
Sample records for bos taurus taurus

  1. Polymorphism and Mobilization of Rransposons in Bos taurus

    DEFF Research Database (Denmark)

    Guldbrandtsen, Bernt; Sahana, Goutam; Lund, Mogens Sandø

    The bovine genome assembly was explored to detect putative retrotransposon sequences. In total 87,310 such sites were detected. Four breeds of dairy cattle (Bos taurus) were examined with respect to the presence, segregation or complete absence of the putative retrotransposon. A total of 10...

  2. Genetic effects on beef tenderness in Bos indicus composite and Bos taurus cattle. (United States)

    O'Connor, S F; Tatum, J D; Wulf, D M; Green, R D; Smith, G C


    Bos indicus composite and Bos taurus cattle, originating from diverse production environments, were used to quantify genetic variation in marbling, 24-h calpastatin activity, and beef tenderness and to identify strategies for prevention of beef tenderness problems in Bos indicus composite cattle. Comparisons among 3/8 Bos indicus breeds (Braford, Red Brangus, Simbrah) revealed significant differences in marbling and 24-h calpastatin activity, but not in tenderness. Compared with Bos taurus cattle, 3/ 8 Bos indicus cattle had similar marbling scores but higher 24-h calpastatin activities. Also, beef from 3/8 Bos indicus composites aged more slowly from 1 to 7 d and was less tender at 4, 7, 14, 21, and 35 d postmortem than beef from Bos taurus cattle. However, beef from 3/8 Bos indicus cattle was relatively tender if it was aged for a sufficient period of time (21 d). The delayed response to aging and greater toughness of beef from 3/8 Bos indicus cattle was associated with Brahman breed effects and was not related to the Bos taurus germplasm source. Marbling was moderately heritable (.52 +/- .21) but exhibited positive genetic correlations with shear force at d 1 through 14 of aging, suggesting that, in these cattle, selection for increased marbling would have an unfavorable effect on beef tenderness. A low heritability estimate for 24-h calpastatin activity (.15 +/- .15), coupled with low genetic correlations between calpastatin activity and shear force at 7, 14, and 35 d, suggested that selection for low calpastatin activity would have little effect on aged beef tenderness. Panel tenderness and shear force at 7, 14, and 21 d were moderately heritable (.27 to .47), indicating that aged beef tenderness could be improved by direct selection (via progeny testing). Comparisons among Simbrah, Senegus x Simbrah, and Red Angus x Simmental steers showed that inclusion of a tropically adapted Bos taurus breed (Senepol) could be an effective strategy for preventing beef

  3. Cow/calf preweaning efficiency of Nellore and Bos taurus x Bos indicus crosses. (United States)

    Calegare, L; Alencar, M M; Packer, I U; Ferrell, C L; Lanna, D P D


    The objectives of this study were to determine if percentage Bos taurus (0 or 50%) of the cow had an effect on ME requirements and milk production, and to compare cow/calf efficiency among 3 mating systems. Metabolizable energy requirements were estimated during a feeding trial that encompassed a gestation and lactation feeding trial for each of 2 groups of cows. Cows were 0 or 50% Bos taurus (100 or 50% Nellore) breed type: Nellore cows (NL; n = 10) mated to Nellore bulls, NL cows (n = 9) mated to Angus bulls, Angus x Nellore (ANL; n = 10) and Simmental x Nellore (SNL; n = 10) cows mated to Canchim (5/8 Charolais 3/8 Zebu) bulls. Cows were individually fed a total mixed diet that contained 11.3% CP and 2.23 Mcal of ME/kg of DM. At 14-d intervals, cows and calves were weighed and the amount of DM was adjusted to keep shrunk BW and BCS of cows constant. Beginning at 38 d of age, corn silage was available to calves ad libitum. Milk production at 42, 98, 126, and 180 d postpartum was measured using the weigh-suckle-weigh technique. At 190 d of age, calves were slaughtered and body composition estimated using 9-10-11th-rib section to obtain energy deposition. Regression of BW change on daily ME intake (MEI) was used to estimate MEI at zero BW change. Increase in percentage Bos taurus had a significant effect on daily ME requirements (Mcal/d) during pregnancy (P < 0.01) and lactation (P < 0.01). Percentage Bos taurus had a positive linear effect on maintenance requirements of pregnant (P = 0.07) and lactating (P < 0.01) cows; during pregnancy, the ME requirements were 91 and 86% of those in lactation (131 +/- 3.5 vs. 145 +/- 3.4 Mcal x kg(-0.75) x d(-1)) for the 0 and 50% B. taurus groups, respectively. The 50% B. taurus cows, ANL and SNL, suckling crossbred calves had greater total MEI (4,319 +/- 61 Mcal; P < 0.01) than 0% B. taurus cows suckling NL (3,484 +/- 86 Mcal) or ANL calves (3,600 +/- 91 Mcal). The 0% B. taurus cows suckling ANL calves were more efficient (45

  4. Life-cycle biological efficiency of Bos indicus x Bos taurus and Bos taurus crossbred cow-calf production to weaning. (United States)

    Green, R D; Cundiff, L V; Dickerson, G E


    A deterministic model was developed that accounted for all biological inputs and outputs for a theoretical herd of F1 females at age equilibrium mated to produce three-way terminal-cross calves and for the required proportion of straightbred cows needed to produce replacements. Two Bos indicus x Bos taurus vs two Bos taurus x Bos taurus types of crossbred cows were compared in the production environment of south-central Nebraska. The four types of F1 females were from Hereford (H) or Angus (A) dams and by H or A (HA), Pinzgauer (Pz), Brahman (Bm), or Sahiwal (Sw) sires. The crossbred females were assumed mated to Red Poll (R) sires for their first calving and to Simmental (S) sires thereafter. Two evaluations of efficiency for each of the four breeding systems were total cow and calf feed energy input 1) per unit of only weaned calf weight output (CALFEFF, Mcal/kg) and 2) per unit of weaned calf plus .55 x cull cow weight output (TVALEFF, Mcal/kg). Results for a terminal age of 7 yr in systems using HA, Pz, Bm, and Sw crossbred cows, respectively, were 64.9, 64.5, 60.9, and 59.3 Mcal/kg for CALFEFF and 45.7, 46.4, 44.1, and 43.7 Mcal/kg for TVALEFF. Changing terminal age to 11 yr reduced CALFEFF about 6% but increased TVALEFF about 7%, because total inputs increased more than output value (10 vs 3%) from 7 to 11 yr terminal ages. These results suggest differences in efficiency among these breed crosses favoring the Bos indicus crossbred cows by over 4% in this particular environment. PMID:1938641

  5. Ganancia diaria y peso al destete en becerros de cruzas Bos taurus con Bos indicus en trópico húmedo.


    Alejandro Córdova; Gustavo Rodríguez; Mary Córdova; Cristian Córdova,; José Pérez


    El objetivo del trabajo fue evaluar la ganancia diaria de peso desde el nacimiento hasta el destete a los cuatromeses de edad de terneros de la cruza Bos taurus con Bos indicus, manejados en pastoreo convencional, para locual se utilizaron los registros de 302 terneros. Las razas Bos taurus utilizadas para las cruzas fueron Belgianblue, Charolais, Limousine y Beef master; las Bos indicus, fueron Brahman, Nelore, Indobrasil y Simbrah. Losresultados se analizaron mediante estadística descriptiv...



    Córdova, Alejandro; Rodriguez, Gustavo; Córdova, Mary; Córdova, Cristian; Pérez, José


    El objetivo del trabajo fue evaluar la ganancia diaria de peso desde el nacimiento hasta el destete a los cuatro meses de edad de terneros de la cruza Bos taurus con Bos indicus, manejados en pastoreo convencional, para lo cual se utilizaron los registros de 302 terneros. Las razas Bos taurus utilizadas para las cruzas fueron Belgian blue, Charolais, Limousine y Beef master; las Bos indicus, fueron Brahman, Nelore, Indobrasil y Simbrah. Los resultados se analizaron mediante estadística descri...

  7. A whole-genome assembly of the domestic cow, Bos taurus (United States)

    Background: The genome of the domestic cow, Bos taurus, was sequenced using a mixture of hierarchical and whole-genome shotgun sequencing methods. Results: We have assembled the 35 million sequence reads and applied a variety of assembly improvement techniques, creating an assembly of 2.86 billion b...

  8. Sarcocystis heydorni, n. sp. (Apicomplexa: Protozoa) with cattle (Bos taurus) and human (Homo sapiens) cycle (United States)

    Cattle (Bos taurus) are intermediate hosts for four species of Sarcocystis, S. cruzi, S. hirsuta, S. hominis, and S. rommeli. Of these four species, mature sarcocysts of S. cruzi are thin-walled (< 1µm) whereas S. hirsuta, S. hominis, and S. rommeli have thick walls (4 µm or more). Here we describe ...

  9. The polled locus maps to BTA1 in a Bos indicus x Bos taurus cross. (United States)

    Brenneman, R A; Davis, S K; Sanders, J O; Burns, B M; Wheeler, T C; Turner, J W; Taylor, J F


    Two hundred and nine reciprocal backcross and F2 progeny produced by embryo transfer from Angus (Bos taurus) and Brahman (Bos indicus) parents and their 60 parents and grandparents were utilized to localize the locus (POLL) responsible for the polled phenotype in a genetic map of bovine chromosome 1. Progeny were scored for polled, scurred, and horned phenotypes at 1 year of age and again following skull disection at slaughter at 20 months of age. Phenotype frequencies were independent of gender. One hundred and forty-two informative meioses for POLL and 13 microsatellite loci with an average of 267 informative meioses per locus contributed to a genetic map spanning 124.6 cM with an average interval of 9.6 cM. POLL mapped proximal to the centromere and 4.9 cM from TGLA49 supporting a previous study that employed two anonymous microsatellites. Difficulties in discriminating between scurred and horned phenotypes indicate that bracketing markers will be essential for refining the model for inheritance of the horned, scurred, and polled phenotypes and for effective marker assisted selection (MAS) for polled. PMID:8830095

  10. INTROGRESIÓN GENÉTICA DE Bos indicus (BOVIDAE EN BOVINOS CRIOLLOS COLOMBIANOS DE ORIGEN Bos taurus Genetic Introgression of Bos indicus (Bovidae in Colombian Creole Cattle Bos taurus

    Directory of Open Access Journals (Sweden)


    Full Text Available El presente trabajo evidencia desde el punto de vista citogenético la introgresión genética, de origen paterno, de Bos indicus en ganado criollo colombiano descendiente de Bos taurus. Para este estudio se realizó el análisis cariológico de la morfología del cromosoma Y a partir de muestras de sangre heparinizada de 67 bovinos machos pertenecientes a siete razas criollas colombianas. Se reporta la presencia de cuatro ejemplares pertenecientes a la raza Romosinuano (40% y 10 toros de la raza Casanareña (100% con cromosoma Y de tipo acrocéntrico característico de Bos indicus, lo cual estaría evidenciando un alto grado de introgresión genética, en estas dos razas, posiblemente originada por la intensiva introducción de sementales de la raza Cebú en la ganadería criolla colombiana. En las otras cinco razas (Blanco Orejinegro (BON, Chino santandereano, Costeño con cuernos, Hartón del valle y Sanmartinero, los toros presentaron el cromosoma Y submetacéntrico, característico de Bos taurus.This work evidenced, using a cytogenetics approach, that Bos indicus exerted a genetic introgression of paternal origin on Creole Colombian cattle descendent from Bos taurus. Analysis of chromosome Y morphology was carried out in heparinized blood samples of 67 bulls belonging to seven Colombian breeds. We report 4 sires belonging to the Romosinuano breed (40% and 10 bulls of the Casanareño breed (100% with acrocentric Y chromosome which is characteristic of Bos taurus. This finding indicates a high degree of genetic introgression in these two breeds probably caused by the continuous input of zebu stallions in the Colombian Creole breeds. In other five Creole breeds (Blanco Orejinegro -BON-, Chino Santandereano, Costeño con Cuernos, Hartón del Valle and Sanmartinero, the bulls had a submetacentric Y chromosome characteristic of Bos taurus.

  11. Frequencies of polymorphisms associated with BSE resistance differ significantly between Bos taurus, Bos indicus, and composite cattle

    Directory of Open Access Journals (Sweden)

    Seabury Christopher M


    Full Text Available Abstract Background Transmissible spongiform encephalopathies (TSEs are neurodegenerative diseases that affect several mammalian species. At least three factors related to the host prion protein are known to modulate susceptibility or resistance to a TSE: amino acid sequence, atypical number of octapeptide repeats, and expression level. These factors have been extensively studied in breeds of Bos taurus cattle in relation to classical bovine spongiform encephalopathy (BSE. However, little is currently known about these factors in Bos indicus purebred or B. indicus × B. taurus composite cattle. The goal of our study was to establish the frequency of markers associated with enhanced susceptibility or resistance to classical BSE in B. indicus purebred and composite cattle. Results No novel or TSE-associated PRNP-encoded amino acid polymorphisms were observed for B. indicus purebred and composite cattle, and all had the typical number of octapeptide repeats. However, differences were observed in the frequencies of the 23-bp and 12-bp insertion/deletion (indel polymorphisms associated with two bovine PRNP transcription regulatory sites. Compared to B. taurus, B. indicus purebred and composite cattle had a significantly lower frequency of 23-bp insertion alleles and homozygous genotypes. Conversely, B. indicus purebred cattle had a significantly higher frequency of 12-bp insertion alleles and homozygous genotypes in relation to both B. taurus and composite cattle. The origin of these disparities can be attributed to a significantly different haplotype structure within each species. Conclusion The frequencies of the 23-bp and 12-bp indels were significantly different between B. indicus and B. taurus cattle. No other known or potential risk factors were detected for the B. indicus purebred and composite cattle. To date, no consensus exists regarding which bovine PRNP indel region is more influential with respect to classical BSE. Should one particular

  12. Evaluation of carcass characteristics and meat chemical composition of Bos indicus and Bos indicus x Bos taurus crossbred steers finished in pasture systems


    Moreira Fernanda Barros; Souza Nilson Evelázio de; Matsushita Makoto; Prado Ivanor Nunes do; Nascimento Willian Gonçalves do


    The objective of this study was to evaluate the carcass characteristics (carcass weight, carcass yield, fat thickness, loin area, marbling and colour) and chemical composition of the Longissimus dorsi muscle (moisture, ash, crude protein, fat and cholesterol) of cuts with or without fat thickness, of Bos indicus and Bos indicus x Bos taurus crossbred steers finished in millet (Pennisetum americanum L.) or star grass (Cynodon plectostachyus Pilger) pasture systems, with mineral or mineral prot...

  13. History and economic importance of cattle (Bos taurus L.) in Switzerland from neolithic to early middle ages


    Schibler, J.; Schlumbaum, A.


    In Switzerland domestic cattle (Bos primigenius f. taurus resp. Bos taurus L.) first appear with the earliest Neolithic settlements (similar to 5000 BC). With the gradual deforestation of the landscape caused by human exploitation of the environment, cattle were used more intensive and in many ways. There is evidence that cattle were used as draught animal since ca. 3400 BC, probably even earlier milk was regularly used. The size of domestic cattle gradually decreased from Early Neolithic unt...

  14. MADURACIÓN DEL SOLOMO (Biceps femoris EN VACAS DE DESCARTE Bos indicus Y Bos taurus

    Directory of Open Access Journals (Sweden)

    Roger Alonso Cubero-Rojas


    Full Text Available El objetivo de este trabajo fue evaluar el efecto de la maduración sobre la terneza del músculo Biceps femoris en vacas de descarte Bos indicus y Bos taurus. En la planta procesadora de Montecillos R.L., ubicada en Alajuela, se realizó la escogencia y sacrificio de los animales, la maduración y empaque al vacío de la carne. La cocción, determinación de la terneza y evaluación sensorial se llevó a cabo a los 0, 14 y 28 días de maduración, en el Laboratorio de Análisis Sensorial del Centro de Investigaciones en Tecnología de Alimentos de la Universidad de Costa Rica, ubicado en San Pedro de Montes de Oca, San José, en julio del año 2011. De acuerdo con la evaluación instrumental, la especie y la cronometría dental no fueron factores significativos en la determinación de la terneza de la carne, mientras que el tiempo de maduración sí mostró cambios altamente significativos (p>0,001 sobre el mismo parámetro. Los mejores resultados se obtuvieron a los 28 días, donde B. indicus mostró 3,78 kg de fuerza al corte, mientras que para B. taurus se obtuvo 3,88 kg. En la evaluación sensorial, los animales B. indicus se calificaron como más jugosos (p=0,016 y con mejor sabor (p<0,001. Se determinó una relación inversa entre sabor y tiempo de maduración, lo cual indicó que a mayor tiempo de maduración el sabor de la carne se volvió menos agradable al paladar.

  15. Genome-Wide Detection and Characterization of Endogenous Retroviruses in Bos taurus


    Garcia-Etxebarria, Koldo; Jugo, Begoña Marina


    Endogenous retroviruses (ERVs) are the proviral phase of exogenous retroviruses that become integrated into a host germ line. They can play an important role in the host genome. Bioinformatic tools have been used to detect ERVs in several vertebrates, primarily primates and rodents. Less information is available regarding ERVs in other mammalian groups, and the source of this information is basically experimental. We analyzed the genome of the cow (Bos taurus) using three different methods. A...

  16. Growth traits and composition of two- and three-way-cross intact male progeny of Bos taurus and Bos indicus X Bos taurus dams. (United States)

    Van Ornum, K M; Bailey, C M; Ringkob, T P; Koh, Y O


    Feedlot traits, carcass traits and distribution of commercial cuts of crossbred intact male progeny (n = 556) from young and mature Hereford, Red Poll, Hereford X Red Poll, Red Poll X Hereford, Angus X Hereford, Angus X Charolais, Brahman X Hereford and Brahman X Angus dams were evaluated. First-calf heifers were bred to Red Angus bulls; Santa Gertrudis sires were used for each cow's second and third breeding seasons. Calves from these young dams were slaughtered at 13 mo. Calves of mature dams were all sired by Limousin bulls and slaughtered at 12 mo. Dam breed was a major source of variation in most bull traits. Progeny of Brahman-cross dams were inferior (P less than .01) in daily gain, final weight, carcass weight and in edible cuts/day of age compared with progeny from Bos taurus dams. Intact male progeny of Angus X Charolais dams ranked highest in longissimus area, cutability, and edible cuts/day of age. The range of dam breed means in percentage of steak, roast, bone-in cuts (chuck short ribs and back ribs), short plate and thin cuts, and lean trim was just over 1%. Greater variation among dam breeds existed in fat measurements. Analyses in which Hereford-Red Poll diallel data for young dams and mature dams were combined showed positive maternal heterosis for dressing percentage (P less than .05), carcass weight (P less than .05), carcass weight/day of age (P less than .05), estimated carcass fat (P less than .05), fat thickness (P less than .01) and marbling score (P less than .01). Reciprocal effects were inconsequential. Results illustrate the importance of dam breed-type effects in formulating breeding strategies for commercial beef herds. PMID:3610866

  17. In vivo comparison of susceptibility between Bos indicus and Bos taurus cattle types to Theileria parva infection

    Directory of Open Access Journals (Sweden)

    S.G. Ndungu


    Full Text Available The objective of this study was to determine whether Bos taurus cattle differ form Bos indicus in their susceptibility to infection with the Muguga stabilate of Theileria parva and in their resistance to the resultant disease. Ten Friesians (B. taurus, ten improved Borans (B. indicus, ten unimproved Borans (B. indicus and ten Zebus (B. indicus born to dams from an East Coast fever (ECF endemic area were inoculated with an infective dose50 dilution of T. parva Muguga stabilate 147. All the animals except one Friesian and one Zebu developed schizont parasitosis. All the improved Borans, nine of the Friesians, eight of the unimproved Borans and six of the Zebus developed a febrile response. Four of the improved Borans, four of the Friesians and three of the unimproved Borans died of theileriosis. No significant difference (P > 0.05 in the prepatent period occurred between the groups, but the Zebus had a significantly shorter duration of schizont parasitosis (P > 0.05 and took a significantly shorter time to recover (P > 0.05 than the other three groups. There was no significant difference in the two parameters between the other three groups. The study showed that three B. indicus breds and a B. taurus breed are equally susceptible to T. parva infection. However, Zebus born to dams from an ECF endemic area showed a better ability to control the course of disease than cattle from ECF free areas.

  18. Chemical composition of whole body and carcass of Bos indicus and tropically adapted Bos taurus breeds. (United States)

    Bonilha, S F M; Tedeschi, L O; Packer, I U; Razook, A G; Nardon, R F; Figueiredo, L A; Alleoni, G F


    Relationships between the chemical composition of the 9th- to 11th-rib section and the chemical composition of the carcass and empty body were evaluated for Bos indicus (108 Nellore and 36 Guzerah; GuS) and tropically adapted Bos taurus (56 Caracu; CaS) bulls, averaging 20 to 24 mo of age at slaughter. Nellore cattle were represented by 56 animals from the selected herd (NeS) and 52 animals from the control herd (NeC). The CaS and GuS bulls were from selected herds. Selected herds were based on 20 yr of selection for postweaning BW. Carcass composition was obtained after grinding, homogenizing, sampling, and analyzing soft tissue and bones. Similarly, empty body composition was obtained after grinding, homogenizing, sampling, analyzing, and combining blood, hide, head + feet, viscera, and carcass. Bulls were separated into 2 groups. Group 1 was composed of 36 NeS, 36 NeC, 36 CaS, and 36 GuS bulls and had water, ether extract (EE), protein, and ash chemically determined in the 9th- to 11th-rib section and in the carcass. Group 2 was composed of 20 NeS, 16 NeC, and 20 CaS bulls and water, EE, protein, and ash were determined in the 9th- to 11th-rib section, carcass, and empty body. Linear regressions were developed between the carcass and the 9th- to 11th-rib section compositions for group 1 and between carcass and empty body compositions for group 2. The 9th- to 11th-rib section percentages of water (RWt) and EE (RF) predicted the percentages of carcass water (CWt) and carcass fat (CF) with high precision: CWt, % = 29.0806 + 0.4873 × RWt, % (r(2) = 0.813, SE = 1.06) and CF, % = 10.4037 + 0.5179 × RF, % (r(2) = 0.863, SE = 1.26), respectively. Linear regressions between percentage of CWt and CF and empty body water (EBWt) and empty body fat (EBF) were also predicted with high precision: EBWt, % = -9.6821 + 1.1626 × CWt, % (r(2) = 0.878, SE = 1.43) and EBF, % = 0.3739 + 1.0386 × CF, % (r(2) = 0.982, SE = 0.65), respectively. Chemical composition of the 9th- to 11


    Directory of Open Access Journals (Sweden)



    Full Text Available

    El presente trabajo evidencia desde el punto de vista citogenético la introgresión genética, de origen paterno, de Bos indicus en ganado criollo colombiano descendiente de Bos taurus. Para este estudio se realizó el análisis cariológico de la morfología del cromosoma Y a partir de muestras de sangre heparinizada de 67 bovinos machos pertenecientes a siete razas criollas colombianas. Se reporta la presencia de cuatro ejemplares pertenecientes a la raza Romosinuano (40% y 10 toros de la raza Casanareña (100% con cromosoma Y de tipo acrocéntrico característico de Bos indicus, lo cual estaría evidenciando un alto grado de introgresión genética, en estas dos razas, posiblemente originada por la intensiva introducción de sementales de la raza Cebú en la ganadería criolla colombiana. En las otras cinco razas (Blanco Orejinegro (BON, Chino santandereano, Costeño con cuernos, Hartón del valle y Sanmartinero, los toros presentaron el cromosoma Y submetacéntrico, característico de Bos taurus.

  20. The Effect of Myogenic Factor 5 Polymorphism on the Meat Quality in Chinese Bos Taurus

    Directory of Open Access Journals (Sweden)

    J. A. Ujan


    Full Text Available In the present study, we evaluated polymorphism of myogenic factor 5, involved in growth and meat quality traits. Based on PCR-SSCP technology, a novel missense substitution SNP (single-nucleotide polymorphism g.1142 A > G was identified in the intron1 region of the MyF-5 gene, it causes an amino acid substitution (1142Glutamine/ Glycine1142. Allele frequencies, gene heterozygosity, effective allele number and polymorphism information content of the bovine MyF-5 SNP in three population breeds were determined and evaluated by the χ2 test. Results showed that the polymorphism distribution was not similar in all of the three Bos taurus breeds, the genotype distributions of two cattle breeds Jia xian red and Nanyang did not agree with Hardy–Weinberg equilibrium (P 0.05. The A/G allelic frequencies in these breeds were 0.797/0.202, 0.770/0.229, 0.863/0.136 respectively. The genotype frequencies in Jia xian red and Nanyang cattle breeds showed moderate diversity (0.25< polymorphism information content <0.5. Furthermore, least squares analysis revealed significant effects of genotype on intramuscular fat, rib area and water holding capacity in 510 individuals (P < 0.05. Our result suggests that A1142G SNP can be used as an efficacious genetic marker for meat quality traits in native Chinese cattle breeds (Bos taurus but a much large number of animals are required for Marker assisted selection.

  1. The Effect of Myogenic Factor 5 Polymorphism on the Meat Quality in Chinese Bos Taurus

    Directory of Open Access Journals (Sweden)

    S. A. Ujan


    Full Text Available In the present study, we evaluated polymorphism of myogenic factor 5, involved in growth and meat quality traits. Based on PCR-SSCP technology, a novel missense substitution SNP (single-nucleotide polymorphism g.1142 A > G was identified in the intron1 region of the MyF-5 gene, it causes an amino acid substitution (1142Glutamine/ Glycine1142. Allele frequencies, gene heterozygosity, effective allele number and polymorphism information content of the bovine MyF-5 SNP in three population breeds were determined and evaluated by the χ2 test. Results showed that the polymorphism distribution was not similar in all of the three Bos taurus breeds, the genotype distributions of two cattle breeds Jia xian red and Nanyang did not agree with Hardy–Weinberg equilibrium (P 0.05. The A/G allelic frequencies in these breeds were 0.797/0.202, 0.770/0.229, 0.863/0.136 respectively. The genotype frequencies in Jia xian red and Nanyang cattle breeds showed moderate diversity (0.25< polymorphism information content <0.5. Furthermore, least squares analysis revealed significant effects of genotype on intramuscular fat, rib area and water holding capacity in 510 individuals (P < 0.05. Our result suggests that A1142G SNP can be used as an efficacious genetic marker for meat quality traits in native Chinese cattle breeds (Bos taurus but a much large number of animals are required for Marker assisted selection.

  2. Sarcocystis heydorni, n. sp. (Apicomplexa: Sarcocystidae) with cattle (Bos taurus) and human (Homo sapiens) cycle. (United States)

    Dubey, Jitender P; van Wilpe, Erna; Calero-Bernal, Rafael; Verma, Shiv Kumar; Fayer, Ronald


    Cattle (Bos taurus) are intermediate hosts for four species of Sarcocystis, namely Sarcocystis cruzi, Sarcocystis hirsuta, Sarcocystis hominis, and Sarcocystis rommeli. Of these four species, mature sarcocysts of S. cruzi are thin-walled (species of Sarcocystis with thin-walled sarcocysts in cattle. Two newborn calves were fed with sporocysts from the feces of a human volunteer who had ingested raw beef. The calves were killed 111 and 222 days later. In addition to thick-walled sarcocysts of S. hominis, both calves were coinfected with a Sarcocystis species that had a thin-walled sarcocysts, distinct from S. cruzi. The sarcocysts were mature, microscopic, up to 80 μm wide, and up to 1060 μm long. By light microscopy, the sarcocyst wall was thin (species of Sarcocystis reported from livestock. This unique species is named in honor of Dr. Alfred Otto Heydorn who provided the sporocysts. PMID:26243573

  3. Fine mapping of a calving QTL on Bos taurus autosome 18 in Holstein cattle. (United States)

    Mao, X; Kadri, N K; Thomasen, J R; De Koning, D J; Sahana, G; Guldbrandtsen, B


    Decreased calving performance not only directly impacts the economic efficiency of dairy cattle farming but also influences public concern for animal welfare. Previous studies have revealed a QTL on Bos taurus autosome (BTA) 18 that has a large effect on calving traits in Holstein cattle. In this study, fine mapping of this QTL was performed using imputed high-density SNP chip (HD) genotypes followed by imputed next-generation sequencing (NGS) variants. BTA18 was scanned for seven direct calving traits in 6113 bulls with imputed HD genotypes. SNP rs136283363 (BTA18: 57 548 213) was consistently the most significantly associated SNP across all seven traits [e.g. p-value = 2.04 × 10(-59) for birth index (BI)]. To finely map the QTL region and to explore pleiotropic effects, we studied NGS variants within the targeted region (BTA18: 57 321 450-57 625 355) for associations with direct calving traits and with three conformation traits. Significant variants were prioritized, and their biological relevance to the traits was interpreted. Considering their functional relationships with direct calving traits, SIGLEC12, CD33 and CEACAM18 were proposed as candidate genes. In addition, pleiotropic effects of this QTL region on direct calving traits and conformation traits were observed. However, the extent of linkage disequilibrium combined with the lack of complete annotation and potential errors in the Bos taurus genome assembly hampered our efforts to pinpoint the causal mutation. PMID:26486911

  4. A disintegrin and metalloprotease-12 is type I myofiber specific in Bos taurus and Bos indicus cattle. (United States)

    Coles, C A; Wadeson, J; Knight, M I; Cafe, L M; Johns, W H; White, J D; Greenwood, P L; McDonagh, M B


    A disintegrin and metalloproteinase-12 (ADAM12) is involved in the regulation of myogenesis and adipogenesis and is of interest as a potential target to manipulate skeletal muscle development and intramuscular fat (IMF) deposition in cattle to increase beef yield and improve meat quality. The longissimus thoracis muscle (LM) and semitendinosus muscle (STM) from 5 Bos taurus (Angus) and 5 Bos indicus (Brahman) cattle were collected for histological and ADAM12 gene and protein expression analysis. Myofiber typing was used to determine if ADAM12 expression patterns related to differences in muscling and IMF deposition, which are influenced by proportions of the different myofiber types. The STM was found to contain a higher proportion of glycolytic myofibers than the LM, which contained a greater proportion of oxidative myofibers (myofiber ratio of glycolytic to more oxidative types in LM and STM of 1.1 and 3.5, respectively; P < 0.05). ADAM12 gene expression, fluorescent immunohistochemical staining for ADAM12, and image analysis found ADAM12 to be greater in the LM (P < 0.05). Regression analysis found a strong, positive relationship for the distribution of ADAM12 against the proportion of type I myofibers (P < 0.05, r(2) = 0.86). These findings suggest ADAM12 is upregulated in muscles with more slow-oxidative myofibres, such as the LM, and is linked to type I myofibers in cattle. ADAM12 may be important in the regulation and maintenance slow myofibers in the LM muscle. PMID:24663211

  5. The Brain of the Domestic Bos taurus: Weight, Encephalization and Cerebellar Quotients, and Comparison with Other Domestic and Wild Cetartiodactyla (United States)

    Ballarin, Cristina; Povinelli, Michele; Granato, Alberto; Panin, Mattia; Corain, Livio; Peruffo, Antonella; Cozzi, Bruno


    The domestic bovine Bos taurus is raised worldwide for meat and milk production, or even for field work. However the functional anatomy of its central nervous system has received limited attention and most of the reported data in textbooks and reviews are derived from single specimens or relatively old literature. Here we report information on the brain of Bos taurus obtained by sampling 158 individuals, 150 of which at local abattoirs and 8 in the dissecting room, these latter subsequently formalin-fixed. Using body weight and fresh brain weight we calculated the Encephalization Quotient (EQ), and Cerebellar Quotient (CQ). Formalin-fixed brains sampled in the necropsy room were used to calculate the absolute and relative weight of the major components of the brain. The data that we obtained indicate that the domestic bovine Bos taurus possesses a large, convoluted brain, with a slightly lower weight than expected for an animal of its mass. Comparisons with other terrestrial and marine members of the order Cetartiodactyla suggested close similarity with other species with the same feeding adaptations, and with representative baleen whales. On the other hand differences with fish-hunting toothed whales suggest separate evolutionary pathways in brain evolution. Comparison with the other large domestic herbivore Equus caballus (belonging to the order Perissodactyla) indicates that Bos taurus underwent heavier selection of bodily traits, which is also possibly reflected in a comparatively lower EQ than in the horse. The data analyzed suggest that the brain of domestic bovine is potentially interesting for comparative neuroscience studies and may represents an alternative model to investigate neurodegeneration processes. PMID:27128674

  6. Embryonic development of the bovine pineal gland (Bos taurus) during prenatal life (30 to 135 days of gestation)


    Regodón, S.; Roncero, V


    The ontogenesis of the pineal gland of 30 bovine embryos (Bos taurus) has been analysed from 30 until 135 days of gestation by means of optical microscopy and immunohistochemical techniques. For this study, the specimens were grouped into three stages in accordance with the most relevant histological characteristics: Stage 1 (30 to 64 days of prenatal development); Stage 2 (70 to 90 days) and Stage 3 (106 to 135 days). In the cow, it is from 30 days of gestatio...

  7. The Brain of the Domestic Bos taurus: Weight, Encephalization and Cerebellar Quotients, and Comparison with Other Domestic and Wild Cetartiodactyla. (United States)

    Ballarin, Cristina; Povinelli, Michele; Granato, Alberto; Panin, Mattia; Corain, Livio; Peruffo, Antonella; Cozzi, Bruno


    The domestic bovine Bos taurus is raised worldwide for meat and milk production, or even for field work. However the functional anatomy of its central nervous system has received limited attention and most of the reported data in textbooks and reviews are derived from single specimens or relatively old literature. Here we report information on the brain of Bos taurus obtained by sampling 158 individuals, 150 of which at local abattoirs and 8 in the dissecting room, these latter subsequently formalin-fixed. Using body weight and fresh brain weight we calculated the Encephalization Quotient (EQ), and Cerebellar Quotient (CQ). Formalin-fixed brains sampled in the necropsy room were used to calculate the absolute and relative weight of the major components of the brain. The data that we obtained indicate that the domestic bovine Bos taurus possesses a large, convoluted brain, with a slightly lower weight than expected for an animal of its mass. Comparisons with other terrestrial and marine members of the order Cetartiodactyla suggested close similarity with other species with the same feeding adaptations, and with representative baleen whales. On the other hand differences with fish-hunting toothed whales suggest separate evolutionary pathways in brain evolution. Comparison with the other large domestic herbivore Equus caballus (belonging to the order Perissodactyla) indicates that Bos taurus underwent heavier selection of bodily traits, which is also possibly reflected in a comparatively lower EQ than in the horse. The data analyzed suggest that the brain of domestic bovine is potentially interesting for comparative neuroscience studies and may represents an alternative model to investigate neurodegeneration processes. PMID:27128674

  8. Evaluation of carcass characteristics and meat chemical composition of Bos indicus and Bos indicus x Bos taurus crossbred steers finished in pasture systems

    Directory of Open Access Journals (Sweden)

    Fernanda Barros Moreira


    Full Text Available The objective of this study was to evaluate the carcass characteristics (carcass weight, carcass yield, fat thickness, loin area, marbling and colour and chemical composition of the Longissimus dorsi muscle (moisture, ash, crude protein, fat and cholesterol of cuts with or without fat thickness, of Bos indicus and Bos indicus x Bos taurus crossbred steers finished in millet (Pennisetum americanum L. or star grass (Cynodon plectostachyus Pilger pasture systems, with mineral or mineral protein supplementation. Animals were slaughtered with an average body weight of 450 kg (Bos indicus or 470 kg (Bos indicus x Bos taurus crossbreed. There was no treatments effect on carcass characteristics and meat chemical composition of cut without fat thickness. The cuts with fat thickness of steers fed millet presented the highest fat deposition. Bos indicus steers presented higher carcass yield (57.23% and fat thickness (4.88 mm compared with crossbreed (53.40% and 3.05 mm. There was no breed effect on chemical composition of meat. The mean levels of cholesterol concentration were 31.41 mg/100 and 37.55 mg/100g of meat with and without fat thickness.O objetivo deste trabalho foi avaliar as características de carcaça (peso de carcaça, rendimento de carcaça, espessura de gordura de cobertura, área de olho de lombo, marmoreio e coloração e composição química do músculo Longissimus dorsi (umidade, cinzas, proteína bruta, gordura e colesterol de cortes, com ou sem gordura de cobertura, de novilhos Bos indicus e mestiços Bos indicus x Bos taurus terminados em sistemas em pastagem de milheto (Pennisetum americanum L. ou grama estrela (Cynodon plectostachyus Pilger, com suplementação mineral ou protéica e mineral. Os animais foram abatidos com peso médio de 450 kg (Bos indicus ou 470 kg (mestiços. Não houve efeito de tratamento sobre as características de carcaça e composição da carne com ou sem gordura de cobertura. Os cortes com gordura de

  9. Genome-wide detection and characterization of endogenous retroviruses in Bos taurus. (United States)

    Garcia-Etxebarria, Koldo; Jugo, Begoña Marina


    Endogenous retroviruses (ERVs) are the proviral phase of exogenous retroviruses that become integrated into a host germ line. They can play an important role in the host genome. Bioinformatic tools have been used to detect ERVs in several vertebrates, primarily primates and rodents. Less information is available regarding ERVs in other mammalian groups, and the source of this information is basically experimental. We analyzed the genome of the cow (Bos taurus) using three different methods. A BLAST-based method detected 928 possible ERVs, LTR_STRUC detected 4,487 elements flanked by long terminal repeats (LTRs), and Retrotector detected 9,698 ERVs. The ERVs were not homogeneously distributed across chromosomes; the number of ERVs was positively correlated with chromosomal size and negatively correlated with chromosomal GC content. The bovine ERVs (BoERVs) were classified into 24 putative families, with 20 of them not previously described. One of these new families, BoERV1, was the most abundant family and appeared to be specific to ruminants. An analysis of representatives of ERV families from rodents, primates, and ruminants showed a phylogenetic relationship following their hosts' relationships. This study demonstrates the importance of using multiple methods when trying to identify new ERVs and shows that the number of bovine ERV families is not as limited as previously thought. PMID:20686017

  10. Bovine Genome Database: new tools for gleaning function from the Bos taurus genome. (United States)

    Elsik, Christine G; Unni, Deepak R; Diesh, Colin M; Tayal, Aditi; Emery, Marianne L; Nguyen, Hung N; Hagen, Darren E


    We report an update of the Bovine Genome Database (BGD) ( The goal of BGD is to support bovine genomics research by providing genome annotation and data mining tools. We have developed new genome and annotation browsers using JBrowse and WebApollo for two Bos taurus genome assemblies, the reference genome assembly (UMD3.1.1) and the alternate genome assembly (Btau_4.6.1). Annotation tools have been customized to highlight priority genes for annotation, and to aid annotators in selecting gene evidence tracks from 91 tissue specific RNAseq datasets. We have also developed BovineMine, based on the InterMine data warehousing system, to integrate the bovine genome, annotation, QTL, SNP and expression data with external sources of orthology, gene ontology, gene interaction and pathway information. BovineMine provides powerful query building tools, as well as customized query templates, and allows users to analyze and download genome-wide datasets. With BovineMine, bovine researchers can use orthology to leverage the curated gene pathways of model organisms, such as human, mouse and rat. BovineMine will be especially useful for gene ontology and pathway analyses in conjunction with GWAS and QTL studies. PMID:26481361

  11. Mutagenic Potential ofBos taurus Papillomavirus Type 1 E6 Recombinant Protein: First Description

    Directory of Open Access Journals (Sweden)

    Rodrigo Pinheiro Araldi


    Full Text Available Bovine papillomavirus (BPV is considered a useful model to study HPV oncogenic process. BPV interacts with the host chromatin, resulting in DNA damage, which is attributed to E5, E6, and E7 viral oncoproteins activity. However, the oncogenic mechanisms of BPV E6 oncoprotein per se remain unknown. This study aimed to evaluate the mutagenic potential of Bos taurus papillomavirus type 1 (BPV-1 E6 recombinant oncoprotein by the cytokinesis-block micronucleus assay (CBMNA and comet assay (CA. Peripheral blood samples of five calves were collected. Samples were subjected to molecular diagnosis, which did not reveal presence of BPV sequences. Samples were treated with 1 μg/mL of BPV-1 E6 oncoprotein and 50 μg/mL of cyclophosphamide (positive control. Negative controls were not submitted to any treatment. The samples were submitted to the CBMNA and CA. The results showed that BPV E6 oncoprotein induces clastogenesis per se, which is indicative of genomic instability. These results allowed better understanding the mechanism of cancer promotion associated with the BPV E6 oncoprotein and revealed that this oncoprotein can induce carcinogenesis per se. E6 recombinant oncoprotein has been suggested as a possible vaccine candidate. Results pointed out that BPV E6 recombinant oncoprotein modifications are required to use it as vaccine.

  12. Sequenciamento e análise dos genes das subunidades alfa e beta do hormônio folículo estimulante de bovino (Bos taurus indicus Sequencing and analysis of subunits alpha and beta of the follicle stimulating hormone from bovine (Bos taurus indicus

    Directory of Open Access Journals (Sweden)

    Luci Sayori Murata


    Full Text Available

    Este trabalho relata uma clonagem e seqüenciamento das subunidades alfa e beta do hormônio folículo estimulante de Bos taurus indicus. Também apresenta os resultados de comparação realizada das seqüências gênicas dessas cadeias com as seqüências das cadeias alfa e beta do FSH de suínos e da cadeia beta de bovinos Bos taurus taurus já presentes no GenBank. Na comparação das seqüências de nucleotídeos e de aminoácidos predita da cadeia αFSH de Bos taurus indicus com as cadeias αFSH de outras espécies como suínos e búfalo (Bubalis bubalis, observou-se que as seqüências são bastante similares. A comparação da seqüência da subunidade αFSH de Bos taurus indicus com a de suíno demonstrou diferenças em três resíduos de aminoácidos. Na comparação com ßFSH, registrou-se modificação na primeira base do codon que levou à alteração no resíduo do aminóacido 83, que, em Bos taurus indicus, é uma glicina, ao invés da serina presente em Bos taurus taurus. Confirmaram-se essa modificação e todas as outras identificadas na seqüência dos cDNA das cadeias αFSH e βFSH em outra clonagem. A modificação Ser para Gly na posição 83 foi a única que alterou a identidade do resíduo de aminoácido na comparação entre as subunidades beta do FSH de Bos taurus indicus e Bos taurus taurus. Contudo, ela não deve alterar significativamente as propriedades fisiológicas do FSH, uma vez que o resíduo de glicina encontrado nessa posição também é encontrado na cadeia βFSH suína. Trata-se, portanto, de uma modificação particular que distingue as cadeias βFSH de B. taurus taurus e B. taurus indicus.


    PALAVRAS-CHAVES: Bovino, clonagem, FSH, hormônio.

    The aim this work was to promove the cloning and analysis sequencing

  13. Influence of calf genotype on colostral immunoglobulins in Bos taurus and Bos indicus cows and serum immunoglobulins in their calves. (United States)

    Vann, R C; Holloway, J W; Carstens, G E; Boyd, M E; Randel, R D


    Purebred Bos indicus calves are documented to have lower survival rates than Bos taurus calves. Thus, this study was designed to investigate the possibility that this decreased survival rate may be attributed to dam colostral immunoglobulin (Ig) concentrations and subsequent calf serum Ig concentrations. The specific objective was to determine the effect of breed type of calf on colostrum production, immunoglobulin concentrations in colostrum and calf serum, and availability and absorption efficiency of Ig. Brahman (B) and Angus (A) cattle were reciprocally mated to produce calves of the following types: A x A (n = 8), A x B (n = 9), B x B (n = 11), and B x A (n = 11). At birth, calves were separated from their dams and a blood sample was collected before feeding pooled colostrum (30 mL/kg birth weight) at 1 and 6 h of age. From 6 to 12 h of age, each calf was placed in a box that allowed interaction with the dam but prevented suckling. At 12 h of age, each calf was fed its dam's colostrum and placed with the dam. Additional blood samples were collected at 12, 24, and 48 h after birth. Serum and colostrum samples were analyzed for IgG, IgG1, IgG2, IgM, and IgA using single radial immunodiffusion (RID) assay techniques. The cows were hand-milked after induction of milk letdown with oxytocin at 1 and 12 h after calving. Colostrum volume was recorded, and samples were collected. Brahman cows produced more (P x B and A x B breed types of calf. Brahman cows had more Ig available at 1 and 12 h than A cows due to increased production of colostrum. Breed type influenced colostral Ig in cattle. Serum concentrations of total Ig, IgG, IgG1, IgG2, IgM, and IgA in the calf and efficiency of absorption at 6 and 12 h were not affected by breed type, sex of calf, or any interaction. PMID:8617676

  14. A new single nucleotide polymorphism in CAPN1 extends the current tenderness marker test to include cattle of Bos indicus, Bos taurus, and crossbred descent. (United States)

    White, S N; Casas, E; Wheeler, T L; Shackelford, S D; Koohmaraie, M; Riley, D G; Chase, C C; Johnson, D D; Keele, J W; Smith, T P L


    The three objectives of this study were to 1) test for the existence of beef tenderness markers in the CAPN1 gene segregating in Brahman cattle; 2) test existing CAPN1 tenderness markers in indicus-influenced crossbred cattle; and 3) produce a revised marker system for use in cattle of all subspecies backgrounds. Previously, two SNP in the CAPN1 gene have been described that could be used to guide selection in Bos taurus cattle (designated Markers 316 and 530), but neither marker segregates at high frequency in Brahman cattle. In this study, we examined three additional SNP in CAPN1 to determine whether variation in this gene could be associated with tenderness in a large, multisire American Brahman population. One marker (termed 4751) was associated with shear force on postmortem d 7 (P Brangus, Beefmaster, Bonsmara, Romosinuano, Hereford, and Angus referred to as the GPE Cycle 8 population). The highly significant association of Marker 4751 with shear force in this population (P < 0.001) confirms the usefulness of Marker 4751 in cattle of all subspecies backgrounds, including Bos taurus, Bos indicus, and crossbred descent. This wide applicability adds substantial value over previously released Markers 316 and 530. However, Marker 316, which had previously been shown to be associated with tenderness in the GPE Cycle 7 population, also was highly associated with shear force in the GPE Cycle 8 animals (P < 0.001). Thus, Marker 316 may continue to be useful in a variety of populations with a high percentage of Bos taurus backgrounds. An optimal marker strategy for CAPN1 in many cases will be to use both Markers 316 and 4751. PMID:16100054

  15. Sarcocystis rommeli, n. sp. (Apicomplexa: Sarcocystidae) from Cattle (Bos taurus) and its Differentiation from Sarcocystis hominis. (United States)

    Dubey, Jitender P; Moré, Gastón; van Wilpe, Erna; Calero-Bernal, Rafael; Verma, Shiv K; Schares, Gereon


    Cattle (Bos taurus) are intermediate hosts for three named species of Sarcocystis, S. cruzi, S. hirsuta, and S. hominis. Recently, a fourth species was identified and named S. sinensis. However, S. sinensis originally named a species of Sarcocystis in water buffalo (Bubalus bubalis) in China. Based on unverifiable evidence, it was suggested that the same parasite infects cattle. In addition, S. sinensis was recently declared as nomen nudum because its naming violated the rules of International Code of Zoological Nomenclature. Thus, the fourth species using cattle as an intermediate host does not have a valid name. Here, we propose a new name, Sarcocystis rommeli for the S. sinensis-like parasite from cattle in Argentina, and differentiate it ultrastructurally from S. hominis sarcocysts from experimentally infected cattle. Sarcocystis rommeli sarcocysts were microscopic with a 5-μm-thick wall with slender villar protrusions (Vp); the Vp were up to 5 μm long, up to 0.5 μm wide, and of uneven thickness, often bent at an angle. The ground substance layer (Gs) was up to 0.8 μm thick and smooth. Vesicular structures were seen at the base of the Vp. The bradyzoites were 10-12 μm long. Sarcocystis hominis sarcocysts had Vp that were often upright, up to 7.5 μm long, and up to 1.8 μm wide; the Gs was up to 2 μm thick and without vesicles. Its sarcocyst wall was up to 5.6 μm thick, the vp were bent at an angle, up to 5.8 μm long, the Gs was up to 2 μm thick, but without vesicles seen in S. rommeli. Beef containing sarcocysts of S. rommeli was not orally infectious for two human volunteers and a red fox (Vulpes vulpes). The Sarcocystis described here is molecularly different from S. cruzi, S. hirsuta, and S. hominis based on 18S rRNA and cox1 gene sequences. PMID:26111603

  16. Identity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus) and the suppression of Sarcocystis sinensis as a nomen nudum (United States)

    There are uncertainties concerning the identity and host species specificity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus). Currently, in cattle three species are recognized with known endogenous stages, viz.: S. cruzi (with canine definitive host), S. hirsuta...

  17. Bos taurus genome sequence reveals the assortment of immunoglobulin and surrogate light chain genes in domestic cattle

    Directory of Open Access Journals (Sweden)

    Liljavirta Jenni


    Full Text Available Abstract Background The assortment of cattle immunoglobulin and surrogate light chain genes has been extracted from the version 3.1 of Bos taurus genome sequence as a part of an international effort to sequence and annotate the bovine genome. Results 63 variable lambda chain and 22 variable kappa chain genes were identified and phylogenetically assigned to 8 and 4 subgroups, respectively. The specified phylogenetic relationships are compatible with the established ruminant light chain variable gene families or subgroups. Because of gaps and uncertainties in the assembled genome sequence, the number of genes might change in the future versions of the genome sequence. In addition, three bovine surrogate light chain genes were identified. The corresponding cDNAs were cloned and the expression of the surrogate light chain genes was demonstrated from fetal material. Conclusion The bovine kappa gene locus is compact and simple which may reflect the preferential use of the lambda chain in cattle. The relative orientation of variable and joining genes in both loci are consistent with a deletion mechanism in VJ joining. The orientation of some variable genes cannot be determined from the data available. The number of functional variable genes is moderate when compared to man or mouse. Thus, post-recombinatorial mechanisms might contribute to the generation of the bovine pre-immune antibody repertoire. The heavy chains probably contribute more to recombinational immunoglobulin repertoire diversity than the light chains but the heavy chain locus could not be annotated from the version 3.1 of Bos taurus genome.

  18. Effect of single nucleotide polymorphisms of CAPN1 and CAST genes on meat traits in Nellore beef cattle (Bos indicus) and in their crosses with Bos taurus. (United States)

    Curi, R A; Chardulo, L A L; Mason, M C; Arrigoni, M D B; Silveira, A C; de Oliveira, H N


    The objectives of this work were to study the segregation of single nucleotide polymorphisms of the calpain 1, large subunit (CAPN1) and calpastatin (CAST) genes in Nellore (Bos indicus) and Nellore xBos taurus beef cattle, as well as to evaluate their effects on meat traits. For this, 300 animals, including 114 Nellore, 67 Angus x Nellore, 44 Rubia Gallega x Nellore, 41 Canchim, 19 Brangus three-way crosses and 15 Braunvieh three-way crosses, were genotyped for the CAPN4751 [AF_248054.2:g.6545C>T (GenBank accession AF248054.2)] and CAST/DdeI [AF_159246.1:g.2959A>G (GenBank accession AF159246.1)] polymorphisms and phenotyped for Ribeye Area, Backfat Thickness, Intramuscular Fat, Shear Force (SF) and Myofibrillar Fragmentation Index (MFI). In relation to the CAPN4751 polymorphism, a frequency of 10.5% was observed for the C allele in the Nellore breed. In the total sample of studied animals, a significant association was found between genotypes and meat tenderness, assessed by SF (P = 0.005) and MFI (P = 0.008), with genotype CT being more favourable than TT. For the CAST/DdeI polymorphism, a frequency of 55.7% was found for the A allele in the Nellore breed. In the total sample, a significant association was observed between genotypes and meat tenderness - SF (P = 0.004) and MFI (P = 0.006), with genotype AA being more favourable than AG. The relationship between genotypes and aged meat tenderness in confluence with the distribution of favourable alleles shows great potential for application of the CAPN4751 and CAST/DdeI polymorphisms in the genetic improvement of the Nellore breed, whilst contributing to the validation, in this breed and in its crosses with B. taurus, of the association results previously described in the literature. PMID:19392828

  19. Energy requirements and cow/calf efficiency of Nellore and Continental and British Bos taurus x Nellore crosses. (United States)

    Calegare, L; Alencar, M M; Packer, I U; Lanna, D P D


    The objective of this work was to compare breed types with increasing percentage of Bos taurus on cow/calf energy requirements and preweaning efficiency. Forty mature, lactating, nonpregnant cows [10 Nellore (NL), 10 Canchim x Nellore (CN), 10 Angus x Nellore (AN), and 10 Simmental x Nellore (SN)] were randomized in blocks by calving date. Calves from cross-bred cows were sired by Canchim bulls (5/8 Charolais + 3/8 Zebu), whereas calves from NL cows were sired by Nellore bulls. Cows were individually fed a pelleted diet with 50% hay (alfalfa and coastcross) and 50% concentrate from calving to weaning (20 to 180 d post-partum). Estimated diet ME content was 2.24 Mcal/kg of DM. Individual cow DMI was adjusted every 14 d to keep shrunk BW and BCS constant. Shrunk BW and BCS were 430 +/- 12 kg and 4.7 +/- 0.09 for NL, 449 +/- 10 kg and 4.8 +/- 0.09 for CN, 496 +/- 10 kg and 5.0 +/- 0.09 for AN, and 507 +/- 12 kg and 5.1 +/- 0.09 for SN. At 40 d calves were allowed ad libitum access to the same diet. Milk yield was recorded using a weigh-suckle-weigh technique. Increasing B. taurus percentage had a linear effect (P body composition was estimated at weaning using the 9-10-11th-rib section. Retained energy (Mcal) was greater (P < 0.05) in 1/4A (384 +/- 19.9) than in Nellore (298 +/- 21.6) and 3/4C calves (312 +/- 19.8), and was intermediate in 1/4S calves (333 +/- 21.6). Cow/calf energetic efficiency (kcal deposited/Mcal of MEI by the pair) was greater (P < 0.05) for AN (103 +/- 5.3) than NL (84.9 +/- 5.9), CN (83 +/- 5.3), and SN pairs (83.5 +/- 6.1). Difference (P < 0.05) between Continental and British crosses was shown in linear contrasts; SN pairs had greater MEI and lower retained energy than AN. Increasing the B. taurus percentage increased inputs as well as outputs. However, a relatively greater increase in outputs resulted in significantly greater preweaning efficiency. Purebred Nellore had lower ME requirements; however, in an environment without nutritional

  20. Select Synch and Co-Synch protocols using a CIDR yield similar pregnancy rates after a fixed-time insemination in suckled Bos indicus × Bos taurus cows. (United States)

    Esterman, Regina D; Alava, Erin N; Austin, Brad R; Hersom, Matthew J; Yelich, Joel V


    Primiparous and multiparous suckled Bos indicus × Bos taurus cows were used to compare a Select Synch + controlled internal drug release (CIDR) and timed artificial insemination (AI) protocol (SSC) to a modified CO-Synch + CIDR protocol (COS). Five separate groups of cows were utilized (n = 659) and within a group, cows were allotted to two treatments on the basis of body condition score (BCS) taken 10 days before and days postpartum at CIDR insertion (Day 0). Blood samples were collected on Day -10 and 0 for assessment of circulating concentrations of progesterone to determine estrous cycling status. Cows in both treatments received intramuscular (im) GnRH (100 μg) and a CIDR inserted on Day 0. On Day 7, the SSC treatment had CIDR removed and received im PGF2α (25 mg), whereas COS treatment had CIDR removed and received im PGF2α (25 mg) on Day 7.5. In the SSC treatment, estrus was detected daily at 0700 and 1700 hours for 72 hours after PGF2α administration, and cows were artificially inseminated 8 to 12 hours after a detected estrus. Cows failing to exhibit estrus were subjected to timed-AI and received im GnRH (100 μg) 76 ± 4 hours after PGF2α administration. In the COS treatment, cows received im GnRH (100 μg) and were fixed-time artificially inseminated at 64 ± 4 hours after PGF2α administration. Although group differences (P 0.05) for SSC (49.4%; n = 164 of 332) and COS (47.1%; n = 154 of 327). Estrous cycling status and days postpartum did not (P > 0.05) influence synchronized AI pregnancy rates but BCS did (P < 0.05). Cows with a BCS greater than or equal to 5 had synchronized AI pregnancy rates of 50% compared to 39% for cows with BCS lesser than 5.0. In summary, the modified COS protocol yielded similar synchronized AI pregnancy rates compared to the SSC protocol, and it appears that the modified COS protocol has the potential to be an effective timed-AI protocol in suckled Bos indicus × Bos taurus cows. PMID:26631280

  1. Mitogenomes from Egyptian Cattle Breeds: New Clues on the Origin of Haplogroup Q and the Early Spread of Bos taurus from the Near East


    Olivieri, Anna; Gandini, Francesca; Achilli, Alessandro; Fichera, Alessandro; Rizzi, Ermanno; Bonfiglio, Silvia; Battaglia, Vincenza; Brandini, Stefania; De Gaetano, Anna; El-Beltagi, Ahmed; Lancioni, Hovirag; Agha, Saif; Semino, Ornella; Ferretti, Luca; Torroni, Antonio


    Background Genetic studies support the scenario that Bos taurus domestication occurred in the Near East during the Neolithic transition about 10 thousand years (ky) ago, with the likely exception of a minor secondary event in Italy. However, despite the proven effectiveness of whole mitochondrial genome data in providing valuable information concerning the origin of taurine cattle, until now no population surveys have been carried out at the level of mitogenomes in local breeds from the Near ...

  2. Candidate SNPs for carcass and meat traits in Nelore animals and in their crosses with Bos taurus

    Directory of Open Access Journals (Sweden)

    Rogério Abdallah Curi


    Full Text Available The objective of this work was to evaluate the effects of single-nucleotide polymorphisms (SNPs in the genes IGF1 (AF_017143.1:g.198C>T, MSTN (AF_320998.1:g.433C>A, MYOD1 (NC_007313:g.1274A>G and MYF5 (NC_007303:g.1911A>G on carcass and meat traits in Nelore (Bos indicus and Nelore x B. taurus. A total of 300 animals were genotyped and phenotyped for rib eye area (REA, backfat thickness (BT, intramuscular fat (IF, shear force (SF and myofibrillar fragmentation index (MFI. The effects of allele substitution for each SNP were estimated by regression of the evaluated phenotypes on the number of copies of a particular allele using the general linear model. The polymorphism at IGF1 was non-informative in Nelore animals. In crossbred animals, the IGF1 C allele was associated with greater REA. However, this relation was not significant after Bonferroni correction for multiple testing. The A allele of the MSTN polymorphism was absent in Nelore cattle and was only found in two crossbred animals. The polymorphisms of MYOD1 and MYF5 were little informative in Nelore animals with G allele frequency of 0.097 and A allele frequency of 0.031, respectively. These markers show no association with the analyzed traits in the total sample of evaluated animals.

  3. Urinary excretion of purine derivatives as an index of microbial protein supply in cross-bred (Bos indicus x Bos taurus) cattle in tropical environment

    International Nuclear Information System (INIS)

    Four experiments were carried out to establish a response model between urinary excretion of purine derivatives (PD) and microbial production in Bos indicus x Bos taurus cross-bred cattle: LZ, MZ and HZ (3/8, 1/2 and 5/8 Bos indicus, respectively). The fasting PD excretion was considered as endogenous excretion and amounted to 268 (± 85.1), 294 (± 128.1) and 269 (± 68.4) μmol/kg W0.75 for LZ, MZ and HZ, respectively. Urinary recovery of absorbed purine bases (PB) was calculated as the urinary recovery of a single dose of intrajugular infused uric acid (1,3-15N). In HZ crossbred cattle 83% (± 20.3) of infused uric acid was recovered in the urinary PD. The relationship between duodenal purine absorption (X, mmol/d) and urinary PD excretion (Y, mmol/d) was defined in HZ crossbred cattle as Y = 0.83 X + 0.269W0.75 (± 85.1), assuming that the endogenous contribution was constant and independent of the exogenous PB supply. The activity of xanthine oxidase (EC was determined in HZ and MZ and was found to be higher in the liver (0.62 and 0.66 units/g, respectively) than in intestinal mucosa (0.09 and 0.03 units/g, respectively), whereas xanthine oxidase activity was practically absent in plasma of both cross breeds. The ratio PB:total N was determined in microbial extracts taken from rumen fluid of cows fed Bermuda grass (Cynodon dactylon) as the sole diet or supplemented (ratio of 80:20, grass: supplement) with gluten feed, soybean hulls or Gliricidia species and were found to range from 1.52-1.62 μmol PB/mg N. (author)

  4. Eficácia do tratamento Ovsynch associado à inseminação artificial prefixada em rebanhos Bos taurus e Bos indicus Efficacy of the Ovsynch treatment associated to fixed-time artificial insemination in Bos taurus and Bos indicus herds

    Directory of Open Access Journals (Sweden)

    Rafael Herrera Alvarez


    Full Text Available O presente trabalho objetivou avaliar a eficácia do tratamento Ovsynch associado à inseminação artificial em tempo prefixado em vacas Bos taurus e Bos indicus. Foram utilizados rebanhos das raças Holandesa, Caracu, Nelore e Mantiqueira. Também foi incluído um rebanho de vacas Gir, com problemas de fertilidade. Cada rebanho foi dividido em três grupos. O grupo 1 recebeu o tratamento Ovsynch e foi inseminado em tempo prefixado. O grupo 2 foi inseminado no cio induzido com cloprostenol. O grupo 3 foi inseminado no cio natural. As taxas de concepção e de prenhez foram determinadas por ultra-sonografia. Não existiu interação significativa das variáveis reprodutivas analisadas para rebanho, idade, período pós-parto, número de parição e presença do bezerro. A taxa de concepção não diferiu (P>0,05 entre os grupos, ao passo que a taxa de prenhez foi superior (PThe present study aimed to evaluate the efficiency of Ovsynch treatment associated with prefixed-time artificial insemination on Bos taurus and Bos indicus cows. Herds of Holstein, Caracu, Nelore and Mantiqueira breeds were used. A herd of Gir cows with poor reproductive performance was also included. Each breed was divided in tree groups. Group 1 received Ovsynch treatment and was inseminated at prefixed time. Group 2 was induced to estrus with cloprostenol and inseminated thereafter. Group 3 was inseminated at natural heat. Conception and pregnancy rates were determined by ultra-sound. No significant interactions were detected among breeds, age, parity, postpartum period and lactating cows with or without their calves. Conception rates did not differ (P>0.05 among groups while pregnancy rate was higher (P<0.05 for group 1 and 2 comparing to group 3. In the Gir herd Ovsynch treatment did not enhance conception nor pregnancy rates. Independently of breed, conception rate is similar after Ovsynch, cloprostenol and control treatments, and pregnancy rate can be improved with

  5. Evaluation of reciprocal differences in Bos indicus x Bos taurus backcross calves produced through embryo transfer: I. Birth and weaning traits. (United States)

    Amen, T S; Herring, A D; Sanders, J O; Gill, C A


    Angus (A) and Bos indicus (B; Brahman or Nellore) reciprocal backcross, embryo transfer calves, belonging to 28 full-sib families, were evaluated for differences in birth weight, gestation length, and weaning weight. Two methods were investigated; method I made no distinction between how the F(1) parents were produced, whereas method II distinguished between the 2 types of F(1) parents (AB vs. BA corresponding to A x B vs. B x A, respectively). Bos indicus backcross calves had a 4.3 d longer (P x F(1) calves had a 5.2 d longer (P = 0.01) gestation length than F(1) x B calves (290.5 vs. 285.3, respectively). Under method II analysis, there was a consistent trend for gestation length, in which BA F(1) parents produced calves that ranked greater than calves from AB F(1) parents, as sires and dams. Crosses with a greater proportion of B in the sire in relation to the amount in the dam had a heavier (P x A and B x F(1); 38.1 and 38.4 kg, respectively) than their respective reciprocal crosses (A x F(1) and F(1) x B; 34.3 and 33.5 kg, respectively). The F(1) x A and B x F(1) crosses showed a large difference in birth weight between males and females (5.3 and 4.1 kg, respectively), whereas A x F(1) and F(1) x B crosses showed a small difference (P > 0.10) in birth weight between males and females (1.5 and 1.1 kg, respectively). Further examination within each sex showed a difference between male reciprocals that was generally much larger than that between female reciprocals. Calves with a greater percentage of B in the sire compared with the proportion in the dam ranked heavier for weaning weight as for birth weight, though these differences were not significant. In breeding systems involving B x Bos taurus crosses, even when using embryo transfer, not only does the breed composition of the calves affect their preweaning performance, but the particular cross that produces the calves also should be considered in making breeding decisions. PMID:17235021

  6. Accuracy of prediction of genomic breeding values for residual feed intake and carcass and meat quality traits in Bos taurus, Bos indicus, and composite beef cattle. (United States)

    Bolormaa, S; Pryce, J E; Kemper, K; Savin, K; Hayes, B J; Barendse, W; Zhang, Y; Reich, C M; Mason, B A; Bunch, R J; Harrison, B E; Reverter, A; Herd, R M; Tier, B; Graser, H-U; Goddard, M E


    The aim of this study was to assess the accuracy of genomic predictions for 19 traits including feed efficiency, growth, and carcass and meat quality traits in beef cattle. The 10,181 cattle in our study had real or imputed genotypes for 729,068 SNP although not all cattle were measured for all traits. Animals included Bos taurus, Brahman, composite, and crossbred animals. Genomic EBV (GEBV) were calculated using 2 methods of genomic prediction [BayesR and genomic BLUP (GBLUP)] either using a common training dataset for all breeds or using a training dataset comprising only animals of the same breed. Accuracies of GEBV were assessed using 5-fold cross-validation. The accuracy of genomic prediction varied by trait and by method. Traits with a large number of recorded and genotyped animals and with high heritability gave the greatest accuracy of GEBV. Using GBLUP, the average accuracy was 0.27 across traits and breeds, but the accuracies between breeds and between traits varied widely. When the training population was restricted to animals from the same breed as the validation population, GBLUP accuracies declined by an average of 0.04. The greatest decline in accuracy was found for the 4 composite breeds. The BayesR accuracies were greater by an average of 0.03 than GBLUP accuracies, particularly for traits with known genes of moderate to large effect mutations segregating. The accuracies of 0.43 to 0.48 for IGF-I traits were among the greatest in the study. Although accuracies are low compared with those observed in dairy cattle, genomic selection would still be beneficial for traits that are hard to improve by conventional selection, such as tenderness and residual feed intake. BayesR identified many of the same quantitative trait loci as a genomewide association study but appeared to map them more precisely. All traits appear to be highly polygenic with thousands of SNP independently associated with each trait. PMID:23658330

  7. Genetic parameters of infectious bovine keratoconjunctivitis and its relationship with weight and parasite infestations in Australian tropical Bos taurus cattle

    Directory of Open Access Journals (Sweden)

    Ali Abdirahman A


    Full Text Available Abstract Background Infectious bovine keratoconjunctivitis (IBK or ‘pinkeye’ is an economically important ocular disease that significantly impacts animal performance. Genetic parameters for IBK infection and its genetic and phenotypic correlations with cattle tick counts, number of helminth (unspecified species eggs per gram of faeces and growth traits in Australian tropically adapted Bos taurus cattle were estimated. Methods Animals were clinically examined for the presence of IBK infection before and after weaning when the calves were 3 to 6 months and 15 to 18 months old, respectively and were also recorded for tick counts, helminth eggs counts as an indicator of intestinal parasites and live weights at several ages including 18 months. Results Negative genetic correlations were estimated between IBK incidence and weight traits for animals in pre-weaning and post-weaning datasets. Genetic correlations among weight measurements were positive, with moderate to high values. Genetic correlations of IBK incidence with tick counts were positive for the pre-weaning and negative for the post-weaning datasets but negative with helminth eggs counts for the pre-weaning dataset and slightly positive for the post-weaning dataset. Genetic correlations between tick and helminth eggs counts were moderate and positive for both datasets. Phenotypic correlations of IBK incidence with helminth eggs per gram of faeces were moderate and positive for both datasets, but were close to zero for both datasets with tick counts. Conclusions Our results suggest that genetic selection against IBK incidence in tropical cattle is feasible and that calves genetically prone to acquire IBK infection could also be genetically prone to have a slower growth. The positive genetic correlations among weight traits and between tick and helminth eggs counts suggest that they are controlled by common genes (with pleiotropic effects. Genetic correlations between IBK incidence

  8. [The changes of expression and Fc-gamma-receptor's polypeptide composition of fetal small intestine enterocytes in Bos primigenius taurus L]. (United States)

    Masiuk, D M; Nedzvets'kyĭ, V S; Tsvilikhovs'kyĭ, M I; Nerush, P O


    The expression and polypeptide composition of Fc-gamma-receptors of enterocytes from Bos primigenius taurus L. intestine at 3-, 5-, 7-, 9- month of fetal development was investigated. The results of immunobloting show similar composition of Fc-gamma-receptors extracted from apical and basolateral membranes. The proteins that bind IgG after PAAG electrophoresis and transferring on nitrocellulose were observed as 120, 87, 72 and 43 kDa polypeptide line. The changes of each polypeptide contents were related to the changes of total content of Fc-gamma-receptor proteins. The rise in concentration of Fc-gamma-receptors on apical membrane was observed from 3-rd to 7-th month of fetal development. Maximal concentration of these proteins was detected on enterocytes at 7-th month of fetal development. Fc-gamma-receptors content on basolateral side was higher than on apical side. The presence of Fc-gamma-receptors on enterocyte's membrane indicates on active recycling of these receptors on plasma membrane and reflects early development of immune system in Bos primigenius taurus L. fetus. PMID:18416181

  9. Heat tolerance in two tropically adapted Bos taurus breeds, Senepol and Romosinuano, compared with Brahman, Angus, and Hereford cattle in Florida. (United States)

    Hammond, A C; Olson, T A; Chase, C C; Bowers, E J; Randel, R D; Murphy, C N; Vogt, D W; Tewolde, A


    Two trials were conducted with heifers to determine heat tolerance among temperate Bos taurus (Angus, Hereford), Bos indicus (Brahman), tropical Bos taurus (Senepol, Romosinuano), and the reciprocal crosses of Hereford and Senepol. Differences among breeds in temperament score, circulating concentrations of cortisol, and blood packed cell volume were also investigated. Trial 1 used 43 Angus, 28 Brahman, 12 Hereford, 23 Romosinuano, 16 Senepol, 5 Hereford x Senepol (H x S), and 5 Senepol x Hereford (S x H) heifers. Trial 2 used 36 Angus, 31 Brahman, 9 Hereford, 14 Senepol, 19 H x S, and 10 S x H heifers. On the hottest summer date in Trial 1, rectal temperature of Angus was greater (P Brahman, Senepol, or Romosinuano. Rectal temperature and plasma cortisol were significantly less in Senepol than in Brahman, suggesting that the differences in rectal temperature between these breeds may be due to differences in stress response possibly related to differences in temperament. Reciprocal crosses of Hereford and Senepol had rectal temperatures nearly as low as that of Senepol and displayed substantial heterosis (-9.4%, P Angus heifers had significantly faster respiration rates than Brahman, Romosinuano, or Senepol heifers, and Brahman had significantly slower respiration rates than Romosinuano or Senepol. On the hottest summer date in Trial 2, rectal temperature in Angus heifers was greater (P Brahman or Senepol had rectal temperatures similar to that of Senepol, or heterosis for log10 rectal temperature was similar to that in Trial 1 (-9.8%, P Brahman always had the slowest respiration rate and greatest packed cell volume. Brahman had significantly greater temperament scores and plasma cortisol concentrations than Angus or Senepol, except that plasma cortisol was not different between Brahman and Senepol on the hottest summer date. On this date, rectal temperature did not differ between Brahman and Senepol, which supports the hypothesis that there is a relationship

  10. Rendimiento de la canal en búfalos de río (Bubalus bubalis y Bovinos mestizos (Bos indicus x Bos taurus en el Municipio Bayazo - Canal performance in river buffaloes (Bubalus bubalis and mixed racial bovines (Bos indicus x Bos taurus in the Bayamo Municipality

    Directory of Open Access Journals (Sweden)

    Ramírez Reyes, B


    Full Text Available ResumenCon el objetivo de determinar algunas características de rendimientoen canales bufalinas (Bubalus bubalis de animales procedentes delCentro de Ceba El Progreso y compararlas con canales vacunas (Bosindicus x Bos taurus comercializadas, se desarrolló esta investigación en el matadero Jucaibama. Se trabajaron 60 animales enteros de cada especie con edades entre 24 y 32 meses, a los cuales se les determinaron los siguientes parámetros: peso de embarque (Kg.(PE, peso vivo reposo (PV (Kg. peso de la canal en kg. (PC,rendimiento en carne en kg. (RC, rendimiento en carne de primera enKg. (RC1 y rendimiento en carne de segunda en Kg. (RC2. Losresultados fueron para (PE 543,43 y 489,92 arrojando el análisisdiferencias altamente significativas, al igual que para las (PV y (PC que fueron de 527,12 y 474,15; 271,52 y 244,83 para búfalos yvacunos respectivamente. Las variables (RC, (RC1 y (RC2 nomostraron diferencias significativas, sus valores fueron 167,37 y171,93; 88,7 y 91,12; 76,66 y 78,74 para canales bubalinas yvacunas. Se concluye que los búfalos presentaron pesos mayores alsacrificio y de canal que los vacunos evaluados. El búfalo presentómayores rendimientos en carne, parámetros que indican que tiene laposibilidad de desarrollar mayor masa muscular que sus competidoresvacunos.SummaryThis research was carried out in the drudgery Jucaibama of determining some quality characteristics in the buffaloes meat(Bubalus bubalis of animal that belong to the feeding place ElProgreso. These characteristics are compare with the ones of the beefcattle (Bos indicus x taurus that are commercialized. 60 whole maleanimals of each species were taken as sample. They were about 24and 32 months old and they were determine the following parameters:Shipment weight (Kg., weight after twelve hours, meat weight, meatservility and servility of the best showed highly significant differences, just as the ones for (PV and (PC whose results were 527,12 and 474

  11. Effects of beta agonists in the diagnosis of fasciolosis in Bos indicus x Bos taurus in the state of Puebla, Mexico

    International Nuclear Information System (INIS)

    currently in Mexico about 30 million cattle of which about 15000.000 million are in areas at high risk of infestation and about 5,000,000 million fascioliosis animals are with, if we estimate the economic losses per year gives us an approximate price of 4,500,000,000 pesos are lost annually, on the other hand, the lack of good pasture especially in times of drought in the state are helping farmers are feeding their animals with food additives in this case the betaagonist (clenbuterol and the like ), At present there are several municipal traces at the state level are discarding the livers of cattle producing very large economic losses. been conducted on prevailing level of municipal trail Atlixco (zone endemic to the disease) in the year 2001-02 with a prevalence of 32-33 % While that in 2007 set a precedence of 7% over the same track municipal; this parasitic disease that affects the liver parenchyma and pipelines, affects the metabolic activity of the liver, this organ is one of the most important thing, because it participates in many metabolic pathways, as in the production and secretion of bile, regulates the metabolism of carbohydrates, lipids and proteins among others. This parasitic disease affects the production of meat and milk in ruminant animals in this very particular case Bos taurus x Bos indicus, the affected animals, these activities are depleted in previous studies have found that animals are fed with food additives such as beta -adrenergic-agonist, whose effect is to produce lipolysis, lipogenesis, are glucoliticos, and glycogen, affecting body composition, favouring neoformation tissue by the redistribution of power, also increasing the release of fatty acids into the blood, facilitating the synthesis of protein and retains the nitrogen fed into skeletal muscle, these components used as food additives are prohibited by federal law nationals (SAGARPA NOM-015-ZOO-2002), as the consumption of meat produced visceral primarily of clinical cases as tachycardia

  12. Identity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus) and the suppression of Sarcocystis sinensis as a nomen nudum. (United States)

    Dubey, J P; Fayer, R; Rosenthal, B M; Calero-Bernal, R; Uggla, A


    There are uncertainties concerning the identity and host species specificity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus). Currently, in cattle three species are recognized with known endogenous stages, viz.: S. cruzi (with canine definitive host), S. hirsuta (feline definitive host), and S. hominis (primate definitive host). Recently, a fourth Sarcocystis species with an unknown life cycle has been reported from cattle. In the water buffalo, four species of Sarcocystis have been described: S. fusiformis (feline definitive host), S. buffalonis (feline definitive host), S. levinei (canine definitive host), and S. dubeyi (definitive host unknown but not cat or dog). Besides, there are studies of Sarcocystis infections in buffalo and cattle from China with results that are difficult to interpret and validate. For example, some of the studies report transmission of Sarcocystis species between cattle and buffalo, but steps to preclude exogenous exposures were not reported. A species of the water buffalo, 'S. sinensis', was proposed at a Chinese national conference in 1990, and published as an abstract without figures and with no archived type specimens for verification. The International Code of Zoological Nomenclature Articles 9 and 10 state that "abstracts of articles, papers, posters, text of lectures, and similar material when issued primarily to participants at meetings, symposia, colloquia or congress does not constitute published work"; therefore, S. sinensis is a nomen nudum. PMID:25034134

  13. Differential abundances of four forms of Binder of SPerm 1 in the seminal plasma of Bos taurus indicus bulls with different patterns of semen freezability. (United States)

    Magalhães, Marcos Jorge; Martins, Leonardo Franco; Senra, Renato Lima; Santos, Thaís Ferreira Dos; Okano, Denise Silva; Pereira, Paulo Roberto Gomes; Faria-Campos, Alessandra; Campos, Sérgio Vale Aguiar; Guimarães, José Domingos; Baracat-Pereira, Maria Cristina


    The Binder of SPerm 1 (BSP1) protein is involved in the fertilization and semen cryopreservation processes and is described to be both beneficial and detrimental to sperm. Previously, the relationship of BSP1 with freezability events has not been completely understood. The objective of this work was to determine the differential abundance of the forms of the BSP1 protein in cryopreserved seminal plasma of Bos taurus indicus bulls with different patterns of semen freezability using proteomics. A wide cohort of adult bulls with high genetic value from an artificial insemination center was used as donors of high quality, fresh semen. Nine bulls presenting different patterns of semen freezability were selected. Two-dimensional gel electrophoresis showed differential abundance in a group of seven protein spots in the frozen/thawed seminal plasma from the bulls, ranging from 15 to 17 kDa, with pI values from 4.6 to 5.8. Four of these spots were confirmed to be BSP1 using mass spectrometry, proteomics, biochemical, and computational analysis (Tukey's test at P < 0.05). The protein spot weighing 15.52 ± 0.53 kDa with a pI value of 5.78 ± 0.12 is highlighted by its high abundance in bulls with low semen freezability and its absence in bulls presenting high semen freezability. This is the first report showing that more than two forms of BSP1 are found in the seminal plasma of Nelore adult bulls and not all animals have a similar abundance of each BSP1 form. Different BSP1 forms may be involved in different events of fertilization and the cryopreservation process. PMID:27118515

  14. Mitogenomes from Egyptian Cattle Breeds: New Clues on the Origin of Haplogroup Q and the Early Spread of Bos taurus from the Near East.

    Directory of Open Access Journals (Sweden)

    Anna Olivieri

    Full Text Available Genetic studies support the scenario that Bos taurus domestication occurred in the Near East during the Neolithic transition about 10 thousand years (ky ago, with the likely exception of a minor secondary event in Italy. However, despite the proven effectiveness of whole mitochondrial genome data in providing valuable information concerning the origin of taurine cattle, until now no population surveys have been carried out at the level of mitogenomes in local breeds from the Near East or surrounding areas. Egypt is in close geographic and cultural proximity to the Near East, in particular the Nile Delta region, and was one of the first neighboring areas to adopt the Neolithic package. Thus, a survey of mitogenome variation of autochthonous taurine breeds from the Nile Delta region might provide new insights on the early spread of cattle rearing outside the Near East.Using Illumina high-throughput sequencing we characterized the mitogenomes from two cattle breeds, Menofi (N = 17 and Domiaty (N = 14, from the Nile Delta region. Phylogenetic and Bayesian analyses were subsequently performed.Phylogenetic analyses of the 31 mitogenomes confirmed the prevalence of haplogroup T1, similar to most African cattle breeds, but showed also high frequencies for haplogroups T2, T3 and Q1, and an extremely high haplotype diversity, while Bayesian skyline plots pointed to a main episode of population growth ~12.5 ky ago. Comparisons of Nile Delta mitogenomes with those from other geographic areas revealed that (i most Egyptian mtDNAs are probably direct local derivatives from the founder domestic herds which first arrived from the Near East and the extent of gene flow from and towards the Nile Delta region was limited after the initial founding event(s; (ii haplogroup Q1 was among these founders, thus proving that it underwent domestication in the Near East together with the founders of the T clades.

  15. Impact of a trace element supplementation programme on health and performance of cross-breed (Bos indicus x Bos taurus) dairy cattle under tropical farming conditions: a double-blinded randomized field trial. (United States)

    Dermauw, V; Dierenfeld, E; Du Laing, G; Buyse, J; Brochier, B; Van Gucht, S; Duchateau, L; Janssens, G P J


    Small-scale urban dairy farms (n = 16) in and around Jimma, Ethiopia with cross-bred (Bos indicus × Bos taurus) cows were enrolled in a double-blinded intervention study to investigate the effect of a trace element supplementation programme on trace element status and milk concentrations as well as performance [body condition score (BCS), milk yield, leptin], milk composition, antioxidant status (ferric-reducing ability of plasma (FRAP), thiobarbituric acid-reactive substances (TBARS)], blood biochemistry, serum proteins and immune response (antibody titre upon rabies vaccination). The farms were allocated to a (1) placebo or (2) Cu, Zn, Se, Co and I supplementation treatment for 150 d. On days 0 and 120, four lactating cows per farm were sampled for milk and plasma, and on day 150 for serum, following primo-vaccination. Cu deficiency was present in 17% and marginal Se deficiency in 30% of initially sampled cows, while no Zn shortage was detected. Over 120 days, trace element supplementation caused a bigger increase in plasma Se and Cu concentrations, but also a larger decrease of plasma Fe concentrations. A larger increase in milk Se concentrations was observed in the supplemented group, whereas none of the other elements were affected. BCS decreased more over time in the supplemented group. None of the other parameters of performance and antioxidant status nor milk composition or blood biochemistry was affected by treatment. Antibody response to rabies vaccination did not differ between groups, whereas α1-globulins tended to be lower and β-globulins tended to be higher in the supplemented group. In conclusion, despite improved Cu and Se status and Se concentrations in milk, cows on tropical urban dairy farms did not seem to benefit from trace element supplementation, with respect to the parameters investigated. PMID:24990384

  16. Taurus (United States)

    Murdin, P.


    (the Bull; abbrev. Tau, gen. Tauri; area 797 sq. deg.) A northern zodiacal constellation which lies between Aries and Orion, and culminates at midnight in late November. It is one of the oldest constellations, dating back to when the Sun was in that part of the sky at the vernal (spring) equinox, between about 4000 and 1800 BC. Later, in Greek mythology, it was identified with the form assumed by...

  17. Identification of a two-marker-haplotype on Bos taurus autosome 18 associated with somatic cell score in German Holstein cattle

    Directory of Open Access Journals (Sweden)

    Reinsch Norbert


    Full Text Available Abstract Background The somatic cell score (SCS is implemented in routine sire evaluations in many countries as an indicator trait for udder health. Somatic cell score is highly correlated with clinical mastitis, and in the German Holstein population quantitative trait loci (QTL for SCS have been repeatedly mapped on Bos taurus autosome 18 (BTA18. In the present study, we report a refined analysis of previously detected QTL regions on BTA18 with the aim of identifying marker and marker haplotypes in linkage disequilibrium with SCS. A combined linkage and linkage disequilibrium approach was implemented, and association analyses of marker genotypes and maternally inherited two-marker-haplotypes were conducted to identify marker and haplotypes in linkage disequilibrium with a locus affecting SCS in the German Holstein population. Results We detected a genome-wide significant QTL within marker interval 9 (HAMP_c.366+109G>A - BMS833 in the middle to telomeric region on BTA18 and a second putative QTL in marker interval 12-13 (BB710 - PVRL2_c.392G>A. Association analyses with genotypes of markers flanking the most likely QTL positions revealed the microsatellite marker BMS833 (interval 9 to be associated with a locus affecting SCS within the families investigated. A further analysis of maternally inherited two-marker haplotypes and effects of maternally inherited two-marker-interval gametes indicated haplotype 249-G in marker interval 12-13 (BB710 - PVRL2_c.392G>A to be associated with SCS in the German Holstein population. Conclusion Our results confirmed previous QTL mapping results for SCS and support the hypothesis that more than one locus presumably affects udder health in the middle to telomeric region of BTA18. However, a subsequent investigation of the reported QTL regions is necessary to verify the two-QTL hypothesis and confirm the association of two-marker-haplotype 249-G in marker interval 12-13 (BB710 - PVRL2_c.392G>A with SCS. For this

  18. Variation in meat quality characteristics between Sanga (Bos taurus africanus) and Sanga-derived cattle breeds and between Sanga and Brahman (Bos indicus). (United States)

    Strydom, P E; Frylinck, L; Smith, M F


    Cattle breeds indigenous to Africa (Sanga) compare favourably to Bos indicus breeds with regard to adaptation to harsh environments. This study compared the meat quality of three Sanga breeds (Nguni, Tuli and Drakensberger), a Sanga-related breed (Bonsmara) and a B. indicus breed (Brahman) and supported these results with biochemical and histological measurements on the M. longissimus lumborum. Twelve young grain-fed steers of each breed were slaughtered and carcasses were electrically stimulated. All Sanga (and related) breeds, with the exception of the Tuli, had lower Warner-Bratzler shear force (SF) values at 2 and 21 days post mortem compared with the BR (P meat than BR, mainly due to favourable calpain-to-calpastatin ratios. Small differences in colour, drip loss and cooking properties were found among breeds (P < 0.05). PMID:22445415

  19. Evaluation of reciprocal differences in Bos indicus x Bos taurus backcross calves produced through embryo transfer: II. Postweaning, carcass, and meat traits. (United States)

    Amen, T S; Herring, A D; Sanders, J O; Gill, C A


    Angus (A) x Bos indicus (B; Brahman or Nellore) reciprocal backcross, embryo transfer calves belonging to 28 full-sib families were evaluated for differences in feedyard initial BW, feedyard final BW, carcass weight, LM area, adjusted fat thickness, intramuscular fat, and Warner-Bratzler shear force. Two methods of analysis were investigated; method I made no distinction between how the F(1) parents were produced, whereas method II distinguished the 2 types of F(1) parents (AB vs. BA, corresponding to A x B vs. B x A, respectively). No significant reciprocal differences for these weight and carcass traits were detected under method I analyses, although the same trend existed for subsequent BW rankings as for birth weight and weaning weight. For each weight phase, the cross that involved a larger proportion of B in the sire in relation to the amount in the dam (F(1) x A and B x F(1)) ranked heavier than the respective reciprocal cross (A x F(1) and F(1) x B). As a whole, A backcross calves had larger (P x dam type interaction was observed for initial feedyard BW. Results from this study suggest that for weight-related traits, both the breed constitution of the embryo transfer calf and the cross that produces the calf play an important role in its ultimate performance for B crossbred calves. For body composition and meat-related traits, it appears that the breed makeup of the embryo transfer calf itself is more important to animal performance than the specific cross used to produce the calf. PMID:17235022

  20. An examination of positive selection and changing effective population size in Angus and Holstein cattle populations (Bos taurus using a high density SNP genotyping platform and the contribution of ancient polymorphism to genomic diversity in Domestic cattle

    Directory of Open Access Journals (Sweden)

    Hayes Ben


    Full Text Available Abstract Background Identifying recent positive selection signatures in domesticated animals could provide information on genome response to strong directional selection from domestication and artificial selection. With the completion of the cattle genome, private companies are now providing large numbers of polymorphic markers for probing variation in domestic cattle (Bos taurus. We analysed over 7,500 polymorphic single nucleotide polymorphisms (SNP in beef (Angus and dairy (Holstein cattle and outgroup species Bison, Yak and Banteng in an indirect test of inbreeding and positive selection in Domestic cattle. Results Outgroup species: Bison, Yak and Banteng, were genotyped with high levels of success (90% and used to determine ancestral and derived allele states in domestic cattle. Frequency spectrums of the derived alleles in Angus and Holstein were examined using Fay and Wu's H test. Significant divergences from the predicted frequency spectrums expected under neutrality were identified. This appeared to be the result of combined influences of positive selection, inbreeding and ascertainment bias for moderately frequent SNP. Approximately 10% of all polymorphisms identified as segregating in B. taurus were also segregating in Bison, Yak or Banteng; highlighting a large number of polymorphisms that are ancient in origin. Conclusion These results suggest that a large effective population size (Ne of approximately 90,000 or more existed in B. taurus since they shared a common ancestor with Bison, Yak and Banteng ~1–2 million years ago (MYA. More recently Ne decreased sharply probably associated with domestication. This may partially explain the paradox of high levels of polymorphism in Domestic cattle and the relatively small recent Ne in this species. The period of inbreeding caused Fay and Wu's H statistic to depart from its expectation under neutrality mimicking the effect of selection. However, there was also evidence for selection

  1. Perfil de ácidos grasos en leche de vacas Chinampas (Bos taurus alimentadas con forraje fresco de matorral sarcocaulescente o heno de alfalfa Fatty acids profile in milk of Chinampo cows (Bos taurus fed fresh forage from sarcocaulescent shrubs or alfalfa hay

    Directory of Open Access Journals (Sweden)

    R Ortega-Pérez


    Full Text Available El objetivo del estudio fue determinar la concentración de ácidos grasos (AG en la leche de vacas Chinampas, con énfasis en los ácidos grasos conjugados (CLA. Se colectó una muestra manual de leche (10 ml de 32 vacas entre los 60 y 120 días de lactación. Un grupo (FV; n = 25 se alimentó en pastoreo con forraje verde durante la estación de lluvias de septiembre a octubre de 2009 en una zona semiárida de matorral sarcocaulescente (Municipio La Paz, B.C.S.. Otro grupo (HA; n = 7 se mantuvo en corral y se alimentó con heno de alfalfa. El análisis cromatográfico revela que la concentración de AG saturados fue menor (P The objective of the present study was to determine the concentration of fatty acids (FA in the milk of Chinampo cows (Bos taurus, with emphasis on conjugated fatty acids (CLA. A sample of 10 ml was collected from 32 cows that had been lactating at least 60 days, but not longer than 120 days. A group (FV, n = 25 was free-ranged grazed on green fresh pasture (sarcocaulescent shrub semiarid area, La Paz, B.C.S. during the wet season (September-October 2009. The second group (HA, n = 7 was penned and fed fodder of alfalfa hay. The FA analysis revealed that there were less saturated FA in the FV group (P < 0.05. This difference was basically explained by the lesser content of 14:0, 15:0, and 16:0. The concentration of total monounsaturated FA was higher in FV (P < 0.05, given by the higher concentration of 18:1 n-9 and 18:1 n-7 trans-11. The total concentration of polyunsaturated FA was similar for both groups, but there was a higher concentration of 18:2 n-6 and 18:2 n-7 cis-9 trans-11 in the FV group (P < 0.01. The proportion of omega-3 FA was similar for both groups, but the concentration of omega-6 FA was higher in FV (P < 0.01, resulting in an increased omega-6:omega-3 ratios in the FV group compared to HA. It is concluded that Chinampo cows left to free-range on fresh green pasture reduced the total saturated FA of

  2. The Taurus Spitzer Survey: New Candidate Taurus Members Selected Using Sensitive Mid-Infrared Photometry

    CERN Document Server

    Rebull, L M; McCabe, C -E; Hillenbrand, L A; Stapelfeldt, K R; Noriega-Crespo, A; Carey, S J; Brooke, T; Huard, T; Terebey, S; Audard, M; Monin, J -L; Fukagawa, M; Guedel, M; Knapp, G R; Menard, F; Allen, L E; Angione, J R; Baldovin-Saavedra, C; Bouvier, J; Briggs, K; Dougados, C; Evans, N J; Flagey, N; Guieu, S; Grosso, N; Glauser, A M; Harvey, P; Hines, D; Latter, W B; Skinner, S L; Strom, S; Tromp, J; Wolf, S


    We report on the properties of pre-main-sequence objects in the Taurus molecular clouds as observed in 7 mid- and far-infrared bands with the Spitzer Space Telescope. There are 215 previously-identified members of the Taurus star-forming region in our ~44 square degree map; these members exhibit a range of Spitzer colors that we take to define young stars still surrounded by circumstellar dust (noting that ~20% of the bonafide Taurus members exhibit no detectable dust excesses). We looked for new objects in the survey field with similar Spitzer properties, aided by extensive optical, X-ray, and ultraviolet imaging, and found 148 candidate new members of Taurus. We have obtained follow-up spectroscopy for about half the candidate sample, thus far confirming 34 new members, 3 probable new members, and 10 possible new members, an increase of 15-20% in Taurus members. Of the objects for which we have spectroscopy, 7 are now confirmed extragalactic objects, and one is a background Be star. The remaining 93 candida...

  3. Circumstellar disks around binary stars in Taurus

    International Nuclear Information System (INIS)

    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10–4 M ☉. We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of Fmm∝M∗1.5--2.0 to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  4. Circumstellar disks around binary stars in Taurus

    Energy Technology Data Exchange (ETDEWEB)

    Akeson, R. L. [NASA Exoplanet Science Institute, IPAC/Caltech, Pasadena, CA 91125 (United States); Jensen, E. L. N. [Swarthmore College, Department of Physics and Astronomy, Swarthmore, PA 19081 (United States)


    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10{sup –4} M {sub ☉}. We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of F{sub mm}∝M{sub ∗}{sup 1.5--2.0} to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  5. 杂交牛(大额牛×云南黄牛)朊蛋白基因的分子克隆及其序列分析%Molecular Cloning and Sequences Characteristics Analysis of the Prion Protein Gene from the Hybrids between Gayal (Bos frontalis)and Yunnan Yellow Cattle (Bos taurus)

    Institute of Scientific and Technical Information of China (English)

    刘情; 席冬梅; 陈学礼; 李继中; 杨舒黎; 邓卫东


    朊蛋白(prion protein,PRNP)基因编码朊蛋白,是引起疯牛病的主效基因.本研究利用PCR方法首次从杂交牛(大额牛×云南黄牛)基因组中扩增了PRNP基因,GenBank登录号为HQ875337.PCR产物直接双向测序表明,该序列包含杂交牛PRNP基因795 bp的开放阅读框(ORF),编码264个氨基酸前体蛋白.生物信息学分析结果发现,该蛋白包含1个信号肽、3个α螺旋、2个β折叠、6个八肽重复序列、1个疏水区域、1个二硫键和1个糖基磷脂酰肌醇锚定位点.与已报道的其他牛PRNP基因进行序列比对分析,核苷酸和氨基酸的同源性均在97%以上.%The priori protein was encoded by the prion protein (PRNP) gene which was the major gene for affecting mad cow disease or BSE. In the present study, the PCR method was used to amplify the PRNP gene from the hybrids between Gay-al (Bos frontalis) and Yunnan Yellow cattle (Bos taurus). The sequence was deposited in the GenBank under accession number HQ875337. The PCR products were sequenced bi-directly. By sequence analysis,the length of open read frame (ORF) of the PRNP gene was 795 bp, which encodes a protein of 264 amino acids,including a signal region,a octapeptide repeat,three α-heli-ces.two β-sheets,a hydrophobic region,a disulfide bridge, a glycosyl phosphatidyl inositol (GPI) anchor site. The homology of both nucleotide and amino acid sequences with other cattle was more than 97%. All this will provide the molecular basal data for breakthrough of transmissible spongiform encephalopathy among different animal species.

  6. N2H+ Observations of Molecular Cloud Cores in Taurus


    Tatematsu, K; Umemoto, T; Kandori, R.; Y. Sekimoto


    N2H+ observations of molecular cloud cores in Taurus with the Nobeyama 45 m radio telescope are reported. We compare ``cores with young stars'' with ``cores without young stars''. The differences in core radius, linewidth, and core mass are small. Linewidth is dominated by thermal motions in both cases. N2H+ maps show that the intensity distribution does not differ much between cores without stars and those with stars. This is in contrast to the result previously obtained in H13CO+ toward Tau...

  7. Change of land use in the Turkish Taurus Mountains

    Directory of Open Access Journals (Sweden)

    Yıldız Güneş


    Full Text Available The effects of land use changes on forests and agricultural areas in the central Taurus Mountains of Turkey have been studied. In this region a progressive conversion of extensive grazing was observed towards more intensively farmed arable land in recent decades. The loss of forest land is obvious, and the remaining forests are currently severely degraded and fragmented. Based on a model area it was shown that forests accounted for more than 80% of the land cover in the 1960s. In the following decades the forest area decreased by more than 20%. To the same extent, the share of agricultural land increased, predominantly of the pastures, too. The use of pastures in turn was replaced in the 1990s by arable use, so that now for almost 30% of land use accont for production crop. Accordingly, the way of life of the rural population changed in the last 50 years. By the middle of the 20th century, people had mostly been living as nomads. Thereafter, they become increasingly stationary. While the population density decreased at the some time agriculture was intensified and livestock reduced. This change led to today to profound changes in the landscape of the Taurus Mountains and its unique habitats. Restrictive measures as a way to curb forest degradation and to intensify the use of arable land are discussed.

  8. Época de nascimento, genótipo e sexo de terneiros cruzas taurinos e zebuínos sobre o peso ao nascer, à desmama e eficiência individual de primíparas Hereford Calving season, genotype and sex of crossbred taurus and indicus calves on the birth and weaning weight and individual efficiency of primiparous Hereford

    Directory of Open Access Journals (Sweden)

    Gilson de Mendonça


    Full Text Available O objetivo deste trabalho foi avaliar o efeito da época de nascimento, genótipo e sexo do terneiro sobre a eficiência individual das vacas à desmama (relação percentual entre o peso do terneiro à desmama e o peso da vaca, peso ao nascer e peso à desmama dos terneiros. Foram utilizadas 48 vacas da raça Hereford (Bos taurus, com idade de três anos, manejadas sobre campo natural, 16 inseminadas com um touro da raça Red Angus (Bos taurus e 32 com Nelore (Bos indicus. Os fatores estudados foram genótipo do terneiro (GENOT - Bos taurus x Bos taurus e Bos taurus x Bos indicus, época de nascimento (EPOCN subdividida em três períodos - 1S (setembro, 2O (outubro e 3N (novembro e sexo do terneiro (SEXO. A produção de leite (PL foi incluída como co-variável. Foram realizadas dez medidas de produção de leite pelo método indireto pesagem - mamada - pesagem e onze medidas de peso para vacas e terneiros, em intervalos de 21 dias. Os fatores que influenciaram significativamente o PN foram GENOT e SEXO (PThe objective of the present study was to evaluate the effect of calving season, genotype and calf sex on the cows weaning individual efficiency ( percentual relationship between cow body weight and calf weaning weight, birth and weaning weight of calves. Forty-eight primiparous Hereford cows with approximate average age of 3 years and grazing only native pastures were used. Sixteen inseminated with one Red Angus bull (Bos taurus and 32 with Nelore (Bos indicus. Effects studied were calf genotype (GENOT, Bos taurus x Bos taurus and Bos taurus x Bos indicus, calving season (EPOCN concentrated in the Spring and subdivided into three periods: 1S (September, 2O (October and 3N (November and December and calf sex (SEXO. Milk production (PL was included as co-variable. Ten measurements of milk production obtained by the indirect method, weighing the calf before and after suckling, and eleven measurements of cow and calf weights, were made at 21

  9. Construction of Bovine (Bos taurus) Transgenic Cloned Embryos with Lysostaphin and Endolysin Genes by Electronic Transfection%电转染法制备奶牛转溶葡球菌酶(Lysostaphin)和内溶素(Endolysin)基因胚胎

    Institute of Scientific and Technical Information of China (English)

    杨林; 杜卫华; 郝海生; 刘岩; 秦彤; 赵学明; 王栋; 朱化彬; 王宗礼


    Lysostaphin is a single chain protease containing zinc which can kill staphylococcus aureus effectively. Endolysin which is the peculiar of the double-stranded DNA bacteriophages is a murein hydrolytic enzyme, it has a wide range of antibacterial effect. Lysostaphin and Endolysin have the high synergistic effect. In this study, the vectors pBCl-seq2 +seq3-EGFP-neo containing Endolysin and Lysostaphin genes and two other marker genes of enhenced green fluorescent protein (EGFP) andneomycin (neo) were transfected into bovine (Bos taurus) fetal fibroblast by electroporation and nucleofector of AMAXA. Stable transfected monoclonal cells which were identified to be the positive-cells in the way of PCR technique were obtained through fluorescence and G418 selection. Using transfected cells as the donor, transfected embryos were produced with somatic cell nuclear transfer, we used different conditions of AMAXA nuleofecor(A-023,V-013, V-023 and T-016) to transfect bovine fetal fibroblast, the results showed the suitable program was T-016. There were 5 times transfection efficient of AMAXA nuleofecor (20.11%) than it of electroporation. The blastocyst developed normally and the rate was of it 20.08%. In our study, we built up bovine fetal fibroblast cell line, sought out transfection parameter of high transfection efficiency, and acquired transgenic cell lines and transgenic blastocyst containing Lysostaphin and Endolysin genes, In conclusion, the results can provide technology supporting for producing anti-mastitis transgenic bovine and searching the new therapy way of mastitis.%溶葡球菌酶(Lysostaphin)是一种含锌的单链蛋白酶,能有效地杀灭金黄色葡萄球菌.内溶素(Endolysin)是双链DNA噬菌体所特有,是一类胞壁质水解酶,具有广泛的抗菌效果.内溶素与抗生素之间有高效的协同作用.本研究通过BTX电转染和AMAXA核转染的方法将含有溶葡球菌酶(Lysostaphin)和内溶素(Endolysin)两个目的基因(Seq2

  10. C18O Depletion in Starless Cores in Taurus

    CERN Document Server

    Ford, Amanda Brady


    We present here findings for C18O depletion in eight starless cores in Taurus: TMC-2, L1498, L1512, L1489, L1517B, L1521E, L1495A-S, and L1544. We compare observations of the C18O J=2-1 transition taken with the ALMA prototype receiver on the Heinrich Hertz Submillimeter Telescope to results of radiative transfer modeling using RATRAN. We use temperature and density profiles calculated from dust continuum radiative transfer models to model the C18O emission. We present modeling of three cores, TMC-2, L1489, and L1495A-S, which have not been modeled before and compare our results for the five cores with published models. We find that all of the cores but one, L1521E, are substantially depleted. We also find that varying the temperature profiles of these model cores has a discernable effect, and varying the central density has an even larger effect. We find no trends with depletion radius or depletion fraction with the density or temperature of these cores, suggesting that the physical structure alone is insuff...

  11. Demographics of Transition Discs in Ophiuchus and Taurus

    CERN Document Server

    Najita, Joan R; Muzerolle, James


    Transition disc systems are young stars that appear to be on the verge of dispersing their protoplanetary discs. We explore the nature of these systems by comparing the stellar accretion rates and disc masses of transition discs and normal T Tauri stars in Taurus and Ophiuchus. After controlling for the known dependencies of stellar accretion rate and disc mass and on age, stellar accretion rate on stellar mass, and disc mass on the presence of stellar or sub-stellar companions, we find that the normal T Tauri stars show a trend of stellar accretion rate increasing with disc mass. The transition discs tend to have higher average disc masses than normal T Tauri stars as well as lower accretion rates than normal T Tauri stars of the same disc mass. These results are most consistent with the interpretation that the transition discs have formed objects massive enough to alter the accretion flow, i.e., single or multiple giant planets. Several Ophiuchus T Tauri stars that are not known transition disc systems also...

  12. B- and A-Type Stars in the Taurus-Auriga Star-Forming Region (United States)

    Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian


    We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), t Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

  13. New Brown Dwarfs and an Updated Initial Mass Function in Taurus

    CERN Document Server

    Luhman, K L


    I have performed a search for young low-mass stars and brown dwarfs (BDs) in 2 regions encompassing a total area of 4 deg^2 in the Taurus star-forming region, discovering 15 new members of Taurus. In addition, I present 7 new members outside of these areas from the initial stage of a survey of all of Taurus. These 22 objects exhibit spectral types of M4.5-M9.25 and masses of 0.3-0.015 M_sun according to the theoretical evolutionary models of Baraffe and Chabrier, 7 of which are likely to be BDs. Emission in H(alpha), He I, Ca II, [O I], and [S II] and excess emission in optical and near-IR bands among some of these objects suggest the presence of accretion, outflows, and circumstellar disks. The results from the 4 deg^2 survey have been combined with previous studies of Taurus to arrive at an IMF for a total area of 12.4 deg^2. As in the previous IMFs for Taurus, the updated IMF peaks at a higher mass (0.8 M_sun) than the mass functions in IC 348 and Orion (0.1-0.2 M_sun). Meanwhile, the deficit of BDs in Tau...

  14. On the mass segregation of stars and brown dwarfs in Taurus

    CERN Document Server

    Parker, Richard J; Goodwin, Simon P; Moraux, Estelle; Allison, Richard J; Guieu, Sylvain; Guedel, Manuel


    We use the new minimum spanning tree (MST) method to look for mass segregation in the Taurus association. The method computes the ratio of MST lengths of any chosen subset of objects, including the most massive stars and brown dwarfs, to the MST lengths of random sets of stars and brown dwarfs in the cluster. This mass segregation ratio (Lambda_MSR) enables a quantitative measure of the spatial distribution of high-mass and low-mass stars, and brown dwarfs to be made in Taurus. We find that the most massive stars in Taurus are inversely mass segregated, with Lambda_MSR = 0.70 +/- 0.10 (Lambda_MSR = 1 corresponds to no mass segregation), which differs from the strong mass segregation signatures found in more dense and massive clusters such as Orion. The brown dwarfs in Taurus are not mass segregated, although we find evidence that some low-mass stars are, with an Lambda_MSR = 1.25 +/- 0.15. Finally, we compare our results to previous measures of the spatial distribution of stars and brown dwarfs in Taurus, and...

  15. Another Look at Taurus Littrow: An Interactive Geographic Information System DataBase (United States)

    Coombs, Cassandra R.; Meisburger, J. L.; Nettles, J. W.


    A variety of data has been amassed for the Apollo 17 landing site, including topography, sample locations, and imagery. These data were compiled into a Geographic Information System (GIS) to analyze their interrelationships more easily. The database will allow the evaluation of the resource potential of the Taurus Littrow region pyroclastic deposits. The database also serves as a catalog for the returned lunar samples. This catalog includes rock type, size, and location. While this project specifically targets the Taurus Littrow region, it is applicable to other regions as well.


    International Nuclear Information System (INIS)

    The Taurus Molecular Cloud subtends a large solid angle on the sky, in excess of 250 deg2. The search for legitimate Taurus members to date has been limited by sky coverage as well as the challenge of distinguishing members from field interlopers. The Wide-field Infrared Survey Explorer has recently observed the entire sky, and we take advantage of the opportunity to search for young stellar object (YSO) candidate Taurus members from a ∼260 deg2 region designed to encompass previously identified Taurus members. We use near- and mid-infrared colors to select objects with apparent infrared excesses and incorporate other catalogs of ancillary data to present a list of rediscovered Taurus YSOs with infrared excesses (taken to be due to circumstellar disks), a list of rejected YSO candidates (largely galaxies), and a list of 94 surviving candidate new YSO-like Taurus members. There is likely to be contamination lingering in this candidate list, and follow-up spectra are warranted.

  17. TAURUS observations of the emission-line velocity field of Centaurus A (NGC 5128)

    International Nuclear Information System (INIS)

    Using TAURUS - an Imaging Fabry Perot system in conjunction with the IPCS on the AAT, the authors have studied the velocity field of the Hα emission line at a spatial resolution of 1.7'' over the dark lane structure of Centaurus A. The derived velocity field is quite symmetrical and strongly suggests that the emission line material is orbiting the elliptical component, as a warped disc. (orig.)


    Energy Technology Data Exchange (ETDEWEB)

    Daemgen, Sebastian [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5H 3H4 (Canada); Bonavita, Mariangela [The University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Jayawardhana, Ray [Physics and Astronomy, York University, Toronto, Ontario L3T 3R1 (Canada); Lafrenière, David [Department of Physics, University of Montréal, Montréal, QC (Canada); Janson, Markus, E-mail: [Department of Astronomy, Stockholm University, Stockholm (Sweden)


    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.

  19. Large-Scale Distribution of Herbig-Haro Objects in Taurus

    Institute of Scientific and Technical Information of China (English)

    Ke-Feng Sun; Ji Yang; Shao-Guang Luo; Min Wang; Li-Cai Deng; Xu Zhou; Jian-Sheng Chen


    We report our new results on Herbig-Haro (HH) objects in the star forming region of Taurus from a wide-field survey with the 60/90 cm Schmidt telescope of the Beijing Astronomical Observatory. This survey using CCD imaging with a narrow band [SⅡ] filter and an intermediate band [BATC10] filter covered approximately 30 square degrees in Taurus. Besides confirming the known HH Objects in the region, we discovered seven new HH candidates, and groups. Six of these are HH 701A-B, HH 702A-D, HH 703, HH 704A-D, HH 705, HH 706 and the seventh is a group, a new component of HH 319, labeled HH 319B-D. Based on the large-scale distribution of pre-main-sequence (PMS) stars in Taurus, we analyze statistically the most probable distance from the HH objects to each PMS star,from which we estimate the typical timescale of these HH objects to be between(1.3 - 2.0) × 104 yrs; and we also obtain the birth rates of HH objects: 0.447±0.198 for Class Ⅰ PMS stars, 0.360±0.222 for Class Ⅱ PMS stars, and -0.148±0.234 for Class Ⅲ PMS stars.

  20. VizieR Online Data Catalog: New young star candidates in Taurus-Auriga (Rebull+, 2011) (United States)

    Rebull, L. M.; Koenig, X. P.; Padgett, D. L.; Terebey, S.; McGehee, P. M.; Hillenbrand, L. A.; Knapp, G. R.; Leisawitz, D.; Liu, W.; Noriega-Crespo, A.; Ressler, M. E.; Stapelfeldt, K. R.; Fajardo-Acosta, S.; Mainzer, A.


    In the context of Rebull et al. (2010ApJS..186..259R), we assembled a substantial multi-wavelength database, spanning Sloan u through Spitzer/MIPS 160um (with some X-rays) for point sources throughout the Taurus region. We use that catalog as the core for our analysis here, updating it with confirmed Taurus members from, e.g., Kenyon et al. ( and Luhman et al. (2010ApJS..186..111L) outside of our original Spitzer map. We have also searched SIMBAD (and literature references therein) for known galaxies and other contaminants in this vicinity. Our Taurus Spitzer Survey spanned ~44deg2 (figure 1). WISE data acquisition and reduction are discussed in Wright et al. (2010AJ....140.1868W), Jarrett et al. (2011, ApJ, submitted), and in the Explanatory Supplement to the WISE Preliminary Data Release Products. There are four WISE bands, with central wavelengths at 3.4, 4.6, 12, and 22um, and a spatial resolution of 6" (12" at 22um). (3 data files).

  1. The Gould Belt Very Large Array Survey IV: The Taurus-Auriga complex

    CERN Document Server

    Dzib, Sergio A; Rodríguez, Luis F; Mioduszewski, Amy J; Ortiz-León, Gisela N; Kounkel, Marina A; Pech, Gerardo; Rivera, Juana L; Torres, Rosa M; Boden, Andrew F; Hartmann, Lee; Evans, Neal J; Briceño, Cesar; Tobin, John


    We present a multi-epoch radio study of the Taurus-Auriga star-forming complex made with the Karl G. Jansky Very Large Array at frequencies of 4.5 GHz and 7.5 GHz. We detect a total of 610 sources, 59 of which are related to young stellar objects and 18 to field stars. The properties of 56\\% of the young stars are compatible with non-thermal radio emission. We also show that the radio emission of more evolved young stellar objects tends to be more non-thermal in origin and, in general, that their radio properties are compatible with those found in other star forming regions. By comparing our results with previously reported X-ray observations, we notice that young stellar objects in Taurus-Auriga follow a G\\"{u}del-Benz relation with $\\kappa$=0.03, as we previously suggested for other regions of star formation. In general, young stellar objects in Taurus-Auriga and in all the previous studied regions seem to follow this relation with a dispersion of $\\sim1$ dex. Finally, we propose that most of the remaining ...

  2. X-ray deficiency on strongly accreting T Tauri stars. Comparing Orion with Taurus (United States)

    Bustamante, I.; Merín, B.; Bouy, H.; Manara, C. F.; Ribas, Á.; Riviere-Marichalar, P.


    Context. Depending on whether a T Tauri star accretes material from its circumstellar disk or not, different X-ray emission properties can be found. The accretion shocks produce cool heating of the plasma, contributing to the soft X-ray emission from the star. Aims: Using X-ray data from the Chandra Orion Ultra-deep Project and accretion rates that were obtained with the Hubble Space Telescope/WFPC2 photometric measurements in the Orion Nebula Cluster (ONC), we studied the relation between the accretion processes and the X-ray emissions of a coherent sample of T Tauri sources in the region. Methods: We performed regression and correlation analyses of our sample of T Tauri stars between the X-ray parameters, stellar properties, and the accretion measurements. Results: We find that a clear anti-correlation is present between the residual X-ray luminosity and the accretion rates in our samples in Orion that is consistent with that found on the XMM-Newton Extended Survey of the Taurus molecular cloud (XEST) study. A considerable number of classified non-accreting sources show accretion rates comparable to those of classical T Tauri Stars (CTTS). Our data do not allow us to confirm the classification between classical and weak-line T Tauri stars (WTTS), and the number of WTTS in this work is small compared to the complete samples. Thus, we have used the entire samples as accretors in our analysis. We provide a catalog with X-ray luminosities (corrected from distance) and accretion measurements of an ONC T Tauri stars sample. Conclusions: Although Orion and Taurus display strong differences in their properties (total gas and dust mass, star density, strong irradiation from massive stars), we find that a similar relation between the residual X-ray emission and accretion rate is present in the Taurus molecular cloud and in the accreting samples from the ONC. The spread in the data suggests dependencies of the accretion rates and the X-ray luminosities other than the

  3. Cambrian small shelly fossils from the Çal Tepe Formation, Taurus Mountains, Turkey


    Sarmiento, Graciela N.; Fernández Remolar, David Carlos; Göncüoglu, M. Cemal


    [EN] Lower and Middle Cambrian carbonate rocks of the Çal Tepe Formation, cropping out in the western Taurus Mountains, yielded a large number of microfossil remains. Small shelly fossils from a single level in the upper Lower Cambrian represent a high diversity biota that could be related to the «Cambrian explosion». Microfossil association from the lower Middle Cambrian sediments of the Çal Tepe Formation is taxonomically very reduced and a dominant taxon is Hadimopanella GEDIK. Th...

  4. Cambrian small shelly fossils from the Çal Tepe Formation, Taurus Mountains, Turkey


    Sarmiento, Graciela; Fernández Remolar, David Carlos; Göncüoglu, M. Cemal


    Lower and Middle Cambrian carbonate rocks of the Çal Tepe Formation, cropping out in the western Taurus Mountains, yielded a large number of microfossil remains. Small shelly fossils from a single level in the upper Lower Cambrian represent a high diversity biota that could be related to the «Cambrian explosion». Microfossil association from the lower Middle Cambrian sediments of the Çal Tepe Formation is taxonomically very reduced and a dominant taxon is Hadimopanella GEDIK. This sudden chan...

  5. Rotationally-supported disks around Class I sources in Taurus: disk formation constraints


    Harsono, Daniel; Jorgensen, Jes K.; van Dishoeck, Ewine F.; Hogerheijde, Michiel R.; Bruderer, Simon; Persson, Magnus V.; Mottram, Joseph C.


    (Abridged) Disks are observed around pre-main sequence stars, but how and when they form is still heavily debated. While disks around young stellar objects have been identified through thermal dust emission, spatially and spectrally resolved molecular line observations are needed to determine their nature. We present subarcsecond observations of dust and gas toward four Class I low-mass young stellar objects in Taurus. The 13CO and C18O J=2-1 transitions at 220 GHz were observed with the Plat...

  6. VLBA determination of the distance to nearby star-forming regions II. Hubble 4 and HDE 283572 in Taurus

    CERN Document Server

    Torres, Rosa M; Mioduszewski, Amy J; Rodriguez, Luis F


    The non-thermal 3.6 cm radio continuum emission from the naked T Tauri stars Hubble 4 and HDE 283572 in Taurus has been observed with the Very Long Baseline Array (VLBA) at 6 epochs between September 2004 and December 2005 with a typical separation between successive observations of 3 months. Thanks to the remarkably accurate astrometry delivered by the VLBA, the trajectory described by both stars on the plane of the sky could be traced very precisely, and modeled as the superposition of their trigonometric parallax and uniform proper motion. The best fits yield distances to Hubble 4 and HDE 283572 of 132.8 +/- 0.5 and 128.5 +/- 0.6 pc, respectively. Combining these results with the other two existing VLBI distance determinations in Taurus, we estimate the mean distance to the Taurus association to be 137 pc with a dispersion (most probably reflecting the depth of the complex) of about 20 pc.

  7. Molecular line study of the very young protostar IRAM 04191 in Taurus: infall, rotation, and outflow (United States)

    Belloche, A.; André, P.; Despois, D.; Blinder, S.


    We present a detailed millimeter spectroscopic study of the circumstellar environment of the low-luminosity Class 0 protostar IRAM 04191+1522 in the Taurus molecular cloud. Molecular line observations with the IRAM 30 m telescope demonstrate that the ~ 14 000 AU radius protostellar envelope is undergoing both extended infall and fast, differential rotation. Radiative transfer modeling of multitransition CS and C34S maps indicate an infall velocity vinf ~0.15 km s-1 at r ~ 1500 AU and v_inf ~ 0.1 km s-1 up to r ~ 11 000 AU, as well as a rotational angular velocity Omega ~ 3.9 x 10-13 rad s-1, strongly decreasing with radius beyond 3500 AU down to a value Omega ~ 1.5-3x 10-14 rad s-1 at ~ 11 000 AU. Two distinct regions, which differ in both their infall and their rotation properties, therefore seem to stand out: the inner part of the envelope (r lower .5excentral star is being built. Comparison with the rotational properties of other objects in Taurus suggests that IRAM 04191 is at a pivotal stage between a prestellar regime of constant angular velocity enforced by magnetic braking and a dynamical, protostellar regime of nearly conserved angular momentum. The rotation velocity profile we derive for the inner IRAM 04191 envelope should thus set some constraints on the distribution of angular momentum on the scale of the outer Solar system at the onset of protostar/disk formation.

  8. Isolation and partial purification of antimicrobial peptides/proteins from dung beetle, Onthophagus taurus immune hemolymph

    International Nuclear Information System (INIS)

    Antimicrobial peptides are important in the first line of the host defense system of all insect species. In the present study antimicrobial peptide(s) were isolated from the hemolymph of the dung beetle Onthophagus taurus. Both non induced and immune induced hemolymphs were tested for their antimicrobial activity against different bacterial strains and C. albicans. Induction was done by injecting E. coli into the abdominal cavity of the O. taurus. The non induced hemolymph did not show activity against any of the tested fungal and bacterial strains where as induced hemolymph showed activity against all tested bacterial strains but no activity against C. albicans. The induced hemolymph was subjected to non reducing SDS-PAGE and UV wavelength scan was performed to detect the presence of peptides. The immune induced hemolymph was purified by gel filtration chromatography to separate the proteins responsible for the antibacterial activity. The fractions within the peak were tested against those bacteria which previously showed sensitivity to the crude immune induced hemolymph. All fractions were found to be active against all tested bacteria with difference in zone of inhibition. The peptides are active against prokaryotes and not against eukaryotes. These properties reveal its unique characteristics and therapeutic application. (author)

  9. Striations in the Taurus molecular cloud: Kelvin-Helmholtz instability or MHD waves?

    CERN Document Server

    Heyer, M; Yildiz, U A; Snell, R L; Falgarone, E; Pineda, J


    The origin of striations aligned along the local magnetic field direction in the translucent envelope of the Taurus molecular cloud is examined with new observations of 12CO and 13CO J=2-1 emission obtained with the 10~m submillimeter telescope of the Arizona Radio Observatory. These data identify a periodic pattern of excess blue and redshifted emission that is responsible for the striations. For both 12CO and 13CO, spatial variations of the J=2-1 to J=1-0 line ratio are small and are not spatially correlated with the striation locations. A medium comprised of unresolved CO emitting substructures (cells) with a beam area filling factor less than unity at any velocity is required to explain the average line ratios and brightness temperatures. We propose that the striations result from the modulation of velocities and the beam filling factor of the cells as a result of either the Kelvin-Helmholtz instability or magnetosonic waves propagating through the envelope of the Taurus molecular cloud. Both processes ar...


    Directory of Open Access Journals (Sweden)

    Vasanth Patil H.B


    Full Text Available Antimicrobial peptides are important in the first line of the host defense system of all insect species. In the present study antimicrobial peptide(s were isolated from the hemolymph of the dung beetle Onthophagus taurus. Both non induced and immune induced hemolymphs were tested for their antimicrobial activity against different bacterial strains and C. albicans. Induction was done by injecting E. coli into the abdominal cavity of the O. taurus. The non induced hemolymph did not show activity against any of the tested fungal and bacterial strains where as induced hemolymph showed activity against all tested bacterial strains but no activity against C. albicans. The induced hemolymph was subjected to non reducing SDS-PAGE and UV wavelength scan was performed to detect the presence of peptides. The immune induced hemolymph was purified by gel filtration chromatography to separate the proteins responsible for the antibacterial activity. The fractions within the peak were tested against those bacteria which previously showed sensitivity to the crude immune induced hemolymph. All fractions were found to be active against all tested bacteria with difference in zone of inhibition. The peptides are active against prokaryotes & not against eukaryotes. These properties reveal its unique characteristics and therapeutic application.

  11. A Search for Companions to Brown Dwarfs in the Taurus and Chamaeleon Star Forming Regions

    CERN Document Server

    Todorov, K O; Konopacky, Q M; McLeod, K K; Apai, D; Ghez, A M; Pascucci, I; Robberto, M


    We present the results of a search for companions to young brown dwarfs in the Taurus and Chamaeleon I star forming regions (1/2-3 Myr). We have used WFPC2 on board HST to obtain F791W and F850LP images of 47 members of these regions that have spectral types of M6-L0 (0.01-0.1 Msun). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. We have applied PSF subtraction to the primaries and have searched the resulting images for objects that have colors and magnitudes that are indicative of young low-mass objects. Through this process, we have identified promising candidate companions to 2MASS J04414489+2301513 (rho=0.105"/15 AU), 2MASS J04221332+1934392 (rho=0.05"/7 AU), and ISO 217 (rho=0.03"/5 AU). We reported the discovery of the first candidate in a previous study, showing that it has a similar proper motion as the primary through a comparison of astrometry measured with WFPC2 and Gemini adaptive optics. We have collected an additional e...

  12. Ultraviolet-Selected Field and Pre-Main-Sequence Stars Towards Taurus and Upper Scorpius

    CERN Document Server

    Findeisen, Krzysztof


    We have carried out a Galaxy Evolution Explorer (GALEX) Cycle 1 guest investigator program covering 56 square degrees near the Taurus T association and 12 square degrees along the northern edge of the Upper Scorpius OB association. We combined photometry in the GALEX FUV and NUV bands with data from the Two Micron All Sky Survey to identify candidate young (<100 Myr old) stars as those with an ultraviolet excess relative to older main sequence stars. Follow-up spectroscopy of a partial sample of these candidates suggest 5 new members of Taurus, with 8-20 expected from additional observations, and 5 new members of Upper Scorpius, with 3-6 expected from additional observations. These candidate new members appear to represent a distributed, non-clustered population in either region, although our sample statistics are as of yet too poor to constrain the nature or extent of this population. Rather, our study demonstrates the ability of GALEX observations to identify young stellar populations distributed over a ...

  13. The evolution of stars in the Taurus-Auriga T association

    CERN Document Server

    Bertout, C; Cabrit, S


    In a recent study, individual parallaxes were determined for many stars of the Taurus-Auriga T association that are members of the same moving group. We use these new parallaxes to re-address the issue of the relationship between classical T Tauri stars (CTTSs) and weak-emission line T Tauri stars (WTTSs). With the available spectroscopic and photometric information for 72 individual stars or stellar systems among the Taurus-Auriga objects with known parallaxes, we derived reliable photospheric luminosities, mainly from the Ic magnitude of these objects. We then studied the mass and age distributions of the stellar sample, using pre-main sequence evolutionary models to determine the basic properties of the stellar sample. Statistical tests and Monte Carlo simulations were then applied to studying the properties of the two T Tauri subclasses. We find that the probability of CTTS and WTTS samples being drawn from the same parental age and mass distributions is low; CTTSs are, on average, younger than WTTSs. The...

  14. VizieR Online Data Catalog: Outflows and bubbles in Taurus (Li+, 2015) (United States)

    Li, H.; Li, D.; Qian, L.; Xu, D.; Goldsmith, P. F.; Noriega-Crespo, A.; Wu, Y.; Song, Y.; Nan, R.


    In our study, we used the 12CO(1-0) and 13CO(1-0 with the 13.7m FCRAO telescope. The FCRAO CO survey was taken between 2003 and 2005. The FWHM beam width is 45" for 12CO and 47" for 13CO. The MIPS maps were created as part of the final products from the Spitzer Legacy Taurus I and II surveys (Padgett et al. 2007AAS...211.1206P). The data were obtained in fast scan mode in three bands, 24, 70, and 160um, over an area of 44deg2. The observations were performed in three epochs between 2005 and 2007, with integration times of 30s (24um) and 15s (70 and 160um). We also adopted the up-to-date catalog of Spitzer YSOs where 215 YSOs and 140 new YSO candidates in Taurus are reported (Rebull et al. 2010, J/ApJS/186/259). (3 data files).

  15. Large-Scale Structure of the Molecular Gas in Taurus Revealed by High Spatial Dynamic Range Spectral Line Mapping (United States)

    Goldsmith, Paul F.


    Viewgraph topics include: optical image of Taurus; dust extinction in IR has provided a new tool for probing cloud morphology; observations of the gas can contribute critical information on gas temperature, gas column density and distribution, mass, and kinematics; the Taurus molecular cloud complex; average spectra in each mask region; mas 2 data; dealing with mask 1 data; behavior of mask 1 pixels; distribution of CO column densities; conversion to H2 column density; variable CO/H2 ratio with values much less than 10(exp -4) at low N indicated by UV results; histogram of N(H2) distribution; H2 column density distribution in Taurus; cumulative distribution of mass and area; lower CO fractional abundance in mask 0 and 1 regions greatly increases mass determined in the analysis; masses determined with variable X(CO) and including diffuse regions agrees well with the found from L(CO); distribution of young stars as a function of molecular column density; star formation efficiency; star formation rate and gas depletion; and enlarged images of some of the regions with numerous young stars. Additional slides examine the origin of the Taurus molecular cloud, evolution from HI gas, kinematics as a clue to its origin, and its relationship to star formation.

  16. A river based stable isotope record of orographic precipitation: Taurus Mountains, south central Turkey (United States)

    Schemmel, Fabian; Mulch, Andreas; Mikes, Tamás.; Schildgen, Taylor


    Reconstructing continental precipitation and vegetation patterns has become one of the most rapidly growing fields in terrestrial paleoclimate research. Furthermore, stable isotopes in precipitation within continental plateau regions represent an increasingly important tool for reconstructing the various effects of uplift related climate change within the world's largest plateau regions. With peak elevations of more than 3,000 m the Taurus Mountains represent the southern margin of the central Anatolian plateau and must have played a pivotal role in controlling the drainage and sedimentation patterns within the plateau interior. However, their surface uplift history remains largely elusive. We sampled a series of tributaries and rivers along the Ermenek valley that crosscuts the Taurus Mountains in Southern Turkey. The aim of this study is to quantify the modern effect of orographic rainout of the Taurus Mountains on the d18O and dD values of river and spring waters and to compare these values to the d18O and dD of recent precipitation gathered by the Global Network of Isotopes in Precipitation (GNIP). Further we try to study the trends of the recent d18O and dD isotopic composition of local rivers and precipitation in the area to create a set of isotopic data that is comparable to isotopic studies on paleosoils and can therefore be used in future paleoaltimetry and paleoclimate studies. We sampled 6 individual rivers during the fall season 2008 to capture mostly groundwater runoff in the south central Taurus Mountains. All sampled rivers belong to the same local drainage system which drains into the Mediterranean Sea. The total elevation difference within the sampling area exceeds 2,000 m and we were able to collect samples over almost 1,800 m of elevation. Our measurements show that both d18O and dD values follow the same basic trend. d18O and dD values decrease systematically with increasing elevation. The lapse rate of d18O is about -2.2 per mil/km, whereas the

  17. The Five College Radio Astronomy Observatory CO Mapping Survey of the Taurus Molecular Cloud

    CERN Document Server

    Narayanan, Gopal; Brunt, Christopher; Goldsmith, Paul F; Snell, Ronald; Li, Di


    The FCRAO Survey of the Taurus Molecular Cloud observed the 12CO and 13CO J=1-0 emission from 98 square degrees of this important, nearby star forming region. This set of data with 45" resolution comprises the highest spatial dynamic range image of an individual molecular cloud constructed to date, and provides valuable insights to the molecular gas distribution, kinematics, and the star formation process. In this contribution, we describe the observations, calibration, data processing, and characteristics of the noise and line emission of the survey. The angular distribution of 12CO and 13CO emission over 1 km/s velocity intervals and the full velocity extent of the cloud are presented. These reveal a complex, dynamic medium of cold, molecular gas.

  18. Magnetically Regulated Star Formation in 3D: The Case of Taurus Molecular Cloud Complex

    CERN Document Server

    Nakamura, Fumitaka


    We carry out three-dimensional MHD simulations of star formation in turbulent, magnetized clouds, including ambipolar diffusion and feedback from protostellar outflows. The calculations focus on relatively diffuse clouds threaded by a strong magnetic field capable of resisting severe tangling by turbulent motions and retarding global gravitational contraction in the cross-field direction. They are motivated by observations of the Taurus molecular cloud complex (and, to a lesser extent, Pipe Nebula), which shows an ordered large-scale magnetic field, as well as elongated condensations that are generally perpendicular to the large-scale field. We find that stars form in earnest in such clouds when enough material has settled gravitationally along the field lines that the mass-to-flux ratios of the condensations approach the critical value. Only a small fraction (of order 1% or less) of the nearly magnetically-critical, condensed material is turned into stars per local free-fall time, however. The slow star form...


    International Nuclear Information System (INIS)

    Thioxoethenylidene (CCS) is an abundant interstellar molecule and a good tracer of high density and evolutionary stage of dense molecular clouds. It is also a suitable candidate for Zeeman splitting observations for its high splitting factor and narrow thermal line widths. We report here Expanded Very Large Array 22.3 GHz observations of three dense molecular cores TMC-1, TMC-1C, and L1521B in the Taurus molecular cloud complex to image the CCS 21-10 transition. For all three sources, the clumpy CCS emission is most likely tracing the starless cores. However, these compact structures account for only ∼1%-13% of the integrated emission detected in single-dish observations, indicating the presence of significant large-scale diffuse emission in favorable conditions for producing CCS.


    International Nuclear Information System (INIS)

    We analyze samples of Spitzer Infrared Spectrograph spectra of T Tauri stars in the Ophiuchus, Taurus, and Chamaeleon I star-forming regions, whose median ages lie in the <1-2 Myr range. The median mid-infrared spectra of objects in these three regions are similar in shape, suggesting, on average, similar disk structures. When normalized to the same stellar luminosity, the medians follow each other closely, implying comparable mid-infrared excess emission from the circumstellar disks. We use the spectral index between 13 and 31 μm and the equivalent width of the 10 μm silicate emission feature to identify objects whose disk configuration departs from that of a continuous, optically thick accretion disk. Transitional disks, whose steep 13-31 μm spectral slope and near-IR flux deficit reveal inner disk clearing, occur with about the same frequency of a few percent in all three regions. Objects with unusually large 10 μm equivalent widths are more common (20%-30%); they could reveal the presence of disk gaps filled with optically thin dust. Based on their medians and fraction of evolved disks, T Tauri stars in Taurus and Chamaeleon I are very alike. Disk evolution sets in early, since already the youngest region, the Ophiuchus core (L1688), has more settled disks with larger grains. Our results indicate that protoplanetary disks show clear signs of dust evolution at an age of a few Myr, even as early as ∼1 Myr, but age is not the only factor determining the degree of evolution during the first few million years of a disk's lifetime.

  1. Brood ball-mediated transmission of microbiome members in the dung beetle, Onthophagus taurus (Coleoptera: Scarabaeidae.

    Directory of Open Access Journals (Sweden)

    Anne M Estes

    Full Text Available Insects feeding on plant sap, blood, and other nutritionally incomplete diets are typically associated with mutualistic bacteria that supplement missing nutrients. Herbivorous mammal dung contains more than 86% cellulose and lacks amino acids essential for insect development and reproduction. Yet one of the most ecologically necessary and evolutionarily successful groups of beetles, the dung beetles (Scarabaeinae feeds primarily, or exclusively, on dung. These associations suggest that dung beetles may benefit from mutualistic bacteria that provide nutrients missing from dung. The nesting behaviors of the female parent and the feeding behaviors of the larvae suggest that a microbiome could be vertically transmitted from the parental female to her offspring through the brood ball. Using sterile rearing and a combination of molecular and culture-based techniques, we examine transmission of the microbiome in the bull-headed dung beetle, Onthophagus taurus. Beetles were reared on autoclaved dung and the microbiome was characterized across development. A ~1425 bp region of the 16S rRNA identified Pseudomonadaceae, Enterobacteriaceae, and Comamonadaceae as the most common bacterial families across all life stages and populations, including cultured isolates from the 3(rd instar digestive system. Finer level phylotyping analyses based on lepA and gyrB amplicons of cultured isolates placed the isolates closest to Enterobacter cloacae, Providencia stuartii, Pusillimonas sp., Pedobacter heparinus, and Lysinibacillus sphaericus. Scanning electron micrographs of brood balls constructed from sterile dung reveals secretions and microbes only in the chamber the female prepares for the egg. The use of autoclaved dung for rearing, the presence of microbes in the brood ball and offspring, and identical 16S rRNA sequences in both parent and offspring suggests that the O. taurus female parent transmits specific microbiome members to her offspring through the brood

  2. Magnetically Regulated Star Formation in Three Dimensions: The Case of the Taurus Molecular Cloud Complex (United States)

    Nakamura, Fumitaka; Li, Zhi-Yun


    We carry out three-dimensional MHD simulations of star formation in turbulent, magnetized clouds, including ambipolar diffusion and feedback from protostellar outflows. The calculations focus on relatively diffuse clouds threaded by a strong magnetic field capable of resisting severe tangling by turbulent motions and retarding global gravitational contraction in the cross field direction. They are motivated by observations of the Taurus molecular cloud complex (and, to a lesser extent, Pipe Nebula), which shows an ordered large-scale magnetic field, as well as elongated condensations that are generally perpendicular to the large-scale field. We find that stars form in earnest in such clouds when enough material has settled gravitationally along the field lines that the mass-to-flux ratios of the condensations approach the critical value. Only a small fraction (of order 1% or less) of the nearly magnetically critical, condensed material is turned into stars per local free-fall time, however. The slow star formation takes place in condensations that are moderately supersonic; it is regulated primarily by magnetic fields, rather than turbulence. The quiescent condensations are surrounded by diffuse halos that are much more turbulent, as observed in the Taurus complex. Strong support for magnetic regulation of star formation in this complex comes from the extremely slow conversion of the already condensed, relatively quiescent C18O gas into stars, at a rate 2 orders of magnitude below the maximum, free-fall value. We analyze the properties of dense cores, including their mass spectrum, which resembles the stellar initial mass function.

  3. DYNA3D, INGRID, and TAURUS: an integrated, interactive software system for crashworthiness engineering

    International Nuclear Information System (INIS)

    Crashworthiness engineering has always been a high priority at Lawrence Livermore National Laboratory because of its role in the safe transport of radioactive material for the nuclear power industry and military. As a result, the authors have developed an integrated, interactive set of finite element programs for crashworthiness analysis. The heart of the system is DYNA3D, an explicit, fully vectorized, large deformation structural dynamics code. DYNA3D has the following four capabilities that are critical for the efficient and accurate analysis of crashes: (1) fully nonlinear solid, shell, and beam elements for representing a structure, (2) a broad range of constitutive models for representing the materials, (3) sophisticated contact algorithms for the impact interactions, and (4) a rigid body capability to represent the bodies away from the impact zones at a greatly reduced cost without sacrificing any accuracy in the momentum calculations. To generate the large and complex data files for DYNA3D, INGRID, a general purpose mesh generator, is used. It runs on everything from IBM PCs to CRAYS, and can generate 1000 nodes/minute on a PC. With its efficient hidden line algorithms and many options for specifying geometry, INGRID also doubles as a geometric modeller. TAURUS, an interactive post processor, is used to display DYNA3D output. In addition to the standard monochrome hidden line display, time history plotting, and contouring, TAURUS generates interactive color displays on 8 color video screens by plotting color bands superimposed on the mesh which indicate the value of the state variables. For higher quality color output, graphic output files may be sent to the DICOMED film recorders. We have found that color is every bit as important as hidden line removal in aiding the analyst in understanding his results. In this paper the basic methodologies of the programs are presented along with several crashworthiness calculations


    International Nuclear Information System (INIS)

    We have conducted a high-resolution imaging study of the Taurus-Auriga star-forming region in order to characterize the primordial outcome of multiple star formation and the extent of the brown dwarf desert. Our survey identified 16 new binary companions to primary stars with masses of 0.25-2.5 Msun, raising the total number of binary pairs (including components of high-order multiples) with separations of 3-5000 AU to 90. We find that ∼2/3-3/4 of all Taurus members are multiple systems of two or more stars, while the other ∼1/4-1/3 appear to have formed as single stars; the distribution of high-order multiplicity suggests that fragmentation into a wide binary has no impact on the subsequent probability that either component will fragment again. The separation distribution for solar-type stars (0.7-2.5 Msun) is nearly log-flat over separations of 3-5000 AU, but lower-mass stars (0.25-0.7 Msun) show a paucity of binary companions with separations of ∼>200 AU. Across this full mass range, companion masses are well described with a linear-flat function; all system mass ratios (q = MB /MA ) are equally probable, apparently including substellar companions. Our results are broadly consistent with the two expected modes of binary formation (free-fall fragmentation on large scales and disk fragmentation on small scales), but the distributions provide some clues as to the epochs at which the companions are likely to form.

  5. VizieR Online Data Catalog: Infrared photometry of all known members in Taurus (Esplin+, 2014) (United States)

    Esplin, T. L.; Luhman, K. L.; Mamajek, E. E.


    To construct a census of the circumstellar disks in Taurus, we begin by compiling a list of all known members of the region. We adopt the 352 members from Luhman et al. 2010 (cat. J/ApJS/186/111), 4 additional stars that have good evidence of membership from previous studies (Section 5.4), 32 members found in a subsequent survey by K. Luhman (in preparation; 33 if GZ Tau A and B are counted separately), and 25 new members (26 if BS Tau A and B are counted separately) that we have confirmed with spectroscopy (Section 5.3). We also adopt as a member HD 285957, which has a proper motion consistent with that of the Taurus subgroup L1551 (Zacharias et al. 2013, cat. I/322; Luhman et al. 2009ApJ...703..399L) and exhibits evidence of youth in the form of Li absorption (Wichmann et al. 2000A&A...359..181W; Sestito et al. 2008, cat. J/A+A/488/943). We make use of mid-infrared photometry for members of Taurus measured with Spitzer's Infrared Array Camera (IRAC) and the Multiband Imaging Photometer for Spitzer (MIPS). We consider the four bands of IRAC (3.6, 4.5, 5.8, and 8.0μm) and the 24μm band of MIPS, which are denoted as [3.6], [4.5], [5.8], [8.0], and [24], respectively. IRAC produced images with a field of view of 5.2'*5.2' and FWHM of 1.6''-1.9'' for [3.6] to [8.0]. MIPS had a field of view of 5.4'*5.4' and a FWHM of 5.9'' for [24]. Photometry from most Spitzer images for most members of Taurus has been measured by Luhman et al. 2010 (cat. J/ApJS/186/111) (see also Hartmann et al. 2005ApJ...629..881H; Luhman et al. 2006, cat. J/ApJ/647/1180; Guieu et al. 2007, cat. 2007A&A...465..855G; Rebull et al. 2010, cat. J/ApJS/186/259). We have measured photometry of the members that were not considered in Luhman et al. 2010 (cat. J/ApJS/186/111) and all known members appearing in Spitzer images that have become publicly available since that study (Astronomical Observation Requests 26470912, 26471168 26477056, 26475264, 26472704, 26473216, and 23272448). These data were

  6. Is the American Zebu really Bos indicus?

    Directory of Open Access Journals (Sweden)

    Meirelles Flávio V.


    Full Text Available The American continent was colonized in the 16th century by Europeans who first introduced cattle of Bos taurus origin. Accounts register introduction of Bos indicus cattle into South America in the 19th and continuing through the 20th century, and most reported imports were males derived from the Indian subcontinent. In the present study we show, by using mitochondrial DNA (mtDNA polymorphism, major participation of matrilineages of taurus origin in the American Zebu purebred origin, i.e., 79, 73 and 100% for the Nellore, Gyr and Brahman breeds, respectively. Moreover, we have created a restriction map identifying polymorphism among B. taurus and B. indicus mtDNA using three restriction enzymes. Results are discussed concerning American Zebu origins and potential use of this information for investigating the contribution of cytoplasmic genes in cattle production traits.

  7. Physiological responses of newborn Bos indicus and Bos indicus x Bos taurus calves after exposure to cold. (United States)

    Godfrey, R W; Smith, S D; Guthrie, M J; Stanko, R L; Neuendorff, D A; Randel, R D


    Brahman (n = 9) and 1/2 Simmental x 1/4 Brahman x 1/4 Hereford (n = 11) calves were utilized to determine the influence of exposure to cold on the physiology of the neonate. All calves were removed from their dams within 20 min of birth and prior to suckling. Calves were assigned randomly within breed to either a warm (W; 31 degrees C) or cold (C; 4 degrees C) environmental treatment group. Jugular blood samples were collected via indwelling catheters at 20-min intervals for 180 min. At 100 to 120 min of sampling, all calves were given 1.2 liters of colostrum from their dams via stomach tube. At 120 min, C calves were placed in the W environment. Calf vigor score (CVS) and rectal temperature were determined at each time blood was collected. Serum or plasma was analyzed for glucose (GLU), lactate (LAC), blood urea nitrogen (BUN), hemoglobin (HEM), triglyceride (TRG), triiodothyronine (T3), thyroxine (T4), insulin (INS), cortisol (CORT) and nonesterified fatty acid (NEFA) concentration. Rectal temperature was lower (P less than .01) in C Brahman than in W Brahman and C or W crossbred calves. Crossbred calves had higher (P less than .01) CVS than Brahman calves. Calves in W had lower (P less than .01) GLU than C calves. Brahman calves had higher GLU, LAC, BUN, TRG, T3, T4 and CORT (P less than .05) than crossbred calves. The C Brahman calves had the highest (P less than .05) TRG, CORT, T3 and T4 of all groups. Concentration of NEFA were higher (P less than .01) in C than in W calves.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2005021

  8. Taurus workbenchyong用于IC制造加工工艺的实验研究%The experimental research of optimize manufacturing and procesing technique for IC on the taurus workbench

    Institute of Scientific and Technical Information of China (English)

    侯国宪; 李惠军; 赵国庆


    介绍了集成电路虚拟工厂系统Taurus Workbench.并基于CMOS工艺的特点,在Tau-rus Workbench环境下进行了亚微米级n沟器件的核心参数优化实验研究,结果印证了集成电路虚拟工厂技术为工艺优化提供了便捷有效的方法.

  9. Organic facies characteristics of the Carboniferous Pamucakyayla Formation, western Taurus, Antalya Nappes, Kemer (Antalya/Turkey) (United States)

    Bertan Gulludag, Cevdet; Altunsoy, Mehmet; Ozcelik, Orhan


    The study area is located in the western part of the Taurus Belt (SW Turkey). This region exhibits a complex structure involving two autochthonous units surrounded and imbricated with three allochthonous complexes. Antalya Nappes is a complex tectonic imbricate structure including sedimantary and ultrabasic rocks. In this study, organic facies characteristics of Carboniferous coaly units in the Pamucakyayla region (Kemer, Antalya-Turkey) were examined. The Carboniferous Pamucakyayla Formation, which is characterized by sandstone, claystone, marl and coaly units. This units includes different levels of coal seams in different thicknesses. Organic matter is composed predominantly of woody and amorphous material, with a minor contribution of planty and coaly material. Kerogen in the deposits is type II/III, as indicated by organic petrographic observations and Rock-Eval data. Total organic carbon (TOC) values are generally between 0.01 and 1.44 %, but reach 5.81 % in the formation. Tmax values vary between 446 and 451 °C and indicate mature zone (Based on the value of 0.25 % TOC). Organic facies type BC, C and CD were identified in the investigated units. Organic facies BC is related sandstoneand marl lithofacies. This facis is deposited under an anoxic water column in a fine grained clastics, where rapid deposition creates anoxia in the sediments after deposition. This facies is characterized by average values of HI around 317 (equivalent to type II kerogene), TOC around 0.02 %, and an average of S2 of 0.04 mg HC/g of rock. Organic facies C is related to sandstone, marl and coal lithofacies. This facies is characterized by average values of HI around 176 (equivalent to type III kerogene), TOC around 0.19 %, and an average of S2 of 0.03 mg HC/g of rock. The organic matter is partly oxidized, and terrestrial. Organic facies C is the "gas-prone" facies. Organic facies CD is related to limestone, marl and coal lithofacies. This facies is characterized by average values

  10. Comportamento de vacas da raça Gir (Bos taurus indicus em estro Estrus behaviour in Gir cows (Bos taurus indicus

    Directory of Open Access Journals (Sweden)

    M.F. Ávila Pires


    Full Text Available O comportamento de vacas da raça Gir em estro e a concentração plasmática de progesterona foram avaliadas durante um estro induzido e o natural subseqüente, em 35 animais da raça Gir, no inverno e no verão de dois anos consecutivos. Observou-se efeito de interação entre estação e ano do experimento sobre a duração do ciclo estral. O proestro foi maior no verão (51,82± 4,77h do que no inverno (33,43± 4,82h e no estro natural (64,41± 4,95h do que no induzido (20,85± 4,64h. Observou-se menor duração da atividade sexual total no estro induzido do que no natural (41,62± 4,81 vs 94,83± 4,56h no inverno, e 64,00± 4,14 vs 127,44± 4,04h no verão. A duração do estro foi similar no inverno (12,33± 0,74h e no verão (11,82± 0,74h, e maior nas vacas sincronizadas (13,24± 0,70 vs 10,91± 0,78h. O número de montas recebidas durante o estro foi similar no inverno (28,16± 2,61 e no verão (22,98± 2,58 e maior nos animais sincronizados (29,97± 2,48 vs 21,17± 2,17. Observou-se efeito de interação entre estação e tipo de luteólise sobre o número de montas recebidas por hora em estro. O inverno não se constituiu em fator limitante à manifestação do estro, cuja duração e intensidade foram suficientes para permitir sua detecção; contudo, a sincronização dos estros interferiu com a manifestação do comportamento sexual.The estrus behaviour and the plasma progesterone concentration were monitored during an induced and a natural subsequent estrus, in 35 Gir cows, during the winter and summer seasons of two consecutives years. The length of estrous cycle was influenced by the interaction between season and experimental year. The proestrus period was longer in the summer (51.82± 4.77h compared to the one in the winter (33.43± 4.82h season as far as in the natural (64.41± 4.95h vs in the induced estrus (20.85± 4.64h. The total sexual activity was shorter in the induced than in the natural estrus (41.62± 4.81 vs 94.83± 4.56h in the winter, and 64.00± 4.14 vs 127.44± 4.04h in the summer. The length of estrus was similar between winter (12.33± 0.74h and summer (11.82± 0.74h, and longer in the synchronized cows (13.24± 0.70 vs 10.91± 0.78h. The number of mounts accepted during the estrus was similar between winter (28.16± 2.61 and summer (22.98± 2.58, and greater in the synchronized animals (29.97± 2.48 vs 21.17± 2.17. It was observed effect of interaction between season of the year and luteolysis type on the total received mountings per hour in estrus. The winter was not a limiting factor to the estrus manifestation, once its length and intensity allowed heat detection, however, heat synchronization meddled the manifestation of sexual behaviour.

  11. SMA and CARMA observations of young brown dwarfs in ρ Ophiuchi and Taurus

    Directory of Open Access Journals (Sweden)

    Lee C.-F.


    Full Text Available Molecular outflows provide vital information about the earliest stages in the birth of stars, studying the molecular outflow properties is therefore crucial for understanding how stars form. Brown dwarfs with masses between that of stars and planets are not massive enough to maintain stable hydrogen-burning fusion reactions during most of their lifetime. Their origins are subject to much debate in recent literature because their masses are far below the typical mass where core collapse is expected to occur. Based on Submillimeter Array (SMA and Combined Array for Research in Millimeter-wave Astronomy (CARMA observations, we present the first detections of bipolar molecular outflows from young brown dwarfs in ρ Ophiuchi and Taurus. Our results demonstrate that the bipolar molecular outflow operates down to brown dwarf masses, occurring in brown dwarfs as a scaled-down version of the universal process seen in young low-mass stars. This demonstrates that brown dwarfs and low-mass stars likely share the same formation mechanism.

  12. Molecular line study of the very young protostar IRAM 04191 in Taurus Infall, rotation, and outflow

    CERN Document Server

    Belloche, A; Despois, D; Blinder, S M


    We present a detailed millimeter line study of the circumstellar environment of the low-luminosity Class 0 protostar IRAM 04191+1522 in the Taurus molecular cloud. New line observations demonstrate that the ~14000 AU radius protostellar envelope is undergoing both extended infall and fast, differential rotation. Radiative transfer modeling of multitransition CS and C34S maps indicate an infall velocity v_inf ~ 0.15 km/s at r ~ 1500 AU and v_inf ~ 0.1 km/s up to r ~ 11000 AU, as well as a rotational angular velocity Omega ~ 3.9 x 10^{-13} rad/s, strongly decreasing with radius beyond 3500 AU down to a value Omega ~ 1.5-3 x 10^{-14} rad/s at ~ 11000 AU. Two distinct regions, which differ in both their infall and their rotation properties, therefore seem to stand out: the inner part of the envelope (r ~< 2000-4000 AU) is rapidly collapsing and rotating, while the outer part undergoes only moderate infall/contraction and slower rotation. These contrasted features suggest that angular momentum is conserved in t...

  13. The behavioural and genetic mating system of the sand tiger shark, Carcharias taurus, an intrauterine cannibal. (United States)

    Chapman, Demian D; Wintner, Sabine P; Abercrombie, Debra L; Ashe, Jimiane; Bernard, Andrea M; Shivji, Mahmood S; Feldheim, Kevin A


    Sand tiger sharks (Carcharias taurus) have an unusual mode of reproduction, whereby the first embryos in each of the paired uteri to reach a certain size ('hatchlings') consume all of their smaller siblings during gestation ('embryonic cannibalism' or EC). If females commonly mate with multiple males ('behavioural polyandry') then litters could initially have multiple sires. It is possible, however, that EC could exclude of all but one of these sires from producing offspring thus influencing the species genetic mating system ('genetic monogamy'). Here, we use microsatellite DNA profiling of mothers and their litters (n = 15, from two to nine embryos per litter) to quantify the frequency of behavioural and genetic polyandry in this system. We conservatively estimate that nine of the females we examined (60%) were behaviourally polyandrous. The genetic mating system was characterized by assessing sibling relationships between hatchlings and revealed only 40 per cent genetic polyandry (i.e. hatchlings were full siblings in 60% of litters). The discrepancy stemmed from three females that were initially fertilized by multiple males but only produced hatchlings with one of them. This reveals that males can be excluded even after fertilizing ova and that some instances of genetic monogamy in this population arise from the reduction in litter size by EC. More research is needed on how cryptic post-copulatory and post-zygotic processes contribute to determining paternity and bridging the behavioural and genetic mating systems of viviparous species. PMID:23637391

  14. Properties of Starless and Prestellar Cores in Taurus Revealed by Herschel SPIRE/PACS Imaging

    CERN Document Server

    Marsh, K A; Palmeirim, P; André, Ph; Kirk, J; Stamatellos, D; Ward-Thompson, D; Roy, A; Bontemps, S; Di Francesco, J; Elia, D; Hill, T; Konyves, V; Motte, F; Nguyen-Luong, Q; Peretto, N; Pezzuto, S; Rivera-Ingraham, A; Schneider, N; Spinoglio, L; White, G


    The density and temperature structures of dense cores in the L1495 cloud of the Taurus star-forming region are investigated using Herschel SPIRE and PACS images in the 70 $\\mu$m, 160 $\\mu$m, 250 $\\mu$m, 350 $\\mu$m and 500 $\\mu$m continuum bands. A sample consisting of 20 cores, selected using spectral and spatial criteria, is analysed using a new maximum likelihood technique, COREFIT, which takes full account of the instrumental point spread functions. We obtain central dust temperatures, $T_0$, in the range 6-12 K and find that, in the majority of cases, the radial density falloff at large radial distances is consistent with the $r^{-2}$ variation expected for Bonnor-Ebert spheres. Two of our cores exhibit a significantly steeper falloff, however, and since both appear to be gravitationally unstable, such behaviour may have implications for collapse models. We find a strong negative correlation between $T_0$ and peak column density, as expected if the dust is heated predominantly by the interstellar radiatio...

  15. Accretion discs as regulators of stellar angular momentum evolution in the ONC and Taurus-Auriga

    CERN Document Server

    Davies, Claire L; Greaves, Jane S


    In light of recent substantial updates to spectral type estimations and newly established intrinsic colours, effective temperatures, and bolometric corrections for pre-main sequence (PMS) stars, we re-address the theory of accretion-disc regulated stellar angular momentum (AM) evolution. We report on the compilation of a consistent sample of fully convective stars within two of the most well-studied and youngest, nearby regions of star formation: the Orion Nebula Cluster (ONC) and Taurus-Auriga. We calculate the average specific stellar AM ($j_{\\star}$) assuming solid body rotation, using surface rotation periods gathered from the literature and new estimates of stellar radii and ages. We use published Spitzer IRAC fluxes to classify our stars as Class II or Class III and compare their $j_{\\star}$ evolution. Our results suggest that disc dispersal is a rapid process that occurs at a variety of ages. We find a consistent $j_{\\star}$ reduction rate between the Class II and Class III PMS stars which we interpret...

  16. VizieR Online Data Catalog: Spitzer observations of Taurus members (Luhman+, 2010) (United States)

    Luhman, K. L.; Allen, P. R.; Espaillat, C.; Hartmann, L.; Calvet, N.


    For our census of the disk population in Taurus, we use images at 3.6, 4.5, 5.8, and 8.0um obtained with Spitzer's Infrared Array Camera (IRAC) and images at 24um obtained with the Multiband Imaging Photometer for Spitzer (MIPS). The cameras produced images with FWHM=1.6"-1.9" from 3.6 to 8.0um and FWHM=5.9" at 24um. The available data were obtained through Guaranteed Time Observations for PID = 6, 36, 37 (G. Fazio), 53 (G. Rieke), 94 (C. Lawrence), 30540 (G. Fazio, J. Houck), and 40302 (J. Houck), Director's Discretionary Time for PID = 462 (L. Rebull), Legacy programs for PID = 139, 173 (N. Evans), and 30816 (D. Padgett), and General Observer programs for PID = 3584 (D. Padgett), 20302 (P. Andre), 20386 (P. Myers), 20762 (J. Swift), 30384 (T. Bourke), 40844 (C. McCabe), and 50584 (D. Padgett). The IRAC and MIPS observations were performed through 180 and 137 Astronomical Observation Requests (AORs), respectively. The characteristics of the resulting images are summarized in Tables 1 and 2. (6 data files).

  17. A GMRT survey of regions towards the Taurus Molecular Cloud at 323 and 608 MHz

    CERN Document Server

    Ainsworth, Rachael E; Green, David A; Scaife, Anna M M; Ray, Tom P


    We present observations of three active sites of star formation in the Taurus Molecular Cloud complex taken at 323 and 608 MHz (90 and 50 cm, respectively) with the Giant Metrewave Radio Telescope (GMRT). Three pointings were observed as part of a pathfinder project, targeted at the young stellar objects (YSOs) L1551 IRS 5, T Tau and DG Tau (the results for these target sources were presented in a previous paper). In this paper, we search for other YSOs and present a survey comprising of all three fields; a by-product of the large instantaneous field of view of the GMRT. The resolution of the survey is of order 10 arcsec and the best rms noise at the centre of each pointing is of order $100\\,\\mu$Jy beam$^{-1}$ at 323 MHz and $50\\,\\mu$Jy beam$^{-1}$ at 608 MHz. We present a catalogue of 1815 and 687 field sources detected above $5\\,\\sigma_{\\rm rms}$ at 323 and 608 MHz, respectively. A total of 440 sources were detected at both frequencies, corresponding to a total unique source count of 2062 sources. We compar...

  18. A radio survey of weak T Tauri stars in Taurus-Auriga

    International Nuclear Information System (INIS)

    A multi-epoch 5 GHz survey of candidate or confirmed weak T Tauri stars in the Taurus-Auriga molecular cloud complex was conducted with the Very Large Array. The stars were chosen from those having detectable X-ray or chromospheric emission, and weak-emission-line pre-main-sequence stars found by other means. Snapshots of 99 VLA fields containing 119 candidate stars were obtained with a sensitivity of 0.7 mJy; most fields were observed on two or three dates. Nine radio sources coincident with cataloged stars were found. One may be an RS CVn binary system; the other eight are pre-main-sequence stars. Three of the detected stars - HD 283447, V410 Tau, and FK X-ray 1 - were previously known radio sources. Five new detections are Herbig's Anon 1, Hubble 4, HDE 283572, Elias 12, and HK Tau/c. At least five of the sources are variable, and no linear or circular polarization was found. Several lines of evidence suggest that the radio-detected weak T Tauri stars are quite young, perhaps younger on average than nondetected stars. 54 refs

  19. X-ray deficiency on strong accreting T Tauri stars - Comparing Orion with Taurus

    CERN Document Server

    Bustamante, Ignacio; Bouy, Hervé; Manara, Carlo; Ribas, Álvaro; Riviere-Marichalar, Pablo


    Depending on whether a T Tauri star accretes material from its circumstellar disk or not, different X-ray emission properties can be found. The accretion shocks produce cool heating of the plasma, contributing to the soft X-ray emission from the star. Using X-ray data from the Chandra Orion Ultra-deep Project and accretion rates that were obtained with the Hubble Space Telescope/WFPC2 photometric measurements in the Orion Nebula Cluster, we studied the relation between the accretion processes and the X-ray emissions of a coherent sample of T Tauri sources in the region. We performed regression and correlation analyses of our sample of T Tauri stars between the X-ray parameters, stellar properties, and the accretion measurements. We find that a clear anti-correlation is present between the residual X-ray luminosity and the accretion rates in our samples in Orion that is consistent with that found on the XMM-Newton Extended Survey of the Taurus molecular cloud (XEST) study. We provide a catalog with X-ray lumin...

  20. Chemistry in Disks X: The Molecular Content of Proto-planetary Disks in Taurus

    CERN Document Server

    Guilloteau, S; Dutrey, A; Chapillon, E; Wakelam, V; Piétu, V; Di Folco, E; Semenov, D; Henning, Th


    (abridged) We used the IRAM 30-m to perform a sensitive wideband survey of 30 protoplanetary disks in the Taurus Auriga region. We simultaneously observed HCO$^+$(3-2), HCN(3-2), C$_2$H(3-2), CS(5-4), and two transitions of SO. We combine the results with a previous survey which observed $^{13}$CO (2-1), CN(2-1), two o-H$_2$CO lines and one of SO. We use available interferometric data to derive excitation temperatures of CN and C$_2$H in several sources. We determine characteristic sizes of the gas disks and column densities of all molecules using a parametric power-law disk model. Our study is mostly sensitive to molecules at 200-400 au from the stars. We compare the derived column densities to the predictions of an extensive gas-grain chemical disk model, under conditions representative of T Tauri disks. This survey provides 20 new detections of HCO$^+$ in disks, 18 in HCN, 11 in C$_2$H, 8 in CS and 4 in SO. HCO$^+$ is detected in almost all sources, and its J=3-2 line is essentially optically thick, provid...

  1. The JCMT Legacy Survey of the Gould Belt: a first look at Taurus with HARP

    CERN Document Server

    Davis, C J; Hatchell, J; Wouterloot, J G A; Buckle, J V; Nutter, D; Fich, M; Brunt, C; Butner, H; Cavanagh, B; Curtis, E I; Duarte-Cabral, A; Di Francesco, J; Etxaluze, M; Friberg, P; Friesen, R; Fuller, G A; Graves, S; Greaves, J S; Hogerheijde, M R; Johnstone, D; Matthews, B; Matthews, H; Rawlings, J M C; Richer, J S; Roberts, J; Sadavoy, S; Simpson, R J; Tothill, N; Tsamis, Y; Viti, S; Ward-Thompson, D; White, Glenn J; Yates, J


    As part of a JCMT Legacy Survey of star formation in the Gould Belt, we present early science results for Taurus. CO J=3-2 maps have been secured along the north-west ridge and bowl, collectively known as L 1495, along with deep 13CO and C18O J=3-2 maps in two sub-regions. With these data we search for molecular outflows, and use the distribution of flows, HH objects and shocked H2 line emission features, together with the population of young stars, protostellar cores and starless condensations to map star formation across this extensive region. In total 21 outflows are identified. It is clear that the bowl is more evolved than the ridge, harbouring a greater population of T Tauri stars and a more diffuse, more turbulent ambient medium. By comparison, the ridge contains a much younger, less widely distributed population of protostars which, in turn, is associated with a greater number of molecular outflows. We estimate the ratio of the numbers of prestellar to protostellar cores in L 1495 to be ~ 1.3-2.3, and...

  2. A Resolved Census of Millimeter Emission from Taurus Multiple Star Systems

    CERN Document Server

    Harris, Robert J; Wilner, David J; Kraus, Adam L


    We present a high angular resolution millimeter-wave dust continuum imaging survey of circumstellar material associated with individual components of 23 multiple star systems in the Taurus-Auriga young cluster. Combined with previous measurements, these new data permit a comprehensive look at how millimeter luminosity (a tracer of disk mass) relates to the separation and mass of a stellar companion. Approximately one third (28-37%) of individual stars in multiples have detectable millimeter emission, a rate half that for single stars (~62%). There is a strong correlation between the luminosity and projected separation (a_p) of a stellar pair. Wide pairs (a_p > 300 AU) have a similar luminosity distribution as single stars, medium pairs (a_p ~ 30-300 AU) are a factor of 5 fainter, and close pairs (a_p < 30 AU) are ~ 5 times fainter yet (aside from a small population of bright circumbinary disks). In most cases, the emission is dominated by a disk around the primary (or a wide tertiary in triples), but there...

  3. Chains of dense cores in the Taurus L1495/B213 complex

    CERN Document Server

    Tafalla, M


    (Abridged) We study the kinematics of the dense gas in the Taurus L1495/B213 filamentary region to investigate the mechanism of core formation. We use observations of N2H+(1-0) and C18O(2-1) carried out with the IRAM 30m telescope. We find that the dense cores in L1495/B213 are significantly clustered in linear chain-like groups about 0.5pc long. The internal motions in these chains are mostly subsonic and the velocity is continuous, indicating that turbulence dissipation in the cloud has occurred at the scale of the chains and not at the smaller scale of the individual cores. The chains also present an approximately constant abundance of N2H+ and radial intensity profiles that can be modeled with a density law that follows a softened power law. A simple analysis of the spacing between the cores using an isothermal cylinder model indicates that the cores have likely formed by gravitational fragmentation of velocity-coherent filaments. Combining our analysis of the cores with our previous study of the large-sc...


    Florio, Daniela; Gridelli, Stefano; Fioravanti, Maria Letizia; Zanoni, Renato Giulio


    This report describes a case of the first isolation of Tenacibaculum maritimum from a captive-bred adult female sand tiger shark (Carcharias taurus) housed at the Cattolica Aquarium (Italy). The animal showed, between the second dorsal fin and the precaudal pit, skin lesions characterized by the presence of abundant whitish necrotic tissue. Through routine bacteriological examination, a bacterium was isolated from a skin lesion and subsequently identified as T. maritimum by phenotypic characters and species-specific polymerase chain reaction. The antimicrobial sensitivity of the isolated strain was evaluated for 11 antimicrobial agents by disk diffusion method. Antibiotic therapy was conducted with enrofloxacin at 10 mg kg(-1) i.m. on alternate days for 10 days. One month after the end of treatment skin lesions showed complete resolution and the shark recovered completely. The case presented here represents the first report of infection by T. maritimum in a sand tiger shark and highlights the potential pathogenic role of this microorganism in elasmobranchs kept in an aquarium. PMID:27010301

  5. Classifying the embedded young stellar population in Perseus and Taurus & the LOMASS database

    CERN Document Server

    Carney, M T; Mottram, J C; van Dishoeck, E F; Ramchandani, J; Jørgensen, J K


    Context. The classification of young stellar objects (YSOs) is typically done using the infrared spectral slope or bolometric temperature, but either can result in contamination of samples. More accurate methods to determine the evolutionary stage of YSOs will improve the reliability of statistics for the embedded YSO population and provide more robust stage lifetimes. Aims. We aim to separate the truly embedded YSOs from more evolved sources. Methods. Maps of HCO+ J=4-3 and C18O J=3-2 were observed with HARP on the James Clerk Maxwell Telescope (JCMT) for a sample of 56 candidate YSOs in Perseus and Taurus in order to characterize emission from high (column) density gas. These are supplemented with archival dust continuum maps observed with SCUBA on the JCMT and Herschel PACS to compare the morphology of the gas and dust in the protostellar envelopes. The spatial concentration of HCO+ J=4-3 and 850 micron dust emission are used to classify the embedded nature of YSOs. Results. Approximately 30% of Class 0+I ...

  6. Two confirmed class I very low-mass objects in Taurus

    CERN Document Server

    Dang-Duc, C; Dao-Van, D T


    [GKH94] 41 and IRAS 04191+1523B were previously identified to be proto-brown dwarf candidates in Taurus. [GKH94] 41 was classified to be a class I object. The dereddened spectral energy distribution of the source was later found to be suggestive of a class II object. IRAS 04191+1523B is a class I object that is the secondary component of a binary. We determine the evolutionary stage of [GKH94] 41 and estimate the final masses of the two proto-brown dwarf candidates. We used archive millimeter observations to produce continuum maps and collected data from the literature to construct the spectral energy distribution of the targets. Our continuum maps revealed that both [GKH94] 41 and IRAS 04191+1523B are surrounded by envelopes. This provides direct evidence that [GKH94] 41 is a class I object, not class II, as previously classified. For IRAS 04191+1523B, our continuum map spatially resolved the binary. Our estimated final masses are below 49$^{+56}_{-27}$ $M_{\\rm J}$ and 75$^{+40}_{-26}$ $M_{\\rm J}$ for [GKH94...

  7. A detailed mass distribution of a high-density core in Taurus with ALMA

    CERN Document Server

    Tokuda, Kazuki; Matsumoto, Tomoaki; Saigo, Kazuya; Kawamura, Akiko; Fukui, Yasuo; Inutsuka, Shu-ichiro; Machida, Masahiro N; Tomida, Kengo; Tachihara, Kengo; André, Philippe


    We present the results of ALMA observations of dust continuum emission and molecular rotational lines, including the ALMA Compact Array, toward a dense core MC27 (a.k.a. L1521F) in Taurus, which is considered to be at very early stage of star formation. Detailed column density distribution with a size scale from a few tens AU to ~10000 AU scale are revealed by combining the ALMA data and the single-dish data. The high angular resolution observation at 0.87 mm reveals that a protostellar source, MMS-1, is still not spatially resolved without gas association and a starless high-density core, MMS-2, has substructures both in dust and molecular emission. The averaged radial column density distribution of the inner part (r < 3000 AU) is N_H2 ~r^-0.4, clearly flatter than that of the outer part, ~r^-1.0. We found the complex velocity/spatial structure obtained with previous ALMA observations is located inside the inner flatter region, which may reflect the dynamical status of the dense core.

  8. Determining the 3D Subsurface Density Structure of Taurus Littrow Valley Using Apollo 17 Gravity Data (United States)

    Urbancic, N.; Ghent, R.; Stanley, S,; Johnson, C. L.; Carroll, K. A.; Hatch, D.; Williamson, M. C.; Garry, W. B.; Talwani, M.


    Surface gravity surveys can detect subsurface density variations that can reveal subsurface geologic features. In 1972, the Apollo 17 (A17) mission conducted the Traverse Gravimeter Experiment (TGE) using a gravimeter that measured the local gravity field near Taurus Littrow Valley (TLV), located on the south-eastern rim of the Serenitatis basin. TLV is hypothesized to be a basaltfilled radial graben resulting from the impact that formed Mare Serenitatis. It is bounded by both the North and South Massifs (NM and SM) as well as other smaller mountains to the East that are thought to be mainly composed of brecciated highland material. The TGE is the first and only successful gravity survey on the surface of the Moon. Other more recent satellite surveys, such as NASA's Gravity Recovery and Interior Laboratory (GRAIL) mission (2011- 2012), have produced the best global gravity field to date (approx. 13km resolution). However, these satellite surveys are not sensitive enough to detect fine-scale (3D modelling techniques in combination with high-resolution topographical and image datasets can reveal additional fine-scale subsurface structure in TLV.

  9. Cores, filaments, and bundles: hierarchical core formation in the L1495/B213 Taurus region

    CERN Document Server

    Hacar, A; Kauffmann, J; Kovacs, A


    (Abridged) Context. Core condensation is a critical step in the star-formation process, but is still poorly characterized observationally. Aims. We have studied the 10 pc-long L1495/B213 complex in Taurus to investigate how dense cores have condensed out of the lower-density cloud material. Results. From the N$_2$H$^+$ emission, we identify 19 dense cores, some starless and some protostellar. They are not distributed uniformly, but tend to cluster with relative separations on the order of 0.25 pc. From the C$^{18}$O emission, we identify multiple velocity components in the gas. We have characterized them by fitting gaussians to the spectra, and by studying the distribution of the fits in position-position-velocity space. In this space, the C$^{18}$O components appear as velocity-coherent structures, and we have identified them automatically using a dedicated algorithm (FIVe: Friends In Velocity). Using this algorithm, we have identified 35 filamentary components with typical lengths of 0.5 pc, sonic internal ...

  10. The XMM-Newton Optical Monitor Survey of the Taurus Molecular Cloud

    CERN Document Server

    Audard, M; Grosso, N; Güdel, M; Scelsi, L; Bouvier, J; Telleschi, A; Audard, Marc; Briggs, Kevin; Grosso, Nicolas; Guedel, Manuel; Scelsi, Luigi; Bouvier, Jerome; Telleschi, Alessandra


    The Optical Monitor (OM) on-board XMM-Newton obtained optical/ultraviolet data for the XMM-Newton Extended Survey of the Taurus Molecular Cloud (XEST), simultaneously with the X-ray detectors. With the XEST OM data, we aim to study the optical and ultraviolet properties of TMC members, and to do correlative studies between the X-ray and OM light curves. In particular, we aim to determine whether accretion plays a significant role in the optical/ultraviolet and X-ray emissions. The Neupert effect in stellar flares is also investigated. Coordinates, average count rates and magnitudes were extracted from OM images, together with light curves with low time resolution (a few kiloseconds). For a few sources, OM FAST mode data were also available, and we extracted OM light curves with high time resolution. The OM data were correlated with Two Micron All Sky Survey (2MASS) data and with the XEST catalogue in the X-rays. The XEST OM catalogue contains 2,148 entries of which 1,893 have 2MASS counterparts. However, only...

  11. Two confirmed class I very low-mass objects in Taurus (United States)

    Dang-Duc, C.; Phan-Bao, N.; Dao-Van, D. T.


    Context. [GKH94] 41 and IRAS 04191+1523B were previously identified to be proto-brown dwarf candidates in Taurus. [GKH94] 41 was classified to be a class I object. The dereddened spectral energy distribution of the source was later found to be suggestive of a class II object. IRAS 04191+1523B is a class I object that is the secondary component of a binary. Aims: We determine the evolutionary stage of [GKH94] 41 and estimate the final masses of the two proto-brown dwarf candidates. Methods: We used archive millimeter observations to produce continuum maps and collected data from the literature to construct the spectral energy distribution of the targets. Results: Our continuum maps revealed that both [GKH94] 41 and IRAS 04191+1523B are surrounded by envelopes. This provides direct evidence that [GKH94] 41 is a class I object, not class II, as previously classified. For IRAS 04191+1523B, our continuum map spatially resolved the binary. Our estimated final masses are below 49-27+56 MJ and 75-26+40 MJ for [GKH94] 41 and IRAS 04191+1523B, respectively. This indicates that both sources will likely become brown dwarfs or very low-mass stars. Therefore, [GKH94] 41 and IRAS 04191+1523B are two new confirmed class I very low-mass objects. Their existence also supports the scenario that brown dwarfs have the same formation stages as low-mass stars.

  12. Far-ultraviolet Observations of the Taurus-Perseus-Auriga Complex

    CERN Document Server

    Lim, Tae-Ho; Seon, Kwang-Il


    We have constructed a far-ultraviolet (FUV) continuum map of the Taurus-Auriga-Perseus complex, one of the largest local associations of dark clouds, by merging the two data sets of GALEX and FIMS, which made observations at similar wavelengths. The FUV intensity varies significantly across the whole region, but the diffuse FUV continuum is dominated by dust scattering of stellar photons. A diffuse FUV background of $\\sim$1000 CU is observed, part of which may be attributable to the scattered photons of foreground FUV light, located in front of the thick clouds. The fluorescent emission of molecular hydrogen constitutes $\\sim$10% of the total FUV intensity throughout the region, generally proportional to the local continuum level. We have developed a Monte Carlo radiative transfer code and applied it to the present clouds complex to obtain the optical properties of dust grains and the geometrical structures of the clouds. The albedo and the phase function asymmetry factor were estimated to be $0.42^{+0.05}_{-...

  13. The relation between gas and dust in the Taurus Molecular Cloud

    CERN Document Server

    Pineda, Jorge L; Chapman, Nicholas; Snell, Ronald L; Li, Di; Cambresy, Laurent; Brunt, Chris


    (abridged) We report a study of the relation between dust and gas over a 100deg^2 area in the Taurus molecular cloud. We compare the H2 column density derived from dust extinction with the CO column density derived from the 12CO and 13CO J= 1-0 lines. We derive the visual extinction from reddening determined from 2MASS data. The comparison is done at an angular size of 200", corresponding to 0.14pc at a distance of 140pc. We find that the relation between visual extinction Av and N(CO) is linear between Av~3 and 10 mag in the region associated with the B213--L1495 filament. In other regions the linear relation is flattened for Av > 4 mag. We find that the presence of temperature gradients in the molecular gas affects the determination of N(CO) by ~30--70% with the largest difference occurring at large column densities. Adding a correction for this effect and accounting for the observed relation between the column density of CO and CO2 ices and Av, we find a linear relationship between the column of carbon mon...

  14. Ultrastructure of spermatozoa of Onthophagus taurus (Coleoptera, Scarabaeidae) exhibits heritable variation (United States)

    Werner, Michael; Simmons, Leigh W.


    Sperm competition is thought to be an important selective pressure shaping sperm form and function. However, few studies have moved beyond gross examinations of sperm morphology. Sperm length is subject to sexual selection via sperm competition in the scarab beetle Onthophagus taurus. Here, the structure and ultrastructure of spermatozoa in this species were investigated using light and electron microscopy. Spermatozoa were found to be filiform, measuring about 1,200 mm in length. The sperm head consists of a three-layered acrosome and a nuclear region bearing the anterior extension of the centriole adjunct. Acrosome and nuclear regions are bilaterally symmetric, with their axes of symmetry being orthogonal to each other. Head and flagellar structures are connected by a well-developed centriole adjunct. The sperm heads are asymmetrically surrounded by accessory material and embedded into the cytoplasm of the spermatocyst cell. The accessory material is produced inside the spermatids and then transferred to the outside due to a new membrane formed around the sperm's organelles. The old spermatid membrane separates the accessory material from the cyst cell. The flagellum contains a 9+9+2 axoneme, two accessory bodies, and two mitochondrial derivatives of unequal size. The major mitochondrial derivative is significantly larger than the minor one. The axoneme is arranged in a sinusoidal manner parallel along the major mitochondrial derivative. The spermatozoa show no progressive motility when released in buffer solution which is likely to be the result of the flagellar arrangement and the structure of the major mitochondrial derivative. The cross-sectional area of the minor and the major mitochondrial derivatives show different patterns of genetic variation. The data provide the first estimates of genetic variation in sperm ultrastructure for any species, and give evidence for the persistence of genetic variation in ultrastructure required for the rapid and divergent

  15. Grey nurse shark (Carcharias taurus) diving tourism: Tourist compliance and shark behaviour at Fish Rock, Australia. (United States)

    Smith, Kirby; Scarr, Mark; Scarpaci, Carol


    Humans can dive with critically endangered grey nurse sharks (Carcharias taurus) along the east coast of Australia. This study investigated both compliance of tourist divers to a code of conduct and legislation and the behaviour of grey nurse sharks in the presence of divers. A total of 25 data collection dives were conducted from December 2008 to January 2009. Grey nurse shark and diver behaviour were documented using 2-min scan samples and continuous observation. The proportion of time spent observing human-shark interactions was 9.4% of total field time and mean human-shark interaction time was 15.0 min. Results were used to gauge the effectiveness of current management practices for the grey nurse shark dive industry at Fish Rock in New South Wales, Australia. Grey nurse shark dive tourists were compliant to stipulations in the code of conduct and legislation (compliance ranged from 88 to 100%). The research detailed factors that may promote compliance in wildlife tourism operations such as the clarity of the stipulations, locality of the target species and diver perceptions of sharks. Results indicated that grey nurse sharks spent the majority of their time milling (85%) followed by active swimming (15%). Milling behaviour significantly decreased in the presence of more than six divers. Distance between sharks and divers, interaction time and number of sharks were not significantly correlated with grey nurse shark school behaviour. Jaw gaping, rapid withdrawal and stiff or jerky movement were the specific behaviours of grey nurse sharks that occurred most frequently and were associated with distance between divers and sharks and the presence of six or more divers. Revision of the number of divers allowed per interaction with a school of grey nurse sharks and further research on the potential impacts that shark-diving tourism may pose to grey nurse sharks is recommended. PMID:20872140

  16. Grey Nurse Shark ( Carcharias taurus) Diving Tourism: Tourist Compliance and Shark Behaviour at Fish Rock, Australia (United States)

    Smith, Kirby; Scarr, Mark; Scarpaci, Carol


    Humans can dive with critically endangered grey nurse sharks ( Carcharias taurus) along the east coast of Australia. This study investigated both compliance of tourist divers to a code of conduct and legislation and the behaviour of grey nurse sharks in the presence of divers. A total of 25 data collection dives were conducted from December 2008 to January 2009. Grey nurse shark and diver behaviour were documented using 2-min scan samples and continuous observation. The proportion of time spent observing human-shark interactions was 9.4% of total field time and mean human-shark interaction time was 15.0 min. Results were used to gauge the effectiveness of current management practices for the grey nurse shark dive industry at Fish Rock in New South Wales, Australia. Grey nurse shark dive tourists were compliant to stipulations in the code of conduct and legislation (compliance ranged from 88 to 100%). The research detailed factors that may promote compliance in wildlife tourism operations such as the clarity of the stipulations, locality of the target species and diver perceptions of sharks. Results indicated that grey nurse sharks spent the majority of their time milling (85%) followed by active swimming (15%). Milling behaviour significantly decreased in the presence of more than six divers. Distance between sharks and divers, interaction time and number of sharks were not significantly correlated with grey nurse shark school behaviour. Jaw gaping, rapid withdrawal and stiff or jerky movement were the specific behaviours of grey nurse sharks that occurred most frequently and were associated with distance between divers and sharks and the presence of six or more divers. Revision of the number of divers allowed per interaction with a school of grey nurse sharks and further research on the potential impacts that shark-diving tourism may pose to grey nurse sharks is recommended.

  17. A census of dense cores in the Taurus L1495 cloud from the Herschel (United States)

    Marsh, K. A.; Kirk, J. M.; André, Ph.; Griffin, M. J.; Könyves, V.; Palmeirim, P.; Men'shchikov, A.; Ward-Thompson, D.; Benedettini, M.; Bresnahan, D. W.; Francesco, J. Di; Elia, D.; Motte, F.; Peretto, N.; Pezzuto, S.; Roy, A.; Sadavoy, S.; Schneider, N.; Spinoglio, L.; White, G. J.


    We present a catalogue of dense cores in a ˜4° × 2° field of the Taurus star-forming region, inclusive of the L1495 cloud, derived from Herschel SPIRE and PACS observations in the 70 μm, 160 μm, 250 μm, 350 μm, and 500 μm continuum bands. Estimates of mean dust temperature and total mass are derived using modified blackbody fits to the spectral energy distributions. We detect 525 starless cores of which ˜10-20 per cent are gravitationally bound and therefore presumably prestellar. Our census of unbound objects is ˜85 per cent complete for M > 0.015 M⊙ in low-density regions (AV ≲ 5 mag), while the bound (prestellar) subset is ˜85 per cent complete for M > 0.1 M⊙ overall. The prestellar core mass function (CMF) is consistent with lognormal form, resembling the stellar system initial mass function, as has been reported previously. All of the inferred prestellar cores lie on filamentary structures whose column densities exceed the expected threshold for filamentary collapse, in agreement with previous reports. Unlike the prestellar CMF, the unbound starless CMF is not lognormal, but instead is consistent with a power-law form below 0.3 M⊙ and shows no evidence for a low-mass turnover. It resembles previously reported mass distributions for CO clumps at low masses (M ≲ 0.3 M⊙). The volume density PDF, however, is accurately lognormal except at high densities. It is consistent with the effects of self-gravity on magnetized supersonic turbulence. The only significant deviation from lognormality is a high-density tail which can be attributed unambiguously to prestellar cores.

  18. Taurus Littrow Pyroclastic Deposit-An Optimum Feedstock for Lunar Oxygen (United States)

    Allen, Carlton C.


    Future human habitation of the Moon will likely require the use of locally derived materials because of the high cost of transportation from Earth. Oxygen, extracted from oxides and silicates, is a potentially abundant lunar resource vital for life support and spacecraft propulsion. The anticipated costs of supplying all oxygen needs for a lunar base from Earth are high enough to warrant serious study of oxygen production from local resources. Over 20 different processes have been proposed for oxygen production on the Moon. Among the simplest and best studied of these processes is the reduction of oxides in lunar minerals and glass using hydrogen gas. Oxygen can be extracted from lunar soils and pyroclastic glass beads by exposing the samples to flowing hydrogen at subsolidus temperatures (approx. 1050 C). Total oxygen yield is directly correlated to the sample's abundance of FeO, but is not correlated to the abundance of any other oxide. Oxygen is extracted predominantly from FeO, with lesser contributions from TiO2 and SiO2. Oxygen yield is independent of soil maturity. All major FeO-bearing phases contribute oxygen, with extraction from ilmenite and glass significantly more efficient than from olivine and pyroxene. This study demonstrates that the optimum location for a lunar resources demonstration mission can be identified, and that the oxygen yield can be predicted, using a combination of high-resolution imaging and thermal-infrared data. A mission to Taurus Littrow will encounter a deposit at least 10 m in depth with few landing hazards, a uniform composition, and a predicted oxygen yield of approximately 3 wt. %, among the highest values on the Moon.

  19. Performance evaluation of bolt-cutter system on first Taurus launch (United States)

    Baban, F.; Williams, R.; Amimoto, S.; Hansen, W.; Bixler, T.


    In rapid response to the request of the Space Test and Experimentation Directorate in Space Launch Operations, a launch-critical experimental investigation was conducted to evaluate the performance of a particular bolt-cutter system for separating stages on the first Taurus launch. The tests were to examine the variation of tension preloading on the bolt system and to demonstrate the tolerable margin on this parameter for such launches with the new types of bolts since the preloading was known to vary as much as 12% from a preset value before launch. We planned and carried out the experiment, designed and assembled the fixture to properly simulate flight application, and developed diagnostics. Four bolt cutters were purchased from the manufacturer for these tests, and one was provided by the contractor. In addition to the obvious requirement to demonstrate the successful severing of bolts under varying preloads, ignition-wire current and timing of chisel impact on the bolt were monitored. An optical diagnostic was designed to determine the flyout velocity and kinetic energy of the broken pieces. These latter measurements will be useful in anchoring performance codes simulating and assessing the structural dynamics of the bolt-cutter function for future missions. The tests were conducted successfully and the bolts were severed successfully in all five tests. The preloads were successively lowered from 2,500 lb to 2,250, 2,000, 1,500, and 1,000 lb These tests contributed in a timely manner to the STEP launch decision and to launch mission assurance. They demonstrated important margin to the nominally set 3,200 lb. preload. The entire complicated experimental program from inception to completion was accomplished in less than three weeks.


    International Nuclear Information System (INIS)

    We present Spitzer images of the Taurus Complex (TC). We take advantage of the sensitivity and the spatial resolution of the observations to characterize the diffuse infrared (IR) emission across the cloud. This work highlights evidence of dust evolution within the translucent sections of the archetype reference for studies of quiescent molecular clouds. We combine the Spitzer 160 μm and IRAS 100 μm observations to produce a dust temperature map and a far-IR (FIR) dust opacity map at 5' resolution. The average dust temperature is about 14.5 K with a dispersion of ±1 K across the cloud. The FIR dust opacity is tightly correlated with the extinction derived from Two Micron All Sky Survey stellar colors and is a factor of 2 larger than the average value for the diffuse interstellar medium. This opacity increase and the attenuation of the radiation field both contribute to account for the lower emission temperature of the large grains. The structure of the TC significantly changes in the mid-IR (MIR) images that trace emission from polycyclic aromatic hydrocarbons (PAHs) and very small grains (VSGs). We focus our analysis of the MIR emission to a range of ecliptic latitudes away from the zodiacal bands and where the zodiacal light residuals are small. Within this cloud area, there are no 8 and 24 μm counterparts to the brightest 160 μm emission features. Conversely, the 8 and 24 μm images reveal filamentary structure that is strikingly inconspicuous in the 160 μm and extinction maps. The IR colors vary over subparsec distances across this filamentary structure. We compare the observed colors with model calculations quantifying the impact of the radiation field intensity and the abundance of stochastically heated particles on the dust spectral energy distribution. To match the range of observed colors, we have to invoke variations by a factor of a few of both the interstellar radiation field and the abundance of PAHs and VSGs. We conclude that within this

  1. Searching for gas emission lines in Spitzer Infrared Spectrograph (IRS) spectra of young stars in Taurus (United States)

    Baldovin-Saavedra, C.; Audard, M.; Güdel, M.; Rebull, L. M.; Padgett, D. L.; Skinner, S. L.; Carmona, A.; Glauser, A. M.; Fajardo-Acosta, S. B.


    Context. Our knowledge of circumstellar disks has traditionally been based on studies of dust. However, gas dominates the disk mass and its study is key to our understanding of accretion, outflows, and ultimately planet formation. The Spitzer Space Telescope provides access to gas emission lines in the mid-infrared, providing crucial new diagnostics of the physical conditions in accretion disks and outflows. Aims: We seek to identify gas emission lines in mid-infrared spectra of 64 pre-main-sequence stars in Taurus. Using line luminosities and other known star-disk-outflow parameters, we aim to identify correlations that will help to constrain gas heating, excitation mechanisms, and the line formation. Methods: We have based our study on Spitzer observations using the Infrared Spectrograph (IRS), mainly with the high-resolution modules. Line luminosities (or 3σ upper limits) have been obtained by fitting Gaussian profiles to the lines. We have further searched for correlations between the line luminosities and different parameters related to the star-disk system. Results: We have detected H2 (17.03, 28.22 μm) emission in 6 objects, [Ne II] (12.81 μm) emission in 18 objects, and [Fe II] (17.93, 25.99 μm) emission in 7 objects. [Ne II] detections are found primarily in Class II objects. The luminosity of the [Ne II] line (LNeII) is in general higher for objects known to drive jets than for those without known jets, but the two groups are not statistically distinguishable. LNeII is correlated with X-ray luminosity, but for Class II objects only. LNeII is also correlated with disk mass and accretion rate when the sample is divided into high and low accretors. Furthermore, we find correlations of LNeII with mid-IR continuum luminosity and with luminosity of the [O I] (6300 Å) line, the latter being an outflow tracer. L [FeII] correlates with Ṁacc. No correlations were found between LH2 and several tested parameters. Conclusions: Our study reveals a general trend

  2. Chemistry in disks. X. The molecular content of protoplanetary disks in Taurus (United States)

    Guilloteau, S.; Reboussin, L.; Dutrey, A.; Chapillon, E.; Wakelam, V.; Piétu, V.; Di Folco, E.; Semenov, D.; Henning, Th.


    Aims: We attempt to determine the molecular composition of disks around young low-mass stars. Methods: We used the IRAM 30 m radio telescope to perform a sensitive wideband survey of 30 stars in the Taurus Auriga region known to be surrounded by gaseous circumstellar disks. We simultaneously observed HCO+(3-2), HCN(3-2), C2H(3-2), CS(5-4), and two transitions of SO. We combined the results with a previous survey that observed 13CO (2-1), CN(2-1), two o-H2CO lines, and another transition of SO. We used available interferometric data to derive excitation temperatures of CN and C2H in several sources. We determined characteristic sizes of the gas disks and column densities of all molecules using a parametric power-law disk model. Our study is mostly sensitive to molecules at 200-400 au from the stars. We compared the derived column densities to the predictions of an extensive gas-grain chemical disk model under conditions representative of T Tauri disks. Results: This survey provides 20 new detections of HCO+ in disks, 18 in HCN, 11 in C2H, 8 in CS, and 4 in SO. HCO+ is detected in almost all sources and its J = 3-2 line is essentially optically thick, providing good estimates of the disk radii. The other transitions are (at least partially) optically thin. Large variations of the column density ratios are observed, but do not correlate with any specific property of the star or disk. Disks around Herbig Ae stars appear less rich in molecules than those around T Tauri stars, although the sample remains small. SO is only found in the (presumably younger) embedded objects, perhaps reflecting an evolution of the S chemistry due to increasing depletion with time. Overall, the molecular column densities, and in particular the CN/HCN and CN/C2H ratios, are well reproduced by gas-grain chemistry in cold disks. Conclusions: This study provides a comprehensive census of simple molecules in disks of radii >200-300 au. Extending that to smaller disks, or searching for less

  3. A GALEX based search for the sparse young stellar population in the Taurus-Aurigae star forming region

    CERN Document Server

    de Castro, Ana I Gomez; López-Martínez, Fátima; Sánchez, Néstor; Sestito, Paola; de Castro, Elisa; Cornide, Manuel; Gestoso, Javier Yañez


    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region using as baseline its ultraviolet excess. The initial data set has been defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near ultraviolet (NUV) and far ultraviolet (FUV) bands where the TTSs show a prominent excess, compared with main sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as, a fraction of the California Nebula and the Perseus complex; bright sources and the dark clouds themselves are avoided. The properties of the TTSs in the ultraviolet (GALEX), optical (UCAC4) and infrared (2MASS) have been defined using as qualification sample the TTSs observed with the International Ultraviolet Explorer. The candidates have been identified by means of a mixed ultraviolet-optical-infrared excess set of colors; it is found that the color-color diagram FUV-NUV versus J-K is ideally suited for this purpose. From an initial sample o...

  4. Variation of the ultraviolet extinction law across the Taurus-Auriga star forming complex. A GALEX based study

    CERN Document Server

    de Castro, Ana I Gomez; Lopez-Martinez, Fatima; Sanchez, Nestor; de Castro, Elisa; Cornide, Manuel


    The Taurus-Auriga molecular complex (TMC) is the main laboratory for the study of low mass star formation. The density and properties of interstellar dust are expected to vary across the TMC. These variations trace important processes such as dust nucleation or the magnetic field coupling with the cloud. In this article, we show how the combination of near ultraviolet (NUV) and infrared (IR) photometry can be used to derive the strength of the 2175 \\AA\\ bump and thus any enhancement in the abundance of small dust grains and PAHs in the dust grains size distribution. This technique is applied to the envelope of the TMC, mapped by the GALEX All Sky Survey (AIS). UV and IR photometric data have been retrieved from the GALEX-AIS and the 2MASS catalogues. NUV and K-band star counts have been used to identify the areas in the cloud envelope where the 2175 \\AA\\ bump is weaker than in the diffuse ISM namely, the low column density extensions of L1495, L1498 and L1524 in Taurus, L1545, L1548, L1519, L1513 in Auriga an...


    Energy Technology Data Exchange (ETDEWEB)

    Xiao Hongyu; Covey, Kevin R.; Lloyd, James P. [Department of Astronomy, Cornell University, 226 Space Sciences Building, Ithaca, NY 14853 (United States); Rebull, Luisa [Spitzer Science Center/Caltech, M/S 220-6, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Charbonneau, David [Department of Astronomy, Harvard University, 60 Garden Street, Cambridge, MA 02138 (United States); Mandushev, Georgi [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); O' Donovan, Francis; Slesnick, Catherine [Astronomy Department, California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States)


    We analyze light curves obtained by the Trans-atlantic Exoplanet Survey (TrES) for a field centered on the L1495 dark cloud in Taurus. The Spitzer Taurus Legacy Survey catalog identifies 179 bona fide Taurus members within the TrES field; 48 of the known Taurus members are detected by TrES, as well as 26 candidate members identified by the Spitzer Legacy team. We quantify the variability of each star in our sample using the ratio of the standard deviation of the original light curve ({sigma}{sub orig.}) to the standard deviation of a light curve that has been smoothed by 9 or 1001 epochs ({sigma}{sub 9} and {sigma}{sub 1001}, respectively). Known Taurus members typically demonstrate ({sigma}{sub orig.}/{sigma}{sub 9}) < 2.0, and ({sigma}{sub orig.}/{sigma}{sub 1001}) < 5, while field stars reveal ({sigma}{sub orig.}/{sigma}{sub 9}) {approx} 3.0 and ({sigma}{sub orig.}/{sigma}{sub 1001}) {approx} 10, as expected for light curves dominated by unstructured white noise. Of the 74 Taurus members/candidates with TrES light curves, we detect significant variability in 49 sources. Adapting a quantitative metric originally developed to assess the reliability of transit detections, we measure the amount of red and white noise in each light curve and identify 18 known or candidate Taurus members with highly significant period measurements. These appear to be the first periods measured for four of these sources (HD 282276, CX Tau, FP Tau, TrES J042423+265008), and in two other cases, the first non-aliased periods (LkCa 21 and DK Tau AB). For the remainder, the TrES measurements typically agree very well ({delta}P < 1%) with previously reported values. Including periods measured at lower confidence for 15 additional sources, we report periods for 11 objects where no previous periods were found, including 8 confirmed Taurus members. We also identify 10 of the 26 candidate Taurus members that demonstrate variability levels consistent with being bona fide T Tauri stars. A

  6. A hidden deformation zone withing the Cilician Taurus Mountains: Analysis of the GPS data using a novel approcah (United States)

    Sinan Özeren, Mehmet; Dimitrova, Lada; Haines, Alan John


    Tectonics within the Anatolian peninsula is shaped mainly by the northward motion of Arabia that collides with the East Anatolian High Plateau in the east and the extension in western Turkey and the Aegean Sea due to the roll-back of the Hellenic Trench in the west. The zone between these tectonically active regions is the central Anatolian block that rotates counterclockwise with respect to the stable Eurasia, hitherto thought to have been undergoing little internal deformation. However, the stalled subduction of the Cyprus Arc exerts compression on the overriding Anatolia, thereby creating compressive stresses all along the Turkish southern coast. The immediate consequence of this tectonic setting along with the east-west extension creates a strike-slip dominated central Anatolian block. Neverthless along the southern coast (southern margin of the Taurus mountains) there is scarse evidence of active faulting. Two exceptions are the Ecemis fault and its antithetic Tuzgolu fault, both strike-slip faults, the former bounding the Cilician Taurus from the west. Very little information exists on the ongoing deformation within the Cilician Taurus Mountains that form a quasi-elliptic structure with the major axis that is almost parallel to the Ecemis fault. Since Turkey is planning to build a nuclear power plant 15 km to the south the Ecemis fault, the hazard community has been giving the major attention to the Ecemis fault itself. Recent studies by Dimitrova et al. (2012) revealed that the subsurface sources of the laterally widespread deformation fields can be located very efficiently if one works with the vertical derivatives of horizontal stress (VDoHS) rates. The alternative approach is to directly calculate the GPS strain rates using kinematic algorithms, but they are much less efficient than working with VDoHS in determining zones of deformation, especially along faults without slip rate information mapped from palaeo-seismicity or along completely hidden faults

  7. Development of a physiologically based pharmacokinetic model for flunixin in cattle (Bos taurus). (United States)

    Leavens, Teresa L; Tell, Lisa A; Kissell, Lindsey W; Smith, Geoffrey W; Smith, David J; Wagner, Sarah A; Shelver, Weilin L; Wu, Huali; Baynes, Ronald E; Riviere, Jim E


    Frequent violation of flunixin residues in tissues from cattle has been attributed to non-compliance with the USFDA-approved route of administration and withdrawal time. However, the effect of administration route and physiological differences among animals on tissue depletion has not been determined. The objective of this work was to develop a physiologically based pharmacokinetic (PBPK) model to predict plasma, liver and milk concentrations of flunixin in cattle following intravenous (i.v.), intramuscular (i.m.) or subcutaneous (s.c.) administration for use as a tool to determine factors that may affect the withdrawal time. The PBPK model included blood flow-limited distribution in all tissues and elimination in the liver, kidney and milk. Regeneration of parent flunixin due to enterohepatic recirculation and hydrolysis of conjugated metabolites was incorporated in the liver compartment. Values for physiological parameters were obtained from the literature, and partition coefficients for all tissues but liver and kidney were derived empirically. Liver and kidney partition coefficients and elimination parameters were estimated for 14 pharmacokinetic studies (including five crossover studies) from the literature or government sources in which flunixin was administered i.v., i.m. or s.c. Model simulations compared well with data for the matrices following all routes of administration. Influential model parameters included those that may be age or disease-dependent, such as clearance and rate of milk production. Based on the model, route of administration would not affect the estimated days to reach the tolerance concentration (0.125 mg kg(-1)) in the liver of treated cattle. The majority of USDA-reported violative residues in liver were below the upper uncertainty predictions based on estimated parameters, which suggests the need to consider variability due to disease and age in establishing withdrawal intervals for drugs used in food animals. The model predicted that extravascular routes of administration prolonged flunixin concentrations in milk, which could result in violative milk residues in treated cattle. PMID:25082521

  8. Diagnosis of Sarcocystis spp. in cattle (Bos taurus) and water buffalo (Bubalus bubalis) in Northern Vietnam. (United States)

    Jehle, C; Dinkel, A; Sander, A; Morent, M; Romig, T; Luc, P V; De, T V; Thai, V V; Mackenstedt, U


    Our aim was to develop a method for species diagnosis and to obtain data on the prevalence of Sarcocystis infections in cattle and water buffalo in the Son La Province of Northern Vietnam. Meat samples of naturally infected animals were examined by light and electron microscopy as well as by molecular methods. A PCR of part of the 18S rDNA gene followed by RFLP analysis was modified to detect infections with different Sarcocystis spp. in cattle and water buffaloes slaughtered in the Son La Province. It showed to be an economical method to detect multiple infections with Sarcocystis spp. Sequence analysis of the PCR amplicons was performed with selected samples and the results were compared with published sequences. With these methods the following Sarcocystis spp. were identified in cattle: Sarcocystis hirsuta, Sarcocystis cruzi and Sarcocystis hominis. Water buffaloes were infected with Sarcocystis fusiformis, S. cruzi, S. hominis and S. hirsuta. The results indicate that Sarcocystis spp. infecting cattle are also able to infect water buffaloes. So the validity of certain Sarcocystis spp. of water buffalo is discussed. Bovine lifestock in Northern Vietnam were commonly infected with Sarcocystis spp. PMID:19783101

  9. Responses of Single Chorda Tympani Taste Fibers of the Calf (Bos taurus)


    Hellekant, Göran; Roberts, Thomas; Elmer, Donald; Cragin, Tiffany; Danilova, Vicktoria


    In spite of a wealth of information on feed and nutrition in cattle, there little is published of what they actually can taste. Here, we attempt to remedy some of this deficiency by presenting recordings of the chorda tympani proper nerve of young Holstein calves during stimulation of approximately 30 compounds. Hierarchical cluster analysis of 46 single taste fibers separated 4 fiber clusters: N (salt best), H (sour best), and 2 clusters, which could not be related to any human taste quality...

  10. Effect of Ractopamine Hydrochloride and Zilpaterol Hydrochloride on tenderness of longissimus steaks of Bos Taurus steers (United States)

    Objectives: Three experiments were conducted to determine 1) the interaction of ractopamine hydrochloride (RH) inclusion rate (0 or 300 mg·hd-1·d-1 for last 30 to 34 d before harvest) and dietary protein level (13.5 or 17.5% CP) on LM slice shear force (SSF) at 14 d postmortem (Exp. 1); 2) the inter...

  11. Spatial movement of free-roaming cattle (Bos Taurus) when in proximity to wolves (Canis lupus) (United States)

    In 1995 and 1996, 31 wolves were reintroduced into Yellowstone National Park and 35 in central Idaho. These populations have grown to more than 1,500 with more than 835 in Idaho. As wolf populations have grown, so has predation on livestock, complicating cow and ranch management. Our study was de...

  12. Development of a physiologically based pharmacokinetic model for flunixin in cattle (Bos taurus) (United States)

    Violative residues of flunixin in tissues from bob veal calves and cull dairy cows has been attributed to noncompliance with the FDA-approved route of administration and withdrawal time, however, the effect of administration route and physiological differences among animals on tissue residue depleti...

  13. Expression Variants of the Lipogenic AGPAT6 Gene Affect Diverse Milk Composition Phenotypes in Bos taurus


    Littlejohn, Mathew D; Kathryn Tiplady; Thomas Lopdell; Law, Tania A.; Andrew Scott; Chad Harland; Ric Sherlock; Kristen Henty; Vlad Obolonkin; Klaus Lehnert; Alistair Macgibbon; Spelman, Richard J; Stephen R. Davis; Snell, Russell G.


    Milk is composed of a complex mixture of lipids, proteins, carbohydrates and various vitamins and minerals as a source of nutrition for young mammals. The composition of milk varies between individuals, with lipid composition in particular being highly heritable. Recent reports have highlighted a region of bovine chromosome 27 harbouring variants affecting milk fat percentage and fatty acid content. We aimed to further investigate this locus in two independent cattle populations, consisting o...

  14. Responses of single chorda tympani taste fibers of the calf (Bos taurus). (United States)

    Hellekant, Göran; Roberts, Thomas; Elmer, Donald; Cragin, Tiffany; Danilova, Vicktoria


    In spite of a wealth of information on feed and nutrition in cattle, there little is published of what they actually can taste. Here, we attempt to remedy some of this deficiency by presenting recordings of the chorda tympani proper nerve of young Holstein calves during stimulation of approximately 30 compounds. Hierarchical cluster analysis of 46 single taste fibers separated 4 fiber clusters: N (salt best), H (sour best), and 2 clusters, which could not be related to any human taste quality. The N fibers responded best to LiCl, NaCl, urea, monosodium glutamate, and KCl, whereas the H fibers responded strongly to citric and ascorbic acid. Interestingly, propionic and butyric acid stimulated best the 3rd cluster, whereas the 4th cluster responded best to denatonium benzoate and only to a small extent to quinine hydrochloride. Sweeteners stimulated moderately all clusters. Beginning with the largest response to sweet, the order between the responses was: acesulfame-K, saccharin, D-phenylalanine, glycine, sucrose, fructose, erythritol, cyclamate, and lactose. Alitame, aspartame, and super-aspartame evoked no or little responses. Three and 5 M ethanol stimulated all clusters. Comparison with taste fibers in other species suggests that the taste world of cattle is quite different from other species'. PMID:20212013

  15. Bos taurus papillomavirus activity in peripheral blood mononuclear cells: demonstrating a productive infection. (United States)

    Melo, T C; Araldi, R P; Pessoa, N S D; de-Sá-Júnior, P L; Carvalho, R F; Beçak, W; Stocco, R C


    Bovine papillomavirus (BPV) is an oncogenic virus with mucous and epithelial tropism. Possible productive virus infection in other tissues, such as blood, has been hypothesized. In order to investigate this possibility, three samples of skin papillomas and blood were collected from bovines with BPV infection and five samples of peripheral blood and one sample of normal tissue were collected from a calf without BPV infection. Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood and examined by reverse transcription-polymerase chain reaction, immunofluorescence, in situ hybridization, and electron microscopy. The tissue samples were examined for histopathological and immunohistochemical features. The skin papillomas showed the presence of DNA sequences of BPV-2, BPV-11, and a putative virus type. The blood samples showed DNA sequences of BPV-1, 2, and 4 simultaneously. Immunohistochemistry showed BPV L1 protein in both epithelium and stroma and BPV E2 protein in koilocytes. In situ hybridization confirmed the presence of BPV DNA in PBMCs and immunofluorescence showed nuclear labeling of E2 and L1 BPV proteins in PBMCs. The transcription analysis revealed transcripts of BPV-1 L1, BPV-2 L2, and BPV-4 E7 in blood and papilloma samples of BPV-infected cattle. The comet assay revealed high levels of host cell DNA damage upon BPV infection. Electron microscopy analysis of PBMCs identified the presence of particles in the cytoplasm that are consistent with papillomavirus in size and shape. The productive infection of PBMCs with BPV has been previously discussed and this study provides evidence indicating that PBMCs are a target of BPV. PMID:26681018


    DNA markers associated with parasite indicator traits are ideal targets for study of marker assisted selection aimed at controlling infections that reduced herd use of anthelminthics. For this study, we collected fecal egg count (FEC) data from post-weaning animals of an Angus resource population c...

  17. Tick loads in Bos taurus cattle grazing in two contrasting production systems


    Raquel Salazar B; Rolando Barahona-Rosales; María-Solange Sánchez P


    Objectives. To relate the effect of biotic and abiotic factors on Rhipicephalus (Boophilus) microplus tick loads on cows grazing either in intensive silvopastoral systems (ISS) (Lucerna) or in grass pastures associated with sugarcane plantations (La Isabela). Materials and methods. Tick counts were performed on 27 Lucerne breed animals that were in different physiological states, six of which were grazing on forage grass paddocks associated with commercial sugarcane plantations and the remain...

  18. The Effect of Myogenic Factor 5 Polymorphism on the Meat Quality in Chinese Bos Taurus


    J. A. Ujan; Zan, L. S.; Wang, H B; Ujan, S. A.


    In the present study, we evaluated polymorphism of myogenic factor 5, involved in growth and meat quality traits. Based on PCR-SSCP technology, a novel missense substitution SNP (single-nucleotide polymorphism) g.1142 A > G was identified in the intron1 region of the MyF-5 gene, it causes an amino acid substitution (1142Glutamine/ Glycine1142). Allele frequencies, gene heterozygosity, effective allele number and polymorphism information content of the bovine MyF-5 SNP in three population bree...

  19. Novel Features of the Prenatal Horn Bud Development in Cattle (Bos taurus.

    Directory of Open Access Journals (Sweden)

    Dominique Judith Wiener

    Full Text Available Whereas the genetic background of horn growth in cattle has been studied extensively, little is known about the morphological changes in the developing fetal horn bud. In this study we histologically analyzed the development of horn buds of bovine fetuses between ~70 and ~268 days of pregnancy and compared them with biopsies taken from the frontal skin of the same fetuses. In addition we compared the samples from the wild type (horned fetuses with samples taken from the horn bud region of age-matched genetically hornless (polled fetuses. In summary, the horn bud with multiple layers of vacuolated keratinocytes is histologically visible early in fetal life already at around day 70 of gestation and can be easily differentiated from the much thinner epidermis of the frontal skin. However, at the gestation day (gd 212 the epidermis above the horn bud shows a similar morphology to the epidermis of the frontal skin and the outstanding layers of vacuolated keratinocytes have disappeared. Immature hair follicles are seen in the frontal skin at gd 115 whereas hair follicles below the horn bud are not present until gd 155. Interestingly, thick nerve bundles appear in the dermis below the horn bud at gd 115. These nerve fibers grow in size over time and are prominent shortly before birth. Prominent nerve bundles are not present in the frontal skin of wild type or in polled fetuses at any time, indicating that the horn bud is a very sensitive area. The samples from the horn bud region from polled fetuses are histologically equivalent to samples taken from the frontal skin in horned species. This is the first study that presents unique histological data on bovine prenatal horn bud differentiation at different developmental stages which creates knowledge for a better understanding of recent molecular findings.

  20. New Q lineage found in bovine (Bos taurus) of Iberian Peninsula. (United States)

    Lopez-Oceja, Andres; Muro-Verde, Amara; Gamarra, David; Cardoso, Sergio; de Pancorbo, Marian M


    The northern Iberian Peninsula is home to a variety of autochthonous cattle breeds, such as the Terreña and Pirenaica. With the objective of characterizing the matrilineal lineages of these breeds, a study of mitochondrial DNA was performed. The D-loop of 155 individuals was analyzed and most of the individuals were carriers of the T3 haplogroup, while haplogroups T and T1 were much less frequent. A Pirenaica individual belonging to the Q haplogroup was found. To verify the presence of the Q haplogroup individual, the entire mitochondrial DNA was sequenced and compared with two descendants. The individuals were assigned to the Q1 sub-haplogroup. These findings extend the geographic distribution of the Q haplogroup to the south west of the European continent. This new Q1 lineage has seven polymorphisms in the coding region, so this lineage is probably as old as the Q lineages described to date. PMID:26554433

  1. Loss of miRNAs during Processing and Storage of Cow's (Bos taurus)Milk


    Howard, Katherine M; Kusuma, Rio Jati; Baier, Scott R.; Friemel, Taylor; Markham, Laura; Vanamala, Jairam; Zempleni, and Janos


    MicroRNAs (miRs, miRNAs) play central roles in gene regulation. Previously, we reported that miRNAs from somatic cell content, and handling by consumers on the degradation of miRNAs in milk; we also quantified miRNAs in dairy products. Pasteurization and homogenization caused a 63% loss of miR-200c, whereas a 67% loss observed for miR-29b was statistically significant only in skim milk. Effects of cold storage and somatic cell content were quantitatively minor (

  2. Loss of miRNAs during processing and storage of cow's (Bos taurus) milk. (United States)

    Howard, Katherine M; Jati Kusuma, Rio; Baier, Scott R; Friemel, Taylor; Markham, Laura; Vanamala, Jairam; Zempleni, Janos


    MicroRNAs (miRs, miRNAs) play central roles in gene regulation. Previously, we reported that miRNAs from pasteurized, store-bought bovine milk have biological activity in humans. Here, we assessed the effects of milk processing, storage, somatic cell content, and handling by consumers on the degradation of miRNAs in milk; we also quantified miRNAs in dairy products. Pasteurization and homogenization caused a 63% loss of miR-200c, whereas a 67% loss observed for miR-29b was statistically significant only in skim milk. Effects of cold storage and somatic cell content were quantitatively minor (caused a 40% loss of miR-29b but no loss of miR-200c. The milk fat content had no effect on miRNA stability during storage and microwave heating. The concentrations of miRNAs in dairy products were considerably lower than in store-bought milk. We conclude that processing of milk by dairies and handling by consumers causes a significant loss of miRNAs. PMID:25565082

  3. Preweaning performance and body composition of calves from straightbred Nellore and Bos taurus x Nellore crosses. (United States)

    Calegare, L; Alencar, M M; Packer, I U; Leme, P R; Ferrell, C L; Lanna, D P D


    The objectives were to evaluate preweaning performance, body composition, and efficiency of calves representing straightbred Nellore (NL), F(1), and 3-breed-cross systems. Energy requirements, milk production, and efficiency of 39 cow-calf pairs were recorded from straightbred NL calves from NL cows (10), crossbred (Angus-sired) calves from NL cows (ANL: 9), and crossbred calves (CC; Canchim-sired: 5/8 Charolais, 3/8 Zebu) from ANL (10) and Simmental x NL (10) cows. Cows and their respective calves were individually fed from birth to weaning (17 to 190 d postpartum). At 38 d of age, corn silage (7.8% CP, 2.19 Mcal of ME/kg of DM) was available to calves ad libitum. Milk production at 42, 98, 126, and 180 d postpartum was recorded by weighing calves before and after suckling. The ratio between GE and ME of milk was considered 1:0.93. Calves were slaughtered at weaning and the 9th-, 10th-, and 11th-rib section was removed for body composition estimation. The ANL calves were lighter (P body energy - birth body energy) than the NL calves (388 +/- 23 for ANL, and 438 +/- 15 for CC vs. 312 +/- 22 Mcal for NL calves). Percentages of water (P = 0.74) and chemical fat (P = 0.51) were similar among groups (63.7 +/- 0.6 and 14.3 +/- 0.7% for ANL calves, 63.1 +/- 0.4 and 14.7 +/- 0.5% for CC calves, and 63.3 +/- 0.6 and 13.7 +/- 0.7% of empty BW for water and chemical fat, respectively, for NL calves). Energetic efficiency (kcal of retained energy/Mcal of ME intake) was similar (P = 0.52) among groups (358 +/- 22 for ANL calves, 355 +/- 14 for CC calves, and 327 +/- 22 for NL calves). The greater BW gains and the differences in empty body composition at weaning were not enough to compensate for the greater ME intake of crossbreds. In this study, the crossbreeding systems evaluated increased preweaning calf performance but did not affect gross or energetic calf efficiency. PMID:19122045

  4. Bovine Genome Database: supporting community annotation and analysis of the Bos taurus genome

    Directory of Open Access Journals (Sweden)

    Childs Kevin L


    Full Text Available Abstract Background A goal of the Bovine Genome Database (BGD; has been to support the Bovine Genome Sequencing and Analysis Consortium (BGSAC in the annotation and analysis of the bovine genome. We were faced with several challenges, including the need to maintain consistent quality despite diversity in annotation expertise in the research community, the need to maintain consistent data formats, and the need to minimize the potential duplication of annotation effort. With new sequencing technologies allowing many more eukaryotic genomes to be sequenced, the demand for collaborative annotation is likely to increase. Here we present our approach, challenges and solutions facilitating a large distributed annotation project. Results and Discussion BGD has provided annotation tools that supported 147 members of the BGSAC in contributing 3,871 gene models over a fifteen-week period, and these annotations have been integrated into the bovine Official Gene Set. Our approach has been to provide an annotation system, which includes a BLAST site, multiple genome browsers, an annotation portal, and the Apollo Annotation Editor configured to connect directly to our Chado database. In addition to implementing and integrating components of the annotation system, we have performed computational analyses to create gene evidence tracks and a consensus gene set, which can be viewed on individual gene pages at BGD. Conclusions We have provided annotation tools that alleviate challenges associated with distributed annotation. Our system provides a consistent set of data to all annotators and eliminates the need for annotators to format data. Involving the bovine research community in genome annotation has allowed us to leverage expertise in various areas of bovine biology to provide biological insight into the genome sequence.

  5. Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene

    International Nuclear Information System (INIS)

    The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region

  6. Molecular characterization of Cryptosporidium spp. in calves (Bos taurus and Bos indicus in the Formiga city, Minas Gerais - Brazil

    Directory of Open Access Journals (Sweden)

    Roberto César Araujo Lima


    Full Text Available Cryptosporidiosis is a waterborne disease, has as aggravating the difficulty of preventing environmental contamination and lack of effective therapeutic measures. With marked importance to the cattle, causes inflammation and intestinal villous atrophy resulting in loss of absorptive surface. This study aimed to perform molecular characterization of Cryptosporidium spp. in calves in the city of Formiga, Minas Gerais. A total of 300 faeces samples from Holstein calves, Nelore and indefinite breed, both healthy, were evaluated by negative contrast staining technique of malachite green and through the reaction of nested PCR for amplification of DNA fragments of the 18S subunit of the RNA gene ribosomal. Occurrence of 5.33 % ( 16/300 for malachite green and 4.66 % ( 14/300 by PCR was observed, whereas no correlation was found between positive and variables studied. Through molecular characterization were identified Cryptosporidium andersoni and Cryptosporidium ryanae species. In conclusion, we observed a low incidence of infection and elimination of Cryptosporidium spp. oocysts, the absence of clinical signs in animals, strong agreement between the results obtained by the two techniques. Beyond, with the molecular characterization ( nested PCR , species of C. andersoni and C. ryanae were diagnosed in age groups not present in the literature. These two species of Cryptosporidium are described above for the first time parasitizing cattle in the state of Minas Gerais.

  7. Comparison of methanogen diversity of yak (Bos grunniens and cattle (Bos taurus from the Qinghai-Tibetan plateau, China

    Directory of Open Access Journals (Sweden)

    Huang Xiao


    Full Text Available Abstract Background Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from “energy-saving” animal (yak and normal animal (cattle in order to investigate the link between methanogen structure and low methane production. Results Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones and four cattle (205 clones from the Qinghai-Tibetan Plateau area (QTP. Overall, a total of 414 clones (i.e. sequences were examined and assigned to 95 operational taxonomic units (OTUs using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110 was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. Conclusion This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle.

  8. Different true-protein sources do not modify the metabolism of crossbred Bos taurus × Bos indicus growing heifers

    Directory of Open Access Journals (Sweden)

    Diego Azevedo Mota


    Full Text Available The present study was conducted to investigate the effect of alternative true-protein sources to soybean meal, with different ruminal degradability, using a sugarcane-based diet, on nutrient digestion, ruminal fermentation, efficiency of microbial protein synthesis and passage rate in prepubertal dairy heifers. Eight crossbred rumen- and duodenum-cannulated Holstein × Gyr dairy heifers (202.0±11.5 kg BW were evaluated in a 4 × 4 Latin square experimental design with four treatments and four periods in two simultaneous replicates. Dietary treatments were: soybean meal; cottonseed meal; peanut meal; and sunflower meal. When associated with diets containing sugarcane, the different protein sources did not affect intake or digestibility of dry mater, crude protein, organic matter and neutral detergent fiber. The average ruminal pH, NH3-N and concentration of total volatile fatty acids were not different among the diets supplied. The concentration of butyric acid was different among the protein sources, wherein the animals fed the diet with sunflower meal presented lower values than those fed the other sources. Diets did not affect nitrogen balance, microbial nitrogen, microbial synthesisefficiency, estimated dry matter flow, or passage rate. Alternative protein sources can be used to reduce the costs without changing the animal metabolism.

  9. Different true-protein sources do not modify the metabolism of crossbred Bos taurus × Bos indicus growing heifers


    Diego Azevedo Mota; Juliana Duarte Messana; Roberta Carrilho Canesin; Giovani Fiorentini; Alexandre Vaz Pires; Telma Teresinha Berchielli


    The present study was conducted to investigate the effect of alternative true-protein sources to soybean meal, with different ruminal degradability, using a sugarcane-based diet, on nutrient digestion, ruminal fermentation, efficiency of microbial protein synthesis and passage rate in prepubertal dairy heifers. Eight crossbred rumen- and duodenum-cannulated Holstein × Gyr dairy heifers (202.0±11.5 kg BW) were evaluated in a 4 × 4 Latin square experimental design with four treatments and four ...

  10. Evaluation of carcass characteristics of Bos indicus and tropically adapted Bos taurus breeds selected for postweaning weight. (United States)

    Bonilha, S F M; Tedeschi, L O; Packer, I U; Razook, A G; Alleoni, G F; Nardon, R F; Resende, F D


    Data from 9 studies were compiled to evaluate the effects of 20 yr of selection for postweaning weight (PWW) on carcass characteristics and meat quality in experimental herds of control Nellore (NeC) and selected Nellore (NeS), Caracu (CaS), Guzerah (GuS), and Gir (GiS) breeds. These studies were conducted with animals from a genetic selection program at the Experimental Station of Sertãozinho, São Paulo State, Brazil. After the performance test (168 d postweaning), bulls (n = 490) from the calf crops born between 1992 and 2000 were finished and slaughtered to evaluate carcass traits and meat quality. Treatments were different across studies. A meta-analysis was conducted with a random coefficients model in which herd was considered a fixed effect and treatments within year and year were considered as random effects. Either calculated maturity degree or initial BW was used interchangeably as the covariate, and least squares means were used in the multiple-comparison analysis. The CaS and NeS had heavier (P = 0.002) carcasses than the NeC and GiS; GuS were intermediate. The CaS had the longest carcass (P body, carcass, and quarter weights of NeS were similar to those of CaS, NeS had more edible meat in the leg region than did CaS bulls. Selection for PWW increased rib-eye area in Nellore bulls. Selected Caracu had the lowest (most favorable) shear force values compared with the NeS (P = 0.003), NeC (P = 0.005), GuS (P = 0.003), and GiS (P = 0.008). Selection for PWW increased body, carcass, and meat retail weights in the Nellore without altering dressing percentage and body fat percentage. PMID:18407987

  11. Allelic Frequency of Kappa-Casein and Beta-Lactoglobulin in Indian Crossbred (Bos taurus X Bos indicus) Dairy Bulls


    Patel, Rajesh K.; Chauhan, Jenabhai B.; Singh, Krishna M.; Kalpesh J. Soni


    A polymerase chain reaction - restriction fragment length polymorphism test was performed on DNA samples extracted from blood samples of 256 Holstein Friesian crossbred and 112 from Jersey crossbred bulls/bull calves to detect allelic frequency of the bovine kappa-casein and beta-lactoglobulin gene responsible for milk production traits. A 350 bp fragment of kappa-casein and a 247 bp fragment of beta-lactoglobulin were amplified and digested with Hinf I and Hae III restriction enzymes, respec...

  12. Analysis of MOST light curves of five young stars in Taurus-Auriga and Lupus~3 Star Forming Regions

    CERN Document Server

    Siwak, Michal; Matthews, Jaymie M; Kuschnig, Rainer; Guenther, David B; Moffat, Anthony F J; Sasselov, Dimitar; Weiss, Werner W


    Continuous photometric observations of five young stars obtained by the MOST satellite in 2009 and 2010 in the Taurus and Lupus star formation regions are presented. Using light curve modelling under the assumption of internal invariability of spots, we obtained small values of the solar-type differential-rotation parameter (k=0.0005-0.009) for three spotted weak-line T Tau stars, V410 Tau, V987 Tau and Lupus 3-14; for another spotted WTTS, Lupus 3-48, the data are consistent with a rigidly rotating surface (k=0). Three flares of similar rise (4 min 30 sec) and decay (1 h 45 min) times were detected in the light curve of Lupus 3-14. The brightness of the classical T Tau star RY Tau continuously decreased over 3 weeks of its observations with a variable modulation not showing any obvious periodic signal.


    Energy Technology Data Exchange (ETDEWEB)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez [AEGORA Research Group, Universidad Complutense de Madrid, Plaza de Ciencias 3, E-28040 Madrid (Spain); De Castro, Elisa; Cornide, Manuel [Fac. de CC. Físicas, Universidad Complutense de Madrid, Plaza de Ciencias 1, E-28040 Madrid (Spain)


    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions.

  14. Conservation of the Critically Endangered Eastern Australian Population of the Grey Nurse Shark ( Carcharias taurus) Through Cross-Jurisdictional Management of a Network of Marine-Protected Areas (United States)

    Lynch, Tim P.; Harcourt, Robert; Edgar, Graham; Barrett, Neville


    Between 2001 and 2009, 26 marine-protected areas (MPA) were established on the east Australian seaboard, at least in part, to manage human interactions with a critically endangered population of grey nurse shark, Carcharias taurus. This network is spread across six MPA systems and includes all 19 sites outlined in the National Recovery Plan for C. taurus, though five sites remain open to some forms of fishing. The reserve network has complex cross-jurisdictional management, as the sharks occur in waters controlled by the Australian states of New South Wales (NSW) and Queensland, as well as by the Commonwealth (Federal) government. Jurisdiction is further complicated by fisheries and conservation departments both engaging in management activities within each state. This has resulted in protected area types that include IUCN category II equivalent zones in NSW, Queensland, and Commonwealth marine parks that either overlay or complement another large scaled network of protected sites called critical habitats. Across the network, seven and eight rule permutations for diving and fishing, respectively, are applied to this population of sharks. Besides sites identified by the recovery plan, additional sites have been protected as part of the general development of MPA networks. A case study at one of these sites, which historically was known to be occupied by C. taurus but had been abandoned, appears to shows re-establishment of an aggregation of juvenile and sub-adult sharks. Concurrent with the re-establishment of the aggregation, a local dive operator increased seasonal dive visitation rates at the site fourfold. As a precautionary measure, protection of abandoned sites, which includes nursery and gestating female habitats are options that may assist recovery of the east coast population of C. taurus.

  15. Conservation of the critically endangered eastern Australian population of the grey nurse shark (Carcharias taurus) through cross-jurisdictional management of a network of marine-protected areas. (United States)

    Lynch, Tim P; Harcourt, Robert; Edgar, Graham; Barrett, Neville


    Between 2001 and 2009, 26 marine-protected areas (MPA) were established on the east Australian seaboard, at least in part, to manage human interactions with a critically endangered population of grey nurse shark, Carcharias taurus. This network is spread across six MPA systems and includes all 19 sites outlined in the National Recovery Plan for C. taurus, though five sites remain open to some forms of fishing. The reserve network has complex cross-jurisdictional management, as the sharks occur in waters controlled by the Australian states of New South Wales (NSW) and Queensland, as well as by the Commonwealth (Federal) government. Jurisdiction is further complicated by fisheries and conservation departments both engaging in management activities within each state. This has resulted in protected area types that include IUCN category II equivalent zones in NSW, Queensland, and Commonwealth marine parks that either overlay or complement another large scaled network of protected sites called critical habitats. Across the network, seven and eight rule permutations for diving and fishing, respectively, are applied to this population of sharks. Besides sites identified by the recovery plan, additional sites have been protected as part of the general development of MPA networks. A case study at one of these sites, which historically was known to be occupied by C. taurus but had been abandoned, appears to shows re-establishment of an aggregation of juvenile and sub-adult sharks. Concurrent with the re-establishment of the aggregation, a local dive operator increased seasonal dive visitation rates at the site fourfold. As a precautionary measure, protection of abandoned sites, which includes nursery and gestating female habitats are options that may assist recovery of the east coast population of C. taurus. PMID:24213854

  16. VLBA determination of the distance to nearby star-forming regions III. HP Tau/G2 and the three-dimensional structure of Taurus

    CERN Document Server

    Torres, Rosa M; Mioduszewski, Amy J; Rodriguez, Luis F


    Using multi-epoch Very Long Baseline Array observations, we have measured the trigonometric parallax of the weak-line T Tauri star HP Tau/G2 in Taurus. The best fit yields a distance of 161.2 $\\pm$ 0.9 pc, suggesting that the eastern portion of Taurus (where HP Tau/G2 is located) corresponds to the far side of the complex. Previous VLBA observations have shown that T Tau, to the South of the complex, is at an intermediate distance of about 147 pc, whereas the region around L1495 corresponds to the near side at roughly 130 pc. Our observations of only four sources are still too coarse to enable a reliable determination of the three-dimensional structure of the entire Taurus star-forming complex. They do demonstrate, however, that VLBA observations of multiple sources in a given star-forming region have the potential not only to provide a very accurate estimate of its mean distance, but also to reveal its internal structure. The proper motion measurements obtained simultaneously with the parallax allowed us to ...

  17. Herschel/PACS Survey of protoplanetary disks in Taurus/Auriga -- Observations of [OI] and [CII], and far infrared continuum

    CERN Document Server

    Howard, Christian D; Vacca, William D; Duchêne, Gaspard; Mathews, Geoffrey; Augereau, Jean-Charles; Barrado, David; Dent, William R F; Eiroa, Carlos; Grady, Carol; Kamp, Inga; Meeus, Gwendolyn; Ménard, Francois; Pinte, Christophe; Podio, Linda; Riviere-Marichalar, Pablo; Roberge, Aki; Thi, Wing-Fai; Vicente, Silvia; Williams, Jonathan P


    The Herschel Space Observatory was used to observe ~ 120 pre-main-sequence stars in Taurus as part of the GASPS Open Time Key project. PACS was used to measure the continuum as well as several gas tracers such as [OI] 63 \\mu m, [OI] 145 \\mu m, [CII] 158 \\mu m, OH, H2O and CO. The strongest line seen is [OI] at 63 \\mu m. We find a clear correlation between the strength of the [OI] 63 \\mu m line and the 63 \\mu m continuum for disk sources. In outflow sources, the line emission can be up to 20 times stronger than in disk sources, suggesting that the line emission is dominated by the outflow. The tight correlation seen for disk sources suggests that the emission arises from the inner disk ($<$ 50 AU) and lower surface layers of the disk where the gas and dust are coupled. The [OI] 63 \\mu m is fainter in transitional stars than in normal Class II disks. Simple SED models indicate that the dust responsible for the continuum emission is colder in these disks, leading to weaker line emission. [CII] 158 \\mu m emiss...

  18. Evolution of OH and CO-dark Molecular Gas Fraction Across a Molecular Cloud Boundary In Taurus

    CERN Document Server

    Xu, Duo; Yue, Nannan; Goldsmith, Paul F


    We present observations of 12CO J=1-0, 13CO J=1-0, HI, and all four ground-state transitions of the hydroxyl (OH) radical toward a sharp boundary region of the Taurus molecular cloud. Based on a PDR model that reproduces CO and [CI] emission from the same region, we modeled the three OH transitions, 1612, 1665, 1667 MHz successfully through escape probability non-LTE radiative transfer model calculations. We could not reproduce the 1720 MHz observations, due to un-modeled pumping mechanisms, of which the most likely candidate is a C-shock. The abundance of OH and CO-dark molecular gas (DMG) are well constrained. The OH abundance [OH]/[H2] decreases from 8*10-7 to 1*10-7 as Av increases from 0.4 to 2.7 mag, following an empirical law [OH]/[H2]= 1.5 * 10^{-7} + 9.0 * 10^{-7} * exp(-Av/0.81), which is higher than PDR model predictions for low extinction regions by a factor of 80. The overabundance of OH at extinctions at or below 1 mag is likely the result of a C-shock. The dark gas fraction (DGF, defined as fra...


    International Nuclear Information System (INIS)

    We present observations of Taurus-Auriga Class I/II protostars obtained with the Spitzer InfraRed Spectrograph. Detailed spectral fits to the 6 and 15.2 micron ice features are made, using publicly available laboratory data, to constrain the molecular composition, abundances, and levels of thermal processing along the lines of sight. We provide an inventory of the molecular environments observed, which have an average composition dominated by water-ice with ∼12% CO2 (abundance relative to H2O), ∼>2%-9% CH3OH, ∼14% NH3, ∼3% CH4, ∼2% H2CO, ∼0.6% HCOOH, and ∼0.5% SO2. We find CO2/H2O ratios nearly equivalent to those observed in cold clouds and lines of sight toward the galactic center. The unidentified 6.8 micron profiles vary from source to source, and it is shown to be likely that even combinations of the most common candidates (NH+4 and CH3OH) are inadequate to explain the feature fully. We discuss correlations among SED spectral indices, abundance ratios, and thermally processed ice fractions and their implications for CO2 formation and evolution. Comparison of our spectral fits with cold molecular cloud sight lines indicates abundant prestellar ice environments made even richer by the radiative effects of protostars. Our results add additional constraints and a finer level of detail to current full-scale models of protostellar and protoplanetary systems.

  20. Spitzer IRS Observations of Class I/II Objects in Taurus: Composition, Temperature and Thermal History of the Circumstellar Ices

    CERN Document Server

    Zasowski, G; Watson, Dan M; Furlan, E; Bohac, C J; Hull, C; Green, J D


    We present observations of Taurus-Auriga Class I/II protostars obtained with the Spitzer InfraRed Spectrograph. Detailed spectral fits to the 6 and 15 micron features are made, using publicly-available laboratory data, to constrain the molecular composition, abundances, and levels of thermal processing along the lines of sight. We provide an inventory of the molecular environments observed, which have an average composition dominated by water ice with ~12% CO_2 (abundance relative to H_2O), >~2-9% CH_3OH, <~14% NH_3, ~4% CH_4, ~2% H_2CO, ~0.6% HCOOH, and ~0.5% SO_2. We find CO_2/H_2O ratios nearly equivalent to those observed in cold clouds and lines of sight toward the galactic center. The unidentified 6.8 micron profile shapes vary from source to source, and it is shown to be likely that even combinations of the most common candidates (NH_4+ and CH_3OH) are inadequate to explain the feature fully. We discuss correlations among SED spectral indices, abundance ratios, and thermally-processed ice fractions ...

  1. A census of dense cores in the Taurus L1495 cloud from the Herschel Gould Belt Survey

    CERN Document Server

    Marsh, K A; Andre, Ph; Griffin, M J; Konyves, V; Palmeirim, P; Men'shchikov, A; Ward-Thompson, D; Benedettini, M; Bresnahan, D W; Di Francesco, J; Elia, D; Peretto, N; Pezzuto, S; Roy, A; Sadavoy, S; Schneider, N; Spinoglio, L; White, G J


    We present a catalogue of dense cores in a $\\sim 4^\\circ\\times2^\\circ$ field of the Taurus star-forming region, inclusive of the L1495 cloud, derived from Herschel SPIRE and PACS observations in the 70 $\\mu$m, 160 $\\mu$m, 250 $\\mu$m, 350 $\\mu$m, and 500 $\\mu$m continuum bands. Estimates of mean dust temperature and total mass are derived using modified blackbody fits to the spectral energy distributions. We detect 528 starless cores of which $\\sim10$-20% are gravitationally bound and therefore presumably prestellar. Our census of unbound objects is $\\sim85$% complete for $M>0.015\\,M_\\odot$ in low density regions ($A_V\\stackrel{0.1\\,M_\\odot$ overall. The prestellar core mass function (CMF) is consistent with lognormal form, resembling the stellar system initial mass function, as has been reported previously. All of the inferred prestellar cores lie on filamentary structures whose column densities exceed the expected threshold for filamentary collapse, in agreement with previous reports. Unlike the prestellar C...

  2. The genetics of maternal care: direct and indirect genetic effects on phenotype in the dung beetle Onthophagus taurus. (United States)

    Hunt, John; Simmons, Leigh W


    While theoretical models of the evolution of parental care are based on the assumption of underlying genetic variance, surprisingly few quantitative genetic studies of this life-history trait exist. Estimation of the degree of genetic variance in parental care is important because it can be a significant source of maternal effects, which, if genetically based, represent indirect genetic effects. A major prediction of indirect genetic effect theory is that traits without heritable variation can evolve because of the heritable environmental variation that indirect genetic effects provide. In the dung beetle, Onthophagus taurus, females provide care to offspring by provisioning a brood mass. The size of the brood mass has pronounced effects on offspring phenotype. Using a half-sib breeding design we show that the weight of the brood mass females produce exhibits significant levels of additive genetic variance due to sires. However, variance caused by dams is considerably larger, demonstrating that maternal effects are also important. Body size exhibited low additive genetic variance. However, body size exerts a strong maternal influence on the weight of brood masses produced, accounting for 22% of the nongenetic variance in offspring body size. Maternal body size also influenced the number of offspring produced but there was no genetic variance for this trait. Offspring body size and brood mass weight exhibited positive genetic and phenotypic correlations. We conclude that both indirect genetic effects, via maternal care, and nongenetic maternal effects, via female size, play important roles in the evolution of phenotype in this species. PMID:11983863

  3. A Combined Spitzer IRAC/MIPS/IRS and XMM-Newton Survey of the Taurus Molecular Cloud (United States)

    Audard, Marc; Briggs, Kevin; Fajardo-Acosta, Sergio; Glauser, Adrian; Guedel, Manuel; Morris, Patrick; Padgett, Deborah; Rebull, Luisa; Skinner, Stephen; Stapelfedlt, Karl; Wolf, Sebastian


    We propose to mine the Spitzer IRS data archive to complement our Spitzer IRAC/MIPS and XMM-Newton X-ray surveys of the Taurus Molecular Cloud (TMC). We will combine the Spitzer data with those obtained in the X-ray regime with XMM-Newton. Our goals are i) to reconstruct the detailed spectral energy distributions of young stellar objects in TMC. Our disk models will provide a comprehensive description of the circumstellar disks in young stars; ii) to combine infrared dust and gas modeling with X-ray spectroscopy. We will derive estimates of the total gas masses, of gas-to-dust ratios, and of disk surface ionization; iii) to determine the role of X-ray irradiation for heating, ionization, and disk chemistry. The Spitzer IRAC, MIPS, and IRS data in combination with the XMM-Newton data provide a unique opportunity to study in detail the structure and composition of circumstellar disks and envelopes in stars from the deeply embedded stage to the accretion-free stage of weak-lined T Tauri stars, and to determine the role of X-rays in these systems.

  4. Taphonomic implications from Upper Triassic mass flow deposits: 2-dimensional reconstructions of an ammonoid mass occurrence (Carnian, Taurus Mountains, Turkey) (United States)

    Mayrhofer, Susanne; Mayrhofer, Susanne


    Ammonoid mass occurrences of Late Triassic age were investigated in sections from A şağlyaylabel and Yukarlyaylabel, which are located in the Taurus Platform-Units of eastern Turkey. The cephalopod beds are almost monospecific, with > 99.9 % of individuals from the ceratitic genus Kasimlarceltites, which comprises more than hundreds of millions of ammonoid specimens. The ontogenetic composition of the event fauna varies from bed to bed, suggesting that these redeposited shell-rich sediments had different source areas. The geographical extent of the mass occurrence can be traced over large areas up to 10 km2. Each of the Early Carnian (Julian 2) ammonoid mass occurrences signifies a single storm (e.g. storm-wave action) or tectonic event (e.g. earthquake) that caused gravity flows and turbidity currents. Three types of ammonoid accumulation deposits are distinguished by their genesis: 1) matrix-supported floatstones, produced by low density debris flows, 2) mixed floatstones and packstones formed by high density debris flows, and 3) densely ammonoid shell-supported packstones which result from turbidity currents. Two-dimensional calculations on the mass occurrences, based on sectioning, reveal aligned ammonoid shells, implying transport in a diluted sediment. The ammonoid shells are predominantely redeposited, preserved as mixed autochthonous/parautochnonous/ allochthonous communities based on biogenic and sedimentological concentration mechanisms ( = in-situ or post-mortem deposited). This taphonomic evaluation of the Kasimlarceltites beds thus reveals new insights into the environment of deposition of the Carnian section, namely that it had a proximal position along a carbonate platform edge that was influenced by a nearby shallow water regime. The Kasimlarceltites-abundance zone is a marker-zone in the study area, developed during the drowning of a shallow water platform, which can be traceable over long distances.


    International Nuclear Information System (INIS)

    We investigate the environment of the very low luminosity object L1521F-IRS using data from the Taurus Spitzer Legacy Survey. The MIPS 160 μm image shows both extended emission from the Taurus cloud and emission from multiple cold cores over a 10 x 20 region. Analysis shows that the cloud dust temperature is 14.2 ± 0.4 K and the extinction ratio is A 160/AK = 0.010 ± 0.001 up to AV ∼ 4 mag. We find κ160 = 0.23 ± 0.046 cm2 g-1 for the specific opacity of the gas-dust mixture. Therefore, for dust in the Taurus cloud we find that the 160 μm opacity is significantly higher than that measured for the diffuse interstellar medium, but not too different from dense cores, even at modest extinction values. Furthermore, the 160 μm image shows features that do not appear in the IRAS 100 μm image. We identify six regions as cold cores, i.e., colder than 14.2 K, all of which have counterparts in extinction maps or C18O maps. Three of the six cores contain embedded young stellar objects, which demonstrates the cores are sites of current star formation. We compare the effects of L1521F-IRS on its natal core and find there is no evidence for dust heating at 160 or 100 μm by the embedded source. From the infrared luminosity L TIR = 0.024 L sun we find Lbol-int=0.034-0.046 Lodot, thus confirming the source's low luminosity. Comparison of L1521F-IRS with theoretical simulations for the very early phases of star formation appears to rule out the first core collapse phase. The evolutionary state appears similar to or younger than the class 0 phase, and the estimated mass is likely to be substellar.

  6. The JCMT and Herschel Gould Belt Surveys: A comparison of SCUBA-2 and Herschel data of dense cores in the Taurus dark cloud L1495


    Ward-Thompson, Derek; Pattle, Kate; Kirk, Jason; Marsh, Ken; Buckle, Jane; Hatchell, Jennifer; Nutter, David; Griffin, Matt; di Francesco, James; André, Philippe; Beaulieu, Sylvie; Berry, David; Broekhoven-Fiene, Hannah; Currie, Malcolm; Fich, Michel


    We present a comparison of SCUBA-2 850-$\\mu$m and Herschel 70--500-$\\mu$m observations of the L1495 filament in the Taurus Molecular Cloud with the goal of characterising the SCUBA-2 Gould Belt Survey (GBS) data set. We identify and characterise starless cores in three data sets: SCUBA-2 850-$\\mu$m, Herschel 250-$\\mu$m, and Herschel 250-$\\mu$m spatially filtered to mimic the SCUBA-2 data. SCUBA-2 detects only the highest-surface-brightness sources, principally detecting protostellar sources a...

  7. Organic geochemical characteristics and depositional environments of the Jurassic coals in the eastern Taurus of Southern Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Korkmaz, S.; Guelbay, R. Kara [Karadeniz Technical University, Department of Geological Engineering, 61080, Trabzon (Turkey)


    In this study, organic matter content, type and maturity as well as some petrographic and physical characteristics of the Jurassic coals exposed in the eastern Taurus were investigated and their depositional environments were interpreted. The total organic carbon (TOC) contents of coals in the Feke-Akkaya, Kozan-Gedikli and Kozan-Kizilinc areas are 24.54, 66.78 and 49.15%, respectively. The Feke-Akkaya and Kozan-Kizilinc coals have low Hydrogen Index (HI) values while the Kozan-Gedikli coals show moderate HI values. All coal samples display very low Oxygen Index (OI) values. The Kozan-Gedikli coals contain Type II organic matter (OM), the Feke-Akkaya coals contain a mixture of type II and type III OM; and the Kozan-Kizilinc coals are composed of Type III OM. Sterane distribution was calculated as C{sub 27} > C{sub 29} > C{sub 28} from the m/z 217 mass chromatogram for all coal samples. T{sub max} values for the Feke-Akkaya, Kozan-Gedikli and Kozan-Kizilinc coals are 439, 412 and 427 C. Vitrinite reflectance values (%R{sub o}) for the Feke-Akkaya and Kozan-Kizilinc coal samples were measured as 0.65 and 0.51 and these values reveal that the Feke-Akkaya and Kozan-Kizilinc coals are at subbituminous A or high volatile C bituminous coal stage. On the basis of biomarker maturity parameters, these coals have a low maturity. The pristane/phytane (Pr/Ph) ratios for the Feke-Akkaya, Kozan-Gedikli and Kozan-Kizilinc coals are 1.53, 1.13 and 1.25, respectively. In addition, all coals show a homohopane distribution which is dominated by low carbon numbers, and C{sub 35} homohopane index is very low for all coal samples. All these features may indicate that these coals were deposited in a suboxic environment. The high sterane/hopane ratios with high concentrations of steranes, low Pr/Ph ratios and C{sub 25}/C{sub 26} tricyclic ratios > 1 may indicate that these coals formed in a swamp environment were temporarily influenced by marine conditions. (author)

  8. The Transitional Protoplanetary Disk Frequency as a Function of Age: Disk Evolution in the Coronet Cluster, Taurus, and Other 1--8 Myr-old Regions (United States)

    Currie, Thayne; Sicilia-Aguilar, Auora


    We present Spitzer 3.6-24 micron photometry and spectroscopy for stars in the 1-3 Myr-old Coronet Cluster, expanding upon the survey of Sicilia-Aguilar et al. (2008). Using sophisticated radiative transfer models, we analyze these new data and those from Sicilia-Aguilar et al. (2008) to identify disks with evidence for substantial dust evolution consistent with disk clearing: transitional disks. We then analyze data in Taurus and others young clusters - IC 348, NGC 2362, and eta Cha -- to constrain the transitional disk frequency as a function of time. Our analysis confirms previous results finding evidence for two types of transitional disks -- those with inner holes and those that are homologously depleted. The percentage of disks in the transitional phase increases from approx.15-20% at 1-2 Myr to > 50% at 5-8 Myr; the mean transitional disk lifetime is closer to approx. 1 Myr than 0.1-0.5 Myr, consistent with previous studies by Currie et al. (2009) and Sicilia-Aguilar et al. (2009). In the Coronet Cluster and IC 348, transitional disks are more numerous for very low-mass M3--M6 stars than for more massive K5-M2 stars, while Taurus lacks a strong spectral type-dependent frequency. Assuming standard values for the gas-to-dust ratio and other disk properties, the lower limit for the masses of optically-thick primordial disks is Mdisk approx. 0.001-0.003 M*. We find that single color-color diagrams do not by themselves uniquely identify transitional disks or primordial disks. Full SED modeling is required to accurately assess disk evolution for individual sources and inform statistical estimates of the transitional disk population in large samples using mid-IR colors.

  9. Detection of Sarcocystis spp. in cattle (Bos taurus) and water buffaloes (Bubalus bubalis) in Iran by PCR-RFLP. (United States)

    Hamidinejat, Hossein; Razi Jalali, Mohammad Hossein; Gharibi, Darioush; Molayan, Pedram Haddad


    Sarcocystis species are cyst-forming intracellular protozoan parasites. Cattle are mainly infected with Sarcocystis cruzi, Sarcocystis hominis and Sarcocystis hirsuta. Water buffaloes are intermediate hosts for Sarcocystis fusiformis, Sarcocystis levinei (S. cruzi-like species), Sarcocystis dubeyi, Sarcocystis sinensis (S. hominis-like species) and Sarcocystis buffalonis (S. hirsuta- like species). The aim of this study was Identification of Sarcocystis spp. in slaughtered cattle and water buffaloes in Ahvaz, Khuzestan province by PCR-restriction fragment length polymorphism. Meat inspection was done on 124 cattle and 147 water buffaloes. From each animal tissue samples (each 50 g) from heart, esophagus, diaphragm and intercostal muscle were collected during meat inspection. Samples examined with digestion method. Genomic DNA of 80 positive samples was extracted and their 18S rRNA gene was amplified. PCR products were digested by restricted enzymes (FokI, SspI and DraI). S. cruzi in cattle and S. fusiformis in water buffaloes were identified. Our study clarified that sarcocystosis in cattle in Ahvaz district may be results acute infection according to determined species, but in buffaloes as S. fusiformis was detected we may expect only economic loss follow up slaughterhouse inspection. PMID:26688630

  10. Comparative proteomics and transcriptomics analyses of livers from two different Bos taurus breeds: "Chianina and Holstein Friesian". (United States)

    Timperio, Anna Maria; D'Alessandro, Angelo; Pariset, Lorraine; D'Amici, Gian Maria; Valentini, Alessio; Zolla, Lello


    The Holstein Friesian and Chianina cattle breeds are representative of extreme selection for milk and meat traits, respectively, with significant changes in metabolism resulting from human selection over the past centuries. In the present study, we wanted to assess whether selection for different purposes has had a measurable effect on liver metabolism through a comparison of the protein and gene expression profiles of the two breeds. We applied 2-DE in order to identify proteins which were differentially expressed in the livers of the two breeds and relate them to different liver functions. We expected to find that only a small number of proteins would be differentially expressed, due to the relatively short phylogenetic distance between these cattle breeds. Nonetheless, thirty nine differentially-expressed proteins were characterized between Chianina and Holstein Friesian, out of a total of 560+/-57 spots that matched. Microarray analyses evidenced the differential expression of 167 genes (148 for the Holstein Friesian and 19 for the Chianina). Despite being closely related at the genetic level, the disparity of the proteomic and transcriptomic profiles of these two breeds allows us to perform pathway analysis thus to pinpoint proteins whose expression might render the latter capable of greater milk production, or proteins involved in altered thermoregulatory ability or hormone production. On the other hand, we found proteins and gene transcripts in Chianina, not expressed in Holstein, which, upon interaction pathway analysis, were mainly involved in anabolic pathways. In brief, our integrated study provides molecular evidences to support the physiological differences between Holstein and Chianina cattle breeds. PMID:19782776

  11. The Agersoe cattle: the last remnants of the Danish island cattle (Bos taurus)?

    DEFF Research Database (Denmark)

    Withen, K B; Brüniche-Olsen, A; Pedersen, B.V.;


    A phenotypically interesting strain of cattle existed on the small island of Agersoe, on the west coast of Zealand, Denmark, in the beginning of the last decade. The cattle share a great resemblance to the extinct Danish breed, the Island cattle. The objective of this study was to genetically...... characterize the Agersoe cattle, using microsatellites, amplified fragment length polymorphism (AFLP) and mtDNA markers, and analyse the genetic variability within the breed and the genetic relationship to 14 European breeds with focus on the Red Danish and Jutland breed. The results show diversity in nuclear...... breeds. Several arguments based on this survey have been put forward in favour of characterizing the Agersoe cattle as being the last remnants of the Danish Island Cattle...

  12. The polymorphisms of bovine cocaine- and amphetamine-regulated transcripts and their associations with cattle (Bos taurus) growth traits

    Indian Academy of Sciences (India)

    Chun Lei Zhang; Hong Chen; Yan Hong Wang; Xian Yong Lan; Chu Zhao Lei; Xing Tang Fang


    We investigated the polymorphisms of bovine cocaine- and amphetamine-regulated transcripts (CART). The coding and regulating regions of CART were screened in 7 cattle breeds by the single-stranded conformation polymorphism (SSCP) technique. The four loci (C1, C2, C3 and C4) studied were all polymorphic. Polymerase chain reaction (PCR) products representing different SSCP variants were sequenced and a total of 9 single-nucleotide polymorphisms (SNPs) were found. The associations between polymorphic loci and the growth traits of Nanyang cattle were analysed. The results indicated that genotype A1A1 of the C1 locus was associated with a higher body weight ( < 0.05) than heterozygous A1B1. Genotype A2A2 of the C2 locus was associated with lower body weight and average daily weight gain ( ≤ 0.001) than heterozygous A2B2. C3 and C4 loci had no significant effect on Nanyang cattle growth traits (P > 0.05).

  13. Association of CAPN1 and CAST gene polymorphisms with meat tenderness in Bos taurus beef cattle from Argentina


    Pablo Corva; Liliana Soria; Alejandro Schor; Edgardo Villarreal; Macarena Pérez Cenci; Mariana Motter; Carlos Mezzadra; Lilia Melucci; Cristina Miquel; Enrique Paván; Gustavo Depetris; Francisco Santini; Juan Grigera Naón


    The activity of the calpains/calpastatin proteolytic system is closely related to the postmortem tenderization of meat. We investigated the association between beef tenderness and single nucleotide polymorphism (SNP) markers on the CAPN1 gene (SNP316, alleles C/G; SNP530 alleles A/G) and the CAST gene 3' untranslated region (SNP2870, alleles A/G). We sampled nine slaughter groups comprising 313 steers which had been reared in beef production systems in Argentina between 2002 and 2004 from cro...

  14. Association of CAPN1 and CAST gene polymorphisms with meat tenderness in Bos taurus beef cattle from Argentina

    Directory of Open Access Journals (Sweden)

    Pablo Corva


    Full Text Available The activity of the calpains/calpastatin proteolytic system is closely related to the postmortem tenderization of meat. We investigated the association between beef tenderness and single nucleotide polymorphism (SNP markers on the CAPN1 gene (SNP316, alleles C/G; SNP530 alleles A/G and the CAST gene 3' untranslated region (SNP2870, alleles A/G. We sampled nine slaughter groups comprising 313 steers which had been reared in beef production systems in Argentina between 2002 and 2004 from crosses between Angus, Hereford and Limousin cattle. Minor allele frequencies for the markers were 0.27 to 0.46 (C, 0.02 to 0.18 (A, and 0.24 to 0.53 (A, respectively. The presence of CAPN1 markers had significant effects on meat shear force but no detectable effects were demonstrated for the CAST marker. The shear force of meat from steers with the SNP316 CC genotype was 11% lower than for the SNP316 CG genotype and 17% lower than for the SNP316 GG genotype. There were very few steers with the SNP530 AA genotype and, contrary to previous studies, meat from steers with the SNP530 GG genotype showed an 11.5% higher shear force than that from steers with the SNP530 GA genotype. Final body weight, carcass weight and rib eye area were not affected by any of the markers. These results support the concept that CAPN1 variants are associated with tenderness across a wide range of beef production systems.

  15. Predicting wolf (Canis lupus)-cattle (Bos Taurus) encounters and consequential effects on cattle resource selection patterns (United States)

    The gray wolf population in Idaho has grown dramatically from the original 35 reintroduced individuals in 1995-1996 to 94 documented packs and a minimum population of 835 individuals in 2009. Wolf depredation on livestock has also increased dramatically with this population growth. Substantial spa...

  16. Accumulation and detoxification of metals and arsenic in tissues of cattle (Bos taurus), and the risks for human consumption

    Energy Technology Data Exchange (ETDEWEB)

    Roggeman, Saskia, E-mail: [Laboratory for Systemic Physiological and Ecotoxicological Research (SPHERE), Department of Biology, University of Antwerp, Groenenborgerlaan 171/U7, 2020 Antwerp (Belgium); de Boeck, Gudrun [Laboratory for Systemic Physiological and Ecotoxicological Research (SPHERE), Department of Biology, University of Antwerp, Groenenborgerlaan 171/U7, 2020 Antwerp (Belgium); De Cock, Hilde [General Medical Laboratory (Medvet/AML), Department of Pathology, Emiel Vloorsstraat 9, 2020 Antwerpen (Belgium); Blust, Ronny; Bervoets, Lieven [Laboratory for Systemic Physiological and Ecotoxicological Research (SPHERE), Department of Biology, University of Antwerp, Groenenborgerlaan 171/U7, 2020 Antwerp (Belgium)


    The aim of this study was to investigate metal accumulation and detoxification processes in cattle from polluted and unpolluted areas. Therefore dairy cows from farms and free ranging Galloway cows from nature reserves were used as study animals. The concentrations of Ag, Cd, Pb, Al, Cr, Mn, Fe, Co, Ni, Cu, Zn and As were determined in muscle, kidney, liver and lungs of cattle from polluted and reference areas in Belgium. In kidney and liver also the metallothionein concentrations were measured. For Ag, Mn, Co, Cu, Zn and As the concentrations in the different tissues were significantly higher in the sampled Galloways than in the sampled dairy cows. On the other hand Cd and Pb were significantly higher in tissues of both cattle breeds from polluted sites. Cadmium seemed to be the most important metal for metallothionein induction in kidneys whereas Zn seemed to be the most important metal for the induction of metallothionein in the liver. This study also suggested that only for Mn and Cd a significant part of the uptake occurs via the lungs. Although in muscle none of the Cd and Pb levels exceeded the European limits for human consumption, 40% of the livers and 85% of the kidneys of all examined cows were above the European limit for cadmium. Based on the existing minimum risk levels (MRLs) for chronic oral exposure, the present results suggested that a person of 70 kg should not eat more than 150 g cow meat per day because of the Cr levels in the muscles. - Highlights: •Cadmium induced metallothionein in kidney while Zn induced metallothionein in liver. •For Mn and Cd a significant part of the uptake happens via the lungs. •40% of the livers and 85% of the kidneys exceeded the European limit for cadmium. •A person of 70 kg should not eat more than 150 g bovine meat per day.

  17. In-Depth Characterization of Sheep (Ovis aries) Milk Whey Proteome and Comparison with Cow (Bos taurus)


    Minh Ha; Manya Sabherwal; Elizabeth Duncan; Stewart Stevens; Peter Stockwell; Michelle McConnell; Alaa El-Din Bekhit; Alan Carne


    An in-depth proteomic study of sheep milk whey is reported and compared to the data available in the literature for the cow whey proteome. A combinatorial peptide ligand library kit (ProteoMiner) was used to normalize protein abundance in the sheep whey proteome followed by an in-gel digest of a 1D-PAGE display and an in-solution digestion followed by OFFGEL isoelectric focusing fractionation. The peptide fractions obtained were then analyzed by LC-MS/MS. This enabled identification of 669 pr...

  18. In-Depth Characterization of Sheep (Ovis aries Milk Whey Proteome and Comparison with Cow (Bos taurus.

    Directory of Open Access Journals (Sweden)

    Minh Ha

    Full Text Available An in-depth proteomic study of sheep milk whey is reported and compared to the data available in the literature for the cow whey proteome. A combinatorial peptide ligand library kit (ProteoMiner was used to normalize protein abundance in the sheep whey proteome followed by an in-gel digest of a 1D-PAGE display and an in-solution digestion followed by OFFGEL isoelectric focusing fractionation. The peptide fractions obtained were then analyzed by LC-MS/MS. This enabled identification of 669 proteins in sheep whey that, to our knowledge, is the largest inventory of sheep whey proteins identified to date. A comprehensive list of cow whey proteins currently available in the literature (783 proteins from unique genes was assembled and compared to the sheep whey proteome data obtained in this study (606 proteins from unique genes. This comparison revealed that while the 233 proteins shared by the two species were significantly enriched for immune and inflammatory responses in gene ontology analysis, proteins only found in sheep whey in this study were identified that take part in both cellular development and immune responses, whereas proteins only found in cow whey in this study were identified to be associated with metabolism and cellular growth.

  19. Accumulation and detoxification of metals and arsenic in tissues of cattle (Bos taurus), and the risks for human consumption

    International Nuclear Information System (INIS)

    The aim of this study was to investigate metal accumulation and detoxification processes in cattle from polluted and unpolluted areas. Therefore dairy cows from farms and free ranging Galloway cows from nature reserves were used as study animals. The concentrations of Ag, Cd, Pb, Al, Cr, Mn, Fe, Co, Ni, Cu, Zn and As were determined in muscle, kidney, liver and lungs of cattle from polluted and reference areas in Belgium. In kidney and liver also the metallothionein concentrations were measured. For Ag, Mn, Co, Cu, Zn and As the concentrations in the different tissues were significantly higher in the sampled Galloways than in the sampled dairy cows. On the other hand Cd and Pb were significantly higher in tissues of both cattle breeds from polluted sites. Cadmium seemed to be the most important metal for metallothionein induction in kidneys whereas Zn seemed to be the most important metal for the induction of metallothionein in the liver. This study also suggested that only for Mn and Cd a significant part of the uptake occurs via the lungs. Although in muscle none of the Cd and Pb levels exceeded the European limits for human consumption, 40% of the livers and 85% of the kidneys of all examined cows were above the European limit for cadmium. Based on the existing minimum risk levels (MRLs) for chronic oral exposure, the present results suggested that a person of 70 kg should not eat more than 150 g cow meat per day because of the Cr levels in the muscles. - Highlights: •Cadmium induced metallothionein in kidney while Zn induced metallothionein in liver. •For Mn and Cd a significant part of the uptake happens via the lungs. •40% of the livers and 85% of the kidneys exceeded the European limit for cadmium. •A person of 70 kg should not eat more than 150 g bovine meat per day

  20. Differences in PAR-2 activating potential by king crab (Paralithodes camtschaticus), salmon (Salmo salar), and bovine (Bos taurus) trypsin


    Larsen, Anett Kristin; Kristiansen, Kurt; Sylte, Ingebrigt; Seternes, Ole Morten; Bang, Berit


    Background: Salmon trypsin is shown to increase secretion of the pro-inflammatory cytokine interleukin (IL)-8 from human airway epithelial cells through activation of PAR-2. Secretion of IL-8 induced by king crab trypsin is observed in a different concentration range compared to salmon trypsin, and seems to be only partially related to PAR-2 activation. This report aim to identify differences in the molecular structure of king crab trypsin (Paralithodes camtschaticus) compared to salmon (S...

  1. Influencia del encierro en la respuesta fisiológica del toro (Bos Taurus, L.) durante la lidia


    Salamanca Llorente, Francisco


    La raza bovina de lidia dispone de una serie de particularidades, en su producción, manejo, selección y comportamiento que la hacen única en el mundo. La raza dispone de un censo aproximado a los 251.000 ejemplares (Lomillos et al, 2012), de los que derivan las reses que demandan los 16.000 espectáculos taurinos (de plaza de toros y populares), que se celebran cada año en España (Ministerio del Interior, 2010). El sector taurino mantiene una cifra cercana a los 200.000 puestos de trabajo y ge...

  2. Localisation of aphidicolin-induced break points in Holstein-Friesian cattle (Bos taurus using RBG-banding

    Directory of Open Access Journals (Sweden)

    Mernies Beatriz


    Full Text Available Abstract Fragile sites (FS seem to play a role in genome instability and may be involved in karyotype evolution and chromosome aberrations. The majority of common fragile sites are induced by aphidicolin. Aphidicolin was used at two different concentrations (0.15 and 0.30 μM to study the occurrence of FS in the cattle karyotype. In this paper, a map of aphidicolin induced break points and fragile sites in cattle chromosomes was constructed. The statistical analysis indicated that any band with three or more breaks was significantly damaged (P r = 0.54. On the contrary, 21 FS were identified on negative R bands while 9 FS were located on positive R bands.

  3. Effects of Stocking Density or Group Size on Intake, Growth, and Meat Quality of Hanwoo Steers (Bos taurus coreanae)


    Lee, Sang Moo; Kim, Jae Yeon; Kim, Eun Joong


    This study was conducted to investigate the effects of stocking density or group size on feed intake, daily gain, and carcass characteristics of Hanwoo (Korean indigenous breed) steers reared from 7 months to 31 months of age. Thirty Hanwoo steers were divided into four groups with three replicates each (a total of 12 pens). In each group, one (G1), two (G2), three (G3), and four steers (G4) per pen were allocated as treatments. Pen size was 32.0 m2, and therefore Hanwoo steers in G1, G2, G3,...

  4. Effects of Stocking Density or Group Size on Intake, Growth, and Meat Quality of Hanwoo Steers (Bos taurus coreanae). (United States)

    Lee, Sang Moo; Kim, Jae Yeon; Kim, Eun Joong


    This study was conducted to investigate the effects of stocking density or group size on feed intake, daily gain, and carcass characteristics of Hanwoo (Korean indigenous breed) steers reared from 7 months to 31 months of age. Thirty Hanwoo steers were divided into four groups with three replicates each (a total of 12 pens). In each group, one (G1), two (G2), three (G3), and four steers (G4) per pen were allocated as treatments. Pen size was 32.0 m(2), and therefore Hanwoo steers in G1, G2, G3, and G4 were reared under different space allowances, i.e. 32.0, 16.0, 10.6, and 8.0 m(2)/steer, respectively. Steers were reared following a conventional beef cattle management method in Korea, and were offered a fixed amount of commercial concentrate with ad libitum forages. Results were subjected to analysis of variance with stocking density as the main effect, and significance was declared at pmeat yield index, and meat yield grade were similar among all levels of stocking density. However, longissimus muscle area was larger in G1 and G2 (pquality traits, including marbling score, meat color, fat color, texture, maturity and meat quality grade, as determined by a group of experts, were not significantly different among the treatments. In conclusion, lower stocking density resulted in increased feed efficiency, daily gain, and carcass weight in Hanwoo steers. However it remains unclear whether such differences are the results of stocking density or group size, or a combination of both. Nonetheless, these results confirm previous studies reporting a negative effect of increased stocking density on animal productivity. Further, animal welfare under an intensive farming system in relation to economical return is discussed. PMID:25049516

  5. Patterns of cell proliferation and apoptosis by topographic region in normal Bos taurus vs. Bos indicus crossbreeds bovine placentae during pregnancy

    Directory of Open Access Journals (Sweden)

    Ambrósio Carlos E


    Full Text Available Abstract Background Placental and fetal growth requires high rates of cellular turnover and differentiation, which contributes to conceptus development. The trophoblast has unique properties and a wide range of metabolic, endocrine and angiogenic functions, but the proliferative profile of the bovine placenta characterized by flow cytometry analysis and its role in fetal development are currently uncharacterized. Complete understanding of placental apoptotic and proliferative rates may be relevant to development, especially if related to the pathogenesis of pregnancy losses and placental abnormalities. Methods In this study, the proliferation activity and apoptosis in different regions of normal bovine placenta (central and boundary regions of placentomes, placentomal fusion, microplacentomes, and interplacentomal regions, from distinct gestation periods (Days 70 to 290 of pregnancy, were analyzed by flow cytometry. Results Our results indicated that microplacentomes presented a lower number of apoptotic cells throughout pregnancy, with a higher proliferative activity by the end of gestation, suggesting that such structures do not contribute significantly to normal of placental functions and conceptus development during pregnancy. The placentome edges revealed a higher number of apoptotic cells from Day 170 on, which suggests that placentome detachment may well initiate in this region. Conclusion Variations involving proliferation and apoptotic rates may influence placental maturation and detachment, compromising placental functions and leading to fetal stress, abnormalities in development and abortion, as frequently seen in bovine pregnancies from in vitro fertilization and cloning procedures. Our findings describing the pattern of cell proliferation and apoptosis in normal bovine pregnancies may be useful for unraveling some of the developmental deviations seen in nature and after in vitro embryo manipulations.

  6. Detection of quantitative trait loci for growth and beef carcass fatness traits in a cross between Bos taurus (Angus) and Bos indicus (Brahman) cattle. (United States)

    Kim, J J; Farnir, F; Savell, J; Taylor, J F


    This study was conducted to detect quantitative trait loci (QTL) affecting growth and beef carcass fatness traits in an experimental population of Angus and Brahman crossbreds. The three-generation mapping population was generated with 602 progeny from 29 reciprocal backcross and three F2 full-sib families, and 417 genetic markers were used to produce a sex-averaged map of the 29 autosomes spanning 2,642.5 Kosambi cM. Alternative interval-mapping approaches were applied under line-cross (LC) and random infinite alleles (RA) models to detect QTL segregating between and within breeds. A total of 35 QTL (five with genomewide significant and 30 with suggestive evidence for linkage) were found on 19 chromosomes. One QTL affecting yearling weight was found with genomewide significant evidence for linkage in the interstitial region of bovine autosome (BTA) 1, and an additional 19 QTL were detected with suggestive evidence for linkage under the LC model. Many of these QTL had a dominant (complete or overdominant) mode of gene action, and only a few of the QTL were primarily additive, which reflects the fact that heterosis for growth is known to be appreciable in crosses among Brahman and British breeds. Four QTL affecting growth were detected with genomewide significant evidence for linkage under the RA model on BTA 2 and BTA 6 for birth weight, BTA 5 for yearling weight, and BTA 23 for hot carcass weight. An additional 11 QTL were detected with suggestive evidence for linkage under the RA model. None of the QTL (except for yearling weight on BTA 5) detected under the RA model were found by the LC analyses, suggesting the segregation of alternate alleles within one or both of the parental breeds. Our results reveal the utility of implementing both the LC and RA models to detect dominant QTL and also QTL with similar allele frequency distributions within parental breeds. PMID:12926775

  7. Preweaning growth of Angus- (Bos taurus), Brahman- (Bos indicus), and Tuli- (Sanga) sired calves and reproductive performance of their Brahman dams. (United States)

    Browning, R; Leite-Browning, M L; Neuendorff, D A; Randel, R D


    Calves born to Angus (A), Brahman (B), or Tuli (T) bulls and B cows were evaluated to determine sire breed of calf effects on preweaning calf growth and reproductive performance of their dams. Records from 242 cow-calf pairs over 2 yr were used to assess birth weight, calf ADG, weaning weight, gestation length, and postpartum interval to estrus (PPI). The sire breed x sex of calf interaction was important (P Angus-sired F1 calves and similar to straightbred Brahman calves in preweaning growth. Crossbred calves had shorter gestations but longer postpartum intervals than purebred calves. PMID:8582844

  8. Purebred-crossbred performance and genetic evaluation of postweaning growth and carcass traits in Bos indicus x Bos taurus crosses in Australia. (United States)

    Newman, S; Reverter, A; Johnston, D J


    Growth and carcass data on 7,154 cattle from a purebred project and 1,241 cattle from a crossbred project, comprising 916 first-crosses and 325 purebred Brahman controls, were analyzed to estimate genetic parameters, including the genetic correlations between purebred and crossbred performance (rpc). The data also allowed the estimation of sire breed means for various growth and carcass traits. Crossbred calves were produced using 9 Angus, 8 Hereford, 7 Shorthorn, 14 Belmont Red, and 8 Santa Gertrudis sires bred to Brahman dams. These same sires produced 1,568 progeny in a separate purebreeding project. Cattle in both projects were managed under two finishing regimens (pasture and feedlot) to representative market live weights of 400 (domestic), 520 (Korean), and 600 kg (Japanese). The traits studied included live weight at around 400 d of age (400W), hot carcass weight (CWT), retail beef yield percentage (RBY), intramuscular fat percentage (IMF), rump fat depth (P8), and preslaughter ultrasound scanned eye muscle area (SEMA). Estimated breeding values (EBV) of sires from their BREEDPLAN genetic evaluations were used to assess their value in predicting crossbred performance. Regressions of actual crossbred calf performance on sire EBV for each of the traits differed little from their expectation of 0.5. Angus sires produced crossbred carcasses with the highest P8 and lowest RBY but highest IMF. In contrast, crossbred progeny from Belmont Red sires had the lightest 400W and CWT, lowest P8, and highest RBY. Estimates of rpc were 0.48, 0.48, 0.83, 0.95, 1.00, and 0.78 for 400W, CWT, RBY, IMF, P8, and SEMA, respectively. Commercial breeders selecting sires for crossbreeding programs with Brahman females, based on EBV computed from purebred data, might encounter some reranking of sire's performance for weight-related traits, with little expected change in carcass traits. PMID:12162647

  9. The JCMT and Herschel Gould Belt Surveys: A comparison of SCUBA-2 and Herschel data of dense cores in the Taurus dark cloud L1495

    CERN Document Server

    Ward-Thompson, Derek; Kirk, Jason; Marsh, Ken; Buckle, Jane; Hatchell, Jennifer; Nutter, David; Griffin, Matt; Di Francesco, James; André, Philippe; Beaulieu, Sylvie; Berry, David; Broekhoven-Fiene, Hannah; Currie, Malcolm; Fich, Michel; Jenness, Timothy; Johnstone, Doug; Kirk, Helen; Mottram, Joseph; Pineda, Jaime; Quinn, Ciera; Sadavoy, Sarah; Salji, Carl; Tisi, Sam; Walker-Smith, Sarah; White, Glenn; Hill, Tracey; Könyves, Vera; Palmeirim, Pedro; Pezzuto, Stefano


    We present a comparison of SCUBA-2 850-$\\mu$m and Herschel 70--500-$\\mu$m observations of the L1495 filament in the Taurus Molecular Cloud with the goal of characterising the SCUBA-2 Gould Belt Survey (GBS) data set. We identify and characterise starless cores in three data sets: SCUBA-2 850-$\\mu$m, Herschel 250-$\\mu$m, and Herschel 250-$\\mu$m spatially filtered to mimic the SCUBA-2 data. SCUBA-2 detects only the highest-surface-brightness sources, principally detecting protostellar sources and starless cores embedded in filaments, while Herschel is sensitive to most of the cloud structure, including extended low-surface-brightness emission. Herschel detects considerably more sources than SCUBA-2 even after spatial filtering. We investigate which properties of a starless core detected by Herschel determine its detectability by SCUBA-2, and find that they are the core's temperature and column density (for given dust properties). For similar-temperature cores, such as those seen in L1495, the surface brightness...

  10. Taurus II Stage Test Simulations: Using Large-Scale CFD Simulations to Provide Critical Insight into Plume Induced Environments During Design (United States)

    Struzenberg, L. L.; West, J. S.


    This paper describes the use of targeted Loci/CHEM CFD simulations to evaluate the effects of a dual-engine first-stage hot-fire test on an evolving integrated launch pad/test article design. This effort was undertaken as a part of the NESC Independent Assessment of the Taurus II Stage Test Series. The underlying conceptual model included development of a series of computational models and simulations to analyze the plume induced environments on the pad, facility structures and test article. A pathfinder simulation was first developed, capable of providing quick-turn around evaluation of plume impingement pressures on the flame deflector. Results from this simulation were available in time to provide data for an ongoing structural assessment of the deflector. The resulting recommendation was available in a timely manner and was incorporated into construction schedule for the new launch stand under construction at Wallops Flight Facility. A series of Reynolds-Averaged Navier-Stokes (RANS) quasi-steady simulations representative of various key elements of the test profile was performed to identify potential concerns with the test configuration and test profile. As required, unsteady Hybrid-RANS/LES simulations were performed, to provide additional insight into critical aspects of the test sequence. Modifications to the test-specific hardware and facility structures thermal protection as well as modifications to the planned hot-fire test profile were implemented based on these simulation results.

  11. An Ammonia Spectral Map of the L1495-B218 Filaments in the Taurus Molecular Cloud : I. Physical Properties of Filaments and Dense cores

    CERN Document Server

    Seo, Young Min; Goldsmith, Paul; Ward-Thompson, Derek; Kirk, Jason M; Schmalzl, Markus; Lee, Jeong-Eun; Friesen, Rachel; Langston, Glen; Masters, Joe; Garwood, Robert W


    We present deep NH$_3$ observations of the L1495-B218 filaments in the Taurus molecular cloud covering over a 3 degree angular range using the K-band focal plane array on the 100m Green Bank Telescope. The L1495-B218 filaments form an interconnected, nearby, large complex extending over 8 pc. We observed NH$_3$ (1,1) and (2,2) with a spectral resolution of 0.038 km/s and a spatial resolution of 31$"$. Most of the ammonia peaks coincide with intensity peaks in dust continuum maps at 350 $\\mu$m and 500 $\\mu$m. We deduced physical properties by fitting a model to the observed spectra. We find gas kinetic temperatures of 8 $-$ 15 K, velocity dispersions of 0.05 $-$ 0.25 km/s, and NH$_3$ column densities of 5$\\times$10$^{12}$ $-$ 1$\\times$10$^{14}$ cm$^{-2}$. The CSAR algorithm, which is a hybrid of seeded-watershed and binary dendrogram algorithms, identifies a total of 55 NH$_3$ structures including 39 leaves and 16 branches. The masses of the NH$_3$ sources range from 0.05 M$_\\odot$ to 9.5 M$_\\odot$. The masses...

  12. The JCMT and Herschel Gould Belt Surveys: A comparison of SCUBA-2 and Herschel data of dense cores in the Taurus dark cloud L1495 (United States)

    Ward-Thompson, D.; Pattle, K.; Kirk, J. M.; Marsh, K.; Buckle, J.; Hatchell, J.; Nutter, D. J.; Griffin, M. J.; Di Francesco, J.; André, P.; Beaulieu, S.; Berry, D.; Broekhoven-Fiene, H.; Currie, M.; Fich, M.; Jenness, T.; Johnstone, D.; Kirk, H.; Mottram, J.; Pineda, J.; Quinn, C.; Sadavoy, S.; Salji, C.; Tisi, S.; Walker-Smith, S.; White, G.; Hill, T.; Könyves, V.; Palmeirim, P.; Pezzuto, S.


    We present a comparison of SCUBA-2 850-μm and Herschel 70-500-μm observations of the L1495 filament in the Taurus Molecular Cloud with the goal of characterising the SCUBA-2 Gould Belt Survey (GBS) data set. We identify and characterise starless cores in three data sets: SCUBA-2 850-μm, Herschel 250-μm, and Herschel 250-μm spatially filtered to mimic the SCUBA-2 data. SCUBA-2 detects only the highest-surface-brightness sources, principally detecting protostellar sources and starless cores embedded in filaments, while Herschel is sensitive to most of the cloud structure, including extended low-surface-brightness emission. Herschel detects considerably more sources than SCUBA-2 even after spatial filtering. We investigate which properties of a starless core detected by Herschel determine its detectability by SCUBA-2, and find that they are the core's temperature and column density (for given dust properties). For similar-temperature cores, such as those seen in L1495, the surface brightnesses of the cores are determined by their column densities, with the highest-column-density cores being detected by SCUBA-2. For roughly spherical geometries, column density corresponds to volume density, and so SCUBA-2 selects the densest cores from a population at a given temperature. This selection effect, which we quantify as a function of distance, makes SCUBA-2 ideal for identifying those cores in Herschel catalogues that are closest to forming stars. Our results can now be used by anyone wishing to use the SCUBA-2 GBS data set.


    Energy Technology Data Exchange (ETDEWEB)

    Howard, Christian D.; Sandell, Göran; Vacca, William D. [SOFIA-USRA, NASA Ames Research Center, MS 232-12, Building N232, Rm. 146, P.O. Box 1, Moffett Field, CA 94035-0001 (United States); Duchêne, Gaspard [Astronomy Department, University of California, Berkeley, CA 94720-3411 (United States); Mathews, Geoffrey [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Augereau, Jean-Charles; Ménard, Francois; Pinte, Christophe; Podio, Linda; Thi, Wing-Fai [UJF-Grenoble 1/CNRS-INSU, Institut de Planétologie et d' Astrophysique (IPAG) UMR 5274, F-38041 Grenoble (France); Barrado, David; Riviere-Marichalar, Pablo [Centro de Astrobiología, Depto. Astrofísica (CSIC/INTA), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Cañada (Spain); Dent, William R. F. [ALMA SCO, Alonso de Córdova 3107, Vitacura, Santiago (Chile); Eiroa, Carlos; Meeus, Gwendolyn [Dep. de Física Teórica, Fac. de Ciencias, UAM Campus Cantoblanco, E-28049 Madrid (Spain); Grady, Carol; Roberge, Aki [Exoplanets and Stellar Astrophysics Laboratory, NASA Goddard Space Flight Center, Code 667, Greenbelt, MD 20771 (United States); Kamp, Inga; Vicente, Silvia [Kapteyn Astronomical Institute, Postbus 800, 9700 AV Groningen (Netherlands); Williams, Jonathan P. [Institute for Astronomy (IfA), University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)


    The Herschel Space Observatory was used to observe ∼120 pre-main-sequence stars in Taurus as part of the GASPS Open Time Key project. Photodetector Array Camera and Spectrometer was used to measure the continuum as well as several gas tracers such as [O I] 63 μm, [O I] 145 μm, [C II] 158 μm, OH, H{sub 2}O, and CO. The strongest line seen is [O I] at 63 μm. We find a clear correlation between the strength of the [O I] 63 μm line and the 63 μm continuum for disk sources. In outflow sources, the line emission can be up to 20 times stronger than in disk sources, suggesting that the line emission is dominated by the outflow. The tight correlation seen for disk sources suggests that the emission arises from the inner disk (<50 AU) and lower surface layers of the disk where the gas and dust are coupled. The [O I] 63 μm is fainter in transitional stars than in normal Class II disks. Simple spectral energy distribution models indicate that the dust responsible for the continuum emission is colder in these disks, leading to weaker line emission. [C II] 158 μm emission is only detected in strong outflow sources. The observed line ratios of [O I] 63 μm to [O I] 145 μm are in the regime where we are insensitive to the gas-to-dust ratio, neither can we discriminate between shock or photodissociation region emission. We detect no Class III object in [O I] 63 μm and only three in continuum, at least one of which is a candidate debris disk.


    International Nuclear Information System (INIS)

    The Herschel Space Observatory was used to observe ∼120 pre-main-sequence stars in Taurus as part of the GASPS Open Time Key project. Photodetector Array Camera and Spectrometer was used to measure the continuum as well as several gas tracers such as [O I] 63 μm, [O I] 145 μm, [C II] 158 μm, OH, H2O, and CO. The strongest line seen is [O I] at 63 μm. We find a clear correlation between the strength of the [O I] 63 μm line and the 63 μm continuum for disk sources. In outflow sources, the line emission can be up to 20 times stronger than in disk sources, suggesting that the line emission is dominated by the outflow. The tight correlation seen for disk sources suggests that the emission arises from the inner disk (<50 AU) and lower surface layers of the disk where the gas and dust are coupled. The [O I] 63 μm is fainter in transitional stars than in normal Class II disks. Simple spectral energy distribution models indicate that the dust responsible for the continuum emission is colder in these disks, leading to weaker line emission. [C II] 158 μm emission is only detected in strong outflow sources. The observed line ratios of [O I] 63 μm to [O I] 145 μm are in the regime where we are insensitive to the gas-to-dust ratio, neither can we discriminate between shock or photodissociation region emission. We detect no Class III object in [O I] 63 μm and only three in continuum, at least one of which is a candidate debris disk

  15. Physical composition, primary cuts and meat cuts of carcasses from Zebu and Bos taurus X Bos indicus crossbred cattle Composição física, cortes primários e cortes cárneos da carcaça de bovinos Zebu e de mestiços Bos taurus X Bos indicus

    Directory of Open Access Journals (Sweden)

    Daniel Perotto


    Full Text Available Data on hot carcass weight, hot carcass yield, hindquarter weights and physical components, forequarter and spare ribs, and the weights of the main commercial cuts from the hindquarters of twenty young intact bulls were assessed. The animals, belonging to four genetic groups (Nellore, ½ Guzerath + ½ Nellore (½ G + ½ N, ½ Red Angus + ½ Nellore (½ R + ½ N and ½ Marchigiana + ½ Nellore (½ M + ½ N, were raised on pastures, finished in dry lot and slaughtered at live weights ranging from 445 to 517 kg, and at ages ranging from 679 to 863 days. During the dry lot period, which lasted 114 days, animals were fed sorghum silage offered ad libitum, and a concentrate (13.5 MJ of ME, 18% CP in the DM at 1% live weight per day. Genetic group influenced hot carcass weight, forequarter weight, meat weight in the spare ribs, as well as meat and bone weights in the forequarter. Animals in the ½ M + ½ N group were superior both to those in the Nellore and in the ½ G + ½ N groups for hot carcass weight, forequarter weight and meat weight in the spare ribs. The ½ M + ½ N group also differed from the ½ R + ½ N and from the ½ G + ½ N groups in terms of forequarter weight and meat weight in the forequarter, respectively. Conversely, forequarter bone weight of ½ M + ½ N animals was higher than in animals from the Nellore and the ½ R + ½ N groups, respectively. There was no effect of genetic group on hindquarter cuts, except for higher shank and knuckle weights in the ½ M + ½ N group compared to the ½ G + ½ N and Nellore groups, respectively.Foram avaliados o peso e o rendimento de carcaça quente, os pesos dos cortes primários, os pesos dos componentes físicos dos cortes primários e os pesos dos principais cortes comerciais do traseiro especial de 20 bovinos machos não-castrados dos grupos genéticos Nelore, ½ Guzerá + ½ Nelore (½ G + ½ N, ½ Red Angus + ½ Nelore (½ R + ½ N e ½ Marchigiana + ½ Nelore (½ M + ½ N terminados em confinamento. O experimento durou em média 114 dias, período no qual os animais foram alimentados com silagem de sorgo à vontade e concentrado composto de 73,5% de grão de milho, 25% de caroço de algodão e 1,5% de ureia, perfazendo 13,5 MJ de EM e 18% de PB por kg de MS, fornecido à base de 1% do peso vivo do animal por dia. O grupo genético influenciou os pesos de carcaça quente, do dianteiro, da carne do costilhar e os pesos da carne e dos ossos do dianteiro. Animais do grupo ½ M + ½ N superaram os Nelore e os ½ G + ½ N em peso de carcaça quente e em peso do corte dianteiro e da porção de carne do costilhar. O grupo ½ M + ½ N distinguiu-se também do ½ R + ½ N quanto ao peso de dianteiro e do ½ G + ½ N quanto ao peso da carne do dianteiro. Por outro lado, a quantidade de ossos do dianteiro dos animais ½ M + ½ N foi superior à dos animais dos grupos Nelore e ½ R + ½ N. Não houve efeito de grupo genético sobre os cortes resultantes do desdobramento do traseiro especial, exceto pelo fato de os animais ½ M + ½ N apresentarem maior peso de músculo em comparação aos ½ G + ½ N e maior peso de patinho em comparação aos Nelore.

  16. Parâmetros genéticos entre características de leite, de peso e a idade ao primeiro parto em gado mestiço leiteiro (Bos taurus x Bos indicus Genetic parameters between milk traits, weight traits and age at first calving in crossbreed dairy cattle (Bos taurus x Bos indicus

    Directory of Open Access Journals (Sweden)

    A.E. Vercesi Filho


    Full Text Available Foram estimadas as correlações genéticas entre características de produção de leite (produção de leite, gordura, proteína e duração da lactação em até 305 dias, na primeira lactação, características de peso (taxa de crescimento de novilhas entre 12-24 meses e peso médio de vacas e idade ao primeiro parto, em uma população de fêmeas Mestiço Leiteiro Brasileiro (MLB, por meio de metodologia REML, sob modelo animal. As estimativas de herdabilidade das características estudadas na ordem acima foram, respectivamente, 0,28± 0,08, 0,30±0,11, 0,28±0,09, 0,19±0,07, 0,18±0,06, 0,42±0,10 e 0,48±0,12. As correlações genéticas entre peso médio da vaca e a produção de leite, gordura e proteína foram, respectivamente, -0,22±0,22, -0,49±0,31 e -0,22±0,23 e da taxa de crescimento das novilhas com a produção de leite, gordura e proteína foram respectivamente, -0,59±0,35, -0,73±0,44 e -0,62±0,37. As correlações genéticas entre produção de leite, peso médio das vacas e taxa de crescimento das novilhas com idade ao primeiro parto foram respectivamente, 0,05±0,18, -0,05±0,18 e 0,02±0,20. A alta correlação genética (0,93±0,02 entre produção de leite e duração da lactação indicou que não se deve remover a variação na duração da lactação na seleção de gado leiteiro tropical.Genetic correlations between milk production (milk, fat, protein yield lactation length in 305-d lactation, live weight (average cow live weight, growth rate between 12-24 mo and age at first calving traits were estimated in a population of Mestiço Leiteiro Brasileiro (MLB females using REML methodology and animal model. The estimates of heritability were respectively, 0.28± 0.08, 0.30±0.11, 0.28±0.09, 0.19±0.07, 0.18±0.06, 0.42±0.10 and 0.48±0.12 for those traits. Genetic correlations between milk, fat and protein yield with cow average weight were, respectively, -0.22±0.22, -0.49±0.31, -0.22±0.23, and between milk, fat and protein yield with heifer live weight gain, -0.59±0.35, -0.73±0.44, -0.62±0.37 as well. Genetic correlations between milk yield, cow average weight and heifer live weight gain with age at first calving were, respectively, 0.05±0.18, -0.05±0.18, 0.02±0.20. The high genetic correlation between milk production and lactation length (0.93±0.02 indicated that variation of the lactation length should not be removed when selecting tropical dairy cattle.

  17. The L1495-B218 filaments in Taurus seen in NH3 & CCS and Dynamical Stability of Filaments and Dense Cores (United States)

    Seo, Youngmin


    We present deep NH3 map of L1495-B218 filaments and the dense cores embedded within the filaments in Taurus. The L1495-B218 filaments form an interconnected, nearby, large complex extending 8 pc. We observed the filaments in NH3 (1,1) & (2,2) and CCS 21-10 with spectral resolution of 0.038 km/s and spatial resolution of 31". The CSAR algorithm, which is a hybrid of seeded-watershed and binary dendrogram algorithm, identifies 39 leaves and 16 branches in NH3 (1,1). Applying a virial analysis for the 39 NH3 leaves, we find only 9 out of 39 leaves are gravitationally bound, and 12 out of 30 gravitationally unbound leaves are pressure-confined. Our analysis suggests that a dense core may form as a pressure-confined structure, evolve to a gravitationally bound core, and then undergo collapse to form a protostar (Seo et al. 2015).We also present more realistic dynamic stability conditions for dense cores with converging motions and under the influence of radiation pressure. The critical Bonnor-Ebert sphere and the isothermal cylinder have been widely used to test stability of dense cores and filaments; however, these assume a quiescent environment while actual star forming regions are turbulent and illuminated by radiation. In a new analysis of stability conditions we account for converging motions which have been modeled toward starless cores (Seo et al. 2011) and the effect of radiation fields into account. We find that the critical size of a dense core having a homologous converging motion with its peak speed being the sound speed is roughly half of the critical size of the Bonnor-Ebert sphere (Seo et al. 2013). We also find that the critical mass/line density of a dense core/filament irradiated by radiation are considerably smaller than that of the Bonnor-Ebert sphere/isothermal cylinder when the radiation pressure is stronger than the central gas pressure of dense core/isothermal cylinder. For inner Galactic regions and regions near OB associations, the critical

  18. Gizza Pyramidas and Taurus constellation

    CERN Document Server

    Pankovic, Vladan; Krmar, Miodrag


    In this work we apply generalized A. Sparavigna method (use of freely available softwares (programs), e.g.,,22.0265,13/2014.12.29/09:22,, and for analysis of possible astronomical characteristics of three remarkable Giza, i.e. Cheops, Chephren and Mikerin pyramids. Concretely, we use mentioned programs for determination of the Giza plateau longitude and latitude, moments of the sunrise and sunset for any day at the Giza plateau, and, simulation of the sky horizon above Giza plateau in any moment of any day, respectively. In this way we obtain a series of the figures which unambiguously imply the following original results. Any of three remarkable Giza pyramids (Cheops, Chephren and Mikerin) holds only one characteristic edge between apex and north-west vertex of the base so that sunrise direction...

  19. Assessment of single nucleotide polymorphisms in genes residing on chromosomes 14 and 29 for association with carcass composition traits in Bos indicus cattle. (United States)

    Casas, E; White, S N; Riley, D G; Smith, T P L; Brenneman, R A; Olson, T A; Johnson, D D; Coleman, S W; Bennett, G L; Chase, C C


    Objective of this study was to assess the association of SNP in the diacylglycerol O-acyltransferase 1 (DGAT1), thyroglobulin (TG), and micromolar calcium-activated neutral protease (CAPN1) genes with carcass composition and meat quality traits in Bos indicus cattle. A population of Brahman calves (n = 479) was developed in central Florida from 1996 to 2000. Traits analyzed were ADG, hip height, slaughter weight, fat thickness, HCW, marbling score, LM area, estimated KPH fat, yield grade, retail yield, sensory panel tenderness score, carcass hump height, and cooked meat tenderness measured as Warner-Bratzler shear force at 7, 14, and 21 d postmortem. Single nucleotide polymorphisms previously reported in the TG and DGAT1 genes were used as markers on chromosome 14. Two previously reported and two new SNP in the CAPN1 gene were used as markers on chromosome 29. One SNP in CAPN1 was uninformative, and another one was associated with tenderness score (P Brahman population than in reported allele frequencies in Bos taurus populations. The results suggest that the use of molecular marker information developed in Bos taurus populations to Bos indicus populations may require development of appropriate additional markers. PMID:15583037

  20. A novel analytical method, Birth Date Selection Mapping, detects response of the Angus (Bos taurus genome to selection on complex traits

    Directory of Open Access Journals (Sweden)

    Decker Jared E


    Full Text Available Abstract Background Several methods have recently been developed to identify regions of the genome that have been exposed to strong selection. However, recent theoretical and empirical work suggests that polygenic models are required to identify the genomic regions that are more moderately responding to ongoing selection on complex traits. We examine the effects of multi-trait selection on the genome of a population of US registered Angus beef cattle born over a 50-year period representing approximately 10 generations of selection. We present results from the application of a quantitative genetic model, called Birth Date Selection Mapping, to identify signatures of recent ongoing selection. Results We show that US Angus cattle have been systematically selected to alter their mean additive genetic merit for most of the 16 production traits routinely recorded by breeders. Using Birth Date Selection Mapping, we estimate the time-dependency of allele frequency for 44,817 SNP loci using genomic best linear unbiased prediction, generalized least squares, and BayesCπ analyses. Finally, we reconstruct the primary phenotypes that have historically been exposed to selection from a genome-wide analysis of the 16 production traits and gene ontology enrichment analysis. Conclusions We demonstrate that Birth Date Selection Mapping utilizing mixed models corrects for time-dependent pedigree sampling effects that lead to spurious SNP associations and reveals genomic signatures of ongoing selection on complex traits. Because multiple traits have historically been selected in concert and most quantitative trait loci have small effects, selection has incrementally altered allele frequencies throughout the genome. Two quantitative trait loci of large effect were not the most strongly selected of the loci due to their antagonistic pleiotropic effects on strongly selected phenotypes. Birth Date Selection Mapping may readily be extended to temporally-stratified human or model organism populations.

  1. Molecular differentiation of Sarcocystis buffalonis and Sarcocystis levinei in water buffaloes (Bubalus bubalis) from Sarcocystis hirsuta and Sarcocystis cruzi in cattle (Bos taurus). (United States)

    Gjerde, Bjørn; Hilali, Mosaad; Abbas, Ibrahim E


    The purpose of the present study was to obtain sarcocysts of Sarcocystis buffalonis and Sarcocystis levinei from water buffaloes and characterize the isolates by molecular methods in order to determine whether the two species were genetically different from Sarcocystis hirsuta and Sarcocystis cruzi, respectively, from cattle, which had been characterized before. About 35 macroscopically visible (3-4 × 1-2 mm) and 20 barely visible (1-3 × 0.2 mm) sarcocysts were excised from the esophagus of 18 naturally infected and freshly slaughtered adult water buffaloes at three slaughterhouses in Egypt. Genomic DNA was extracted from the sarcocysts, and all isolates were first characterized at the mitochondrial cytochrome c oxidase subunit I gene (cox1) gene through PCR amplification and direct sequencing. Selected isolates were subsequently further characterized at the 18S and 28S ribosomal (r) RNA genes and the internal transcribed spacer 1 (ITS1) region of the nuclear rDNA unit by direct sequencing or cloning. Only six of the isolated macroscopic sarcocysts belonged to S. buffalonis, whereas the others belonged to Sarcocystis fusiformis. Twelve of the smaller cysts belonged to S. levinei and seven to Sarcocystis sinensis. The characterization of the sarcocysts of S. sinensis and some of the sarcocysts of S. fusiformis have been reported before. Fifteen additional sarcocyst isolates of S. fusiformis were characterized at cox1 in the present study and found to be identical or closely similar to previous isolates. At cox1, the sequence identity between the six isolates of S. buffalonis was 99.8-100 % (two haplotypes), whereas the identity between the 12 isolates of S. levinei was 99.0-100 % (10 haplotypes). The identity between cox1 sequences of S. buffalonis and S. hirsuta (n = 56) was 92.9-93.6 % (on average 93.4 %), and the identity between cox1 sequences of S. levinei and S. cruzi (n = 22) was 92.9-94.0 % (on average 93.5 %). The phylogenetic analyses placed with high support the cox1 sequences of S. buffalonis and S. hirsuta into two monophyletic sister groups, and the same was true for the cox1 sequences of S. levinei and S. cruzi. Hence, the study established that S. buffalonis and S. levinei are distinct species different from S. hirsuta and S. cruzi, respectively. Nucleotide sequences of S. buffalonis could be distinguished from those of S. hirsuta also at the 28S rRNA gene (clearly different) and the ITS1 region (small and uncertain difference) but not at the 18S rRNA gene. Sequences of S. levinei could be distinguished from those of S. cruzi both at the 18S and 28S rRNA genes (ITS1 region not examined). However, the cox1 gene was superior to the 18S and 28S rRNA genes as regards the ability to unambiguously delimit the species within each species pair, since at the latter markers, the number of consistent nucleotide differences between the species was low and there was a slight overlap between the intraspecific and interspecific sequence divergence. Comparison of the newly generated 18S rRNA gene sequences of S. levinei from water buffaloes with similar sequences deposited in GenBank suggested that S. levinei and S. cruzi are not strictly intermediate host specific but might occasionally infect cattle and water buffaloes, respectively. PMID:26979729

  2. Morfologia e grânulos citoplasmáticos do corpo lúteo de vacas aneloradas (Bos taurus indicus) gestantes e não gestantes


    L.R. Vargas; P.R. Xavier; C.A. Rezende; M.M. Neves; A.P. Marques Júnior


    Avaliaram-se a proporção volumétrica dos constituintes do corpo lúteo e a distribuição de células lúteas com grânulos citoplasmáticos no corpo lúteo de animais Nelore ao longo da gestação e em animais não gestantes. Foram coletados ovários com corpos lúteos de 24 animais abatidos em frigorífico. Os animais foram distribuídos em dois grupos: gestantes e não gestantes. A idade gestacional foi determinada pela medição do comprimento apicocaudal do feto. Os ovários foram distribuídos segundo o tr...

  3. Studies on the food and feeding habits of Gaur Bos taurus H. Smith (Mammalia: Artiodactyla: Bovidae) in two protected areas of Goa


    S.D. Gad; S.K. Shyama


    Feeding habits and diet composition of gaur were studied at Bhagvan Mahaveer Wildlife Sanctuary and Mollem National Park, Goa. Altogether, 32 species of plants belonging to 17 families constitute the gaur diet. The fruits, leaves, young shoots, bark and flowers are consumed, with a preference for leaves (87%). In summer gaur also consumed the bark of cashew (Anacardium occidentale) and teak (Tectona grandis) trees. Strong association was observed between food preference and season (chi-square...

  4. Studies on the food and feeding habits of Gaur Bos taurus H. Smith (Mammalia: Artiodactyla: Bovidae in two protected areas of Goa

    Directory of Open Access Journals (Sweden)

    S.D. Gad


    Full Text Available Feeding habits and diet composition of gaur were studied at Bhagvan Mahaveer Wildlife Sanctuary and Mollem National Park, Goa. Altogether, 32 species of plants belonging to 17 families constitute the gaur diet. The fruits, leaves, young shoots, bark and flowers are consumed, with a preference for leaves (87%. In summer gaur also consumed the bark of cashew (Anacardium occidentale and teak (Tectona grandis trees. Strong association was observed between food preference and season (chi-square=12.94; p=0.001. Peak feeding activity was observed early in the morning (0630 to 0830 hr and in the evening (1730 to 1845 hr. During hot hours of the day (1330 to 1530 hr, animals were found resting in the shade of large trees.

  5. Short communication: Effects of Bos taurus autosome 9-located quantitative trait loci haplotypes on enzymatic mastitis indicators of milk from dairy cows experimentally inoculated with Escherichia coli. (United States)

    Sørensen, L P; Engberg, R M; Løvendahl, P; Larsen, T


    The aim of this study was to investigate the effect of a quantitative trait locus associated with mastitis caused by Escherichia coli, with one haplotype being more susceptible (HH) and another being more resistant (HL) to E. coli mastitis, on the activity of 4 inflammatory related milk enzymes. In particular, we investigated the suitability of β-glucuronidase (GLU) as an early indicator of E. coli mastitis. Besides GLU, the enzymes l-lactate dehydrogenase (LDH), N-acetyl-β-d-glucosaminidase (NAGase), and alkaline phosphatase were included. The study was conducted in an experimental setup with 31 Holstein cows divided into 4 groups representing repeated experiments and, within group, divided according to quantitative trait locus haplotype. All cows were inoculated with viable E. coli, and milk samples were collected 27 times from -6 to 396 h post-E. coli inoculation (PI). Activity of the 4 enzymes in milk, somatic cell count (SCC), daily milk yield, viable E. coli counts, and results of a semiquantitative polymerase chain reaction for pathogen detection, were all analyzed with a repeatability model. The response variables all expressed a strong reaction to the E. coli infection. Daily milk yield decreased significantly at 12 h PI and bacteria counts increased 100-fold and peaked at 18 h PI, which was validated by PCR. Also, SCC started to increase at 12 h PI and increased on average 70 times; however, no significant differences in SCC level were detected between HH and HL cows at any sampling point. The enzymes LDH, NAGase, and alkaline phosphatase showed similar responses, with a significantly increased activity and higher peak values for the HH than the HL cows. Significant differences between HH and HL cows were detected at different time points for these 3 enzymes, but not after adjusting P-values for multiple testing. A different pattern was also observed for GLU, where HL cows expressed the highest peak activity. Indication of differences in GLU activity between the 2 haplotype groups was only seen at 60 h PI. It was concluded that HL and HH cows expressed similar response patterns after E. coli infection but with differences in the size and profile of the activity of the 4 enzymes. The enzyme GLU was an equally good indicator of E. coli mastitis compared with the other studied enzymes, although it showed a slower response compared with LDH and NAGase. PMID:26026757

  6. Digital infrared thermography of the scrotum, semen quality, serum testosterone levels in Nellore bulls (Bos taurus indicus) and their correlation with climatic factors


    Felipe Rydygier de Ruediger; Marcelo George Mungai Chacur; Francisco Carlos Platzeck Estrella Alves; Eunice Oba; Alcides de Amorim Ramos


    The objective was to study the relationship of climatic conditions with the temperature of the scrotum surface and sperm quality through digital infrared thermography in Nellore bulls, raised extensively. In six bulls held with scrotal thermography Flir E40® cameras, blood samples for serum testosterone and semen collection were taken by electroejaculation every 10 days, with six replications. Climatic factors: ambient temperature, relative humidity, dry globe temperature and temperature of t...

  7. Digital infrared thermography of the scrotum, semen quality, serum testosterone levels in Nellore bulls (Bos taurus indicus and their correlation with climatic factors

    Directory of Open Access Journals (Sweden)

    Felipe Rydygier de Ruediger


    Full Text Available The objective was to study the relationship of climatic conditions with the temperature of the scrotum surface and sperm quality through digital infrared thermography in Nellore bulls, raised extensively. In six bulls held with scrotal thermography Flir E40® cameras, blood samples for serum testosterone and semen collection were taken by electroejaculation every 10 days, with six replications. Climatic factors: ambient temperature, relative humidity, dry globe temperature and temperature of the wet globe were recorded using a globe thermometer (InstruTemp®, ITWTG-2000. Thermal images of the scrotum were analyzed with the Flir Tools® software for the temperatures of scrotal surface, the right and left sides of the scrotum lap thirds: dorsal, middle and ventral testicles; and tails of the epididymis. The semen data and thermograms were submitted to ANOVA and Tukey’s test at 5%. Pearson correlation was used for the surface temperatures of the scrotum, rectal temperature, quantitative and qualitative characteristics of semen and climatic factors. There was a positive correlation (P<0.05 for sperm motility x scrotal temperatures; sperm concentration x scrotal temperatures; climatic factors x rectal temperature. There was a negative correlation (P<0.05 between ambient temperature x sperm concentration. It was concluded that the temperature of the scrotum surface and climatic factors, temperature and humidity, influence the quality of semen. Thermography is recommended as a supplementary examination for reproductive evaluation of bulls.

  8. Genetic parameters of infectious bovine keratoconjunctivitis and its relationship with weight and parasite infestations in Australian tropical Bos taurus cattle

    DEFF Research Database (Denmark)

    Ali, A.; O'Neill, C.J.; Thomson, P.C.;


    Background: Infectious bovine keratoconjunctivitis (IBK) or 'pinkeye' is an economically important ocular disease that significantly impacts animal performance. Genetic parameters for IBK infection and its genetic and phenotypic correlations with cattle tick counts, number of helminth (unspecified...... recorded for tick counts, helminth eggs counts as an indicator of intestinal parasites and live weights at several ages including 18 months. Results: Negative genetic correlations were estimated between IBK incidence and weight traits for animals in pre-weaning and post-weaning datasets. Genetic...... correlations among weight measurements were positive, with moderate to high values. Genetic correlations of IBK incidence with tick counts were positive for the pre-weaning and negative for the post-weaning datasets but negative with helminth eggs counts for the pre-weaning dataset and slightly positive for...

  9. Postweaning substitution of grazed forage with a high-energy concentrate has variable long-term effects on subcutaneous fat and marbling in Bos taurus genotypes. (United States)

    Greenwood, P L; Siddell, J P; Walmsley, B J; Geesink, G H; Pethick, D W; McPhee, M J


    The objective of this study was to quantify the effects and interactions of stage of growth and genotype on commercial carcass traits and intramuscular fat (IMF) content in 5 muscles of steers ( = 165) and to test the hypothesis that substituting pasture with a high-energy concentrate during the immediate postweaning period increases IMF. Cattle of 3 genotypes (Angus, Hereford, and Wagyu × Angus; = 55/genotype) were selected at weaning from commercial herds, targeting genotypic differences in marbling and subcutaneous fatness. Following weaning, steers were fed for 168 d within 2 different improved, temperate pasture-based nutritional systems: a forage-only system (FS) and forage with high-energy supplemented system (SS), with 2 replicates per system. The supplement was fed at a level of 1% of average BW adjusted every 2 wk to provide an estimated 50% of energy requirements for 168 d from weaning. Pasture on offer in both systems was managed to match the BW of the FS and SS steers during the postweaning treatment period to avoid confounding due to differences in growth rate during this period. Steers were then regrouped into 2 replicates and backgrounded on improved, temperate pasture for 158 d and then grain fed within 1 group for 105 d (short fed) or 259 d (long fed). Groups were slaughtered at commencement (d 0) and end of postweaning nutritional treatments (d 168), end of backgrounding (d 326), and after short (d 431) or long feedlotting (d 585). Serial slaughter stage had an effect on all traits assessed ( < 0.01). The FS steers had more rib fat ( < 0.01) and higher Meat Standards Australia marbling score ( < 0.05) and a tendency ( < 0.10) to have greater eye muscle area than the SS steers throughout the study. Genotypic differences were evident ( < 0.05) for all traits assessed except HCW, dressing percentage, rib fat depth, ossification score, ultimate pH, and IMF in the semitendinosus muscle. The results for marbling and IMF do not support the use of a high-energy feed as a substitute for an equivalent amount of energy from pasture during the immediate postweaning period to enhance development of marbling. PMID:26440193

  10. Molecular characterisation of Sarcocystis bovifelis, Sarcocystis bovini n. sp., Sarcocystis hirsuta and Sarcocystis cruzi from cattle (Bos taurus) and Sarcocystis sinensis from water buffaloes (Bubalus bubalis). (United States)

    Gjerde, Bjørn


    About 200 individual sarcocysts were excised from 12 samples of cattle beef from five countries (Argentina, Brazil, Germany, New Zealand, Uruguay) and tentatively identified to species or cyst type on the basis of their size and shape and cyst wall morphology. Genomic DNA was extracted from 147 of these sarcocysts and used initially for PCR amplification and sequencing of the partial mitochondrial cytochrome c oxidase subunit I gene (cox1) in order to identify the sarcocysts to species and/or sequence type. In addition, seven Sarcocystis sinensis-like sarcocysts collected from the oesophagus of water buffaloes in Egypt were examined at cox1 for comparative purposes. Based on the results from the cox1 marker, selected sarcocyst isolates from both hosts were further characterised at one to three regions of the nuclear ribosomal (r) DNA unit, i.e. the complete 18S rRNA gene, the complete internal transcribed spacer 1 (ITS1) region and the partial 28S rRNA gene. This was done in order to compare the results with previous molecular identifications based on 18S rRNA gene sequences and to evaluate the utility of these regions for species delimitations and phylogenetic inferences. On the basis of sarcocyst morphology and molecular data, primarily the cox1 sequences, four Sarcocystis spp. were identified in the samples of cattle beef. Twenty-two microscopic sarcocysts (1 × 0.1 mm) with hair-like protrusions were assigned to Sarcocystis cruzi, 56 macroscopic sarcocysts (3-8 × 0.5 mm) with finger-like protrusions were assigned to Sarcocystis hirsuta and 45 and 24 microscopic sarcocysts (1-3 × 0.1-0.2 mm) with finger-like protrusions were assigned to Sarcocystis bovifelis and Sarcocystis bovini n. sp., respectively. Sarcocysts of S. cruzi were identified in samples of beef from Argentina and Uruguay; sarcocysts of S. hirsuta in samples from Argentina, Brazil, Germany and New Zealand; sarcocysts of S. bovifelis in samples from Argentina and Germany; and sarcocysts of S. bovini in samples from Argentina and New Zealand. The microscopic sarcocysts from water buffaloes were confirmed to belong to S. sinensis. The cox1 sequences of S. bovifelis and S. bovini, respectively, shared an identity of 93-94 % with each other, and these sequences shared an identity of 89-90 % with cox1 of S. sinensis. In contrast, the intraspecific sequence identity was 98.4-100 % (n = 45), 99.3-100 % (n = 24) and 99.5-100 % (n = 7) for sequences of S. bovifelis, S. bovini and S. sinensis, respectively. In each of the latter three species, an aberrant type of cox1 sequences was also identified, which was only 91-92 % identical with the predominant cox1 type of the same species and about 98 % identical with the aberrant types of the two other species. These aberrant cox1 sequences are believed to represent non-functional nuclear copies of the mitochondrial genes (numts or pseudogenes). They might be used as additional markers to separate the three species from each other. Sequencing of a considerable number of clones of S. bovifelis, S. bovini and S. sinensis from each of the three regions of the rDNA unit revealed intraspecific sequence variation in all loci in all species and particularly in the ITS1 locus (78-100 % identity). As regards the 18S rRNA gene, it was possible to separate the three species from each other on the basis of a few consistent nucleotide differences in the less variable 3' end half of the gene. A comparison of the new sequences with GenBank sequences obtained from S. sinensis-like sarcocysts in cattle in other studies indicated that previous sequences derived from cattle in Germany and Austria belonged to S. bovifelis, whereas those derived from cattle in China belonged to S. bovini. On the basis of the new 28S rRNA sequences, it was possible to separate S. sinensis from S. bovifelis and S. bovini, whereas the latter two species could not be separated from each other. Based on ITS1 sequences, the three species were indistinguishable. Phylogenetic analysis using maximum parsimony placed with fairly high support cox1 sequences of S. bovifelis, S. bovini and S. sinensis, respectively, into three monophyletic clusters, with S. bovifelis and S. bovini being a sister group to S. sinensis. In contrast, phylogenies based on each of the three regions of the rDNA unit did not separate sequences of the three species completely from each other. Characterisation of cox1 of 56 isolates of S. hirsuta from four countries revealed only 13 haplotypes and an intraspecific sequence identity of 99.3-100 %. In the three regions of the rDNA unit, there was more extensive sequence variation, particularly in the ITS1 region. The 22 cox1 sequences of S. cruzi displayed a moderate intraspecific variation (98.6-100 %), whereas there was no variation at the 18S rRNA gene among 10 sequenced isolates. Sequencing of 16 clones of the partial 28S rRNA gene of S. cruzi yielded two markedly different sequence types, having an overall sequence identity of 95-100 %. PMID:26677095

  11. The first identification of a blood-sucking abomasal nematode Ashworthius sidemi in cattle (Bos taurus) using simple polymerase chain reaction (PCR). (United States)

    Moskwa, Bożena; Bień, Justyna; Cybulska, Aleksandra; Kornacka, Aleksandra; Krzysiak, Michał; Cencek, Tomasz; Cabaj, Władysław


    A simple polymerase chain reaction (PCR) test was used to identify Ashworthius sidemi, a blood-sucking gastrointestinal nematode that commonly infects bison, red and roe deer, and moose in Poland. The present study uses this technique to confirm the possibility of transmission of A. sidemi infection from wildlife to domestic animals, such as cattle and sheep, grazing on the same natural pastures. A 406 bp fragment of genomic A. sidemi DNA was actually detected in DNA isolated from larval cultures derived from feces from cattle. A. sidemi DNA has been detected in cattle which represent a new host for this parasite. This is the first evidence of A. sidemi in cattle. The results reveal that a PCR test based on DNA from L3 larvae can be used for in vivo detection of A. sidemi invasions in breeding animals. In conclusion, the transfer of A. sidemi infection from wildlife to the farm animals sharing the same pastures appears possible. PMID:25981105

  12. Effects of Bos taurus autosome 9-located quantitative trait loci haplotypes on enzymatic mastitis indicators of milk from dairy cows experimentally inoculated with Escherichia coli

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Engberg, Ricarda Greuel; Løvendahl, Peter;


    particular, we investigated the suitability of β-glucuronidase (GLU) as an early indicator of E. coli mastitis. Besides GLU, the enzymes l-lactate dehydrogenase (LDH), N-acetyl-β-d-glucosaminidase (NAGase), and alkaline phosphatase were included. The study was conducted in an experimental setup with 31...... adjusting P-values for multiple testing. A different pattern was also observed for GLU, where HL cows expressed the highest peak activity. Indication of differences in GLU activity between the 2 haplotype groups was only seen at 60 h PI. It was concluded that HL and HH cows expressed similar response...

  13. An original SERPINA3 gene cluster: Elucidation of genomic organization and gene expression in the Bos taurus 21q24 region

    Directory of Open Access Journals (Sweden)

    Ouali Ahmed


    Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.

  14. The prey pathway: a regional history of cattle (Bos taurus and pig (Sus scrofa domestication in the northern Jordan Valley, Israel.

    Directory of Open Access Journals (Sweden)

    Nimrod Marom

    Full Text Available The faunal assemblage from the 9(th-8(th millennium BP site at Sha'ar Hagolan, Israel, is used to study human interaction with wild suids and cattle in a time period just before the appearance of domesticated animals of these species in the Jordan Valley. Our results, based on demographic and osteometric data, indicate that full domestication of both cattle and suids occurred at the site during the 8(th millennium. Importantly, domestication was preceded in both taxa by demographic and metric population parameters indicating severe overhunting. The possible role of overhunting in shaping the characteristics of domesticated animals and the social infrastructure to ownership of herds is then explored.

  15. Taxonomy Icon Data: cattle [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available rus_L.png Bos_taurus_NL.png Bos_taurus_S.png Bos_taurus_NS.png ...

  16. NCBI nr-aa BLAST: CBRC-RMAC-01-0084 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-01-0084 ref|XP_594146.3| PREDICTED: Toll-like receptor 5 [Bos taurus] gb|...ABC68311.1| toll-like receptor 5 [Bos taurus] gb|ABU86924.1| Toll-like receptor 5 [Bos taurus x Bos indicus]... gb|ABU86926.1| Toll-like receptor 5 [Bos taurus] gb|ABU86927.1| Toll-like receptor 5 [Bos taurus] gb|ABU869...28.1| Toll-like receptor 5 [Bos taurus] gb|ABU86929.1| Toll-like receptor 5 [Bos tau...rus] gb|ABU86931.1| Toll-like receptor 5 [Bos taurus x Bos indicus] gb|ABU86932.1| Toll-like receptor 5 [Bos taurus x Bos indicus] XP_594146.3 0.0 78% ...

  17. NCBI nr-aa BLAST: CBRC-TNIG-22-0261 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0261 ref|XP_594146.3| PREDICTED: Toll-like receptor 5 [Bos taurus] gb|...ABC68311.1| toll-like receptor 5 [Bos taurus] gb|ABU86924.1| Toll-like receptor 5 [Bos taurus x Bos indicus]... gb|ABU86926.1| Toll-like receptor 5 [Bos taurus] gb|ABU86927.1| Toll-like receptor 5 [Bos taurus] gb|ABU869...28.1| Toll-like receptor 5 [Bos taurus] gb|ABU86929.1| Toll-like receptor 5 [Bos tau...rus] gb|ABU86931.1| Toll-like receptor 5 [Bos taurus x Bos indicus] gb|ABU86932.1| Toll-like receptor 5 [Bos taurus x Bos indicus] XP_594146.3 9e-85 39% ...


    Directory of Open Access Journals (Sweden)

    Guillermo Henao Restrepo


    Full Text Available El desarrollo folicular bovino durante un ciclo estral normal, se caracteriza por un crecimiento en forma de ondas con presencia de dos a cinco cohortes foliculares por ciclo, de las cuales solo un folículo se torna ovulatorio. El crecimiento folicular en forma de ondas también se produce durante el período prepuberal, puberal, primer tercio de la gestación y período de anestro posparto. Aunque existe mucha similitud en el patrón fundamental del desarrollo de ondas foliculares entre Bos taurus y Bos indicus, se han encontrado diferencias en la dinámica folicular que pueden afectar el comportamiento reproductivo y la aplicación de biotecnologías reproductivas. La dinámica folicular puede variar por efectos ambientales y estados fisiológicos de hembras Bos indicus que impiden establecer un patrón específico de dinámica folicular para cada raza y etapa fisiológica. El propósito de esta revisión es analizar la función reproductiva teniendo en cuenta las diferencias de la dinámica folicular entre estados fisiológicos y condiciones ambientales de hembras bovinas con énfasis en B. indicus.The bovine follicular development during a normal estrous cycle, is characterized by a growth in wave form with presence of two to five follicular cohorts by cycle, of which only one follicle ovulate. The follicular growth in wave form also occurs during the prepubertal and pubertal periods, first quarter of the gestation, and in the postpartum anestrous period. Although there is great similarity in the fundamental pattern of the development of follicular waves between Bos taurus and Bos indicus, differences of follicular dynamics has been detected, that can affect the reproductive behavior and the application of reproductive biotechnologies. Follicular dynamics can change by environmental effects and physiological states of Bos indicus females that impede to establish a specific pattern of follicular dynamics for each breed and physiological

  19. Malignant catarrhal fever-like lesions associated with ovine herpesvirus-2 infection in young calves (Bos indicus: a case report

    Directory of Open Access Journals (Sweden)

    MCR Luvizotto


    Full Text Available Infection of susceptible ruminants, including domestic cattle (Bos taurus and American bison (Bison bison, with ovine herpesvirus-2 (OvHV-2 may provoke the fatal vasculitis and lymphoproliferative syndrome, known as malignant catarrhal fever (MCF, reported worldwide. To the best of our knowledge, this is the first report of a clinical case of MCF-like lesions associated with ovine herpesvirus-2 (OvHV-2 infection in young calves (Bos indicus including central nervous symptoms that occurred in Três Lagoas city, Mato Grosso do Sul state, a border town near São Paulo state, Brazil. The diagnosis was based on typical histological lesions characterized by systemic lymphohistiocytic and fibrinoid vasculitis, confirmed by polymerase chain reaction and subsequent phylogenetic analysis of detected OvHV-2 sequences. This finding indicates that MCF disease is spread among herds concentrated in border areas between Mato Grosso do Sul and São Paulo states.

  20. Random Regression Models for Estimation of Covariance Functions, Genetic Parameters and Prediction of Breeding Values for Rib Eye Area in a Colombian Bos indicus-Bos taurus Multibreed Cattle Population

    Directory of Open Access Journals (Sweden)



    Full Text Available In this paper we present an application of random regression models (RRM to obtain restricted maximum likelihood estimates of covariance functions and predictions of breeding values for longitudinal records of rib eye area measured by ultrasound (REA in a Colombian multibreed cattle population. The dataset contained 708 records from 340 calves progeny of 37 sires from nine breeds mated to Gray Brahman Cows. The mixed model was a RRM that used Legendre polynomials (LP of order 1 to 3. Fixed effects were age of animal, dam parity, contemporary group (herd*year*season*sex, breed additive genetic and heterosis, whereas direct and maternal additive genetic and maternal permanent environment were random effects. Residual variances were modeled either as constant or changing across the growth trajectory. Models were compared with two Information Criteria, the corrected Akaikes and the Schwartzs Bayesian. According to these criteria the best model was the one with first order LP and constant residual variance. Given that with this model estimated maternal additive genetic and permanent environment covariance functions showed that these effects were not accurately disentangled, a parsimonious model without maternal additive genetic effects was used to obtain genetic parameters and breeding values. Direct additive genetic variance decreased until 150 days and then increased. Maternal permanent environment variance increased with age. Direct heritability estimates for REA at 4 months, weaning, 12 and 15 months (considered as target ages, were 0.003, 0.007, 0.034 and 0.058, respectively. Direct additive correlations ranged from -0.7 to 1. Maternal permanent environmental correlations were close to unity across the entire range of ages. Estimates of (covariance components showed the need to validate results with larger multigenerational multibreed populations before implement RRM in regional or national genetic evaluation procedures in Colombia.

  1. Estimulação hormonal, punção folicular transvaginal e avaliação ovocitária em bezerras pré-púberes da raça Nelore (Bos taurus indicus Hormonal stimulation and ultrasound guided transvaginal follicle aspiration and oocyte recovery in Nelore (Bos taurus indicus prepubertal calves

    Directory of Open Access Journals (Sweden)

    Marilia Viviane Snel-Oliveira


    Full Text Available O uso de bezerras pré-púberes como doadoras de ovócitos oferece um considerável potencial para acelerar o ganho genético através da diminuição do intervalo de gerações, além de incrementar o aproveitamento de fêmeas bovinas de alto valor genético. Os objetivos deste estudo foram analisar o efeito da idade e do tratamento estimulatório com gonadotrofinas sobre a resposta folicular, a taxa de recuperação, a produção e a avaliação morfológica de ovócitos colhidos em bezerras da raça nelore (B. t. indicus a partir de 10 meses de idade. As bezerras foram distribuídas aleatoriamente em três grupos (n=4 e receberam tratamentos hormonais distintos, repetidos nos mesmos animais nos três períodos, aos 10, 11 e 12 meses de idade. No dia zero (D0, todas as bezerras receberam um implante intravaginal de progesterona e, em D1, 2 mg de benzoato de estradiol intramuscular (im. Em D6, deu-se início à diferenciação dos tratamentos (T: T1- 120 UI de FSH, divididos em quatro aplicações im a cada 12 horas; T2 - 120 UI de FSH, em uma única aplicação subcutânea (sc, mais 300 UI de eCG sc, T3 - sem tratamento estimulatório. No D8, o implante de progesterona foi retirado e a punção folicular transvaginal, guiada por ultra-som (PFTV, foi realizada no D9. Dos 402 ovócitos coletados, 53 foram desnudados e medidos, incluindo a zona pelúcida, encontrando-se um diâmetro médio de 153,38 (8,06 mm. Não houve diferença significativa entre os tratamentos e entre as idades para quantidade de folículos > 3 mm, de ovócitos recuperados e de ovócitos viáveis. A média de ovócitos recuperados e ovócitos viáveis para cada tratamento foi: T1- 11,08 (6,20 e 59,58% (25,80, T2- 12,75 (8,04 e 66,02% (36,71, T3 - 9,66 (8,15 e 51,51% (30,69, respectivamente. O valor médio da taxa de recuperação foi de 78,70%. O uso de FSH e FSH + eCG não aumentou significantemente a quantidade de folículos > 3 mm no momento da PFTV, assim como dos ovócitos recuperados e viáveis aos 10, 11 e 12 meses de idade.The use of pre-pubertal calves as oocyte donors offers a considerable potential to increase the genetic gain lowering the generations interval, as well as increase the usage of bovine females with high genetic value. The objectives of this study were to analyze the effect of age and of the stimulatory treatment with gonadotropins in the follicular response, the recovery rate, quantity and quality of oocytes of the prepubertal Nelore (B. t. indicus calves. Twelve Nelore prepubertal females were stimulated with gonadotrophin hormone and were submitted to ultrasound guided transvaginal oocyte recovery (OPU at 10, 11 and 12 months of age. Before OPU the females were randomly distributed into three treatment groups (n=4, which consist of different protocols of ovarian super stimulation. For all treatments the animals on day zero (D0 received one intravaginal progesterone implant (CIDR-G® and on D1, 2 mg of estradiol benzoate im (Estrogin®. The stimulatory treatment began on D6 according to the following treatments: T1-120 IU of FSH (Foltropin®, divided in 4 im injections with 12 hours interval; T2-120 IU of FSH in one sc application plus 300 IU of eCG (Folligon® on D6; T3 - without stimulatory treatment (control. At D8 the CIDR-G®was removed and OPU was performed on D9. Among the 402 oocytes retrieved, 53 were denuded and measured (including the pellucid zone where a mean diameter of 153.38 ± 8.06 mm was obtained. No significant difference was detected among treatments and among ages for the quantity of follicles > 3 mm, quantity of oocytes recovery and quantity of oocytes morphologically viable. The mean of recovery oocytes and viable oocytes for each treatment was T1- 11.08 (6.20 and 59.58% (25.80, T2 - 12.75 (8.04 and 66.02% (36.71, T3 - 9.66 (8.15 and 51.51% (30.69, respectively. The mean value of recovery rate was 78.70%. The use of FSH or FSH + eCG does not increase significantly the amount of follicles > 3 mm at the OPU moment, as well as the total and viable oocytes by 10, 11 and 12 months of age.

  2. Estimación del comportamiento productivo y parámetros genéticos de características predestete en bovinos de carne (Bos taurus y sus cruzas, VIII Región, Chile Estimation of pre-weaning productive performance and genetic parameters in beef cattle (Bos taurus and crosses, VIII Region of Chile

    Directory of Open Access Journals (Sweden)

    E G Cienfuegos-Rivas


    Full Text Available El objetivo del presente estudio fue determinar el comportamiento productivo al nacimiento y destete de los terneros hijos de toros Angus, Hereford y Polled Hereford con vacas Clavel, Hereford, Holstein, Polled Hereford e Híbridas (cruzas de Holstein con combinaciones de Hereford en un rebaño bovino de carne en la provincia de Ñuble, VIII Región de Chile. Los animales fueron clasificados de acuerdo a sus características fenotípicas. El comportamiento productivo se evaluó analizando 1.119 registros productivos, desde 1999 al 2000, para las variables peso al nacimiento (PN, N=1.119, peso al destete ajustado (PD205, N=660 y ganancia predestete (GDP, N=660 utilizando el método de mínimos cuadrados para determinar el efecto de la raza del toro (GRT, la raza de la vaca (GRV, el grupo contemporáneo (GC y edad de la vaca (EDV como covariable sobre las variables PN, PD205 y GDP. Los parámetros genéticos y ambientales fueron estimados usando un modelo animal con la metodología MTDFREML, empleándose análisis univariados y bivariados para la estimación de los componentes de varianza. El efecto de GRT y GC fue significativo (PThe objective was to determine the productive performance in body weight change from birth until weaning, of calves sired by Angus, Hereford and Polled Hereford with Clavel, Hereford, Holstein, Polled Hereford, and Hybrid (different Holstein and Hereford combinations cows in a beef cattle herd in the dry area of the Ñuble, province of the VIII Region in Chile. The sires and cows were classified according to their phenotypic characteristics. The productive performance was evaluated by analyzing 1,119 production records from year 1990 to 2000 for the variables: birth weight (PN, N=1,119, adjusted weaning weight (PD205, N=660 and preweaning daily gain (GDP; N=660 using the least squares method to determine the effects of breed group of the sire (GRT, breed group of the dam (GRV, and contemporary groups (GC, with age of dam (EDV as a covariable, on PN, PD205 and GDP. Genetic and environmental parameters were estimated using an animal model with MTDFREML methodology, through univariable and bivariable analyses to estimate variance and covariance components. GRT and the GC had a significant effect (P<0.05 on PN and PD205 but did not affect GDP (P•0.05. Calves sired by Hereford bulls were 7.5, 12.5 y 14.0 % above the herd average for PN, PD205 and GDP, respectively. The GRV did not have an effect (P•0.05 on PN, PD205 and GDP. Heritabilities (h² calculated were 0.49 for PN, 0.15 for PD205 and 0.35 for GDP. Genetic correlation between PN and PD205 was 0.23. Within the GRT the h2 for PN and PD205 were 0.69 and 0.21 for Angus and 0.47 and 0.23 for Polled Hereford, respectively.



    Valéria da Silva Gandolfo; Gabriella Biondi de Godoy; Andrea Novoa Castillo Oliveira; Marcelo George Mungai Chacur; Sérgio do Nascimento Kronka


    Neste experimento avaliou-se o efeito do probiótico Proenzime® no perímetro escrotal e espermiograma em touros jovens Tabapuã. Duas colheitas de sêmen de 21 touros Tabapuã, com trinta meses de idade, foram realizadas nos dias zero (D0) e 120 (D120) por eletroejaculação, totalizando 42 amostras. Dividiram-se os touros em grupo-controle (GC) com dez animais e grupo tratado (GT) com onze animais. Os to...


    Directory of Open Access Journals (Sweden)

    Valéria da Silva Gandolfo


    Full Text Available

    Neste experimento avaliou-se o efeito do probiótico Proenzime® no perímetro escrotal e espermiograma em touros jovens Tabapuã. Duas colheitas de sêmen de 21 touros Tabapuã, com trinta meses de idade, foram realizadas nos dias zero (D0 e 120 (D120 por eletroejaculação, totalizando 42 amostras. Dividiram-se os touros em grupo-controle (GC com dez animais e grupo tratado (GT com onze animais. Os touros do GT receberam 4g de probiótico/animal/dia, durante 120 dias. Houve diferença (p<0,01 entre as colheitas (D0 e D120 nos grupos GC e GT para o perímetro escrotal (GC – D0: 30,50 cm e D120: 33,55 cm; GT – D0: 29,90 cm e D120: 34,30 cm. Houve diferença (p<0,05 entre colheitas (D0 e D120 nos grupos GC e GT, respectivamente, para: defeitos menores (GC – D0: 13,84 % e D120: 21,79%; GT – D0: 14,99% e D120: 20,84% e defeitos totais (GC – D0: 22,29% e D120: 29,24%; GT – D0: 25,14% e D120: 32,81%. Os resultados demonstram que, entre grupos, não houve alteração significativa das características seminais e perímetro escrotal.
    PALAVRAS-CHAVES: Aditivo, nutrição, sêmen, touro.

    PALAVRAS-CHAVE: Touro, sêmen, nutrição, aditivo.    The objective of this experiment was to evaluate the effect of the probiotic Proenzime® on scrotal perimeter and spermiogram in young Tabapua bulls. Two samples of semen from 21 Tabapua bulls, aging 30 months, were collected in day zero (D0 and 120 (D120 by electroejaculation, totalizing 42 samples. The bulls were divided in control group (CG with 10 animals and trated group (TG with 11 animals. The bulls of TG received 4g of probiotic/animal/day, during 120 days. There was difference (p<0.01 between collects (D0 and D120 in the groups CG and TG for scrotal perimeter (CG – D0: 30.50 cm and D120: 33.55 cm; TG – D0: 29.90 cm and D120: 34.30 cm. There was difference (p<0.05 between collects (D0 and D120 in the groups CG and TG, respectively. Minor defects (CG – D0: 13.84% and D120: 21.79%; TG – D0: 14.99% and D120: 20.84% and total defects (CG – D0: 22.29% and D120: 29.24%; TG – D0: 25.14% and D120: 32.81%. The results exposed allow concluding that significant alterations were not observed between groups for the seminal characteristics and scrotal perimeter.   

    KEY WORDS: Aditive, bull, nutrition, semen.


    Institute of Scientific and Technical Information of China (English)


    利用病理组织学及组织化学技术对9例水牛和2例黄牛的胆汁及肝胆系统进行比较研究,发现所取组织中有寄生虫感染和不同程度的炎症.牛胆囊的炎症.牛胆囊的炎症反应和胆囊粘膜上皮的损伤是胆结石形成的主要条件,然而在我们观察中却未发现水牛胆囊损伤后有胆结石形成迹象.胆汁成分分析证明水牛的胆法中β-葡萄糖苷酸酶、胆固醇和钙的含量明显低于黄牛,而黄牛的胆红素含量低于水牛.本研究结果阐述了黄牛较水牛易发生胆结石的组织学及组织化学基础.%The aim of the study is to understand why gallstones are easily formed in Cattle(B.taurus) but rarely in Water buffaloes (B.bubalis). Gallbladders and liver sample were collected from 9 Water buffaloes and 2 Cattle, divided into three groups, and studied by means of light microscopy and histochemical techniques. It was found that G1 had parasitic infection, G2 showed inflammation and no typical lesion was seen in G3. Previous observations firmly indicated that the gallbladder epithelial injury took before gallstone formation and the consequences of these cellular changes played a contributory role in causing gallstone. The same observation was noted in our findings in Water buffaloes, but no sign of gallstone formation. The results of bile analysis showed clearly the difference between the Water buffaloes and Cattle, that the β-glucuronidase, cholesterol and calcium levels were lower in Water buffaloes than those in Cattle, however, the bilirubin level was lower in Cattle.

  6. NCBI nr-aa BLAST: CBRC-TTRU-01-1041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-1041 gb|ABU86942.1| Toll-like receptor 10 [Bos taurus x Bos indicus] g...b|ABU86944.1| Toll-like receptor 10 [Bos taurus] gb|ABU86945.1| Toll-like receptor 10 [Bos taurus] gb|ABU869...46.1| Toll-like receptor 10 [Bos taurus] gb|ABU86949.1| Toll-like receptor 10 [Bos taurus x Bos indicus] ABU86942.1 0.0 83% ...

  7. NCBI nr-aa BLAST: CBRC-PVAM-01-0803 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0803 gb|ABU86942.1| Toll-like receptor 10 [Bos taurus x Bos indicus] g...b|ABU86944.1| Toll-like receptor 10 [Bos taurus] gb|ABU86945.1| Toll-like receptor 10 [Bos taurus] gb|ABU869...46.1| Toll-like receptor 10 [Bos taurus] gb|ABU86949.1| Toll-like receptor 10 [Bos taurus x Bos indicus] ABU86942.1 0.0 83% ...

  8. NCBI nr-aa BLAST: CBRC-VPAC-01-1397 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1397 gb|ABU86942.1| Toll-like receptor 10 [Bos taurus x Bos indicus] g...b|ABU86944.1| Toll-like receptor 10 [Bos taurus] gb|ABU86945.1| Toll-like receptor 10 [Bos taurus] gb|ABU869...46.1| Toll-like receptor 10 [Bos taurus] gb|ABU86949.1| Toll-like receptor 10 [Bos taurus x Bos indicus] ABU86942.1 0.0 88% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0585 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0585 ref|NP_001071387.1| hypothetical protein LOC514131 [Bos taurus] r...ef|XP_001254537.1| PREDICTED: hypothetical protein LOC514131 [Bos taurus] dbj|BAF36506.1| p97Bucentaur-2 [Bos tau...rus] gb|AAI49203.1| P97Bucentaur-2 [Bos taurus] NP_001071387.1 4e-12 32% ...

  10. NCBI nr-aa BLAST: CBRC-FCAT-01-0063 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-0063 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 2e-49 86% ...

  11. NCBI nr-aa BLAST: CBRC-OANA-01-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0052 ref|NP_001094755.1| chemokine receptor CXCR2 [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 1e-113 62% ...

  12. NCBI nr-aa BLAST: CBRC-CFAM-37-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-37-0004 ref|NP_001094755.1| chemokine receptor CXCR2 [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 1e-173 82% ...

  13. NCBI nr-aa BLAST: CBRC-HSAP-03-0018 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-03-0018 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 1e-169 79% ...

  14. NCBI nr-aa BLAST: CBRC-MMUS-01-0025 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-01-0025 ref|NP_001094755.1| chemokine receptor CXCR2 [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 1e-145 71% ...

  15. NCBI nr-aa BLAST: CBRC-MDOM-07-0080 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-07-0080 ref|NP_001094755.1| interleukin 8 receptor beta [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 1e-148 71% ...

  16. NCBI nr-aa BLAST: CBRC-MMUR-01-0053 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0053 ref|NP_001094755.1| interleukin 8 receptor beta [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 6e-33 72% ...

  17. NCBI nr-aa BLAST: CBRC-OCUN-01-1390 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-1390 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 6e-88 76% ...

  18. NCBI nr-aa BLAST: CBRC-PCAP-01-1467 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-1467 ref|NP_001069804.1| solute carrier family 16, member 7 [Bos tauru...s] gb|ABD39318.1| monocarboxylate transporter 2 [Bos taurus] gb|AAI40525.1| SLC16A7 protein [Bos taurus] NP_001069804.1 1e-117 81% ...

  19. NCBI nr-aa BLAST: CBRC-ETEL-01-1472 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ETEL-01-1472 ref|NP_001094755.1| chemokine receptor CXCR2 [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 1e-121 76% ...

  20. NCBI nr-aa BLAST: CBRC-MEUG-01-2178 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2178 ref|NP_001071415.1| G protein-coupled receptor 77 [Bos taurus] gb...|AAI23494.1| G protein-coupled receptor 77 [Bos taurus] gb|ABI98946.1| C5L2 [Bos taurus] NP_001071415.1 1e-61 57% ...

  1. NCBI nr-aa BLAST: CBRC-TSYR-01-1334 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-1334 ref|NP_001069804.1| solute carrier family 16, member 7 [Bos tauru...s] gb|ABD39318.1| monocarboxylate transporter 2 [Bos taurus] gb|AAI40525.1| SLC16A7 protein [Bos taurus] NP_001069804.1 1e-134 79% ...

  2. NCBI nr-aa BLAST: CBRC-ACAR-01-0816 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0816 ref|NP_001069804.1| solute carrier family 16, member 7 [Bos tauru...s] gb|ABD39318.1| monocarboxylate transporter 2 [Bos taurus] gb|AAI40525.1| SLC16A7 protein [Bos taurus] NP_001069804.1 1e-125 79% ...

  3. NCBI nr-aa BLAST: CBRC-ACAR-01-0732 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0732 ref|NP_001094755.1| chemokine receptor CXCR2 [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 1e-113 59% ...

  4. NCBI nr-aa BLAST: CBRC-MLUC-01-0338 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0338 ref|NP_001071415.1| G protein-coupled receptor 77 [Bos taurus] gb...|AAI23494.1| G protein-coupled receptor 77 [Bos taurus] gb|ABI98946.1| C5L2 [Bos taurus] NP_001071415.1 1e-124 68% ...

  5. NCBI nr-aa BLAST: CBRC-MEUG-01-2252 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2252 ref|NP_001094755.1| interleukin 8 receptor beta [Bos taurus] gb|ABC59060.1| CXCR2 [Bos tau...rus] gb|ABR88132.1| chemokine receptor CXCR2 [Bos taurus] NP_001094755.1 4e-70 71% ...

  6. Detecção imunoistoquímica de receptores de estrógeno e progesterona no endométrio de vacas Nelore (Bos taurus indicus durante o anestro pós-parto

    Directory of Open Access Journals (Sweden)

    R.S. Lima


    Full Text Available Foram utilizadas 24 vacas Nelore P.O., em anestro pós-parto, diagnosticado pelo histórico reprodutivo, por avaliações ultrassonográficas transretais e por dosagem de progesterona plasmática, que foram submetidas à colheita de fragmento uterino via transcervical. Os animais foram divididos em dois grupos conforme o máximo diâmetro folicular: grupo 1: folículos 6mm (n=12. Para avaliar receptor de estrógeno e receptor de progesterona no epitélio glandular e no estroma, foi utilizada a técnica de imunoistoquímica. Altas contagens relativas e alta intensidade de marcação para receptor de estrógeno e progesterona no epitélio glandular e no estroma foram observadas nos dois grupos. No entanto, a intensidade de marcação para o receptor de progesterona no epitélio glandular foi mais alta no grupo 2 comparado ao grupo 1. Quando o epitélio glandular e o estroma foram comparados, o número relativo de receptor de estrógeno no grupo 1 foi mais alto no epitélio glandular comparado ao estroma, e a intensidade de marcação para o receptor de progesterona no grupo 2 foi mais alta no epitélio glandular comparado ao estroma. Os resultados sugerem que os mecanismos que controlam a expressão de receptores no anestro são semelhantes aos observados durante o ciclo estral.

  7. Parámetros protéicos del plasma seminal y su relación con la calidad del semen en toros de la raza nelore (bos taurus indicus

    Directory of Open Access Journals (Sweden)

    Ana Sánchez


    Full Text Available El propósito de este estudio fue investigar la presenciae incidencia de bandas proteicas específicas delplasma seminal en toros Nelore, completa y parcialmente aptos para la actividad reproductiva. Se utilizaron 68 ejemplares; 20 de variedad Padrón y 48 Mochos, con edad media de 4 años. En el perímetro escrotal (35,05±0,49 cm e 33,30±0,39cm, índice de masa corpórea (302,62±5,87 e 284,19±5,15Kg|m2 hubo diferencia (p<0,05 entre las variedades Padrón y Mocho, respectivamente. Con respecto al peso corpóreo (627,70±11,37 e 611,58±8,66Kg; la altura (1,44±0,01e 1,47±0,01m; el volumen del eyaculado (5,82±0,48 e 5,17±0,29 mL, la motilidad espermática progresiva (73,50±2,81% e75,62±0,97%, el vigor espermático (4,30±0,19 e4,27±0,11 y motilidad en masa (4,27±0,11 e3,33±0,23 no se presentó diferencia (p>0,05. En morfología espermática, tampoco hubo desigualdad entre las variedades Padrón y Mocho, respectivamente con 5,06 ± 8,20% e 5,32 ± 6,40% de defectos mayores; 9,91±6,74% e 8,36±6,06% para los defectos menores; e 14,76±13,20% e 13,82±12,61% para los defectos totales. La electroforesis del plasma seminal reveló bandas proteicas con pesos entre 5 a 105 KDa. En el 100% de toros aptos para la reproducción, la proteína con pesos de 13 Kda estuvo presente. De la misma forma ocurrió con las bandas de 20 KDa. El resto de las bandas proteicas mostraron presencia con diferentes porcentajes de incidencia en toros aptos o parcialmente aptos para la actividad reproductiva. Las dos variedades estudiadas hicieron evidente la adaptación reproductiva eficaz en condiciones de clima semejantes.

  8. Tipos de fibras en el músculo esquelético del toro bravo (bos taurus ibericus) : su relación con la caída durante la lídia / 2001.


    Martínez Gomariz, Francisco


    Tesis-Universidad de Murcia. Consulte la tesis en: BCA. GENERAL. ARCHIVO UNIVERSITARIO. T.M.-2275. Consulte la tesis en: BCA. GENERAL. Fac. Veterinaria. Departamentos. E002B TESIS 95. Consulte la tesis en: BCA. GENERAL. Fac. Veterinaria. Sala de estudio. Tesis-V 153.

  9. Análisis de los tipos de fibras musculares del toro bravo (Bos Taurus ibericus): su relación con algunas enzimas de fatiga muscular y el comportamiento durante la lidia


    Ros Sempere, Juan


    Muestras de músculo esquelético y sangre fueron tomadas a 48 toros bravos (novillos) lidiados en la plaza de toros de Calasparra (Murcia). Los músculos seleccionados, cabeza larga del tríceps braquial y semitendinoso, fueron analizados desde el punto de vista histológico, con el fin de estudiar las características morfológicas e histoquímicas de los distintos tipos de miocitos y las posibles alteraciones consecuencia de la lidia. Las técnicas histoquímicas han posibilitado reconocer tres tipo...

  10. Análisis de los tipos de fibras musculares del toro bravo (Bos Taurus ibericus): su relación con algunas enzimas de fatiga muscular y el comportamiento durante la lidia


    Ros Sempere, Juan


    Muestras de músculo esquelético y sangre fueron tomadas a 48 toros bravos (novillos) lidiados en la plaza de toros de Calasparra (Murcia). Los músculos seleccionados, cabeza larga del tríceps braquial y semitendinoso, fueron analizados desde el punto de vista histológico, con el fin de estudiar las características morfológicas e histoquímicas de los distintos tipos de miocitos y las posibles alteraciones consecuencia de la lidia. Las técnicas histoquímicas han posibilitado reconocer tres tip...

  11. Detecção imunoistoquímica de receptores de estrógeno e progesterona no endométrio de vacas Nelore (Bos taurus indicus) durante o anestro pós-parto


    Lima, R S; I. Martin; W.C. Marques Filho; M.M.P. Rodrigues; R Laufer-Amorim; Ferreira, J.C.P.


    Foram utilizadas 24 vacas Nelore P.O., em anestro pós-parto, diagnosticado pelo histórico reprodutivo, por avaliações ultrassonográficas transretais e por dosagem de progesterona plasmática, que foram submetidas à colheita de fragmento uterino via transcervical. Os animais foram divididos em dois grupos conforme o máximo diâmetro folicular: grupo 1: folículos 6mm (n=12). Para avaliar receptor de estrógeno e receptor de progesterona no epitélio glandular e no estroma, foi utilizada a técnica d...

  12. Effects of Bos taurus autosome 9-located quantitative trait loci haplotypes on the disease phenotypes of dairy cows with experimentally induced Escherichia coli mastitis

    DEFF Research Database (Denmark)

    Khatun, Momena; Sørensen, Peter; Jørgensen, Hanne Birgitte Hede;


    , rumen motility; and the paraclinical parameters: bacterial counts, somatic cell count (SCC), and milk amyloid A levels in milk; and white blood cell count, polymorphonuclear neutrophilic leukocyte (PMNL) count, and serum amyloid A levels in blood were recorded at different time points post-E. coli...

  13. Parámetros protéicos del plasma seminal y su relación con la calidad del semen en toros de la raza nelore (bos taurus indicus)


    Ana Sánchez; Marcelo Mungai; Nelson Machado


    El propósito de este estudio fue investigar la presenciae incidencia de bandas proteicas específicas delplasma seminal en toros Nelore, completa y parcialmente aptos para la actividad reproductiva. Se utilizaron 68 ejemplares; 20 de variedad Padrón y 48 Mochos, con edad media de 4 años. En el perímetro escrotal (35,05±0,49 cm e 33,30±0,39cm), índice de masa corpórea (302,62±5,87 e 284,19±5,15Kg|m2 ) hubo diferencia (p<0,05) entre las variedades Padrón y Mocho, respectivamente. Con respecto...

  14. Gastrointestinal nematodes (Nematoda: Trichostrongyloidea) in cattle (Bos taurus), moose (Alces alces) and roe deer (Capreolus capreolus) in southern Norway. The effect of anthelmintic treatment in relation to a possible cross-infection.



    The presence of gastrointestinal nematodes is considered to be a problem in domestic cattle, and various studies have tried to present reasons for and solutions to this problem. A study was conducted in Southern Norway in order to examine whether anthelmintic treatment in cattle is adequate and to investigate if wild cervids like moose and roe deer should be considered as a reservoir for nematode parasites in cattle. The results showed that egg output from cattle was low, which together with ...

  15. Determinación de las condiciones de crecimiento in vitro de una cepa probiótica (Lactobacillus delbruekii subsp. bulgaricus aislada del tracto intestinal de terneros (Bos taurus

    Directory of Open Access Journals (Sweden)

    José Ávila


    Full Text Available El objetivo de este estudio fue conocer el efecto de la temperatura, pH y la concentración de inóculo sobre el crecimiento in vitro de una cepa probiótica (Lactobacillus delbruekii subsp. bulgaricus aislada del intestino delgado de terneros. Para ello se utilizó en el primer caso, el método de superficie de respuesta para determinar las condiciones de pH y temperatura óptimas de la cepa, y en el segundo, un diseño experimental completamente aleatorizado considerando el factor concentración de inóculo inicial a seis niveles, donde el crecimiento (en medio De Man, Rogosa y Sharpe expresado en unidades de Absorbancia, constituyó la variable respuesta; presentándose una máxima respuesta (0,806 uA para 5 % de concentración inicial de inóculo. Los valores de pH y temperatura utilizados permitieron el establecimiento de una zona óptima de crecimiento in vitro en los siguientes intervalos, pH entre 5,1 y 5,6; y temperatura entre 38,0 y 41,5 °C, donde el máximo crecimiento se obtuvo a pH 5,31 y a 39,38 °C. Por otro lado se encontraron incrementos significativos del crecimiento in vitro (p < 0,05 a medida que se utiliza menor concentración de inóculo inicial. Con la información obtenida se espera incrementar los rendimientos de la cepa y así promover la producción de productos probióticos para el consumo animal en Venezuela.

  16. Determinación de las condiciones de crecimiento in vitro de una cepa probiótica (Lactobacillus delbruekii subsp. bulgaricus aislada del tracto intestinal de terneros (Bos taurus

    Directory of Open Access Journals (Sweden)

    José Ávila


    Full Text Available El objetivo de este estudio fue conocer el efecto de la temperatura, pH y la concentración de inóculo sobre el crecimiento in vitro de una cepa probiótica (Lactobacillus delbruekii subsp. bulgaricus aislada del intestino delgado de terneros. Para ello se utilizó en el primer caso, el método de superficie de respuesta para determinar las condiciones de pH y temperatura óptimas de la cepa, y en el segundo, un diseño experimental completamente aleatorizado considerando el factor concentración de inóculo inicial a seis niveles, donde el crecimiento (en medio De Man, Rogosa y Sharpe expresado en unidades de Absorbancia, constituyó la variable respuesta; presentándose una máxima respuesta (0,806 uA para 5 % de concentración inicial de inóculo. Los valores de pH y temperatura utilizados permitieron el establecimiento de una zona óptima de crecimiento in vitroen los siguientes intervalos, pH entre 5,1 y 5,6; y temperatura entre 38,0 y 41,5 °C, donde el máximo crecimiento se obtuvo a pH 5,31 y a 39,38 °C. Por otro lado se encontraron incrementos significativos del crecimiento in vitro (p < 0,05 a medida que se utiliza menor concentración de inóculo inicial. Con la información obtenida se espera incrementar los rendimientos de la cepa y así promover la producción de productos probióticos para el consumo animal en Venezuela.

  17. Alteración diurna de la carga calórica corporal e interrelación de las temperaturas rectal y láctea en vacas cruzadas (6/8 Bos taurus x 2/8 Bos indicus, Pardo Suizo y Holstein bajo estrés calórico diurno durante la época seca en el clima tropical húmedo - Daytime alteration of body heat load and relationship between rectal and milk temperatures in crossbred (6/8 Bos taurus x 2/8 Bos indicus, Brown Swiss and Holstein lactating cows under heat stress during summer time in the humid tropical climate

    Directory of Open Access Journals (Sweden)

    Araúz, E. E.


    Full Text Available ResumenLas temperaturas rectal y de la secreción láctea y la carga calóricacorporal fueron evaluadas en 191 vacas en lactación (cruzadas 6/8Pardo Suizo x 2/8 Cebú y 6/8 Holstein x 2/8 Cebú: 27; Pardo Suizo:131; y Holstein: 33; bajo estrés calórico diurno en la época secadistribuidas entre 45 y 1064 msnm; con el objetivo de establecer laalteración diurna y su interrelación según el grupo genético y el grado de sensibilidad calórica.SummaryRectal and milk temperatures were measured in the afternoon (2 PM to4 PM in 191 lactating dairy cows (6/8 Brown Swiss x 2/8 Zebu and 6/8Holstein x 2/8 Zebu: 27, Brown Swiss: 131 and Holstein: 33 underheat stress in the tropical environment to evaluate daytime alterationof body heat load and establish the relationship between rectal andmilk temperature.

  18. A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius).

    LENUS (Irish Health Repository)

    Edwards, Ceiridwen J


    BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius) has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs) from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+\\/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer). In total, 289.9 megabases (22.48%) of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously identified

  19. Dicty_cDB: Contig-U16181-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available dren's ... 48 0.79 1 ( AC231868 ) Bos taurus BAC CH240-211C14 (Children's Hospital...aurus BAC CH240-242E2 (Children's Hospital ... 48 0.79 1 ( AC231833 ) Bos taurus NOVECTOR CH240-254C23 (Chil...dren's Hos... 48 0.79 1 ( AC231397 ) Bos taurus BAC CH240-464P17 (Children's Hospital...... 48 0.79 1 ( AC229882 ) Bos taurus BAC CH240-237N14 (Children's Hospital... 48 0.79 1 ( AC229870 ) Bo...s taurus NOVECTOR CH240-367D19 (Children's Hos... 48 0.79 1 ( AC229801 ) Bos taurus BAC CH240-431E22 (Children's Hospital

  20. NCBI nr-aa BLAST: CBRC-VPAC-01-1445 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1445 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-116 76% ...

  1. NCBI nr-aa BLAST: CBRC-OPRI-01-0130 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-0130 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-149 83% ...

  2. NCBI nr-aa BLAST: CBRC-MEUG-01-0695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0695 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 2e-85 72% ...

  3. NCBI nr-aa BLAST: CBRC-MLUC-01-0520 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0520 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 6e-62 69% ...

  4. NCBI nr-aa BLAST: CBRC-PVAM-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1099 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 9e-88 57% ...

  5. NCBI nr-aa BLAST: CBRC-STRI-01-2166 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2166 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-140 84% ...

  6. NCBI nr-aa BLAST: CBRC-MMUR-01-1320 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1320 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-131 73% ...

  7. NCBI nr-aa BLAST: CBRC-MMUR-01-0605 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0605 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-135 74% ...

  8. NCBI nr-aa BLAST: CBRC-STRI-01-2300 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2300 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 8e-44 81% ...

  9. NCBI nr-aa BLAST: CBRC-MMUR-01-1132 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1132 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 3e-53 70% ...

  10. NCBI nr-aa BLAST: CBRC-MDOM-04-0282 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-04-0282 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-125 69% ...

  11. NCBI nr-aa BLAST: CBRC-PVAM-01-0460 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0460 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-149 84% ...

  12. NCBI nr-aa BLAST: CBRC-PCAP-01-0607 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0607 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-108 65% ...

  13. NCBI nr-aa BLAST: CBRC-GGOR-01-0397 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-0397 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-151 85% ...

  14. NCBI nr-aa BLAST: CBRC-PCAP-01-0275 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0275 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-101 71% ...

  15. NCBI nr-aa BLAST: CBRC-PHAM-01-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-0010 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 6e-65 81% ...

  16. NCBI nr-aa BLAST: CBRC-STRI-01-2372 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2372 ref|XP_001250098.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001787946.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos t...aurus] ref|XP_001788047.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001250098.1 1e-127 71% ...

  17. Gene : CBRC-PCAP-01-0209 [SEVENS

    Lifescience Database Archive (English)


  18. Gene : CBRC-PHAM-01-1469 [SEVENS

    Lifescience Database Archive (English)


  19. Gene : CBRC-TTRU-01-1304 [SEVENS

    Lifescience Database Archive (English)


  20. Transcriptome analysis and SNP identification in SCC of horn in (Bos indicus) Indian cattle. (United States)

    Koringa, Prakash G; Jakhesara, Subhash J; Bhatt, Vaibhav D; Patel, Anand B; Dash, Debabrata; Joshi, Chaitanya G


    Single Nucleotide Polymorphisms (SNPs) have become the marker of choice for genome wide association studies. In order to provide the best genome coverage for the analysis of disease, production and performance traits, a large number of relatively evenly distributed SNPs are needed. The main objective of present work was to identify large numbers of gene-associated SNPs using high-throughput sequencing in squamous cell carcinoma of horn. RNA-seq analysis was conducted on 2 tissues viz. Horn Cancer (HC) and Horn Normal (HN) in Kankrej breed of cattle. A total of 909,362 reads with average read length of 405 bp for HC and 583,491 reads with average read length of 411 bp for HN were obtained. We found 9532 and 7065 SNPs as well as 1771 and 1172 Indels in HC and HN, respectively, from which, 7889 SNPs and 1736 Indels were uniquely present in HC, 5886 SNPs and 1146 Indels were uniquely present in HN and reported first time in Bos indicus, whereas the rest are already reported in Bos taurus dbSNP database. The gene-associated SNPs and Indels were high in upregulated genes of HC as compared to HN. Analysis of differentially expressed genes was identified, these genes are involved in regulation of cell proliferation, apoptosis, gene transcription, cell survival and metabolism through various metabolic pathways. The result of transcriptome expression profiling was validated using Real Time quantitative PCR in nine randomly selected genes. We identified numbers aberrant signaling pathways responsible for carcinogenesis in HC which are also commonly altered in squamous cell carcinoma (SCC) of lung in human being. We conclude that a large number of altered genes and dysfunction of multiple pathways are involved in the development of Horn Cancer. The present findings contribute to theoretical information for further screening of genes and identification of markers for early diagnosis of HC as well as SNPs identified in this report provide a much needed resource for genetic

  1. A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius.

    Directory of Open Access Journals (Sweden)

    Ceiridwen J Edwards

    Full Text Available BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer. In total, 289.9 megabases (22.48% of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously

  2. Genomic divergence of zebu and taurine cattle identified through high-density SNP genotyping


    Porto-Neto, Laercio R; Sonstegard, Tad S; Liu, George E; Bickhart, Derek M.; Da Silva, Marcos VB; Marco A. Machado; Utsunomiya, Yuri T.; Garcia, Jose F.; Gondro, Cedric; Van Tassell, Curtis P


    Background Natural selection has molded evolution across all taxa. At an arguable date of around 330,000 years ago there were already at least two different types of cattle that became ancestors of nearly all modern cattle, the Bos taurus taurus more adapted to temperate climates and the tropically adapted Bos taurus indicus. After domestication, human selection exponentially intensified these differences. To better understand the genetic differences between these subspecies and detect genomi...

  3. NCBI nr-aa BLAST: CBRC-STRI-01-2431 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2431 ref|NP_001030220.1| neuromedin U receptor 2 [Bos taurus] sp|Q58CW...4|NMUR2_BOVIN RecName: Full=Neuromedin-U receptor 2; Short=NMU-R2 gb|AAX46680.1| neuromedin U receptor 2 [Bos taurus] NP_001030220.1 0.0 84% ...

  4. NCBI nr-aa BLAST: CBRC-TTRU-01-1168 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-1168 ref|NP_001030220.1| neuromedin U receptor 2 [Bos taurus] sp|Q58CW...4|NMUR2_BOVIN RecName: Full=Neuromedin-U receptor 2; Short=NMU-R2 gb|AAX46680.1| neuromedin U receptor 2 [Bos taurus] NP_001030220.1 1e-163 90% ...

  5. NCBI nr-aa BLAST: CBRC-PVAM-01-0659 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0659 ref|NP_001030220.1| neuromedin U receptor 2 [Bos taurus] sp|Q58CW...4|NMUR2_BOVIN RecName: Full=Neuromedin-U receptor 2; Short=NMU-R2 gb|AAX46680.1| neuromedin U receptor 2 [Bos taurus] NP_001030220.1 0.0 84% ...

  6. Dicty_cDB: SSI876 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSI876 (Link to dictyBase) - - - Contig-U15499-1 SSI876F (Link to Original ... 6 AF451177 |AF451177.1 AF451177 Bos taurus retinal pigment ... epithelium Bos taurus cDNA, mRNA sequence. 36 0.40 ...

  7. NCBI nr-aa BLAST: CBRC-ETEL-01-0844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ETEL-01-0844 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 0.0 88% ...

  8. NCBI nr-aa BLAST: CBRC-ACAR-01-1166 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-1166 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 0.0 68% ...

  9. NCBI nr-aa BLAST: CBRC-GGAL-05-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-05-0029 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 0.0 75% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0850 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0850 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 1e-159 92% ...

  11. NCBI nr-aa BLAST: CBRC-BTAU-01-2842 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2842 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 0.0 99% ...

  12. NCBI nr-aa BLAST: CBRC-FCAT-01-0577 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-0577 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 1e-156 77% ...

  13. NCBI nr-aa BLAST: CBRC-TGUT-08-0024 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-08-0024 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 0.0 72% ...

  14. NCBI nr-aa BLAST: CBRC-CFAM-08-0025 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-08-0025 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 0.0 90% ...

  15. NCBI nr-aa BLAST: CBRC-PMAR-01-0572 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0572 ref|NP_776631.1| thyroid stimulating hormone receptor [Bos taurus] sp|Q27987|TSH ... SHR_BOVIN Thyrotropin receptor precursor (TSH -R) (Thyroid-stimulating hormone receptor) gb|AAC18 ... 639.1| thyrotropin (TSH ) receptor [Bos taurus] NP_776631.1 0.0 52% ...

  16. NCBI nr-aa BLAST: CBRC-OLAT-15-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-15-0022 ref|NP_001073692.1| solute carrier family 29 (nucleoside transporters...), member 3 [Bos taurus] gb|AAI26742.1| Solute carrier family 29 (nucleoside transporters), member 3 [Bos taurus] NP_001073692.1 9e-68 49% ...

  17. NCBI nr-aa BLAST: CBRC-FRUB-02-0631 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0631 ref|NP_776543.2| myocilin, trabecular meshwork inducible glucocor...ticoid response [Bos taurus] gb|AAI04572.1| Myocilin, trabecular meshwork inducible glucocorticoid response [Bos taurus] NP_776543.2 1e-102 53% ...

  18. NCBI nr-aa BLAST: CBRC-OLAT-17-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-17-0016 ref|NP_776543.2| myocilin, trabecular meshwork inducible glucocor...ticoid response [Bos taurus] gb|AAI04572.1| Myocilin, trabecular meshwork inducible glucocorticoid response [Bos taurus] NP_776543.2 1e-99 58% ...

  19. NCBI nr-aa BLAST: CBRC-GACU-03-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-03-0016 ref|NP_776543.2| myocilin, trabecular meshwork inducible glucocor...ticoid response [Bos taurus] gb|AAI04572.1| Myocilin, trabecular meshwork inducible glucocorticoid response [Bos taurus] NP_776543.2 1e-115 50% ...

  20. NCBI nr-aa BLAST: CBRC-TTRU-01-0439 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0439 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 91% ...

  1. NCBI nr-aa BLAST: CBRC-PTRO-13-0056 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PTRO-13-0056 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 89% ...

  2. NCBI nr-aa BLAST: CBRC-HSAP-12-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-12-0048 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 89% ...

  3. NCBI nr-aa BLAST: CBRC-PHAM-01-1399 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1399 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 86% ...

  4. NCBI nr-aa BLAST: CBRC-RNOR-07-0387 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-07-0387 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 82% ...

  5. NCBI nr-aa BLAST: CBRC-RMAC-11-0047 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-11-0047 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 86% ...

  6. NCBI nr-aa BLAST: CBRC-TBEL-01-1351 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-1351 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 85% ...

  7. NCBI nr-aa BLAST: CBRC-PVAM-01-1419 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1419 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-156 73% ...

  8. NCBI nr-aa BLAST: CBRC-ACAR-01-1013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-1013 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-129 59% ...

  9. NCBI nr-aa BLAST: CBRC-OCUN-01-1169 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OCUN-01-1169 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-167 79% ...

  10. NCBI nr-aa BLAST: CBRC-GACU-23-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-23-0004 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-108 51% ...

  11. NCBI nr-aa BLAST: CBRC-CFAM-27-0019 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-27-0019 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 83% ...

  12. NCBI nr-aa BLAST: CBRC-FRUB-02-0486 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0486 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-105 52% ...

  13. NCBI nr-aa BLAST: CBRC-MMUS-15-0051 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUS-15-0051 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 82% ...

  14. NCBI nr-aa BLAST: CBRC-ETEL-01-0242 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ETEL-01-0242 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 85% ...

  15. NCBI nr-aa BLAST: CBRC-GGOR-01-0838 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-0838 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-92 84% ...

  16. NCBI nr-aa BLAST: CBRC-PABE-13-0047 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-13-0047 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 89% ...

  17. NCBI nr-aa BLAST: CBRC-BTAU-01-1883 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-1883 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 99% ...

  18. NCBI nr-aa BLAST: CBRC-STRI-01-2762 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2762 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-110 85% ...

  19. NCBI nr-aa BLAST: CBRC-EEUR-01-1395 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-EEUR-01-1395 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-132 85% ...

  20. NCBI nr-aa BLAST: CBRC-CJAC-01-1501 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CJAC-01-1501 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 89% ...

  1. NCBI nr-aa BLAST: CBRC-MLUC-01-0607 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0607 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 86% ...

  2. NCBI nr-aa BLAST: CBRC-MEUG-01-0121 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0121 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-131 72% ...

  3. NCBI nr-aa BLAST: CBRC-OGAR-01-1283 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OGAR-01-1283 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 89% ...

  4. NCBI nr-aa BLAST: CBRC-MMUR-01-1175 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1175 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 89% ...

  5. NCBI nr-aa BLAST: CBRC-PCAP-01-1579 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-1579 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 84% ...

  6. NCBI nr-aa BLAST: CBRC-OPRI-01-0778 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-0778 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 8e-63 89% ...

  7. NCBI nr-aa BLAST: CBRC-OANA-01-0848 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0848 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-135 64% ...

  8. NCBI nr-aa BLAST: CBRC-TNIG-11-0018 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-11-0018 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 1e-105 51% ...

  9. NCBI nr-aa BLAST: CBRC-FCAT-01-1221 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FCAT-01-1221 ref|NP_001033657.1| inflammation-related G protein-coupled recept...or EX33 [Bos taurus] gb|AAX31354.1| inflammation-related G protein-coupled receptor EX33 [Bos taurus] NP_001033657.1 0.0 85% ...

  10. NCBI nr-aa BLAST: CBRC-MLUC-01-0682 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0682 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predict...ed) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 1e-134 90% ...

  11. NCBI nr-aa BLAST: CBRC-PHAM-01-1390 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1390 ref|XP_874556.1| PREDICTED: similar to olfactory receptor 49 (predict...ed) [Bos taurus] ref|XP_001255792.1| PREDICTED: similar to olfactory receptor 49 (predicted) [Bos taurus] XP_874556.1 1e-151 83% ...

  12. NCBI nr-aa BLAST: CBRC-MLUC-01-0520 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0520 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predict...ed) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 6e-62 69% ...

  13. NCBI nr-aa BLAST: CBRC-MLUC-01-0986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0986 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predict...ed) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-146 83% ...

  14. NCBI nr-aa BLAST: CBRC-STRI-01-2306 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2306 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predict...ed) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 1e-110 86% ...

  15. NCBI nr-aa BLAST: CBRC-MEUG-01-0990 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0990 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predict...ed) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-150 86% ...

  16. NCBI nr-aa BLAST: CBRC-VPAC-01-1177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1177 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predict...ed) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 6e-36 79% ...

  17. NCBI nr-aa BLAST: CBRC-PHAM-01-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-0010 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predict...ed) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 6e-65 81% ...

  18. NCBI nr-aa BLAST: CBRC-MLUC-01-0373 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0373 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predict...ed) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-125 82% ...

  19. NCBI nr-aa BLAST: CBRC-PVAM-01-0503 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0503 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predict...ed) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-139 80% ...

  20. NCBI nr-aa BLAST: CBRC-MMUR-01-1137 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1137 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predict...ed) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-147 84% ...

  1. NCBI nr-aa BLAST: CBRC-VPAC-01-0651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-0651 ref|XP_609523.4| PREDICTED: similar to olfactory receptor 694 (predict...ed) [Bos taurus] ref|XP_001256288.2| PREDICTED: similar to olfactory receptor 694 (predicted) [Bos taurus] XP_609523.4 1e-141 82% ...

  2. NCBI nr-aa BLAST: CBRC-PCAP-01-0607 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0607 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predict...ed) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-108 65% ...

  3. NCBI nr-aa BLAST: CBRC-MLUC-01-0797 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0797 ref|XP_874556.1| PREDICTED: similar to olfactory receptor 49 (predict...ed) [Bos taurus] ref|XP_001255792.1| PREDICTED: similar to olfactory receptor 49 (predicted) [Bos taurus] XP_874556.1 1e-156 85% ...

  4. NCBI nr-aa BLAST: CBRC-TSYR-01-1100 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-1100 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predict...ed) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-104 76% ...

  5. NCBI nr-aa BLAST: CBRC-VPAC-01-1007 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1007 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predict...ed) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 5e-98 56% ...

  6. NCBI nr-aa BLAST: CBRC-MDOM-05-0267 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-05-0267 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predict...ed) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-130 74% ...

  7. NCBI nr-aa BLAST: CBRC-VPAC-01-1333 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1333 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predict...ed) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-140 81% ...

  8. NCBI nr-aa BLAST: CBRC-TTRU-01-0126 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0126 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predict...ed) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-158 88% ...

  9. NCBI nr-aa BLAST: CBRC-MLUC-01-0609 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0609 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predict...ed) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-161 88% ...

  10. NCBI nr-aa BLAST: CBRC-PVAM-01-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0013 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predict...ed) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 2e-93 80% ...

  11. NCBI nr-aa BLAST: CBRC-MDOM-04-0282 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-04-0282 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predict...ed) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-125 69% ...

  12. NCBI nr-aa BLAST: CBRC-PVAM-01-0460 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0460 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predict...ed) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-149 84% ...

  13. NCBI nr-aa BLAST: CBRC-TSYR-01-0987 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-0987 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predict...ed) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-128 78% ...

  14. NCBI nr-aa BLAST: CBRC-MLUC-01-0889 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0889 ref|NP_001039933.1| protein kinase C and casein kinase substrate in neurons... 2 [Bos taurus] gb|AAI14746.1| Protein kinase C and casein kinase substrate in neurons 2 [Bos taurus] NP_001039933.1 1e-173 68% ...

  15. NCBI nr-aa BLAST: CBRC-TTRU-01-0672 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0672 ref|NP_001039933.1| protein kinase C and casein kinase substrate in neurons... 2 [Bos taurus] gb|AAI14746.1| Protein kinase C and casein kinase substrate in neurons 2 [Bos taurus] NP_001039933.1 1e-178 74% ...

  16. NCBI nr-aa BLAST: CBRC-LAFR-01-0470 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-LAFR-01-0470 ref|NP_776863.1| protein S (alpha) [Bos taurus] sp|P07224|PROS_BOVIN Vitamin ... K ... nnamed protein product [Bos taurus] gb|AAA30757.1| vitamin ... K-dependent protein S precursor NP_776863.1 2.1 37 ...

  17. NCBI nr-aa BLAST: CBRC-MEUG-01-2855 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2855 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-104 69% ...

  18. NCBI nr-aa BLAST: CBRC-PCAP-01-0169 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0169 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-134 76% ...

  19. NCBI nr-aa BLAST: CBRC-PHAM-01-1454 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1454 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-146 84% ...

  20. NCBI nr-aa BLAST: CBRC-OPRI-01-0130 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-0130 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-149 83% ...

  1. NCBI nr-aa BLAST: CBRC-PVAM-01-1251 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1251 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-158 88% ...

  2. NCBI nr-aa BLAST: CBRC-MEUG-01-1902 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-1902 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-62 43% ...

  3. NCBI nr-aa BLAST: CBRC-MMUR-01-1320 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1320 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-131 73% ...

  4. NCBI nr-aa BLAST: CBRC-MDOM-05-0266 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-05-0266 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-130 74% ...

  5. NCBI nr-aa BLAST: CBRC-VPAC-01-1001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1001 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-159 90% ...

  6. NCBI nr-aa BLAST: CBRC-PVAM-01-0007 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0007 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-131 80% ...

  7. NCBI nr-aa BLAST: CBRC-OPRI-01-1224 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-1224 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-153 85% ...

  8. NCBI nr-aa BLAST: CBRC-MMUR-01-0630 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0630 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-149 84% ...

  9. NCBI nr-aa BLAST: CBRC-TTRU-01-0358 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0358 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-73 59% ...

  10. NCBI nr-aa BLAST: CBRC-STRI-01-2166 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2166 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-140 84% ...

  11. NCBI nr-aa BLAST: CBRC-STRI-01-2372 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2372 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-127 71% ...

  12. NCBI nr-aa BLAST: CBRC-MMUR-01-0453 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0453 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-157 89% ...

  13. NCBI nr-aa BLAST: CBRC-STRI-01-0147 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-0147 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 3e-56 86% ...

  14. NCBI nr-aa BLAST: CBRC-PVAM-01-0947 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0947 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predi...cted) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 3e-55 88% ...

  15. NCBI nr-aa BLAST: CBRC-OPRI-01-0797 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-0797 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 3e-62 66% ...

  16. NCBI nr-aa BLAST: CBRC-VPAC-01-1445 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1445 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-116 76% ...

  17. NCBI nr-aa BLAST: CBRC-MEUG-01-1697 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-1697 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 5e-96 55% ...

  18. NCBI nr-aa BLAST: CBRC-MMUR-01-1184 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1184 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predi...cted) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 1e-135 90% ...

  19. NCBI nr-aa BLAST: CBRC-VPAC-01-0115 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-0115 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predi...cted) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 5e-96 89% ...

  20. NCBI nr-aa BLAST: CBRC-VPAC-01-0218 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-0218 ref|XP_609523.4| PREDICTED: similar to olfactory receptor 694 (predi...cted) [Bos taurus] ref|XP_001256288.2| PREDICTED: similar to olfactory receptor 694 (predicted) [Bos taurus] XP_609523.4 6e-61 49% ...

  1. NCBI nr-aa BLAST: CBRC-VPAC-01-1344 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1344 ref|XP_874556.1| PREDICTED: similar to olfactory receptor 49 (predi...cted) [Bos taurus] ref|XP_001255792.1| PREDICTED: similar to olfactory receptor 49 (predicted) [Bos taurus] XP_874556.1 3e-26 80% ...

  2. NCBI nr-aa BLAST: CBRC-MEUG-01-0695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0695 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 2e-85 72% ...

  3. NCBI nr-aa BLAST: CBRC-VPAC-01-1210 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1210 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predi...cted) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 1e-158 89% ...

  4. NCBI nr-aa BLAST: CBRC-MLUC-01-0866 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0866 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-157 88% ...

  5. NCBI nr-aa BLAST: CBRC-PVAM-01-0549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0549 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-163 91% ...

  6. NCBI nr-aa BLAST: CBRC-STRI-01-2179 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2179 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 4e-84 75% ...

  7. NCBI nr-aa BLAST: CBRC-MEUG-01-2070 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2070 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-144 81% ...

  8. NCBI nr-aa BLAST: CBRC-MMUR-01-0605 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0605 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-135 74% ...

  9. NCBI nr-aa BLAST: CBRC-OPRI-01-1169 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-1169 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 8e-50 71% ...

  10. NCBI nr-aa BLAST: CBRC-PVAM-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1099 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 9e-88 57% ...

  11. NCBI nr-aa BLAST: CBRC-MEUG-01-1941 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-1941 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-144 81% ...

  12. NCBI nr-aa BLAST: CBRC-TSYR-01-1421 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-1421 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predi...cted) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 1e-155 87% ...

  13. NCBI nr-aa BLAST: CBRC-VPAC-01-0256 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-0256 ref|XP_609523.4| PREDICTED: similar to olfactory receptor 694 (predi...cted) [Bos taurus] ref|XP_001256288.2| PREDICTED: similar to olfactory receptor 694 (predicted) [Bos taurus] XP_609523.4 1e-130 80% ...

  14. NCBI nr-aa BLAST: CBRC-GGOR-01-0397 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGOR-01-0397 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-151 85% ...

  15. NCBI nr-aa BLAST: CBRC-MDOM-04-0253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-04-0253 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-143 81% ...

  16. NCBI nr-aa BLAST: CBRC-MEUG-01-2113 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2113 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-128 72% ...

  17. NCBI nr-aa BLAST: CBRC-OPRI-01-1172 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-1172 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-42 89% ...

  18. NCBI nr-aa BLAST: CBRC-MMUR-01-0509 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0509 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-95 56% ...

  19. NCBI nr-aa BLAST: CBRC-MLUC-01-0240 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0240 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-136 78% ...

  20. NCBI nr-aa BLAST: CBRC-MMUR-01-1132 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1132 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 3e-53 70% ...

  1. NCBI nr-aa BLAST: CBRC-MLUC-01-0366 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0366 ref|XP_589319.3| PREDICTED: similar to olfactory receptor 601 (predi...cted) [Bos taurus] ref|XP_001256154.2| PREDICTED: similar to olfactory receptor 601 (predicted) [Bos taurus] XP_589319.3 1e-145 83% ...

  2. NCBI nr-aa BLAST: CBRC-PHAM-01-1507 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1507 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predi...cted) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 1e-148 84% ...

  3. NCBI nr-aa BLAST: CBRC-PVAM-01-0746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-0746 ref|XP_595062.2| PREDICTED: similar to olfactory receptor 564 (predi...cted) [Bos taurus] ref|XP_001256907.1| PREDICTED: similar to olfactory receptor 564 (predicted) [Bos taurus] XP_595062.2 1e-156 87% ...

  4. NCBI nr-aa BLAST: CBRC-STRI-01-2300 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-STRI-01-2300 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 8e-44 81% ...

  5. NCBI nr-aa BLAST: CBRC-MDOM-04-0254 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-04-0254 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-146 82% ...

  6. NCBI nr-aa BLAST: CBRC-VPAC-01-1531 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1531 ref|XP_609523.4| PREDICTED: similar to olfactory receptor 694 (predi...cted) [Bos taurus] ref|XP_001256288.2| PREDICTED: similar to olfactory receptor 694 (predicted) [Bos taurus] XP_609523.4 1e-120 74% ...

  7. NCBI nr-aa BLAST: CBRC-PCAP-01-0275 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0275 ref|XP_001255625.1| PREDICTED: similar to olfactory receptor 586 (predi...cted) [Bos taurus] ref|XP_001252523.1| PREDICTED: similar to olfactory receptor 586 (predicted) [Bos taurus] XP_001255625.1 1e-101 71% ...

  8. NCBI nr-aa BLAST: CBRC-TSYR-01-1380 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-1380 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-158 88% ...

  9. NCBI nr-aa BLAST: CBRC-MLUC-01-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0034 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 1e-41 92% ...

  10. NCBI nr-aa BLAST: CBRC-PCAP-01-0356 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PCAP-01-0356 ref|XP_875347.3| PREDICTED: similar to olfactory receptor 561 (predi...cted) [Bos taurus] ref|XP_001788816.1| PREDICTED: similar to olfactory receptor 561 (predicted) [Bos taurus] XP_875347.3 3e-66 84% ...

  11. NCBI nr-aa BLAST: CBRC-TTRU-01-0107 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0107 ref|XP_595585.2| PREDICTED: similar to olfactory receptor Olr60 (predi...cted) [Bos taurus] ref|XP_001253182.1| PREDICTED: similar to olfactory receptor Olr60 (predicted) [Bos taurus] XP_595585.2 1e-125 77% ...

  12. NCBI nr-aa BLAST: CBRC-RNOR-02-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-02-0074 ref|NP_001068665.1| hypothetical protein LOC505318 [Bos taurus] gb|AAI20076.1| ... ar to Olfactomedin-like protein 3 precursor (HNOEL-iso ) (hOLF44) [Bos taurus] NP_001068665.1 1e-169 88% ...

  13. Mitochondrial DNA of Nellore and European x Nellore crossing cattle of high performance DNA mitocondrial de bovinos Nelore e cruzados Europeu x Nelore de alto desempenho

    Directory of Open Access Journals (Sweden)

    Rogério Abdallah Curi


    Full Text Available The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69 and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275. Only 2.26% (8/354 of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.O objetivo deste trabalho foi avaliar, por meio de um polimorfismo no gene ND5 do DNA mitocondrial de bovinos, a porcentagem de indivíduos portadores de mtDNA Bos taurus indicus em animais Nelore PO (n = 69 e em animais provenientes do cruzamento entre machos europeus e fêmeas Nelore PO (n = 275. Apenas 2,26% (8/354 dos animais apresentaram mtDNA Bos taurus indicus. A alta freqüência de mtDNA Bos taurus taurus nesses animais pode ser reflexo de seleção, uma vez que os animais estudados se originam de linhagens selecionadas para alto desempenho de produção de carne.

  14. NCBI nr-aa BLAST: CBRC-MEUG-01-2806 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2806 ref|NP_001019744.1| phosphatidic acid phosphatase type 2 domain c...ontaining 2 [Bos taurus] sp|Q58DI5|PPAC2_BOVIN RecName: Full=Presqualene diphosphate phosphatase; AltName: Full=Phosphatidic acid ph...osphatase type 2 domain-containing protein 2 gb|AAX46459.1| hypothetical LOC403313 [...Bos taurus] gb|AAI48000.1| Phosphatidic acid phosphatase type 2 domain containing 2 [Bos taurus] NP_001019744.1 1e-126 78% ...

  15. NCBI nr-aa BLAST: CBRC-TTRU-01-0145 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0145 ref|NP_001019744.1| phosphatidic acid phosphatase type 2 domain c...ontaining 2 [Bos taurus] sp|Q58DI5|PPAC2_BOVIN RecName: Full=Presqualene diphosphate phosphatase; AltName: Full=Phosphatidic acid ph...osphatase type 2 domain-containing protein 2 gb|AAX46459.1| hypothetical LOC403313 [...Bos taurus] gb|AAI48000.1| Phosphatidic acid phosphatase type 2 domain containing 2 [Bos taurus] NP_001019744.1 1e-152 93% ...

  16. NCBI nr-aa BLAST: CBRC-TSYR-01-1455 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TSYR-01-1455 ref|NP_001019744.1| phosphatidic acid phosphatase type 2 domain c...ontaining 2 [Bos taurus] sp|Q58DI5|PPAC2_BOVIN RecName: Full=Presqualene diphosphate phosphatase; AltName: Full=Phosphatidic acid ph...osphatase type 2 domain-containing protein 2 gb|AAX46459.1| hypothetical LOC403313 [...Bos taurus] gb|AAI48000.1| Phosphatidic acid phosphatase type 2 domain containing 2 [Bos taurus] NP_001019744.1 1e-142 88% ...

  17. NCBI nr-aa BLAST: CBRC-MDOM-06-0110 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-06-0110 ref|NP_001019744.1| phosphatidic acid phosphatase type 2 domain c...ontaining 2 [Bos taurus] sp|Q58DI5|PPAC2_BOVIN RecName: Full=Presqualene diphosphate phosphatase; AltName: Full=Phosphatidic acid ph...osphatase type 2 domain-containing protein 2 gb|AAX46459.1| hypothetical LOC403313 [...Bos taurus] gb|AAI48000.1| Phosphatidic acid phosphatase type 2 domain containing 2 [Bos taurus] NP_001019744.1 1e-124 75% ...

  18. Bovine gene polymorphisms related to fat deposition and meat tenderness

    Directory of Open Access Journals (Sweden)

    Marina R.S. Fortes


    Full Text Available Leptin, thyroglobulin and diacylglycerol O-acyltransferase play important roles in fat metabolism. Fat deposition has an influence on meat quality and consumers' choice. The aim of this study was to determine allele and genotype frequencies of polymorphisms of the bovine genes, which encode leptin (LEP, thyroglobulin (TG and diacylglycerol O-acyltransferase (DGAT1. A further objective was to establish the effects of these polymorphisms on meat characteristics. We genotyped 147 animals belonging to the Nelore (Bos indicus, Canchim (5/8 Bos taurus + 3/8 Bos indicus, Rubia Gallega X Nelore (1/2 Bos taurus + 1/2 Bos indicus, Brangus Three-way cross (9/16 Bos taurus + 7/16 Bos indicus and Braunvieh Three-way cross (3/4 Bos taurus + 1/4 Bos indicus breeds. Backfat thickness, total lipids, marbling score, ribeye area and shear force were fitted, using the General Linear Model (GLM procedure of the SAS software. The least square means of genotypes and genetic groups were compared using Tukey's test. Allele frequencies vary among the genetic groups, depending on Bos indicus versus Bos taurus influence. The LEP polymorphism segregates in pure Bos indicus Nelore animals, which is a new finding. The T allele of TG is fixed in Nelore, and DGAT1 segregates in all groups, but the frequency of allele A is lower in Nelore animals. The results showed no association between the genotypes and traits studied, but a genetic group effect on these traits was found. So, the genetic background remains relevant for fat deposition and meat tenderness, but the gene markers developed for Bos taurus may be insufficient for Bos indicus.

  19. Bovine gene polymorphisms related to fat deposition and meat tenderness. (United States)

    Fortes, Marina R S; Curi, Rogério A; Chardulo, Luis Artur L; Silveira, Antonio C; Assumpção, Mayra E O D; Visintin, José Antonio; de Oliveira, Henrique N


    Leptin, thyroglobulin and diacylglycerol O-acyltransferase play important roles in fat metabolism. Fat deposition has an influence on meat quality and consumers' choice. The aim of this study was to determine allele and genotype frequencies of polymorphisms of the bovine genes, which encode leptin (LEP), thyroglobulin (TG) and diacylglycerol O-acyltransferase (DGAT1). A further objective was to establish the effects of these polymorphisms on meat characteristics. We genotyped 147 animals belonging to the Nelore (Bos indicus), Canchim (5/8 Bos taurus + 3/8 Bos indicus), Rubia Gallega X Nelore (1/2 Bos taurus + 1/2 Bos indicus), Brangus Three-way cross (9/16 Bos taurus + 7/16 Bos indicus) and Braunvieh Three-way cross (3/4 Bos taurus + 1/4 Bos indicus) breeds. Backfat thickness, total lipids, marbling score, ribeye area and shear force were fitted, using the General Linear Model (GLM) procedure of the SAS software. The least square means of genotypes and genetic groups were compared using Tukey's test. Allele frequencies vary among the genetic groups, depending on Bos indicus versus Bos taurus influence. The LEP polymorphism segregates in pure Bos indicus Nelore animals, which is a new finding. The T allele of TG is fixed in Nelore, and DGAT1 segregates in all groups, but the frequency of allele A is lower in Nelore animals. The results showed no association between the genotypes and traits studied, but a genetic group effect on these traits was found. So, the genetic background remains relevant for fat deposition and meat tenderness, but the gene markers developed for Bos taurus may be insufficient for Bos indicus. PMID:21637649

  20. UniProt search blastx result: AK289205 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK289205 J100052K23 Q06154|PME17_BOVIN Melanocyte protein Pmel 17 precursor (Silver locus protei ... n homolog) (Retinal pigment ... epithelial-specific protein) - Bos taurus (Bovine) ...

  1. 50 CFR 14.4 - What terms do I have to understand? (United States)


    ... zoological park, accredited institution of higher education, accredited member of the American Zoo and... domesticus; Cattle—Bos taurus; Dog (domestic)—Canis familiaris; European rabbit—Ortyctolagus...

  2. ClEST cluster :Cl_contig0318 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0318 histone-lysine ... n-methyltransferase setmar Cimex lectularius nuclear gene 571 TTTGA ... AATTTTCGAGTTTTTTCACTTTTC fw04055 mb08029 2 histone-lysine ... N-methyltransferase SETMAR [Bos taurus] NP_0010771 ...

  3. ClEST cluster :Cl_singleton0423 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0423 dna ... replication licensing factor mcm9-like Cimex lectularius nuclear gene 423 C ... CAAAGAAAGAGTGAGGCGTTAAATGCATC fb20074 1 PREDICTED: DNA ... replication licensing factor MCM9-like [Bos taurus ...

  4. Gene : CBRC-EEUR-01-0692 [SEVENS

    Lifescience Database Archive (English)


  5. Gene : CBRC-EEUR-01-1371 [SEVENS

    Lifescience Database Archive (English)


  6. Gene : CBRC-EEUR-01-0808 [SEVENS

    Lifescience Database Archive (English)


  7. Gene : CBRC-LAFR-01-2783 [SEVENS

    Lifescience Database Archive (English)


  8. Gene : CBRC-OGAR-01-0064 [SEVENS

    Lifescience Database Archive (English)


  9. Gene : CBRC-DNOV-01-1361 [SEVENS

    Lifescience Database Archive (English)


  10. Gene : CBRC-SARA-01-0996 [SEVENS

    Lifescience Database Archive (English)


  11. Gene : CBRC-TBEL-01-2442 [SEVENS

    Lifescience Database Archive (English)


  12. Genome sequences of mannheimia haemolytica serotype A2: ovine and bovine isolates (United States)

    This report describes the genome sequences of Mannheimia haemolytica, serotype A2 isolated from pneumonic lungs of two different ruminant species, one from Ovis aries, designated as Ovine (O) and the other from Bos taurus, designated as Bovine (B)....

  13. Revisiting AFLP fingerprinting for an unbiased assessment of genetic structure and differentiation of taurine and zebu cattle

    NARCIS (Netherlands)

    Utsunomiya, Yuri T.; Bomba, Lorenzo; Lucente, Giordana; Colli, Licia; Negrini, Riccardo; Lenstra, Johannes A.; Erhardt, Georg; Garcia, José F.; Ajmone-Marsan, Paolo; Moazami-Goudarzi, K.; Williams, J.; Wiener, P.; Olsaker, I.; Kantanen, J.; Dunner, S.; Cañón, J.; Rodellar, C.; Martín-Burriel, I.; Valentini, A.; Zanotti, M.; Holm, L. E.; Eythorsdottir, E.; Mommens, G.; Polygen, Van Haeringen; Nijman, I. J.; Dolf, G.; Bradley, D. G.


    Background: Descendants from the extinct aurochs (Bos primigenius), taurine (Bos taurus) and zebu cattle (Bos indicus) were domesticated 10,000 years ago in Southwestern and Southern Asia, respectively, and colonized the world undergoing complex events of admixture and selection. Molecular data, in

  14. Gene : CBRC-BTAU-01-2842 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2842 UN A Glycoprotein hormones receptors TSH R_BOVIN 0.0 99% ref|NP_776631.1| thyro ... timulating hormone receptor [Bos taurus] sp|Q27987|TSH R_BOVIN Thyrotropin receptor precursor (TSH -R) (Thy ... ting hormone receptor) gb|AAC18639.1| thyrotropin (TSH ) receptor [Bos taurus] 0.0 99% gnl|UG|Bt#S11933528 ...

  15. NCBI nr-aa BLAST: CBRC-DNOV-01-3022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ase type 2 domain-containing protein 2) gb|AAX46459.1| hypothetical LOC403313 [Bos taurus] gb|AAI48000.1| Phosphatidic acid phospha...CBRC-DNOV-01-3022 ref|NP_001019744.1| phosphatidic acid phosphatase type 2 domain c...ontaining 2 [Bos taurus] sp|Q58DI5|PPAC2_BOVIN Presqualene diphosphate phosphatase (Phosphatidic acid phosphat

  16. NCBI nr-aa BLAST: CBRC-OANA-01-1315 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-1315 ref|NP_776671.1| arginine vasopressin receptor 2 (nephrogenic diabetes insipidus) [Bos taurus] sp|P48044|V2R_BOVIN Vasopressin V2 receptor (Renal-type arginine vasopressin receptor) (Antidiuretic hormone receptor) (AVPR V2) emb|CAA58709.1| arginine vasopressin receptor V2 [Bos taurus] NP_776671.1 1e-124 67% ...

  17. NCBI nr-aa BLAST: CBRC-CFAM-39-0039 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CFAM-39-0039 ref|NP_776671.1| arginine vasopressin receptor 2 (nephrogenic diabetes insipidus) [Bos taurus] sp|P48044|V2R_BOVIN Vasopressin V2 receptor (Renal-type arginine vasopressin receptor) (Antidiuretic hormone receptor) (AVPR V2) emb|CAA58709.1| arginine vasopressin receptor V2 [Bos taurus] NP_776671.1 0.0 88% ...

  18. Unigene BLAST: CBRC-PMAR-01-0271 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0271 gnl|UG|Pma#S35112282 PMAH-aab50h07.g1 Lamprey_EST_Olfactory Petromyzon marinus ... cDNA 5' similar to ref|NP_776765.1| histidine ... triad nucleotide binding protein 2 [Bos taurus] gb ... |AAM00370.1| histidine ... triad protein 3 [Bos taurus], mRNA sequence /clone ...

  19. Unigene BLAST: CBRC-PMAR-01-0315 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0315 gnl|UG|Pma#S35112282 PMAH-aab50h07.g1 Lamprey_EST_Olfactory Petromyzon marinus ... cDNA 5' similar to ref|NP_776765.1| histidine ... triad nucleotide binding protein 2 [Bos taurus] gb ... |AAM00370.1| histidine ... triad protein 3 [Bos taurus], mRNA sequence /clone ...

  20. Growth and reproductive development from weaning through 20 months of age among breeds of bulls in subtropical Florida. (United States)

    Chase, C C; Chenoweth, P J; Larsen, R E; Olson, T A; Hammond, A C; Menchaca, M A; Randel, R D


    To determine the effect of breed on growth and reproductive development, weaned bulls in each of 2 yr were managed as a single group for approximately a year. In Year 1, the study group consisted of 24 Angus, 24 Brahman, 20 Hereford and 14 Senepol bulls, while in Year 2, it contained 25 Angus, 17 Brahman. 13 Romosinuano and 9 Nellore x Brahman bulls. Body and testicular growth measurements were recorded at 6-wk intervals. At approximately 1 yr of age and quarterly thereafter (4 periods), bulls were evaluated for libido, pubertal status, and GnRH-induced LH and testosterone secretion. Significant breed-by-age interactions occurred for most growth measurements. Brahman bulls (Bos indicus ) were (P Angus, Hereford, Senepol and Romosinuano bulls (Bos taurus ). Libido scores were lowest for Brahman and Nell ore x Brahman bulls (Bos indicus ). highest for Angus and Hereford bulls (temperate Bos taurus breeds) and intermediate for Senepol and Romosinuano bulls (tropical Bos taurus breeds; P Angus and Hereford bulls (temperate breeds) than for Brahman, Senepol, Romosinuano and Nellore x Brahman bulls (tropical breeds). In conclusion, reproductive development of Senepol and Romosinuano bulls (tropical Bos taurus breeds) was more similar to Angus and Hereford bulls (temperate Bos taurus breeds) than to Brahman and Nellore x Brahman bulls (Bos indicus ). PMID:16728024

  1. Observations of the interstellar ice grain feature in the Taurus molecular clouds

    Energy Technology Data Exchange (ETDEWEB)

    Whittet, D.C.B.; Bode, H.F.; Longmore, A.J.; Baines, D.W.T.; Evans, A.


    Although water ice was originally proposed as a major constituent of the interstellar grain population (e.g. Oort and van de Hulst, 1946), the advent of infrared astronomy has shown that the expected absorption due to O-H stretching vibrations at 3 is illusive. Observations have in fact revealed that the carrier of this feature is apparently restricted to regions deep within dense molecular clouds (Merrill et al., 1976; Willner et al., 1982). However, the exact carrier of this feature is still controversial, and many questions remain as to the conditions required for its appearance. It is also uncertain whether it is restricted to circumstellar shells, rather than the general cloud medium. Detailed discussion of the 3 band properties is given elsewhere in this volume. 15 references, 4 figures.

  2. Polyphase Alpine deformation at the northern edge of the Menderes Taurus block, North Konya, Central Turkey (United States)

    Eren, Yasar


    Low-grade metamorphic rocks of Paleozoic-Mesozoic age to the north of Konya, consist of two different groups. The Silurian-Lower Permian Sizma Group is composed of reefal complex metacarbonates at the base, and flyschoid metaclastics at the top. Metaigneous rocks of various compositions occur as dykes, sills, and lava flows within this group. The ?Upper Permian-Mesozoic age Ardicli Group unconformably overlies the Sizma Group and is composed of, from bottom to top, coarse metaclastics, a metaclastic-metacarbonate alternation, a thick sequence of metacarbonate, and alternating units of metachert, metacarbonates and metaclastics. Although pre-Alpine overthrusts can be recognized in the Sizma Group, intense Alpine deformation has overprinted and obliterated earlier structures. Both the Sizma and Ardicli Groups were deformed, and metamorphosed during the Alpine orogeny. Within the study area evidence for four phases of deformation and folding is found. The first phase of deformation resulted in the major Ertugrul Syncline, overturned tight to isoclinal and minor folding, and penetrative axial planar cleavage developed during the Alpine crustal shortening at the peak of metamorphism. Depending on rock type, syntectonic crystallization, rotation, and flattening of grains and pressure solution were the main deformation mechanisms. During the F 2-phase, continued crustal shortening produced coaxial Type-3 refolded folds, which can generally be observed in outcrop with associated crenulation cleavage (S 2). Refolding of earlier folds by the noncoaxial F 3-folding event generated Type-2 interference patterns and the major Meydan Synform which is the largest map-scale structure within the study area. Phase 3 structures also include crenulation cleavage (S 3) and conjugate kink folds. Further shortening during phase 4 deformation also resulted in crenulation cleavage and conjugate kink folds. According to thin section observations, phases 2-4 crenulation cleavages are mainly the result of microfolding with pressure solution and mineral growth.

  3. Het Nederlandse bos als vorm van bodemgebruik

    NARCIS (Netherlands)

    Slangen, L.H.G.; Boven, van B.


    Behandeling van de oppervlakte en verdeling van het bos en de veranderingen die hierin zijn opgetreden, met de bedrijfsgrootte-struktuur als belangrijke invalshoek daarbij; de rol van de overheid: doeleinden, instrumenten en effekten van het beleid

  4. 9 CFR 95.1 - Definitions. (United States)


    ... in the FSIS regulations at 9 CFR 310.22(a). Suspect for a transmissible spongiform encephalopathy. (1..., hoof meal, horn meal, blood meal, meat meal, tankage, glands, organs, or other parts or products of... animals. Bone meal means ground animal bones and hoof meal and horn meal. Bovine. Bos taurus, Bos...

  5. Dual Origins of Dairy Cattle Farming – Evidence from a Comprehensive Survey of European Y-Chromosomal Variation

    DEFF Research Database (Denmark)

    Edwards, Ceiridwen J; Genja, Catarina; Kantanen, Juha;


    , with limited breed panels, identified two Bos taurus (taurine) haplogroups (Y1 and Y2; both composed of several haplotypes) and one Bos indicus (indicine/zebu) haplogroup (Y3), as well as a strong phylogeographic structuring of paternal lineages. Methodology and Principal Findings: Haplogroup data were...

  6. Mapping of quantitative trait loci controlling tick [Riphicephalus (Boophilus) microplus] resistance on bovine cjrp,psp,es 5, 7 and 14 (United States)

    Since Bos taurus and Bos indicus cattle breeds have diverged at approximately 10.000 years ago, the differences in the process of domestication and subsequent selection for desired phenotypes is presumed to have contributed the phenotypic and genetic differences between these subspecies. Of particu...

  7. AcEST: DK955653 [AcEST

    Lifescience Database Archive (English)

    Full Text Available nase WNK4 OS=Rattu... 29 9.6 sp|P98091|MUCS_BOVIN Submaxillary mucin-like protein OS=Bos taur... 29 9.6 sp|Q...PLPLASC----DQESLSAQTAETENEASRN 971 >sp|P98091|MUCS_BOVIN Submaxillary mucin-like protein OS=Bos taurus PE=2

  8. Genomic divergence of indicine and taurine cattle identified through high-density SNP genotyping (United States)

    At an arguable date of around 330,000 years ago there were already at least two different types of cattle that became ancestors of nearly all modern cattle, the Bos primigenius taurus more adapted to temperate climates and the tropically adapted Bos primigenius indicus. Human selection exponentially...

  9. Genome-wide association study for intramuscular fat deposition and composition in Nellore cattle (United States)

    Red meat from Bos taurus and Bos indicus breeds are an important source of nutrients for humans and intramuscular fat (IMF) influences its flavor, nutritional value and impacts human health. Human consumption of fat that contains high levels of monounsaturated fatty acids (MUFA) can reduce the conce...

  10. Imunoidentification of Albumin and Osteopontin in Seminal Plasma of Taurine and Zebuine Bulls/ Imunoidentificação de Albumina e Osteopontina no Plasma Seminal de Reprodutores Taurinos e Zebuínos

    Directory of Open Access Journals (Sweden)

    Rodrigo Costa Mattos


    Full Text Available Two dimensional polyacrylamide gel electrophoresis was performed in seminal plasma of seven Bos taurus taurus and seven Bos taurus indicus bulls with high semen freezability, from an artificialinsemination center. In a 8% polyacrylamide gels, three bands of 195, 66 and 55 kDa, present in 100% of the samples in both sub-species, were analyzed by their optical densities. In Bos taurus samples, the opticals densities of 55 kDa band, imunoidentified as osteopontin were superior (pAs proteínas do plasma seminal de 14 reprodutores (7 Bos taurus taurus e 7 Bos taurus indicus, foram analisadas por eletroforese bidimensional, em géis de poliacrilamida a 8%, corados por Comassie Blue. Três bandas protéicas, presentes em 100% das amostras de plasma seminal, foram quantificadas de acordo com a densidade óptica exibida: 195 kDa, pI 6,5-7,5 ; 66 kDa, pI 5,4 e 55 kDa, pI 4,5. As amostras de plasma seminal provenientes de taurinos apresentaram densidades ópticas significativamente superiores (p < 0,05 às dos zebuínos na banda de 55 kDa, que foi imunoidentificada como osteopontina. As demais proteínas analisadas não apresentaram variações significativas entre as subespécies. A banda protéica de 66 kDa, foi imunoidentificada como albumina. Nas amostras provenientes de taurinos, as densidades ópticas das três bandas protéicas quantificadas não evidenciaram variação significativa entre os reprodutores. Entretanto, nos zebuínos, as densidades ópticas da albumina apresentaram diferenças significativas entre os touros (p < 0,05.

  11. Infestación natural de hembras de Boophilus microplus Canestrini, 1887 (Acari: Ixodidae) en dos genotipos de bovinos en el trópico húmedo de Veracruz, México


    Miguel Ángel Alonso Díaz; Barud Josué López Silva; Ana Carolina Leme de Magalhães Labarthe; Roger Iván Rodríguez Vivas


    El objetivo del presente estudio fue determinar la dinámica poblacional anual de Boophilus microplus en dos genotipos de ganado bovino. El estudio se realizó en Martínez de la Torre, Veracruz, México (región trópico húmeda). Se utilizaron 20 toretes de diez meses de edad y 185 kg de peso, infestados naturalmente con garrapatas B. microplus. Se formaron dos grupos de diez animales cada uno, según el genotipo (¾ Bos taurus [½ Holstein, ¼ Simmental, ¼ Cebú] y ½ Bos taurus [½ Holstein, ½ Cebú]). ...

  12. Evidence for detection of 1-10 MeV emission from the Taurus region in 1971 August (United States)

    Gruber, D. E.; Ling, J. C.


    Results are reported for three observations of the Crab Nebula with a balloon-borne actively collimated NaI detector over the energy range from 0.2 to 10 MeV. Possible changes in instrument performance and environmental background levels during the balloon flights are investigated, and fits for source strength are made over four broad energy channels. X-ray power-law spectra and pulsed-flux fractions are determined for both the Crab Nebula and its pulsar, NP 0532. A statistically significant flux greatly in excess of the power law was detected above 1 MeV during one flight; this flux, which has declined by at least a factor of 4 or 5 at the times of more recent observations, is assumed to be real and is attributed to the nebula.

  13. Dust Processing and Grain Growth in Protoplanetary Disks in the Taurus-Auriga Star-Forming Region

    CERN Document Server

    Sargent, B A; Tayrien, C; McClure, M K; Watson, Dan M; Sloan, G C; Li, A; Manoj, P; Bohac, C J; Furlan, E; Kim, K H; Green, J D


    Mid-infrared spectra of 65 T Tauri stars (TTS) taken with the Infrared Spectrograph (IRS) on board the Spitzer Space Telescope are modeled using dust at two temperatures to probe the radial variation in dust composition in the uppermost layers of protoplanetary disks. Most spectra indicating crystalline silicates require Mg-rich minerals and silica, but a few suggest otherwise. Spectra indicating abundant enstatite at higher temperatures also require crystalline silicates at temperatures lower than those required for spectra showing high abundance of other crystalline silicates. A few spectra show 10 micron complexes of very small equivalent width. They are fit well using abundant crystalline silicates but very few large grains, inconsistent with the expectation that low peak-to-continuum ratio of the 10 micron complex always indicates grain growth. Most spectra in our sample are fit well without using the opacities of large crystalline silicate grains. If large grains grow by agglomeration of submicron grain...

  14. Produção de Leite em Primíparas de Bovinos Hereford e Desenvolvimento Ponderal de Terneiros Cruzas Taurinos e Zebuínos

    Directory of Open Access Journals (Sweden)

    Mendonça Gilson de


    Full Text Available O objetivo deste trabalho foi avaliar a produção de leite de vacas de corte primíparas e o desenvolvimento ponderal dos terneiros de dois genótipos entre o nascimento e o desmame. Foram utilizadas 48 novilhas da raça Hereford (Bos taurus, com idade de três anos, manejadas sobre campo natural. As raças paternas utilizadas foram Red Angus (Bos taurus e Nelore (Bos indicus, em 16 e 32 vacas respectivamente. Os fatores estudados foram genótipo do terneiro (GENOT -- Bos taurus x Bos taurus e Bos taurus x Bos indicus, época de nascimento (EPOCN distribuída em três períodos -- 1S (setembro, 2O (outubro e 3N (novembro e sexo do terneiro (SEXO. Foram realizadas dez medidas de produção de leite pelo método indireto pesagem - mamada - pesagem e onze medidas de peso para vacas e terneiros, em intervalos de 21 dias. A média diária geral de produção de leite foi de 4,80 ± 0,09 kg. Não foram verificadas diferenças significativas na produção de leite em relação aos fatores estudados. O ganho de peso dos terneiros foi influenciado significativamente pela EPOCN, mas não pelo GENOT e SEXO. Concluiu-se que a produção de leite de vacas de corte primíparas, manejadas em campo natural, não foi influenciada pelo GENOT, EPOCN e SEXO dos terneiros. O desenvolvimento ponderal dos terneiros sofreu influência apenas da EPOCN.

  15. Composição lipídica de carne bovina de grupos genéticos taurinos e zebuínos terminados em confinamento Lipid composition of meat from zebu and taurine cattle finished in confinement

    Directory of Open Access Journals (Sweden)

    Lizandra Vercezi Rossato


    Full Text Available O objetivo neste trabalho foi avaliar a composição em lipídeos totais, colesterol e ácidos graxos do músculo longissimus dorsi de bovinos Bos taurus (n=40 e Bos indicus (n=40 com 30 a 36 meses de idade e peso de carcaça entre 240 e 270 kg terminados em confinamento por 90 dias. Os resultados de lipídeos totais foram semelhantes entre os dois grupos. O nível de colesterol foi mais elevado em Bos indicus (66,95 mg/100 g que em Bos taurus (37,37 mg/100 g. Os valores médios dos ácidos graxos saturados de C14:0 e C18:0 foram mais elevados nos Bos indicus (3,52 e 22,45% em comparação aos Bos taurus (3,08 e 18,67%. O C16:0 nos Bos taurus (26,14% foi maior que nos Bos indicus (24,77%. Na análise do perfil de ácidos graxos monoinsaturados (AGM, os Bos taurus apresentaram os percentuais mais elevados de C14:1 cis9, C16:1 cis9, C18:1 cis9, ΣAGM e os menores de C18:1 trans. Os animais Bos taurus apresentaram maiores percentuais de C18:3 n-3, C20:4 n-6 e C22:5 n-3 (ácidos graxos poliinsaturados. Os ácidos graxos C18:2 n-6, CLA, C20:5 n-3, C22:6 n-3, ΣAGP e Σn-6 foram semelhantes entre grupos de bovinos. A razão n-6/n-3 foi menor em Bos taurus (4,63 em comparação aos Bos indicus (5,70. Em geral, o grupo genético influencia o perfil de colesterol e ácidos graxos de bovinos e esse efeito é mais pronunciado nos ácidos graxos saturados e monoinsaturados.This study was carried out to evaluate total lipids (TL, cholesterol and fatty acids (FA in the longissimus dorsi muscle of Bos taurus (n=40 and Bos indicus (n=40 bulls, aged 30-36 months and 240-270 kg carcass weight, finished in the feedlot for 90 days. The total lipids content was similar in both groups. Cholesterol was higher in Bos indicus (66.95 mg/100 g than in Bos taurus (37.37 mg/100 g. For saturated fatty acids, the means for C14:0 and C18:0 were higher in Bos indicus (3.52 and 22.45%, than in Bos taurus (3.08 e 18.67%. The C16:0 was higher in Bos taurus (26.14%, as compared to

  16. MULTINDELS-BOV: Zebu traceback method based on DNA insertion-deletion polymorphisms. (United States)

    Groenner-Penna, M; Croce, E F D; Pimenta, C G; Bicalho, H M S; Pena, S D J


    Brazil is a major producer and exporter of beef, with a herd of approximately 210 million animals. For the meat industry, a reliable animal traceback from its origin to the consumer market is paramount. Of all available identification systems, DNA is the only one that survives the slaughterhouse and reaches the dish of the consumer. DNA polymorphisms are already used for cattle traceback, but primarily for the subspecies Bos taurus taurus. However, in Brazil, another subspecies, B. taurus indicus predominates. We describe here the development of a DNA traceback method designed primarily for B. taurus indicus (Zebu), without leaving B. taurus taurus aside. We used insertion/deletion (indel) polymorphisms, which have the advantage of being simple and easily automatable, since in most cases, the variable loci are biallelic. We studied 94 indels, with a difference of two or more base pairs, in DNA pools of 60 Zebu and 60 taurine animals. A set of 22 indels with heterozygosity greater than 0.3 were selected and used to construct two multiplex PCRs. On the basis of the allelic frequency of these indels, the probability of random match was calculated to be 1.12 x 10(-8) for B. taurus indicus and 1.60 x 10(-6) for B. taurus taurus. Moreover, we estimated that an analysis would cost less than US$15.00 per animal. Thus, this system (MULTINDELS-BOV) is perfectly suited for building large genetic databases and offering viable prospects of a national system for cattle traceback DNA in Brazil. PMID:25501139

  17. Application of Background Oriented Schlieren (BOS) in Underground Mine Ventilation


    Jong, Edmund Chime


    The schlieren technique describes an optical analysis method designed to enhance light distortions caused by air movement. The ability to visualize gas flows has significant implications for analyzing underground mine ventilation systems. Currently, the widely utilized traditional schlieren methods are impractical underground due to complex equipment and design requirements. Background oriented schlieren (BOS) provides a solution to this problem. BOS requires two primary components, a pro...

  18. Quantitative trait locus affecting birth weight on bovine chromosome 5 in a F2 Gyr x Holstein population

    Directory of Open Access Journals (Sweden)

    Gustavo Gasparin


    Full Text Available Segregation between a genetic marker and a locus influencing a quantitative trait in a well delineated population is the basis for success in mapping quantitative trait loci (QTL. To detect bovine chromosome 5 (BTA5 birth weight QTL we genotyped 294 F2 Gyr (Bos indicus x Holstein (Bos taurus crossbreed cattle for five microsatellite markers. A linkage map was constructed for the markers and an interval analysis for the presence of QTL was performed. The linkage map indicated differences in the order of two markers relative to the reference map ( Interval analysis detected a QTL controlling birth weight (p < 0.01 at 69 centimorgans (cM from the most centromeric marker with an effect of 0.32 phenotypic standard-error. These results support other studies with crossbred Bos taurus x Bos indicus populations.

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available yelinase 2) (Neutral sphingomyelinase II) (nSMase2) (nSMase-2) (Confluent 3Y1 cell-associated protein 1) isoform 1 [Bos taurus] XP_592012.3 7.4 33% ... ...CBRC-SARA-01-1177 ref|XP_592012.3| PREDICTED: similar to Sphingomyelin phosphodiesterase 3 (Neutral sphingom

  20. Dicty_cDB: CFH537 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available one) Bos taurus sphingomyelin phosphodi... 43 0.006 ( Q92485 ) RecName: Full=Acid sphingomyelinase...A sequence from clone ... 37 0.26 ( P58242 ) RecName: Full=Acid sphingomyelinase-like phosphodiester... 37 0

  1. NCBI nr-aa BLAST: CBRC-TBEL-01-0595 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-0595 ref|NP_001014890.1| rhodopsin [Bos taurus] sp|P02699|OPSD_BOVIN Rhodopsin pdb| ... ms Resolution pdb|2G87|A Chain A, Crystallographic Model ... Of Bathorhodopsin pdb|2G87|B Chain B, Crystallogra ... phic Model ... Of Bathorhodopsin pdb|2HPY|A Chain A, Crystallogra ...

  2. NCBI nr-aa BLAST: CBRC-BTAU-01-2416 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2416 ref|NP_001014890.1| rhodopsin [Bos taurus] sp|P02699|OPSD_BOVIN Rhodopsin pdb| ... ms Resolution pdb|2G87|A Chain A, Crystallographic Model ... Of Bathorhodopsin pdb|2G87|B Chain B, Crystallogra ... phic Model ... Of Bathorhodopsin pdb|2HPY|A Chain A, Crystallogra ...

  3. Gene : CBRC-BTAU-01-2416 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-BTAU-01-2416 UN A Opsins OPSD_BOVIN 0.0 100% ref|NP_001014890.1| rhodopsin [Bos taurus] sp| ... ms Resolution pdb|2G87|A Chain A, Crystallographic Model ... Of Bathorhodopsin pdb|2G87|B Chain B, Crystallogra ... phic Model ... Of Bathorhodopsin pdb|2HPY|A Chain A, Crystallogra ...

  4. Optimizing Stocking Rate for Maximum Return to Wheat-cattle Enterprise Using Model Simulation and Economics (United States)

    Managing dual-purpose wheat is complex because of the tradeoff relationship between cattle (Bos taurus) and wheat (Triticum aestivum L.) production. Stocking rate (SR) and planting date are the key decision variables of the dual systems. The objective was to develop decision support information th...

  5. NCBI nr-aa BLAST: CBRC-OPRI-01-1271 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OPRI-01-1271 ref|XP_607274.4| PREDICTED: similar to Neurofilament heavy polypeptide (NF-H) (Neurofilame...nt triplet H protein) (200 kDa neurofilament protein) isoform 1 [Bos taurus] XP_607274.4 0.0 68% ...

  6. NCBI nr-aa BLAST: CBRC-MMUR-01-0931 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-0931 ref|XP_870725.3| PREDICTED: similar to Neurofilament heavy polypeptide (NF-H) (Neurofilame...nt triplet H protein) (200 kDa neurofilament protein) isoform 2 [Bos taurus] XP_870725.3 1e-176 70% ...

  7. NCBI nr-aa BLAST: CBRC-CJAC-01-0290 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available f yeast long chain polyunsaturated fatty acid elongatio [Bos taurus] NP_001040062.1 1e-162 87% ... ...p|Q2KJD9|ELOV5_BOVIN Elongation of very long chain fatty acids protein 5 gb|AAI05392.1| Similar to homolog o

  8. Zvířecí skelet z laténského objektu v Nových Dvorech, okr. Kutná Hora

    Czech Academy of Sciences Publication Activity Database

    Kyselý, René


    Roč. 63, č. 2 (2011), s. 253-255. ISSN 0323-1267 Institutional research plan: CEZ:AV0Z80020508 Keywords : ritual * La Tène period * osteology * Bos taurus * cattle Subject RIV: AC - Archeology, Anthropology, Ethnology

  9. NCBI nr-aa BLAST: CBRC-TTRU-01-0638 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TTRU-01-0638 ref|NP_776631.1| thyroid stimulating hormone receptor precursor [Bos taurus] s ... p|Q27987|TSH R_BOVIN RecName: Full=Thyrotropin receptor; AltName ... : Full=Thyroid-stimulating hormone receptor; Short=TSH -R; Flags: Precursor gb|AAC18639.1| thyrotropin (TS ...

  10. NCBI nr-aa BLAST: CBRC-MLUC-01-0781 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-0781 ref|NP_776631.1| thyroid stimulating hormone receptor precursor [Bos taurus] s ... p|Q27987|TSH R_BOVIN RecName: Full=Thyrotropin receptor; AltName ... : Full=Thyroid-stimulating hormone receptor; Short=TSH -R; Flags: Precursor gb|AAC18639.1| thyrotropin (TS ...

  11. NCBI nr-aa BLAST: CBRC-MDOM-01-0248 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-01-0248 ref|NP_776631.1| thyroid stimulating hormone receptor precursor [Bos taurus] s ... p|Q27987|TSH R_BOVIN RecName: Full=Thyrotropin receptor; AltName ... : Full=Thyroid-stimulating hormone receptor; Short=TSH -R; Flags: Precursor gb|AAC18639.1| thyrotropin (TS ...

  12. NCBI nr-aa BLAST: CBRC-PVAM-01-1583 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1583 ref|NP_776631.1| thyroid stimulating hormone receptor precursor [Bos taurus] s ... p|Q27987|TSH R_BOVIN RecName: Full=Thyrotropin receptor; AltName ... : Full=Thyroid-stimulating hormone receptor; Short=TSH -R; Flags: Precursor gb|AAC18639.1| thyrotropin (TS ...

  13. NCBI nr-aa BLAST: CBRC-VPAC-01-1644 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-VPAC-01-1644 ref|NP_776631.1| thyroid stimulating hormone receptor precursor [Bos taurus] s ... p|Q27987|TSH R_BOVIN RecName: Full=Thyrotropin receptor; AltName ... : Full=Thyroid-stimulating hormone receptor; Short=TSH -R; Flags: Precursor gb|AAC18639.1| thyrotropin (TS ...

  14. NCBI nr-aa BLAST: CBRC-MEUG-01-0280 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-0280 ref|NP_776631.1| thyroid stimulating hormone receptor precursor [Bos taurus] s ... p|Q27987|TSH R_BOVIN RecName: Full=Thyrotropin receptor; AltName ... : Full=Thyroid-stimulating hormone receptor; Short=TSH -R; Flags: Precursor gb|AAC18639.1| thyrotropin (TS ...

  15. Dicty_cDB: Contig-U00839-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U00839-1 no gap 136 2 3438619 3438483 MINUS 1 1 U00839 0 0 0 0 0 0 0 0 0 0 1 0 0 0 Show C ... 64 1 ( EW966801 ) HDLice3rdlarv_01_O07_T7 Headlice composite ... librar... 54 0.001 1 ( AC185064 ) Bos taurus clone ...

  16. Dicty_cDB: Contig-U16097-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available none) Danio rerio mRNA for calcium/calmo... 198 2e-57 BC120285_1( BC120285 |pid:none) Bos taurus pregnancy u...yvqvkkvmilg*qild*vkylemvii*khvvvvhqnm*hqkf*nvnhtikhviygvlv lspmfy*lvvshfgirimlyfmrklem*tygwpeglevsneakdlvshl...gafsivreatsratgtkvaiksintrfiknkllmreieimkkvgdhpnilklyevy ettkhlhlvlelvtggelfdkivekgsyseadaskivrqivsavghlhsig...nqr iyyvqvkkvmilg*qild*vkylemvii*khvvvvhqnm*hqkf*nvnhtikhviygvlv lspmfy*lvvshfgirimlyfmrklem*tygwpeglevsneak

  17. Dicty_cDB: CHQ187 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2 AY689436 |AY689436.1 Deerpox virus W-848-83, complete genome. 38 2.9 3 AY689437 |AY689437.1 Deer...57063 |AC157063.2 Bos taurus clone CH240-64J16, *** SEQUENCING IN PROGRESS ***, 29 unordered pieces. 40 2.4

  18. AcEST: DK943793 [AcEST

    Lifescience Database Archive (English)

    Full Text Available cus GN=Cry2 P... 30 4.9 sp|Q0IIH7|ST14_BOVIN Suppressor of tumorigenicity protein 14 OS=... 30 6.5 sp|O88307...TNNPRFDRMEG 329 >sp|Q0IIH7|ST14_BOVIN Suppressor of tumorigenicity protein 14 OS=Bos taurus GN=ST14 PE=2 SV=

  19. Grazing initiation timing affects net rturn to dual-purpose wheat systems (United States)

    Limited experimental data are available to allow direct evaluation of the effects of grazing initiation timing on net returns to dual-purpose wheat systems. The objectives were to simulate the effect of grazing initiation dates on net returns to a wheat (Triticum aestivum L.) – cattle (Bos taurus) ...

  20. NCBI nr-aa BLAST: CBRC-MEUG-01-2752 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2752 ref|NP_001094680.1| GDP-fucose ... transporter 1 [Bos taurus] sp|A6QM03|FUCT1_BOVI ... N RecName: Full=GDP-fucose ... transporter 1; AltName: Full=Solute carrier family ...