Supramolecular gel electrophoresis of large DNA fragments.

Science.gov (United States)

Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

2017-10-01

Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

BRCA1-associated exclusion of 53BP1 from DNA damage sites underlies temporal control of DNA repair

Science.gov (United States)

Chapman, J. Ross; Sossick, Alex J.; Boulton, Simon J.; Jackson, Stephen P.

2012-01-01

Summary Following irradiation, numerous DNA-damage-responsive proteins rapidly redistribute into microscopically visible subnuclear aggregates, termed ionising-radiation-induced foci (IRIF). How the enrichment of proteins on damaged chromatin actually relates to DNA repair remains unclear. Here, we use super-resolution microscopy to examine the spatial distribution of BRCA1 and 53BP1 proteins within single IRIF at subdiffraction-limit resolution, yielding an unprecedented increase in detail that was not previously apparent by conventional microscopy. Consistent with a role for 53BP1 in promoting DNA double-strand break repair by non-homologous end joining, 53BP1 enrichment in IRIF is most prominent in the G0/G1 cell cycle phases, where it is enriched in dense globular structures. By contrast, as cells transition through S phase, the recruitment of BRCA1 into the core of IRIF is associated with an exclusion of 53BP1 to the focal periphery, leading to an overall reduction of 53BP1 occupancy at DNA damage sites. Our data suggest that the BRCA1-associated IRIF core corresponds to chromatin regions associated with repair by homologous recombination, and the enrichment of BRCA1 in IRIF represents a temporal switch in the DNA repair program. We propose that BRCA1 antagonises 53BP1-dependent DNA repair in S phase by inhibiting its interaction with chromatin proximal to damage sites. Furthermore, the genomic instability exhibited by BRCA1-deficient cells might result from a failure to efficiently exclude 53BP1 from such regions during S phase. PMID:22553214

Lamin A/C-dependent interaction with 53BP1 promotes cellular responses to DNA damage

DEFF Research Database (Denmark)

Gibbs-Seymour, Ian; Markiewicz, Ewa; Bekker-Jensen, Simon

2015-01-01

Lamins A/C have been implicated in DNA damage response pathways. We show that the DNA repair protein 53BP1 is a lamin A/C binding protein. In undamaged human dermal fibroblasts (HDF), 53BP1 is a nucleoskeleton protein. 53BP1 binds to lamins A/C via its Tudor domain, and this is abrogated by DNA...... damage. Lamins A/C regulate 53BP1 levels and consequently lamin A/C-null HDF display a 53BP1 null-like phenotype. Our data favour a model in which lamins A/C maintain a nucleoplasmic pool of 53BP1 in order to facilitate its rapid recruitment to sites of DNA damage and could explain why an absence...

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

Energy Technology Data Exchange (ETDEWEB)

Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

2012-07-29

Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

Science.gov (United States)

Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

2017-05-09

Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

Directory of Open Access Journals (Sweden)

Sedlackova Tatiana

2013-02-01

Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability

DEFF Research Database (Denmark)

Germann, Susanne Manuela; Schramke, Vera; Pedersen, Rune Troelsgaard

2014-01-01

yeast Saccharomyces cerevisiae and the avian DT40 cell line as model systems for studying DNA anaphase bridges and show that TopBP1/Dpb11 plays an evolutionarily conserved role in their metabolism. Together with the single-stranded DNA binding protein RPA, TopBP1/Dpb11 binds to UFBs, and depletion...

DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

DEFF Research Database (Denmark)

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability.

Science.gov (United States)

Germann, Susanne M; Schramke, Vera; Pedersen, Rune Troelsgaard; Gallina, Irene; Eckert-Boulet, Nadine; Oestergaard, Vibe H; Lisby, Michael

2014-01-06

DNA anaphase bridges are a potential source of genome instability that may lead to chromosome breakage or nondisjunction during mitosis. Two classes of anaphase bridges can be distinguished: DAPI-positive chromatin bridges and DAPI-negative ultrafine DNA bridges (UFBs). Here, we establish budding yeast Saccharomyces cerevisiae and the avian DT40 cell line as model systems for studying DNA anaphase bridges and show that TopBP1/Dpb11 plays an evolutionarily conserved role in their metabolism. Together with the single-stranded DNA binding protein RPA, TopBP1/Dpb11 binds to UFBs, and depletion of TopBP1/Dpb11 led to an accumulation of chromatin bridges. Importantly, the NoCut checkpoint that delays progression from anaphase to abscission in yeast was activated by both UFBs and chromatin bridges independently of Dpb11, and disruption of the NoCut checkpoint in Dpb11-depleted cells led to genome instability. In conclusion, we propose that TopBP1/Dpb11 prevents accumulation of anaphase bridges via stimulation of the Mec1/ATR kinase and suppression of homologous recombination.

Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

Science.gov (United States)

Richardson, Ruth E.; Suzuki, Yo

2015-01-01

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

Radiosensitivity evaluation of Human tumor cell lines by detecting 4977bp deletion in mitochondrial DNA

International Nuclear Information System (INIS)

Zhang Yipei

2009-01-01

Objective: To explore the feasibility of determining radiosensitivity of human tumor cell lines in vitro using the assay of mtDNA4977bp deletion. Methods: Three human tumor cell lines were selected in this study, HepG 2 , EC-9706 and MCF-7. The surviving fraction(SF), the ratio of mtDNA4977bp deletion and DNA damage were detected by MTT assay and nested PCR technique respectively. Results: MTT assay: The SF of HepG 2 and EC-9706 after irradiated by 2, 4and 8Gy was lower significantly than that of MCF-7, which showed that the radiosensitivity of HepG 2 and EC-9706 was higher than that of MCF-7. But there was no statistical difference of SF between HepG 2 and EC-9706. PCR method:The differences on mtDNA 4977bp deletion in mitochondrial DNA among HepG 2 , EC-9706 and MCF-7 were not significant after 1Gy and 4Gy γ-ray irradiation. The ratio of 4977bp deletion in mitochondrial DNA of HepG 2 and EC-9706 increased while that of MCF-7 decreased after 8Gy irradiation. The ratio of mtDNA 4977bp deletion of HepG 2 and EC-9706 was higher significantly than that of MCF-7, which implies that the radiosensitivity of HepG 2 and EC-9706 was higher than that of MCF -7. Conclusion: As a new biological marker, mtDNA4977bp deletion may be hopeful to evaluate the radiosensitivity of tumor cells more objectively and exactly. (authors)

Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

Science.gov (United States)

Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

2016-04-01

Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

Science.gov (United States)

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

Directory of Open Access Journals (Sweden)

Nguyen-Hieu Tung

2012-09-01

Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

Complementary DNA-amplified fragment length polymorphism ...

African Journals Online (AJOL)

Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

Science.gov (United States)

Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

2015-01-01

Genome integrity is critically dependent on timely DNA replication and accurate chromosome segregation. Replication stress delays replication into G2/M, which in turn impairs proper chromosome segregation and inflicts DNA damage on the daughter cells. Here we show that TopBP1 forms foci upon mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin recruitment of SLX4 and by facilitating unscheduled DNA synthesis. PMID:26283799

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

Science.gov (United States)

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

Science.gov (United States)

Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

2018-02-01

To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

High efficiency hydrodynamic DNA fragmentation in a bubbling system

NARCIS (Netherlands)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

2017-01-01

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

Directory of Open Access Journals (Sweden)

Carol Coughlan

2015-01-01

Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

Directory of Open Access Journals (Sweden)

Leclerc Xavier

2009-04-01

Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

[Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

Science.gov (United States)

Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

2009-02-01

To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

Visualization of DNA in highly processed botanical materials.

Science.gov (United States)

Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

2018-04-15

DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Prediction of radiosensitivity of human tumor cell lines in vitro by determining 4977bp deletion in mitochondrial DNA

International Nuclear Information System (INIS)

Rong Qinglin; Cao Yongzhen; Zhang Yaowen; Zhao Xinran; Wang Qin; Li Jin; Liu Qiang

2008-01-01

Objective: To evaluate the possibility of predicting the radiosensitivity of tumor cell lines using the assay of the mtDNA4977bp deletion. Methods: The mtDNA4977bp deletion of HepG 2 cells and PC-3 cells were detected by nested PCR after irradiated by various doses of x-ray. Results: The radiation-induced mtDNA4977bp deletion of the tumor cell lines of HepG 2 and PC-3 were detected after irradiated. There was a dose dependent in the mtDNA4977bp deletion of two tumor cell lines. The deletion rate of HepG 2 was higher significantly than that of PC-3 at each point of radiation dose (P 2 was higher than that of PC-3. Conclusion: The assay of the mtDNA4977bp deletion may be an approach to predict the radiosensitivity of tumor cells. (authors)

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

Science.gov (United States)

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

Characterization of DNA antigens from immune complexes deposited in the skin of patients with systemic lupus erythematosus

Institute of Scientific and Technical Information of China (English)

曾凡钦; 尹若菲; 谭国珍; 郭庆; 许德清

2004-01-01

Background Skin lesions are common manifestations in systemic lupus erythematosus (SLE). It is still unknown what the definite pathogenesis of skin involvement was and whether DNA participated in it. Our study was designed to explore the pathogenetic role and nature of nuclear antigen (DNA) deposited in the skin lesions of patients with SLE.Methods Thirty skin samples from patients with SLE and 2 normal skin samples were studied. Extracellular DNA was evaluated by indirect immunofluorescence methods. The deposited immune complexes were extracted by cryoprecipitation, and DNA was then isolated with phenol and chloroform. DNA fragment sizes were detected by agarose gel electrophoresis. Finally, 8 different probes were used to analyze the origin of these DNA molecules using Dot hybridization.Results Extracellular DNA staining was found only in skin lesions, mainly those located in the basement membrane zone, vascular wall, and hair follicle wall. Normal skin and non-lesion SLE skin showed no fluorescence at locations outside the nuclei. There were no differences in the rate and intensity of extracellular DNA staining when comparing active phase to remission phase patients. No relationship was found between extracellular DNA and circulating anti-dsDNA antibodies. Deposited DNA fragments clustered into four bands of somewhat discrete sizes: 20 000 bp, 1300 bp, 800-900 bp, 100-200 bp. Small sized fragments (100-200 bp) were positively correlated with disease activity (P<0.05, r=0.407). Dot hybridization showed significant homology of the various extracellular DNA fragments examined with human genomic DNA, but not with DNA from the microorganisms and viruses we examined. There were also homologies between DNA samples from different individuals.Conclusions DNA and its immune complexes may contribute to the pathogenesis of skin lesions in SLE. These DNA molecules range in size from 100 bp to 20 kb and may be endogenous in origin.

The mitochondrial DNA 4,977-bp deletion and its implication in copy number alteration in colorectal cancer

Science.gov (United States)

2011-01-01

Background Qualitative and quantitative changes in human mitochondrial DNA (mtDNA) have been implicated in various cancer types. A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging. Methods We conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China. In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients. Results We found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027). In patients with the 4,977 bp deletion, the deletion level decreased as the cancer stage advanced (p = 0.031). Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion. Such mtDNA content increase correlated with the levels of the 4,977 bp deletion and with cancer stage (p deletion may play a role in the early stage of colorectal cancer, and it is also implicated in alteration of mtDNA content in cancer cells. PMID:21232124

Effect of turmeric and curcumin on BP-DNA adducts.

Science.gov (United States)

Mukundan, M A; Chacko, M C; Annapurna, V V; Krishnaswamy, K

1993-03-01

Many human cancers that are widely prevalent today can be prevented through modifications in life-styles, of which diet appears to be an important agent. Several dietary constituents modulate the process of carcinogenesis and prevent genotoxicity. Many plant constituents including turmeric appear to be potent antimutagens and antioxidants. Therefore the modulatory effects of turmeric and curcumin on the levels of benzo[a]pyrene induced DNA adducts in the livers of rats were studied by the newly developed 32P-postlabelling assay method. Turmeric when fed at 0.1, 0.5 and 3% and the active principle of turmeric (curcumin) when fed at a level of 0.03% in the diet for 4 weeks significantly reduced the level of BP-DNA adducts including the major adduct dG-N2-BP, formed within 24 h in response to a single i.p. injection of benzo[a]pyrene. The significance of these effects in terms of the potential anticarcinogenic effects of turmeric is discussed. Further, these results strengthen the various other biological effects of turmeric which have direct relevance to anticarcinogenesis and chemoprevention.

TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

DEFF Research Database (Denmark)

Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

2015-01-01

mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise...... temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin...

Construction of recombinant DNA clone for bovine viral diarrhea virus

International Nuclear Information System (INIS)

Yeo, S.G.; Cho, H.J.; Masri, S.A.

1992-01-01

Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment

利用 DDRT-PCR 鉴定芸芥自交不亲和系与自交亲和系的差异表达 cDNA%Identification of cDNA Fragments in Self-incompatible and Self-compatible Lines of Eruca sativa Mill.by DDRT-PCR

Institute of Scientific and Technical Information of China (English)

范惠玲; 白生文; 李华清; 孙万仓

2016-01-01

Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系，也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官，并分离与自交亲和性有关的 cDNA 片段，以芸芥的一对近等基因系，自交亲和系（SC）与自交不亲和系（SI）为试材，利用差异显示 RT-PCR �

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

Directory of Open Access Journals (Sweden)

Kotoka Masuyama

Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

Science.gov (United States)

García-Vilchis, David; Aranda-Anzaldo, Armando

2017-12-01

Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

Science.gov (United States)

Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

2002-04-01

We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH

Directory of Open Access Journals (Sweden)

Jaime Gosálvez

2013-02-01

Full Text Available We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH. A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL, 10 with high-grade SIL (HG-SIL, and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH).

Science.gov (United States)

Cortés-Gutiérrez, Elva I; Ortíz-Hernández, Brenda L; Dávila-Rodríguez, Martha I; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime

2013-02-19

We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH). A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL), 10 with high-grade SIL (HG-SIL), and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

[Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

Science.gov (United States)

Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

2016-01-01

Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage*

Science.gov (United States)

Acevedo, Julyana; Yan, Shan; Michael, W. Matthew

2016-01-01

A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

Science.gov (United States)

Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

2017-01-01

Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

Science.gov (United States)

Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

2012-01-01

Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

1995-01-01

Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

53BP1 nuclear bodies form around DNA lesions generated by mitotic transmission of chromosomes under replication stress

DEFF Research Database (Denmark)

Lukas, Claudia; Savic, Velibor; Bekker-Jensen, Simon

2011-01-01

stress increases the frequency of chromosomal lesions that are transmitted to daughter cells. Throughout G1, these lesions are sequestered in nuclear compartments marked by p53-binding protein 1 (53BP1) and other chromatin-associated genome caretakers. We show that the number of such 53BP1 nuclear bodies...... increases after genetic ablation of BLM, a DNA helicase associated with dissolution of entangled DNA. Conversely, 53BP1 nuclear bodies are partially suppressed by knocking down SMC2, a condensin subunit required for mechanical stability of mitotic chromosomes. Finally, we provide evidence that 53BP1 nuclear...... bodies shield chromosomal fragile sites sequestered in these compartments against erosion. Together, these data indicate that restoration of DNA or chromatin integrity at loci prone to replication problems requires mitotic transmission to the next cell generations....

Molecular characterization of the rDNA-ITS sequence and a PCR diagnostic technique for Pileolaria terebinthi, the cause of pistachio rust

Directory of Open Access Journals (Sweden)

Hossein ALAEI

2013-01-01

Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.

DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

International Nuclear Information System (INIS)

Kosaka, T.; Kuwabara, M.; Koide, F.

1992-01-01

Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

Science.gov (United States)

Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

2013-04-01

An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

GEMC1 is a TopBP1 interacting protein required for chromosomal DNA replication

Science.gov (United States)

Balestrini, Alessia; Cosentino, Claudia; Errico, Alessia; Garner, Elizabeth; Costanzo, Vincenzo

2010-01-01

Many factors required for chromosomal DNA replication have been identified in unicellular eukaryotes. However, DNA replication in complex multicellular organisms is poorly understood. Here, we report the identification of GEMC1, a novel vertebrate protein required for chromosomal DNA replication. GEMC1 is highly conserved in vertebrates and is preferentially expressed in proliferating cells. Using Xenopus egg extract we show that Xenopus GEMC1 (xGEMC1) binds to checkpoint and replication factor TopBP1, which promotes xGEMC1 binding to chromatin during pre-replication complex (pre-RC) formation. We demonstrate that xGEMC1 directly interacts with replication factors such as Cdc45 and Cdk2-CyclinE by which it is heavily phosphorylated. Phosphorylated xGEMC1 stimulates initiation of DNA replication whereas depletion of xGEMC1 prevents DNA replication onset due to impairment of Cdc45 loading onto chromatin. Likewise, inhibition of GEMC1 expression by morpholino and siRNA oligos prevents DNA replication in embryonic and somatic vertebrate cells. These data suggest that GEMC1 promotes initiation of chromosomal DNA replication in higher eukaryotes by mediating TopBP1 and Cdk2 dependent recruitment of Cdc45 onto replication origins. PMID:20383140

DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

Directory of Open Access Journals (Sweden)

Olga Makarova

Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

Science.gov (United States)

Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

2014-01-01

The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

Primary quantitative analysis of the mtDNA4977bp deletion induced by lonizing radiation in human peripheral blood u-sing real-time PCR

International Nuclear Information System (INIS)

Duan Zhikai; Liu Jiangong; Guo Wanlong; Zhang Shuxian

2011-01-01

Objective: To observe the influence of mtDNA4977bp deletion induced by different dose of γ ray in human peripheral blood in order to explore the feasibility of mtDNA4977bp deletion as biodosimeter. Methods: Human peripheral blood samples were collected from three healthy donors and irradiated by γ ray, MtDNA4977bp deletion was detected by real-time PCR. Results: It indicated that that from the range of 0 ∼ 8 Gy, the relationship between mtDNA4977bp deletion and irradiation dose represents certain curvilinear correlation (Y=1.2693+1.0660X+0.0198X 2 ). Conclusion: We find that γ ray has influence on the mtDNA4977bp deletion, so it may be an important biodosmeter in future. (authors)

Quantitative analysis of plasma cell-free DNA and its DNA integrity in patients with metastatic prostate cancer using ALU sequence

International Nuclear Information System (INIS)

Fawzy, A.; Sweify, K.M.; Nofal, N.; El-Fayoumy, H.M.

2016-01-01

Background: Prostate cancer (PC) is the most common cancer affecting men, it accounts for 29% of all male cancer and 11% of all male cancer related death. DNA is normally released from an apoptotic source which generates small fragments of cell-free DNA, whereas cancer patients have cell-free circulating DNA that originated from necrosis, autophagy, or mitotic catastrophe, which produce large fragments. Aim of work: Differentiate the cell free DNA levels (cfDNA) and its integrity in prostate cancer patients and control group composed of benign prostate hyperplasia (BPH) and healthy persons. Methodology: cf-DNA levels were quantified by real-time PCR amplification in prostate cancer patients ( n = 50), (BPH) benign prostate hyperplasia ( n = 25) and healthy controls ( n = 30) using two sets of ALU gene (product size of 115 bp and 247-bp) and its integrity was calculated as a ratio of qPCR results of 247 bp ALU over 115 bp ALU. Results: Highly significant levels of cf-DNA and its integrity in PC patients compared to BPH. Twenty-eight (56%) patients with prostate cancer had bone metastasis. ALU115 qpcr is superior to the other markers in discriminating metastatic patients with a sensitivity of 96.4% and a specificity of 86.4% and (AUC = 0.981) Conclusion: ALU115 qpcr could be used as a valuable biomarker helping in identifying high risk patients, indicating early spread of tumor cells as a potential seed for future metastases

Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

International Nuclear Information System (INIS)

Lau How Mooi

1998-01-01

Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

GEMC1 is a TopBP1-interacting protein required for chromosomal DNA replication.

Science.gov (United States)

Balestrini, Alessia; Cosentino, Claudia; Errico, Alessia; Garner, Elizabeth; Costanzo, Vincenzo

2010-05-01

Many of the factors required for chromosomal DNA replication have been identified in unicellular eukaryotes. However, DNA replication is poorly understood in multicellular organisms. Here, we report the identification of GEMC1 (geminin coiled-coil containing protein 1), a novel vertebrate protein required for chromosomal DNA replication. GEMC1 is highly conserved in vertebrates and is preferentially expressed in proliferating cells. Using Xenopus laevis egg extract we show that Xenopus GEMC1 (xGEMC1) binds to the checkpoint and replication factor TopBP1, which promotes binding of xGEMC1 to chromatin during pre-replication complex (pre-RC) formation. We demonstrate that xGEMC1 interacts directly with replication factors such as Cdc45 and the kinase Cdk2-CyclinE, through which it is heavily phosphorylated. Phosphorylated xGEMC1 stimulates initiation of DNA replication, whereas depletion of xGEMC1 prevents the onset of DNA replication owing to the impairment of Cdc45 loading onto chromatin. Similarly, inhibition of GEMC1 expression with morpholino and siRNA oligos prevents DNA replication in embryonic and somatic vertebrate cells. These data suggest that GEMC1 promotes initiation of chromosomal DNA replication in multicellular organisms by mediating TopBP1- and Cdk2-dependent recruitment of Cdc45 onto replication origins.

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

Science.gov (United States)

Cheng, Xin; Ivessa, Andreas S

2012-10-01

Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

Science.gov (United States)

2005-10-01

1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

Directory of Open Access Journals (Sweden)

Barbara Dariš

2018-02-01

Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

1994-08-01

The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

VARIAN NON-DELESI 9 PASANG BASA DNA MITOKONDRIA MANUSIA SAMPEL FORENSIK BALI

Directory of Open Access Journals (Sweden)

Gun Gun Gumilar

2005-06-01

Full Text Available One of human mitochondrial DNA (mtDNA variant is a 9 base pairs (bp deletion in the COII/tRNALys intergenic region. In construction mtDNA nomenclature, 9-bp deletion database consist of primary and secondary data is needed, including Bali bombing forensic samples. Here we report a 9-bp non- deletion mtDNA variant from Bali bombing forensic samples to complete primary data. Polymerase Chain Reaction (PCR technique with 2 set primer was used to detect 9-bp deletion. The PCR result was detected by agarose gel electrophoresis, which showed two bands (0.1 and 0.4 kb for non-deletion variant control, and one band (0.4 kb for deletion variant control. If the sample has 9-bp deletion, only one of the primer pairs could amplify a fragment of 0.4 kb. If the sample does not have 9-bp deletion, the other primer pair will amplify a 0.1 kb product. The result showed that none of the 24 samples has 9-bp deletion. These results are contributed to the human mtDNA database and nomenclature construction. Keywords: mtDNA, 9-bp deletion, PCR

Low-dose ionizing irradiation triggers a 53BP1 response to DNA double strand breaks in mouse spermatogonial stem cells.

Science.gov (United States)

Le, Wei; Qi, Lixin; Li, Jiaxuan; Wu, DengIong; Xu, Jun; Zhang, Jinfu

2016-01-01

The present study aims to examine the effect of low-dose ionizing irradiation on DNA double strand breaks (DSB) in mouse spermatogonial stem cells (SSCs) and reveal the underlying pathways for the DNA repair for DSB in SSCs. Eighteen one-month-old mice were divided into 6 groups and sacrificed separately at 45 minutes, 2 hours, 24 hours, 48 hours, and 72 hours after 0.1Gy X-ray irradiation (mice without receiving ionizing irradiation served as control). After perfusion fixation, testes were removed, sectioned, and followed by staining of γH2AX, 53BP1, Caspase 3, and promyelocytic leukemia zinc-finger (PLZF) for analysis among the different groups. The staining was observed by immunofluorescence visualized by confocal laser scanning. After low-dose irradiation, only 53BP1, but not Caspase3 or γH2AX was upregulated in PLZF positive SSCs within 45 minutes. The expression level of 53BP1 gradually decreased 24 hours after irradiation. Moreover, low-dose irradiation had no effect on the cell number and apoptotic status of SSCs. However other spermatogenic cells highly expressed γH2AX shortly after irradiation which was dramatically reduced following the events of DNA repair. It appears that low-dose ionizing irradiation may cause the DNA DSB of mouse spermatogenic cells. 53BP1, but not γH2AX, is involved in the DNA repair for DSB in SSCs. Our data indicates that 53BP1 plays an important role in the pathophysiological repair of DNA DSB in SSCs. This may open a new avenue to understanding the mechanisms of DNA repair of SSCs and male infertility.

Radiosensitivity evaluation of human tumor cell lines by detecting 4977 bp deletion in mitochondrial DNA and comet assay

International Nuclear Information System (INIS)

Chu Liping; Liu Qiang; Wang Qin; Li Jin; Yue Jingyin; Mu Chuanjie; Fan Feiyue

2008-01-01

Objective: To explore the feasibility of determining radiosensitivity of human tumor cell lines in vitro using the assay of mtDNA 4977 bp deletion and comet assay. Methods: Three human tumor cell lines were selected in this study, HepG 2 , EC-9706 and MCF-7. The surviving fraction(SF), the ratio of mtDNA 4977 bp deletion and DNA damage were detected by MTY assay, nested PCR technique and comet assay, respectively. Results: The results of MTT assay showed that the radiosensitivity of HepG 2 and EC-9706 was higher than that of MCF-7. The ratio of mtDNA 4977 bp deletion of HepG 2 and EC-9706 was higher significantly than that of MCF-7 (P 2 and EC-9706 was higher than that of MCF-7. The difference of radiosensitivity among these three tumor cell lines was significant after 8 Gy γ-ray irradiation. Conclusions: Combination of many biological parameter is helpful to evaluate the radiosensitivity of tumor cells more accurately. (authors)

Extraction of ultrashort DNA molecules from herbarium specimens.

Science.gov (United States)

Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

2017-02-01

DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

Energy Technology Data Exchange (ETDEWEB)

Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

2000-06-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

International Nuclear Information System (INIS)

Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

2000-01-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

Isolation of a sex-linked DNA sequence in cranes.

Science.gov (United States)

Duan, W; Fuerst, P A

2001-01-01

A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

Fragmentation of sperm DNA using the TUNEL method.

Science.gov (United States)

Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

2014-11-01

To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

Science.gov (United States)

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

Science.gov (United States)

Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

2013-10-01

Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

Architecture of the 99 bp DNA-six-protein regulatory complex of the lambda att site.

Science.gov (United States)

Sun, Xingmin; Mierke, Dale F; Biswas, Tapan; Lee, Sang Yeol; Landy, Arthur; Radman-Livaja, Marta

2006-11-17

The highly directional and tightly regulated recombination reaction used to site-specifically excise the bacteriophage lambda chromosome out of its E. coli host chromosome requires the binding of six sequence-specific proteins to a 99 bp segment of the phage att site. To gain structural insights into this recombination pathway, we measured 27 FRET distances between eight points on the 99 bp regulatory DNA bound with all six proteins. Triangulation of these distances using a metric matrix distance-geometry algorithm provided coordinates for these eight points. The resulting path for the protein-bound regulatory DNA, which fits well with the genetics, biochemistry, and X-ray crystal structures describing the individual proteins and their interactions with DNA, provides a new structural perspective into the molecular mechanism and regulation of the recombination reaction and illustrates a design by which different families of higher-order complexes can be assembled from different numbers and combinations of the same few proteins.

A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

International Nuclear Information System (INIS)

Jones, J.L.; Bulford, B.B.

1990-07-01

The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

Science.gov (United States)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Effect of pyrimido[1,6-a]benzimidazoles, quinolones, and Ca2+ on the DNA gyrase-mediated cleavage reaction.

Science.gov (United States)

Gmünder, H; Kuratli, K; Keck, W

1995-01-01

The quinolones inhibit the A subunit of DNA gyrase in the presence of Mg2+ by interrupting the DNA breakage and resealing steps, and the latter step is also retarded without quinolones if Mg2+ is replaced by Ca2+. Pyrimido[1,6-a]benzimidazoles have been found to represent a new class of potent DNA gyrase inhibitors which also act at the A subunit. To determine alterations in the DNA sequence specificity of DNA gyrase for cleavage sites in the presence of inhibitors of both classes or in the presence of Ca2+, we used DNA restriction fragments of 164, 85, and 71 bp from the pBR322 plasmid as model substrates. Each contained, at a different position, the 20-bp pBR322 sequence around position 990, where DNA gyrase preferentially cleaves in the presence of quinolones. Our results show that pyrimido[1,6-a]benzimidazoles have a mode of action similar to that of quinolones; they inhibit the resealing step and influence the DNA sequence specificity of DNA gyrase in the same way. Differences between inhibitors of both classes could be observed only in the preferences of DNA gyrase for these cleavage sites. The 20-bp sequence appeared to have some properties that induced DNA gyrase to cleave all three DNA fragments in the presence of inhibitors within this sequence, whereas cleavage in the presence of Ca2+ was in addition dependent on the length of the DNA fragments. PMID:7695300

Sequence Dependent Electrophoretic Separations of DNA in Pluronic F127 Gels

Science.gov (United States)

You, Seungyong; van Winkle, David H.

2010-03-01

Two-dimensional (2-D) electrophoresis has successfully been used to visualize the separation of DNA fragments of the same length. We electrophorese a double-stranded DNA ladder in an Agarose gel for the first dimension and in gels of Pluronic F127 for the second dimension at room temperature. The 1000 bp band that travels together as a single band in an Agarose gel is split into two bands in Pluronic gels. The slower band follows the exponential decay trend that the other ladder constituents do. After sequencing the DNA fragments, the faster band has an apparently random sequence, while the slower band and the others have two A-tracts in each 250 bp segment. The A-tracts consist of a series of at least five adenine bases pairing with thymine bases. This result leads to the conclusion that the migration of the DNA molecules bent with A-tracts is more retarded in Pluronic gels than the wild-type of DNA molecules.

Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

Directory of Open Access Journals (Sweden)

Gosalvez Jaime

2009-04-01

Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Isolation and characterization of microsatellite DNA loci from Sillago ...

Indian Academy of Sciences (India)

A diluted digestion–ligation mixture (1:10) was amplified with adaptor-specific primers (MSEP: 5 -GAT GAG TCC. TGA GTA A-3 ). Amplified DNA fragments, with a size range of 200–1000 bp, were enriched for repeats by mag- netic bead selection with a 5 -biotinylated (AC)15 probes, respectively. Enriched fragments were ...

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

Ancient DNA Reveals Late Pleistocene Existence of Ostriches in Indian Sub-Continent.

Directory of Open Access Journals (Sweden)

Sonal Jain

Full Text Available Ancient DNA (aDNA analysis of extinct ratite species is of considerable interest as it provides important insights into their origin, evolution, paleogeographical distribution and vicariant speciation in congruence with continental drift theory. In this study, DNA hotspots were detected in fossilized eggshell fragments of ratites (dated ≥25000 years B.P. by radiocarbon dating using confocal laser scanning microscopy (CLSM. DNA was isolated from five eggshell fragments and a 43 base pair (bp sequence of a 16S rRNA mitochondrial-conserved region was successfully amplified and sequenced from one of the samples. Phylogenetic analysis of the DNA sequence revealed a 92% identity of the fossil eggshells to Struthio camelus and their position basal to other palaeognaths, consistent with the vicariant speciation model. Our study provides the first molecular evidence for the presence of ostriches in India, complementing the continental drift theory of biogeographical movement of ostriches in India, and opening up a new window into the evolutionary history of ratites.

Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

International Nuclear Information System (INIS)

Evenson, Donald P.; Wixon, Regina

2005-01-01

Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

Science.gov (United States)

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

Dpb11/TopBP1 plays distinct roles in DNA replication, checkpoint response and homologous recombination

DEFF Research Database (Denmark)

Germann, Susanne Manuela; Østergaard, Vibe Hallundbæk; Haas, Caroline

2011-01-01

DPB11/TopBP1 is an essential evolutionarily conserved gene involved in initiation of DNA replication and checkpoint signaling. Here, we show that Saccharomyces cerevisiae Dpb11 forms nuclear foci that localize to sites of DNA damage in G1, S and G2 phase, a recruitment that is conserved for its...... and Tel1, and of the checkpoint mediator Rad9. In a site-directed mutagenesis screen, we identify a separation-of-function mutant, dpb11-PF, that is sensitive to DSB-inducing agents yet remains proficient for DNA replication and the S-phase checkpoint at the permissive temperature. The dpb11-PF mutant...... homologue TopBP1 in Gallus gallus. Damage-induced Dpb11 foci are distinct from Sld3 replication initiation foci. Further, Dpb11 foci are dependent on the checkpoint proteins Mec3 (9-1-1 complex) and Rad24, and require the C-terminal domain of Dpb11. Dpb11 foci are independent of the checkpoint kinases Mec1...

Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

Science.gov (United States)

Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

2006-12-01

The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

DEFF Research Database (Denmark)

Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

2013-01-01

It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

Science.gov (United States)

Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

2015-01-01

Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

(PCR) for direct cloning of blunt-end DNA fragments

African Journals Online (AJOL)

Administrator

2011-09-19

Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

NARCIS (Netherlands)

Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

1996-01-01

We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

International Nuclear Information System (INIS)

Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

1990-01-01

A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

International Nuclear Information System (INIS)

Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

2006-01-01

Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

Mitochondrial DNA pattern of the fine shrimp Metapenaeus elegans (De Man, 1907) in the lagoon of Segara Anakan, Central Java, using Hind III

Science.gov (United States)

Nugraha, Fitra Arya Dwi; Holil, Kholifah; Kurniawan, Nia

2017-05-01

Ecological damages to the Lagoon of Segara Anakan, Central Java, as well as large-scale and continuous exploitation are threatening the sustainability of fine shrimp, Metapenaeus elegans, and resources. Information in regards to genetic resources is crucial to establish long-term conservation programs and to preserve germplasm quality. This study aims to evaluate the number and size of the fragment which is digested with restriction enzyme Hind III. Seven individuals of Metapenaeus elegans from the Lagoon of Segara Anakan were examined using Hind III. Amplification of mitochondrial DNA resulted in 950 bp, and the digestion using Hind III generated four fragments consisting of 114 bp, 200 bp, 250 bp, and 386 bp, which formed a monomorphic pattern. The restriction pattern showed the probability of homozygosity of alleles that restricted using Hind III. Homozygosity indicates no variation of DNA sequence.

Ionization and fragmentation of DNA-RNA bases: a density functional theory study

International Nuclear Information System (INIS)

Sadr-Arani, Leila

2014-01-01

Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

Improved DNA electrophoresis in conditions favoring polyborates and lewis acid complexation.

Directory of Open Access Journals (Sweden)

Hari Singhal

2010-06-01

Full Text Available Spatial compression among the longer DNA fragments occurs during DNA electrophoresis in agarose and non-agarose gels when using certain ions in the conductive buffer, impairing the range of fragment sizes resolved well in a single gel. Substitutions using various polyhydroxyl anions supported the underlying phenomenon as the complexation of Lewis acids to DNA. We saw significant improvements using conditions (lithium borate 10 mM cations, pH 6.5 favoring the formation of borate polyanions and having lower conductance and Joule heating, delayed electrolyte exhaustion, faster electrophoretic run-speed, and sharper separation of DNA bands from 100 bp to 12 kb in a single run.

Use of a fragment of the tuf gene for phytoplasma 16Sr group/subgroup differentiation

DEFF Research Database (Denmark)

Contaldo, Nicoletta; Canel, Alessandro; Makarova, Olga

2011-01-01

The usefulness of RFLP analyses on a 435 bp fragment of the tuf gene for preliminary identification of phytoplasmas from a number of phytoplasma ribosomal groups and/or 'Candidatus. Phytoplasma' was verified. The strains employed belong to thirteen 16Sr DNA groups and 22 different subgroups...

Origin of DNA in human serum and usefulness of serum as a material for DNA typing.

Science.gov (United States)

Takayama, T; Yamada, S; Watanabe, Y; Hirata, K; Nagai, A; Nakamura, I; Bunai, Y; Ohya, I

2001-06-01

The aims of this study were to clarify the origin of DNA in human serum and to investigate whether serum is a material available for DNA typing in routine forensic practice. Blood was donated from 10 healthy adult volunteers and stored for up to 8 days, at 4 degrees C and at room temperature. The serum DNA concentration at zero time was in the range of 5.6 to 21.8 ng/ml with a mean of 12.2+/-1.6 ng/ml. The concentrations increased with storage time. On agarose gel electrophoresis, all serum samples showed ladder patterns and the size of each band was an integer multiple of approximately 180 bp considered to be characteristic of apoptosis. DNA typing from DNA released by apoptosis was possible. Exact DNA typing of D1S80, HLA DQA1, PM, CSF1PO, TPOX, TH01 and vWA was possible for each sample. These results indicate that serum contains fragmented DNA derived from apoptosis of leukocytes, especially neutrophils, and that fragmented DNA is an appropriate material for DNA typing.

Comparative d2/d3 LSU–rDNA sequence study of some Iranian ...

African Journals Online (AJOL)

SERVER

2007-11-05

Nov 5, 2007 ... segments yielded one fragment at over all sequenced isolates as 787 bp in size. The DNA sequences were aligned .... expansion segments of the 28S rDNA subunit (D2/D3. LSU-rDNA) are the ... isolated from different geographical location from tea shrubs infested roots of Guilan province, Iran (Table 1).

Use of RAPD and PCR double amplification in the study of ancient DNA

Directory of Open Access Journals (Sweden)

F. Balzano

2011-01-01

Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

Influence of DNA conformation on radiation-induced single-strand breaks

International Nuclear Information System (INIS)

Barone, F.; Belli, M.; Mazzei, F.

1994-01-01

We performed experiments on two DNA fragments of about 300 bp having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or γ-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA. (orig./MG)

ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

Science.gov (United States)

Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

2004-10-01

Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

TopBP1 associates with NBS1 and is involved in homologous recombination repair

International Nuclear Information System (INIS)

Morishima, Ken-ichi; Sakamoto, Shuichi; Kobayashi, Junya; Izumi, Hideki; Suda, Tetsuji; Matsumoto, Yoshiyuki; Tauchi, Hiroshi; Ide, Hiroshi; Komatsu, Kenshi; Matsuura, Shinya

2007-01-01

TopBP1 is involved in DNA replication and DNA damage checkpoint. Recent studies have demonstrated that TopBP1 is a direct positive effecter of ATR. However, it is not known how TopBP1 recognizes damaged DNA. Here, we show that TopBP1 formed nuclear foci after exposure to ionizing radiation, but such TopBP1 foci were abolished in Nijmegen breakage syndrome cells. We also show that TopBP1 physically associated with NBS1 in vivo. These results suggested that NBS1 might regulate TopBP1 recruitment to the sites of DNA damage. TopBP1-depleted cells showed hypersensitivity to Mitomycin C and ionizing radiation, an increased frequency of sister-chromatid exchange level, and a reduced frequency of DNA double-strand break induced homologous recombination repair. Together, these results suggested that TopBP1 might be a mediator of DNA damage signaling from NBS1 to ATR and promote homologous recombination repair

Around and beyond 53BP1 Nuclear Bodies.

Science.gov (United States)

Fernandez-Vidal, Anne; Vignard, Julien; Mirey, Gladys

2017-12-05

Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.

Around and beyond 53BP1 Nuclear Bodies

Directory of Open Access Journals (Sweden)

Anne Fernandez-Vidal

2017-12-01

Full Text Available Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1, a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.

'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

Science.gov (United States)

Eichmann, Cordula; Parson, Walther

2008-09-01

The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

Science.gov (United States)

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

African Journals Online (AJOL)

Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

2015-01-01

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

International Nuclear Information System (INIS)

Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

1979-01-01

Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

International Nuclear Information System (INIS)

Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

1991-01-01

The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

2015-05-15

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

Science.gov (United States)

Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

2018-03-23

To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

Science.gov (United States)

Fraser, L; Strzezek, J

2007-07-15

In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

Frequent non-reciprocal exchange in microsatellite-containing-DNA-regions of vertebrates

DEFF Research Database (Denmark)

Ziegler, J.O.; Wälther, M.; Linzer, T.R.

2009-01-01

Microsatellites are DNA-fragments containing short repetitive motifs with 2-10 bp. They are highly variable in most species and distributed throughout the whole genome. It is broadly accepted that their high degree of variability is closely associated with mispairing of DNA-strands during...... on stepwise mutation models should be interpreted with caution if no detailed information on the allelic variation of microsatellites is available....

A 310-bp minimal promoter mediates smooth muscle cell-specific expression of telokin.

Science.gov (United States)

Smith, A F; Bigsby, R M; Word, R A; Herring, B P

1998-05-01

A cell-specific promoter located in an intron of the smooth muscle myosin light chain kinase gene directs transcription of telokin exclusively in smooth muscle cells. Transgenic mice were generated in which a 310-bp rabbit telokin promoter fragment, extending from -163 to +147, was used to drive expression of simian virus 40 large T antigen. Smooth muscle-specific expression of the T-antigen transgene paralleled that of the endogenous telokin gene in all smooth muscle tissues except uterus. The 310-bp promoter fragment resulted in very low levels of transgene expression in uterus; in contrast, a transgene driven by a 2.4-kb fragment (-2250 to +147) resulted in high levels of transgene expression in uterine smooth muscle. Telokin expression levels correlate with the estrogen status of human myometrial tissues, suggesting that deletion of an estrogen response element (ERE) may account for the low levels of transgene expression driven by the 310-bp rabbit telokin promoter in uterine smooth muscle. Experiments in A10 smooth muscle cells directly showed that reporter gene expression driven by the 2.4-kb, but not 310-bp, promoter fragment could be stimulated two- to threefold by estrogen. This stimulation was mediated through an ERE located between -1447 and -1474. Addition of the ERE to the 310-bp fragment restored estrogen responsiveness in A10 cells. These data demonstrate that in addition to a minimal 310-bp proximal promoter at least one distal cis-acting regulatory element is required for telokin expression in uterine smooth muscle. The distal element may include an ERE between -1447 and -1474.

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

International Nuclear Information System (INIS)

Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

1986-01-01

The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

Energy Technology Data Exchange (ETDEWEB)

Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

1988-01-11

The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

DNA extraction from dry museum beetles without conferring external morphological damage

DEFF Research Database (Denmark)

Gilbert, M Thomas P; Moore, Wendy; Melchior, Linea

2007-01-01

undesirable when dealing with rare species or otherwise important specimens, such as type specimens. METHODOLOGY: We describe a method for the extraction of PCR-amplifiable mitochondrial and nuclear DNA from dry insects without causing external morphological damage. Using PCR to amplify approximately 220 bp...... of the mitochondrial gene cytochrome c oxidase I, and 250-345 bp fragments of the multi-copy, nuclear 28s ribosomal DNA gene, we demonstrate the efficacy of this method on beetles collected up to 50 years ago. CONCLUSIONS: This method offers a means of obtaining useful genetic information from rare insects without...... conferring external morphological damage. Udgivelsesdato: 2007-null...

KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

Directory of Open Access Journals (Sweden)

Gusti Ngurah Permana

2016-11-01

The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

A Qualitative and Quantitative Assay to Study DNA/Drug Interaction ...

African Journals Online (AJOL)

Purpose: To explore the use of restriction inhibition assay (RIA) to study the binding specificity of some anticancer drugs. Methods: A 448 bp DNA fragment derived from pBCKS+ plasmid (harboring the polylinker region with multiple restriction endonuclease sites) was used as a template for sequence selective inhibition of ...

The effect of chronic alcohol consumption on mitochondrial DNA mutagenesis in human blood

Energy Technology Data Exchange (ETDEWEB)

Wurmb-Schwark, N. von [Institute of Legal Medicine, Christian Albrecht University of Kiel, Arnold-Heller-Str. 12, 24105 Kiel (Germany)], E-mail: nvonwurmb@rechtsmedizin.uni-kiel.de; Ringleb, A.; Schwark, T. [Institute of Legal Medicine, Christian Albrecht University of Kiel, Arnold-Heller-Str. 12, 24105 Kiel (Germany); Broese, T.; Weirich, S.; Schlaefke, D. [Clinic of Psychiatry and Psychotherapy, University of Rostock, Gehlsheimer Str. 20, Rostock (Germany); Wegener, R. [Institute of Legal Medicine, St-Georg-Str. 108, University of Rostock, 18055 Rostock (Germany); Oehmichen, M. [Institute of Legal Medicine, Christian Albrecht University of Kiel, Arnold-Heller-Str. 12, 24105 Kiel (Germany)

2008-01-01

The 4977 bp deletion of mitochondrial DNA (mtDNA) is known to accumulate with increasing age in post mitotic tissues. Recently, studies came out detecting this specific alteration also in fast replicating cells, e.g. in blood or skin tissue, often in correlation to specific diseases or - specifically in skin - external stressors such as UV radiation. In this study, we investigated mitochondrial mutagenesis in 69 patients with a chronic alcoholic disease and 46 age matched controls with a moderate drinking behavior. Two different fragments, specific for total and for deleted mtDNA (dmtDNA) were amplified in a duplex-PCR. A subsequent fragment analysis was performed and for relative quantification, the quotient of the peak areas of amplification products specific for deleted and total mtDNA was determined. Additionally, a real time PCR was performed to quantify mtDNA copy number. The relative amount of 4977 bp deleted mtDNA in alcoholics was significantly increased compared to controls. On the other hand, no difference regarding the mtDNA/nuclear DNA ratio in both investigated groups was detected. Additionally, no age dependence could be found nor in alcoholics, neither in the control group. These findings indicate that mtDNA mutagenesis in blood can be influenced by stressors such as alcohol. Ethanol seems to be a significant factor to alter mitochondrial DNA in blood and might be an additional contributor for the cellular aging process.

The effect of chronic alcohol consumption on mitochondrial DNA mutagenesis in human blood

International Nuclear Information System (INIS)

Wurmb-Schwark, N. von; Ringleb, A.; Schwark, T.; Broese, T.; Weirich, S.; Schlaefke, D.; Wegener, R.; Oehmichen, M.

2008-01-01

The 4977 bp deletion of mitochondrial DNA (mtDNA) is known to accumulate with increasing age in post mitotic tissues. Recently, studies came out detecting this specific alteration also in fast replicating cells, e.g. in blood or skin tissue, often in correlation to specific diseases or - specifically in skin - external stressors such as UV radiation. In this study, we investigated mitochondrial mutagenesis in 69 patients with a chronic alcoholic disease and 46 age matched controls with a moderate drinking behavior. Two different fragments, specific for total and for deleted mtDNA (dmtDNA) were amplified in a duplex-PCR. A subsequent fragment analysis was performed and for relative quantification, the quotient of the peak areas of amplification products specific for deleted and total mtDNA was determined. Additionally, a real time PCR was performed to quantify mtDNA copy number. The relative amount of 4977 bp deleted mtDNA in alcoholics was significantly increased compared to controls. On the other hand, no difference regarding the mtDNA/nuclear DNA ratio in both investigated groups was detected. Additionally, no age dependence could be found nor in alcoholics, neither in the control group. These findings indicate that mtDNA mutagenesis in blood can be influenced by stressors such as alcohol. Ethanol seems to be a significant factor to alter mitochondrial DNA in blood and might be an additional contributor for the cellular aging process

Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

International Nuclear Information System (INIS)

Yakura, Kimitaka; Tanifuji, Shigeyuki.

1983-01-01

EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

Science.gov (United States)

Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

1976-09-01

Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Nature of defects produced on thymine fragment by gamma irradiation of DNA

International Nuclear Information System (INIS)

Teoule, R.; Bonicel, A.

1975-01-01

A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

Characterization of a cancer cell line that expresses a splicing variant form of 53BP1: Separation of checkpoint and repair functions in 53BP1

International Nuclear Information System (INIS)

Iwabuchi, Kuniyoshi; Matsui, Tadashi; Hashimoto, Mitsumasa; Matsumoto, Yoshihisa; Kurihara, Takayuki; Date, Takayasu

2008-01-01

53BP1 plays important roles in checkpoint signaling and repair for DNA double-strand breaks. We found that a colon cancer cell line, SW48, expressed a splicing variant form of 53BP1, which lacks the residues corresponding to exons 10 and 11. Activation of ATM and phosphorylation of ATM and ATR targets occurred in SW48 cells in response to X-irradiation, and these X-ray-induced responses were not enhanced by expression of full-length 53BP1 in SW48 cells, indicating that this splicing variant fully activates the major checkpoint signaling in SW48 cells. In contrast, the expression of full-length 53BP1 in SW48 cells promoted the repair of X-ray-induced DNA damage, evidenced by faster disappearance of X-ray-induced γ-H2AX foci, a marker for DNA damage, and less residual chromosomal aberrations after X-irradiation. We conclude that the two major roles of 53BP1, the checkpoint signaling and repair for DNA damage, can be functionally separated

A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

Directory of Open Access Journals (Sweden)

Manesh Kumar Panner Selvam

2018-03-01

Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

NARCIS (Netherlands)

ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

International Nuclear Information System (INIS)

Jackson, Christopher B.; Gallati, Sabina; Schaller, André

2012-01-01

Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

Energy Technology Data Exchange (ETDEWEB)

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

2012-07-06

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Telomere Restriction Fragment (TRF) Analysis.

Science.gov (United States)

Mender, Ilgen; Shay, Jerry W

2015-11-20

restriction enzyme recognition sites within TTAGGG tandem telomeric repeats, therefore digestion of genomic DNA, not telomeric DNA, with a combination of 6 base restriction endonucleases reduces genomic DNA size to less than 800 bp.

InterProScan Result: BP184018 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP184018 BP184018_2_ORF2 4FEA411FDBEADEDD PANTHER PTHR21347 CLEFT LIP AND PALATE ASSOCIATED TRANSME...MBRANE PROTEIN-RELATED 6.1e-73 T IPR008429 Cleft lip and palate transmembrane 1 ...

AcEST: BP912127 [AcEST

Lifescience Database Archive (English)

Full Text Available YMU001_000015_D09 582 Adiantum capillus-veneris mRNA. clone: YMU001_000015_D09. BP912127 - Show BP91212...is mRNA. clone: YMU001_000015_D09. Accession BP912127 Tissue type prothallium Developmental stage - Contig I...n database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912127|Adiantum capillus-veneris mRNA,... clone: YMU001_000015_D09. (582 letters) Database: uniprot_sprot.fasta 412,525 sequences; 148,809,765 total ...p|P42825|DNAJ2_ARATH Chaperone protein dnaJ 2 OS=Arabidopsis th... 79 2e-14 sp|Q09912|PSI1_SCHPO Protein psi

Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

Science.gov (United States)

Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

2012-03-01

The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

Directory of Open Access Journals (Sweden)

Beiyu Liu

2009-09-01

Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

Directory of Open Access Journals (Sweden)

Agustín García-Peiró

2014-01-01

Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

Direct quantification of fungal DNA from soil substrate using real-time PCR.

Science.gov (United States)

Filion, Martin; St-Arnaud, Marc; Jabaji-Hare, Suha H

2003-04-01

Detection and quantification of genomic DNA from two ecologically different fungi, the plant pathogen Fusarium solani f. sp. phaseoli and the arbuscular mycorrhizal fungus Glomus intraradices, was achieved from soil substrate. Specific primers targeting a 362-bp fragment from the SSU rRNA gene region of G. intraradices and a 562-bp fragment from the F. solani f. sp. phaseoli translation elongation factor 1 alpha gene were used in real-time polymerase chain reaction (PCR) assays conjugated with the fluorescent SYBR(R) Green I dye. Standard curves showed a linear relation (r(2)=0.999) between log values of fungal genomic DNA of each species and real-time PCR threshold cycles and were quantitative over 4-5 orders of magnitude. Real-time PCR assays were applied to in vitro-produced fungal structures and sterile and non-sterile soil substrate seeded with known propagule numbers of either fungi. Detection and genomic DNA quantification was obtained from the different treatments, while no amplicon was detected from non-seeded non-sterile soil samples, confirming the absence of cross-reactivity with the soil microflora DNA. A significant correlation (Pgenomic DNA of F. solani f. sp. phaseoli or G. intraradices detected and the number of fungal propagules present in seeded soil substrate. The DNA extraction protocol and real-time PCR quantification assay can be performed in less than 2 h and is adaptable to detect and quantify genomic DNA from other soilborne fungi.

InterProScan Result: BP116799 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP116799 BP116799_1_ORF2 D3F3F8C61868AD4C PANTHER PTHR11792 ARRESTIN 3.5e-15 T IPR000698 Arrestin Biological... Process: signal transduction (GO:0007165)|Biological Process: sensory perception (GO:0007600) ...

InterProScan Result: BP116799 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP116799 BP116799_1_ORF2 D3F3F8C61868AD4C PRINTS PR00309 ARRESTIN 6e-17 T IPR000698 Arrestin Biological... Process: signal transduction (GO:0007165)|Biological Process: sensory perception (GO:0007600) ...

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

Science.gov (United States)

Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

1991-01-01

Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

Self-DNA inhibitory effects: Underlying mechanisms and ecological implications.

Science.gov (United States)

Cartenì, Fabrizio; Bonanomi, Giuliano; Giannino, Francesco; Incerti, Guido; Vincenot, Christian Ernest; Chiusano, Maria Luisa; Mazzoleni, Stefano

2016-01-01

DNA is usually known as the molecule that carries the instructions necessary for cell functioning and genetic inheritance. A recent discovery reported a new functional role for extracellular DNA. After fragmentation, either by natural or artificial decomposition, small DNA molecules (between ∼50 and ∼2000 bp) exert a species specific inhibitory effect on individuals of the same species. Evidence shows that such effect occurs for a wide range of organisms, suggesting a general biological process. In this paper we explore the possible molecular mechanisms behind those findings and discuss the ecological implications, specifically those related to plant species coexistence.

Evaluation on the effects of ageing factor, sampling and preservation methods on Asiatic black bear (Ursus thibetanus noninvasive DNA amplification

Directory of Open Access Journals (Sweden)

Chih-Chin SHIH

2017-11-01

Full Text Available Noninvasive genetic sampling allows studying wildlife without having to catch, handle or even observe individuals. In this study, factors which may affect the quality of noninvasive samples of Asiatic black bear (Ursus thibetanus in the subtropical areas were identified. We collected hair and faecal samples from captive Asiatic black bears and quantitatively evaluated the effects of hair age (from fresh to 60 days, faeces age (from fresh to 14 days, faeces sampling locations (i.e. sample collected from either the surface, inside or a mixture of both the surface and inside of faeces, and faeces preservation methods (frozen or kept at room temperature in 95% ethanol on amplification success rates of mitochondrial DNA fragments of different sizes (450bp, 900bp, and 1600bp. The results showed that the amplification success rates decreased with sample age and amplicon size in both hair and faecal DNA. In subtropical environment, there was no significant difference between amplification success of DNA extracted from fresh and 7-day-old samples of either the hair or faeces. The amplification success rates were not influenced by sampling location of faeces. For faeces preserved in 95% ethanol, the amplification success appeared unaffected by frozen at -20 °C or kept at room temperature in shorter mtDNA fragments, but was significantly influenced when amplicon size was 1600bp. The results of this study will reinforce the optimization of noninvasive sampling approaches in Asiatic black bear research, especially in the subtropics.

DNA lability induced by nimustine and ramustine in rat glioma cells.

Science.gov (United States)

Mineura, K; Fushimi, S; Itoh, Y; Kowada, M

1988-01-01

The DNA labile sites induced by two nitrosoureas, nimustine (ACNU) and ramustine (MCNU) synthesised in Japan, have been examined in highly reiterated DNA sequences of rat glioma cells. Reiterated fragments of 167 and 203 base pairs (bp), obtained after Hind III and Hae III restriction endonuclease digestion of rat glioma cells DNA, were used as target DNA sequences to determine the labile sites. In vitro reaction with ACNU and MCNU resulted in scission products corresponding to the locations of guanine. Subsequent piperidine hydrolysis produced more frequent breaks of the phosphodiester bonds at guanine positions, thus forming alkali-labile sites. Images PMID:3236017

The MCM-associated protein MCM-BP is important for human nuclear morphology.

Science.gov (United States)

Jagannathan, Madhav; Sakwe, Amos M; Nguyen, Tin; Frappier, Lori

2012-01-01

Mini-chromosome maintenance complex-binding protein (MCM-BP) was discovered as a protein that is strongly associated with human MCM proteins, known to be crucial for DNA replication in providing DNA helicase activity. The Xenopus MCM-BP homologue appears to play a role in unloading MCM complexes from chromatin after DNA synthesis; however, the importance of MCM-BP and its functional contribution to human cells has been unclear. Here we show that depletion of MCM-BP by sustained expression of short hairpin RNA (shRNA) results in highly abnormal nuclear morphology and centrosome amplification. The abnormal nuclear morphology was not seen with depletion of other MCM proteins and was rescued with shRNA-resistant MCM-BP. MCM-BP depletion was also found to result in transient activation of the G2 checkpoint, slowed progression through G2 and increased replication protein A foci, indicative of replication stress. In addition, MCM-BP depletion led to increased cellular levels of MCM proteins throughout the cell cycle including soluble MCM pools. The results suggest that MCM-BP makes multiple contributions to human cells that are not limited to unloading of the MCM complex.

InterProScan Result: BP117067 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP117067 BP117067_1_ORF2 D483359C05197373 PFAM PF00067 p450 6e-05 T IPR001128 Cytochrome P450 Molecular... Function: monooxygenase activity (GO:0004497)|Molecular Function: iron ion binding (GO:0005506)|Molecular... Function: electron carrier activity (GO:0009055)|Molecular Function: heme binding (GO:0020037) ...

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

InterProScan Result: BP124291 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP124291 BP124291_5_ORF1 92B626ADD33C8436 PFAM PF00067 p450 1.8e-09 T IPR001128 Cytochrome P450 Molecular... Function: monooxygenase activity (GO:0004497)|Molecular Function: iron ion binding (GO:0005506)|Molecular... Function: electron carrier activity (GO:0009055)|Molecular Function: heme binding (GO:0020037) ...

InterProScan Result: BP123442 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP123442 BP123442_1_ORF1 331440C6CA592A17 PRINTS PR00385 P450 6.3e-05 T IPR001128 Cytochrome P450 Molecular... Function: monooxygenase activity (GO:0004497)|Molecular Function: iron ion binding (GO:0005506)|Molecular... Function: electron carrier activity (GO:0009055)|Molecular Function: heme binding (GO:0020037) ...

Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication

International Nuclear Information System (INIS)

Kanginakudru, Sriramana; DeSmet, Marsha; Thomas, Yanique; Morgan, Iain M.; Androphy, Elliot J.

2015-01-01

The evolutionarily conserved DNA topoisomerase II beta-binding protein 1 (TopBP1) functions in DNA replication, DNA damage response, and cell survival. We analyzed the role of TopBP1 in human and bovine papillomavirus genome replication. Consistent with prior reports, TopBP1 co-localized in discrete nuclear foci and was in complex with papillomavirus E2 protein. Similar to E2, TopBP1 is recruited to the region of the viral origin of replication during G1/S and early S phase. TopBP1 knockdown increased, while over-expression decreased transient virus replication, without affecting cell cycle. Similarly, using cell lines harboring HPV-16 or HPV-31 genome, TopBP1 knockdown increased while over-expression reduced viral copy number relative to genomic DNA. We propose a model in which TopBP1 serves dual roles in viral replication: it is essential for initiation of replication yet it restricts viral copy number. - Highlights: • Protein interaction study confirmed In-situ interaction between TopBP1 and E2. • TopBP1 present at papillomavirus ori in G1/S and early S phase of cell cycle. • TopBP1 knockdown increased, over-expression reduced virus replication. • TopBP1 protein level change did not influence cell survival or cell cycle. • TopBP1 displaced from papillomavirus ori after initiation of replication

Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication

Energy Technology Data Exchange (ETDEWEB)

Kanginakudru, Sriramana, E-mail: skangina@iu.edu [Department of Dermatology, Indiana University School of Medicine, Indianapolis, IN (United States); DeSmet, Marsha, E-mail: mdesmet@iupui.edu [Department of Dermatology, Indiana University School of Medicine, Indianapolis, IN (United States); Thomas, Yanique, E-mail: ysthomas@umail.iu.edu [Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN (United States); Morgan, Iain M., E-mail: immorgan@vcu.edu [VCU Philips Institute for Oral Health Research, Virginia Commonwealth University, Richmond, Virginia (United States); Androphy, Elliot J., E-mail: eandro@iu.edu [Department of Dermatology, Indiana University School of Medicine, Indianapolis, IN (United States); Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN (United States)

2015-04-15

The evolutionarily conserved DNA topoisomerase II beta-binding protein 1 (TopBP1) functions in DNA replication, DNA damage response, and cell survival. We analyzed the role of TopBP1 in human and bovine papillomavirus genome replication. Consistent with prior reports, TopBP1 co-localized in discrete nuclear foci and was in complex with papillomavirus E2 protein. Similar to E2, TopBP1 is recruited to the region of the viral origin of replication during G1/S and early S phase. TopBP1 knockdown increased, while over-expression decreased transient virus replication, without affecting cell cycle. Similarly, using cell lines harboring HPV-16 or HPV-31 genome, TopBP1 knockdown increased while over-expression reduced viral copy number relative to genomic DNA. We propose a model in which TopBP1 serves dual roles in viral replication: it is essential for initiation of replication yet it restricts viral copy number. - Highlights: • Protein interaction study confirmed In-situ interaction between TopBP1 and E2. • TopBP1 present at papillomavirus ori in G1/S and early S phase of cell cycle. • TopBP1 knockdown increased, over-expression reduced virus replication. • TopBP1 protein level change did not influence cell survival or cell cycle. • TopBP1 displaced from papillomavirus ori after initiation of replication.

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

[Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

Science.gov (United States)

Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

2011-01-01

The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

International Nuclear Information System (INIS)

Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

2012-01-01

Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

Energy Technology Data Exchange (ETDEWEB)

Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2012-04-20

Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

Evaluation of the efficiency and utility of recombinant enzyme-free seamless DNA cloning methods

Directory of Open Access Journals (Sweden)

Ken Motohashi

2017-03-01

Full Text Available Simple and low-cost recombinant enzyme-free seamless DNA cloning methods have recently become available. In vivo Escherichia coli cloning (iVEC can directly transform a mixture of insert and vector DNA fragments into E. coli, which are ligated by endogenous homologous recombination activity in the cells. Seamless ligation cloning extract (SLiCE cloning uses the endogenous recombination activity of E. coli cellular extracts in vitro to ligate insert and vector DNA fragments. An evaluation of the efficiency and utility of these methods is important in deciding the adoption of a seamless cloning method as a useful tool. In this study, both seamless cloning methods incorporated inserting DNA fragments into linearized DNA vectors through short (15–39 bp end homology regions. However, colony formation was 30–60-fold higher with SLiCE cloning in end homology regions between 15 and 29 bp than with the iVEC method using DH5α competent cells. E. coli AQ3625 strains, which harbor a sbcA gene mutation that activates the RecE homologous recombination pathway, can be used to efficiently ligate insert and vector DNA fragments with short-end homology regions in vivo. Using AQ3625 competent cells in the iVEC method improved the rate of colony formation, but the efficiency and accuracy of SLiCE cloning were still higher. In addition, the efficiency of seamless cloning methods depends on the intrinsic competency of E. coli cells. The competency of chemically competent AQ3625 cells was lower than that of competent DH5α cells, in all cases of chemically competent cell preparations using the three different methods. Moreover, SLiCE cloning permits the use of both homemade and commercially available competent cells because it can use general E. coli recA− strains such as DH5α as host cells for transformation. Therefore, between the two methods, SLiCE cloning provides both higher efficiency and better utility than the iVEC method for seamless DNA plasmid

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

Construction and identification of subtracted cDNA library in bone marrow cells of radon-exposed mice

International Nuclear Information System (INIS)

Li Jianxiang; Nie Jihua; Tong Jian; Fu Chunling; Zhou Jianwei

2008-01-01

Objective: To construct and identify subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation. Methods: Adult male BALB/c mice, weighing 18-22 g, were placed in a multi- functional radon chamber. One group of mice was exposed to radon up to the accumulative dose of 105 work level month (WLM). The control group of mice was housed in a room with an accumulative dose of 1 WLM. To construct a subtracted cDNA library enriched with differentially expressed genes, the SMART technique and the suppression subtractive hybridization were performed. The obtained forward and reverse cDNA fragments were directly inserted into pMD18-T vector and transformed into E. coli JM109. The inserting cDNA fragments were screened by the blue-and-white blot screening and nested PCR of bacterium liquid. Results: The 244 of 285 white bacteria clones obtained randomly were positive clones contained 100-1100 bp inserted cDNA fragments. Conclusions: The forward and reverse subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation is successfully constructed. (authors)

Detection the human mitochondrial DNA 4977 bp deletion induced by 60Co γ-rays in vitro by nest-PCR

International Nuclear Information System (INIS)

Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie; Chen Xiaosui

2004-01-01

Objective: To establish a method for detecting the mitochondrial DNA 4977 bp deletion (mtDNA 4977) induced by different doses of ionizing radiation. Methods: A nest-PCR method was established with 3 primer pairs for detecting the human peripheral mtDNA 4977. The final PCR products were sequenced after purified and the sequence was BLASTed with the standard genome information of human mitochondrion. The mtDNA 4977 level induced by 0-5 Gy 60 Co γ-rays of 5 healthy individuals was analyzed with the established nest-PCR. Results: The mtDNA 4977 could be detected by the established nest-PCR method. The mtDNA 4977 was observed on samples after exposed to 1-5 Gy 60 Co γ-rays, but it was not observed before (0 Gy) exposure. Conclusion: The nest-PCR method established in this study could be used to detect the mtDNA 4977 induced by ionizing radiation. (authors)

Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

International Nuclear Information System (INIS)

Wei Kang; Liu Xueying; Zhu Xuefen

1984-01-01

The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

Science.gov (United States)

Boyko, Alex; Kovalchuk, Igor

2010-01-01

Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

International Nuclear Information System (INIS)

Zhu Shoupeng; Xiao Dong; Han Xiaofeng

1997-01-01

The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

Metagenome Fragment Classification Using -Mer Frequency Profiles

Directory of Open Access Journals (Sweden)

Gail Rosen

2008-01-01

Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.

Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin

Directory of Open Access Journals (Sweden)

Mayra Eduardoff

2017-09-01

Full Text Available The analysis of mitochondrial DNA (mtDNA has proven useful in forensic genetics and ancient DNA (aDNA studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR is commonly sequenced using established Sanger-type Sequencing (STS protocols involving fragment sizes down to approximately 150 base pairs (bp. Recent developments include Massively Parallel Sequencing (MPS of (multiplex PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less, and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples, and tested challenging forensic samples (n = 2 as well as compromised solid tissue samples (n = 15 up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS

Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

Science.gov (United States)

Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

1996-01-01

For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

Directory of Open Access Journals (Sweden)

Jiabing Ji

Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

ATM signaling and 53BP1

International Nuclear Information System (INIS)

Zgheib, Omar; Huyen, Yentram; DiTullio, Richard A.; Snyder, Andrew; Venere, Monica; Stavridi, Elena S.; Halazonetis, Thanos D.

2005-01-01

The ATM (mutated in Ataxia-Telangiectasia) protein kinase is an important player in signaling the presence of DNA double strand breaks (DSBs) in higher eukaryotes. Recent studies suggest that ATM monitors the presence of DNA DSBs indirectly, through DNA DSB-induced changes in chromatin structure. One of the proteins that sense these chromatin structure changes is 53BP1, a DNA damage checkpoint protein conserved in all eukaryotes and the putative ortholog of the S. cerevisiae RAD9 protein. We review here the mechanisms by which ATM is activated in response to DNA DSBs, as well as key ATM substrates that control cell cycle progression, apoptosis and DNA repair

A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

Science.gov (United States)

Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

2015-07-01

In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

Analysis of mitochondrial DNA: taxonomic and phylogenetic relationships in two fish taxa (Pisces: Mugilidae and Cyprinidae).

Science.gov (United States)

Semina, A V; Polyakova, N E; Brykov, Vl A

2007-12-01

To solve some systematic questions as well as to study genetic variability and evolutionary relationships in two groups of fish belonging to the Mugilid (Mugilidae) and Cyprinid (Cyprinidae) families, we have used restriction fragment length polymorphism analysis of mitochondrial DNA (mtDNA) fragments amplified in polymerase chain reaction. The analysis of three mtDNA fragments of 7220 bp total length of six Mugilid species has shown that Mediterranean Liza aurata, L. ramada, L. saliens, and Chelon labrosus form a common cluster, L. aurata and C. labrosus being the closest relatives, whereas L. haematocheilus (syn. C. haematocheilus) of the Sea of Japan forms a sister group to the Mediterranean cluster. It was found that Chelon and Liza genera are paraphyletic, and therefore their division into two genera is unnatural and they should be synonymized. According to priority, Liza species should be ascribed to Chelon genus. Mugil cephalus is the most distant compared to the rest of the species studied. The level of genetic divergence between allopatric samples of M. cephalus from the Sea of Japan and the Mediterranean Sea has proved to be very high--4.5% of nucleotide substitutions. The analysis of four mtDNA fragments of 9340 bp total length of six Cyprinid species has shown that L. waleckii is the most genetically distant. Pseudaspius leptocephalus is a sister group to Tribolodon species. All Tribolodon species form a common cluster with T. sachalinensis as a root. The remaining species form two branches, one of which includes T. nakamurai and T. brandtii, another one combines T. hakonensis and a new form of Tribolodon revealed that is close to T. hakonensis by its mtDNA (2.4% of nucleotide substitutions). This new form might be an independent species.

Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

International Nuclear Information System (INIS)

Sage, E.; Moustacchi, E.

1987-01-01

The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

Evidence supporting a role for TopBP1 and Brd4 in the initiation but not continuation of human papillomavirus 16 E1/E2-mediated DNA replication.

Science.gov (United States)

Gauson, Elaine J; Donaldson, Mary M; Dornan, Edward S; Wang, Xu; Bristol, Molly; Bodily, Jason M; Morgan, Iain M

2015-05-01

To replicate the double-stranded human papillomavirus 16 (HPV16) DNA genome, viral proteins E1 and E2 associate with the viral origin of replication, and E2 can also regulate transcription from adjacent promoters. E2 interacts with host proteins in order to regulate both transcription and replication; TopBP1 and Brd4 are cellular proteins that interact with HPV16 E2. Previous work with E2 mutants demonstrated the Brd4 requirement for the transactivation properties of E2, while TopBP1 is required for DNA replication induced by E2 from the viral origin of replication in association with E1. More-recent studies have also implicated Brd4 in the regulation of DNA replication by E2 and E1. Here, we demonstrate that both TopBP1 and Brd4 are present at the viral origin of replication and that interaction with E2 is required for optimal initiation of DNA replication. Both cellular proteins are present in E1-E2-containing nuclear foci, and the viral origin of replication is required for the efficient formation of these foci. Short hairpin RNA (shRNA) against either TopBP1 or Brd4 destroys the E1-E2 nuclear bodies but has no effect on E1-E2-mediated levels of DNA replication. An E2 mutation in the context of the complete HPV16 genome that compromises Brd4 interaction fails to efficiently establish episomes in primary human keratinocytes. Overall, the results suggest that interactions between TopBP1 and E2 and between Brd4 and E2 are required to correctly initiate DNA replication but are not required for continuing DNA replication, which may be mediated by alternative processes such as rolling circle amplification and/or homologous recombination. Human papillomavirus 16 (HPV16) is causative in many human cancers, including cervical and head and neck cancers, and is responsible for the annual deaths of hundreds of thousands of people worldwide. The current vaccine will save lives in future generations, but antivirals targeting HPV16 are required for the alleviation of disease

Gene prediction in metagenomic fragments: A large scale machine learning approach

Directory of Open Access Journals (Sweden)

Morgenstern Burkhard

2008-04-01

Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

The last Viking King: a royal maternity case solved by ancient DNA analysis

DEFF Research Database (Denmark)

Dissing, Jørgen; Binladen, Jonas; Hansen, Anders

2006-01-01

Estridsen to haplogroup H; Estrid's sequence differed from that of Sven at two positions in HVR-1, 16093T-->C and 16304T-->C, indicating that she belongs to subgroup H5a. Given the maternal inheritance of mtDNA, offspring will have the same mtDNA sequence as their mother with the exception of rare cases...... doubts among historians whether the woman entombed was indeed Estrid. To shed light on this problem, we have extracted and analysed mitochondrial DNA (mtDNA) from pulp of teeth from each of the two royals. Four overlapping DNA-fragments covering about 400bp of hypervariable region 1 (HVR-1) of the D...

EST Table: BP117517 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP117517 ce--0464 10/09/28 63 %/173 aa ref|XP_002092422.1| GE14184 [Drosophila yakuba] gb|EDW92134.1| GE14...184 [Drosophila yakuba] 10/08/28 63 %/173 aa FBpp0259194|DyakGE14184-PA 10/08/28 35 %

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

International Nuclear Information System (INIS)

Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

1998-01-01

Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

The fission yeast minichromosome maintenance (MCM)-binding protein (MCM-BP), Mcb1, regulates MCM function during prereplicative complex formation in DNA replication.

Science.gov (United States)

Santosa, Venny; Martha, Sabrina; Hirose, Noriaki; Tanaka, Katsunori

2013-03-08

The minichromosome maintenance (MCM) complex is a replicative helicase, which is essential for chromosome DNA replication. In recent years, the identification of a novel MCM-binding protein (MCM-BP) in most eukaryotes has led to numerous studies investigating its function and its relationship to the MCM complex. However, the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood; in addition, the functional role of MCM-BP remains controversial and may vary between model organisms. The present study aims to elucidate the nature and biological function of the MCM-BP ortholog, Mcb1, in fission yeast. The Mcb1 protein continuously interacts with MCM proteins during the cell cycle in vivo and can interact with any individual MCM subunit in vitro. To understand the detailed characteristics of mcb1(+), two temperature-sensitive mcb1 gene mutants (mcb1(ts)) were isolated. Extensive genetic analysis showed that the mcb1(ts) mutants were suppressed by a mcm5(+) multicopy plasmid and displayed synthetic defects with many S-phase-related gene mutants. Moreover, cyclin-dependent kinase modulation by Cig2 repression or Rum1 overproduction suppressed the mcb1(ts) mutants, suggesting the involvement of Mcb1 in pre-RC formation during DNA replication. These data are consistent with the observation that Mcm7 loading onto replication origins is reduced and S-phase progression is delayed in mcb1(ts) mutants. Furthermore, the mcb1(ts) mutation led to the redistribution of MCM subunits to the cytoplasm, and this redistribution was dependent on an active nuclear export system. These results strongly suggest that Mcb1 promotes efficient pre-RC formation during DNA replication by regulating the MCM complex.

The Fission Yeast Minichromosome Maintenance (MCM)-binding Protein (MCM-BP), Mcb1, Regulates MCM Function during Prereplicative Complex Formation in DNA Replication*

Science.gov (United States)

Santosa, Venny; Martha, Sabrina; Hirose, Noriaki; Tanaka, Katsunori

2013-01-01

The minichromosome maintenance (MCM) complex is a replicative helicase, which is essential for chromosome DNA replication. In recent years, the identification of a novel MCM-binding protein (MCM-BP) in most eukaryotes has led to numerous studies investigating its function and its relationship to the MCM complex. However, the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood; in addition, the functional role of MCM-BP remains controversial and may vary between model organisms. The present study aims to elucidate the nature and biological function of the MCM-BP ortholog, Mcb1, in fission yeast. The Mcb1 protein continuously interacts with MCM proteins during the cell cycle in vivo and can interact with any individual MCM subunit in vitro. To understand the detailed characteristics of mcb1+, two temperature-sensitive mcb1 gene mutants (mcb1ts) were isolated. Extensive genetic analysis showed that the mcb1ts mutants were suppressed by a mcm5+ multicopy plasmid and displayed synthetic defects with many S-phase-related gene mutants. Moreover, cyclin-dependent kinase modulation by Cig2 repression or Rum1 overproduction suppressed the mcb1ts mutants, suggesting the involvement of Mcb1 in pre-RC formation during DNA replication. These data are consistent with the observation that Mcm7 loading onto replication origins is reduced and S-phase progression is delayed in mcb1ts mutants. Furthermore, the mcb1ts mutation led to the redistribution of MCM subunits to the cytoplasm, and this redistribution was dependent on an active nuclear export system. These results strongly suggest that Mcb1 promotes efficient pre-RC formation during DNA replication by regulating the MCM complex. PMID:23322785

EST Table: BP124521 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP124521 epV32477 10/09/28 59 %/164 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 55 %/163 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

EST Table: BP123885 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP123885 epV31590 10/09/28 57 %/174 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 55 %/163 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

EST Table: BP125106 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP125106 fbpv0387 10/09/28 58 %/165 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 56 %/165 aa FBpp0212871|DsimGD14469-PA 10/08/28 n.h 10/09/1

EST Table: BP125521 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP125521 fbpv0944 10/09/28 59 %/165 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 56 %/164 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

EST Table: BP125005 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP125005 fbpv0197 10/09/28 58 %/185 aa dbj|BAA86911.1| homologue of Sarcophaga 26,29kDa proteinase [Periplan...eta americana] 10/08/29 58 %/173 aa FBpp0160847|DmojGI11630-PA 10/08/28 n.h 10/09/1

EST Table: BP121749 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP121749 ceN-5256 10/09/28 100 %/172 aa ref|NP_001036831.1| saposin-related [Bombyx...|GB16561-PA 10/09/10 44 %/178 aa gi|91077504|ref|XP_966852.1| PREDICTED: similar to saposin isoform 1 [Tribolium castaneum] FS791050 ceN- ...

EST Table: BP121763 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP121763 ceN-5273 10/09/28 99 %/184 aa ref|NP_001036831.1| saposin-related [Bombyx ...GB16561-PA 10/09/10 43 %/192 aa gi|91077504|ref|XP_966852.1| PREDICTED: similar to saposin isoform 1 [Tribolium castaneum] FS791050 ceN- ...

EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

Directory of Open Access Journals (Sweden)

S. Yu. Borovets

2017-01-01

Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

EST Table: BP182610 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP182610 NRPG0829 10/09/28 35 %/122 aa ref|XP_967620.1| PREDICTED: similar to anopheles stephen...nl|Amel|GB19565-PA 10/09/10 35 %/122 aa gi|91093471|ref|XP_967620.1| PREDICTED: similar to anopheles stephensi ubiquitin, putative [Tribolium castaneum] FS914988 NRPG ...

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

Science.gov (United States)

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

BP1 Homeoprotein Enhances Metastatic Potential in ER-negative Breast Cancer

Science.gov (United States)

Fu, Yebo; Lian, Yi; Kim, Kyung Soon; Zhang, Lei; Hindle, A. Katharine; Brody, Fred; Siegel, Robert S.; McCaffrey, Timothy A.; Fu, Sidney W.

2010-01-01

Tumor invasion and metastasis remain a major cause of mortality in breast cancer patients. It was reported that BP1, a homeobox isoform of DLX4, is overexpressed in 80% of breast cancer patients and in 100% of estrogen receptor negative (ER-) tumors. The prevalence of BP1 positive cells and the intensity of BP1 immunoreactivity increased with the extent of ductal proliferation and tumorigenesis. These findings imply that BP1 may play an important role in ER- breast cancer. We sought to determine the effects and mechanisms of BP1 on cell proliferation and metastasis using ER- Hs578T cells as a model. Cells were transfected with either pcDNA3.2 plasmid containing BP1 gene, or pcDNA3.2 vector, then selected and cloned. Overexpression of BP1 increased cell proliferation rate by 2-5 fold (p=2.0. Of those genes, 49 were up-regulated and 22 were down-regulated. Significant pathways were identified involving cell proliferation and metastasis. These data demonstrated that overexpression of BP1 significantly enhanced cell proliferation and metastatic potential in ER- Hs578T cells. Further analysis with more ER- cell lines and patient samples is warranted to establish BP1 as a therapeutic target for ER- breast cancer. PMID:20842225

EST Table: BP121050 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP121050 ceN-4078 10/09/28 35 %/122 aa ref|XP_967620.1| PREDICTED: similar to anopheles stephen...nl|Amel|GB19565-PA 10/09/10 35 %/122 aa gi|91093471|ref|XP_967620.1| PREDICTED: similar to anopheles stephensi ubiquitin, putative [Tribolium castaneum] FS914988 ceN- ...

Direct PCR amplification of the HVSI region in mitochondrial DNA from buccal cell swabs

Directory of Open Access Journals (Sweden)

Kovačević-Grujičić Nataša

2012-01-01

Full Text Available Amplification of human mitochondrial DNA (mtDNA has been widely used in population genetics, human evolutionary and molecular anthropology studies. mtDNA hypervariable segments I and II (HVSI and HVSII were shown to be a suitable tool in genetic analyses due to the unique properties of mtDNA, such as the lack of recombination, maternal mode of inheritance, rapid evolutionary rate and high population-specific polymorphisms. Here we present a rapid and low-cost method for direct PCR amplification of a 330 bp fragment of HVSI from buccal cell samples. Avoiding the DNA isolation step makes this method appropriate for the analysis of a large number of samples in a short period of time. Since the transportation of samples and fieldwork conditions can affect the quality of samples and subsequent DNA analysis, we tested the effects of long-term storage of buccal cell swabs on the suitability of such samples for direct PCR amplification. We efficiently amplified a 330 bp fragment of HVSI even after the long-term storage of buccal cells at room temperature, +4°C or at -20°C, for up to eight months. All examined PCR products were successfully sequenced, regardless of sample storage time and conditions. Our results suggest that the direct PCR amplification of the HVSI region from buccal cells is a method well suited for large-scale mtDNA population studies.[Acknowledgments. This work was supported by the Ministry of Education and Science of the Republic of Serbia (Grant no. III 47025.

Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

Directory of Open Access Journals (Sweden)

Stephane Boyer

Full Text Available DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI is over 600 base pairs (bp, amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R. This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey DNA from 46 landsnail (predator faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1 when dealing with degraded DNA for which only small fragments can be amplified, (2 for cases where no consensus has yet been reached on the appropriate barcode gene, or (3 to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

Science.gov (United States)

Boyer, Stephane; Brown, Samuel D J; Collins, Rupert A; Cruickshank, Robert H; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D

2012-01-01

DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Directory of Open Access Journals (Sweden)

Jorge A. Bertolotto

2016-06-01

Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Science.gov (United States)

Bertolotto, Jorge A.; Umazano, Juan P.

2016-06-01

In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

Science.gov (United States)

de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

2015-03-01

Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

A secreted aspartic proteinase from Glomerella cingulata: purification of the enzyme and molecular cloning of the cDNA.

Science.gov (United States)

Clark, S J; Templeton, M D; Sullivan, P A

1997-04-01

A secreted aspartic proteinase from Glomerella cingulata (GcSAP) was purified to homogeneity by ion exchange chromatography. The enzyme has an M, of 36000 as estimated by SDS-PAGE, optimal activity from pH 3.5 to pH 4.0 and is inhibited by pepstatin. The N-terminal sequence, 23 residues long, was used to design a gene-specific primer. This was used in 3' RACE (rapid amplification of cDNA ends) PCR to amplify a 1.2 kb fragment of the gcsap cDNA. A second gene-specific primer was designed and used in 5' RACE PCR to clone the 5' region. This yielded a 600 bp DNA fragment and completed the open reading frame. The gcsap open reading frame encodes a protein with a 78 residue prepro-sequence typical of other fungal secreted aspartic proteinases. Based on the deduced sequence, the mature enzyme contains 329 amino acids and shows approximately 40% identity to other fungal aspartic proteinases. Subsequent cloning and sequencing of gcsap fragments obtained from PCR with genomic DNA revealed a 73 bp intron beginning at nt 728. Southern analyses at medium and high stringency indicated that G. cingulata possesses one gene for the secreted aspartic proteinase, and Northern blots indicated that gene expression was induced by exogenous protein and repressed by ammonium salts. GcSAP is a putative pathogenicity factor of G. cingulata, and it will now be possible to create SAP-mutants and assess the role GcSAP plays in pathogenicity.

Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

Science.gov (United States)

Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

2016-06-20

Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

Directory of Open Access Journals (Sweden)

George Anifandis

2018-05-01

Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

Typing of Mycobacterium avium subspecies paratuberculosis isolates from Newfoundland using fragment analysis.

Directory of Open Access Journals (Sweden)

Milka P Podder

Full Text Available Short Sequence Repeat (SSR typing of Mycobacterium avium subspecies paratuberculosis (Map isolates is one of the most commonly used method for genotyping this pathogen. Currently used techniques have challenges in analyzing mononucleotide repeats >15 bp, which include some of the Map SSRs. Fragment analysis is a relatively simple technique, which can accurately measure the size of DNA fragments and can be used to calculate the repeat length of the target SSR loci. In the present study, fragment analysis was used to analyze 4 Map SSR loci known to provide sufficient discriminatory power to determine the relationship between Map isolates. Eighty-five Map isolates from 18 animals from the island of Newfoundland were successfully genotyped using fragment analysis. To the best of our knowledge, this is the first report on Map SSR diversity from Newfoundland dairy farms. Previously unreported Map SSR-types or combinations were also identified during the course of the described work. In addition, multiple Map SSR-types were isolated from a single animal in many cases, which is not a common finding.

Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

Science.gov (United States)

Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

2017-12-01

In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

MCM-BP regulates unloading of the MCM2–7 helicase in late S phase

Science.gov (United States)

Nishiyama, Atsuya; Frappier, Lori; Méchali, Marcel

2011-01-01

Origins of DNA replication are licensed by recruiting MCM2–7 to assemble the prereplicative complex (pre-RC). How MCM2–7 is inactivated or removed from chromatin at the end of S phase is still unclear. Here, we show that MCM-BP can disassemble the MCM2–7 complex and might function as an unloader of MCM2–7 from chromatin. In Xenopus egg extracts, MCM-BP exists in a stable complex with MCM7, but is not associated with the MCM2–7 hexameric complex. MCM-BP accumulates in nuclei in late S phase, well after the loading of MCM2–7 onto chromatin. MCM-BP immunodepletion in Xenopus egg extracts inhibits replication-dependent MCM dissociation without affecting pre-RC formation and DNA replication. When excess MCM-BP is incubated with Xenopus egg extracts or immunopurified MCM2–7, it binds to MCM proteins and promotes disassembly of the MCM2–7 complex. Recombinant MCM-BP also releases MCM2–7 from isolated late-S-phase chromatin, but this activity is abolished when DNA replication is blocked. MCM-BP silencing in human cells also delays MCM dissociation in late S phase. We propose that MCM-BP plays a key role in the mechanism by which pre-RC is cleared from replicated DNA in vertebrate cells. PMID:21196493

Effect of superoxide dismutase supplementation on sperm DNA fragmentation

Directory of Open Access Journals (Sweden)

Luciano Negri

2017-10-01

Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

International Nuclear Information System (INIS)

Al-Gubory, Kais H.

2005-01-01

The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

EST Table: BP182659 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP182659 NRPG0886 10/09/28 51 %/153 aa ref|XP_001659582.1| xaa-pro dipeptidase pepd/pepq(e.coli...) [Aedes aegypti] gb|EAT39285.1| xaa-pro dipeptidase pepd/pepq(e.coli) [Aedes aegypti] 10/08/29 ...33738|ref|XP_971576.2| PREDICTED: similar to xaa-pro dipeptidase pepd/pepq(e.coli) [Tribolium castaneum] FS768084 NRPG ...

EST Table: BP125370 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available 10 56 %/150 aa gi|189241063|ref|XP_967018.2| PREDICTED: similar to restin (Reed-Steinberg cell-expressed intermediate filament-associated protein) [Tribolium castaneum] FS906662 fbpv ... ...n (Reed-Steinberg cell-expressed intermediate filament-associated protein) [Tribolium castaneum] 10/08/29 55...BP125370 fbpv0758 10/09/28 56 %/150 aa ref|XP_967018.2| PREDICTED: similar to resti

EST Table: BP182152 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP182152 NRPG0186 10/09/28 87 %/125 aa ref|NP_001098702.1| nanos-like protein [Bomb...yx mori] gb|ABS17681.1| nanos-like protein [Bombyx mori] 10/08/29 low homology 10/08/28 n.h 10/09/10 low homology 10/09/10 low homology 10/09/10 low homology NM_001105232 NRPG ...

125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

International Nuclear Information System (INIS)

Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

1987-01-01

The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

Science.gov (United States)

Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

2014-12-15

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

EST Table: BP183868 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP183868 P5PG0462 10/09/28 50 %/126 aa ref|XP_001659582.1| xaa-pro dipeptidase pepd/pepq(e.coli...) [Aedes aegypti] gb|EAT39285.1| xaa-pro dipeptidase pepd/pepq(e.coli) [Aedes aegypti] 10/08/29 ...33738|ref|XP_971576.2| PREDICTED: similar to xaa-pro dipeptidase pepd/pepq(e.coli) [Tribolium castaneum] FS768084 P5PG ...

EST Table: BP126151 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available BP126151 ps4M0084 10/09/28 52 %/232 aa ref|XP_001659582.1| xaa-pro dipeptidase pepd/pepq(e.coli...) [Aedes aegypti] gb|EAT39285.1| xaa-pro dipeptidase pepd/pepq(e.coli) [Aedes aegypti] 10/08/29 ...33738|ref|XP_971576.2| PREDICTED: similar to xaa-pro dipeptidase pepd/pepq(e.coli) [Tribolium castaneum] FS768084 ps4M ...

Cloning and characterisation of the sagA gene of Aspergillus nidulans: a gene which affects sensitivity to DNA-damaging agents.

Science.gov (United States)

Jones, G W; Hooley, P; Farrington, S M; Shawcross, S G; Iwanejko, L A; Strike, P

1999-03-01

Mutations within the sagA gene of Aspergillus nidulans cause sensitisation to DNA-damaging chemicals but have no effect upon spontaneous or damage-induced mutation frequency. The sagA gene was cloned on a 19-kb cosmid-derived fragment by functional complementation of a sagA1 sagC3 double mutant; subsequently, a fragment of the gene was also isolated on a 3.9-kb genomic subclone. Initial sequencing of a small section of the 19-kb fragment allowed the design of primers that were subsequently used in RTPCR experiments to show that this DNA is transcribed. A 277-bp fragment derived from the transcribed region was used to screen an A. nidulans cDNA library, resulting in the isolation of a 1.4-kb partial cDNA clone which had sequence overlap with the genomic sagA fragment. This partial cDNA was incomplete but appeared to contain the whole coding region of sagA. The sagA1 mutant was shown to possess two mutations; a G-T transversion and a+ 1 frameshift due to insertion of a T. causing disruption to the C-terminal region of the SagA protein. Translation of the sagA cDNA predicts a protein of 378 amino acids, which has homology to the Saccharomyces cerevisiae End3 protein and also to certain mammalian proteins capable of causing cell transformation.

DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

Science.gov (United States)

Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

2017-09-01

Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

[Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

Science.gov (United States)

Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

2016-09-01

Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

[Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

Science.gov (United States)

Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

2015-08-01

In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

Science.gov (United States)

Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

1974-01-01

By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs

DEFF Research Database (Denmark)

Yuan, Xiao Long; Zhang, Zhe; Pan, Rong Yang

2017-01-01

sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40...

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

International Nuclear Information System (INIS)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki; Ohashi, Yuko; Kano-Murakami, Yuriko; Ozeki, Yoshihiro

1989-01-01

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M r of its subunit was 77,000. The cells converted [ 14 C]-L-phenylalanine into [ 14 C]-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading frame capable of coding for a polypeptide with 707 amino acids (M r 77,137), a 22-bp 5'-noncoding region and a 207-bp 3'-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology

BP1 Homeoprotein Enhances Metastatic Potential in Er-Negative Breast Cancer

Directory of Open Access Journals (Sweden)

Yebo Fu, Yi Lian, Kyung Soon Kim, Lei Zhang, A. Katharine Hindle, Fred Brody, Robert S. Siegel, Timothy A. McCaffrey, Sidney W. Fu

2010-01-01

Full Text Available Tumor invasion and metastasis remain a major cause of mortality in breast cancer patients. It was reported that BP1, a homeobox isoform of DLX4, is overexpressed in 80% of breast cancer patients and in 100% of estrogen receptor negative (ER- tumors. The prevalence of BP1 positive cells and the intensity of BP1 immunoreactivity increased with the extent of ductal proliferation and tumorigenesis. These findings imply that BP1 may play an important role in ER- breast cancer. I sought to determine the effects and mechanisms of BP1 on cell proliferation and metastasis using ER- Hs578T cells as a model. Cells were transfected with either pcDNA3.2 plasmid containing BP1 gene, or pcDNA3.2 vector, then selected and cloned. Overexpression of BP1 increased cell proliferation rate by 2-5 fold (p<0.005, and enhanced the in vitro invasive activity by 25-65 fold (p<0.001. Microarray experiments were performed to identify differentially expressed genes when BP1 is overexpressed. The gene expression profile of the transfected cell lines were compared, resulting in 71 differentially expressed genes with a fold-change of >=2.0. Of those genes, 49 were up-regulated and 22 were down-regulated. Significant pathways were identified involving cell proliferation and metastasis. These data demonstrated that overexpression of BP1 significantly enhanced cell proliferation and metastatic potential in ER- Hs578T cells. Further analysis with more ER- cell lines and patient samples is warranted to establish BP1 as a therapeutic target.

BanII dimorphic site located in the third intron of the human apolipoprotein AI (APOA1) gene

Energy Technology Data Exchange (ETDEWEB)

Coleman, R T; Kresnak, M T; Frossard, P M

1988-02-11

A 0.7kb fragment generated by AvaII digestion of pBL13AI, a 0.965kb full-length human apolipoprotein AI cDNA was cloned into the EcoRI site of pBR322. The apoAI cDNA was isolated from a lambdagt10 human fetal liver cDNA library. BanII (GPuGCPyC) (International Biotechnologies, Inc.) identifies two invariant bands at 1122bp and 417bp, and a single two-allele polymorphism with bands at either 274bp or 452bp. The human apolipoprotein AI-CIII-AIV gene complex has been localized on the long arm of chromosome 11 by Southern blot analysis of human-chinese hamster cell hybrids. Co-dominant segregation has been observed in two families (13 individuals). The BanII restriction map was constructed from DNA sequence data of the human apoAI gene. The 452bp fragment is generated by the loss of a BanII dimorphic site in the third intron of the apoAI gene, between the 178bp and the 274bp fragments.

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

EST Table: BP183486 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available n (Reed-Steinberg cell-expressed intermediate filament-associated protein) [Tribolium castaneum] 10/08/29 56...43 aa gnl|Amel|GB30360-PB 10/09/10 54 %/174 aa gi|189241063|ref|XP_967018.2| PREDICTED: similar to restin (Reed-Steinberg cell-expres...sed intermediate filament-associated protein) [Tribolium castaneum] FS906662 NRPG ... ...BP183486 NRPG1970 10/09/28 54 %/174 aa ref|XP_967018.2| PREDICTED: similar to resti

Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

Directory of Open Access Journals (Sweden)

Cheuk-Chun Szeto

Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

Science.gov (United States)

Pegels, N; González, I; Fernández, S; García, T; Martín, R

2012-01-01

A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

Interactions of the human MCM-BP protein with MCM complex components and Dbf4.

Directory of Open Access Journals (Sweden)

Tin Nguyen

Full Text Available MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK.

Interactions of the human MCM-BP protein with MCM complex components and Dbf4.

Science.gov (United States)

Nguyen, Tin; Jagannathan, Madhav; Shire, Kathy; Frappier, Lori

2012-01-01

MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK.

A cell cycle-dependent regulatory circuit composed of 53BP1-RIF1 and BRCA1-CtIP controls DNA repair pathway choice.

Science.gov (United States)

Escribano-Díaz, Cristina; Orthwein, Alexandre; Fradet-Turcotte, Amélie; Xing, Mengtan; Young, Jordan T F; Tkáč, Ján; Cook, Michael A; Rosebrock, Adam P; Munro, Meagan; Canny, Marella D; Xu, Dongyi; Durocher, Daniel

2013-03-07

DNA double-strand break (DSB) repair pathway choice is governed by the opposing activities of 53BP1 and BRCA1. 53BP1 stimulates nonhomologous end joining (NHEJ), whereas BRCA1 promotes end resection and homologous recombination (HR). Here we show that 53BP1 is an inhibitor of BRCA1 accumulation at DSB sites, specifically in the G1 phase of the cell cycle. ATM-dependent phosphorylation of 53BP1 physically recruits RIF1 to DSB sites, and we identify RIF1 as the critical effector of 53BP1 during DSB repair. Remarkably, RIF1 accumulation at DSB sites is strongly antagonized by BRCA1 and its interacting partner CtIP. Lastly, we show that depletion of RIF1 is able to restore end resection and RAD51 loading in BRCA1-depleted cells. This work therefore identifies a cell cycle-regulated circuit, underpinned by RIF1 and BRCA1, that governs DSB repair pathway choice to ensure that NHEJ dominates in G1 and HR is favored from S phase onward. Copyright © 2013 Elsevier Inc. All rights reserved.

Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

Science.gov (United States)

Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

2014-01-01

The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

Mitochondrial DNA variation, but not nuclear DNA, sharply divides morphologically identical chameleons along an ancient geographic barrier.

Directory of Open Access Journals (Sweden)

Dan Bar Yaacov

Full Text Available The Levant is an important migration bridge, harboring border-zones between Afrotropical and palearctic species. Accordingly, Chameleo chameleon, a common species throughout the Mediterranean basin, is morphologically divided in the southern Levant (Israel into two subspecies, Chamaeleo chamaeleon recticrista (CCR and C. c. musae (CCM. CCR mostly inhabits the Mediterranean climate (northern Israel, while CCM inhabits the sands of the north-western Negev Desert (southern Israel. AFLP analysis of 94 geographically well dispersed specimens indicated moderate genetic differentiation (PhiPT = 0.097, consistent with the classical division into the two subspecies, CCR and CCM. In contrast, sequence analysis of a 637 bp coding mitochondrial DNA (mtDNA fragment revealed two distinct phylogenetic clusters which were not consistent with the morphological division: one mtDNA cluster consisted of CCR specimens collected in regions northern of the Jezreel Valley and another mtDNA cluster harboring specimens pertaining to both the CCR and CCM subspecies but collected southern of the Jezreel Valley. AMOVA indicated clear mtDNA differentiation between specimens collected northern and southern to the Jezreel Valley (PhiPT = 0.79, which was further supported by a very low coalescent-based estimate of effective migration rates. Whole chameleon mtDNA sequencing (∼17,400 bp generated from 11 well dispersed geographic locations revealed 325 mutations sharply differentiating the two mtDNA clusters, suggesting a long allopatric history further supported by BEAST. This separation correlated temporally with the existence of an at least 1 million year old marine barrier at the Jezreel Valley exactly where the mtDNA clusters meet. We discuss possible involvement of gender-dependent life history differences in maintaining such mtDNA genetic differentiation and suggest that it reflects (ancient local adaptation to mitochondrial-related traits.

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

International Nuclear Information System (INIS)

Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

2010-01-01

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

Energy Technology Data Exchange (ETDEWEB)

Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

2010-01-05

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

International Nuclear Information System (INIS)

Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

1998-01-01

The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

Construction of C35 gene bait recombinants and T47D cell cDNA library.

Science.gov (United States)

Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

2017-11-20

C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

Science.gov (United States)

Bille, Todd W; Cromartie, Carter; Farr, Matthew

2009-09-01

This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

Response of BP cell lines to γ-radiation: evaluation of DNA repair and apoptosis

International Nuclear Information System (INIS)

Paris, F.E.; Martin, M.; Le Rhum, Y.; May, E.; Duriez, P; Shah, G.

1997-01-01

In the BP cell lines, mutation of p53 gene is associated with an increased radiosensitivity. In order to understand the relation between p53 and radiosensitivity, we looked at DNA repair and cell death. Unexpectedly, after radiation the mutated p53 cell line BPp- Tu and the wild type p53 cell line BPp- Tu cells, both ell lines died by the same non necrotic process: a programmed cell death independent of their p53 status. The cleavage of poly (ADP-ribose) polymerase (PARP) by an ICE-related protease is considered an early and critical event during apoptosis. The fate of PARP was monitored by Western extensively in the apoptotic BPp- Tu cells than in the BPp cells. This faster PARP cleavage might be linked to the increased radiosensitivity of the BPp- Tu cells. (authors)

Fragmentation of Pb-Projectiles at SPS Energies

CERN Multimedia

2002-01-01

% EMU17 \\\\ \\\\ We have exposed stacks consisting of solid state nuclear track detectors (CR-39 plastic and BP-1 glass) and different target materials at the SPS to beams of Pb projectiles. Our detectors record tracks of relativistic nuclei with charge numbers of Z~$\\geq$~6 for CR-39 and Z~$\\geq$75 for BP-1. After development of the tracks by etching they are detected and measured using completely automated microscope systems. Thus experiments with high statistics are possible. \\\\ \\\\BP-1 detectors were exposed to measure total charge changing cross sections and elemental production cross sections for heavy projectile fragments. These experiments were performed for different targets CH$ _{2} $, C, Al, Cu, Ag and Pb. Comparison of the results for different targets allows to investigate contributions to charge changing reactions by electromagnetic dissociation. Multifragmentation events in which several intermediate mass fragments are emitted from the heavy Pb projectile are studied using stacks containing CR-39 d...

Coupling of an indicator-free electrochemical DNA biosensor with polymerase chain reaction for the detection of DNA sequences related to the apolipoprotein E

Energy Technology Data Exchange (ETDEWEB)

Lucarelli, Fausto; Marrazza, Giovanna; Palchetti, Ilaria; Cesaretti, S.; Mascini, Marco

2002-09-26

This paper describes a disposable indicator-free electrochemical DNA biosensor applied to the detection of apolipoprotein E (apoE) sequences in PCR samples. In the indicator-free assays, the duplex formation was detected by measuring the electrochemical signal of the guanine base of nucleic acids. The biosensor format involved the immobilisation of an inosine-modified (guanine-free) probe onto a screen-printed electrode (SPE) transducer and the detection of the duplex formation in connection with the square-wave voltammetric measurement of the oxidation peak of the guanine of the target sequence. The indicator-free scheme has been characterised using 23-mer oligonucleotides as model: parameters affecting the hybridisation assay such as probe immobilisation conditions, hybridisation time, use of hybridisation accelerators were examined and optimised. The analysis of PCR samples (244 bp DNA fragments, obtained by amplification of DNA extracted from human blood) required a further optimisation of the experimental procedure. In particular, a lower steric hyndrance of the probe modified surface was essential to allow an efficient hybridisation of the target DNA fragment. Negative controls have been performed using the PCR blank and amplicons unrelated to the immobilised probe. A 10 min hybridisation time allowed a full characterisation of each sample.

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Science.gov (United States)

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

Science.gov (United States)

Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

2011-05-01

Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.

Characterization of the microDNA through the response to chemotherapeutics in lymphoblastoid cell lines.

Directory of Open Access Journals (Sweden)

Pamela Mehanna

Full Text Available Recently, a new class of extrachromosomal circular DNA, called microDNA, was identified. They are on average 100 to 400 bp long and are derived from unique non-repetitive genomic regions with high gene density. MicroDNAs are thought to arise from DNA breaks associated with RNA metabolism or replication slippage. Given the paucity of information on this entirely novel phenomenon, we aimed to get an additional insight into microDNA features by performing the microDNA analysis in 20 independent human lymphoblastoid cell lines (LCLs prior and after treatment with chemotherapeutic drugs. The results showed non-random genesis of microDNA clusters from the active regions of the genome. The size periodicity of 190 bp was observed, which matches DNA fragmentation typical for apoptotic cells. The chemotherapeutic drug-induced apoptosis of LCLs increased both number and size of clusters further suggesting that part of microDNAs could result from the programmed cell death. Interestingly, proportion of identified microDNA sequences has common loci of origin when compared between cell line experiments. While compatible with the original observation that microDNAs originate from a normal physiological process, obtained results imply complementary source of its production. Furthermore, non-random genesis of microDNAs depicted by redundancy between samples makes these entities possible candidates for new biomarker generation.

Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

Science.gov (United States)

Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

2001-01-01

Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

Science.gov (United States)

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Detection of DNA Double Strand Breaks by γH2AX Does Not Result in 53bp1 Recruitment in Mouse Retinal Tissues

Directory of Open Access Journals (Sweden)

Brigitte Müller

2018-05-01

Full Text Available Gene editing is an attractive potential treatment of inherited retinopathies. However, it often relies on endogenous DNA repair. Retinal DNA repair is incompletely characterized in humans and animal models. We investigated recruitment of the double stranded break (DSB repair complex of γH2AX and 53bp1 in both developing and mature mouse neuroretinas. We evaluated the immunofluorescent retinal expression of these proteins during development (P07-P30 in normal and retinal degeneration models, as well as in potassium bromate induced DSB repair in normal adult (3 months retinal explants. The two murine retinopathy models used had different mutations in Pde6b: the severe rd1 and the milder rd10 models. Compared to normal adult retina, we found increased numbers of γH2AX positive foci in all retinal neurons of the developing retina in both model and control retinas, as well as in wild type untreated retinal explant cultures. In contrast, the 53bp1 staining of the retina differed both in amount and character between cell types at all ages and in all model systems. There was strong pan nuclear staining in ganglion, amacrine, and horizontal cells, and cone photoreceptors, which was attenuated. Rod photoreceptors did not stain unequivocally. In all samples, 53bp1 stained foci only rarely occurred. Co-localization of 53bp1 and γH2AX staining was a very rare event (< 1% of γH2AX foci in the ONL and < 3% in the INL, suggesting the potential for alternate DSB sensing and repair proteins in the murine retina. At a minimum, murine retinal DSB repair does not appear to follow canonical pathways, and our findings suggests further investigation is warranted.

Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

Science.gov (United States)

Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

2018-02-01

Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

Science.gov (United States)

Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

2017-06-26

Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

Science.gov (United States)

Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

2017-05-11

Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

Phylogenetic relationships of German heavy draught horse breeds inferred from mitochondrial DNA D-loop variation.

Science.gov (United States)

Aberle, K S; Hamann, H; Drögemüller, C; Distl, O

2007-04-01

We analysed a 610-bp mitochondrial (mt)DNA D-loop fragment in a sample of German draught horse breeds and compared the polymorphic sites with sequences from Arabian, Hanoverian, Exmoor, Icelandic, Sorraia and Przewalski's Horses as well as with Suffolk, Shire and Belgian horses. In a total of 65 horses, 70 polymorphic sites representing 47 haplotypes were observed. The average percentage of polymorphic sites was 11.5% for the mtDNA fragment analysed. In the nine different draught horse breeds including South German, Mecklenburg, Saxon Thuringa coldblood, Rhenisch German, Schleswig Draught Horse, Black Forest Horse, Shire, Suffolk and Belgian, 61 polymorphic sites and 24 haplotypes were found. The phylogenetic analysis failed to show monophyletic groups for the draught horses. The analysis indicated that the draught horse populations investigated consist of diverse genetic groups with respect to their maternal lineage.

Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

Science.gov (United States)

Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

1998-01-01

We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2014-10-01

Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

Science.gov (United States)

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Gadolinium-enhanced cardiac MR exams of human subjects are associated with significant increases in the DNA repair marker 53BP1, but not the damage marker γH2AX.

Directory of Open Access Journals (Sweden)

Jennifer S McDonald

Full Text Available Magnetic resonance imaging is considered low risk, yet recent studies have raised a concern of potential damage to DNA in peripheral blood leukocytes. This prospective Institutional Review Board-approved study examined potential double-strand DNA damage by analyzing changes in the DNA damage and repair markers γH2AX and 53BP1 in patients who underwent a 1.5 T gadolinium-enhanced cardiac magnetic resonance (MR exam. Sixty patients were enrolled (median age 55 years, 39 males. Patients with history of malignancy or who were receiving chemotherapy, radiation therapy, or steroids were excluded. MR sequence data were recorded and blood samples obtained immediately before and after MR exposure. An automated immunofluorescence assay quantified γH2AX or 53BP1 foci number in isolated peripheral blood mononuclear cells. Changes in foci number were analyzed using the Wilcoxon signed-rank test. Clinical and MR procedural characteristics were compared between patients who had a >10% increase in γH2AX or 53BP1 foci numbers and patients who did not. The number of γH2AX foci did not significantly change following cardiac MR (median foci per cell pre-MR = 0.11, post-MR = 0.11, p = .90, but the number of 53BP1 foci significantly increased following MR (median foci per cell pre-MR = 0.46, post-MR = 0.54, p = .0140. Clinical and MR characteristics did not differ significantly between patients who had at least a 10% increase in foci per cell and those who did not. We conclude that MR exposure leads to a small (median 25% increase in 53BP1 foci, however the clinical relevance of this increase is unknown and may be attributable to normal variation instead of MR exposure.

Expression of the Transcription Factor E4BP4 in Human Basophils

DEFF Research Database (Denmark)

Jensen, Bettina Margrethe; Gohr, Maria; Poulsen, Lars Kærgaard

2014-01-01

Rationale The cytokine IL-3 plays an important role for human basophil development, function and survival. IL-3 is also reported to induce the expression of the transcription factor E4BP4, but it is not known whether E4BP4 is expressed in basophils and influences basophil responsiveness. The aim...... by Alcian blue. RNA was extracted (0.005-0.02 µg RNA from 0.5 - 1 x 106 cells), and the corresponding cDNA analyzed by real-time PCR where E4BP4 expression was calculated as 2-(CT(E4BP4) - CT(β-actin)). E4BP4 protein expression was visualized in basophil lysates (107 cells/ml) by Western blot followed...... the transcription factor E4BP4 which might have an impact on basophil histamine release....

A simple and accurate two-step long DNA sequences synthesis strategy to improve heterologous gene expression in pichia.

Directory of Open Access Journals (Sweden)

Jiang-Ke Yang

Full Text Available In vitro gene chemical synthesis is a powerful tool to improve the expression of gene in heterologous system. In this study, a two-step gene synthesis strategy that combines an assembly PCR and an overlap extension PCR (AOE was developed. In this strategy, the chemically synthesized oligonucleotides were assembled into several 200-500 bp fragments with 20-25 bp overlap at each end by assembly PCR, and then an overlap extension PCR was conducted to assemble all these fragments into a full length DNA sequence. Using this method, we de novo designed and optimized the codon of Rhizopus oryzae lipase gene ROL (810 bp and Aspergillus niger phytase gene phyA (1404 bp. Compared with the original ROL gene and phyA gene, the codon-optimized genes expressed at a significantly higher level in yeasts after methanol induction. We believe this AOE method to be of special interest as it is simple, accurate and has no limitation with respect to the size of the gene to be synthesized. Combined with de novo design, this method allows the rapid synthesis of a gene optimized for expression in the system of choice and production of sufficient biological material for molecular characterization and biotechnological application.

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

Science.gov (United States)

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae) provide evidence for pervasive mitochondrial DNA recombination.

Science.gov (United States)

Sammler, Svenja; Bleidorn, Christoph; Tiedemann, Ralph

2011-01-14

Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA) may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes) is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni) and 22,737 bp (P. panini), they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB), which has been described from the chicken mitochondrial genome. As this RFB

Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae provide evidence for pervasive mitochondrial DNA recombination

Directory of Open Access Journals (Sweden)

Bleidorn Christoph

2011-01-01

Full Text Available Abstract Background Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Results Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni and 22,737 bp (P. panini, they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. Conclusions The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB, which has been

Accelerating plant DNA barcode reference library construction using herbarium specimens: improved experimental techniques.

Science.gov (United States)

Xu, Chao; Dong, Wenpan; Shi, Shuo; Cheng, Tao; Li, Changhao; Liu, Yanlei; Wu, Ping; Wu, Hongkun; Gao, Peng; Zhou, Shiliang

2015-11-01

A well-covered reference library is crucial for successful identification of species by DNA barcoding. The biggest difficulty in building such a reference library is the lack of materials of organisms. Herbarium collections are potentially an enormous resource of materials. In this study, we demonstrate that it is likely to build such reference libraries using the reconstructed (self-primed PCR amplified) DNA from the herbarium specimens. We used 179 rosaceous specimens to test the effects of DNA reconstruction, 420 randomly sampled specimens to estimate the usable percentage and another 223 specimens of true cherries (Cerasus, Rosaceae) to test the coverage of usable specimens to the species. The barcode rbcLb (the central four-sevenths of rbcL gene) and matK was each amplified in two halves and sequenced on Roche GS 454 FLX+. DNA from the herbarium specimens was typically shorter than 300 bp. DNA reconstruction enabled amplification fragments of 400-500 bp without bringing or inducing any sequence errors. About one-third of specimens in the national herbarium of China (PE) were proven usable after DNA reconstruction. The specimens in PE cover all Chinese true cherry species and 91.5% of vascular species listed in Flora of China. It is very possible to build well-covered reference libraries for DNA barcoding of vascular species in China. As exemplified in this study, DNA reconstruction and DNA-labelled next-generation sequencing can accelerate the construction of local reference libraries. By putting the local reference libraries together, a global library for DNA barcoding becomes closer to reality. © 2015 John Wiley & Sons Ltd.

Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.

Directory of Open Access Journals (Sweden)

Nina Winter

Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.

Duplex Alu Screening for Degraded DNA of Skeletal Human Remains

Directory of Open Access Journals (Sweden)

Fabian Haß

2017-10-01

Full Text Available The human-specific Alu elements, belonging to the class of Short INterspersed Elements (SINEs, have been shown to be a powerful tool for population genetic studies. An earlier study in this department showed that it was possible to analyze Alu presence/absence in 3000-year-old skeletal human remains from the Bronze Age Lichtenstein cave in Lower Saxony, Germany. We developed duplex Alu screening PCRs with flanking primers for two Alu elements, each combined with a single internal Alu primer. By adding an internal primer, the approximately 400–500 bp presence signals of Alu elements can be detected within a range of less than 200 bp. Thus, our PCR approach is suited for highly fragmented ancient DNA samples, whereas NGS analyses frequently are unable to handle repetitive elements. With this analysis system, we examined remains of 12 individuals from the Lichtenstein cave with different degrees of DNA degradation. The duplex PCRs showed fully informative amplification results for all of the chosen Alu loci in eight of the 12 samples. Our analysis system showed that Alu presence/absence analysis is possible in samples with different degrees of DNA degradation and it reduces the amount of valuable skeletal material needed by a factor of four, as compared with a singleplex approach.

Putative in vitro expressed gene fragments unique to Mycobacterium avium subspecies para tuberculosis

DEFF Research Database (Denmark)

Nielsen, Kirstine Klitgaard; Ahrens, Peter

2002-01-01

By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria. The uniquen......By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria....... The uniqueness and diagnostic potential of seven of these fragments in relation to M. paratuberculosis closest relative Mycobacterium avium subsp. avium (M. avium) was confirmed by species-specific PCR and Southern blot. Furthermore, RT-PCR indicated that eight of the nine fragments originate from areas...

Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

Science.gov (United States)

Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

2017-11-01

The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

Molecular structure and chromosome distribution of three repetitive DNA families in Anemone hortensis L. (Ranunculaceae).

Science.gov (United States)

Mlinarec, Jelena; Chester, Mike; Siljak-Yakovlev, Sonja; Papes, Drazena; Leitch, Andrew R; Besendorfer, Visnja

2009-01-01

The structure, abundance and location of repetitive DNA sequences on chromosomes can characterize the nature of higher plant genomes. Here we report on three new repeat DNA families isolated from Anemone hortensis L.; (i) AhTR1, a family of satellite DNA (stDNA) composed of a 554-561 bp long EcoRV monomer; (ii) AhTR2, a stDNA family composed of a 743 bp long HindIII monomer and; (iii) AhDR, a repeat family composed of a 945 bp long HindIII fragment that exhibits some sequence similarity to Ty3/gypsy-like retroelements. Fluorescence in-situ hybridization (FISH) to metaphase chromosomes of A. hortensis (2n = 16) revealed that both AhTR1 and AhTR2 sequences co-localized with DAPI-positive AT-rich heterochromatic regions. AhTR1 sequences occur at intercalary DAPI bands while AhTR2 sequences occur at 8-10 terminally located heterochromatic blocks. In contrast AhDR sequences are dispersed over all chromosomes as expected of a Ty3/gypsy-like element. AhTR2 and AhTR1 repeat families include polyA- and polyT-tracks, AT/TA-motifs and a pentanucleotide sequence (CAAAA) that may have consequences for chromatin packing and sequence homogeneity. AhTR2 repeats also contain TTTAGGG motifs and degenerate variants. We suggest that they arose by interspersion of telomeric repeats with subtelomeric repeats, before hybrid unit(s) amplified through the heterochromatic domain. The three repetitive DNA families together occupy approximately 10% of the A. hortensis genome. Comparative analyses of eight Anemone species revealed that the divergence of the A. hortensis genome was accompanied by considerable modification and/or amplification of repeats.

Dpb11/TopBP1 contributes to genomicstability via homologous recombinationand checkpoint signaling

DEFF Research Database (Denmark)

Germann, Susanne Manuela

for recruitment. Also, the chicken homologue TopBP1 colocalizes with RPA1 as well as Rad51 when DNA damage is induced. Previously, dpb11 mutants have been shown to be sensitive to DNA-damaging agents that cause DSBs, DNA alkylation and stalled replication forks. Interestingly, we found the point mutants dpb11-PF...

Crystal structure of an Okazaki fragment at 2-A resolution

Science.gov (United States)

Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

1992-01-01

In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

Science.gov (United States)

Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

2016-01-01

DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

Directory of Open Access Journals (Sweden)

Sara Sadeghi

2016-01-01

Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

STR analysis of artificially degraded DNA-results of a collaborative European exercise

DEFF Research Database (Denmark)

Schneider, Peter M; Bender, Klaus; Mayr, Wolfgang R

2004-01-01

Degradation of human DNA extracted from forensic stains is, in most cases, the result of a natural process due to the exposure of the stain samples to the environment. Experiences with degraded DNA from casework samples show that every sample may exhibit different properties in this respect......, and that it is difficult to systematically assess the performance of routinely used typing systems for the analysis of degraded DNA samples. Using a batch of artificially degraded DNA with an average fragment size of approx. 200 bp a collaborative exercise was carried out among 38 forensic laboratories from 17 European...... countries. The results were assessed according to correct allele detection, peak height and balance as well as the occurrence of artefacts. A number of common problems were identified based on these results such as strong peak imbalance in heterozygous genotypes for the larger short tandem repeat (STR...

Construction and sequencing analysis of scFv antibody fragment derived from monoclonal antibody against norfloxacin (Nor155

Directory of Open Access Journals (Sweden)

J. Mala

2017-06-01

Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.

Detection of mitochondrial DNA deletions in human cells induced by ionizing radiation

International Nuclear Information System (INIS)

Liu, Qing-Jie; Feng, Jiang-Bin; Lu, Xue; Li, Yu-Wen; Chen, De-Qing

2008-01-01

Full text: Purpose: To screen the novel mitochondrial DNA (mt DNA) deletions induced by ionizing radiation, and analyze the several kinds of mt DNA deletions, known as 3895 bp, 889 bp, 7436 bp or 4934 bp deletions. Methods: Long-range PCR with two pairs of primers, which could amplify the whole human mitochondrial genome, was used to analyze the lymphoblastoid cell line before and after exposed to 10 Gy 60 Co γ-rays. The limited condition PCR was used to certify the possible mt DNA deletion showed by long-range PCR. The PCR products were purified, cloned, sequenced and the sequence result were BLASTed. Regular PCR or nest-PCR were used to analyze the 3895 bp, 889 bp, 7436 bp or 4934 bp deletions before and after radiation exposure. The final PCR products were purified, sequenced and BALSTed on standard human mitochondrial genome sequence database. Results: (1) The predicted bands of mt DNA were observed on the control cell lines, and the possible mt DNA deletions were also detected on the irradiated cell lines. The deletions were certified by the limited condition PCR. The sequence BLAST results of the cloned PCR products showed that two kinds of deletions, 7455 bp deletion (nt 475-7929 in heavy strand) and 9225 bp deletion (nt 7714-369 in heavy strand), which were between two 8 bp direct repeats. Further bioinformatics analysis showed that the two deletions were novel deletions. (2) The 889 bp and 3895 bp deletion were not detected for the cell line samples not exposed to 60 Co γ-rays. The 889 bp and 3895 bp deletions were detected on samples exposed to 10 Gy 60 Co γ-rays. The BALST results showed that the 889 bp and 3895 deletions flanked nt 11688 bp-12576, nt 548 bp-4443, respectively. The 7436 bp deletion levels were not changed much before and after irradiation. (3) The 4934 bp deletions had the same pattern as 7436 bp deletion, but it could induced by radiation. Conclusions: Ionizing radiation could induce the human lymphoblastoid two novel mt DNA

Cloning and expression of cell wall acid invertase gene fragment ...

African Journals Online (AJOL)

A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

DNA damage response mediators MDC1 and 53BP1: constitutive activation and aberrant loss in breast and lung cancer, but not in testicular germ cell tumours

Czech Academy of Sciences Publication Activity Database

Bartkova, J.; Hořejší, Zuzana; Sehested, M.; Nesland, J.M.; Rajpert-De Meyts, E.; Skakkebaek, N.E.; Stucki, M.; Jackson, S.; Lukas, J.; Bartek, Jiří

2007-01-01

Roč. 26, č. 53 (2007), s. 7414-7422 ISSN 0950-9232 Institutional research plan: CEZ:AV0Z50520514 Keywords : DNA damage response * cancer * MDC1 and 53BP1 defects * tumour suppressors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.440, year: 2007

Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

International Nuclear Information System (INIS)

Vejko, N.N.; Spitkovskij, D.M.

2000-01-01

The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

Fragment growing induces conformational changes in acetylcholine-binding protein: A structural and thermodynamic analysis

NARCIS (Netherlands)

Edink, E.S.; Rucktooa, P.; Retra, K.; Akdemir, A.; Nahar, T.T.; Zuiderveld, O.P.; van Elk, R.; Janssen, E.; van Nierop, P.; van Muijlwijk-Koezen, J.E.; Smit, A.B.; Sixma, T.K.; Leurs, R.; de Esch, I.J.P.

2011-01-01

Optimization of fragment hits toward high-affinity lead compounds is a crucial aspect of fragment-based drug discovery (FBDD). In the current study, we have successfully optimized a fragment by growing into a ligand-inducible subpocket of the binding site of acetylcholine-binding protein (AChBP).

The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

International Nuclear Information System (INIS)

Schowalter, D.B.; Sommer, S.S.

1989-01-01

By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

Salt-Dependent DNA-DNA Spacings in Intact Bacteriophage lambda Reflect Relative Importance of DNA Self-Repulsion and Bending Energies

Energy Technology Data Exchange (ETDEWEB)

X Qiu; D Rau; V Parsegian; L Fang; C Knobler; W Gelbart

2011-12-31

Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In the commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

Science.gov (United States)

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-03-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

Science.gov (United States)

Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

2014-04-01

Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

Science.gov (United States)

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

Science.gov (United States)

Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

2000-01-01

DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

Science.gov (United States)

Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

2017-01-01

Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

Directory of Open Access Journals (Sweden)

Afrooz DANESHPARVAR

2017-06-01

Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

DNA barcoding commercially important aquatic invertebrates of Turkey.

Science.gov (United States)

Keskin, Emre; Atar, Hasan Hüseyin

2013-08-01

DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.

Polymorphism of κ-Casein in Italian Goat Breeds: A New ACRS-PCR Designed DNA Test for Discrimination of A and B Alleles

Directory of Open Access Journals (Sweden)

Vlatka Cubric-Curik

2002-01-01

Full Text Available The objective of this study was to develop a DNA test for rapid characterisation of goat κ-casein (κ-CN A and B variants and to study this polymorphism in Italian goat breeds. Genetic polymorphism of κ-CN gene was, in addition to isoelectric focusing, analysed according to a new technique designated as amplification created restriction site. Two alleles that differ in one nucleotide mutation (G Ø A in exon 4 were characterised. The 167-bp PCR product surrounding the nucleotide mutation was amplified from genomic DNA and the PCR product was digested with MaeIII. After digestion the A allele gives three fragments of 77, 65 and 25 bp in comparison with the B allele which gives two fragments of 90 and 77 bp. The analysis of allele frequency distribution at κ-CN locus, based on 401 individual samples, revealed significant differences among three goat breeds from the north of Italy (Nera di Verzasca, Frontalasca and Alpine with frequency of κ-CN B allele around 0.3, versus two goat breeds from the south of Italy (Maltese and Sarda with frequency of κ-CN B allele around 0.5. While two goat breeds (Maltese and Nera di Verzasca did not show significant deviations from the Hardy-Weinberg equilibrium, a highly significant excess of heterozygote genotype (AB was observed in Alpine, Frontalasca and Sarda goats. Here the developed DNA method and observed relatively high frequency of κ-CN B allele give a prerequisite for the assessment of research related to the simultaneous estimation of the effects of composite αs1/κ-CN genotypes on milk production and cheese-making properties.

Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

Science.gov (United States)

Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

2017-09-01

In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

Scar-less multi-part DNA assembly design automation

Science.gov (United States)

Hillson, Nathan J.

2016-06-07

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

Science.gov (United States)

Santangelo, G M; Tornow, J

1997-12-01

As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

Science.gov (United States)

Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

2018-01-01

Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

Analysis of mtDNT 4977bp deletion induced by ionizing radiation in human peripheral blood nucleated cells using real-time PCR

International Nuclear Information System (INIS)

Fan Tianli; Wang Ping; Han Lin; Liu Yulong; Liu Yumin

2010-01-01

To detect mitochondrial DNA(mtDNA) 4977bp deletion(triangle open mtDNA 4977 ) in human peripheral blood nucleated cells exposed to ionizing radiation in vitro by using real-time PCR, and explore possibility of the index as biodosimetry for estimating biological dose in radiation accident,six healthy individuals' peripheral blood was collected,and the blood samples were irradiated with 0,1,2,3,4 and 5 Gy 60 Co gamma-ray. The triangle open mtDNA 4977 and total mtDNA copy number(mtDNA total ) in the mtDNA samples were detected, and then the deletion rates were calculated. The results showed that the mtDNA total and triangle open mtDNA 4977 copy number, and the deletion rates of mtDNA 4977bp in the mtDNA samples from 6 healthy individuals' blood exposed to 1-5 Gy radiation were higher than that with the samples exposed to 0 Gy radiation(p 0.05). The results indicated that ionizing radiation can induce accumulation of the triangle open mtDNA 4977 and increase of mtDNA total copy number in human peripheral blood nucleated cells,but both the mtDNA 4977bp deletion and exposure dose(0-5 Gy) were not obviously correlated. (authors)

Molecular cloning, sequence analysis and structure prediction of the ...

African Journals Online (AJOL)

AJL

2012-04-19

Apr 19, 2012 ... The primers were based on the rBAT sequences of other animals deposited in GenBank. .... fragment; M1, 2000 bp DNA ladder; M2, 1000 bp DNA ladder. spliced to obtain the ..... A traffic signal for heterodimeric amino acid.

Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

Directory of Open Access Journals (Sweden)

Mojtaba Sankian

2014-05-01

Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

An 11bp region with stem formation potential is essential for de novo DNA methylation of the RPS element.

Directory of Open Access Journals (Sweden)

Matthew Gentry

Full Text Available The initiation of DNA methylation in Arabidopsis is controlled by the RNA-directed DNA methylation (RdDM pathway that uses 24nt siRNAs to recruit de novo methyltransferase DRM2 to the target site. We previously described the REPETITIVE PETUNIA SEQUENCE (RPS fragment that acts as a hot spot for de novo methylation, for which it requires the cooperative activity of all three methyltransferases MET1, CMT3 and DRM2, but not the RdDM pathway. RPS contains two identical 11nt elements in inverted orientation, interrupted by a 18nt spacer, which resembles the features of a stemloop structure. The analysis of deletion/substitution derivatives of this region showed that deletion of one 11nt element RPS is sufficient to eliminate de novo methylation of RPS. In addition, deletion of a 10nt region directly adjacent to one of the 11nt elements, significantly reduced de novo methylation. When both 11nt regions were replaced by two 11nt elements with altered DNA sequence but unchanged inverted repeat homology, DNA methylation was not affected, indicating that de novo methylation was not targeted to a specific DNA sequence element. These data suggest that de novo DNA methylation is attracted by a secondary structure to which the two 11nt elements contribute, and that the adjacent 10nt region influences the stability of this structure. This resembles the recognition of structural features by DNA methyltransferases in animals and suggests that similar mechanisms exist in plants.

Image-Based Modeling Reveals Dynamic Redistribution of DNA Damageinto Nuclear Sub-Domains

Energy Technology Data Exchange (ETDEWEB)

Costes Sylvain V., Ponomarev Artem, Chen James L.; Nguyen, David; Cucinotta, Francis A.; Barcellos-Hoff, Mary Helen

2007-08-03

Several proteins involved in the response to DNA doublestrand breaks (DSB) f orm microscopically visible nuclear domains, orfoci, after exposure to ionizing radiation. Radiation-induced foci (RIF)are believed to be located where DNA damage occurs. To test thisassumption, we analyzed the spatial distribution of 53BP1, phosphorylatedATM, and gammaH2AX RIF in cells irradiated with high linear energytransfer (LET) radiation and low LET. Since energy is randomly depositedalong high-LET particle paths, RIF along these paths should also berandomly distributed. The probability to induce DSB can be derived fromDNA fragment data measured experimentally by pulsed-field gelelectrophoresis. We used this probability in Monte Carlo simulations topredict DSB locations in synthetic nuclei geometrically described by acomplete set of human chromosomes, taking into account microscope opticsfrom real experiments. As expected, simulations produced DNA-weightedrandom (Poisson) distributions. In contrast, the distributions of RIFobtained as early as 5 min after exposure to high LET (1 GeV/amu Fe) werenon-random. This deviation from the expected DNA-weighted random patterncan be further characterized by "relative DNA image measurements." Thisnovel imaging approach shows that RIF were located preferentially at theinterface between high and low DNA density regions, and were morefrequent than predicted in regions with lower DNA density. The samepreferential nuclear location was also measured for RIF induced by 1 Gyof low-LET radiation. This deviation from random behavior was evidentonly 5 min after irradiation for phosphorylated ATM RIF, while gammaH2AXand 53BP1 RIF showed pronounced deviations up to 30 min after exposure.These data suggest that DNA damage induced foci are restricted to certainregions of the nucleus of human epithelial cells. It is possible that DNAlesions are collected in these nuclear sub-domains for more efficientrepair.

Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

Directory of Open Access Journals (Sweden)

Kush Shrivastava

2015-10-01

Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

Science.gov (United States)

Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

2012-01-01

Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

International Nuclear Information System (INIS)

Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

1986-01-01

A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

Radiosensitivity in breast cancer assessed by the histone γ-H2AX and 53BP1 foci

International Nuclear Information System (INIS)

Djuzenova, Cholpon S; Elsner, Ines; Katzer, Astrid; Worschech, Eike; Distel, Luitpold V; Flentje, Michael; Polat, Bülent

2013-01-01

High expression of constitutive histone γ-H2AX, a sensitive marker of DNA damage, might be indicative of defective DNA repair pathway or genomic instability. 53BP1 (p53-binding protein 1) is a conserved checkpoint protein with properties of a DNA double-strand breaks sensor. This study explores the relationship between the clinical radiosensitivity of tumor patients and the expression/induction of γ-H2AX and 53BP1 in vitro. Using immunostaining, we assessed spontaneous and radiation-induced foci of γ-H2AX and 53 BP1 in peripheral blood mononuclear cells derived from unselected breast cancer (BC) patients (n=57) undergoing radiotherapy (RT). Cells from apparently healthy donors (n=12) served as references. Non-irradiated cells from controls and unselected BC patients exhibited similar baseline levels of DNA damage assessed by γ-H2AX and 53BP1 foci. At the same time, the γ-H2AX assay of in vitro irradiated cells revealed significant differences between the control group and the group of unselected BC patients with respect to the initial (0.5 Gy, 30 min) and residual (2 Gy, 24 h post-radiation) DNA damage. The numbers of 53BP1 foci analyzed in 35 BC patients were significantly higher than in controls only in case of residual DNA damage. A weak correlation was found between residual foci of both proteins tested. In addition, cells from cancer patients with an adverse acute skin reaction (grade 3) to RT showed significantly increased radiation-induced γ-H2AX foci and their protracted disappearance compared to the group of BC patients with normal skin reaction (grade 0–1). The mean number of γ-H2AX foci after 5 clinical fractions was significantly higher than that before RT, especially in clinically radiosensitive patients. The γ-H2AX assay may have potential for screening individual radiosensitivity of breast cancer patients.

Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

Science.gov (United States)

Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

2012-05-01

The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter

DEFF Research Database (Denmark)

Christiansen, H; Hansen, A C; Vijn, I

1996-01-01

The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod...... factor-induced tissue-specific expression. We have isolated a Vicia sativa cDNA encoding a 1641 amino acid protein, ENBP1, that interacts with the 199 bp ENOD12 promoter. Two different DNA-binding domains were identified in ENBP1. A domain containing six AT-hooks interacts specifically with an AT...... of the ENBP1 transcript in cells expressing ENOD12 strongly suggest that ENBP1 is a transcription factor involved in the regulation of ENOD12. Finally, the C-terminal region of ENBP1 shows strong homology to a protein from rat that is specifically expressed in testis tissue. Udgivelsesdato: 1996-Dec...

Sequence-specific DNA alkylation targeting for Kras codon 13 mutation by pyrrole-imidazole polyamide seco-CBI conjugates.

Science.gov (United States)

Taylor, Rhys Dylan; Asamitsu, Sefan; Takenaka, Tomohiro; Yamamoto, Makoto; Hashiya, Kaori; Kawamoto, Yusuke; Bando, Toshikazu; Nagase, Hiroki; Sugiyama, Hiroshi

2014-01-27

Hairpin N-methylpyrrole-N-methylimidazole polyamide seco-CBI conjugates 2-6 were designed for synthesis by Fmoc solid-phase synthesis, and their DNA-alkylating activities against the Kras codon 13 mutation were compared by high-resolution denaturing gel electrophoresis with 225 base pair (bp) DNA fragments. Conjugate 5 had high reactivity towards the Kras codon 13 mutation site, with alkylation occurring at the A of the sequence 5'-ACGTCACCA-3' (site 2), including minor 1 bp-mismatch alkylation against wild type 5'-ACGCCACCA-3' (site 3). Conjugate 6, which differs from conjugate 5 by exchanging one Py unit with a β unit, showed high selectivity but only weakly alkylated the A of 5'-ACGTCACCA-3' (site 2). The hairpin polyamide seco-CBI conjugate 5 thus alkylates according to Dervan's pairing rule with the pairing recognition which β/β pair targets T-A and A-T pairs. SPR and a computer-minimized model suggest that 5 binds to the target sequence with high affinity in a hairpin conformation, allowing for efficient DNA alkylation. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

CacyBP/SIP binds ERK1/2 and affects transcriptional activity of Elk-1

International Nuclear Information System (INIS)

Kilanczyk, Ewa; Filipek, Slawomir; Jastrzebska, Beata; Filipek, Anna

2009-01-01

In this work we showed for the first time that mouse CacyBP/SIP interacts with extracellular signal regulated kinases 1 and 2 (ERK1/2). We also established that a calcium binding protein, S100A6, competes for this interaction. Moreover, the E217K mutant of CacyBP/SIP does not bind significantly to ERK1/2 although it retains the ability to interact with S100A6. Molecular modeling shows that the E217K mutation in the 189-219 CacyBP/SIP fragment markedly changes its electrostatic potential, suggesting that the binding with ERK1/2 might have an electrostatic character. We also demonstrate that CacyBP/SIP-ERK1/2 interaction inhibits phosphorylation of the Elk-1 transcription factor in vitro and in the nuclear fraction of NB2a cells. Altogether, our data suggest that the binding of CacyBP/SIP with ERK1/2 might regulate Elk-1 phosphorylation/transcriptional activity and that S100A6 might further modulate this effect via Ca 2+ -dependent interaction with CacyBP/SIP and competition with ERK1/2.

Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae

Directory of Open Access Journals (Sweden)

Teofânia HDA Vidigal

2004-03-01

Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.

Using environmental DNA to census marine fishes in a large mesocosm.

Directory of Open Access Journals (Sweden)

Ryan P Kelly

Full Text Available The ocean is a soup of its resident species' genetic material, cast off in the forms of metabolic waste, shed skin cells, or damaged tissue. Sampling this environmental DNA (eDNA is a potentially powerful means of assessing whole biological communities, a significant advance over the manual methods of environmental sampling that have historically dominated marine ecology and related fields. Here, we estimate the vertebrate fauna in a 4.5-million-liter mesocosm aquarium tank at the Monterey Bay Aquarium of known species composition by sequencing the eDNA from its constituent seawater. We find that it is generally possible to detect mitochondrial DNA of bony fishes sufficient to identify organisms to taxonomic family- or genus-level using a 106 bp fragment of the 12S ribosomal gene. Within bony fishes, we observe a low false-negative detection rate, although we did not detect the cartilaginous fishes or sea turtles present with this fragment. We find that the rank abundance of recovered eDNA sequences correlates with the abundance of corresponding species' biomass in the mesocosm, but the data in hand do not allow us to develop a quantitative relationship between biomass and eDNA abundance. Finally, we find a low false-positive rate for detection of exogenous eDNA, and we were able to diagnose non-native species' tissue in the food used to maintain the mesocosm, underscoring the sensitivity of eDNA as a technique for community-level ecological surveys. We conclude that eDNA has substantial potential to become a core tool for environmental monitoring, but that a variety of challenges remain before reliable quantitative assessments of ecological communities in the field become possible.

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

Science.gov (United States)

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Comet assay optimization for assessment of DNA damage due to radiation exposure

International Nuclear Information System (INIS)

Dwi Ramadhani; Devita Tetriana; Viria Agesti Suvifan

2016-01-01

Comet assay can be used to measure the deoxyribonucleic acid (DNA) damage level caused by ionizing radiation exposure in peripheral blood lymphocytes. The principle of the comet assay is based on the amount of denatured DNA fragments that migrated out of the cell nucleus during electrophoresis. There are several aspects that must be concerned when doing the comet assay. For example the agarose concentration, duration of alkaline incubation, electrophoresis conditions (time, temperature, and voltage gradient), and the measurement parameters that used in analyze the comet. Percentage of DNA in the comet tail (% tail DNA) is strongly recommended as a parameter when analyze the comet because it can be converted to lesions per 106 base pairs (bp) using calibration curve that show relationship between the dose of ionizing radiation and % tail DNA. To obtain an accurate result, the calibration curve must be made and comet should be analyzing using image processing analysis software since it can be increase the precision and reduce the subjectivity of the measurement process. (author)

Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

Science.gov (United States)

Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

2013-01-01

Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

Science.gov (United States)

Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

2015-08-18

The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Directory of Open Access Journals (Sweden)

Edith Burbano

2006-05-01

Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

Genetic diversity among four Eucalyptus species (myrtaceae) based ...

African Journals Online (AJOL)

The results indicate that 16 positive and 13 negative markers were detected. The marker fragments size ranged between 175 to 630 bp for the negative markers and 235 to 945 bp for the positive markers. Key words: Eucalyptus, random amplified polymorphic DNA (RAPD), genetic diversity, DNA fingerprinting PCR, ...

Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

International Nuclear Information System (INIS)

Ali, M. S.; Latif, Z.

2016-01-01

Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

Science.gov (United States)

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

International Nuclear Information System (INIS)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

[Identification of an auxin response factor-like protein cDNA from mango cotyledon section].

Science.gov (United States)

Xiao, Jie-Ning; Huang, Xue-Lin; Huang, Xia; Li, Xiao-Ju

2004-01-01

Auxin-responsive elements (AuxRE) interact with a new class of plant-specific transcription factors, auxin response factors (ARFs). Some of ARFs have been shown to repress or activate expression of genes with an AuxRE promotor element. In Arabidopsis, ARFs play important roles in early embryo development and vascular strand formation (ARF5), floral patterning (ARF3) and photo- and gravitropic responses (ARF7). Two cut surfaces (distal and proximal) of mango (Mangifera indica L. var. Zi-Hua) cotyledon showed different patterns of adventitious root formation, with only the proximal cut surface, but not the distal one, could be induced to form the roots. Thus, the mango cotyledon is a good system for studying adventitious root formation. A cDNA fragment homologous to the Arabidopsis auxin response factor-like protein and relates to adventitious root formation from the cut sections were isolated using suppressive subtractive hybridization (SSH). Two cDNA clones, designated as MiARF1 (mango auxin response factor 1 gene, GenBank accession number AY255705) and MiARF2 (mango auxin response factor 2 gene, GenBank accession number is AY300808), were identified by 3'RACE. MiARF1, 3 272bp long, contains an open reading frame (ORF) of 2 523bp, 5'UTR of 285bp and 3'UTR of 464bp, MiARF2, 1 474bp long, contains an ORF of 981bp, 5' UTR of 285bp and 3'UTR of 208bp. The deduced MiARF1 and MiARF2 are homologues of auxin response factor (ARF) family of transcriptional regulators, and show high similarity to ARF of Arabidopsis in conserved domains. The motifs of MiARF1 EL-WHACAGPL in DBD (DNA binding domain) and GDDPW in IV domain are identical to that of ARF-like protein of Arabidopsis. MiARF2 is identical to MiARF1 in a large part of DBD, but lacks a carboxyl-terminal domain containing conserved motifs III and IV. Virtual Northern blot showed that the expression of MiARF2 was high in rooting tissue of cultured cotyledon sections but low in non-rooting tissue, and the MiARF1 was

Comprehensive preimplantation genetic screening and sperm deoxyribonucleic acid fragmentation from three males carrying balanced chromosome rearrangements.

Science.gov (United States)

Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima

2015-09-01

To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.

Fragman: an R package for fragment analysis.

Science.gov (United States)

Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

2016-04-21

Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

OpenAIRE

C. Selva Kumar

2011-01-01

Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol＋1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

Association between the CCR5 32-bp deletion allele and late onset of schizophrenia

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Timm, Sally; Wang, August G

2006-01-01

OBJECTIVE: The 32-bp deletion allele in chemokine receptor CCR5 has been associated with several immune-mediated diseases and might be implicated in schizophrenia as well. METHOD: The authors genotyped DNA samples from 268 schizophrenia patients and 323 healthy subjects. Age at first admission...... of the deletion allele in the latter subgroup of patients. CONCLUSIONS: These findings suggest that the CCR5 32-bp deletion allele is a susceptibility factor for schizophrenia with late onset. Alternatively, the CCR5 32-bp deletion allele may act as a modifier by delaying the onset of schizophrenia without...

Effect of Cavity Size of Mesoporous Silica on Short DNA Duplex Stability.

Science.gov (United States)

Masuda, Tsubasa; Shibuya, Yuuta; Arai, Shota; Kobayashi, Sayaka; Suzuki, Sotaro; Kijima, Jun; Itoh, Tetsuji; Sato, Yusuke; Nishizawa, Seiichi; Yamaguchi, Akira

2018-05-15

We studied the stabilities of short (4- and 3-bp) DNA duplexes within silica mesopores modified with a positively charged trimethyl aminopropyl (TMAP) monolayer (BJH pore diameter 1.6-7.4 nm). The DNA fragments with fluorescent dye were introduced into the pores, and their fluorescence resonance energy transfer (FRET) response was measured to estimate the structuring energies of the short DNA duplexes under cryogenic conditions (temperature 233-323 K). The results confirmed the enthalpic stability gain of the duplex within size-matched pores (1.6 and 2.3 nm). The hybridization equilibrium constants found for the size-matched pores were 2 orders of magnitude larger than those for large pores (≥3.5 nm), and this size-matching effect for the enhanced duplex stability was explained by a tight electrostatic interaction between the duplex and the surface TMAP groups. These results indicate the requirement of the precise regulation of mesopore size to ensure the stabilization of hydrogen-bonded supramolecular assemblies.

DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

Directory of Open Access Journals (Sweden)

Deming Li

2014-06-01

Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

Fragmentation of chromatin with 125I radioactive disintegrations

International Nuclear Information System (INIS)

Turner, G.N.; Nobis, P.; Dewey, W.C.

1976-01-01

The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated

Development and validation of InnoQuant™, a sensitive human DNA quantitation and degradation assessment method for forensic samples using high copy number mobile elements Alu and SVA.

Science.gov (United States)

Pineda, Gina M; Montgomery, Anne H; Thompson, Robyn; Indest, Brooke; Carroll, Marion; Sinha, Sudhir K

2014-11-01

There is a constant need in forensic casework laboratories for an improved way to increase the first-pass success rate of forensic samples. The recent advances in mini STR analysis, SNP, and Alu marker systems have now made it possible to analyze highly compromised samples, yet few tools are available that can simultaneously provide an assessment of quantity, inhibition, and degradation in a sample prior to genotyping. Currently there are several different approaches used for fluorescence-based quantification assays which provide a measure of quantity and inhibition. However, a system which can also assess the extent of degradation in a forensic sample will be a useful tool for DNA analysts. Possessing this information prior to genotyping will allow an analyst to more informatively make downstream decisions for the successful typing of a forensic sample without unnecessarily consuming DNA extract. Real-time PCR provides a reliable method for determining the amount and quality of amplifiable DNA in a biological sample. Alu are Short Interspersed Elements (SINE), approximately 300bp insertions which are distributed throughout the human genome in large copy number. The use of an internal primer to amplify a segment of an Alu element allows for human specificity as well as high sensitivity when compared to a single copy target. The advantage of an Alu system is the presence of a large number (>1000) of fixed insertions in every human genome, which minimizes the individual specific variation possible when using a multi-copy target quantification system. This study utilizes two independent retrotransposon genomic targets to obtain quantification of an 80bp "short" DNA fragment and a 207bp "long" DNA fragment in a degraded DNA sample in the multiplex system InnoQuant™. The ratio of the two quantitation values provides a "Degradation Index", or a qualitative measure of a sample's extent of degradation. The Degradation Index was found to be predictive of the observed loss

Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

2016-09-02

Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

International Nuclear Information System (INIS)

Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

2016-01-01

Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

Polymer fragmentation in extensional flow

Energy Technology Data Exchange (ETDEWEB)

Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

2001-06-01

In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

Directory of Open Access Journals (Sweden)

Yuqian Luo

2016-11-01

Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

Science.gov (United States)

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Transformation and fragmentation behavior of molten metal drop in sodium pool

International Nuclear Information System (INIS)

Nishimura, Satoshi; Kinoshita, Izumi; Zhang, Zhi-gang; Sugiyama, Ken-ichiro

2006-01-01

In order to clarify the fragmentation mechanism of a metallic alloy (U-Pu-Zr) fuel on liquid phase formed by metallurgical reactions (liquefaction temperature =650degC), which is important in evaluating the sequence of core disruptive accidents for metallic fuel fast reactors, a series of experiments was carried out using molten aluminum (m.p.=660degC) and sodium mainly under the condition that the boiling of sodium does not occur. When the instantaneous contact interface temperature (T i ) between molten aluminum drop and sodium is lower than the boiling point of sodium (T c,bp ), the molten aluminum drop can be fragmented and the mass median diameter (D m ) of aluminum fragments becomes small with increasing T i . When T i is roughly equivalent to or higher than T c,bp , the fragmentation of aluminum drop is promoted by thermal interaction caused by the boiling of sodium on the surface of the drop. Furthermore, even under the condition that the boiling of sodium does not occur and the solid crust is formed on the surface of the drop, it is found from an analytical evaluation that the thermal fragmentation of molten aluminum drop with solid crust is caused by the transient pressurization within the melt confined by the crust. These results indicate the possibility that the metallic alloy fuel on liquid phase formed by the metallurgical reactions can be fragmented without occurring the boiling of sodium on the surface of the melt. (author)

Risk assessment of cadmium-contaminated soil on plant DNA damage using RAPD and physiological indices

International Nuclear Information System (INIS)

Liu Wan; Yang, Y.S.; Li, P.J.; Zhou, Q.X.; Xie, L.J.; Han, Y.P.

2009-01-01

Impact assessment of contaminants in soil is an important issue in environmental quality study and remediation of contaminated land. A random amplified polymorphic DNA (RAPD) 'fingerprinting' technique was exhibited to detect genotoxin-induced DNA damage of plants from heavy metal contaminated soil. This study compared the effects occurring at molecular and population levels in barley seedlings exposed to cadmium (Cd) contamination in soil. Results indicate that reduction of root growth and increase of total soluble protein level in the root tips of barley seedlings occurred with the ascending Cd concentrations. For the RAPD analyses, nine 10-base pair (bp) random RAPD primers (decamers) with 60-70% GC content were found to produce unique polymorphic band patterns and subsequently were used to produce a total of 129 RAPD fragments of 144-2639 base pair in molecular size in the root tips of control seedlings. Results produced from nine primers indicate that the changes occurring in RAPD profiles of the root tips following Cd treatment included alterations in band intensity as well as gain or loss of bands compared with the control seedlings. New amplified fragments at molecular size from approximately 154 to 2245 bp appeared almost for 10, 20 and 40 mg L -1 Cd with 9 primers (one-four new polymerase chain reaction, (PCR) products), and the number of missing bands enhanced with the increasing Cd concentration for nine primers. These results suggest that genomic template stability reflecting changes in RAPD profiles were significantly affected and it compared favourably with the traditional indices such as growth and soluble protein level at the above Cd concentrations. The DNA polymorphisms detected by RAPD can be applied as a suitable biomarker assay for detection of the genotoxic effects of Cd stress in soil on plants. As a tool in risk assessment the RAPD assay can be used in characterisation of Cd hazard in soil

The Functional Role of TopBP1 in DNA Maintenance at Mitosis

DEFF Research Database (Denmark)

Pedersen, Rune Troelsgaard

When cells traverse mitosis, genome integrity of the emerging daughter cells is dependent on replication of the entire genome during the preceding S-phase and accurate chromosome segregation in mitosis. Replication stress may cause cells to enter mitosis with underreplicated loci, consisting...... can lead to anaphase bridges that impair accurate chromosome segregation. The recent decade featured many advances in our understanding of how cells cope with underreplicated loci in mitosis. A major advance was the description of ultra-fine anaphase bridges (UFBs), a class of anaphase bridges...... established Saccharomyces cerevisiae as a model organism to study anaphase bridges, and we identified Dpb11/TopBP1 as a novel UFB-associated protein in yeast and avian DT40 cells, respectively. TopBP1 localized to confined areas on replication-stress induced UFBs. Upon onset of mitosis we observed a burst...

A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

Energy Technology Data Exchange (ETDEWEB)

Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

1994-09-15

In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

[Construction of fetal mesenchymal stem cell cDNA subtractive library].

Science.gov (United States)

Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

2002-04-01

To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

Science.gov (United States)

Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

2015-10-30

Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

Energy Technology Data Exchange (ETDEWEB)

Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

2012-06-01

Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

Polo-like kinase 1 inhibits DNA damage response during mitosis.

Science.gov (United States)

Benada, Jan; Burdová, Kamila; Lidak, Tomáš; von Morgen, Patrick; Macurek, Libor

2015-01-01

In response to genotoxic stress, cells protect their genome integrity by activation of a conserved DNA damage response (DDR) pathway that coordinates DNA repair and progression through the cell cycle. Extensive modification of the chromatin flanking the DNA lesion by ATM kinase and RNF8/RNF168 ubiquitin ligases enables recruitment of various repair factors. Among them BRCA1 and 53BP1 are required for homologous recombination and non-homologous end joining, respectively. Whereas mechanisms of DDR are relatively well understood in interphase cells, comparatively less is known about organization of DDR during mitosis. Although ATM can be activated in mitotic cells, 53BP1 is not recruited to the chromatin until cells exit mitosis. Here we report mitotic phosphorylation of 53BP1 by Plk1 and Cdk1 that impairs the ability of 53BP1 to bind the ubiquitinated H2A and to properly localize to the sites of DNA damage. Phosphorylation of 53BP1 at S1618 occurs at kinetochores and in cytosol and is restricted to mitotic cells. Interaction between 53BP1 and Plk1 depends on the activity of Cdk1. We propose that activity of Cdk1 and Plk1 allows spatiotemporally controlled suppression of 53BP1 function during mitosis.

Design and Construction of a Cloning Vector Containing the hspX Gene of Mycobacterium tuberculosis.

Science.gov (United States)

Yaghoubi, Atieh; Aryan, Ehsan; Zare, Hosna; Alami, Shadi; Teimourpour, Roghayeh; Meshkat, Zahra

2016-10-01

Tuberculosis (TB) is a major cause of death worldwide. Finding an effective vaccine against TB is the best way to control it. Several vaccines against this disease have been developed but none are completely protective. The aim of this study was to design and construct a cloning vector containing the Mycobacterium tuberculosis (M. tuberculosis) heat shock protein X (hspX) . First, an hspX fragment was amplified by PCR and cloned into plasmid pcDNA3.1(+) and recombinant vector was confirmed. A 435 bp hspX fragment was isolated. The fragment was 100% homologous with hspX of M. tuberculosis strain H37Rv in GenBank. In this study, the cloning vector pcDNA3.1(+), containing a 435-bp hspX fragment of M. tuberculosis , was constructed. This could be used as a DNA vaccine to induce immune responses in animal models in future studies.