in gradient mode using water with 0.5% formic acid and acetonitrile with 0.5% formic acid and using a reverse phase C18 column. The electrospray ion source operated in negative and positive mode for the detection of glucosinolates and isothiocyanates, respectively, and the multiple reaction monitoring (MRM) was selected as acquisition mode. The method was validated following the ICH guidelines. Replicate experiments demonstrated a good accuracy (bias%glucosinolates and isothiocyanates determination both in biomasses and in complex matrices such as food products enriched with glucosinolates, or nutraceutical bakery products. In addition, the developed method was applied to the simultaneous determination of glucosinolates and isothiocyanates in bakery product enriched with glucosinolates, to evaluate their thermal stability after different industrial processes from cultivation phases to consumer processing. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Transparent Testa Glabra 1 (TTG1) and TTG1-like genes in Matthiola incana R. Br. and related Brassicaceae and mutation in the WD-40 motif.

    Science.gov (United States)

    Dressel, A; Hemleben, V

    2009-03-01

    TTG1 (Transparent Testa Glabra 1), a WD-40 repeat protein, is involved in regulation of flavonoid/anthocyanin biosynthesis, seed coat (mucilage) development/pigmentation and trichome formation in leaves. Here, we characterized the TTG1 gene of Matthiola incana wild type (e locus), showing 85.3% similarity to TTG1 of A. thaliana on the nucleotide level and 96.2% on the protein level. A white-flowered and glabrous mutant, line 17, of M. incana exhibits one nucleotide change, leading to an amino acid substitution directly in the WD motif (W158R). Correspondingly, the DFR (dihydroflavonol 4-reductase) gene, in which the expression is known to be dependent on TTG1, is not expressed in Matthiola mutant lines 17 (and 19). Comparison of the GC content of the Matthiola TTG1 (54.1%) and Arabidopsis TTG1 (46.1%) genes revealed a strong difference, mostly obtained by neutral substitutions (C to T transitions). To examine whether this is an ecologically influenced trend, a fragment of TTG1 was characterized from another Matthiola species (M. tricuspidata) and from Malcolmia flexuosa subsp. naxensis from the eastern Mediterranean, near a beach with sandy and salty soils. Both Matthiola species have a higher GC content in the TTG1 gene than Arabidopsis and the closer-related Malcolmia, indicating that the GC content is rather an evolutionary than an ecological signal. A similar WD-40 repeat protein gene (containing no intron in the 3' untranslated region) with high similarity to the Arabidopsis TTG1-like (AtAN11) gene was found in Matthiola.

  1. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-A light in turnip (Brassica rapa; Brassicaceae).

    Science.gov (United States)

    Zhou, Bo; Wang, Yu; Zhan, Yaguang; Li, Yuhua; Kawabata, Saneyuki

    2013-12-01

    The epidermis of Brassica rapa (turnip) cv. Tsuda contains light-induced anthocyanins, visible signs of activity of chalcone synthase (CHS), a key anthocyanin biosynthetic enzyme, which is encoded by the CHS gene family. To elucidate the regulation of this light-induced pigmentation, we isolated Brassica rapa CHS1-CHS6 (BrCHS1-CHS6) and characterized their cis-elements and expression patterns. Epidermises of light-exposed swollen hypocotyls (ESHS) were harvested to analyze transcription levels of BrCHS genes by real-time PCR. Different promoters for the genes were inserted into tobacco to examine pCHS-GUS activity by histochemistry. Yeast-one-hybridization was used to detect binding activity of BrCHS motifs to transcription factors. Transcript levels of BrCHS1, -4, and -5 and anthocyanin-biosynthesis-related genes F3H, DFR, and ANS were high, while those of BrCHS2, -3, and -6 were almost undetectable in pigmented ESHS. However, in leaves, CHS5, F3H, and ANS expression was higher than in nonpigmented ESHS, but transcription of DFR was not detected. In the analysis of BrCHS1 and BrCHS3 promoter activity, GUS activity was strong in pigmented flowers of BrPCHS1-GUS-transformed tobacco plants, but nearly absent in BrPCHS3-GUS-transformed plants. Transcript levels of regulators, BrMYB75 and BrTT8, were strongly associated with the anthocyanin content and were light-induced. Coregulated cis-elements were found in promoters of BrCHS1,-4, and -5, and BrMYB75 and BrTT8 had high binding activities to the BrCHS Unit 1 motif. The chalcone synthase gene family encodes a redundant set of light-responsive, tissue-specific genes that are expressed at different levels and are involved in flavonoid biosynthesis in Tsuda turnip.

  2. Glucosinolate diversity within a phylogenetic framework of the tribe Cardamineae (Brassicaceae) unraveled with HPLC-MS/MS and NMR-based analytical distinction of 70 desulfoglucosinolates

    DEFF Research Database (Denmark)

    Olsen, Carl Erik; Huang, Xiao-Chen; Hansen, Cecilie Ida Cetti

    2016-01-01

    As a basis for future investigations of evolutionary trajectories and biosynthetic mechanisms underlying variations in glucosinolate structures, we screened members of the crucifer tribe Cardamineae by HPLC-MS/MS, isolated and identified glucosinolates by NMR, searched the literature for previous...

  3. Producción de IFN−γ en cultivos de linfocitos humanos por efecto de los extractos metanólicos de cuatro ecotipos de Lepidium peruvianum, Chacón (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Libertad Alzamora

    2013-05-01

    Full Text Available Se estudió la actividad inmunoduladora sobre cultivos de linfocitos T humanos de sangre periférica. Se evaluó la producción de IFN−γ inducida por los extractos metanólicos (EM de los ecotipos blanco, negro, rojo y morado de Lepidium peruvianum (conocida también como Lepidium meyenii Walp. maca. Luego de cultivar los linfocitos con los respectivos EM de maca durante 14 horas sólo el EM del ecotipo morado indujo la producción significativa de IFN−γ cuantificada mediante Elispot. El extracto metanólico del ecotipo morado de maca posee propiedades inmunoestimuladoras importantes, desencadenando la activación de linfocitos T humanos.

  4. Research on possibilities of utilization of chosen Brassicaceae plants in protection of cucumber against damping-off caused by Rhizoctonia solani Kühn and Fusarium culmorum (W.G.SmithSacc.

    Directory of Open Access Journals (Sweden)

    Zbigniew J. Burgieł

    2012-12-01

    Full Text Available The aim of the work was to determine the usefulness of dried leaves of savoy cabbage, red cabbage, horse radish and fringed cabbage in protection of cucumber against damping-off caused by fungi Rhizoctonia solani and Fusarium culmorum. In the laboratory experiments, pathogens were grown on PDA containing dried leaves (3g·100 cm-3 and in atmosphere containing volatile substances evolved from plant material. The addition of radish horse leaves into PDA caused total inhibition of R. solani development. Remaining plants were also characterized by high fungistatic activity (% of growth inhibition about 85%. F. culmorum was less sensitive. The horse radish leaves showed the strongest activity (65 %, weakest in combination with fringed cabbage leaves (38,9%. The similar regularity in the case of fumigation activity was observed. The effectiveness of dried leaves in protection of cucumber against damping-off was confirmed in greenhouse experiment. The amendment of soil inoculated with R. solani in dose 2 g per 500 cm3 of soil significantly increased the number of cucumber sprouts compared to the control. In the experiment with F. culmorum only in combination with horse radish and red cabbage leaves significant action was observed.

  5. Utilização de substâncias naturais para o manejo de Lipaphis erysimi (Kaltenbach, 1843) (Hemiptera: Aphididae) em cultivo orgânico de brócolis, Brassica oleracea var. italica (Brassicaceae).

    OpenAIRE

    Broglio,S.M.F.; SANTOS, A. J. N. dos; DIAS, N. da S.; VALENTE, E. C. N.; MICHELETTI, L. B.

    2014-01-01

    Objetivou-se avaliar o efeito de extratos aquosos de folhas de nim, Azadirachta indica, frutos de pimenta-malagueta, Capsicum frutescens, rama e folhas de melão-de-são-caetano, Mormodica charantia, sementes de pimenta-do-reino, Piper nigrum e NeenMax® (óleo de nim 2% i.a) para o manejo do pulgão, Lipaphis erysimi, em cultivo orgânico de Brassica oleracea. Aplicações dos extratos a 10% (v/v) foram realizadas semanalmente, durante cinco semanas. Avaliou-se o número de plantas infestadas, porcen...

  6. Capacidade reprodutiva e preferência da traça-das-crucíferas para diferentes brassicáceas Reproductive capacity and preference of the diamondback moth feeding on different brassicacea

    Directory of Open Access Journals (Sweden)

    Sergio A De Bortoli

    2011-06-01

    Full Text Available O objetivo desta pesquisa foi comparar diferentes cultivares de brassicáceas em relação à capacidade reprodutiva e preferência para alimentação e oviposição da traça-das-crucíferas. Os experimentos foram realizados utilizando-se as cultivares de repolho Midori, Chato-de-Quintal, híbridos da Top Seed® - Agristar (TPC 308, TPC 681 e TPC 668, couve-flor Bola de Neve, couve brócolis Ramoso Piracicaba Precoce e couve Manteiga da Geórgia, sendo esta última utilizada como padrão de suscetibilidade. Por meio dos dados biológicos de P. xylostella foram estimados os parâmetros necessários para a construção de tabela de vida de fertilidade, para comparação das cultivares testadas em relação à capacidade reprodutiva da praga. Em gaiolas de criação da traça-das-crucíferas foram colocados quatro quartos de folha, dois a dois, que justapostos formavam um círculo de 8 cm de diâmetro, confrontando-se os materiais dois a dois. As partes foram dispostas equidistantemente, para realização do teste de dupla chance de escolha (preferência para alimentação e oviposição e de múltipla chance de escolha, confrontando todos os substratos (preferência para alimentação. As cultivares que proporcionaram melhor desenvolvimento e reprodução para a traça-das-crucíferas foram couve Manteiga da Geórgia e couve brócolis. Para preferência alimentar constatou-se alta suscetibilidade em couve Manteiga e TPC 681 e para preferência de oviposição alta preferência para couve-flor Bola de Neve. Com isso, sugere-se a divisão das cultivares estudadas em quatro classes distintas: repolho Midori como moderadamente resistente (MR; couve-flor Bola de Neve e repolho Chato-de-Quintal como suscetíveis (S; couve brócolis, TPC308, TPC681 e TPC668 como moderadamente suscetíveis (MS; e couve Manteiga como altamente suscetível (AS.We compared different cultivars of crucifer in relation to reproductive capacity and preference for feeding and oviposition of the diamondback moth. The experiments were carried out with the following cultivars: Midori and Chato-de-Quintal cabbage, hybrids of cabbage Top Seed® - Agristar (TPC 308, TPC 681 and TPC 668, cauliflower Bola de Neve, broccolis Ramoso Piracicaba Precoce and collard green Manteiga da Geórgia, being this last one used as the susceptible control. Through the biological parameters of P. xylostella we elaborated a fertility life table, Comparing the cultivars in relation to the pest reproductive capacity. Four leaf parts were placed in diamondback moth rearing chambers, being two leaves of the treatment and two of the control which, put together formed a circle with 8 cm in diameter. The parts were disposed in an equidistantly form, to perform the dual-choice test (feeding and oviposition preference and multiple-choice test, confronting all substrates (feeding preference. The cultivars that provided better development and reproduction for the diamondback moth were collard green Manteiga da Georgia and broccolis Ramoso Piracicaba Precoce. For feeding preference high susceptibility was verified in collard green Manteiga da Geórgia and TPC 681 and for oviposition preference high preference was observed for cauliflower Bola de Neve. Four different groups of cultivars could be formed: cabbage Midori as moderately resistant (MR; cauliflower Bola de Neve and cabbage Chato-de-Quintal as susceptible (S; broccolis, TPC 308, TPC 681 and TPC 668 as moderately susceptible (MS; and collard green as highly susceptible (HS.

  7. Feeding preferences of Microtheca punctigera (Achard (Coleoptera: Chrysomelidae for some Brassicaceae plants in multiple-choice assays Preferência alimentar de Microtheca punctigera (Achard (Coleoptera: Chrysomelidae por algumas crucíferas em testes de mútipla escolha

    Directory of Open Access Journals (Sweden)

    Ayres Oliveira Menezes Jr.

    2005-01-01

    Full Text Available Host plant feeding preference is important basic information for the development of insect management strategies. Multiple-choice feeding preference assays were conducted in the laboratory for the chrysomelid beetle, Microtheca punctigera (Achard. Feeding was assessed 72 h after onset of experiments. With one larva per Petri dish, food items comprised watercress, Nasturtium officinale L., arugula, Eruca sativa L., mustard, Brassica juncea Cosson, Chinese cabbage, B. pekinensis (Lour. Rupr. and wild radish (Raphanus raphanistrum L.. Feeding ranking preferences were Chinese cabbage, mustard, wild radish, arugula and watercress (7.97, 1.85, 0.98, 0.36 and 0.11 mm², respectively. Feeding on Chinese cabbage was 4.31 times more intense than on mustard. The same experiment was repeated with one adult per dish. Responses of males and females were quite similar. Feeding was higher on mustard (87.2 and 142.8 for males and females, respectively. Feeding on arugula (51.5 and 132.7 and Chinese cabbage (51.8 and 89.0 were intermediate. Watercress (22.96 and 39.3 and wild radish (12.03 and 28.4 were the least preferred host plants. In a third experiment, ten larvae per dish were used and spinach, Tetragonia expansa Murr., radish, Raphanus sativus L. and collard, B. oleracea var. acephala L., were also included. Daily larval frequencies on each food were also measured. Feeding was similar on Chinese cabbage and mustard (47.89 and 53.78, respectively. Number of insects was greater on mustard, Chinese cabbage and wild radish. Probable explanations for results and proposals for further investigations are discussed.Preferência alimentar é informação básica importante para o desenvolvimento de estratégias de manejo. Experimentos de preferência alimentar com múltipla chance de escolha foram conduzidos em laboratório para o crisomelídeo Microtheca punctigera (Acherd. A alimentação foi avaliada 72h após o início dos experimentos. Com uma larva por placa de Petri, foram utilizadas discos de folhas de almeirão, Nasturtium officinale L., rúcula, Eruca sativa L., mostarda, Brassica juncea Cosson, couve chinesa, B. pekinensis (Lour. Rupr., e nabiça (Raphanus raphanistrum L.. A alimentação em ordem decrescente foi em couve chinesa, mostarda, nabiça, rúcula e almeirão (7,97; 1,85; 0,98; 0,36 e 0,11 mm², respectivamente. A alimentação em couve chinesa foi de 4,31 vezes maior do que em mostarda. O mesmo experimento foi repetido com um adulto por placa. Respostas de machos e fêmeas foram similares. A alimentação foi maior em mostarda (87,2 e 142,8 para machos e fêmeas, respectivamente; em rúcula (51,5 e 132,7 e couve chinesa (51,8 e 89,0 foi intermediária. Agrião (22,96 e 39,3 e nabiça (12,03 e 28,4 foram os menos consumidos. Num terceiro experimento, dez larvas por placa foram usadas, incluindo-se também espinafre, Tetragonia expansa Murr., rabanete, Raphanus sativus L., e couve, B. oleracea var. acephala L. A freqüências diárias de larvas em cada alimento foram também medidas. A alimentação foi similar em couve chinesa e mostarda (47,89 e 53,78, respectivamente. O número de insetos foi maior em mostarda, couve chinesa e nabiça. Prováveis explicações da preferência e proposições de novas pesquisas são discutidos.

  8. Changes in the Relative Abundance and Movement of Insect Pollinators During the Flowering Cycle of Brassica rapa Crops: Implications for Gene Flow

    National Research Council Canada - National Science Library

    Laura A. Mesa; Bradley G. Howlett; Jan E. Grant; Raphael K. Didham

    2013-01-01

    .... This study tested the degree of variation in the diversity and relative abundance of flower-visiting insects entering versus leaving pak choi, Brassica rapa var. chinensis L. (Brassicales: Brassicaceae...

  9. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background: Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  10. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; Van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  11. QTL list: RPF.dry2 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT88762 Brassica napus Brassicaceae RPF.dry2 root pulling force root pulling force... under rainfed treatment (dry) conditions 1 ... Chr02 63.3 7.22 ... 10.1093/jxb/eru423 25371500

  12. QTL list: RPF.dry1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT88760 Brassica napus Brassicaceae RPF.dry1 root pulling force root pulling force... under rainfed treatment (dry) conditions 1 ... ChrA10 76 12.15 ... 10.1093/jxb/eru423 25371500

  13. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available thesis 4 pW125dE LG_03 ... 46 3.3 ... 10.1371/journal.pone.0091428 24614913 ... QT84689 Brassica oleracea Brassicaceae ... Flower buds_Aliphatic glucosinolates (Aliphatic ) Glucosinolate Syn

  14. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT84692 Brassica oleracea Brassicaceae ... Flower buds_Aliphatic glucosinolates (Aliphatic) Glucosinolate Synt...hesis 4 BRMS042, BRMS050 LG_07 ... 43 20.3 ... 10.1371/journal.pone.0091428 24614913

  15. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT84691 Brassica oleracea Brassicaceae ... Flower buds_Aliphatic glucosinolates (Aliphatic) Glucosinolate Synt...hesis 4 ... LG_03 ... 100 5.3 ... 10.1371/journal.pone.0091428 24614913

  16. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT84688 Brassica oleracea Brassicaceae ... Flower buds_Aliphatic glucosinolates (Aliphatic) Glucosinolate Synt...hesis 4 fito375 LG_02 ... 90 7.1 ... 10.1371/journal.pone.0091428 24614913

  17. Drug: D09374 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D09374 Crude, Drug Rapeseed oil, fully hydrogenated superglycerinated (NF) Brassica... napus [TAX:3708], Brassica campestris [TAX:439823] Brassicaceae (mustard family) Brassica napus, Brassica campestris seed oil hydrogenated, superglycerinated PubChem: 96026054 ...

  18. Download this PDF file

    African Journals Online (AJOL)

    2000). This may confirm the fact that phylogenetically, moringaceae were actual relatives of the brassicaceae since stomatal complexes are produced by the direct influence of the genetic information of the parentage lineage. Flint and Moreland ...

  19. Effects of glucosinolates and their hydrolysis products on biochemical and performance parameters in broiler chicken diets

    Science.gov (United States)

    Glucosinolates are important bioactive molecules and widely found in Brassicaceae species (cress, brussels sprouts, mustard, broccoli, kale, etc.). Depending on the amount of these vegetables consumed, both positive and negative metabolic effects from glucosinolate metabolites may occur. The aim of ...

  20. Efficacité d'extraits de feuilles de neem Azadirachta indica ...

    African Journals Online (AJOL)

    Efficacité d'extraits de feuilles de neem Azadirachta indica (Sapindale) sur Plutella xylostella (Lepidoptera : Plutellidae), Hellula undalis (Lepidoptera : Pyralidae) et Lipaphis erysimi (Hemiptera : Aphididae) du chou Brassica oleracea (Brassicaceae) da.

  1. Ecological genomics of Boechera stricta: Identification of a QTL controlling the allocation of methionine- vs branched-chain amino acid-derived glucosinolates and levels of insect herbivory

    NARCIS (Netherlands)

    Schranz, M.E.; Manzaneda, A.J.; Windsor, A.J.; Clauss, M.; Mitchell-Olds, T.

    2009-01-01

    In the Brassicaceae, glucosinolates influence the feeding, reproduction and development of many insect herbivores. Glucosinolate production and effects on herbivore feeding have been extensively studied in the model species, Arabidopsis thaliana and Brassica crops, both of which constitutively

  2. Marker list: QM300242 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM300242 Brassica napus Brassicaceae MR181 SSR AGATTTGCATGTGGTTTGAC ATTGCTTANTGATGTTGGGAA 'Mansholt's Hambu...rger Raps' x 'Samourai' LG_17 ... 10.1046/j.1439-0523.1999.00371.x ...

  3. Pseudomonas moraviensis subsp. stanleyae, a bacterial endophyte of hyperaccumulator Stanleya pinnata, is capable of efficient selenite reduction to elemental selenium under aerobic conditions

    NARCIS (Netherlands)

    Staicu, L. C.; Ackerson, C. J.; Cornelis, P.; Ye, L.; Berendsen, R. L.; Hunter, W. J.; Noblitt, S. D.; Henry, C. S.; Cappa, J. J.; Montenieri, R. L.; Wong, A. O.; Musilova, L.; Sura-de Jong, M.; van Hullebusch, E. D.; Lens, P. N L; Reynolds, R. J B; Pilon-Smits, Elizabeth A H

    2015-01-01

    Aims: To identify bacteria with high selenium tolerance and reduction capacity for bioremediation of wastewater and nanoselenium particle production. Methods and Results: A bacterial endophyte was isolated from the selenium hyperaccumulator Stanleya pinnata (Brassicaceae) growing on seleniferous

  4. Effect of water content and temperature on inactivation kinetics of myrosinase in broccoli (Brassica oleracea var. italica)

    NARCIS (Netherlands)

    Oliviero, T.; Verkerk, R.; Boekel, van M.A.J.S.; Dekker, M.

    2014-01-01

    Broccoli belongs to the Brassicaceae plant family consisting of widely eaten vegetables containing high concentrations of glucosinolates. Enzymatic hydrolysis of glucosinolates by endogenous myrosinase (MYR) can form isothiocyanates with health-promoting activities. The effect of water content (WC)

  5. Environ: E00816 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00816 Maca Medicinal herb Glucosinalbin, Benzyl isothiocyanate [CPD:C03098], Macaridine, Linoleate [CPD:C01595], Phytosterol, L-Arginine [CPD:C00062] [DR:D02982], B vitamins, Ascorbate [CPD:C00072], Iron [CPD:C00023], Calcium [CPD:C00076], Zinc [CPD:C00038] Lepidium meyenii [TAX:153348] Brassicaceae (mustard family) Maca tuber Medicinal herbs [BR:br08322] Dicot plants: rosids Brassicaceae (mustard family) E00816 Maca ...

  6. Evidence for suppression of immunity as a driver for genomic introgressions and host range expansion in races of Albugo candida, a generalist parasite

    DEFF Research Database (Denmark)

    McMullan, Mark; Gardiner, Anastasia; Bailey, Kate

    2015-01-01

    How generalist parasites with wide host ranges can evolve is a central question in parasite evolution. Albugo candida is an obligate biotrophic parasite that consists of many physiological races that each specialize on distinct Brassicaceae host species. By analyzing genome sequence assemblies...

  7. Antibiosis in Ascia monuste orseis Godart (Lepidoptera: Pieridae ...

    African Journals Online (AJOL)

    The genotypes Gigante I-915 and Pires 1 de Campinas have antibiosis resistance. Gigante I-915 caused high larval mortality and Pires 1 de Campinas resulted in low larval and pupal viability of A. monuste orseis. Key words: Brassica oleracea L. var. acephala, Brassicaceae, Great Southern White, host plant resistance, ...

  8. Isolation and identification of 4-a-rhamnosyloxy benzyl glucosinolate in Noccaea caerulescens showing intraspecific variation

    NARCIS (Netherlands)

    Graaf, de R.M.; Krosse, S.; Swolfs, A.E.M.; Brinke, te E.; Prill, N.; Leimu, R.; Galen, van P.M.; Wang, Y.; Aarts, M.G.M.; Dam, van N.M.

    2015-01-01

    Glucosinolates are secondary plant compounds typically found in members of the Brassicaceae and a few other plant families. Usually each plant species contains a specific subset of the ~130 different glucosinolates identified to date. However, intraspecific variation in glucosinolate profiles is

  9. Theodor von Heldreich (1822-1902) and his Turkish collections

    DEFF Research Database (Denmark)

    Baytop, Asuman; Tan, Kit

    2008-01-01

    excluding 2 in the United States. He is commemorated by the genus Heldreichia Boiss. (Brassicaceae), which has 4 species in Turkey. Numerous other taxa bear the epithets heldreichii, heldreichianus, -a or -um. At least 18 such taxa are listed in the Flora of Turkey. Heldreich died in Athens at the age of 80...

  10. Temporal and host-related variation in frequencies of genes that enable Phyllotreta nemorum to utilize a novel host plant, Barbarea vulgaris

    NARCIS (Netherlands)

    Nielsen, J.K.; Jong, de P.W.

    2005-01-01

    The flea beetle, Phyllotreta nemorum L. (Coleoptera: Chrysomelidae), is an intermediate specialist feeding on a small number of plants within the family Brassicaceae. The most commonly used host plant is Sinapis arvensis L., whereas the species is found more rarely on Cardaria draba (L.) Desv.,

  11. Genetic and Biochemical Basis for the Transformation of Energetic Materials (RDX, TNT, DNTs) by Plants

    Science.gov (United States)

    2007-04-01

    Brassicaceae) family, which also includes cabbage and radish . Seedlings of Arabidopsis can be grown under sterile conditions in the lab, starting from seeds... fertility and decreased birth weights were also seen in female rats exposed to an oral dose of RDX (12). RDX was not found to be carcinogenic to

  12. Expression of the Znt1 zinc transporter from the metal hyperaccumulator noccaea caerulescens confers enhanced zinc and cadmium tolerance and accumulation to arabidopsis thaliana

    NARCIS (Netherlands)

    Lin, Ya Fen; Hassan, Zeshan; Talukdar, S.; Schat, Henk; Aarts, Mark G.M.

    2016-01-01

    Prompt regulation of transition metal transporters is crucial for plant zinc homeostasis. NcZNT1 is one of such transporters, found in the metal hyperaccumulator Brassicaceae species Noccaea caerulescens. It is orthologous to AtZIP4 from Arabidopsis thaliana, an important actor in Zn homeostasis.

  13. Report on the new and insufficiently studied taxa in the flora of Serbia

    Directory of Open Access Journals (Sweden)

    Zlatković, B.

    2014-09-01

    Full Text Available Several important floristic records were established during our recent floristic investigations of southeastern Serbia and Province Kosovo-Metohija. Minuartia mediterranea (Caryophyllaceae and Arabis glabra subsp. pseudoturritis (Brassicaceae are reported for the first time from the territory of Serbia, while presence of neglected species Symphytum bulbosum (Boraginaceae and Valerianella microcarpa (Valerianaceae is reevaluated, as they were reported from new localities.

  14. QTL list: QTL1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT58275 Brassica oleracea Brassicaceae QTL1 fusarium resistance fusarium wilt resi...stance trait, Foc-Bo1 (fusarium wilt-resistant) gene (QTL2) 3 ... LG_O04 ... 42.2 2.06 ... 10.1007/s11032-011-9665-8 ...

  15. QTL list: QTL2 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT58276 Brassica oleracea Brassicaceae QTL2 fusarium resistance fusarium wilt resi...stance trait, Foc-Bo1 (fusarium wilt-resistant) gene (QTL2) 3 ... LG_O07 ... 30.1 19.5 ... 10.1007/s11032-011-9665-8 ...

  16. Camelina seed transcriptome: Tool for meal and oil improvement and translational research

    Science.gov (United States)

    Camelina (Camelina sativa), a Brassicaceae oilseed, has received intense interest as a biofuel crop and production platform for industrial oils. Limiting wider production of camelina for these uses is the need to improve seed composition traits such as the quality and content of the protein rich-me...

  17. Integrating winter camelina into maize and soybean cropping systems

    Science.gov (United States)

    Camelina [Camelina sativa (L.) Crantz.] is an industrial oilseed crop in the Brassicaceae family with multiple uses. Currently, camelina is not used as a cover crop, but it has the potential to be used as such in maize (Zea mays L.)-soybean [Glycine max (L.) Merr.] systems. The objectives of this st...

  18. Sowing date and tillage effects on fall-seeded camelina in the northern Corn Belt

    Science.gov (United States)

    Camelina (camelina sativa L.), a member of the Brassicaceae family, can potentially serve as a low-input alternative oil source for advanced biofuels as well as for food and other industrial uses. Winter annual camelina genotypes may be economically and environmentally advantageous for the northern ...

  19. Camelina uses, genetics, genomics, production and management

    Science.gov (United States)

    Camelina [Camelina sativa L. Crantz] is an annual oilseed crop in the Brassicaceae family that has been cultivated since 4000 BC. Recently, interest in its oil and meal and the products developed from it have increased research in this crop. This renewed interest is evidenced by the tremendous incre...

  20. Agronomic performance and seed quality attributes of Camelina (Camelina sativa L. crantz) in multi-environment trials across Europe and Canada

    NARCIS (Netherlands)

    Zanetti, Federica; Eynck, Christina; Christou, Myrsini; Krzyzaniak, Michal; Righini, Daria; Alexopoulou, Efthimia; Stolarski, Mariusz J.; Loo, van Eibertus N.; Puttick, Debbie; Monti, Andrea

    2017-01-01

    Camelina (Camelina sativa L. Crantz) is considered a relatively new oilseed Brassicacea in both Europe and North America, even though its history as a crop dates back to the Bronze Age. Camelina has recently received renewed interest from both the scientific community and bio-based industries

  1. Marker list: QM101556 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CTGCATTTCTGCAAGAC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101556 Brassica oleracea Brassicaceae BoCL3297s SNP ATAGCGAGAGCGCAAGAGAGAT ATCAG

  2. Marker list: QM101626 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ACGCAAAAGTCAATCAC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101626 Brassica oleracea Brassicaceae BoCL6101s SNP CACTTCAAGAATCCAGCCAAGA GAGCA

  3. Marker list: QM101525 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GCCTATATTCGAGGATG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101525 Brassica oleracea Brassicaceae BoCL1816s SNP TGCTCGAGCTGCTACTATTGCT CAAGG

  4. Marker list: QM101635 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TCTCTTCTGTTGCTTC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101635 Brassica oleracea Brassicaceae BoCL6387s SNP TTGATGCGCTTAAAGGTGGTC CCCTGA

  5. Marker list: QM101646 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ACCTGCAGCACAAGACG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101646 Brassica oleracea Brassicaceae BoCL7239s SNP AACATGGGAGCATTCAGCTACA TATAA

  6. Marker list: QM101547 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101547 Brassica oleracea Brassicaceae BoCL3164s SNP AATGAGGCGAAGAGAGCAAGAC TTGCTGTGCACATACACAAACC CY (dev

  7. Marker list: QM101636 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GGCTCTTTCTTCTATCG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC02 ... 10.1007/s10681-012-0847-1 ... ... QM101636 Brassica oleracea Brassicaceae BoCL6590s SNP GTCTTCATTGGAGCCTCTGGAT ACCGA

  8. Marker list: QM101661 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101661 Brassica oleracea Brassicaceae BoCL7702s SNP GGAGCCCAGAAAAACCCTAAAA GCGTGGTACATTTTCCTCAAGA CY (dev

  9. Marker list: QM101662 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101662 Brassica oleracea Brassicaceae BoCL7713s SNP AGGCTTGACGACCCGTCTATAA ACCCGACATTAAAACCAGAACC CY (dev

  10. Marker list: QM101587 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CCGAGATCAGTGAGAAG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC02 ... 10.1007/s10681-012-0847-1 ... ... QM101587 Brassica oleracea Brassicaceae BoCL4055s SNP GATTAACATGGCGGCTTGTCTT CAAAG

  11. Marker list: QM101659 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101659 Brassica oleracea Brassicaceae BoCL7671s SNP CGTTTAAAGCAAGCCACCTCTT CGACTGCCTGAAAATCAATCTG CY (dev

  12. Marker list: QM101663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101663 Brassica oleracea Brassicaceae BoCL7728s SNP CGCGGAGATGAAACCGTTAT CTCTCAGATTTGCGGAAAAAGC CY (devel...oped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ...

  13. Marker list: QM101571 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101571 Brassica oleracea Brassicaceae BoCL3557s SNP GAAGGCGAGAAGGGAAGCTTAT AACCTCCAGGGATGATAGCAAG CY (dev

  14. Marker list: QM101542 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TGCGTTAGGAGAAGAGA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101542 Brassica oleracea Brassicaceae BoCL2981s SNP CCGAAGCTCAAAAAGCTTCATC CGTTG

  15. Marker list: QM101639 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101639 Brassica oleracea Brassicaceae BoCL6696s SNP TTGCGGGTCTTCTTGAAGGTAT CTGTGTTCCTCACTGCACACAA CY (dev

  16. Marker list: QM101501 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AGAAAGCACACTTCTG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101501 Brassica oleracea Brassicaceae BoCL998s SNP TGGCCACAGTGTTGGTTCTATT TACCGG

  17. Marker list: QM101590 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TCTTCCCAGTTTCTTGG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101590 Brassica oleracea Brassicaceae BoCL4155s SNP GCTAAATCGAGCAAAGCTGGTT GCATT

  18. Marker list: QM101668 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AGGATCAGGTCCATTTG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101668 Brassica oleracea Brassicaceae BoCL7942s SNP GTTAGCTTCCCATTTCGCTTTC TGGAT

  19. Marker list: QM101532 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101532 Brassica oleracea Brassicaceae BoCL2360s SNP CATCAGCAGCTTGATTCTCCAG CAATGGAAGTGGAAGGGAGAGT CY (dev

  20. Marker list: QM101497 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101497 Brassica oleracea Brassicaceae BoCL949s SNP GCTCTGTACATGGAGCAACTGA ATGACAATGGCACCAAAGCA CY (develo...ped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ...

  1. Marker list: QM101523 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101523 Brassica oleracea Brassicaceae BoCL1770s SNP GCTTCCTTTCACATGCTCCTCT CCTGGAATCGTGCTTGATGTT CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  2. Marker list: QM101544 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101544 Brassica oleracea Brassicaceae BoCL3027s SNP AGAGGAAGTGGATCCAAACGAG TTTTCCTCAGGCTCATCCTTCT CY (dev

  3. Marker list: QM101505 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101505 Brassica oleracea Brassicaceae BoCL1037s SNP CAGCATGGAAAATATGGGGAAC AAAAGCATCTACTCGGCTCCA CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  4. Marker list: QM101582 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101582 Brassica oleracea Brassicaceae BoCL3876s SNP CGCACAAGGAGGGAGATACTTT CGGCTTTCCAATGTAACCTCTT CY (dev

  5. Marker list: QM101492 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CCTGAGCAAGAAAACA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101492 Brassica oleracea Brassicaceae BoCL756s SNP CAACCAGAAGGATGAAATCACG CAAGAG

  6. Marker list: QM101513 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC01 ... 10.1007/s10681-012-0847-1 ... ... QM101513 Brassica oleracea Brassicaceae BoCL1400s SNP CTAGAACGGCTGGCTGATGATA ACCATGAAAGGGTTCGAGTGTT CY (dev

  7. Marker list: QM101526 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101526 Brassica oleracea Brassicaceae BoCL1824s SNP GGAACTTCCCTCGAGAGTCAAA AAACTTCAGTTCAGGGCATGG CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  8. Marker list: QM101558 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101558 Brassica oleracea Brassicaceae BoCL3335s SNP ACACAGACAAAGCAAAGGCAAG CATTAGAGGCAACGGGAAGAAC CY (dev

  9. Marker list: QM101609 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TCGCATTTACATACACG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101609 Brassica oleracea Brassicaceae BoCL5710s SNP CAAGGCATGTCCGTAACGTAAG GGGTC

  10. Marker list: QM101539 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CTGAAACACGTCGAACT -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101539 Brassica oleracea Brassicaceae BoCL2671s SNP AATGCAAACACTCTGCGTCATC TTGTC

  11. Marker list: QM101550 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CGTCAAGGAAGTTGTGG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101550 Brassica oleracea Brassicaceae BoCL3221s SNP AGATGGCAAGTCTCCTTCCAAA GTGAA

  12. Marker list: QM101573 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101573 Brassica oleracea Brassicaceae BoCL3636s SNP CCATCAGCGAGATAAGCTCCAT TCATCTTCGTTGATGACGGAGT CY (dev

  13. Marker list: QM101596 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TCCACCGTCTACCTTTG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101596 Brassica oleracea Brassicaceae BoCL4550s SNP CACATCCATAGCTCTCGAAGGA TGTTC

  14. Marker list: QM101657 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101657 Brassica oleracea Brassicaceae BoCL7601s SNP ATAGATCATGCCTGTGGAGCAA ACCATAACGATCCCACGAGTCT CY (dev

  15. Marker list: QM101509 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TGTCTTCGCCGATGTTA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101509 Brassica oleracea Brassicaceae BoCL1200s SNP CCCTTCCTCAGAGTTGGTTTTG GATGA

  16. Marker list: QM101586 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AAGTTTCTGGGGAAAAC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101586 Brassica oleracea Brassicaceae BoCL4042s SNP AGGAGGAAGAAGCCAAGACTGA GATGC

  17. Marker list: QM101517 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ATTACAGGCTTCACATC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC08 ... 10.1007/s10681-012-0847-1 ... ... QM101517 Brassica oleracea Brassicaceae BoCL1495s SNP CATGGACGATCCATACTCATCA TTGCC

  18. Marker list: QM101585 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GAACCACCAACAAGGAA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101585 Brassica oleracea Brassicaceae BoCL4014s SNP GCTCGTGAGTTGCTGAAACTTG TGGTA

  19. Marker list: QM101578 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101578 Brassica oleracea Brassicaceae BoCL3732s SNP CAATGGAGCTGTTGCTGATTCT TAGTGACAGCAAGTGCAGCAGA CY (dev

  20. Marker list: QM101633 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101633 Brassica oleracea Brassicaceae BoCL6277s SNP CCGATATGGTGGAGATGGTACT CAACGTCCAAAACACACTATGC CY (dev

  1. Marker list: QM101621 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101621 Brassica oleracea Brassicaceae BoCL5949s SNP TGGAGAAACCGAAGAAGAGGAC AGGTGAAATGCGAAGGTGAATC CY (dev

  2. Marker list: QM101654 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101654 Brassica oleracea Brassicaceae BoCL7417s SNP TATAGTTCCCAGCTGCCACAAA CTCACCGCGAATATGACGATAA CY (dev

  3. Marker list: QM101570 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TGACGTCTCGGTAGCAA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101570 Brassica oleracea Brassicaceae BoCL3550s SNP TCTCATCGCTCCACTCTCTCAT CTTCA

  4. Marker list: QM101651 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101651 Brassica oleracea Brassicaceae BoCL7340s SNP CGAAAAAGTCTGAACGGTGATG GTAAGGGCCGACTTTGTTTGAG CY (dev

  5. Marker list: QM101554 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101554 Brassica oleracea Brassicaceae BoCL3258s SNP CTCTGGTCTCGGATTTGGTTTC TCGAGATGTATTCCGATCGTGT CY (dev

  6. Marker list: QM101555 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GACACTCACTCCAGGTT -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC01 ... 10.1007/s10681-012-0847-1 ... ... QM101555 Brassica oleracea Brassicaceae BoCL3283s SNP TGTATCGGTTGAGTTGGGTAGG TTCTG

  7. Marker list: QM101593 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101593 Brassica oleracea Brassicaceae BoCL4251s SNP TGCGTAAAGCAGGATACAATGG GTTGCGTTTTCAGAGAATGGTG CY (dev

  8. Marker list: QM101535 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101535 Brassica oleracea Brassicaceae BoCL2426s SNP TTGTCCAGAGCATCTTTTGCAG TATCCATTACATTCGCGTGGTC CY (dev

  9. Marker list: QM101648 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101648 Brassica oleracea Brassicaceae BoCL7289s SNP CGTGTATGAGAAGGGGAGGAAT ATCAAGGCCTTCTGCAAAACC CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ...

  10. Marker list: QM101514 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101514 Brassica oleracea Brassicaceae BoCL1453s SNP GAATTGCAGCCGTCAGATAACA GGGACCAATGGCGATAAGTAGT CY (dev

  11. Marker list: QM101569 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GAGTCAACACGCGAGAA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101569 Brassica oleracea Brassicaceae BoCL3500s SNP GCAACATGATTCGTGGTTTAGC GAAGA

  12. Marker list: QM101631 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101631 Brassica oleracea Brassicaceae BoCL6219s SNP GAGAAACAAGGCATGTCACCAG AATGGGCCAGCAACAATAACTC CY (dev

  13. Marker list: QM101598 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC02 ... 10.1007/s10681-012-0847-1 ... ... QM101598 Brassica oleracea Brassicaceae BoCL4802s SNP AAAGAAGGGCTGCAAGAAGATG GCTTGAGCAGCAATCAAATCAG CY (dev

  14. Marker list: QM101521 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AAACTCCGTGGTTCAAG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101521 Brassica oleracea Brassicaceae BoCL1629s SNP CCTGCTTTTTCTCCTCACTGGT CATTC

  15. Marker list: QM101630 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101630 Brassica oleracea Brassicaceae BoCL6174s SNP ACAAGGGCTTTCTAATGGCTGA AGTGCTTCAACTTGCTCAGGTG CY (dev

  16. Marker list: QM101622 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101622 Brassica oleracea Brassicaceae BoCL5961s SNP ACAGCTACGGCTACCATGATGA TGGAAGTGGGTGGTAGCTTTTT CY (dev

  17. Marker list: QM101647 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101647 Brassica oleracea Brassicaceae BoCL7286s SNP ATGGTTTGATCCGCTCAAGG GAAGCTGAAGCTAAAACGCATC -|CY (dev

  18. Marker list: QM101606 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ACGCGTTTACACTCTGC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC02 ... 10.1007/s10681-012-0847-1 ... ... QM101606 Brassica oleracea Brassicaceae BoCL5584s SNP CAAGAGCACAATCTCGGTCCTA ATGAC

  19. Marker list: QM101529 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TCGGATGGTACAAACAA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101529 Brassica oleracea Brassicaceae BoCL1947s SNP GATTGACGAGAACCGTACTGGA CTCGA

  20. Marker list: QM101595 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CCGCTTCTCATCTTTCC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101595 Brassica oleracea Brassicaceae BoCL4441s SNP GGAAAGGACACGACTTTGAGGT AGACT

  1. Marker list: QM101574 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TAACATTCACGTGCTTT -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101574 Brassica oleracea Brassicaceae BoCL3657s SNP TATGGAGTTTCAACGGATGCAC GTGGG

  2. Marker list: QM101655 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101655 Brassica oleracea Brassicaceae BoCL7467s SNP GAGTCCTCTTCACGCTTTTTGG TGTCCGGTCAGCTTTTTAACCT CY (dev

  3. Marker list: QM101553 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ATGATCCCTGGAAAGAC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101553 Brassica oleracea Brassicaceae BoCL3252s SNP ATAAACCCTAAATCCGGGAGGA CTTCC

  4. Marker list: QM101508 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101508 Brassica oleracea Brassicaceae BoCL1135s SNP TACAAGTACCGGCCATAGGTGA GCATGCTGAAAGATTCTCTGTG CY (dev

  5. Marker list: QM101530 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GTGCCTGAACCTGAACC -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC08 ... 10.1007/s10681-012-0847-1 ... ... QM101530 Brassica oleracea Brassicaceae BoCL1982s SNP CTTTTTCCCAGTGAAAGCTTGG AAGTT

  6. Marker list: QM101536 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AACCAGAGAGCGAGAGA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101536 Brassica oleracea Brassicaceae BoCL2526s SNP CGACACCATTTGCAGATAAAGC CAAAC

  7. Marker list: QM101512 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101512 Brassica oleracea Brassicaceae BoCL1384s SNP GAAGAACAAAGTGGCGGCTATT CATGGTTGATGGCTTCATACG CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  8. Marker list: QM101504 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC08 ... 10.1007/s10681-012-0847-1 ... ... QM101504 Brassica oleracea Brassicaceae BoCL1018s SNP CGTCCACTGACTTTGACGATGT ATATAACACGGGCCTCATTGCT CY (dev

  9. Marker list: QM101625 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ATGGCTTCCTCATCTTG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101625 Brassica oleracea Brassicaceae BoCL6009s SNP TGTGAGCAAGGTTACCGTCTTG TTACC

  10. Marker list: QM101600 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC08 ... 10.1007/s10681-012-0847-1 ... ... QM101600 Brassica oleracea Brassicaceae BoCL5083s SNP ACGGAGTTTGAGGAACAGAAGG TCCTTCCGAGAATGCCTAACTC CY (dev

  11. Marker list: QM101629 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CCTTTTACCTCATCAAA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101629 Brassica oleracea Brassicaceae BoCL6133s SNP CGAACTGAATCAGCATCAAAGG GGAGC

  12. Marker list: QM101634 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101634 Brassica oleracea Brassicaceae BoCL6244s SNP CTATGTCGATAATGCCGGTGAA TGTGATCTTAACGGCGATGGT CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ...

  13. Marker list: QM101561 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101561 Brassica oleracea Brassicaceae BoCL3381s SNP ACATATGGCACAGATCGACAGG TTTGCCTTCCACTTATGGGTTC CY (dev

  14. Marker list: QM101643 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101643 Brassica oleracea Brassicaceae BoCL6865s SNP ACTCCATCGTTAAACCCCCAAT CGTTGTCGAATGTGAGCTCTTT CY (dev

  15. Marker list: QM101538 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ... ... QM101538 Brassica oleracea Brassicaceae BoCL2635s SNP AAAGGATGAGGACCATGCAACT CTTTACCCACACGTGCATCATT CY (dev

  16. Marker list: QM101575 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101575 Brassica oleracea Brassicaceae BoCL3682s SNP ATCCCCTTCCTTCATCTGAGTG CACCAGGTACACGTCATCATCA CY (dev

  17. Marker list: QM101541 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GAGAAGACGGTGTCATT -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC01 ... 10.1007/s10681-012-0847-1 ... ... QM101541 Brassica oleracea Brassicaceae BoCL2938s SNP TACGTTCCCATGATGAACCAAC CTGCA

  18. Marker list: QM101599 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC01 ... 10.1007/s10681-012-0847-1 ... ... QM101599 Brassica oleracea Brassicaceae BoCL5007s SNP GTGTGTCGGCTGTGGAAATAAA ATCCTGCAATTAGGTTCGTGGT CY (dev

  19. Marker list: QM101602 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101602 Brassica oleracea Brassicaceae BoCL5305s SNP GAAGAGGATGAGGCTTTTTGGA TCAGGAACCCTTGACAAAAGAC CY (dev

  20. Marker list: QM101610 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101610 Brassica oleracea Brassicaceae BoCL5785s SNP AGATTGTGATGTGGGCTGAGAA TCTCGTTTAGCAACTCCACTGC CY (dev

  1. Marker list: QM101656 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101656 Brassica oleracea Brassicaceae BoCL7572s SNP AATGGAGAACTCGCCCAGATAC AATCGAGGATGCTTGGAGAGAG CY (dev

  2. Marker list: QM101604 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC01 ... 10.1007/s10681-012-0847-1 ... ... QM101604 Brassica oleracea Brassicaceae BoCL5411s SNP GGGCAGAACTGGTGTTCTGTAA CAACAAACACAAGGTTGGAAGC CY (dev

  3. Marker list: QM101510 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101510 Brassica oleracea Brassicaceae BoCL1204s SNP TCCCAAATCTCCTTACGAGTGG GCAAAGCACACAACAGAGGAAC CY (dev

  4. Marker list: QM101524 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available TCAAACATACCCAAGCA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101524 Brassica oleracea Brassicaceae BoCL1788s SNP GCTGCTGATCCAAAGAAAGGTT GGACA

  5. Marker list: QM101607 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101607 Brassica oleracea Brassicaceae BoCL5672s SNP AGATGGATATGGGGATCAATCG CCCCAAACATAATAAGCCAAGC CY (dev

  6. Marker list: QM101667 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CCTTTGCCATTACAGG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC08 ... 10.1007/s10681-012-0847-1 ... ... QM101667 Brassica oleracea Brassicaceae BoCL7922s SNP ACATGGACGATCCATACACACC ACATG

  7. Marker list: QM101584 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC08 ... 10.1007/s10681-012-0847-1 ... ... QM101584 Brassica oleracea Brassicaceae BoCL3972s SNP CGCTATAGCTTGCGGTTACACA TTTACACAACACGGCAAGAAGC CY (dev

  8. Marker list: QM101500 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AGGTCACGTGATGGAG -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC07 ... 10.1007/s10681-012-0847-1 ... ... QM101500 Brassica oleracea Brassicaceae BoCL980s SNP TGGAACTCCACGTACAAGATCA AATTGA

  9. Marker list: QM100634 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CTCTCCCTTTCCCATT -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM100634 Brassica oleracea Brassicaceae BoCL665s SNP TTGAAGAACCAGGAGTTGAAGG GTCTTG

  10. Marker list: QM101660 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC09 ... 10.1007/s10681-012-0847-1 ... ... QM101660 Brassica oleracea Brassicaceae BoCL7690s SNP AATCTCTGCAACAGCACGGTTA CCACTCTCTCTCAACTGCCTTT CY (dev

  11. Marker list: QM101493 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ACGGTCACTGAGAATA -|CY (developed from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC03 ... 10.1007/s10681-012-0847-1 ... ... QM101493 Brassica oleracea Brassicaceae BoCL810s SNP CAAGCACACAAGAACAGACCAA ACGACC

  12. Marker list: QM101562 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC06 ... 10.1007/s10681-012-0847-1 ... ... QM101562 Brassica oleracea Brassicaceae BoCL3387s SNP GGTAAGAAGGCGACAGCTTTTC GCTGGAGTGACAACTGACTGAA CY (dev

  13. Marker list: QM101601 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available eloped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ... ... QM101601 Brassica oleracea Brassicaceae BoCL5208s SNP GACGCAAATGTAAGACGGGTTT TACTGCTATCAAACACCGTTGG CY (dev

  14. Extraction and properties of protein from camelina engineered to produce acetyl-triacylglycerols (camelina acetyl-TAG)

    Science.gov (United States)

    Camelina (Camelina sativa, Brassicaceae) has attracted interest for its seed oil as alternative feedstock for biofuels production. Researchers at Michigan State University successfully engineered camelina to produce seeds with oil containing high levels of acetyl-triacylglerol (acetyl-TAG) by incorp...

  15. AFLP markers for the R-gene in the flea beetle, Phyllotreta nemorum, conferring resistance to defenses in Barbarea vulgaris

    NARCIS (Netherlands)

    Breuker, C.J.; Victoir, K.; Jong, de P.W.; Meijden, van der E.; Brakefield, P.M.; Vrieling, K.

    2005-01-01

    A so-called R-gene renders the yellow-striped flea beetle Phyllotreta nemorum L. (Coleoptera: Chrysomelidae: Alticinae) resistant to the defenses of the yellow rocket Barbarea vulgaris R.Br. (Brassicacea) and enables it to use it as a host plant in Denmark. In this study, genetic markers for an

  16. An atlas of over 90.000 conserved noncoding sequences provides insight into crucifer regulatory regions

    NARCIS (Netherlands)

    Haudry, A.; Platts, A.E.; Vello, E.; Hoen, D.R.; Leclerq, M.; Williamson, R.J.; Forczek, E.; Joly-Lopez, Z.; Steffen, J.G.; Hazzouri, K.M.; Dewar, K.; Stinchcombe, J.R.; Schoen, D.J.; Wang, X.; Schmutz, J.; Town, C.D.; Edger, P.P.; Pires, J.C.; Schumaker, K.S.; Jarvis, D.E.; Mandakova, T.; Lysak, M.; Bergh, van den E.; Schranz, M.E.; Harrison, P.M.

    2013-01-01

    Despite the central importance of noncoding DNA to gene regulation and evolution, understanding of the extent of selection on plant noncoding DNA remains limited compared to that of other organisms. Here we report sequencing of genomes from three Brassicaceae species (Leavenworthia alabamica,

  17. Diverse phytoplasmas associated with diseases in various crops in Russia - pathogens and vectors

    Science.gov (United States)

    Over a long-term survey (2006-2014), we detected that at least 22 species of cultivated crops from 10 families (Amaranthaceae, Apiaceae, Asteraceae, Brassicaceae, Cucurbitaceae, Fabaceae, Vitaceae, Poaceae, Rosaceae, Solanaceae) were infected with phytoplasma. Most of the plant species are herbaceou...

  18. 78 FR 31498 - Endangered and Threatened Wildlife and Plants; Proposed Threatened Status for Leavenworthia...

    Science.gov (United States)

    2013-05-24

    ..., including narrow range, low genetic diversity, and small population size. We will seek peer review. We are... var. laciniata is an annual member of the mustard family (Brassicaceae) known only from two counties... (Rollins 1963, p. 17, Kral 1983, p. 2; Baskin and Baskin 1988, p. 835). Shading from shrubs and trees makes...

  19. Differential Attachment to and Subsequent Contamination of Agricultural Crops by Salmonella enterica▿

    OpenAIRE

    Barak, Jeri D.; Liang, Anita; Narm, Koh-Eun

    2008-01-01

    U.S. salmonellosis outbreaks have occurred following consumption of tomato and cantaloupe but not lettuce. We report differential contamination among agricultural seedlings by Salmonella enterica via soil. Members of the family Brassicaceae had a higher incidence of outbreak than carrot, lettuce, and tomato. Once they were contaminated, phyllosphere populations were similar, except for tomato. Contamination differences exist among tomato cultivars.

  20. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29020 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O2/C8 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... XsORA43-185/178 LG_O02/C8 ... 16 3 ... 10.1007/s00122-003-1570-z 14740090

  1. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29025 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O9/C7 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... LG_O02/C8 ... 11 4.68 ... 10.1007/s00122-003-1570-z 14740090

  2. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29022 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O2/C8 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... XsORA43-185/178 LG_O02/C8 ... 17 4.75 ... 10.1007/s00122-003-1570-z 14740090

  3. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29021 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O2/C8 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... XsORA43-185/178 LG_O02/C8 ... 17 4.64 ... 10.1007/s00122-003-1570-z 14740090

  4. Aggregation and foraging behavior of imported cabbageworm (Lepidoptera: pieridae) adults on blue vervain flowers

    Science.gov (United States)

    The imported cabbageworm [Pieris rapae (L.) (Lepidoptera: Pieridae)], also known as the cabbage white butterfly, is an important specialized pest on cruciferous plants (Brassicales: Brassicaceae) worldwide. an unusual aggregation of the cabbage white butterflies was observed on a patch of flowering...

  5. Scientific Opinion on erucic acid in feed and food

    DEFF Research Database (Denmark)

    Petersen, Annette

    Erucic acid is the trivial name of the fatty acid cis-13-docosenoic acid and occurs at high concentrations mainly in the seeds of species of the Brassicaceae (e.g. rape seed or mustard seed). The European Commission requested EFSA to deliver a scientific opinion on the risks for animal and human...

  6. The Antimicrobial effects of Glucosinolates Hydrolysis compounds on E. Coli O157:H12 into field soil

    Science.gov (United States)

    Introduction: Soil can be a source of pre-harvest contamination of produce by pathogens. Natural antimicrobials such as glucosinolate-hydrolyzed products (GHP) found in Brassicaceae family crops can be used as a green manure to control enteric pathogens in soil. Purpose: The antimicrobial activit...

  7. Contenu pollinique de l'atmosphère de deux régions de Nord -Est ...

    African Journals Online (AJOL)

    The survey of plant table setting revealed us its wealth and its diversity and permitted to count several allergenic families as: Poaceae, Asteraceae, Plantaginaceae, Oleaceae, Polygonaceae, Cupressaceae, Chenopodiaceae and of other families little allergenic as: Myrtaceae, Ericaceae, Brassicaceae, Salicaceae and ...

  8. Meligethes aeneus pollen-feeding suppresses, and oviposition induces, Brassica napus volatiles: beetle attraction/repellence to lilac aldehydes and veratrole

    Science.gov (United States)

    Insect pollination and pollen-feeding can reduce plant volatile emissions and future insect floral attraction, with oviposition having different effects. Meligethes aeneus F. (Coleoptera: Nitidulidae), is a pollen-feeding pest beetle of oilseed rape, Brassica napus L. (Brassicaceae). We measured pla...

  9. Rapid Communication. Tamarixia monesus (Walker (Hym.: Eulophidae parasitoid of Bactericera tremblayi (Wagner, 1961 (Hemiptera: Triozidae in Iran

    Directory of Open Access Journals (Sweden)

    Lotfalizadeh Hossein

    2016-08-01

    Full Text Available Bactericera tremblayi (Wagner, 1961 (Hemiptera: Triozidae is reported on Brassica oleracea var. capitata (Brassicaceae in northwestern Iran. Tamarixia monesus (Walker (Hymenoptera: Chalcidoidea, Eulophidae was reared for the first time on B. tremblayi, and compared with Tamarixia tremblayi, another parasitoid of B. tremblayi. This is a new record of T. monesus from the Middle East.

  10. Biotechnology for improving hydroxy fatty acid production in lesquerella

    Science.gov (United States)

    P Lesquerella [Physaria fendleri (A. Gray)], formerly Lesquerella fendleri, (Brassicaceae), being developed as a new industrial oilseed crop in the southwestern region of the United States, is valued for its unusual hydroxy fatty acid (HFA) in seed. The majority of HFA in lesquerella is lesquerolic...

  11. New floristic records in the Balkans: 8

    DEFF Research Database (Denmark)

    Tan, Kit; Issigoni, Margarita

    2008-01-01

    ew chorological data are presented for 90 species and subspecies from Bulgaria (records no. 49-52), Greece (2-36, 53-90) and Turkey-in-Europe (1, 37-48). The taxa belong to the following families: Apiaceae (21), Araceae (87), Asteraceae (5-9, 22-26, 82), Boraginaceae (53, 83), Brassicaceae (54-56...

  12. Effet de la teneur en protéines alimentaires sur la croissance de l ...

    African Journals Online (AJOL)

    Caricaceae), Brassica oleracea (Brassicaceae), de Cecropia peltata (Moraceae), Laportea aestuans (Urticaceae) et de Phaulopsis falcisepala (Acanthaceae). Le régime R2, en plus des feuilles utilisées pour le régime R1, est additionné de ...

  13. Growth and metal accumulation of an Alyssum murale nickel hyperaccumulator ecotype co-cropped with Alyssum montanum or perennial ryegrass in serpentine soil

    Science.gov (United States)

    More than 400 plant species naturally accumulate high levels of metals such as Cd, Cu, Co, Mn, Ni, and Zn. The genus Alyssum (Brassicaceae) contains the greatest number of reported Ni hyperaccumulators (50), many of which can achieve 3 wt% Ni in dry leaves. Some Alyssum hyperaccumulators are viabl...

  14. The multiple personalities of Streptomyces spp. from the rhizosphere of apple cultivated in brassica seed meal ameded soils

    Science.gov (United States)

    Brassicaceae seed meal soil amendments proved control of Rhizoctonia root rot, in part, through the proliferation of indigenous rhizosphere colonizing Streptomyces spp. Studies were conducted to assess the relative role of antibiosis and nitric oxide (NO) production in the capacity of Streptomyces ...

  15. Flower vs. leaf feeding by Pieris brassicae : Glucosinolate-rich flower tissues are preferred and sustain higher growth rate

    NARCIS (Netherlands)

    Smallegange, R.C.; van Loon, J.J.A.; Blatt, S.E.; Harvey, J.A.; Agerbirk, N.; Dicke, M.

    2007-01-01

    Interactions between butterflies and caterpillars in the genus Pieris and plants in the family Brassicaceae are among the best explored in the field of insect–plant biology. However, we report here for the first time that Pieris brassicae, commonly assumed to be a typical folivore, actually prefers

  16. Flower vs. leaf feeding by Pieris brassicae: Glucosinolate-rich flower tissues are preferred and sustain higher growth rate

    NARCIS (Netherlands)

    Smallegange, R.C.; Loon, van J.J.A.; Blatt, S.E.; Harvey, J.A.; Agerbirk, N.; Dicke, M.

    2007-01-01

    Interactions between butterflies and caterpillars in the genus Pieris and plants in the family Brassicaceae are among the best explored in the field of insect-plant biology. However, we report here for the first time that Pieris brassicae, commonly assumed to be a typical folivore, actually prefers

  17. QTLs controlling antioxidant capacity in leaves and flower buds of Brassica oleracea

    OpenAIRE

    Sotelo Pérez, Tamara; Francisco Candeira, Marta; Cartea González, María Elena; Rodríguez Graña, Víctor Manuel; Soengas Fernández, María del Pilar

    2014-01-01

    Póster presentado en la 19th Crucifer Genetics Workshop “Genetic Improvement of Brassicaceae Crops in the Era of Genomics”, celebrado en Wuhan (China) entre los días 30 de marzo y 2 de abril de 2014.

  18. An efficient and rapid synthesis of 3-hydroxy-3-alkyl-2-oxindoles via ...

    Indian Academy of Sciences (India)

    L Raju Chowhan

    sis, biosynthesis, and biotransformation Phytochemistry. 53 161; (c) Gross D 1993 Phytoalexins of Brassicaceae. J. Plant. Dis. Prot. 100 433. 13. (a) Mehta R G, Liu J, Constantinou A, Hawthorne. M, Pezzuto J M, Moon R C and Moriarty R M 1994. Structure-activity relationships of brassinin in prevent- ing the development of ...

  19. Quality of field pennycress oil obtained by screw pressing and solvent extraction

    Science.gov (United States)

    Field pennycress (Thlasphi arvense L., Brassicaceae) is a winter annual that grows widely in temperate North America. Its seeds contain up to 36% oil (dry basis, db) with the major fatty acid being erucic acid (38 %). With an estimated seed production of 1,700 – 2,200 kg/ha, pennycress can be a majo...

  20. Palyonological studies of the semi-desert plant species from Pakistan

    African Journals Online (AJOL)

    The detailed palynological description of 40 angiospermic plant species, belonging to 22 families and 38 genera were made. Out of the 22 families, 3 families were monocotyledonous and 19 dicotyledonous. The Brassicaceae and Papilionaceae were the largest families regarding number of species having four species ...

  1. homegardens and agrobiodiversity conservation in sabata town

    African Journals Online (AJOL)

    Preferred Customer

    Brassicaceae. L o n g an iaceae. Fabaceae. Myrtaceae. Fabaceae. Ca nna ce a e. Solanaceae. A p ocy n aceae. Rutaceae. Celastraceae. A p ocy n aceae. Rutaceae. Rutaceae. Rutaceae. Rutaceae. Rubiaceae. A raceae. Comm elin aceae. Bora gina cea e. A m aryllidaceae. Eup h orbia cea e. Cuc u rbitaceae. Cupressa.

  2. QTL list: YldSens.2 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT88676 Brassica napus Brassicaceae YldSens.2 Yield sensitivity Yield sensitivity calculated as the differe...nce between the yield of a DH line in the wet environment and its yield in the dry environment 6 ... ChrC02 56 6.36 ... 10.1093/jxb/eru423 25371500

  3. QTL list: YldSens.1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT88675 Brassica napus Brassicaceae YldSens.1 Yield sensitivity Yield sensitivity calculated as the differe...nce between the yield of a DH line in the wet environment and its yield in the dry environment 6 ... ChrA10 73.6 5.19 ... 10.1093/jxb/eru423 25371500

  4. Development of an efficient glucosinolate extraction method

    OpenAIRE

    Doheny-Adams, Timothy; Redeker, Kelly Robert; Kittipol, Varanya; Bancroft, Ian; Hartley, Susan E

    2017-01-01

    Background Glucosinolates, anionic sulfur rich secondary metabolites, have been extensively studied because of their occurrence in the agriculturally important brassicaceae and their impact on human and animal health. There is also increasing interest in the biofumigant properties of toxic glucosinolate hydrolysis products as a method to control agricultural pests. Evaluating biofumigation potential requires rapid and accurate quantification of glucosinolates, but current commonly used method...

  5. New floristic records in the Balkans: 6

    DEFF Research Database (Denmark)

    Tan, Kit; Sfikas, George

    2007-01-01

    ), Anacardiaceae (80), Apiaceae (2, 58), Asteraceae (3, 4, 61, 62, 83, 117, 123-127), Boraginaceae (5, 63, 84-86), Brassicaceae (64), Campanulaceae (45, 46, 118), Caprifoliaceae (6), Caryophyllaceae (51, 59, 87, 119), Chenopodiaceae (7, 8, 136), Cistaceae (88, 89), Convolvulaceae (9, 65), Cupressaceae (116...

  6. New floristic records in the Balkans: 8

    DEFF Research Database (Denmark)

    Biel, Burkhard; Tan, Kit

    2008-01-01

    ew chorological data are presented for 90 species and subspecies from Bulgaria (records no. 49-52), Greece (2-36, 53-90) and Turkey-in-Europe (1, 37-48). The taxa belong to the following families: Apiaceae (21), Araceae (87), Asteraceae (5-9, 22-26, 82), Boraginaceae (53, 83), Brassicaceae (54...

  7. Botanical criteria of Baharkish Rangeland in Quchan, Khorasan ...

    African Journals Online (AJOL)

    The results of the research conducted in the spring of 2014, showed that the total study area includes 77 species from 22 families with Poaceae, Asteraceae, Lamiaceae, Fabaceae, Apiaceae and Brassicaceae being the dominant families with 18%, 13%, 12%, 9%, 8% and 6% respectively. Classification of life form ...

  8. How does traditional home-gardens support ethnomedicinal values ...

    African Journals Online (AJOL)

    Out of 33 families, Cucurbitaceae contributed maximum 06 genera followed by Poaceae, Brassicaceae, Solanaceae and Apiaceae. The documented plants were listed as 32 herbs, 06 shrubs, 15 trees and 07climbers. Different parts of investigated plants such as leaves (34%), fruits (19%), bark (only 2%) etc. were useful to ...

  9. New floristic records in the Balkans: 8

    DEFF Research Database (Denmark)

    Biel, Burkhard; Tan, Kit

    2008-01-01

    New chorological data are presented for 90 species and subspecies from Bulgaria (records no. 49-52), Greece (2-36, 53-90) and Turkey-in-Europe (1, 37-48). The taxa belong to the following families: Apiaceae (21), Araceae (87), Asteraceae (5-9, 22-26, 82), Boraginaceae (53, 83), Brassicaceae (54...

  10. 76 FR 27183 - Endangered and Threatened Wildlife and Plants; Designation of Critical Habitat for Lepidium...

    Science.gov (United States)

    2011-05-10

    ... small, flowering plant in the mustard family (Brassicaceae). The plant grows in unique microsite... characterized by soils with high sodium content and distinct clay layers; they tend to be highly reflective and.... papilliferum, because the species is specifically adapted to occupy these unique microsite habitats that...

  11. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29024 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O9/C7 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... LG_O02/C8 ... 11 4.65 ... 10.1007/s00122-003-1570-z 14740090

  12. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29023 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O9/C7 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... LG_O02/C8 ... 11 2.93 ... 10.1007/s00122-003-1570-z 14740090

  13. First report of albugo lepidi causing white rust on broadleaved pepperweed (lepidium latifolium) in Nevada and California

    Science.gov (United States)

    The biology and taxonomy of a white rust that is commonly found on the exotic invasive weed Lepidium latifolium were studied in order to assess its potential as a bioherbicide. Previously assumed to be Albugo candida, a common disease of Brassicaceae crops, comparisons of spore morphology and DNA s...

  14. Natural enemies of perennial pepperweed, lepidium latifolium L., in its introduced range

    Science.gov (United States)

    Perennial pepperweed, Lepidium latifolium L., is a member of the Brassicaceae native to Eurasia. It was unintentionally introduced to North America in the early 1900s, where it has since spread over millions of acres. This weed is an aggressive invader of wetlands, meadows, roadsides, and agricult...

  15. Field observations in central Turkey on Lasiosina deviata Nartshuk, a chloropid stem boring fly and potential biological control agent of Lepidium latifolium

    Science.gov (United States)

    Perennial pepperweed (PPW), Lepidium latifolium L. (syn.: Cardaria latifolium), (Brassicaceae) is a herbaceous, semi-woody perennial weed, native of Central Asia, that typically reaches 0.5–1.5 m in height and reproduces vegetatively and by seed. The weed is often associated with mesic habitats, suc...

  16. Natural enemies associated with the invasive weed, Lepidium latifolium L., in its introduced range

    Science.gov (United States)

    Perennial pepperweed, Lepidium latifolium L., is a perennial mustard (Brassicaceae) native to Eurasia. It was unintentionally introduced to North America in the early 1900s, and has since spread over millions of acres. This weed is an aggressive invader of wetlands, meadows, roadsides, and agricul...

  17. Can we “cultivate” erucic acid in southern Europe?

    Directory of Open Access Journals (Sweden)

    Federica Zanetti

    Full Text Available Over the last fifteen years, considerable progress has been made in the field of “green chemistry”, as regards both research aspects and market development. In particular, extraction of erucic acid (C22:1 from plants and its industrial applications have received increasing attention. At present, known species producing oils yielding large quantities of erucic acid belong, with few exceptions, to the Brassicaceae family. Among these, the two major sources of erucic acid in the world are HEAR (High Erucic Acid Rapeseed, Brassica napus var. oleifera and crambe (Crambe abyssinica, both mainly cultivated in the USA. Their cultivation has also recently been considered and extended to southern Europe, supported by specific research projects. The quantity of erucic acid in Brassicaceae oils ranges greatly, from 55% in Crambe abyssinica to nearly zero in some varieties of Brassica napus var. oleifera. Even more differentiated and peculiar to each species and variety is adaptability to specific climatic and soil conditions. In this regard, the major limitation to the cultivation of some interesting Brassicaceae species, crambe in particular, is their poor tolerance to cold. Among Brassicaceae producing erucic acid, the less frequently cultivated species, such as Brassica juncea and B. carinata, if grown in areas with relatively mild winters, may give yields of seed and oil similar to those of the most productive rapeseed genotypes. Within this framework, in order to achieve high production of erucic acid, it is essential to identify the most productive genotypes, among available species, for each environment. In this report, seed and oil productions of some important Brassicaceae species for extraction of erucic acid, derived from 15 years of field trials in northern Italy, are discussed in relation to the possibility of autumn or spring sowing.

  18. Genome-Wide Survey of Flavonoid Biosynthesis Genes and Gene Expression Analysis between Black- and Yellow-Seeded Brassica napus

    Science.gov (United States)

    Qu, Cunmin; Zhao, Huiyan; Fu, Fuyou; Wang, Zhen; Zhang, Kai; Zhou, Yan; Wang, Xin; Wang, Rui; Xu, Xinfu; Tang, Zhanglin; Lu, Kun; Li, Jia-Na

    2016-01-01

    Flavonoids, the compounds that impart color to fruits, flowers, and seeds, are the most widespread secondary metabolites in plants. However, a systematic analysis of these loci has not been performed in Brassicaceae. In this study, we isolated 649 nucleotide sequences related to flavonoid biosynthesis, i.e., the Transparent Testa (TT) genes, and their associated amino acid sequences in 17 Brassicaceae species, grouped into Arabidopsis or Brassicaceae subgroups. Moreover, 36 copies of 21 genes of the flavonoid biosynthesis pathway were identified in Arabidopsis thaliana, 53 were identified in Brassica rapa, 50 in Brassica oleracea, and 95 in B. napus, followed the genomic distribution, collinearity analysis and genes triplication of them among Brassicaceae species. The results showed that the extensive gene loss, whole genome triplication, and diploidization that occurred after divergence from the common ancestor. Using qRT-PCR methods, we analyzed the expression of 18 flavonoid biosynthesis genes in 6 yellow- and black-seeded B. napus inbred lines with different genetic background, found that 12 of which were preferentially expressed during seed development, whereas the remaining genes were expressed in all B. napus tissues examined. Moreover, 14 of these genes showed significant differences in expression level during seed development, and all but four of these (i.e., BnTT5, BnTT7, BnTT10, and BnTTG1) had similar expression patterns among the yellow- and black-seeded B. napus. Results showed that the structural genes (BnTT3, BnTT18, and BnBAN), regulatory genes (BnTTG2 and BnTT16) and three encoding transfer proteins (BnTT12, BnTT19, and BnAHA10) might play an crucial roles in the formation of different seed coat colors in B. napus. These data will be helpful for illustrating the molecular mechanisms of flavonoid biosynthesis in Brassicaceae species. PMID:27999578

  19. Genome-wide survey of flavonoid biosynthesis genes and gene expression analysis between black- and yellow-seeded Brassica napus

    Directory of Open Access Journals (Sweden)

    Cunmin Qu

    2016-12-01

    Full Text Available Flavonoids, the compounds that impart color to fruits, flowers, and seeds, are the most widespread secondary metabolites in plants. However, a systematic analysis of these loci has not been performed in Brassicaceae. In this study, we isolated 649 nucleotide sequences related to flavonoid biosynthesis, i.e., the Transparent Testa (TT genes, and their associated amino acid sequences in 17 Brassicaceae species, grouped into Arabidopsis or Brassicaceae subgroups. Moreover, 36 copies of 21 genes of the flavonoid biosynthesis pathway were identified in A. thaliana, 53 were identified in B. rapa, 50 in B. oleracea, and 95 in B. napus, followed the genomic distribution, collinearity analysis and genes triplication of them among Brassicaceae species. The results showed that the extensive gene loss, whole genome triplication, and diploidization that occurred after divergence from the common ancestor. Using qRT-PCR methods, we analyzed the expression of eighteen flavonoid biosynthesis genes in 6 yellow- and black-seeded B. napus inbred lines with different genetic background, found that 12 of which were preferentially expressed during seed development, whereas the remaining genes were expressed in all B. napus tissues examined. Moreover, fourteen of these genes showed significant differences in expression level during seed development, and all but four of these (i.e., BnTT5, BnTT7, BnTT10, and BnTTG1 had similar expression patterns among the yellow- and black-seeded B. napus. Results showed that the structural genes (BnTT3, BnTT18 and BnBAN, regulatory genes (BnTTG2 and BnTT16 and three encoding transfer proteins (BnTT12, BnTT19, and BnAHA10 might play an crucial roles in the formation of different seed coat colors in B. napus. These data will be helpful for illustrating the molecular mechanisms of flavonoid biosynthesis in Brassicaceae species.

  20. New records in vascular plants alien to Kyrgyzstan

    Science.gov (United States)

    2014-01-01

    Abstract A series of brief notes on distribution of vascular plants alien to Kyrgyzstan is presented. A further expansion of Anthemis ruthenica (Asteraceae), Crambe orientalis (Brassicaceae) and Salvia aethiopis (Lamiaceae) in northern and northwestern Kyrgyzstan is recorded. The first record of Chenopodium vulvaria (Amaranthaceae) from the northern side of Kyrgyz Range is confirmed, and the species was found for the second time in Alay Range. The ephemerous occurrence of Hirschfeldia incana (Brassicaceae) in Central Asia is recorded for the first time from Fergana Range. Tragus racemosus (Poaceae) is first recorded from the Chüy Depression as an ephemerous alien. Arrhenatherum elatius, escaped from cultivation and locally established, is new to the country. The second record of established occurrence of Centaurea solstitialis (Asteraceae) and an ephemerous occurrence of Glaucium corniculatum (Papaveraceae) are presented. Complete information is collected about the occurrence of every mentioned species in Kyrgyzstan. PMID:24855435

  1. New records in vascular plants alien to Kyrgyzstan

    Directory of Open Access Journals (Sweden)

    Georgy Lazkov

    2014-01-01

    Full Text Available A series of brief notes on distribution of vascular plants alien to Kyrgyzstan is presented. A further expansion of Anthemis ruthenica (Asteraceae, Crambe orientalis (Brassicaceae and Salvia aethiopis (Lamiaceae in northern and northwestern Kyrgyzstan is recorded. The first record of Chenopodium vulvaria (Amaranthaceae from the northern side of Kyrgyz Range is confirmed, and the species was found for the second time in Alay Range. The ephemerous occurrence of Hirschfeldia incana (Brassicaceae in Central Asia is recorded for the first time from Fergana Range. Tragus racemosus (Poaceae is first recorded from the Chüy Depression as an ephemerous alien. Arrhenatherum elatius, escaped from cultivation and locally established, is new to the country. The second record of established occurrence of Centaurea solstitialis (Asteraceae and an ephemerous occurrence of Glaucium corniculatum (Papaveraceae are presented. Complete information is collected about the occurrence of every mentioned species in Kyrgyzstan.

  2. QTL list: qEA.A8.2 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT91796 Brassica napus Brassicaceae qEA.A8.2 erucic acid content BnA8.FAE1 loci (c...ontrolling the synthesis of erucic acid in seeds, paralogue of FAE1 (Fatty acid elongase1) in A. thaliana) 4 ... ChrA08 15.9 34.16-39.43 ... 10.1016/S1673-8527(09)60041-2 20439099

  3. QTL list: qEA.A8.1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT91795 Brassica napus Brassicaceae qEA.A8.1 erucic acid content BnA8.FAE1 loci (c...ontrolling the synthesis of erucic acid in seeds, paralogue of FAE1 (Fatty acid elongase1) in A. thaliana) 4 ... ChrA08 22.8 47.99-65.66 ... 10.1016/S1673-8527(09)60041-2 20439099

  4. Producción de frutos y semillas en Diplotaxis erucoides (L.) DC. sometida a diferentes tratamientos de polinización

    OpenAIRE

    Sans, F.; Bonet, A.

    1993-01-01

    The breeding system of Diplotaxis erucoides (L.) DC. Brassicaceae), a widespread Mediterranean weed found on arable fields and roadsides, is studied in this paper. The effects of different hand-pollination treatments on fruit and seed production are analyzed. Results demonstrate that individuals of Diplotaxis erucoides are able to self-pollinate. There are significant differences in fertility, number of seeds produced per fruit and frui...

  5. High Added-Value Products from Industrial Crop Biomass: Uses in the Agro-Food Sector

    OpenAIRE

    Ugolini, Luisa

    2017-01-01

    The aim of this work was the study of the valorization of industrial crop biomasses into high-value products with different applications in the agro-food sector, in a full biorefinery approach. Defatted seed meals (DSMs), co-products of the oil extraction procedure, from industrial crops of high economic importance such as Brassicaceae (Rapeseed, Carinata et al.) and of Asteraceae (Sunflower et al.), were used, such as or after processing. Their biological active compound and protein content ...

  6. Development of genomic and EST-SSR markers in radish (Raphanus sativus L.)

    OpenAIRE

    Nakatsuji, Ryoichi; Hashida, Tomoko; Matsumoto, Naoko; Tsuro, Masato; Kubo, Nakao; Hirai, Masashi

    2011-01-01

    Radish (Raphanus sativus L.) belongs to Brassicaceae family and is a close relative of Brassica. This species shows a wide morphological diversity, and is an important vegetable especially in Asia. However, molecular research of radish is behind compared to that of Brassica. For example, reports on SSR (simple sequence repeat) markers are limited. Here, we designed 417 radish SSR markers from SSR-enriched genomic libraries and the cDNA data. Of the 256 SSR markers succeeded in PCR, 130 showed...

  7. Evolution of genes associated with gynoecium patterning and fruit development in Solanaceae.

    Science.gov (United States)

    Ortiz-Ramírez, Clara Inés; Plata-Arboleda, Sayonara; Pabón-Mora, Natalia

    2018-02-17

    The genetic basis of fruit development has been extensively studied in Arabidopsis, where major transcription factors controlling valve identity (i.e. FRUITFULL), replum development (i.e. REPLUMLESS) and the differentiation of the dehiscence zones (i.e. SHATTERPROOF, INDEHISCENT and ALCATRAZ) have been identified. This gene regulatory network in other flowering plants is influenced by duplication events during angiosperm diversification. Here we aim to characterize candidate fruit development genes in the Solanaceae and compare them with those of Brassicaceae. ALC/SPT, HEC/IND, RPL and AG/SHP homologues were isolated from publicly available databases and from our own transcriptomes of Brunfelsia australis and Streptosolen jamesonii. Maximum likelihood phylogenetic analyses were performed for each of the gene lineages. Shifts in protein motifs, as well as expression patterns of all identified homologues, are shown in dissected floral organs and fruits in different developmental stages of four Solanaceae species exhibiting different fruit types. Each gene lineage has undergone different duplication time-points, resulting in very different genetic complements in the Solanaceae when compared with the Brassicaceae. In general, Solanaceae species have more copies of HEC1/2 and RPL than Brassicaceae, have fewer copies of SHP and the same number of copies of AG, ALC and SPT. Solanaceae lack IND orthologues, but have pre-duplication HEC3 homologues. The expression analyses showed opposite expression of SPT and ALC orthologues between dry- and fleshy-fruited species during fruit maturation. Fleshy-fruited species turn off RPL and SPT orthologues during maturation. The gynoecium patterning and fruit developmental genetic network in the Brassicaceae cannot be directly extrapolated to the Solanaceae. In Solanaceae ALC, SPT and RPL contribute differently to maturation of dry dehiscent and fleshy fruits, whereas HEC genes are not generally expressed in the gynoecium. RPL genes

  8. Histopathological and morphological alterations caused by plasmodiophora brassicae in brassica oleracea l.

    OpenAIRE

    Riascos, Donald; Ortiz, Emiro; Quintero, Daimy; Montoya, Lina; Hoyos Carvajal, Lilliana

    2012-01-01

    Plasmodiophora brassicae is a plant pathogen of the Brassicaceae family, which presents a remarkable ability to survive in soil and high capacity of infection, significantly reducing crop yields. The present histopathologycal study conducted with the aim of contributing to knowledge of the infection cycle of the pathogen, showed the presence of multinucleated plasmodia at cortex and periderm cells level in infected cabbage roots, as well as thickening and disruption of cell wall. As a result ...

  9. Evaluation of antiulcerogenic activity of aqueous extract of Brassica oleracea var. capitata (cabbage) on Wistar rat gastric ulceration

    OpenAIRE

    Carvalho, Camilo Amaro de; Fernandes,Kenner Moraes; Matta, Sérgio Luiz Pinto; Silva, Marcelo Barreto da; De Oliveira, Leandro Licursi; Fonseca, Cláudio César

    2011-01-01

    CONTEXT: The cabbage (Brassica oleraceae var. capitata) is an herbaceous and leafy plant which belongs to the Brassicaceae family, native to coastal southern and Western Europe. Used in cooking for its nutritional value also has known anti-inflammatory activity. OBJECTIVE We studied the antiulcerogenic activity of aqueous extract of Brassica oleracea var. capitata (AEB) in order to validate ethnobotanical claims regarding the plant use in the gastric disorders. METHOD: Acute gastric ulcers we...

  10. Strong selection genome-wide enhances fitness tradeoffs across environments and episodes of selection

    OpenAIRE

    Anderson, Jill T.; Lee, Cheng-Ruei; Mitchell-Olds, Thomas

    2013-01-01

    Fitness tradeoffs across episodes of selection and environments influence life history evolution and adaptive population divergence. Documenting these tradeoffs remains challenging as selection can vary in magnitude and direction through time and space. Here, we evaluate fitness tradeoffs at the levels of the whole organism and the quantitative trait locus (QTL) in a multiyear field study of Boechera stricta (Brassicaceae), a genetically tractable mustard native to the Rocky Mountains. Recipr...

  11. Mechanisms of Selenium Enrichment and Measurement in Brassicaceous Vegetables, and Their Application to Human Health

    Directory of Open Access Journals (Sweden)

    Melanie Wiesner-Reinhold

    2017-08-01

    Full Text Available Selenium (Se is an essential micronutrient for human health. Se deficiency affects hundreds of millions of people worldwide, particularly in developing countries, and there is increasing awareness that suboptimal supply of Se can also negatively affect human health. Selenium enters the diet primarily through the ingestion of plant and animal products. Although, plants are not dependent on Se they take it up from the soil through the sulphur (S uptake and assimilation pathways. Therefore, geographic differences in the availability of soil Se and agricultural practices have a profound influence on the Se content of many foods, and there are increasing efforts to biofortify crop plants with Se. Plants from the Brassicales are of particular interest as they accumulate and synthesize Se into forms with additional health benefits, such as methylselenocysteine (MeSeCys. The Brassicaceae are also well-known to produce the glucosinolates; S-containing compounds with demonstrated human health value. Furthermore, the recent discovery of the selenoglucosinolates in the Brassicaceae raises questions regarding their potential bioefficacy. In this review we focus on Se uptake and metabolism in the Brassicaceae in the context of human health, particularly cancer prevention and immunity. We investigate the close relationship between Se and S metabolism in this plant family, with particular emphasis on the selenoglucosinolates, and consider the methodologies available for identifying and quantifying further novel Se-containing compounds in plants. Finally, we summarize the research of multiple groups investigating biofortification of the Brassicaceae and discuss which approaches might be most successful for supplying Se deficient populations in the future.

  12. Metabolic Activity of Radish Sprouts Derived Isothiocyanates in Drosophila melanogaster

    OpenAIRE

    Baenas, Nieves; Piegholdt, Stefanie; Schloesser, Anke; Moreno, Diego A.; García-Viguera, Cristina; Rimbach, Gerald; Wagner, Anika E.

    2016-01-01

    We used Drosophila melanogaster as a model system to study the absorption, metabolism and potential health benefits of plant bioactives derived from radish sprouts (Raphanus sativus cv. Rambo), a Brassicaceae species rich in glucosinolates and other phytochemicals. Flies were subjected to a diet supplemented with lyophilized radish sprouts (10.6 g/L) for 10 days, containing high amounts of glucoraphenin and glucoraphasatin, which can be hydrolyzed by myrosinase to the isothiocyanates sulforap...

  13. A multiplex PCR for rapid identification of Brassica species in the triangle of U

    OpenAIRE

    Koh, Joshua C. O.; Denise M Barbulescu; Norton, Sally; Redden, Bob; Salisbury, Phil A.; Kaur, Sukhjiwan; Cogan, Noel; Slater, Anthony T.

    2017-01-01

    Background Within the Brassicaceae, six species from the genus Brassica are widely cultivated throughout the world as oilseed, condiment, fodder or vegetable crops. The genetic relationships among the six Brassica species are described by U?s triangle model. Extensive shared traits and diverse morphotypes among Brassica species make identification and classification based on phenotypic data alone challenging and unreliable, especially when dealing with large germplasm collections. Consequentl...

  14. The genome sequence of Barbarea vulgaris facilitates the study of ecological biochemistry

    DEFF Research Database (Denmark)

    Byrne, Stephen L.; Erthmann, Pernille Østerbye; Agerbirk, Niels

    2017-01-01

    The genus Barbarea has emerged as a model for evolution and ecology of plant defense compounds, due to its unusual glucosinolate profile and production of saponins, unique to the Brassicaceae. One species, B. vulgaris, includes two ‘types’, G-type and P-type that differ in trichome density, and t...... deter larvae to the extent that they die. The B. vulgaris genome will promote the study of mechanisms in ecological biochemistry to benefit crop resistance breeding....

  15. Does gamma-irradiation affect the quality of fresh-cut watercress?

    OpenAIRE

    Pinela, José; Barreira, João C.M.; Antonio, Amilcar L.; Barros, Lillian; Cabo Verde, Sandra; Carvalho, Ana Maria; Oliveira, M.B.P.P.; Ferreira, Isabel C.F.R.

    2015-01-01

    Watercress (Nasturtium officinale R. Br.) is a nutrient rich perennial plant of the Brassicaceae family highly appreciated in the Mediterranean cuisine. It is eaten raw in salads, soups and other recipes and used in folk medicine due to its medicinal and therapeutic properties [1,2]. However, it has a reduced shelf-life of approximately 7 days [3]. Since most conventional preservation treatments can't extend the shelf-life without compromising the quality and consumers are more aware about th...

  16. Karakterisasi Simplisia dan Skrining Fitokimia serta Uji Aktivitas Antioksidan Ekstrak n-Heksan Etilasetat dan Metanol Selada Air (Nasturtium officinale W.T.Aiton)

    OpenAIRE

    Novia, Jessica

    2014-01-01

    Watercress (Nasturtium officinale W.T.Aiton) is a annual plant from Brassicaceae family. It is easily grown and often grows wildly at small river, pond, swamp and swallow lake. It is not only consumed as vegetable but also used as anticancer, antidiabetes, antiallergy, and tuberculosis drug. The objective of this research are to determine characteristic of simplex, phythochemical content in simplex, n-hexane, ethylacetate and methanol extract of watercress and also to test the antioxidant a...

  17. Pollen load composition and size in the leafcutting bee Megachile rotundata (Hymenoptera: Megachilidae)

    OpenAIRE

    O'Neill, Ruth; O'Neill, Kevin

    2011-01-01

    International audience; We examined how the species composition and volumes of pollen loads of Megachile rotundata varied seasonally and among females of different body sizes. Alfalfa and mustards (Brassicaceae) made up, on average, 88-95% of the pollen load volumes in each of three seasonal samples; in total, the 300 females sampled carried ten different pollen types. Because of variation in pollen grain size among plant species, estimates of the contribution of different species to pollen l...

  18. Differential transcriptome analysis reveals insight into monosymmetric corolla development of the crucifer Iberis amara

    OpenAIRE

    Busch, Andrea; Horn, Stefanie; Zachgo, Sabine

    2014-01-01

    Background In the co-evolution between insects and plants, the establishment of floral monosymmetry was an important step in angiosperm development as it facilitated the interaction with insect pollinators and, by that, likely enhanced angiosperm diversification. In Antirrhinum majus, the TCP transcription factor CYCLOIDEA is the molecular key regulator driving the formation of floral monosymmetry. Although most Brassicaceae form a polysymmetric corolla, six genera develop monosymmetric flowe...

  19. Development of an efficient glucosinolate extraction method.

    Science.gov (United States)

    Doheny-Adams, T; Redeker, K; Kittipol, V; Bancroft, I; Hartley, S E

    2017-01-01

    Glucosinolates, anionic sulfur rich secondary metabolites, have been extensively studied because of their occurrence in the agriculturally important brassicaceae and their impact on human and animal health. There is also increasing interest in the biofumigant properties of toxic glucosinolate hydrolysis products as a method to control agricultural pests. Evaluating biofumigation potential requires rapid and accurate quantification of glucosinolates, but current commonly used methods of extraction prior to analysis involve a number of time consuming and hazardous steps; this study aimed to develop an improved method for glucosinolate extraction. Three methods previously used to extract glucosinolates from brassicaceae tissues, namely extraction in cold methanol, extraction in boiling methanol, and extraction in boiling water were compared across tissue type (root, stem leaf) and four brassicaceae species (B. juncea, S. alba, R. sativus, and E. sativa). Cold methanol extraction was shown to perform as well or better than all other tested methods for extraction of glucosinolates with the exception of glucoraphasatin in R. sativus shoots. It was also demonstrated that lyophilisation methods, routinely used during extraction to allow tissue disruption, can reduce final glucosinolate concentrations and that extracting from frozen wet tissue samples in cold 80% methanol is more effective. We present a simplified method for extracting glucosinolates from plant tissues which does not require the use of a freeze drier or boiling methanol, and is therefore less hazardous, and more time and cost effective. The presented method has been shown to have comparable or improved glucosinolate extraction efficiency relative to the commonly used ISO method for major glucosinolates in the Brassicaceae species studied: sinigrin and gluconasturtiin in B. juncea; sinalbin, glucotropaeolin, and gluconasturtiin in S. alba; glucoraphenin and glucoraphasatin in R. sativus; and glucosatavin

  20. Impact of elicitors on glucosinolate production in plants and exudates of turnip (Brassica rapa)

    OpenAIRE

    Smetanska, Iryna

    2006-01-01

    Glucosinolate sind charakteristische sekundäre Pflanzenstoffe der Brassicaceae. Ausgewählte Glucosinolate besitzen nachweislich antikanzerogene, antioxidative sowie antimikrobielle Eigenschaften. Die Extraktion von Glucosinolaten erfolgte bisher aus pflanzlichen Rest- bzw. Abfallmaterial (z.B. Brokkoli-Stiele), in denen oft nur sehr niedrige Konzentrationen an gewünschten, gesundheitsfördernden Gesamtglucosinolaten vorhanden sind. Zudem variiert der Gehalt an Gesamt- und Einzelglucosinolaten ...

  1. A comprehensive metabolite profiling of "Isatis tinctoria" leaf extracts

    OpenAIRE

    Mohn, Tobias

    2009-01-01

    Woad (Isatis tinctoria L., Brassicaceae) is an ancient indigo dye and anti-inflammatory medicinal plant, which has been used and cultivated in Europe since antiquity. The antiinflammatory potential of lipophilic leaf extracts was recently confirmed in a broad-based pharmacological profiling, in various animal models and in a clinical pilot study. Tryptanthrin, an indolin-2-one derivative, and γ-linoleic acid were identified as pharmacologically active compounds inhibiting cyclooxygenase-2 (CO...

  2. A Cytogenetical Study on Some Plants Taxa in Nizip Region (Aksaray, Turkey)

    OpenAIRE

    ÖZTÜRK, Meryem; MARTİN, Esra; DİNÇ, Muhittin; DURAN, Ahmet

    2009-01-01

    This cytological study was performed in 19 taxa grown naturally in Nizip region (Aksaray). These taxa are Conringia perfoliata (C.A.Mey.) Busch, Alyssum strigosum Banks & Sol. subsp. strigosum, Alyssum murale Waldst. & Kit. subsp. murale var. murale, Matthiola longipetala (Vent.) DC. subsp. bicornis (Sibth. & Sm.) P.W.Ball., Erysimum thyrsoideum Boiss. subsp. thyrsoideum (Brassicaceae), Silene alba (Mill.) E.H.L. Krause subsp. divaricata (Reichb.) Walters, Silene conoidea L., Sile...

  3. A Cytogenetical Study on Some Plants Taxa in Nizip Region (Aksaray, Turkey)

    OpenAIRE

    ÖZTÜRK, Meryem; MARTİN, Esra; DİNÇ, Muhittin; DURAN, Ahmet; ÖZDEMİR, Ayşe; ÇETİN, Özlem

    2014-01-01

    This cytological study was performed in 19 taxa grown naturally in Nizip region (Aksaray). These taxa are Conringia perfoliata (C.A.Mey.) Busch, Alyssum strigosum Banks & Sol. subsp. strigosum, Alyssum murale Waldst. & Kit. subsp. murale var. murale, Matthiola longipetala (Vent.) DC. subsp. bicornis (Sibth. & Sm.) P.W.Ball., Erysimum thyrsoideum Boiss. subsp. thyrsoideum (Brassicaceae), Silene alba (Mill.) E.H.L. Krause subsp. divaricata (Reichb.) Walters, Silene conoi...

  4. Pest categorisation of Spodoptera frugiperda

    OpenAIRE

    Jeger, Michael; Bragard, Claude; Caffier, David; Candresse, Thierry; Chatzivassiliou, Elisavet; Dehnen-Schmutz, Katharina; Gilioli, Gianni; Grégoire, Jean-Claude; Jaques Miret, Josep Anton; Navajas Navarro, María; Niere, Björn; Parnell, Stephen; Potting, Roel; Rafoss, Trond; Rossi, Vittorio

    2017-01-01

    The European Commission requested EFSA to conduct a pest categorisation of Spodoptera frugiperda (Lepidoptera: Noctuidae) a pest with hosts in 27 plant families. Favoured hosts include maize, rice and sorghum (Poaceae). Hosts also include crops within the Brassicaceae, Cucurbitaceae, Solanaceae, Rutaceae and other families. S. frugiperda is a taxonomic entity with reliable methods for identification. It is regulated in the EU as a harmful organism whose introduction into the EU is...

  5. Lineage-specific evolution of Methylthioalkylmalate synthases (MAMs involved in glucosinolates biosynthesis

    Directory of Open Access Journals (Sweden)

    Jifang eZhang

    2015-02-01

    Full Text Available Methylthioalkylmalate synthases (MAMs encoded by MAM genes are central to the diversification of the glucosinolates, which are important secondary metabolites in Brassicaceae species. However, the evolutionary pathway of MAM genes is poorly understood. We analyzed the phylogenetic and synteny relationships of MAM genes from 13 sequenced Brassicaceae species. Based on these analyses, we propose that the syntenic loci of MAM genes, which underwent frequent tandem duplications, divided into two independent lineage-specific evolution routes and were driven by positive selection after the divergence from Aethionema arabicum. In the lineage I species Capsella rubella, Camelina sativa, Arabidopsis lyrata, and A. thaliana, the MAM loci evolved three tandem genes encoding enzymes responsible for the biosynthesis of aliphatic glucosinolates with different carbon chain-lengths. In lineage II species, the MAM loci encode enzymes responsible for the biosynthesis of short-chain aliphatic glucosinolates. Our proposed model of the evolutionary pathway of MAM genes will be useful for understanding the specific function of these genes in Brassicaceae species.

  6. Lineage-specific evolution of Methylthioalkylmalate synthases (MAMs) involved in glucosinolates biosynthesis.

    Science.gov (United States)

    Zhang, Jifang; Wang, Xiaobo; Cheng, Feng; Wu, Jian; Liang, Jianli; Yang, Wencai; Wang, Xiaowu

    2015-01-01

    Methylthioalkylmalate synthases (MAMs) encoded by MAM genes are central to the diversification of the glucosinolates, which are important secondary metabolites in Brassicaceae species. However, the evolutionary pathway of MAM genes is poorly understood. We analyzed the phylogenetic and synteny relationships of MAM genes from 13 sequenced Brassicaceae species. Based on these analyses, we propose that the syntenic loci of MAM genes, which underwent frequent tandem duplications, divided into two independent lineage-specific evolution routes and were driven by positive selection after the divergence from Aethionema arabicum. In the lineage I species Capsella rubella, Camelina sativa, Arabidopsis lyrata, and A. thaliana, the MAM loci evolved three tandem genes encoding enzymes responsible for the biosynthesis of aliphatic glucosinolates with different carbon chain-lengths. In lineage II species, the MAM loci encode enzymes responsible for the biosynthesis of short-chain aliphatic glucosinolates. Our proposed model of the evolutionary pathway of MAM genes will be useful for understanding the specific function of these genes in Brassicaceae species.

  7. Evolution of specifier proteins in glucosinolate-containing plants

    Directory of Open Access Journals (Sweden)

    Kuchernig Jennifer C

    2012-07-01

    Full Text Available Abstract Background The glucosinolate-myrosinase system is an activated chemical defense system found in plants of the Brassicales order. Glucosinolates are stored separately from their hydrolytic enzymes, the myrosinases, in plant tissues. Upon tissue damage, e.g. by herbivory, glucosinolates and myrosinases get mixed and glucosinolates are broken down to an array of biologically active compounds of which isothiocyanates are toxic to a wide range of organisms. Specifier proteins occur in some, but not all glucosinolate-containing plants and promote the formation of biologically active non-isothiocyanate products upon myrosinase-catalyzed glucosinolate breakdown. Results Based on a phytochemical screening among representatives of the Brassicales order, we selected candidate species for identification of specifier protein cDNAs. We identified ten specifier proteins from a range of species of the Brassicaceae and assigned each of them to one of the three specifier protein types (NSP, nitrile-specifier protein, ESP, epithiospecifier protein, TFP, thiocyanate-forming protein after heterologous expression in Escherichia coli. Together with nine known specifier proteins and three putative specifier proteins found in databases, we subjected the newly identified specifier proteins to phylogenetic analyses. Specifier proteins formed three major clusters, named AtNSP5-cluster, AtNSP1-cluster, and ESP/TFP cluster. Within the ESP/TFP cluster, specifier proteins grouped according to the Brassicaceae lineage they were identified from. Non-synonymous vs. synonymous substitution rate ratios suggested purifying selection to act on specifier protein genes. Conclusions Among specifier proteins, NSPs represent the ancestral activity. The data support a monophyletic origin of ESPs from NSPs. The split between NSPs and ESPs/TFPs happened before the radiation of the core Brassicaceae. Future analyses have to show if TFP activity evolved from ESPs at least twice

  8. A 2-Oxoglutarate-Dependent Dioxygenase Mediates the Biosynthesis of Glucoraphasatin in Radish1[OPEN

    Science.gov (United States)

    Kitashiba, Hiroyasu; Li, Feng; Fukino, Nobuko; Ohara, Takayoshi; Nishio, Takeshi; Ishida, Masahiko

    2017-01-01

    Glucosinolates (GSLs) are secondary metabolites whose degradation products confer intrinsic flavors and aromas to Brassicaceae vegetables. Several structures of GSLs are known in the Brassicaceae, and the biosynthetic pathway and regulatory networks have been elucidated in Arabidopsis (Arabidopsis thaliana). GSLs are precursors of chemical defense substances against herbivorous pests. Specific GSLs can act as feeding blockers or stimulants, depending on the pest species. Natural selection has led to diversity in the GSL composition even within individual species. However, in radish (Raphanus sativus), glucoraphasatin (4-methylthio-3-butenyl glucosinolate) accounts for more than 90% of the total GSLs, and little compositional variation is observed. Because glucoraphasatin is not contained in other members of the Brassicaceae, like Arabidopsis and cabbage (Brassica oleracea), the biosynthetic pathways for glucoraphasatin remain unclear. In this report, we identified and characterized a gene encoding GLUCORAPHASATIN SYNTHASE 1 (GRS1) by genetic mapping using a mutant that genetically lacks glucoraphasatin. Transgenic Arabidopsis, which overexpressed GRS1 cDNA, accumulated glucoraphasatin in the leaves. GRS1 encodes a 2-oxoglutarate-dependent dioxygenase, and it is abundantly expressed in the leaf. To further investigate the biosynthesis and transportation of GSLs in radish, we grafted a grs1 plant onto a wild-type plant. The grafting experiment revealed a leaf-to-root long-distance glucoraphasatin transport system in radish and showed that the composition of GSLs differed among the organs. Based on these observations, we propose a characteristic biosynthesis pathway for glucoraphasatin in radish. Our results should be useful in metabolite engineering for breeding of high-value vegetables. PMID:28100450

  9. Housekeeping Gene Sequencing and Multilocus Variable-Number Tandem-Repeat Analysis To Identify Subpopulations within Pseudomonas syringae pv. maculicola and Pseudomonas syringae pv. tomato That Correlate with Host Specificity

    Science.gov (United States)

    Gironde, S.

    2012-01-01

    Pseudomonas syringae pv. maculicola causes bacterial spot on Brassicaceae worldwide, and for the last 10 years severe outbreaks have been reported in the Loire Valley, France. P. syringae pv. maculicola resembles P. syringae pv. tomato in that it is also pathogenic for tomato and causes the same types of symptoms. We used a collection of 106 strains of P. syringae to characterize the relationships between P. syringae pv. maculicola and related pathovars, paying special attention to P. syringae pv. tomato. Phylogenetic analysis of gyrB and rpoD gene sequences showed that P. syringae pv. maculicola, which causes diseases in Brassicaceae, forms six genetic lineages within genomospecies 3 of P. syringae strains as defined by L. Gardan et al. (Int. J. Syst. Bacteriol. 49[Pt 2]:469–478, 1999), whereas P. syringae pv. tomato forms two distinct genetic lineages. A multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) conducted with eight minisatellite loci confirmed the genetic structure obtained with rpoD and gyrB sequence analyses. These results provide promising tools for fine-scale epidemiological studies on diseases caused by P. syringae pv. maculicola and P. syringae pv. tomato. The two pathovars had distinct host ranges; only P. syringae pv. maculicola strains were pathogenic for Brassicaceae. A subpopulation of P. syringae pv. maculicola strains that are pathogenic for Pto-expressing tomato plants were shown to lack avrPto1 and avrPtoB or to contain a disrupted avrPtoB homolog. Taking phylogenetic and pathological features into account, our data suggest that the DC3000 strain belongs to P. syringae pv. maculicola. This study shows that P. syringae pv. maculicola and P. syringae pv. tomato appear multiclonal, as they did not diverge from a single common ancestral group within the ancestral P. syringae genomospecies 3, and suggests that pathovar specificity within P. syringae may be due to independent genetic events. PMID:22389364

  10. Selenium hyperaccumulators harbor a diverse endophytic bacterial community characterized by high selenium resistance and plant growth promoting properties

    Directory of Open Access Journals (Sweden)

    Martina eSura - de Jong

    2015-03-01

    Full Text Available Selenium (Se-rich plants may be used to provide dietary Se to humans and livestock, and also to clean up Se-polluted soils or waters. This study focused on endophytic bacteria of plants that hyperaccumulate selenium (Se to 0.5-1% of dry weight. Terminal restriction fragment length polymorphism (T-RFLP analysis was used to compare the diversity of endophytic bacteria of hyperaccumulators Stanleya pinnata (Brassicaceae and Astragalus bisulcatus (Fabaceae with those from related non-accumulators Physaria bellii (Brassicaceae and Medicago sativa (Fabaceae collected on the same, seleniferous site. Hyperaccumulators and non-accumulators showed equal T-RF diversity. Parsimony analysis showed that T-RFs from individuals of the same species were more similar to each other than to those from other species, regardless of plant Se content or spatial proximity. Cultivable endophytes from hyperaccumulators S. pinnata and A. bisulcatus were further identified and characterized. The 66 bacterial morphotypes were shown by MS MALDI-TOF Biotyper analysis and 16S rRNA gene sequencing to include strains of Bacillus, Pseudomonas, Pantoea, Staphylococcus, Paenibacillus, Advenella, Arthrobacter and Variovorax. Most isolates were highly resistant to selenate and selenite (up to 200 mM and all could reduce selenite to red elemental Se, reduce nitrite and produce siderophores. Seven isolates were selected for plant inoculation and found to have plant growth promoting properties, both in pure culture and when co-cultivated with crop species Brassica juncea (Brassicaceae or M. sativa. There were no effects on plant Se accumulation. We conclude that Se hyperaccumulators harbor an endophytic bacterial community in their natural seleniferous habitat that is equally diverse to that of comparable non-accumulators. The hyperaccumulator endophytes are characterized by high Se resistance, capacity to produce elemental Se and plant growth promoting properties.

  11. The genome sequence of Barbarea vulgaris facilitates the study of ecological biochemistry

    DEFF Research Database (Denmark)

    Byrne, Stephen L.; Erthmann, Pernille Østerbye; Agerbirk, Niels

    2017-01-01

    The genus Barbarea has emerged as a model for evolution and ecology of plant defense compounds, due to its unusual glucosinolate profile and production of saponins, unique to the Brassicaceae. One species, B. vulgaris, includes two ‘types’, G-type and P-type that differ in trichome density...... candidate genes underlying glucosinolate diversity, trichome density, and study the genetics of biochemical variation for glucosinolate and saponins. B. vulgaris is resistant to the diamondback moth, and may be exploited for “dead-end” trap cropping where glucosinolates stimulate oviposition and saponins...

  12. Phytochemical and Biological Investigation of Two Diplotaxis Species Growing in Tunisia: D. virgata & D. erucoides

    OpenAIRE

    Nizar Ben Salah; Hervé Casabianca; Hichem Ben Jannet; Sophie Chenavas; Corinne Sanglar; Aurélie Fildier; Nabiha Bouzouita

    2015-01-01

    A phytochemical investigation of Diplotaxis virgata D.C. and D. erucoides (L.) D.C. (Brassicaceae) offered to the isolation of two new flavonoids isorhamnetin-3-O-α-l-glucopyranoside (1) and rhamnetin-3,3ʹ-di-O-β-d-glucopyranoside (2), respectively. Their structures have been elucidated from the extended spectroscopic methods, including 1D- and 2D-NMR, UV and mass spectrometry analysis and by comparison with literature data. The fatty acid composition of the hexane extracts of the two specie...

  13. Produccion de frutos y semillas en Diplotaxis erucoides(L.) DC. sometida a diferentes tratamientos de polinizacion

    OpenAIRE

    Sans, Xavier (Sans i Serra); Bonet, Andreu

    1993-01-01

    En este trabajo se estudia el sistema reproductivo de Diplotaxis erucoides (L.) DC. (Brassicaceae), una especie arvense ampliamente distribuida en los cultivos y los márgenes de caminos de la región mediterránea. Mediante polinizaciones manuales con polen procedente de la propia flor (autogamia), de flores del mismo individuo (geitonogamia) y de flores de individuos de otras poblaciones (alogamia) se analiza el efecto de los diferentes tratamientos de polinización sobre la producción de fruto...

  14. Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae preying on Microtheca spp. (Coleoptera: Chrysomelidae larvae

    Directory of Open Access Journals (Sweden)

    VS Sturza

    Full Text Available Microtheca spp. (Coleoptera: Chrysomelidae are insect pests primarily related to Brassicaceae crops. In the State of Rio Grande do Sul (RS, southern Brazil, they are found on forage turnip, Raphanus sativus L. var. oleiferus Metzg., which is commonly grown during fall/winter seasons. This work reports the predation of Microtheca spp. larvae by Toxomerus duplicatus Wiedemann, 1830 (Diptera: Syrphidae larvae, on forage turnip crop, in Santa Maria, RS. This register provides new information about Microtheca spp. natural enemies in Brazil, which might be a new option for integrate pest management of these species.

  15. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  16. Reference: 538 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available RS6, selected from hybridomas raised against sieve elements isolated from California shield leaf (Stre...ptanthus tortuosus; Brassicaceae) tissue cultures, recognizes an antigen in the Arabido...ve elements, but not companion cells, and accumulates at the earliest stages of sieve element differe...ntiation. The identity of the RS6 antigen was revealed by reverse transcription-PCR of A...rabidopsis leaf RNA using degenerate primers to be an early nodulin (ENOD)-like protein that is encoded by the expre

  17. Determination of Agronomic Properties and Oil Content of Camelina (Camelina sativa (L.) Crantz) At The Adıyaman Conditions

    OpenAIRE

    İnan, Memet; Kırpık, Muzaffer

    2016-01-01

    Camelina (Camelina sativa (L.) Crantz) is an annual plant and an oilseed belonging to the family Brassicaceae (Syn.Cruciferae) which can be cultivated in summer and winter in our country conditions. In this study which has been carried out on the possibilities of Camelina being cultivated as a winter season plant within Kahta/Adıyaman conditions that have semi-arid climate features of the plant, camelina seeds were sown in mid-November depending on rainfall and successful germination were obs...

  18. Genes Involved in the Evolution of Herbivory by a Leaf-Mining, Drosophilid Fly

    DEFF Research Database (Denmark)

    Whiteman, Noah K.; Gloss, Andrew D.; Sackton, Timothy B.

    2012-01-01

    Herbivorous insects are among the most successful radiations of life. However, we know little about the processes underpinning the evolution of herbivory. We examined the evolution of herbivory in the fly, Scaptomyza flava, whose larvae are leaf miners on species of Brassicaceae, including...... a total of 341 transcripts that were differentially regulated by glucosinolate uptake in larval S. flava. Of these, approximately a third corresponded to homologs of Drosophila melanogaster genes associated with starvation, dietary toxin-, heat-, oxidation-, and aging-related stress. The upregulated...

  19. Characterization of two coexisting pathogen populations of Leptosphaeria spp., the cause of stem canker of brassicas

    Directory of Open Access Journals (Sweden)

    Joanna Kaczmarek

    2012-12-01

    Full Text Available Stem canker of brassicas, also known as blackleg is the most damaging disease of many Brassicaceae. The disease is caused by Leptosphaeria maculans (Desm. Ces et de Not. and L. biglobosa sp. nov., Shoemaker & Brun, which coexist in plants and resulting in disease symptoms and decreased yield, quantity and quality of cultivated vegetables and oilseed rape. The paper presents taxonomic relationships between these coexisting pathogen species, describes particular stages of their life cycles, summarizes the differences between the species, and reviews methods for their identification.

  20. Archaeological Investigations at the North Cove, Site Harlan County Lake, Harlan County, Nebraska: An Interdisciplinary Approach. Phase 2

    Science.gov (United States)

    1989-01-01

    Seeds Asteraceae Seeds Seeds Poaceae Seeds Seeds Lamiaceae Seeds Seeds Cyperaceae Seeds Seeds Brassicaceae(?) Seeds Polvgonum(?) Seeds Other taxa...Hi. annuus common sunflower Agoseris type A. glauca false dandelion Cheno-Am Chenopodium desiccutum goosefoot Amaranthus retroflexus pigweed Poaceae ...0.2 0.5 Tubliflora type 0.3 0.2 0.5 Bidens type 0.7 0.4 0.2 Helianthus type 0.3 0.0 0.0 Agoseris type 0.0 1.0 0.9 Cheno-Am 5.5

  1. Unequal segregation of SRK alleles at the S locus in Brassica cretica.

    Science.gov (United States)

    Edh, Kristina; Widén, Björn; Ceplitis, Alf

    2008-06-01

    In the Brassicaceae plant family, which includes the Arabidopsis and Brassica genera, self-incompatibility (SI) is controlled by genes at the S locus. Using experimental crosses, we studied the pattern of inheritance of S-locus alleles in the wild species Brassica cretica. Four full-sib families were established and unequal segregation of alleles at the SRK SI gene was found in one family. The segregation distortion acted in favour of a recessive (class II) allele and was best explained by some form of gametic-level selection. Our findings are discussed in the light of theoretical predictions of differential accumulation of deleterious mutations among S-locus alleles.

  2. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana.

    Science.gov (United States)

    Hemleben, V; Frey, M; Rall, S; Koch, M; Kittel, M; Kreuzaler, F; Ragg, H; Fautz, E; Hahlbrock, K

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  3. Evaluation of genetic diversity amongst Descurainia sophia L. genotypes by inter-simple sequence repeat (ISSR) marker

    OpenAIRE

    Saki, Sahar; Bagheri, Hedayat; Deljou, Ali; Zeinalabedini, Mehrshad

    2015-01-01

    Descurainia sophia is a valuable medicinal plant in family of Brassicaceae. To determine the range of diversity amongst D. sophia in Iran, 32 naturally distributed plants belonging to six natural populations of the Iranian plateau were investigated by inter-simple sequence repeat (ISSR) markers. The average percentage of polymorphism produced by 12 ISSR primers was 86 %. The PIC values for primers ranged from 0.22 to 0.40 and Rp values ranged between 6.5 and 19.9. The relative genetic diversi...

  4. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  5. Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling

    KAUST Repository

    Lori, M.

    2015-05-22

    Plant elicitor peptides (Peps) are potent inducers of pattern-triggered immunity and amplify the immune response against diverse pathogens. Peps have been discovered and studied extensively in Arabidopsis and only recently orthologs in maize were also identified and characterized in more detail. Here, the presence of PROPEPs, the Pep precursors, and PEPRs, the Pep receptors, was investigated within the plant kingdom. PROPEPs and PEPRs were identified in most sequenced species of the angiosperms. The conservation and compatibility of the Pep-PEPR-system was analysed by using plants of two distantly related dicot families, Brassicaceae and Solanaceae, and a representative family of monocot plants, the Poaceae. All three plant families contain important crop plants, including maize, rice, tomato, potato, and canola. Peps were not recognized by species outside of their plant family of origin, apparently because of a divergence of the Pep sequences. Three family-specific Pep motifs were defined and the integration of such a motif into the Pep sequence of an unrelated Pep enabled its perception. Transient transformation of Nicotiana benthamiana with the coding sequences of the AtPEPR1 and ZmPEPR1a led to the recognition of Pep peptides of Brassicaceae or Poaceae origin, respectively, and to the proper activation of downstream signalling. It was concluded that signalling machinery downstream of the PEPRs is highly conserved whereas the leucine-rich repeat domains of the PEPRs co-evolved with the Peps, leading to distinct motifs and, with it, interfamily incompatibility.

  6. Insect attraction versus plant defense: young leaves high in glucosinolates stimulate oviposition by a specialist herbivore despite poor larval survival due to high saponin content.

    Science.gov (United States)

    Badenes-Perez, Francisco R; Gershenzon, Jonathan; Heckel, David G

    2014-01-01

    Glucosinolates are plant secondary metabolites used in plant defense. For insects specialized on Brassicaceae, such as the diamondback moth, Plutella xylostella L. (Lepidoptera: Plutellidae), glucosinolates act as "fingerprints" that are essential in host plant recognition. Some plants in the genus Barbarea (Brassicaceae) contain, besides glucosinolates, saponins that act as feeding deterrents for P. xylostella larvae, preventing their survival on the plant. Two-choice oviposition tests were conducted to study the preference of P. xylostella among Barbarea leaves of different size within the same plant. P. xylostella laid more eggs per leaf area on younger leaves compared to older ones. Higher concentrations of glucosinolates and saponins were found in younger leaves than in older ones. In 4-week-old plants, saponins were present in true leaves, while cotyledons contained little or no saponins. When analyzing the whole foliage of the plant, the content of glucosinolates and saponins also varied significantly in comparisons among plants that were 4, 8, and 12 weeks old. In Barbarea plants and leaves of different ages, there was a positive correlation between glucosinolate and saponin levels. This research shows that, in Barbarea plants, ontogenetical changes in glucosinolate and saponin content affect both attraction and resistance to P. xylostella. Co-occurrence of a high content of glucosinolates and saponins in the Barbarea leaves that are most valuable for the plant, but are also the most attractive to P. xylostella, provides protection against this specialist herbivore, which oviposition behavior on Barbarea seems to be an evolutionary mistake.

  7. Anastatica hierochuntica, an Arabidopsis Desert Relative, Is Tolerant to Multiple Abiotic Stresses and Exhibits Species-Specific and Common Stress Tolerance Strategies with Its Halophytic Relative, Eutrema (Thellungiella) salsugineum

    Science.gov (United States)

    Eshel, Gil; Shaked, Ruth; Kazachkova, Yana; Khan, Asif; Eppel, Amir; Cisneros, Aroldo; Acuna, Tania; Gutterman, Yitzhak; Tel-Zur, Noemi; Rachmilevitch, Shimon; Fait, Aaron; Barak, Simon

    2017-01-01

    The search for novel stress tolerance determinants has led to increasing interest in plants native to extreme environments – so called “extremophytes.” One successful strategy has been comparative studies between Arabidopsis thaliana and extremophyte Brassicaceae relatives such as the halophyte Eutrema salsugineum located in areas including cold, salty coastal regions of China. Here, we investigate stress tolerance in the desert species, Anastatica hierochuntica (True Rose of Jericho), a member of the poorly investigated lineage III Brassicaceae. We show that A. hierochuntica has a genome approximately 4.5-fold larger than Arabidopsis, divided into 22 diploid chromosomes, and demonstrate that A. hierochuntica exhibits tolerance to heat, low N and salt stresses that are characteristic of its habitat. Taking salt tolerance as a case study, we show that A. hierochuntica shares common salt tolerance mechanisms with E. salsugineum such as tight control of shoot Na+ accumulation and resilient photochemistry features. Furthermore, metabolic profiling of E. salsugineum and A. hierochuntica shoots demonstrates that the extremophytes exhibit both species-specific and common metabolic strategies to cope with salt stress including constitutive up-regulation (under control and salt stress conditions) of ascorbate and dehydroascorbate, two metabolites involved in ROS scavenging. Accordingly, A. hierochuntica displays tolerance to methyl viologen-induced oxidative stress suggesting that a highly active antioxidant system is essential to cope with multiple abiotic stresses. We suggest that A. hierochuntica presents an excellent extremophyte Arabidopsis relative model system for understanding plant survival in harsh desert conditions. PMID:28144244

  8. A draft genome of field pennycress (Thlaspi arvense) provides tools for the domestication of a new winter biofuel crop.

    Science.gov (United States)

    Dorn, Kevin M; Fankhauser, Johnathon D; Wyse, Donald L; Marks, M David

    2015-04-01

    Field pennycress (Thlaspi arvense L.) is being domesticated as a new winter cover crop and biofuel species for the Midwestern United States that can be double-cropped between corn and soybeans. A genome sequence will enable the use of new technologies to make improvements in pennycress. To generate a draft genome, a hybrid sequencing approach was used to generate 47 Gb of DNA sequencing reads from both the Illumina and PacBio platforms. These reads were used to assemble 6,768 genomic scaffolds. The draft genome was annotated using the MAKER pipeline, which identified 27,390 predicted protein-coding genes, with almost all of these predicted peptides having significant sequence similarity to Arabidopsis proteins. A comprehensive analysis of pennycress gene homologues involved in glucosinolate biosynthesis, metabolism, and transport pathways revealed high sequence conservation compared with other Brassicaceae species, and helps validate the assembly of the pennycress gene space in this draft genome. Additional comparative genomic analyses indicate that the knowledge gained from years of basic Brassicaceae research will serve as a powerful tool for identifying gene targets whose manipulation can be predicted to result in improvements for pennycress. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  9. Expression of a transferred nuclear gene in a mitochondrial genome

    Directory of Open Access Journals (Sweden)

    Yichun Qiu

    2014-08-01

    Full Text Available Transfer of mitochondrial genes to the nucleus, and subsequent gain of regulatory elements for expression, is an ongoing evolutionary process in plants. Many examples have been characterized, which in some cases have revealed sources of mitochondrial targeting sequences and cis-regulatory elements. In contrast, there have been no reports of a nuclear gene that has undergone intracellular transfer to the mitochondrial genome and become expressed. Here we show that the orf164 gene in the mitochondrial genome of several Brassicaceae species, including Arabidopsis, is derived from the nuclear ARF17 gene that codes for an auxin responsive protein and is present across flowering plants. Orf164 corresponds to a portion of ARF17, and the nucleotide and amino acid sequences are 79% and 81% identical, respectively. Orf164 is transcribed in several organ types of Arabidopsis thaliana, as detected by RT-PCR. In addition, orf164 is transcribed in five other Brassicaceae within the tribes Camelineae, Erysimeae and Cardamineae, but the gene is not present in Brassica or Raphanus. This study shows that nuclear genes can be transferred to the mitochondrial genome and become expressed, providing a new perspective on the movement of genes between the genomes of subcellular compartments.

  10. Influence of changes in crop cultivation areas on pollen contents of honey (Research Note

    Directory of Open Access Journals (Sweden)

    A.-L. VARIS

    2008-12-01

    Full Text Available Pollen counts were done on honey collected by a Finnish honey corporation in late summer 1997 from the entire beekeeping area of Finland. The most common pollen type was Brassicaceae pollen, which was represented by 60% of the grains counted. It was followed by Salix spp. (10%, Trifolium repens + T. hybridum (10% and T. pratense + T. medium (6.5% species. Pollen grains of Phacelia spp, Filipendula ulmaria, Apiaceae, Sorbus aucuparia, Malus domestica, and Rubus idaeus were also numerous. These pollen types constituted 96% of all the pollen examined. These results and those of the earlier pollen counts in Finland were compared with the cultivation areas of the most important nectariferous crops. In the 1930s white clover was the most important honey source in Finland and its pollen was very dominant in honey. Since the 1950s oilseed crops have been grown in increasing rates and pure timothy-meadow fescue pastures and hay stands with heavy N applications have decreased the share of Trifolium species. The proportion of Brassicaceae pollen has continuously increased with the increase of the growing area of turnip rape Brassica rapa ssp. oleifera and rape, B. napus ssp. oleifera. At the same time the proportion of T. repens + T. hybridum pollen has decreased so that their mutual relationships are now reversed compared to the beginning of the 1960s. Changes in land use were thus very clearly to be seen in the pollen content of honey.;

  11. Effect of water stress on the agressiveness of oilsseed rape (Brassica napus L.) and two mustards (Sinapis alba L. and S. arvensis L.).

    Science.gov (United States)

    Maataoui, A; Talouizte, A; Benbella, M; Bouhache, M

    2003-01-01

    Oilseed rape (Brassica napus L.), a winter sown crop, may compete for water especially with Brassicaceae weeds. Investigating plant competition under water stress conditions is necessary for achieving a good yield in a Mediterranean climate characterized by a scarse water availability. This experiment was carried out to study the competiveness of oilseed rape (Brassica napus L.) with two brassicaceae weeds (Sinapis alba L. and S. arvensis L.). Species were grown at a density of two plants per bucket either in monoculture or as a binary mixture under water stress conditions in a greenhouse. Results of monoculture showed that B. napus had the highest shoot dry matter. Shoot dry matter of B. napus was more reduced by intraspecific competition than by interspecific competition due to S. arvensis. Shoot dry matter of S. alba in monoculture was higher than in mixture with S. arvensis, but more reduced in mixture with B. napus. In case of S. arvensis, shoot dry matter was more reduced by interspecific competition than by intraspecific competition. Agressivity based on grain yield showed, that B. napus was the most agressive species followed by S. alba. This agressivity did not change by the imposed water stress.

  12. The effects of glucosinolates and their breakdown products on necrotrophic fungi.

    Directory of Open Access Journals (Sweden)

    Kobi Buxdorf

    Full Text Available Glucosinolates are a diverse class of S- and N-containing secondary metabolites that play a variety of roles in plant defense. In this study, we used Arabidopsis thaliana mutants that contain different amounts of glucosinolates and glucosinolate-breakdown products to study the effects of these phytochemicals on phytopathogenic fungi. We compared the fungus Botrytis cinerea, which infects a variety of hosts, with the Brassicaceae-specific fungus Alternaria brassicicola. B. cinerea isolates showed variable composition-dependent sensitivity to glucosinolates and their hydrolysis products, while A. brassicicola was more strongly affected by aliphatic glucosinolates and isothiocyanates as decomposition products. We also found that B. cinerea stimulates the accumulation of glucosinolates to a greater extent than A. brassicicola. In our work with A. brassicicola, we found that the type of glucosinolate-breakdown product is more important than the type of glucosinolate from which that product was derived, as demonstrated by the sensitivity of the Ler background and the sensitivity gained in Col-0 plants expressing epithiospecifier protein both of which accumulate simple nitrile and epithionitriles, but not isothiocyanates. Furthermore, in vivo, hydrolysis products of indole glucosinolates were found to be involved in defense against B. cinerea, but not in the host response to A. brassicicola. We suggest that the Brassicaceae-specialist A. brassicicola has adapted to the presence of indolic glucosinolates and can cope with their hydrolysis products. In contrast, some isolates of the generalist B. cinerea are more sensitive to these phytochemicals.

  13. Development of genomic and EST-SSR markers in radish (Raphanus sativus L.)

    Science.gov (United States)

    Nakatsuji, Ryoichi; Hashida, Tomoko; Matsumoto, Naoko; Tsuro, Masato; Kubo, Nakao; Hirai, Masashi

    2011-01-01

    Radish (Raphanus sativus L.) belongs to Brassicaceae family and is a close relative of Brassica. This species shows a wide morphological diversity, and is an important vegetable especially in Asia. However, molecular research of radish is behind compared to that of Brassica. For example, reports on SSR (simple sequence repeat) markers are limited. Here, we designed 417 radish SSR markers from SSR-enriched genomic libraries and the cDNA data. Of the 256 SSR markers succeeded in PCR, 130 showed clear polymorphisms between two radish lines; a rat-tail radish and a Japanese cultivar, ‘Harufuku’. As a test case for evaluation of the present SSRs, we conducted two studies. First, we selected 16 SSRs to calculate polymorphism information contents (PICs) using 16 radish cultivars and four other Brassicaceae species. These markers detected 3–15 alleles (average = 9.6). PIC values ranged from 0.54 to 0.92 (average = 0.78). Second, part of the present SSRs were tested for mapping using our previously-examined mapping population. The map spanned 672.7 cM with nine linkage groups (LGs). The 21 radish SSR markers were distributed throughout the LGs. The SSR markers developed here would be informative and useful for genetic analysis in radish and its related species. PMID:23136479

  14. The Whole Genome Assembly and Comparative Genomic Research of Thellungiella parvula (Extremophile Crucifer Mitochondrion

    Directory of Open Access Journals (Sweden)

    Xuelin Wang

    2016-01-01

    Full Text Available The complete nucleotide sequences of the mitochondrial (mt genome of an extremophile species Thellungiella parvula (T. parvula have been determined with the lengths of 255,773 bp. T. parvula mt genome is a circular sequence and contains 32 protein-coding genes, 19 tRNA genes, and three ribosomal RNA genes with a 11.5% coding sequence. The base composition of 27.5% A, 27.5% T, 22.7% C, and 22.3% G in descending order shows a slight bias of 55% AT. Fifty-three repeats were identified in the mitochondrial genome of T. parvula, including 24 direct repeats, 28 tandem repeats (TRs, and one palindromic repeat. Furthermore, a total of 199 perfect microsatellites have been mined with a high A/T content (83.1% through simple sequence repeat (SSR analysis and they were distributed unevenly within this mitochondrial genome. We also analyzed other plant mitochondrial genomes’ evolution in general, providing clues for the understanding of the evolution of organelles genomes in plants. Comparing with other Brassicaceae species, T. parvula is related to Arabidopsis thaliana whose characters of low temperature resistance have been well documented. This study will provide important genetic tools for other Brassicaceae species research and improve yields of economically important plants.

  15. The FLC-like gene BvFL1 is not a major regulator of vernalization response in biennial beets

    Directory of Open Access Journals (Sweden)

    Sebastian Hagen Vogt

    2014-04-01

    Full Text Available Many plant species in temperate climate regions require vernalization over winter to initiate flowering. FLOWERING LOCUS C (FLC and FLC-like genes are key regulators of vernalization requirement and growth habit in winter-annual and perennial Brassicaceae. In the biennial crop species Beta vulgaris ssp. vulgaris in the evolutionarily distant Caryophyllales clade of core eudicots growth habit and bolting time are controlled by the vernalization and photoperiod response gene BTC1 and the downstream BvFT1-BvFT2 module. B. vulgaris also contains a vernalization-responsive FLC homolog (BvFL1. Here, to further elucidate the regulation of vernalization response and growth habit in beet, we functionally characterized BvFL1 by RNAi and over-expression in transgenic plants. BvFL1 RNAi neither eliminated the requirement for vernalization of biennial beets nor had a major effect on bolting time after vernalization. Over-expression of BvFL1 resulted in a moderate late-bolting phenotype, with bolting after vernalization being delayed by approximately one week. By contrast, RNAi-induced down-regulation of the BvFT1-BvFT2 module led to a strong delay in bolting after vernalization by several weeks. The data demonstrate for the first time that an FLC homolog does not play a major role in the control of vernalization response in a dicot species outside the Brassicaceae.

  16. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  17. Genome of Plant Maca (Lepidium meyenii) Illuminates Genomic Basis for High-Altitude Adaptation in the Central Andes.

    Science.gov (United States)

    Zhang, Jing; Tian, Yang; Yan, Liang; Zhang, Guanghui; Wang, Xiao; Zeng, Yan; Zhang, Jiajin; Ma, Xiao; Tan, Yuntao; Long, Ni; Wang, Yangzi; Ma, Yujin; He, Yuqi; Xue, Yu; Hao, Shumei; Yang, Shengchao; Wang, Wen; Zhang, Liangsheng; Dong, Yang; Chen, Wei; Sheng, Jun

    2016-07-06

    Maca (Lepidium meyenii Walp, 2n = 8x = 64), belonging to the Brassicaceae family, is an economic plant cultivated in the central Andes sierra in Peru (4000-4500 m). Considering that the rapid uplift of the central Andes occurred 5-10 million years ago (Ma), an evolutionary question arises regarding how plants such as maca acquire high-altitude adaptation within a short geological period. Here, we report the high-quality genome assembly of maca, in which two closely spaced maca-specific whole-genome duplications (WGDs; ∼6.7 Ma) were identified. Comparative genomic analysis between maca and closely related Brassicaceae species revealed expansions of maca genes and gene families involved in abiotic stress response, hormone signaling pathway, and secondary metabolite biosynthesis via WGDs. The retention and subsequent functional divergence of many duplicated genes may account for the morphological and physiological changes (i.e., small leaf shape and self-fertility) in maca in a high-altitude environment. In addition, some duplicated maca genes were identified with functions in morphological adaptation (i.e., LEAF CURLING RESPONSIVENESS) and abiotic stress response (i.e., GLYCINE-RICH RNA-BINDING PROTEINS and DNA-DAMAGE-REPAIR/TOLERATION 2) under positive selection. Collectively, the maca genome provides useful information to understand the important roles of WGDs in the high-altitude adaptation of plants in the Andes. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Camelina as a sustainable oilseed crop: contributions of plant breeding and genetic engineering.

    Science.gov (United States)

    Vollmann, Johann; Eynck, Christina

    2015-04-01

    Camelina is an underutilized Brassicaceae oilseed plant with a considerable agronomic potential for biofuel and vegetable oil production in temperate regions. In contrast to most Brassicaceae, camelina is resistant to alternaria black spot and other diseases and pests. Sequencing of the camelina genome revealed an undifferentiated allohexaploid genome with a comparatively large number of genes and low percentage of repetitive DNA. As there is a close relationship between camelina and the genetic model plant Arabidopsis, this review aims at exploring the potential of translating basic Arabidopsis results into a camelina oilseed crop for food and non-food applications. Recently, Arabidopsis genes for drought resistance or increased photosynthesis and overall productivity have successfully been expressed in camelina. In addition, gene constructs affecting lipid metabolism pathways have been engineered into camelina for synthesizing either long-chain polyunsaturated fatty acids, hydroxy fatty acids or high-oleic oils in particular camelina strains, which is of great interest in human food, industrial or biofuel applications, respectively. These results confirm the potential of camelina to serve as a biotechnology platform in biorefinery applications thus justifying further investment in breeding and genetic research for combining agronomic potential, unique oil quality features and biosafety into an agricultural production system. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Phylogenetic relationships of Albugo species (white blister rusts) based on LSU rDNA sequence and oospore data.

    Science.gov (United States)

    Voglmayr, Hermann; Riethmüller, Alexandra

    2006-01-01

    Phylogenetic maximum parsimony and Bayesian analyses of 60 collections belonging to 12 species of Albugo (Peronosporales) and two species of Pythium (Pythiales) were performed using nuclear large subunit ribosomal DNA sequences containing the D1 and D2 regions. These data were supplemented with detailed light and scanning electron microscopical analyses of oospore morphology, and the morphological data of insufficiently studied taxa (e.g. A. caryophyllacearum, A. gomphrenae) are revised. Molecular data revealed two main clades: one containing the collections from hosts belonging to the Caryophyllales and Asteraceae, and the other containing the collections from hosts belonging to the Brassicaceae and Convolvulaceae. Separation into these two clades was also corroborated by oospore morphology. Whereas the Albugo collections from Caryophyllales did not form a monophyletic lineage, the collections originating from Brassicaceae, Convolvulaceae and Asteraceae each formed highly supported monophyletic clades. According to DNA sequence data and oospore morphology, the host genus Amaranthus harbors two distinct species, Albugo amaranthi and Albugo bliti. The DNA sequence data further indicate that Albugo candida and Albugo tragopogonis each may consist of several distinct lineages, but additional data need to be collected before further taxonomic conclusions can be made.

  20. Identification of metabolic QTLs and candidate genes for glucosinolate synthesis in Brassica oleracea leaves, seeds and flower buds.

    Science.gov (United States)

    Sotelo, Tamara; Soengas, Pilar; Velasco, Pablo; Rodríguez, Víctor M; Cartea, María Elena

    2014-01-01

    Glucosinolates are major secondary metabolites found in the Brassicaceae family. These compounds play an essential role in plant defense against biotic and abiotic stresses, but more interestingly they have beneficial effects on human health. We performed a genetic analysis in order to identify the genome regions regulating glucosinolates biosynthesis in a DH mapping population of Brassica oleracea. In order to obtain a general overview of regulation in the whole plant, analyses were performed in the three major organs where glucosinolates are synthesized (leaves, seeds and flower buds). Eighty two significant QTLs were detected, which explained a broad range of variability in terms of individual and total glucosinolate (GSL) content. A meta-analysis rendered eighteen consensus QTLs. Thirteen of them regulated more than one glucosinolate and its content. In spite of the considerable variability of glucosinolate content and profiles across the organ, some of these consensus QTLs were identified in more than one tissue. Consensus QTLs control the GSL content by interacting epistatically in complex networks. Based on in silico analysis within the B. oleracea genome along with synteny with Arabidopsis, we propose seven major candidate loci that regulate GSL biosynthesis in the Brassicaceae family. Three of these loci control the content of aliphatic GSL and four of them control the content of indolic glucosinolates. GSL-ALK plays a central role in determining aliphatic GSL variation directly and by interacting epistatically with other loci, thus suggesting its regulatory effect.

  1. Variabilidade genética de Diadegma sp., parasitóide da traça-das-crucíferas, através de RAPD-PCR Genetic variability of Diadegma sp., parasitoid of diamondback moth using RAPD-PCR

    Directory of Open Access Journals (Sweden)

    Rose Monnerat

    2004-03-01

    Full Text Available O gênero Diadegma compreende espécies que são parasitóides de larvas da traça-das-crucíferas Plutella xylostella, uma das mais importantes pragas das plantas da família Brassicacea. Este gênero possui distribuição mundial. Neste trabalho, três populações de Diadegma spp. oriundas de diferentes países (Brasil, Ilha da Reunião e Malásia foram caracterizadas geneticamente por meio da técnica de RAPD-PCR. Não foi constatada variabilidade intra-populacional, no entanto o alto coeficiente de similaridade entre populações sugeriram que esses insetos poderiam pertencer a espécies diferentes.The genus Diadegma has species that are parasitoids of larvae of diamondback moth, Plutella xylostella, one of the most important pests of Brassicacea. This genus has a worldwide distribution. Representative samples of three Diadegma populations from Brazil, Reunion Island and Malaysia were characterized by RAPD-PCR. No intra-population variability was found. However, the high coefficient of genetic similarity between the populations suggests that they could belong to different species.

  2. The unusual S locus of Leavenworthia is composed of two sets of paralogous loci.

    Science.gov (United States)

    Chantha, Sier-Ching; Herman, Adam C; Castric, Vincent; Vekemans, Xavier; Marande, William; Schoen, Daniel J

    2017-12-01

    The Leavenworthia self-incompatibility locus (S locus) consists of paralogs (Lal2, SCRL) of the canonical Brassicaceae S locus genes (SRK, SCR), and is situated in a genomic position that differs from the ancestral one in the Brassicaceae. Unexpectedly, in a small number of Leavenworthia alabamica plants examined, sequences closely resembling exon 1 of SRK have been found, but the function of these has remained unclear. BAC cloning and expression analyses were employed to characterize these SRK-like sequences. An SRK-positive Bacterial Artificial Chromosome clone was found to contain complete SRK and SCR sequences located close by one another in the derived genomic position of the Leavenworthia S locus, and in place of the more typical Lal2 and SCRL sequences. These sequences are expressed in stigmas and anthers, respectively, and crossing data show that the SRK/SCR haplotype is functional in self-incompatibility. Population surveys indicate that S loci possess such alleles. An ancestral translocation or recombination event involving SRK/SCR and Lal2/SCRL likely occurred, together with neofunctionalization of Lal2/SCRL, and both haplotype groups now function as Leavenworthia S locus alleles. These findings suggest that S locus alleles can have distinctly different evolutionary origins. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  3. Functional innovations of three chronological mesohexaploid Brassica rapa genomes.

    Science.gov (United States)

    Kim, Jungeun; Lee, Jeongyeo; Choi, Jae-Pil; Park, Inkyu; Yang, Kyungbong; Kim, Min Keun; Lee, Young Han; Nou, Ill-Sup; Kim, Dae-Soo; Min, Sung Ran; Park, Sang Un; Kim, HyeRan

    2014-07-18

    The Brassicaceae family is an exemplary model for studying plant polyploidy. The Brassicaceae knowledge-base includes the well-annotated Arabidopsis thaliana reference sequence; well-established evidence for three rounds of whole genome duplication (WGD); and the conservation of genomic structure, with 24 conserved genomic blocks (GBs). The recently released Brassica rapa draft genome provides an ideal opportunity to update our knowledge of the conserved genomic structures in Brassica, and to study evolutionary innovations of the mesohexaploid plant, B. rapa. Three chronological B. rapa genomes (recent, young, and old) were reconstructed with sequence divergences, revealing a trace of recursive WGD events. A total of 636 fast evolving genes were unevenly distributed throughout the recent and young genomes. The representative Gene Ontology (GO) terms for these genes were 'stress response' and 'development' both through a change in protein modification or signaling, rather than by enhancing signal recognition. In retention patterns analysis, 98% of B. rapa genes were retained as collinear gene pairs; 77% of those were singly-retained in recent or young genomes resulting from death of the ancestral copies, while others were multi-retained as long retention genes. GO enrichments indicated that single retention genes mainly function in the interpretation of genetic information, whereas, multi-retention genes were biased toward signal response, especially regarding development and defense. In the recent genome, 13,302, 5,790, and 20 gene pairs were multi-retained following Brassica whole genome triplication (WGT) events with 2, 3, and 4 homoeologous copies, respectively. Enriched GO-slim terms from B. rapa homomoelogues imply that a major effect of the B. rapa WGT may have been to acquire environmental adaptability or to change the course of development. These homoeologues seem to more frequently undergo subfunctionalization with spatial expression patterns compared with

  4. An early nodulin-like protein accumulates in the sieve element plasma membrane of Arabidopsis

    DEFF Research Database (Denmark)

    Khan, Junaid A.; Wang, Qi; Sjölund, Richard D.

    2007-01-01

    ) tissue cultures, recognizes an antigen in the Arabidopsis (Arabidopsis thaliana) ecotype Columbia that is associated specifically with the plasma membrane of sieve elements, but not companion cells, and accumulates at the earliest stages of sieve element differentiation. The identity of the RS6 antigen...... from the precursor protein, resulting in a mature peptide of approximately 15 kD that is attached to the sieve element plasma membrane via a carboxy-terminal glycosylphosphatidylinositol membrane anchor. Many of the Arabidopsis ENOD-like proteins accumulate in gametophytic tissues, whereas in both......Membrane proteins within the sieve element-companion cell complex have essential roles in the physiological functioning of the phloem. The monoclonal antibody line RS6, selected from hybridomas raised against sieve elements isolated from California shield leaf (Streptanthus tortuosus; Brassicaceae...

  5. Dispersal of solitary bees and bumblebees in a winter oilseed rape field

    DEFF Research Database (Denmark)

    Calabuig, Isabel

    2000-01-01

    Dispersal distributions of solitary bees and bumblebees were studied in a winter oilseed rape field. Window-traps were placed in the rape field along a line transect perpendicular to the field edge. 19 species of solitary bees were recorded and all but four species are polylectic, including...... Brassicaceae as host-plant family. Through non-linear regression, the decline in solitary bee individuals versus distance from field edge significantly fitted a steep two-parameter exponential decay function. Activity of solitary bees was clearly highest within 30 metres from the field edge. Apparently......, solitary bees do not play any noteworthy role in the pollination of winter oilseed rape in Denmark. The traps yielded ten species of bumblebees, and a significant linear correlation was found between numbers of individuals and distance from the field edge. This result is attributed to bumblebee foraging...

  6. Pollen Foraging by Honey Bees (Apis Mellifera L. in Greece: Botanical and Geographical Origin

    Directory of Open Access Journals (Sweden)

    Dimou Maria

    2014-12-01

    Full Text Available Pollen is very important for honey bee colony development and nutrition. It is also a valuable product for human consumption, considered to have high nutritional value. In this study, we performed melissopalynological analysis of 285 pollen load samples collected from 44 apiaries throughout Greece. The analysis revealed 229 plant taxa represented in total. The abundance of each pollen type varied among the geographical areas from which the samples were collected. We also observed variation among samples collected from the same geographical region. The most frequently found families were Fabaceae, Asteraceae and Rosaceae. The most frequently observed taxa were Brassicaceae, Carduus type, Cistus and Papaver rhoeas. Statistical analysis showed that the geographical classification of pollen samples among northern, central and southern Greece is possible.

  7. Biological and ecophysiological reactions of white wall rocket (Diplotaxis erucoides L.) grown on sewage sludge compost.

    Science.gov (United States)

    Korboulewsky, Nathalie; Bonin, Gilles; Massiani, Catherine

    2002-01-01

    We studied the effects of sewage sludge compost on white wall rocket (Diplotaxis erucoides L.) compared with mineral fertilization and control (without any fertilizer) in a greenhouse experiment. The plants grown on the compost-amended soil showed a different growth dynamic: a significant delay in flowering and a bigger root system. Both the compost and the fertilization treatments increased biomass and seed yield. Heavy metal (Cu, Cd, Zn, Ni) distribution within the plant was in the following order: roots > leaves > stems, except for zinc which was homogeneously distributed. The balance of mineral nutrition was not affected by treatments. Zinc was the trace element which was most taken up. Unlike many species of Brassicaceae, white wall rocket is not a hyperaccumulator. Although sewage sludge compost improved plant growth, delay in flowering shows that it is necessary to take precautions when spreading sewage sludge in natural areas.

  8. A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.).

    Science.gov (United States)

    Tanaka, Yoshiyuki; Tsuda, Mizue; Yasumoto, Keita; Yamagishi, Hiroshi; Terachi, Toru

    2012-07-31

    Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS) is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF) created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138. Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%). It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size) that are non-syntenic to normal-type genome, and the gene orf138 was found to be located at the edge of the

  9. A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.

    Directory of Open Access Journals (Sweden)

    Tanaka Yoshiyuki

    2012-07-01

    Full Text Available Abstract Background Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138. Results Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%. It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size that are non-syntenic to normal-type genome, and the gene orf138

  10. Key factors influencing the potential of catch crops for methane production

    DEFF Research Database (Denmark)

    Molinuevo-Salces, Beatriz; Fernandez-Varela, Raquel; Uellendahl, Hinrich

    2014-01-01

    studied for 14 different catch crops species, with 19 samples harvested in 2010 and 36 harvested in 2011. Principal component analysis was applied to the data to identify the variables characterizing the potential for the different catch crops species for methane production. Two principal components......Catch crops are grown in crop rotation primarily for soil stabilization. The excess biomass of catch crops was investigated for its potential as feedstock for biogas production. Ten variables affecting catch crop growth and methane potential were evaluated. Field trials and methane potential were...... explained up to 84.6% and 71.6% of the total variation for 2010 and 2011 samples, respectively. Specific methane yield, climate conditions (rainfall and temperature) and total nitrogen in the biomass were the variables classifying the different catch crops. Catch crops in the Brassicaceae and Graminaceae...

  11. The Spatial Organization of Glucosinolate Biosynthesis

    DEFF Research Database (Denmark)

    Nintemann, Sebastian

    resistance and nutritional value and many plant specialized metabolites are of high value due to their health promoting characteristics. Glucosinolates are defense compounds found in many crops from the Brassicaceae family and are of high interest because of their nutritional and antinutritional properties...... in human and animal food sources. The glucosinolate defense system belongs to the best-studied pathways in plant specialized metabolism and the steps involved in their biosynthesis are known, their action as defense compounds is well understood and glucosinolate transport proteins have been identified...... between the individual classes of glucosinolates under constitutive and induced conditions and identified the source tissues of these defense compounds. Protein-protein interaction studies were carried out to investigate the subcellular organization of glucosinolate biosynthesis. We identified a family...

  12. Development and validation of a duplex real-time PCR method for the simultaneous detection of celery and white mustard in food.

    Science.gov (United States)

    Fuchs, Magdalena; Cichna-Markl, Margit; Hochegger, Rupert

    2013-11-01

    The developed duplex real-time PCR method allows the simultaneous detection of traces of potentially allergenic white mustard (Sinapis alba) and celery roots (Apium graveolens var. rapaceum), celery stalks (A. g. var. dulce) and leaf celery (A. g. var. secalinum). The duplex assay does not show any cross-reactivity with 64 different biological species, including various members of the Brassicaceae and Apiaceae family. In raw model sausages spiked with white mustard and celery roots, the LOD was found to be 0.001% white mustard and 0.005% celery. In model sausages brewed at 75-78°C for 15 min the LOD was found to be 0.005% white mustard and 0.005% celery. The duplex real-time PCR assay was applied to check if commercial food products are labelled in compliance with the legal regulations. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. De novo assembly and characterization of Camelina sativa transcriptome by paired-end sequencing.

    Science.gov (United States)

    Liang, Chao; Liu, Xuan; Yiu, Siu-Ming; Lim, Boon Leong

    2013-03-05

    Biofuels extracted from the seeds of Camelina sativa have recently been used successfully as environmentally friendly jet-fuel to reduce greenhouse gas emissions. Camelina sativa is genetically very close to Arabidopsis thaliana, and both are members of the Brassicaceae. Although public databases are currently available for some members of the Brassicaceae, such as A. thaliana, A. lyrata, Brassica napus, B. juncea and B. rapa, there are no public Expressed Sequence Tags (EST) or genomic data for Camelina sativa. In this study, a high-throughput, large-scale RNA sequencing (RNA-seq) of the Camelina sativa transcriptome was carried out to generate a database that will be useful for further functional analyses. Approximately 27 million clean "reads" filtered from raw reads by removal of adaptors, ambiguous reads and low-quality reads (2.42 gigabase pairs) were generated by Illumina paired-end RNA-seq technology. All of these clean reads were assembled de novo into 83,493 unigenes and 103,196 transcripts using SOAPdenovo and Trinity, respectively. The average length of the transcripts generated by Trinity was 697 bp (N50 = 976), which was longer than the average length of unigenes (319 bp, N50 = 346 bp). Nonetheless, the assembly generated by SOAPdenovo produced similar number of non-redundant hits (22,435) with that of Trinity (22,433) in BLASTN searches of the Arabidopsis thaliana CDS sequence database (TAIR). Four public databases, the Kyoto Encyclopedia of Genes and Genomes (KEGG), Swiss-prot, NCBI non-redundant protein (NR), and the Cluster of Orthologous Groups (COG), were used for unigene annotation; 67,791 of 83,493 unigenes (81.2%) were finally annotated with gene descriptions or conserved protein domains that were mapped to 25,329 non-redundant protein sequences. We mapped 27,042 of 83,493 unigenes (32.4%) to 119 KEGG metabolic pathways. This is the first report of a transcriptome database for Camelina sativa, an environmentally important member of the

  14. The emerging biofuel crop Camelina sativa retains a highly undifferentiated hexaploid genome structure.

    Science.gov (United States)

    Kagale, Sateesh; Koh, Chushin; Nixon, John; Bollina, Venkatesh; Clarke, Wayne E; Tuteja, Reetu; Spillane, Charles; Robinson, Stephen J; Links, Matthew G; Clarke, Carling; Higgins, Erin E; Huebert, Terry; Sharpe, Andrew G; Parkin, Isobel A P

    2014-04-23

    Camelina sativa is an oilseed with desirable agronomic and oil-quality attributes for a viable industrial oil platform crop. Here we generate the first chromosome-scale high-quality reference genome sequence for C. sativa and annotated 89,418 protein-coding genes, representing a whole-genome triplication event relative to the crucifer model Arabidopsis thaliana. C. sativa represents the first crop species to be sequenced from lineage I of the Brassicaceae. The well-preserved hexaploid genome structure of C. sativa surprisingly mirrors those of economically important amphidiploid Brassica crop species from lineage II as well as wheat and cotton. The three genomes of C. sativa show no evidence of fractionation bias and limited expression-level bias, both characteristics commonly associated with polyploid evolution. The highly undifferentiated polyploid genome of C. sativa presents significant consequences for breeding and genetic manipulation of this industrial oil crop.

  15. Taraxacum officinale pollen depresses seed set of montane wildflowers through pollen allelopathy

    Directory of Open Access Journals (Sweden)

    Deirdre Loughnan

    2014-08-01

    Full Text Available Plant species that share pollinators can suffer from interspecific pollen deposition. Male reproductive success is inevitably reduced by the loss of pollen to flowers of another species. Female reproductive success can be affected by reduced stigmatic area or, more strongly, through allelopathic effects by which the admixture of some foreign pollen reduces seed or fruit set. We tested for allelopathic effects of Taraxacum officinale (Asteracaeae pollen on the seed set of montane wildflowers Erythronium grandiflorum (Liliaceae and Erysimum capitatum (Brassicaceae, by hand-pollinating plants with pollen mixtures. Taraxacum is a common invasive species, which produces allelopathic chemicals in its root and vegetative tissue, making it a likely candidate for pollen allelopathy. Flowers of both species produced fewer well-developed seeds when pollinated with pollen mixtures containing Taraxacum pollen. The pollen-allelopathic potential of weedy dandelion may add to its ability to disrupt communities that it invades.

  16. The invasive plant, Brassica nigra, degrades local mycorrhizas across a wide geographical landscape.

    Science.gov (United States)

    Pakpour, Sepideh; Klironomos, John

    2015-09-01

    Disruption of mycorrhizal fungi that form symbioses with local native plants is a strategy used by some invasive exotic plants for competing within their resident communities. Example invasive plants include Alliaria petiolata (garlic mustard) and Brassica nigra (black mustard), both non-mycorrhizal plants in the Family Brassicaceae. Although there is clear evidence for mycorrhizal degradation, it is not known if such an effect is widespread across the naturalized range. In this study, we tested the ability of black mustard to degrade the local mycorrhizal symbiosis and supress the growth of native flora from across a variety of locations where black mustard has invaded. We found that the effects on mycorrhizal fungi and on the growth of native plants were consistently negative at the various sites. The present results indicate that degradation of the mycorrhizal symbiosis by black mustard is of general significance, and may be highly problematic considering the large range that it has occupied in open fields across North America.

  17. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  18. Phenolic Compounds in Brassica Vegetables

    Directory of Open Access Journals (Sweden)

    Pablo Velasco

    2010-12-01

    Full Text Available Phenolic compounds are a large group of phytochemicals widespread in the plant kingdom. Depending on their structure they can be classified into simple phenols, phenolic acids, hydroxycinnamic acid derivatives and flavonoids. Phenolic compounds have received considerable attention for being potentially protective factors against cancer and heart diseases, in part because of their potent antioxidative properties and their ubiquity in a wide range of commonly consumed foods of plant origin. The Brassicaceae family includes a wide range of horticultural crops, some of them with economic significance and extensively used in the diet throughout the world. The phenolic composition of Brassica vegetables has been recently investigated and, nowadays, the profile of different Brassica species is well established. Here, we review the significance of phenolic compounds as a source of beneficial compounds for human health and the influence of environmental conditions and processing mechanisms on the phenolic composition of Brassica vegetables.

  19. Urinary diseases and ethnobotany among pastoral nomads in the Middle East

    Directory of Open Access Journals (Sweden)

    Abu-Rabia Aref

    2005-08-01

    Full Text Available Abstract This article is derived from a broad, twenty-year study of ethnobotany and folk medicine among pastoral nomads in the Middle East which took place from 1984 to 2004. The article presents examples of different treatments of diseases and disorders of the urinary tract carried out by healer herbalists. The preparation of remedies includes boiling infusions, extraction of dry or fresh leaves, flowers, seeds or whole plants. Some of these plants were used both as food and as medicine, by ingesting different parts of the plants, such as leaves, flowers, fruits, and so on, either while soft, cooked or dried. Data were collected by using unstructured interviews and by observation. These plants were identified by healers, patients, and university botanists. This paper identified eighty-five plant species, which belong to thirty-six families. The most representative families are: Asteraceae (8, Brassicaceae (6, Poaceae (6, Umbelliferae (6.

  20. Bunias orientalis L. as a natural overwintering host OF Turnip mosaic virus

    Directory of Open Access Journals (Sweden)

    Tadeusz Kobyłko

    2012-12-01

    Full Text Available A virus was isolated, using mechanical inoculation, from hill mustard (Bunias orientalis L. plants exhibiting yellow mottling and blistering on leaves, which were frequently accompanied by asymmetric leaf narrowing. It systemically infected certain plants from the family Brassicaceae (Brassica rapa, Bunias orientalis, Hesperis matronalis, Sinapis alba as well as Cleome spinosa and Nicotiana clevelandii, and locally Atriplex hortensis, Chenopodium quinoa, Ch. amaranticolor, N. tabacum. In the sap, it maintained infectivity for 3-4 days and lost it after heating for 10 min. at a temperature of 55 - 60oC or when diluted with water at 10-3. Virus particles were thread- like with a length of 675 - 710 nm. Based on an analysis of biological properties of the pathogen, serological response, particle morphology and data from field observations, it was identified as an isolate of Turnip mosaic virus (TuMV, and hill mustard was recognised as a natural overwintering host for this pathogen.

  1. Plant morphology and allometric relationships in competing and non-competing plants of Tagetes patula L.

    Directory of Open Access Journals (Sweden)

    Ingeborga Jarzyna

    2014-01-01

    Full Text Available Allometric relationships (defined as correlation coefficients between plant mass - stem diameter, plant mass - stem height and stem diameter - stem height in plants of Tagetes patula L. (Brassicaceae var. "Tangerine" were analyzed. Competing and non-competing plants were compared in a glasshouse experiment. Competing plants were grown in broad range of densities, from 200 to 6000 individuals • m-2. For non-competing plants no allometric relationships were observed, while for competing plants they were strong, irrespective of density treatment used. Gradual changes of plant morphology (plant mass, stem diameter, stem height and height/mass ratio with the increase of competition intensity were also analyzed.The present study clearly showed, that the intraspecific competition influenced allometric relationships between height, mass and stem diameter of Tagetes patula.

  2. Improving immunity in crops: new tactics in an old game.

    Science.gov (United States)

    Wulff, Brande B H; Horvath, Diana M; Ward, Eric R

    2011-08-01

    Crop disease remains a major cause of yield loss and emerging diseases pose new threats to global food security. Despite the dearth of commercial development to date, progress in using our rapidly expanding knowledge of plant-pathogen interactions to invent new ways of controlling diseases in crops has been good. Many major resistance genes have now been shown to retain function when transferred between species, and evidence indicates that resistance genes are more effective when deployed in a background containing quantitative resistance traits. The EFR pattern-recognition receptor, present in only the Brassicaceae, functions to provide bacterial disease control in the Solanaceae. Knowledge of how transcription activator-like effectors bind DNA is leading to new methods for triggering disease resistance and broader applications in genome engineering. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Migration of plant viruses: Time correlations with the agriculture history and human immigration.

    Science.gov (United States)

    Ohshima, Kazusato

    2015-01-01

    In this review, I made the phylodynamic comparisons of three plant viruses, Turnip mosaic virus (TuMV), Cauliflower mosaic virus (CaMV) and Cucumber mosaic virus (CMV), using the genomic sequences of a large numbers of isolates collected worldwide. We analyzed these genomic nucleotide sequences, in combination with published sequences, to estimate the timescale and rate of evolution of the individual genes of TuMV, CaMV and CMV. The main hosts of the viruses are Brassicaceae crops. We also compared these estimates from complete sequences with those from which non-synonymous and invariate codons had been removed. Our analyses provided a preliminary definition of the present geographical structure of three plant virus populations in the world, and showed that the time of migration of three plant viruses correlate well with agriculture history and human immigration.

  4. Defense and signalling metabolites of the crucifer Erucastrum canariense: Synchronized abiotic induction of phytoalexins and galacto-oxylipins.

    Science.gov (United States)

    Pedras, M Soledade C; To, Q Huy

    2017-07-01

    Erucastrum canariense Webb & Berthel. (Brassicaceae) is a wild crucifer that grows in rocky soils, in salt and water stressed habitats, namely in the Canary Islands and similar environments. Abiotic stress induced by copper chloride triggered formation of a phytoalexin and galacto-oxylipins in E. canariense, whereas wounding induced galacto-oxylipins but not phytoalexins. Analysis of the metabolite profiles of leaves of E. canariense followed by isolation and structure determination afforded the phytoalexin erucalexin, the phytoanticipin indolyl-3-acetonitrile, the galacto-oxylipins arabidopsides A, C, and D, and the oxylipin 12-oxophytodienoic acid. In addition, arabidopsides A and D were also identified in extracts of leaves of Nasturtium officinale R. Br. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Larval performance of the mustard leaf beetle (Phaedon cochleariae, Coleoptera, Chrysomelidae) on white mustard (Sinapis alba) and watercress (Nasturtium officinale) leaves in dependence of plant exposure to ultraviolet radiation.

    Science.gov (United States)

    Reifenrath, Kerstin; Müller, Caroline

    2009-07-01

    Short-term exposure to ambient or attenuated ultraviolet (UV) radiation resulted in shifts in plant metabolite concentrations of the Brassicaceae Sinapis alba and Nasturtium officinale. Leaf quality also varied between plant species and within species due to age. Larvae of the oligophagous leaf beetle Phaedon cochleariae were raised on these different host leaves, in order to investigate the effects of variable plant chemistry on this herbivore. The performance of P. cochleariae was influenced by chemical differences between and within plant species but it responded with high plasticity to plants stressed by ultraviolet radiation. Body mass increase and developmental times of larvae were exclusively affected by plant species and leaf-age. However, developmental differences were fully compensated in the pupal stage. We suggest that the plasticity of herbivores may depend on the degree of specialisation, and insect performance may not necessarily be altered by stress-induced host plants.

  6. Efficient expression of SRK intracellular domain by a modeling-based protein engineering.

    Science.gov (United States)

    Murase, Kohji; Hirano, Yoshinori; Takayama, Seiji; Hakoshima, Toshio

    2017-03-01

    S-locus protein kinase (SRK) is a receptor kinase that plays a critical role in self-recognition in the Brassicaceae self-incompatibility (SI) response. SRK is activated by binding of its ligand S-locus protein 11 (SP11) and subsequently induced phosphorylation of the intracellular kinase domain. However, a detailed activation mechanism of SRK is still largely unknown because of the difficulty in stably expressing SRK recombinant proteins. Here, we performed modeling-based protein engineering of the SRK kinase domain for stable expression in Escherichia coli. The engineered SRK intracellular domain was expressed about 54-fold higher production than wild type SRK, without loss of the kinase activity, suggesting it could be useful for further biochemical and structural studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Glyoxalase Goes Green: The Expanding Roles of Glyoxalase in Plants.

    Science.gov (United States)

    Sankaranarayanan, Subramanian; Jamshed, Muhammad; Kumar, Abhinandan; Skori, Logan; Scandola, Sabine; Wang, Tina; Spiegel, David; Samuel, Marcus A

    2017-04-24

    The ubiquitous glyoxalase enzymatic pathway is involved in the detoxification of methylglyoxal (MG), a cytotoxic byproduct of glycolysis. The glyoxalase system has been more extensively studied in animals versus plants. Plant glyoxalases have been primarily associated with stress responses and their overexpression is known to impart tolerance to various abiotic stresses. In plants, glyoxalases exist as multigene families, and new roles for glyoxalases in various developmental and signaling pathways have started to emerge. Glyoxalase-based MG detoxification has now been shown to be important for pollination responses. During self-incompatibility response in Brassicaceae, MG is required to target compatibility factors for proteasomal degradation, while accumulation of glyoxalase leads to MG detoxification and efficient pollination. In this review, we discuss the importance of glyoxalase systems and their emerging biological roles in plants.

  8. Sequence organization and putative regulatory elements in the 5S rRNA genes of two higher plants (Vigna radiata and Matthiola incana).

    Science.gov (United States)

    Hemleben, V; Werts, D

    1988-01-01

    The tandemly arranged and clustered highly repeated 5S rRNA genes are investigated for two plants belonging to different higher plant families: Matthiola incana (Brassicaceae, Dilleniidae, Rosidae; 3600 5S rRNA genes/n) shows a homogeneous repeat size of 510 bp, whereas Vigna radiata (mung bean, former Phaseolus aureus, Fabaceae, Rosidae; approx. 4300 5S rRNA genes) has a repeat size of 215 bp. The mung-bean 5S rRNA coding region starts 5' with AGG and ends with CCT; Matthiola starts with GGG and ends with CCC. Striking is the strict occurrence of a 'TATA' box starting at nucleotide-28 similar to Neurospora crassa 5S rRNA genes. The 3' end is followed by CTTTT or GTTT stretches present in different numbers in the non-transcribed spacer suggesting a function in termination.

  9. A using of biometric methods for the delineation of floral units on the plant

    Directory of Open Access Journals (Sweden)

    Viktoria E. Kharchenko

    2012-03-01

    Full Text Available On the base of the using of biometric analysis of linear dimensions of the leaves, stipules, bracts and bracteoles in the Brassicaceae (Arabidopsis thaliana, Matthiola longipetala, Lobularia maritime, Lamiaceae (Lamium purpureum, Salvia tesquicola and Boraginaceae (Cynoglossum offisinale, Echium vulgare, Nonea pulla, it has found that the linear dimensions of the leaves and bracts are changed in a similar pattern, which is different from the pattern of change of the stipules and bracteole. In this regard, the biometric analysis of the linear dimensions of the leaves on the shoot can be used as an additional criterion for establishing of the boundaries and composition of floral pieces, as well as for the homologation of shoot elements.

  10. Etude des groupements d'adventices dans le Maroc occidental

    Directory of Open Access Journals (Sweden)

    Douira, A.

    2010-01-01

    Full Text Available Study of the weeds groupings in western Morocco. An ecological floristic study was carried out in the principal areas of Morocco severely infested by the sterile oats. From 110 readings taken in cereals, the 324 listed species belong to 47 botanical families including 39 dicotyledons. Six families: Asteraceae, Fabaceae, Poaceae, Brassicaceae, Caryophyllaceae and Apiaceae add up 59% of the total staff complement alone. The biological aspect shows a prevalence of the therophytes with 80%, followed by the hemicryptophytes and the geophytes with respectively 11 and 7%. Mediterranean taxa are dominating with 62% of the total staff complement. The taking into account of the index partial of noxiousness made it possible to release 27 problematic species whose Avena sterilis, Phalaris paradoxa, Phalaris brachystachys, Scolymus maculates, Lolium multiflorum, Papaver rhoeas and Lolium rigidum are most harmful by far. The factorial analysis of correspondences (A.F.C., by the means of the edaphic variables, made it possible to highlight six ecological groups.

  11. Floristic study of Arjan-Parishan protected area in Fars province

    Directory of Open Access Journals (Sweden)

    Mehdi Dolatkhahi

    2012-03-01

    Full Text Available Arjan-Parishan protected area with two very beautiful Parishan and Arjan wetlands is situated in the 60 km west of Shiraz in Fars province which covers an area of 60000 hectares. In this study, the flora, life form and geographical features of the protected area were investigated. In this area, a total of 393 species including 3 pteridophyta, 2 gymnosperma, 337 dicotyledons and 56 monocotyledons were identified. They belonged to 81 families and 268 genera. The following families had the highest number of species: Asteraceae, Papilonaceae, Poaceae, Brassicaceae, Apiaceae,and Boraginaceae. The following genera had the highest number of species: Astragalus, Juncus, Convolvulus, Anthemis and Plantago. 230 species (58.52% were Irano-Turanian region. Therophytes with 215 species (54.70% was the most frequent life form of the protected area.

  12. Study of floristics, life form and chorology of plants in Shimbar protected area (Khuzestan province

    Directory of Open Access Journals (Sweden)

    Bahram Andarzian

    2015-03-01

    Full Text Available The Shimbar or Shirin Bahar region with an area of 53000 h is located in 45 km north east of Masjed Soleyman city, Andica town and north of Shahid Abaspour dam. The area belongs to the Zagrosian district of Irano-Turanian region. In three seasons, winter, spring and summer of 2012 to 2013, herbarium specimens of the area were collected and named by the Floras of Iran and neighboring countries. In this research, 189 species belonged to 149 genera and 51 families were determined. Most of the species belonged to Asteraceae with 23, Poaceae with 19, Lamiaceae and Papilionaceae with 18, Rosaceae with 10, Apiaceae with 9 and, Brassicaceae followed by the Caryophyllaceae each with 8 species. The life forms of the species in Shimbar included 13% phanerophytes, 6% chamephytes, 25% hemicryptophytes, 15% cryptophytes and 41% therophytes. The highest precent of the species belonged to the Irano-Turanian region.

  13. Effects of Pyriproxyfen on Life Table Indices of Plutella xylostella in Multigenerations

    Directory of Open Access Journals (Sweden)

    Mohammad Mahmoudvand

    2015-01-01

    Full Text Available The diamondback moth (DBM, Plutella xylostella (L. (Lepidoptera: Plutellidae, is a major pest of Brassicaceae family in Iran. This study investigated the sublethal effects of pyriproxyfen, a juvenile hormone analogue, on DBM, for two subsequent generations. The leaf dip bioassay method was adopted in conducting this experiment. Sublethal concentrations resulted in a significant decrease in fecundity, oviposition period, and pupal weight of parents and offspring generations. Also, the development time of DBM was prolonged after exposure to pyriproxyfen. The biological parameters such as net reproductive rate (R0 and intrinsic (rm and finite (λ rate of increase were lower than control in treatment groups, significantly. From our investigations, pyriproxyfen is a good choice for control of the diamondback moth population through continuous generations.

  14. Impact of the UPR on the virulence of the plant fungal pathogen A. brassicicola

    Science.gov (United States)

    Guillemette, Thomas; Calmes, Benoit; Simoneau, Philippe

    2014-01-01

    The fungal genus Alternaria contains many destructive plant pathogens, including Alternaria brassicicola, which causes black spot disease on a wide range of Brassicaceae plants and which is routinely used as a model necrotrophic pathogen in studies with Arabidopsis thaliana. During host infection, many fungal proteins that are critical for disease progression are processed in the endoplasmic reticulum (ER)/Golgi system and secreted in planta. The unfolded protein response (UPR) is an essential part of ER protein quality control that ensures efficient maturation of secreted and membrane-bound proteins in eukaryotes. This review highlights the importance of the UPR signaling pathway with respect to the ability of A. brassicicola to efficiently accomplish key steps of its pathogenic life cycle. Understanding the pathogenicity mechanisms that fungi uses during infection is crucial for the development of new antifungal therapies. Therefore the UPR pathway has emerged as a promising drug target for plant disease control. PMID:24189567

  15. Colorless chlorophyll catabolites in senescent florets of broccoli (Brassica oleracea var. italica).

    Science.gov (United States)

    Roiser, Matthias H; Müller, Thomas; Kräutler, Bernhard

    2015-02-11

    Typical postharvest storage of broccoli (Brassica oleracea var. italica) causes degreening of this common vegetable with visible loss of chlorophyll (Chl). As shown here, colorless Chl-catabolites are generated. In fresh extracts of degreening florets of broccoli, three colorless tetrapyrrolic Chl-catabolites accumulated and were detected by high performance liquid chromatography (HPLC): two "nonfluorescent" Chl-catabolites (NCCs), provisionally named Bo-NCC-1 and Bo-NCC-2, and a colorless 1,19-dioxobilin-type "nonfluorescent" Chl-catabolite (DNCC), named Bo-DNCC. Analysis by nuclear magnetic resonance spectroscopy and mass spectrometry of these three linear tetrapyrroles revealed their structures. In combination with a comparison of their HPL-chromatographic properties, this allowed their identification with three known catabolites from two other brassicacea, namely two NCCs from oil seed rape (Brassica napus) and a DNCC from degreened leaves of Arabidopsis thaliana.

  16. [Advances on Lepidii Semen and Descurainiae Semen].

    Science.gov (United States)

    Zhou, Xi-dan; Tang, Li-ying; Zhou, Guo-hong; Kou, Zhen-zhen; Wang, Ting; Wang, Zhu-ju

    2014-12-01

    "Tinglizi", the ripe seed of Descurainia sophia and Lepidium apetalum, is a member of Brassicaceae (Cruciferae). Traditionally, the former is called "Nantinglizi" (Descurainiae Semen) while the latter is called "Beitinglizi" (Lepidii Semen). In the theory of traditional Chinese medicine, it has the power to purge lung-fire, relieve dyspnea, promote diuresis and reduce edema, and it is mainly indicated in a case with phlegm-fluid accumulation, cough with excessive sputum, dyspnea with being unable to lie, and general swelling. In view of its wide-spread application in clinic, a comprehensive review of Lepidii Semen and Descurainiae Semen was conducted from the following aspects: herbalogical study, variety identification, historical evolution of processing, chemical constituents, pharmacological effects, quantitative determination and toxicity which could provide reference for further research and development of "Tinglizi".

  17. De novo transcriptome analysis in radish (Raphanus sativus L.) and identification of critical genes involved in bolting and flowering.

    Science.gov (United States)

    Nie, Shanshan; Li, Chao; Xu, Liang; Wang, Yan; Huang, Danqiong; Muleke, Everlyne M; Sun, Xiaochuan; Xie, Yang; Liu, Liwang

    2016-05-23

    The appropriate timing of bolting and flowering is pivotal for reproductive success in Brassicaceae crops including radish (Raphanus sativus L.). Although several flowering regulatory pathways had been described in some plant species, no study on genetic networks of bolting and flowering regulation was performed in radish. In this study, to generate dataset of radish unigene sequences for large-scale gene discovery and functional pathway identification, a cDNA library from mixed radish leaves at different developmental stages was subjected to high-throughput RNA sequencing (RNA-seq). A total of 54.64 million clean reads and 111,167 contigs representing 53,642 unigenes were obtained from the radish leaf transcriptome. Among these, 50,385 unigenes were successfully annotated by BLAST searching against the public protein databases. Functional classification and annotation indicated that 42,903 and 15,382 unique sequences were assigned to 55 GO terms and 25 COG categories, respectively. KEGG pathway analysis revealed that 25,973 unigenes were classified into 128 functional pathways, among which 24 candidate genes related to plant circadian rhythm were identified. Moreover, 142 potential bolting and flowering-related genes involved in various flowering pathways were identified. In addition, seven critical bolting and flowering-related genes were isolated and profiled by T-A cloning and RT-qPCR analysis. Finally, a schematic network model of bolting and flowering regulation and pathways was put forward in radish. This study is the first report on systematic identification of bolting and flowering-related genes based on transcriptome sequencing and assembly in radish. These results could provide a foundation for further investigating bolting and flowering regulatory networks in radish, and facilitate dissecting molecular genetic mechanisms underlying bolting and flowering in Brassicaceae vegetable crops.

  18. De novo assembly and characterization of the complete chloroplast genome of radish (Raphanus sativus L.).

    Science.gov (United States)

    Jeong, Young-Min; Chung, Won-Hyung; Mun, Jeong-Hwan; Kim, Namshin; Yu, Hee-Ju

    2014-11-01

    Radish (Raphanus sativus L.) is an edible root vegetable crop that is cultivated worldwide and whose genome has been sequenced. Here we report the complete nucleotide sequence of the radish cultivar WK10039 chloroplast (cp) genome, along with a de novo assembly strategy using whole genome shotgun sequence reads obtained by next generation sequencing. The radish cp genome is 153,368 bp in length and has a typical quadripartite structure, composed of a pair of inverted repeat regions (26,217 bp each), a large single copy region (83,170 bp), and a small single copy region (17,764 bp). The radish cp genome contains 87 predicted protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence analysis revealed the presence of 91 simple sequence repeats (SSRs) in the radish cp genome. Phylogenetic analysis of 62 protein-coding gene sequences from the 17 cp genomes of the Brassicaceae family suggested that the radish cp genome is most closely related to the cp genomes of Brassica rapa and Brassicanapus. Comparisons with the B. rapa and B. napus cp genomes revealed highly divergent intergenic sequences and introns that can potentially be developed as diagnostic cp markers. Synonymous and nonsynonymous substitutions of cp genes suggested that nucleotide substitutions have occurred at similar rates in most genes. The complete sequence of the radish cp genome would serve as a valuable resource for the development of new molecular markers and the study of the phylogenetic relationships of Raphanus species in the Brassicaceae family. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A comprehensive set of transcript sequences of the heavy metal hyperaccumulator Noccaea caerulescens

    Directory of Open Access Journals (Sweden)

    YA-FEN eLIN

    2014-06-01

    Full Text Available Noccaea caerulescens is an extremophile plant species belonging to the Brassicaceae family. It has adapted to grow on soils containing high, normally toxic, concentrations of metals such as nickel, zinc and cadmium. Next to being extremely tolerant to these metals, it is one of the few species known to hyperaccumulate these metals to extremely high concentrations in their aboveground biomass. In order to provide additional molecular resources for this model metal hyperaccumulator species to study and understand the mechanism of heavy metal exposure adaptation, we aimed to provide a comprehensive database of transcript sequences for N. caerulescens. In this study, 23830 transcript sequences (isotigs with an average length of 1025 bps were determined for roots, shoots and inflorescences of N. caerulescens accession ‘Ganges’ by Roche GS-FLEX 454 pyrosequencing. These isotigs were grouped into 20,378 isogroups, representing potential genes. This is a large expansion of the existing N. caerulescens transcriptome set consisting of 3705 unigenes. When compared to a Brassicaceae proteome set, 22,232 (93.2% of the N. caerulescens isotigs (corresponding to 19191 isogroups had a significant match and could be annotated accordingly. Of the remaining sequences, 98 isotigs resembled non-plant sequences and 1386 had no significant similarity to any sequence in the GenBank database. Among the annotated set there were many isotigs with similarity to metal homeostasis genes or genes for glucosinolate biosynthesis. Only for transcripts similar to Metallothionein3 (MT3, clear evidence for an additional copy was found. This comprehensive set of transcripts is expected to further contribute to the discovery of mechanisms used by N. caerulescens to adapt to heavy metal exposure.

  20. Novel bioresources for studies of Brassica oleracea: identification of a kale MYB transcription factor responsible for glucosinolate production.

    Science.gov (United States)

    Araki, Ryoichi; Hasumi, Akiko; Nishizawa, Osamu Ishizaki; Sasaki, Katsunori; Kuwahara, Ayuko; Sawada, Yuji; Totoki, Yasushi; Toyoda, Atsushi; Sakaki, Yoshiyuki; Li, Yimeng; Saito, Kazuki; Ogawa, Toshiya; Hirai, Masami Yokota

    2013-10-01

    Plants belonging to the Brassicaceae family exhibit species-specific profiles of glucosinolates (GSLs), a class of defence compounds against pathogens and insects. GSLs also exhibit various human health-promoting properties. Among them, glucoraphanin (aliphatic 4-methylsulphinylbutyl GSL) has attracted the most attention because it hydrolyses to form a potent anticancer compound. Increased interest in developing commercial varieties of Brassicaceae crops with desirable GSL profiles has led to attempts to identify genes that are potentially valuable for controlling GSL biosynthesis. However, little attention has been focused on genes of kale (Brassica oleracea var. acephala). In this study, we established full-length kale cDNA libraries containing 59 904 clones, which were used to generate an expressed sequence tag (EST) data set with 119 204 entries. The EST data set clarified genes related to the GSL biosynthesis pathway in kale. We specifically focused on BoMYB29, a homolog of Arabidopsis MYB29/PMG2/HAG3, not only to characterize its function but also to demonstrate its usability as a biological resource. BoMYB29 overexpression in wild-type Arabidopsis enhanced the expression of aliphatic GSL biosynthetic genes and the accumulation of aliphatic GSLs. When expressed in the myb28myb29 mutant, which exhibited no detectable aliphatic GSLs, BoMYB29 restored the expression of biosynthetic genes and aliphatic GSL accumulation. Interestingly, the ratio of methylsulphinyl GSL content, including glucoraphanin, to that of methylthio GSLs was greatly increased, indicating the suitability of BoMYB29 as a regulator for increasing methylsulphinyl GSL content. Our results indicate that these biological resources can facilitate further identification of genes useful for modifications of GSL profiles and accumulation in kale. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Glucosinolates profile, volatile constituents, antimicrobial, and cytotoxic activities of Lobularia libyca.

    Science.gov (United States)

    Al-Gendy, Amal A; Nematallah, Khaled A; Zaghloul, Soumaya S; Ayoub, Nahla A

    2016-12-01

    Brassicaceae plants are associated with protection against cancers due to their glucosinolate contents. We investigate fresh leaves, roots and ripe seeds of Lobularia libyca (Viv.) C.F.W. Meissn. (Brassicaceae) to identify their glucosinolate constituents, antimicrobial and cytotoxic activities Materials and methods: The glucosinolates were identified using GC-MS analysis of their hydrolysis products and LC-MS analysis in the case of seeds. Disc diffusion (1 mg/disc) and minimum inhibitory concentration (0-160 μg/mL) methods were used to evaluate the antimicrobial activity of seed hydrolysate. In vitro cytotoxicity against colorectal HCT-116, hepatic HUH-7, breast MCF-7 and lung A-549 cells was evaluated for seed hydrolysate (0.01-100 μg/mL) using the sulforhodamine B assay and doxorubicin as a standard Results: Three glucosinolates were identified for the first time in this plant and genus Lobularia. Glucoiberverin was the major compound accumulated in the seeds and leaves, while glucoiberin and glucoerucin were detected only in the seeds. No glucosinolates were detected in roots under the same experimental conditions. Other volatile constituents, e.g., terpenes and fatty acids were only identified in the seeds. The seed hydrolysate showed significant antimicrobial activities against Candida albicans and Pseudomonas aeruoginosa (MIC = 64 and 82 μg/mL, respectively). The seed hydrolysate exhibited a marked selective cytotoxicity in vitro against colorectal, hepatic and breast cancer cell lines. The IC50 values were 0.31, 2.25 and 37 μg/mL, respectively. The results indicated the antimicrobial activity of L. libyca and the selective effect of the seed hydrolysate as a cytotoxic drug that is potentially more active than doxorubicin against HCT-116.

  2. Insights from ANA-grade angiosperms into the early evolution of CUP-SHAPED COTYLEDON genes

    Science.gov (United States)

    Vialette-Guiraud, Aurélie C. M.; Adam, Hélène; Finet, Cédric; Jasinski, Sophie; Jouannic, Stefan; Scutt, Charles P.

    2011-01-01

    Background and Aims The closely related NAC family genes NO APICAL MERISTEM (NAM) and CUP-SHAPED COTYLEDON3 (CUC3) regulate the formation of boundaries within and between plant organs. NAM is post-transcriptionally regulated by miR164, whereas CUC3 is not. To gain insight into the evolution of NAM and CUC3 in the angiosperms, we analysed orthologous genes in early-diverging ANA-grade angiosperms and gymnosperms. Methods We obtained NAM- and CUC3-like sequences from diverse angiosperms and gymnosperms by a combination of reverse transcriptase PCR, cDNA library screening and database searching, and then investigated their phylogenetic relationships by performing maximum-likelihood reconstructions. We also studied the spatial expression patterns of NAM, CUC3 and MIR164 orthologues in female reproductive tissues of Amborella trichopoda, the probable sister to all other flowering plants. Key Results Separate NAM and CUC3 orthologues were found in early-diverging angiosperms, but not in gymnosperms, which contained putative orthologues of the entire NAM + CUC3 clade that possessed sites of regulation by miR164. Multiple paralogues of NAM or CUC3 genes were noted in certain taxa, including Brassicaceae. Expression of NAM, CUC3 and MIR164 orthologues from Am. trichopoda was found to co-localize in ovules at the developmental boundary between the chalaza and nucellus. Conclusions The NAM and CUC3 lineages were generated by duplication, and CUC3 was subsequently lost regulation by miR164, prior to the last common ancestor of the extant angiosperms. However, the paralogous NAM clade genes CUC1 and CUC2 were generated by a more recent duplication, near the base of Brassicaceae. The function of NAM and CUC3 in defining a developmental boundary in the ovule appears to have been conserved since the last common ancestor of the flowering plants, as does the post-transcriptional regulation in ovule tissues of NAM by miR164. PMID:21320879

  3. Insights from ANA-grade angiosperms into the early evolution of CUP-SHAPED COTYLEDON genes.

    Science.gov (United States)

    Vialette-Guiraud, Aurélie C M; Adam, Hélène; Finet, Cédric; Jasinski, Sophie; Jouannic, Stefan; Scutt, Charles P

    2011-06-01

    The closely related NAC family genes NO APICAL MERISTEM (NAM) and CUP-SHAPED COTYLEDON3 (CUC3) regulate the formation of boundaries within and between plant organs. NAM is post-transcriptionally regulated by miR164, whereas CUC3 is not. To gain insight into the evolution of NAM and CUC3 in the angiosperms, we analysed orthologous genes in early-diverging ANA-grade angiosperms and gymnosperms. We obtained NAM- and CUC3-like sequences from diverse angiosperms and gymnosperms by a combination of reverse transcriptase PCR, cDNA library screening and database searching, and then investigated their phylogenetic relationships by performing maximum-likelihood reconstructions. We also studied the spatial expression patterns of NAM, CUC3 and MIR164 orthologues in female reproductive tissues of Amborella trichopoda, the probable sister to all other flowering plants. Separate NAM and CUC3 orthologues were found in early-diverging angiosperms, but not in gymnosperms, which contained putative orthologues of the entire NAM + CUC3 clade that possessed sites of regulation by miR164. Multiple paralogues of NAM or CUC3 genes were noted in certain taxa, including Brassicaceae. Expression of NAM, CUC3 and MIR164 orthologues from Am. trichopoda was found to co-localize in ovules at the developmental boundary between the chalaza and nucellus. The NAM and CUC3 lineages were generated by duplication, and CUC3 was subsequently lost regulation by miR164, prior to the last common ancestor of the extant angiosperms. However, the paralogous NAM clade genes CUC1 and CUC2 were generated by a more recent duplication, near the base of Brassicaceae. The function of NAM and CUC3 in defining a developmental boundary in the ovule appears to have been conserved since the last common ancestor of the flowering plants, as does the post-transcriptional regulation in ovule tissues of NAM by miR164.

  4. Home gardening near a mining site in an arsenic-endemic region of Arizona: assessing arsenic exposure dose and risk via ingestion of home garden vegetables, soils, and water.

    Science.gov (United States)

    Ramirez-Andreotta, Monica D; Brusseau, Mark L; Beamer, Paloma; Maier, Raina M

    2013-06-01

    The human-health risk posed by gardening near a legacy mine and smelter in an arsenic-endemic region of Arizona was characterized in this study. Residential soils were used in a greenhouse study to grow common vegetables, and local residents, after training, collected soil, water, and vegetables samples from their home gardens. Concentrations of arsenic measured in water, soil, and vegetable samples were used in conjunction with reported US intake rates to calculate the daily dose, Incremental Excess Lifetime Cancer Risk (IELCR), and Hazard Quotient for arsenic. Relative arsenic intake dose decreased in order: water>garden soils>homegrown vegetables, and on average, each accounted for 77, 16, and 7% of a residential gardener's daily arsenic intake dose. The IELCR ranges for vegetables, garden soils, and water were 10(-8) to 10(-4), 10(-6) to 10(-4), and 10(-5) to 10(-2), respectively. All vegetables (greenhouse and home garden) were grouped by scientific family, and the risk posed decreased as: Asteraceae≫Fabaceae>Amaranthaceae>Liliaceae>Brassicaceae>Solanaceae≫Cucurbitaceae. Correlations observed between concentrations of arsenic in vegetables and soils were used to estimate a maximum allowable level of arsenic in soil to limit the excess cancer risk to 10(-6). The estimated values are 1.56 mg kg(-1), 5.39 mg kg(-1), 11.6 mg kg(-1) and 12.4 mg kg(-1) for the Asteraceae, Brassicaceae, Fabaceae, and Amaranthaceae families, respectively. It is recommended that home gardeners: sample their private wells annually, test their soils prior to gardening, and, if necessary, modify their gardening behavior to reduce incidental soil ingestion. This study highlights the importance of site-specific risk assessment, and the need for species-specific planting guidelines for communities. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. The C-terminal extension peptide of non-photoconvertible water-soluble chlorophyll-binding proteins (Class II WSCPs) affects their solubility and stability: comparative analyses of the biochemical and chlorophyll-binding properties of recombinant Brassica, Raphanus and Lepidium WSCPs with or without their C-terminal extension peptides.

    Science.gov (United States)

    Takahashi, Shigekazu; Uchida, Akira; Nakayama, Katsumi; Satoh, Hiroyuki

    2014-02-01

    Numerous members of the Brassicaceae possess non-photoconvertible water-soluble chlorophyll (Chl)-binding proteins (Class II WSCPs), which function as Chl scavengers during cell disruption caused by wounding, pest/pathogen attacks, and/or environmental stress. Class II WSCPs have two extension peptides, one at the N-terminus and one at the C-terminus. The N-terminal peptide acts as a signal peptide, targeting the protein to the endoplasmic reticulum body, a unique defensive organelle found only in the Brassicaceae. However, the physiological and biochemical functions of the C-terminal extension peptide had not been characterized previously. To investigate the function of the C-terminal extension peptide, we produced expression constructs of recombinant WSCPs with or without the C-terminal extension peptide. The WSCPs used were of Brussels sprouts (Brassica oleracea), Japanese wild radish (Raphanus sativus) and Virginia pepperweed (Lepidium virginicum). The solubility of all of the WSCPs with the C-terminal extension peptide was drastically lower than that of the recombinant WSCPs without the C-terminal extension peptide. In addition, the stability of the reconstituted WSCPs complexes with the C-terminal extension peptide was altered compared with that of the proteins without the C-terminal extension peptide. These finding indicate that the C-terminal extension peptide affects not only the solubility, but also the stability of Class II WSCP. Furthermore, we characterized the Chl-binding properties of the recombinant WSCP from Japanese wild radish (RshWSCP-His) in a 40 % methanol solution. An electrophoretic mobility shift assay revealed that RshWSCP-His required a half-molar ratio of Chls to form a tetramer.

  6. Plant infection by two different viruses induce contrasting changes of vectors fitness and behavior.

    Science.gov (United States)

    Chesnais, Quentin; Couty, Aude; Uzest, Maryline; Brault, Véronique; Ameline, Arnaud

    2017-07-21

    Insect-vectored plant viruses can induce changes in plant phenotypes, thus influencing plant-vector interactions in a way that may promote their dispersal according to their mode of transmission (i.e., circulative vs. noncirculative). This indirect vector manipulation requires host-virus-vector coevolution and would thus be effective solely in very specific plant-virus-vector species associations. Some studies suggest this manipulation may depend on multiple factors relative to various intrinsic characteristics of vectors such as transmission efficiency. In anintegrative study, we tested the effects of infection of the Brassicaceae Camelina sativa with the noncirculative Cauliflower mosaic virus (CaMV) or the circulative Turnip yellows virus (TuYV) on the host-plant colonization of two aphid species differing in their virus transmission efficiency: the polyphagous Myzus persicae, efficient vector of both viruses, and the Brassicaceae specialist Brevicoryne brassicae, poor vector of TuYV and efficient vector of CaMV. Results confirmed the important role of virus mode of transmission as plant-mediated effects of CaMV on the two aphid species induced negative alterations of feeding behavior (i.e., decreased phloem sap ingestion) and performance that were both conducive for virus fitness by promoting dispersion after a rapid acquisition. In addition, virus transmission efficiency may also play a role in vector manipulation by viruses as only the responses of the efficient vector to plant-mediated effects of TuYV, that is, enhanced feeding behavior and performances, were favorable to their acquisition and further dispersal. Altogether, this work demonstrated that vector transmission efficiency also has to be considered when studying the mechanisms underlying vector manipulation by viruses. Our results also reinforce the idea that vector manipulation requires coevolution between plant, virus and vector. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  7. Home Gardening Near a Mining Site in an Arsenic-Endemic Region of Arizona: Assessing Arsenic Exposure Dose and Risk via Ingestion of Home Garden Vegetables, Soils, and Water

    Science.gov (United States)

    Ramirez-Andreotta, Monica D.; Brusseau, Mark L.; Beamer, Paloma; Maier, Raina M.

    2013-01-01

    The human-health risk posed by gardening near the Iron King Mine and Humboldt Smelter Superfund Site in Arizona was characterized in this study. Residential soils were used in a greenhouse study to grow common household vegetables, and local residents, after training, collected soil, water, and vegetables samples from their household gardens. Concentrations of arsenic measured in water, soil, and vegetable samples were used in conjunction with reported US intake rates to calculate the daily dose, Incremental Excess Lifetime Cancer Risk (IELCR), and Hazard Quotient for arsenic. Relative arsenic intake dose decreased in order: water > garden soils > homegrown vegetables, and on average, each accounted for 77, 16, and 7% of a residential gardener’s daily arsenic intake dose. The IELCR ranges for vegetables, garden soils, and water were 10−8 to 10−4, 10−6 to 10−4, and 10−5 to 10−2, respectively. All vegetables (greenhouse and home garden) were grouped by scientific family, and the risk posed decreased as: Asteraceae >> Fabaceae > Amaranthaceae > Liliaceae > Brassicaceae > Solanaceae >> Cucurbitaceae. Correlations observed between concentrations of arsenic in vegetables and soils were used to estimate a maximum allowable level of arsenic in soil to limit the excess cancer risk to 10−6. The estimated values are 1.56 mg kg−1, 5.39 mg kg−1, 11.6 mg kg−1 and 12.4 mg kg−1 for the Asteraceae, Brassicaceae, Fabaceae, and Amaranthaceae families, respectively. It is recommended that home gardeners: sample their private wells annually, test their soils prior to gardening, and, if necessary, modify their gardening behavior to reduce incidental soil ingestion. This study highlights the importance of site-specific risk assessment, and the need for species-specific planting guidelines for communities. PMID:23562690

  8. Bioinformatics Reveal Five Lineages of Oleosins and the Mechanism of Lineage Evolution Related to Structure/Function from Green Algae to Seed Plants1[OPEN

    Science.gov (United States)

    Huang, Ming-Der; Huang, Anthony H.C.

    2015-01-01

    Plant cells contain subcellular lipid droplets with a triacylglycerol matrix enclosed by a layer of phospholipids and the small structural protein oleosin. Oleosins possess a conserved central hydrophobic hairpin of approximately 72 residues penetrating into the lipid droplet matrix and amphipathic amino- and carboxyl (C)-terminal peptides lying on the phospholipid surface. Bioinformatics of 1,000 oleosins of green algae and all plants emphasizing biological implications reveal five oleosin lineages: primitive (in green algae, mosses, and ferns), universal (U; all land plants), and three in specific organs or phylogenetic groups, termed seed low-molecular-weight (SL; seed plants), seed high-molecular-weight (SH; angiosperms), and tapetum (T; Brassicaceae) oleosins. Transition from one lineage to the next is depicted from lineage intermediates at junctions of phylogeny and organ distributions. Within a species, each lineage, except the T oleosin lineage, has one to four genes per haploid genome, only approximately two of which are active. Primitive oleosins already possess all the general characteristics of oleosins. U oleosins have C-terminal sequences as highly conserved as the hairpin sequences; thus, U oleosins including their C-terminal peptide exert indispensable, unknown functions. SL and SH oleosin transcripts in seeds are in an approximately 1:1 ratio, which suggests the occurrence of SL-SH oleosin dimers/multimers. T oleosins in Brassicaceae are encoded by rapidly evolved multitandem genes for alkane storage and transfer. Overall, oleosins have evolved to retain conserved hairpin structures but diversified for unique structures and functions in specific cells and plant families. Also, our studies reveal oleosin in avocado (Persea americana) mesocarp and no acyltransferase/lipase motifs in most oleosins. PMID:26232488

  9. Bioinformatics Reveal Five Lineages of Oleosins and the Mechanism of Lineage Evolution Related to Structure/Function from Green Algae to Seed Plants.

    Science.gov (United States)

    Huang, Ming-Der; Huang, Anthony H C

    2015-09-01

    Plant cells contain subcellular lipid droplets with a triacylglycerol matrix enclosed by a layer of phospholipids and the small structural protein oleosin. Oleosins possess a conserved central hydrophobic hairpin of approximately 72 residues penetrating into the lipid droplet matrix and amphipathic amino- and carboxyl (C)-terminal peptides lying on the phospholipid surface. Bioinformatics of 1,000 oleosins of green algae and all plants emphasizing biological implications reveal five oleosin lineages: primitive (in green algae, mosses, and ferns), universal (U; all land plants), and three in specific organs or phylogenetic groups, termed seed low-molecular-weight (SL; seed plants), seed high-molecular-weight (SH; angiosperms), and tapetum (T; Brassicaceae) oleosins. Transition from one lineage to the next is depicted from lineage intermediates at junctions of phylogeny and organ distributions. Within a species, each lineage, except the T oleosin lineage, has one to four genes per haploid genome, only approximately two of which are active. Primitive oleosins already possess all the general characteristics of oleosins. U oleosins have C-terminal sequences as highly conserved as the hairpin sequences; thus, U oleosins including their C-terminal peptide exert indispensable, unknown functions. SL and SH oleosin transcripts in seeds are in an approximately 1:1 ratio, which suggests the occurrence of SL-SH oleosin dimers/multimers. T oleosins in Brassicaceae are encoded by rapidly evolved multitandem genes for alkane storage and transfer. Overall, oleosins have evolved to retain conserved hairpin structures but diversified for unique structures and functions in specific cells and plant families. Also, our studies reveal oleosin in avocado (Persea americana) mesocarp and no acyltransferase/lipase motifs in most oleosins. © 2015 American Society of Plant Biologists. All Rights Reserved.

  10. Identification of shared single copy nuclear genes in Arabidopsis, Populus, Vitis and Oryza and their phylogenetic utility across various taxonomic levels

    Directory of Open Access Journals (Sweden)

    Ma Hong

    2010-02-01

    Full Text Available Abstract Background Although the overwhelming majority of genes found in angiosperms are members of gene families, and both gene- and genome-duplication are pervasive forces in plant genomes, some genes are sufficiently distinct from all other genes in a genome that they can be operationally defined as 'single copy'. Using the gene clustering algorithm MCL-tribe, we have identified a set of 959 single copy genes that are shared single copy genes in the genomes of Arabidopsis thaliana, Populus trichocarpa, Vitis vinifera and Oryza sativa. To characterize these genes, we have performed a number of analyses examining GO annotations, coding sequence length, number of exons, number of domains, presence in distant lineages, such as Selaginella and Physcomitrella, and phylogenetic analysis to estimate copy number in other seed plants and to demonstrate their phylogenetic utility. We then provide examples of how these genes may be used in phylogenetic analyses to reconstruct organismal history, both by using extant coverage in EST databases for seed plants and de novo amplification via RT-PCR in the family Brassicaceae. Results There are 959 single copy nuclear genes shared in Arabidopsis, Populus, Vitis and Oryza ["APVO SSC genes"]. The majority of these genes are also present in the Selaginella and Physcomitrella genomes. Public EST sets for 197 species suggest that most of these genes are present across a diverse collection of seed plants, and appear to exist as single or very low copy genes, though exceptions are seen in recently polyploid taxa and in lineages where there is significant evidence for a shared large-scale duplication event. Genes encoding proteins localized in organelles are more commonly single copy than expected by chance, but the evolutionary forces responsible for this bias are unknown. Regardless of the evolutionary mechanisms responsible for the large number of shared single copy genes in diverse flowering plant lineages, these

  11. An ethnomedicinal survey and documentation of important medicinal folklore food phytonims of flora of Samahni valley, (Azad Kashmir) Pakistan.

    Science.gov (United States)

    Ishtiaq, Muhammad; Hanif, Wajahat; Khan, M A; Ashraf, M; Butt, Ansar M

    2007-07-01

    ; Veronica anthelmintica for bandage of broken bones and Withania coagulans is used to treat small pox. Many wild plants are eaten green and raw as salad, or in boiled form of soup as blood and intestine cleansing tonics. Moreover, some plants are spiritually recorded as sacred and used as ritual plant for good omens or against the evil eye and removal of giant. About 95 species of 38 families were recorded to be important part of phyto heritage of folk pharmacopoeia of Samahni valley. Among most frequent used families are Papilionaceae 9.47%, Solanaceae and Poaceae 8.42% each, Cucurbitaceae 7.36% and Brassicaceae and Rosaceae 6.31% each. Among the surveyed families used to treat various diseases, Solanaceae is at first rank with 9.74%, Brassicaceae 8.23% and Cucurbitaceae 7.39% subsequently. Most commonly used families with highest percentage of plants used as food medicines are Solanaceae (11.37%), Brassicaceae (8.38%) and Papilionaceae (7.18%) respectively. Most frequent plant parts used are; roots, leaves, seeds and flowers while popular forms of plants uses are decoction, poultice, infusions, soups and raw form as salad. Importance of ethnobotanical inventory constructed from ethnomedicinal uses and folklore phytonims of flora in perspectives of initiative for future phytochemical and pharmacological research on these taxa to develop and discover of new drugs is present and discussed.

  12. Ocorrência de formas aladas de pulgões e sua relação com fatores meteorológicos e plantas hospedeiras Occurrence of alate aphids and their relationship with meteorological factors and host plants

    Directory of Open Access Journals (Sweden)

    Francisco Jorge Cividanes

    2010-01-01

    Full Text Available O objetivo deste trabalho foi determinar o padrão de revoadas e a influência de fatores meteorológicos e de Brassicaceae sobre populações de formas aladas dos pulgões Brevicoryne brassicae, Lipaphis erysimi e Myzus persicae. Os pulgões foram amostrados em armadilhas tipo bandeja amarela com água, entre julho de 1997 e agosto de 2005. A correlação parcial de Pearson foi utilizada para verificar a influência da temperatura do ar, umidade relativa, chuva e insolação na abundância de alados das três espécies. A influência de brassicáceas foi avaliada pelo cálculo do número de graus-dia acumulados acima da temperatura base inferior dessas plantas. Lipaphis erysimi foi mais numerosa que M. persicae e B. brassicae. Os alados de B. brassicae apresentaram revoadas que predominaram de agosto a outubro, com o pico de abundância em setembro. Os períodos de revoada de L. erysimi e M. persicae foram mais longos que o de B. brassicae, com os maiores picos de L. erysimi e M. persicae observados de abril a novembro e de junho a outubro, respectivamente. A população de B. brassicae teve correlação significativa com as temperaturas máxima e mínima, insolação e umidade relativa do ar, enquanto L. erysimi e M. persicae foram afetadas apenas pela insolação e umidade relativa.The objective of this work was to determine the flight patterns and the influence of meteorological factors and Brassicaceae on the populations of the alate aphids Brevicoryne brassicae, Lipaphis erysimi and Myzus persicae. The alate aphids were sampled using yellow water traps between July of 1997 and August of 2005. The Pearson partial correlation was used to determine the influence of air temperature, relative humidity, rainfall and insolation on the abundance of alate. The influence of Brassicaceae was assessed by accumulated degree-days above the temperature threshold of these plants. Lipaphis erysimi was more abundant than M. persicae and B. brassicae. The

  13. Implications of metal accumulation mechanisms to phytoremediation.

    Science.gov (United States)

    Memon, Abdul R; Schröder, Peter

    2009-03-01

    example, glutathione (GSH), a precursor of phytochelatin synthesis, plays a key role not only in metal detoxification but also in protecting plant cells from other environmental stresses including intrinsic oxidative stress reactions. In the last decade, tremendous developments in molecular biology and success of genomics have highly encouraged studies in molecular genetics, mainly transcriptomics, to identify functional genes implied in metal tolerance in plants, largely belonging to the metal homeostasis network. Analyzing the genetics of metal accumulation in these accumulator plants has been greatly enhanced through the wealth of tools and the resources developed for the study of the model plant Arabidopsis thaliana such as transcript profiling platforms, protein and metabolite profiling, tools depending on RNA interference (RNAi), and collections of insertion line mutants. To understand the genetics of metal accumulation and adaptation, the vast arsenal of resources developed in A. thaliana could be extended to one of its closest relatives that display the highest level of adaptation to high metal environments such as A. halleri and T. caerulescens. This review paper deals with the mechanisms of heavy metal accumulation and tolerance in plants. Detailed information has been provided for metal transporters, metal chelation, and oxidative stress in metal-tolerant plants. Advances in phytoremediation technologies and the importance of metal accumulator plants and strategies for exploring these immense and valuable genetic and biological resources for phytoremediation are discussed. A number of species within the Brassicaceae family have been identified as metal accumulators. To understand fully the genetics of metal accumulation, the vast genetic resources developed in A. thaliana must be extended to other metal accumulator species that display traits absent in this model species. A. thaliana microarray chips could be used to identify differentially expressed genes in

  14. Floración de las especies de interés apícola en el noroeste de Santa Cruz, Argentina Flowering of species with apicultural importance in the northwest of Santa Cruz, Argentina

    Directory of Open Access Journals (Sweden)

    Alicia Forcone

    2009-12-01

    Full Text Available Con el propósito de relevar la disponibilidad de fuentes de néctar y polen en el noroeste de Santa Cruz se siguió la fenología de floración de 113 especies del valle de Los Antiguos. Las plantas relevadas pertenecen a 36 familias, de ellas, las más representadas en la oferta de floración fueron Asteraceae, Fabaceae, Brassicaceae y Rosaceae. Del total de especies relevadas, 47 son nativas, 40 naturalizadas y 26 cultivadas. El pico máximo en la oferta de floración se registró a fin de noviembre y principios de diciembre con el mayor número de especies en floración plena. Las plantas introducidas dominaron las floraciones durante la mayor parte del período apícola, con excepción de la segunda quincena de octubre y el mes de noviembre en que predominaron las nativas. Se registraron 32 especies muy visitadas por Apis mellifera L., tres de ellas pertenecen a la flora característica de la estepa: Mulinum spinosum (Cav. Pers., Phacelia secunda J. F. Gmel. y Schinus marchandii F. A. Barkley.With the aim of surveying the availability of sources of nectar and pollen in the northwest of Santa Cruz, the flowering phenology of 113 species from Los Antiguos Valley was recorded. The plants studied belonged to 36 families, from which the most represented in the flowering offer were Asteraceae, Fabaceae, Brassicaceae and Rosaceae. Of the total species surveyed, 47 are native, 40, naturalized and 26 cultivated. Peak flowering was registered at the end of November and beginnings of December with the maximum number of species in full flowering. Introduced plants dominated the flowerings during most of the apicultural period, except in the second half of October and during November, when native plants prevailed. Thirty-two species frequently visited by Apis mellifera L. were registered, three of them belonged to characteristic flora from the steppe: Mulinum spinosum (Cav. Pers., Phacelia secunda J. F. Gmel. and Schinus marchandii F. A. Barkley

  15. Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)

    Science.gov (United States)

    Itoh, Nobuya; Toda, Hiroshi; Matsuda, Michiko; Negishi, Takashi; Taniguchi, Tomokazu; Ohsawa, Noboru

    2009-01-01

    Background Biogenic emissions of methyl halides (CH3Cl, CH3Br and CH3I) are the major source of these compounds in the atmosphere; however, there are few reports about the halide profiles and strengths of these emissions. Halide ion methyltransferase (HMT) and halide/thiol methyltransferase (HTMT) enzymes concerning these emissions have been purified and characterized from several organisms including marine algae, fungi, and higher plants; however, the correlation between emission profiles of methyl halides and the enzymatic properties of HMT/HTMT, and their role in vivo remains unclear. Results Thirty-five higher plant species were screened, and high CH3I emissions and HMT/HTMT activities were found in higher plants belonging to the Poaceae family, including wheat (Triticum aestivum L.) and paddy rice (Oryza sativa L.), as well as the Brassicaceae family, including daikon radish (Raphanus sativus). The in vivo emission of CH3I clearly correlated with HMT/HTMT activity. The emission of CH3I from the sprouting leaves of R. sativus, T. aestivum and O. sativa grown hydroponically increased with increasing concentrations of supplied iodide. A gene encoding an S-adenosylmethionine halide/thiol methyltransferase (HTMT) was cloned from R. sativus and expressed in Escherichia coli as a soluble protein. The recombinant R. sativus HTMT (RsHTMT) was revealed to possess high specificity for iodide (I-), bisulfide ([SH]-), and thiocyanate ([SCN]-) ions. Conclusion The present findings suggest that HMT/HTMT activity is present in several families of higher plants including Poaceae and Brassicaceae, and is involved in the formation of methyl halides. Moreover, it was found that the emission of methyl iodide from plants was affected by the iodide concentration in the cultures. The recombinant RsHTMT demonstrated enzymatic properties similar to those of Brassica oleracea HTMT, especially in terms of its high specificity for iodide, bisulfide, and thiocyanate ions. A survey of

  16. Beta-glucosidase activity of ER-bodies in Arabidopsis thaliana seedlings under clinorotation and after X-ray irradiation

    Science.gov (United States)

    Romanchuk, Svitlana

    Realization of long-term space flight requires the life support bioregenerative systems, an indispensable component of which are plants as a source of oxygen, water and food. Although it is well known now that plants adopt to spaceflight factors, in particular to microgravity, by changing some their patterns at the cellular, physiological, biochemical and molecular levels, many questions on cause and effect of these changes are still open. In addition, it is necessary to find the plant species which will be the most suited to the conditions in a space craft cabin. Plants of the family Brassicaceae are known to be resistant to a variety of abiotic stresses, including irradiation. Among them there are many cultivated plants with which we encounter every day: cabbage, radish, mustard, rapeseed, etc., and Arabidopsis thaliana - a convenient model object. The family Brassicaceae to be characterized by the presence of ER-bodies in plant cells, which are derivative of granular endoplasmic reticulum. Earlier, an enzyme beta-glucosidase (beta-D-glucoside glucohydrolase; EC 3.2.1.21) with an ER retention signal has been shown to accumulate selectively in such bodies in response to different unfavorable factors. Recently, we reported that formation of ER-bodies in A. thaliana seedling roots is sensitive to the clinorotation and X-ray irradiation, as their quantity and size in creased under the influence of these factors in comparison with control.begin{itemize} Therefore, we determined the beta-glucosidase activity in A. thaliana (line Columbia) seedlings grown in the stationary conditions and under clinorotation (a); and after X-ray irradiation (b): a) 3- and 7-day-old seedlings grown on a slow horizontal clinostat (2rpm); b) 3-day-old seedlings were treated with X-ray radiation dose of 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 10 and 12 Gray. For the first time, an increase in beta-glucosidase activity, which is the main component of the ER-bodies in A. thaliana seedlings, were found

  17. Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish

    Directory of Open Access Journals (Sweden)

    Taniguchi Tomokazu

    2009-09-01

    Full Text Available Abstract Background Biogenic emissions of methyl halides (CH3Cl, CH3Br and CH3I are the major source of these compounds in the atmosphere; however, there are few reports about the halide profiles and strengths of these emissions. Halide ion methyltransferase (HMT and halide/thiol methyltransferase (HTMT enzymes concerning these emissions have been purified and characterized from several organisms including marine algae, fungi, and higher plants; however, the correlation between emission profiles of methyl halides and the enzymatic properties of HMT/HTMT, and their role in vivo remains unclear. Results Thirty-five higher plant species were screened, and high CH3I emissions and HMT/HTMT activities were found in higher plants belonging to the Poaceae family, including wheat (Triticum aestivum L. and paddy rice (Oryza sativa L., as well as the Brassicaceae family, including daikon radish (Raphanus sativus. The in vivo emission of CH3I clearly correlated with HMT/HTMT activity. The emission of CH3I from the sprouting leaves of R. sativus, T. aestivum and O. sativa grown hydroponically increased with increasing concentrations of supplied iodide. A gene encoding an S-adenosylmethionine halide/thiol methyltransferase (HTMT was cloned from R. sativus and expressed in Escherichia coli as a soluble protein. The recombinant R. sativus HTMT (RsHTMT was revealed to possess high specificity for iodide (I-, bisulfide ([SH]-, and thiocyanate ([SCN]- ions. Conclusion The present findings suggest that HMT/HTMT activity is present in several families of higher plants including Poaceae and Brassicaceae, and is involved in the formation of methyl halides. Moreover, it was found that the emission of methyl iodide from plants was affected by the iodide concentration in the cultures. The recombinant RsHTMT demonstrated enzymatic properties similar to those of Brassica oleracea HTMT, especially in terms of its high specificity for iodide, bisulfide, and thiocyanate ions

  18. Resposta da couve-da-Malásia (Brassica chinensis L. var. parachinensis (Bailey Sinskaja à deficiência nutricional = Response of Malaysian cabbage (Brassica chinensis L. var. parachinensis (Bailey Sinskaja to nutritional deficiency

    Directory of Open Access Journals (Sweden)

    Geraldo Magella Flôres da Mota

    2009-04-01

    Full Text Available Brassica chinensis var. parachinensis é uma hortaliça folhosa, de ciclo curto, introduzida no Brasil em 1992, em função de sua excelente qualidade nutricional. Apresenta elevado teor de b-caroteno, vitamina C, Ca e Fe, o que a torna importante alimento,especialmente no combate à anemia. Este trabalho teve como objetivo avaliar a produtividade biológica e agronômica da couve-da-Malásia, cultivada sob deficiência de N, P, K, Ca, Mg, S, B, Cu, Fe, Mn, Mo e Zn e comparada com o tratamento-testemunha que incluiu todos os macro e micronutrientes. As plantas cultivadas na ausência de N e Pconseguiram completar o ciclo, mas foram significativamente menos produtivas e pouco desenvolvidas em relação às que receberam nutrição completa. Além disso, apresentaram coloração das folhas verde-acinzentada e arroxeamento do pecíolo e nervuras. Na ausênciade B, todas as plantas morreram entre 30 e 37 dias após a semeadura e, na ausência de S, elas não produziram frutos, o que mostra a importância destes dois nutrientes para essa Brassicaceae.Brassica chinensis var. parachinensis is a vegetable with short cycle, which was introduced in Brazil in 1992 due to its highnutritional qualities. It presents high concentration of b-carotene, vitamin C, Ca, and Fe, becoming an important food for the prevention of anemia. The aim of this paper was to evaluate the biological and agronomic productivity of plants grown under N, P, K, Ca, Mg,S, B, Cu, Fe, Mn, Mo, and Zn deficiency. The results were compared with plants grown with all macro and micronutrients. Plants cultured without N and P completed their cycle, but had lower yield than those cultured with complete nutrition. Additionally, they had green-grayish leaves, and purple petiole and veins. Plants cultured without B died between 30 and 37 days after sowing, and without S they did not produce fruits. These results show the importance of S and B to this Brassicaceae.

  19. Palinologia do componente herbáceo na atmosfera de Caxias do Sul, RS, Brasil Palinology of the herbaceous component in the atmosphere of Caxias do Sul, Rio Grande do Sul State, Brazil

    Directory of Open Access Journals (Sweden)

    Sandra Maria Vergamini

    2006-12-01

    Full Text Available Este estudo foi realizado na cidade de Caxias do Sul de 1/janeiro/2001 a 31/dezembro/2002 e objetivou identificar os tipos polínicos de táxons herbáceos presentes na atmosfera e suas oscilações sazonais. A cidade está localizada na Encosta Superior Nordeste, Estado do Rio Grande do Sul. Seu clima é tropical pluvisazonal e apresenta três diferentes tipos de vegetação: Floresta Ombrófila Mista, Floresta Decidual e Campo. O monitoramento polínico foi realizado utilizando o captador volumétrico de sucção Burkard®, instalado no topo do Hospital Geral a uma altura aproximada de 20 m. Durante o período de estudo foram identificados 40 tipos polínicos, sendo 11 de táxons herbáceos, representando 23,22% do total de grãos coletados. A concentração máxima das táxons herbáceos registrou-se nos meses de outubro e novembro. O tipo polínico Poaceae R.Brown apresentou a maior incidência, seguido por Cyperaceae Juss., Plantago L., Amaranthus L., Rumex L., Iridaceae Juss., Brassicaceae Burnett, Apiaceae Lindl., Alternanthera Forssk., Convolvulaceae Juss. e Caryophyllaceae Juss.This study was carried out in the city of Caxias do Sul, from January 1, 2001 to December 31, 2002 and aimed to identify pollen types and seasonal fluctuation of herbaceous taxa in the atmosphere. The city is located on the Upper Northeast Slopes in Rio Grande do Sul State. The climate is tropical with seasonal rainfall and there are three different types of vegetation: mixed ombrophilous forest, deciduous forest and grassland. Pollen monitoring was done with a Burkard® volumetric spore-trap sampler placed on top of the Hospital Geral, about 20m above ground level. During the study period 40 pollen types were identified, 11 from herbaceous taxa, which represents 23.22% of the total number of grains collected. Maximum concentration of herbaceous taxa was registered in October and November. The Poaceae R.Brown pollen type had the highest incidence, followed by

  20. Molecular Characterization of MYB28 Involved in Aliphatic Glucosinolate Biosynthesis in Chinese Kale (Brassica oleracea var. alboglabra Bailey).

    Science.gov (United States)

    Yin, Ling; Chen, Hancai; Cao, Bihao; Lei, Jianjun; Chen, Guoju

    2017-01-01

    Glucosinolates are Brassicaceae-specific secondary metabolites that act as crop protectants, flavor precursors, and cancer-prevention agents, which shows strong evidences of anticarcinogentic, antioxidant, and antimicrobial activities. MYB28, the R2R3-MYB28 transcription factor, directly activates genes involved in aliphatic glucosinolate biosynthesis. In this study, the MYB28 homology (BoaMYB28) was identified in Chinese kale (Brassica oleracea var. alboglabra Bailey). Analysis of the nucleotide sequence indicated that the cDNA of BoaMYB28 was 1257 bp with an ORF of 1020 bp. The deduced BoaMYB28 protein was a polypeptide of 339 amino acid with a putative molecular mass of 38 kDa and a pI of 6.87. Sequence homology and phylogenetic analysis showed that BoaMYB28 was most closely related to MYB28 homologs from the Brassicaceae family. The expression levels of BoaMYB28 varies across the tissues and developmental stages. BoaMYB28 transcript levels were higher in leaves and stems compared with those in cotyledons, flowers, and siliques. BoaMYB28 was expressed across all developmental leaf stages, with higher transcript accumulation in mature and inflorescence leaves. Over-expression and RNAi studies showed that BoaMYB28 retains the basic MYB28 gene function as a major transcriptional regulator of aliphatic glucosinolate pathway. The results indicated that over-expression and RNAi lines showed no visible difference on plant morphology. The contents of aliphatic glucosinolates and transcript levels of aliphatic glucosinolate biosynthesis genes increased in over-expression lines and decreased in RNAi lines. In over-expression lines, aliphatic glucosinolate contents were 1.5- to 3-fold higher than those in the wild-type, while expression levels of aliphatic glucosinolate biosynthesis genes were 1.5- to 4-fold higher than those in the wild-type. In contrast, the contents of aliphatic glucosinolates and transcript levels of aliphatic glucosinolate biosynthesis genes in RNAi

  1. Molecular Characterization of MYB28 Involved in Aliphatic Glucosinolate Biosynthesis in Chinese Kale (Brassica oleracea var. alboglabra Bailey

    Directory of Open Access Journals (Sweden)

    Ling Yin

    2017-06-01

    Full Text Available Glucosinolates are Brassicaceae-specific secondary metabolites that act as crop protectants, flavor precursors, and cancer-prevention agents, which shows strong evidences of anticarcinogentic, antioxidant, and antimicrobial activities. MYB28, the R2R3-MYB28 transcription factor, directly activates genes involved in aliphatic glucosinolate biosynthesis. In this study, the MYB28 homology (BoaMYB28 was identified in Chinese kale (Brassica oleracea var. alboglabra Bailey. Analysis of the nucleotide sequence indicated that the cDNA of BoaMYB28 was 1257 bp with an ORF of 1020 bp. The deduced BoaMYB28 protein was a polypeptide of 339 amino acid with a putative molecular mass of 38 kDa and a pI of 6.87. Sequence homology and phylogenetic analysis showed that BoaMYB28 was most closely related to MYB28 homologs from the Brassicaceae family. The expression levels of BoaMYB28 varies across the tissues and developmental stages. BoaMYB28 transcript levels were higher in leaves and stems compared with those in cotyledons, flowers, and siliques. BoaMYB28 was expressed across all developmental leaf stages, with higher transcript accumulation in mature and inflorescence leaves. Over-expression and RNAi studies showed that BoaMYB28 retains the basic MYB28 gene function as a major transcriptional regulator of aliphatic glucosinolate pathway. The results indicated that over-expression and RNAi lines showed no visible difference on plant morphology. The contents of aliphatic glucosinolates and transcript levels of aliphatic glucosinolate biosynthesis genes increased in over-expression lines and decreased in RNAi lines. In over-expression lines, aliphatic glucosinolate contents were 1.5- to 3-fold higher than those in the wild-type, while expression levels of aliphatic glucosinolate biosynthesis genes were 1.5- to 4-fold higher than those in the wild-type. In contrast, the contents of aliphatic glucosinolates and transcript levels of aliphatic glucosinolate

  2. Estudio de la composición en ácidos grasos del aceite de las semillas en algunas plantas silvestres españolas

    Directory of Open Access Journals (Sweden)

    Vioque, J.

    1994-06-01

    Full Text Available The fatty acid composition of 34 species of plants from a variety of families that grow wild in the Iberian Peninsula was analysed. The aim to the survey was to indentify oils that contain a mix of fatty acids that from a qualitative or quantitative point of view have a commercial value. Because of the diverse taxonomic origin of the samples, the oil content between species was very variable, fluctuating between an average value of 3.4% in the Caryophyllaceae and 31.1% in Euphorbiaceae. Like the oil content, the fatty acid composition was quite variable, but, in general, the main fatty acids were palmitic, oleic, linoleic and linolenic acid, while in the Brassicaceae and in the Apiaceae erucic acid and petroselinic acid were the principal fatty acids respectively.

    Se ha estudiado la composición en ácidos grasos del aceite de las semillas en 34 plantas silvestres de la Península Ibérica. Se pretende la obtención de aceites con una composición en ácidos grasos que cualitativa o cuantitativamente puedan resultar de interés desde un punto de vista comercial. Debido al origen taxonómico tan diverso de las muestras, el contenido en aceite resulta muy variable, oscilando entre un valor medio del 3.4% en las Caryophyllaceae y el 31.1% de media en las Euphorbiaceae. Como el contenido en aceite, la composición en ácidos grasos es también bastante Variable, pero en general los principales ácidos grasos son palmítico, oleico, linoleico y linolénico, mientras que en las Brassicaceae domina el ácido erúcico y en las Apiaceae el ácido petroselínico.

  3. A comparative transcriptomic analysis reveals the core genetic components of salt and osmotic stress responses in Braya humilis.

    Directory of Open Access Journals (Sweden)

    Pengshan Zhao

    Full Text Available Braya humilis is a member of the Euclidieae tribe within the family Brassicaceae. This species exhibits a broad range of adaptations to different climatic zones and latitudes as it has a distribution that ranges from northern Asia to the arctic-alpine regions of northern North America. In China, B. humilis is mainly found on the Qinghai-Tibetan Plateau (QTP and in adjacent arid regions. In this study, we sequenced a sample from an arid region adjacent to the QTP using the Illumina platform generating a total of 46,485 highly accurate unigenes, of which 78.41% were annotated by BLASTing versus public protein databases. The B. humilis transcriptome is characterized by a high level of sequence conservation compared with its close relative, Arabidopsis thaliana. We also used reciprocal blast to identify shared orthologous genes between B. humilis and four other sequenced Brassicaceae species (i.e. A. thaliana, A. lyrata, Capsella rubella, and Thellungiella parvula. To enable precise characterization of orthologous genes, the early-diverging basal angiosperm Amborella trichopoda was also included. A total of 6,689 orthologous genes were identified before stricter criteria for the determination of e-values, amino acid hit lengths, and identity values was applied to further reduce this list. This led to a final list of 381 core orthologous genes for B. humilis; 39 out of these genes are involved in salt and osmotic stress responses and estimations of nonsynonymous/synonymous substitution ratios for this species and A. thaliana orthologs show that these genes are under purifying selection in B. humilis. Expression of six genes was detected in B. humilis seedlings under salt and osmotic stress treatments. Comparable expression patterns to their counterparts in Arabidopsis suggest that these orthologous genes are both sequence and functional conservation. The results of this study demonstrate that the environmental adaptations of B. humilis are mainly the

  4. The reference genome of the halophytic plant Eutrema salsugineum

    Directory of Open Access Journals (Sweden)

    Ruolin eYang

    2013-03-01

    Full Text Available A halophyte refers to a plant that can naturally tolerate high concentrations of salt in the soil, and its tolerance to salt stress may occur through various evolutionary and molecular mechanisms. Eutrema salsugineum is one of the halophytic species in the Brassicaceae family that can naturally tolerate multiple types of abiotic stresses that typically limit crop productivity, such as extreme salinity and cold. It has been widely used as a laboratorial model for stress biology research in plants. Here, we present the reference genome sequence (241 Mb of E. salsugineum at 8x coverage sequenced by traditional Sanger sequencing-based approach with comparison to its close relative Arabidopsis thaliana. The E. salsugineum genome contains 26,531 protein-coding genes and 51.4% of its genome is composed of repetitive sequences that mostly reside in pericentromeric regions. Comparative analyses of the genome structures, protein-coding genes, microRNAs, stress-related pathways and estimated translation efficiency of proteins between E. salsugineum and A. thaliana suggest adaptation of halophyte to environmental stresses may occur via a global network adjustment of multiple regulatory mechanisms. The E. salsugineum genome provides a resource to identify naturally occurring genetic alterations contributing to the adaptation of the halophyte plants to salinity might be bioengineered in related crop species.

  5. Glucoraphanin, the bioprecursor of the widely extolled chemopreventive agent sulforaphane found in broccoli, induces Phase-I xenobiotic metabolizing enzymes and increases free radical generation in rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Perocco, Paolo [Department of Experimental Pathology, Cancerology Section, viale Filopanti 22, I-40126, University of Bologna, Bologna (Italy); Bronzetti, Giorgio [Institute of Biology and Agricultural Biotechnology - CNR Research Area, via Moruzzi, I-56124 Pisa (Italy); Canistro, Donatella; Sapone, Andrea; Affatato, Alessandra; Pozzetti, Laura; Broccoli, Massimiliano [Department of Pharmacology, Molecular Toxicology Unit, via Irnerio 48, I-40126, University of Bologna, Bologna (Italy); Valgimigli, Luca [Department of Organic Chemistry ' A. Mangini' , Viale Risorgimento 4, I-40127, Alma-Mater Studiorum, University of Bologna, Bologna (Italy); Pedulli, Gian Franco [Department of Organic Chemistry ' A. Mangini' , Viale Risorgimento 4, I-40127, Alma-Mater Studiorum, University of Bologna, Bologna (Italy); Iori, Renato [C.R.A - Research Institute for Industrial Crops, via di Corticella 133, I-40129 Bologna (Italy); Barillari, Jessica [Institute of Biology and Agricultural Biotechnology - CNR Research Area, via Moruzzi, I-56124 Pisa (Italy)]|[C.R.A - Research Institute for Industrial Crops, via di Corticella 133, I-40129 Bologna (Italy); Sblendorio, Valeriana [Department of Pharmacology, Molecular Toxicology Unit, via Irnerio 48, I-40126, University of Bologna, Bologna (Italy); Legator, Marvin S. [Department of Preventive Medicine and Community Health, Division of Environmental Toxicology, The University of Texas Medical Branch at Galveston, 700 Harborside Drive, Galveston, TX 77555-1110 (United States); Paolini, Moreno [Department of Pharmacology, Molecular Toxicology Unit, via Irnerio 48, I-40126, University of Bologna, Bologna (Italy); Abdel-Rahman, Sherif Z. [Department of Preventive Medicine and Community Health, Division of Environmental Toxicology, The University of Texas Medical Branch at Galveston, 700 Harborside Drive, Galveston, TX 77555-1110 (United States)]. E-mail: sabdelra@utmb.edu

    2006-03-20

    Epidemiological and animal studies linking high fruit and vegetable consumption to lower cancer risk have strengthened the belief that long-term administration of isolated naturally occurring dietary constituents could reduce the risk of cancer. In recent years, metabolites derived from phytoalexins, such as glucoraphanin found in broccoli and other cruciferous vegetables (Brassicaceae), have gained much attention as potential cancer chemopreventive agents. The protective effect of these micronutrients is assumed to be due to the inhibition of Phase-I carcinogen-bioactivating enzymes and/or induction of Phase-II detoxifying enzymes, an assumption that still remains uncertain. The protective effect of glucoraphanin is thought to be due to sulforaphane, an isothiocyanate metabolite produced from glucoraphanin by myrosinase. Here we show, in rat liver, that while glucoraphanin slightly induces Phase-II enzymes, it powerfully boosts Phase-I enzymes, including activators of polycyclic aromatic hydrocarbons (PAHs), nitrosamines and olefins. Induction of the cytochrome P450 (CYP) isoforms CYP1A1/2, CYP3A1/2 and CYP2E1 was confirmed by Western immunoblotting. CYP induction was paralleled by an increase in the corresponding mRNA levels. Concomitant with this Phase-I induction, we also found that glucoraphanin generated large amount of various reactive radical species, as determined by electron paramagnetic resonance (EPR) spectrometry coupled to a radical-probe technique. This suggests that long-term uncontrolled administration of glucoraphanin could actually pose a potential health hazard.

  6. Botanical Characteristics of Polish Honeys from Natura 2000 Habitats

    Directory of Open Access Journals (Sweden)

    Wróblewska Anna

    2015-06-01

    Full Text Available Eighteen samples of honeys which were harvested over several beekeeping seasons from apiaries located in the area of the “Kózki” Nature Reserve (central-eastern Poland were the subject of the present study. The “Kózki” Nature Reserve is included in the European Ecological Network Natura 2000 program. A microscopic analysis of the pollen sediment in the honeys showed the presence of 61 pollen types from 32 botanical families in the investigated material. There were represented by nectariferous (72.1% and nonnectariferous plants (27.9% and both entomophilous and anemophilous ones. The total number of pollen taxa in individual samples ranged from 13 to 37. The main sources of nectar from trees and shrubs were: Frangula alnus, Prunus, Robinia pseudacacia, Rubus, Salix, Tilia. The main sources of nectar from herbaceous plants were: Anthriscus, Brassicaceae, Caryophyllaceae, Centaurea cyanus, Taraxacum, and Trifolium repens. Four unifloral honeys (three fruit tree honeys and one lime honey and fourteen multifloral honeys, with a significant percentage of pollen from several nectariferous plant taxa, were distinguished in the studied material.

  7. Glucosinolate Profile of Croatian Stenoendemic Plant Fibigia triquetra (DC. Boiss. ex Prantl.

    Directory of Open Access Journals (Sweden)

    Ivica Blažević

    2015-12-01

    Full Text Available As part of our ongoing investigation of the stenoendemic plants belonging to the Brassicaceae family, we report on the chemistry of Fibigia triquetra (DC. Boiss. ex Prantl for the first time. Different plant parts (flower, leaf, stem, and seed of F. triquetra were characterized and quantified for glucosinolates (GLs according to the ISO 9167-1 EU official method based on the HPLC analysis of desulfo-GLs. A taxonomic screening showed that F. triquetra contained relatively high levels of C-4 GLs, namely but-3-enyl GL (gluconapin, 1a, 4-methylsulfanylbutyl GL (glucoerucin, 3a, and 4-methylsulfinylbutyl GL (glucoraphanin, 5a. GC-MS analysis of the volatile fractions obtained after enzyme hydrolysis and/or HPLC-ESI-MS of intact GLs confirmed the GL profile. Four minor GLs, namely isopropyl GL (glucoputranjivin, 6a, sec-butyl GL (glucocochlearin, 7a, pent-4-enyl GL (glucobrassicanapin, 2a, and 5-methylsulfanylpentyl GL (glucoberteroin, 4a were also identified and quantified while 4-methylpentyl GL, 5-methylhexyl GL, and n-heptyl GL, were tentatively identified by GC-MS of their degradation products. Based on the major, as well as the minor GLs, this study shows differences in chemotaxonomy between F. triquetra and the related Degenia velebitica (Degen Hayek as well as other investigated species of the genus Fibigia.

  8. Protein Subcellular Relocalization of Duplicated Genes in Arabidopsis

    Science.gov (United States)

    Liu, Shao-Lun; Pan, An Qi; Adams, Keith L.

    2014-01-01

    Gene duplications during eukaroytic evolution, by successive rounds of polyploidy and by smaller scale duplications, have provided an enormous reservoir of new genes for the evolution of new functions. Preservation of many duplicated genes can be ascribed to changes in sequences, expression patterns, and functions. Protein subcellular relocalization (protein targeting to a new location within the cell) is another way that duplicated genes can diverge. We studied subcellular relocalization of gene pairs duplicated during the evolution of the Brassicaceae including gene pairs from the alpha whole genome duplication that occurred at the base of the family. We analyzed experimental localization data from green fluorescent protein experiments for 128 duplicate pairs in Arabidopsis thaliana, revealing 19 pairs with subcellular relocalization. Many more of the duplicate pairs with relocalization than with the same localization showed an accelerated rate of amino acid sequence evolution in one duplicate, and one gene showed evidence for positive selection. We studied six duplicate gene pairs in more detail. We used gene family analysis with several pairs to infer which gene shows relocalization. We identified potential sequence mutations through comparative analysis that likely result in relocalization of two duplicated gene products. We show that four cases of relocalization have new expression patterns, compared with orthologs in outgroup species, including two with novel expression in pollen. This study provides insights into subcellular relocalization of evolutionarily recent gene duplicates and features of genes whose products have been relocalized. PMID:25193306

  9. The Environmental Fluctuations of some Bioactive Nutraceutical Compounds in Zilla spinosa Inhabiting Arid Habitats

    Directory of Open Access Journals (Sweden)

    Hemmat Ibrahim KHATTAB

    2017-12-01

    Full Text Available Zilla spinosa is one of the dominated woody perennial shrubs widespread in the Egyptian Red sea coastal desert, belonging to family Brassicacea. Z. spinosa is used as a folk medicine and for heating by local people. Z. spinosa inhabits arid habitats exposed to adverse climatic changes which influence the production of the bioactive natural products. The natural secondary products have significant importance for plant acclimatization to the arid habitats beside their significant practical application in medicinal, nutritive and industrial purposes. The accumulation levels of some natural products including phenols, tannins, glucosinolates, flavonoids, saponins, proanthocyanidins and cardiac glycosides were measured in Z. spinosa inhabiting different locations of Wadi Hagul during spring and summer seasons. The results of the current study showed that Z. spinosa grown in the adverse environment has adapted to cope with extreme temperature, water deficit and geoclimate changes especially in summer, by enhancing the accumulation of some antioxidant compounds including phenols, tannins, glucosinolates, flavonoids, saponins, cardiac glycosides, concomitant with increments in the total antioxidant capacity and PAL activity. Consequently, Z. spinosa shrubs inhabiting the arid environment is a promising new source of saponins, glucosinolates, cardiac glycosides, phenols and flavonoids which could participate in drug development and exploration of alternative strategies to increase productivity of wild plants.

  10. The fate of retrotransposed processed genes in Arabidopsis thaliana.

    Science.gov (United States)

    Abdelkarim, Basma T M; Maranda, Vincent; Drouin, Guy

    2017-04-20

    Processed genes are functional genes that have arisen as a result of the retrotransposition of mRNA molecules. We found 6 genes that generated processed genes in the common ancestor of five Brassicaceae species (Arabidopsis thaliana, Arabidopsis lyrata, Capsella rubella, Brassica rapa and Thellungiella parvula). These processed genes have therefore been kept for at least 30millionyears. Analyses of the Ka/Ks ratio of these genes, and of those having given rise to them, show that they evolve relatively slowly and suggest that the processed genes maintained the same function as that of their parental gene. There is a significant negative correlation between the number of ESTs and transcripts produced and the Ka/Ks ratios of the parental genes but not of the processed genes. This suggests that selection has not yet adapted the selective pressure the processed genes experience to their expression level. However, the A. thaliana processed genes tend to be expressed in the same tissues as that of their parental genes. Furthermore, most have a CAATT-box, a TATA-box and are located about 1kb from another protein-coding gene. Altogether, our results suggest that the processed genes found in the A. thaliana genome have been kept to produce more of the same product, and in the same tissues, as that encoded by their parental gene. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

  11. Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

    Science.gov (United States)

    Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

    2015-09-01

    In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

  12. Size-specific imprinted polymer embedded carbon nanodots modified magnetic nanoparticle for specific recognition of titanium nanoparticle: The round versus round.

    Science.gov (United States)

    Patra, Santanu; Choudhary, Raksha; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K

    2016-12-15

    Like the two sides of a coin, any new invention or discovery also possess their two faces. Similarly, while nanomaterials were identified as a boon in several fields like industrial, medicinal or agriculture; some of them have been also validated as a risk to the environment and living organisms. In this report, we addressed an efficient optical method for the detection of popularly used titanium dioxide nanoparticle (TiO2) by a size-specific imprinted polymer embedded heteroatom-doped carbon nanodots (CNDs) decorated at the surface of the water-soluble magnetic nanoparticle. The CNDs were prepared by an economic and eco-friendly one-step hydrothermal method using a series of Brassicaceae family members (i.e. radish, cabbage, broccoli, and cauliflower). The as prepared CNDs shows very good production (12.8%) and quantum yields (40.7%). The size-specific imprinted polymer is biocompatible and biodegradable in nature and was able to detect the TiO2 nanoparticles with a high selectivity i.e. limit of detection (LOD)=6.88ngL(-1) (S/N=3) and remove the nanoparticle very efficiently. Furthermore, the method was successfully applied for the detection of TiO2 nanoparticles in wastewater, human sera, and cosmetic samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Phytochemical and Biological Investigation of Two Diplotaxis Species Growing in Tunisia: D. virgata & D. erucoides.

    Science.gov (United States)

    Salah, Nizar Ben; Casabianca, Hervé; Jannet, Hichem Ben; Chenavas, Sophie; Sanglar, Corinne; Fildier, Aurélie; Bouzouita, Nabiha

    2015-10-05

    A phytochemical investigation of Diplotaxis virgata D.C. and D. erucoides (L.) D.C. (Brassicaceae) offered to the isolation of two new flavonoids isorhamnetin-3-O-α-l-glucopyranoside (1) and rhamnetin-3,3'-di-O-β-d-glucopyranoside (2), respectively. Their structures have been elucidated from the extended spectroscopic methods, including 1D- and 2D-NMR, UV and mass spectrometry analysis and by comparison with literature data. The fatty acid composition of the hexane extracts of the two species was also investigated by using GC-MS. The antioxidant activity of ethanol, ethyl acetate, n-butanol extracts and the isolated compounds from the two species was evaluated using DPPH and ABTS⁺ scavenging assays. All the tested samples showed an efficient radical scavenging ability, with IC50 values ranging from 16-40 µg/mL for the DPPH and from 17-44 µg/mL for the ABTS⁺ assays. In addition, the antibacterial activity of the prepared extracts and compounds 1 and 2, determined by well diffusion agar method against two Gram positive and five Gram negative bacteria, was evaluated and the results showed significant effects against all strains used.

  14. Phytochemical and Biological Investigation of Two Diplotaxis Species Growing in Tunisia: D. virgata & D. erucoides

    Directory of Open Access Journals (Sweden)

    Nizar Ben Salah

    2015-10-01

    Full Text Available A phytochemical investigation of Diplotaxis virgata D.C. and D. erucoides (L. D.C. (Brassicaceae offered to the isolation of two new flavonoids isorhamnetin-3-O-α-l-glucopyranoside (1 and rhamnetin-3,3ʹ-di-O-β-d-glucopyranoside (2, respectively. Their structures have been elucidated from the extended spectroscopic methods, including 1D- and 2D-NMR, UV and mass spectrometry analysis and by comparison with literature data. The fatty acid composition of the hexane extracts of the two species was also investigated by using GC-MS. The antioxidant activity of ethanol, ethyl acetate, n-butanol extracts and the isolated compounds from the two species was evaluated using DPPH and ABTS+ scavenging assays. All the tested samples showed an efficient radical scavenging ability, with IC50 values ranging from 16–40 µg/mL for the DPPH and from 17–44 µg/mL for the ABTS+ assays. In addition, the antibacterial activity of the prepared extracts and compounds 1 and 2, determined by well diffusion agar method against two Gram positive and five Gram negative bacteria, was evaluated and the results showed significant effects against all strains used.

  15. Allergy to Diplotaxis erucoides pollen: occupational sensitization and cross-reactivity with other common pollens.

    Science.gov (United States)

    García-Ortega, P; Bartolomé, B; Enrique, E; Gaig, P; Richart, C

    2001-07-01

    Diplotaxis erucoides is a common weed of the Brassicaceae family widespread in southern and central Europe. A total of 410 consecutive patients referred for allergy study of rhinoconjunctivitis and/or asthma were skin tested with D. erucoides pollen, 14 proving positive. A purified D. erucoides pollen extract was prepared to perform quantitative skin tests, provocation tests, immunoblotting, and EIA inhibition in the 14 sensitized patients. Three patients, directly involved in viniculture, had rhinoconjunctivitis related to D. erucoides pollen. No D. erucoides-related symptoms were observed in most patients, who were also sensitized to Artemisia pollen. RAST was positive in 12/14 patients and nasal provocation tests in 9/12. The molecular masses of the most prevalent IgE-binding proteins ranged from 26 to 27.5 and from 31 to 34 kDa. D. erucoides pollen inhibited the IgE-binding of other sensitizing pollens in the three viniculture workers, whereas both Artemisia and D. erucoides pollen produced similar heterologous inhibition in the pooled serum of the remaining, nonclinically affected, D. erucoides-sensitized patients. D. erucoides pollen may be an important prevalent aeroallergen, particularly in rural areas. It may act as an occupational allergen in vineyard workers, in whom it seems to be the primary sensitizing agent, playing a secondary cross-reactive role in other sensitized patients.

  16. Effects of Zn Deficiency and Bicarbonate on the Growth and Photosynthetic Characteristics of Four Plant Species.

    Directory of Open Access Journals (Sweden)

    Kuan Zhao

    Full Text Available Calcareous soils are characterized by low nutrient contents, high bicarbonate (HCO3- content, and high alkalinity. The effects of HCO3- addition under zinc-sufficient (+Zn and zinc-deficient (-Zn conditions on the growth and photosynthetic characteristics of seedlings of two Moraceae species (Broussonetia papyrifera and Morus alba and two Brassicaceae species (Orychophragmus violaceus and Brassica napus were investigated. These four species were hydroponically grown in nutrient solution with 0 mM Zn (-Zn or 0.02 mM Zn (+Zn and 0 mM or 10 mM HCO3-. The photosynthetic response to HCO3- treatment, Zn deficiency, or both varied according to plant species. Of the four species, Broussonetia papyrifera showed the best adaptability to Zn deficiency for both the 0 mM and 10 mM HCO3- treatments due to its strong growth and minimal inhibition of photosynthesis and photosystem II (PS II. Brassica napus was sensitive to Zn deficiency, HCO3- treatment, or both as evidenced by the considerable inhibition of photosynthesis and high PS II activity. The results indicated different responses of various plant species to Zn deficiency and excess HCO3-. Broussonetia papyrifera was shown to have potential as a pioneer species in karst regions.

  17. Effects of Zn Deficiency and Bicarbonate on the Growth and Photosynthetic Characteristics of Four Plant Species.

    Science.gov (United States)

    Zhao, Kuan; Wu, Yanyou

    2017-01-01

    Calcareous soils are characterized by low nutrient contents, high bicarbonate (HCO3-) content, and high alkalinity. The effects of HCO3- addition under zinc-sufficient (+Zn) and zinc-deficient (-Zn) conditions on the growth and photosynthetic characteristics of seedlings of two Moraceae species (Broussonetia papyrifera and Morus alba) and two Brassicaceae species (Orychophragmus violaceus and Brassica napus) were investigated. These four species were hydroponically grown in nutrient solution with 0 mM Zn (-Zn) or 0.02 mM Zn (+Zn) and 0 mM or 10 mM HCO3-. The photosynthetic response to HCO3- treatment, Zn deficiency, or both varied according to plant species. Of the four species, Broussonetia papyrifera showed the best adaptability to Zn deficiency for both the 0 mM and 10 mM HCO3- treatments due to its strong growth and minimal inhibition of photosynthesis and photosystem II (PS II). Brassica napus was sensitive to Zn deficiency, HCO3- treatment, or both as evidenced by the considerable inhibition of photosynthesis and high PS II activity. The results indicated different responses of various plant species to Zn deficiency and excess HCO3-. Broussonetia papyrifera was shown to have potential as a pioneer species in karst regions.

  18. Ethnobiology and Ethnopharmacology of Lepidium meyenii (Maca, a Plant from the Peruvian Highlands

    Directory of Open Access Journals (Sweden)

    Gustavo F. Gonzales

    2012-01-01

    Full Text Available Lepidium meyenii (maca is a Peruvian plant of the Brassicaceae family cultivated for more than 2000 years, which grows exclusively in the central Andes between 4000 and 4500 m altitude. Maca is used as a food supplement and also for its medicinal properties described traditionally. Since the 90s of the XX century, an increasing interest in products from maca has been observed in many parts of the world. In the last decade, exportation of maca from Peru has increased from 1,415,000 USD in 2001 to USD 6,170,000 USD in 2010. Experimental scientific evidence showed that maca has nutritional, energizer, and fertility-enhancer properties, and it acts on sexual dysfunctions, osteoporosis, benign prostatic hyperplasia, memory and learning, and protects skin against ultraviolet radiation. Clinical trials showed efficacy of maca on sexual dysfunctions as well as increasing sperm count and motility. Maca is a plant with great potential as an adaptogen and appears to be promising as a nutraceutical in the prevention of several diseases.

  19. Characterization of RsMYB28 and RsMYB29 transcription factor genes in radish (Raphanus sativus L.).

    Science.gov (United States)

    Luo, X B; Liu, Z; Xu, L; Wang, Y; Zhu, X W; Zhang, W; Chen, W; Zhu, Y L; Su, X J; Everlyne, M; Liu, L W

    2016-09-23

    Glucosinolates (GSLs) are important secondary metabolites in Brassicaceae plants. Previous studies have mainly focused on GSL contents, types, and biosynthesis-related genes, but the molecular characterization patterns of GSL biosynthesis-related transcription factors remain largely unexplored in radish (Raphanus sativus L.). To isolate transcription factor genes regulating the GSL biosynthesis, genomic DNA and cDNA sequences of RsMYB28 and RsMYB29 genes were isolated in radish. Two R2R3-MYB domains were identified in the deduced amino acid sequences. Subcellular localization and yeast-one hybrid assays indicated that both the RsMYB28 and RsMYB29 genes were located in the nucleus and possessed transactivation activity. Reverse transcription quantitative analysis showed that the RsMYB28 and RsMYB29 genes were expressed in seeds, leaves, stems, and roots at the seedling, taproot thickening, and mature stages. Both genes were highly expressed during the seedling and taproot thickening stages. The expression level of RsMYB28 was found to be up-regulated following wounding, glucose, and abscisic acid treatments, whereas RsMYB29 was up-regulated following wounding and methyl jasmonate treatments. These results provide insights into the biological function and characterization of the RsMYB28 and RsMYB29 genes, and facilitate further dissection of the molecular regulatory mechanism underlying the GSL biosynthesis in radish.

  20. Extensive Chromosome Homoeology among Brassiceae Species Were Revealed by Comparative Genetic Mapping with High-Density EST-Based SNP Markers in Radish (Raphanus sativus L.)‡

    Science.gov (United States)

    Li, Feng; Hasegawa, Yoichi; Saito, Masako; Shirasawa, Sachiko; Fukushima, Aki; Ito, Toyoaki; Fujii, Hiroshi; Kishitani, Sachie; Kitashiba, Hiroyasu; Nishio, Takeshi

    2011-01-01

    A linkage map of expressed sequence tag (EST)-based markers in radish (Raphanus sativus L.) was constructed using a low-cost and high-efficiency single-nucleotide polymorphism (SNP) genotyping method named multiplex polymerase chain reaction–mixed probe dot-blot analysis developed in this study. Seven hundred and forty-six SNP markers derived from EST sequences of R. sativus were assigned to nine linkage groups with a total length of 806.7 cM. By BLASTN, 726 markers were found to have homologous genes in Arabidopsis thaliana, and 72 syntenic regions, which have great potential for utilizing genomic information of the model species A. thaliana in basic and applied genetics of R. sativus, were identified. By construction and analysis of the genome structures of R. sativus based on the 24 genomic blocks within the Brassicaceae ancestral karyotype, 23 of the 24 genomic blocks were detected in the genome of R. sativus, and half of them were found to be triplicated. Comparison of the genome structure of R. sativus with those of the A, B, and C genomes of Brassica species and that of Sinapis alba L. revealed extensive chromosome homoeology among Brassiceae species, which would facilitate transfer of the genomic information from one Brassiceae species to another. PMID:21816873