
Sample records for bohrium 274

  1. Atomic Mass and Nuclear Binding Energy for Bh-274 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-274 (Bohrium, atomic number Z = 107, mass number A = 274).

  2. Graphs for Isotopes of 107-Bh (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides a graphic representation of nucleon separation energies and residual interaction parameters for isotopes of the chemical element 107-Bh (Bohrium, atomic number Z = 107).

  3. Chemical characterization of bohrium (element 107) (United States)

    Eichler; Bruchle; Dressler; Dullmann; Eichler; Gaggeler; Gregorich; Hoffman; Hubener; Jost; Kirbach; Laue; Lavanchy; Nitsche; Patin; Piguet; Schadel; Shaughnessy; Strellis; Taut; Tobler; Tsyganov; Turler; Vahle; Wilk; Yakushev


    The arrangement of the chemical elements in the periodic table highlights resemblances in chemical properties, which reflect the elements' electronic structure. For the heaviest elements, however, deviations in the periodicity of chemical properties are expected: electrons in orbitals with a high probability density near the nucleus are accelerated by the large nuclear charges to relativistic velocities, which increase their binding energies and cause orbital contraction. This leads to more efficient screening of the nuclear charge and corresponding destabilization of the outer d and f orbitals: it is these changes that can give rise to unexpected chemical properties. The synthesis of increasingly heavy elements, now including that of elements 114, 116 and 118, allows the investigation of this effect, provided sufficiently long-lived isotopes for chemical characterization are available. In the case of elements 104 and 105, for example, relativistic effects interrupt characteristic trends in the chemical properties of the elements constituting the corresponding columns of the periodic table, whereas element 106 behaves in accordance with the expected periodicity. Here we report the chemical separation and characterization of six atoms of element 107 (bohrium, Bh), in the form of its oxychloride. We find that this compound is less volatile than the oxychlorides of the lighter elements of group VII, thus confirming relativistic calculations that predict the behaviour of bohrium, like that of element 106, to coincide with that expected on the basis of its position in the periodic table. PMID:10993071

  4. Chemical characterization of bohrium (element 107) (United States)

    Eichler, R.; Brüchle, W.; Dressler, R.; Düllmann, Ch. E.; Eichler, B.; Gäggeler, H. W.; Gregorich, K. E.; Hoffman, D. C.; Hübener, S.; Jost, D. T.; Kirbach, U. W.; Laue, C. A.; Lavanchy, V. M.; Nitsche, H.; Patin, J. B.; Piguet, D.; Schädel, M.; Shaughnessy, D. A.; Strellis, D. A.; Taut, S.; Tobler, L.; Tsyganov, Y. S.; Türler, A.; Vahle, A.; WiIk, P. A.; Yakushev, A. B.


    The arrangement of the chemical elements in the periodic table highlights resemblances in chemical properties, which reflect the elements' electronic structure. For the heaviest elements, however, deviations in the periodicity of chemical properties are expected: electrons in orbitals with a high probability density near the nucleus are accelerated by the large nuclear charges to relativistic velocities, which increase their binding energies and cause orbital contraction. This leads to more efficient screening of the nuclear charge and corresponding destabilization of the outer d and f orbitals: it is these changes that can give rise to unexpected chemical properties. The synthesis of increasingly heavy elements, now including that of elements 114, 116 and 118, allows the investigation of this effect, provided sufficiently long-lived isotopes for chemical characterization are available. In the case of elements 104 and 105, for example, relativistic effects interrupt characteristic trends in the chemical properties of the elements constituting the corresponding columns of the periodic table, whereas element 106 behaves in accordance with the expected periodicity. Here we report the chemical separation and characterization of six atoms of element 107 (bohrium, Bh), in the form of its oxychloride. We find that this compound is less volatile than the oxychlorides of the lighter elements of group VII, thus confirming relativistic calculations that predict the behaviour of bohrium, like that of element 106, to coincide with that expected on the basis of its position in the periodic table.

  5. Chemical separation procedure proposed for studies of bohrium

    International Nuclear Information System (INIS)

    Off-line and on-line studies have been performed with radioactive tracers of various elements to develop a chemical separation procedure for bohrium (element 107). The proposed procedure is intended for use in the fast solvent extraction system SISAK. The homologs technetium and rhenium were used to model the chemical behavior of bohrium. The results show that high decontamination factors can be obtained for technetium and rhenium with respect to unwanted contaminants like trivalent actinides, polonium and the Group 5 elements. (author)

  6. From bohrium to copernicium and beyond SHE research at SHIP (United States)

    Münzenberg, G.


    Heavy-element research with SHIP at GSI is reviewed including the discovery of the chemical elements bohrium to copernicium, experimental developments, cold fusion of heavy ions, and the discovery of a shell region around hassium. Elements bohrium and heavier are located beyond the limit of liquid-drop stability. They exist by shell stabilization. A universal, sensitive, and fast method: in-flight separation and identification of single atomic nuclei has been developed with the velocity filter SHIP and the detector system to measure decay sequences of individual atoms. Research with single atomic nuclei including detection methods, identification, and physics results will be discussed. Experiments with actinide targets as well as prospects with NUSTAR at FAIR will be addressed.

  7. 7 CFR 274.7 - Coupon management. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Coupon management. 274.7 Section 274.7 Agriculture... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM ISSUANCE AND USE OF COUPONS § 274.7 Coupon management. (a) Coupon inventory management. State agencies shall establish coupon inventory management systems...

  8. 7 CFR 274.3 - Issuance systems. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Issuance systems. 274.3 Section 274.3 Agriculture... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM ISSUANCE AND USE OF COUPONS § 274.3 Issuance systems. (a) System classification. State agencies may issue benefits to households through any of the...

  9. 33 CFR 274.3 - References. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false References. 274.3 Section 274.3 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE PEST CONTROL PROGRAM FOR CIVIL WORKS PROJECTS Project Operation § 274.3 References. (a) Pub. L. 92-516,...

  10. Atomic Mass and Nuclear Binding Energy for Bh-318 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-318 (Bohrium, atomic number Z = 107, mass number A = 318).

  11. Atomic Mass and Nuclear Binding Energy for Bh-356 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-356 (Bohrium, atomic number Z = 107, mass number A = 356).

  12. Atomic Mass and Nuclear Binding Energy for Bh-322 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-322 (Bohrium, atomic number Z = 107, mass number A = 322).

  13. Atomic Mass and Nuclear Binding Energy for Bh-351 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-351 (Bohrium, atomic number Z = 107, mass number A = 351).

  14. Atomic Mass and Nuclear Binding Energy for Bh-310 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-310 (Bohrium, atomic number Z = 107, mass number A = 310).

  15. Atomic Mass and Nuclear Binding Energy for Bh-336 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-336 (Bohrium, atomic number Z = 107, mass number A = 336).

  16. Atomic Mass and Nuclear Binding Energy for Bh-299 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-299 (Bohrium, atomic number Z = 107, mass number A = 299).

  17. Atomic Mass and Nuclear Binding Energy for Bh-288 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-288 (Bohrium, atomic number Z = 107, mass number A = 288).

  18. Atomic Mass and Nuclear Binding Energy for Bh-359 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-359 (Bohrium, atomic number Z = 107, mass number A = 359).

  19. Atomic Mass and Nuclear Binding Energy for Bh-343 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-343 (Bohrium, atomic number Z = 107, mass number A = 343).

  20. Atomic Mass and Nuclear Binding Energy for Bh-304 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-304 (Bohrium, atomic number Z = 107, mass number A = 304).

  1. Atomic Mass and Nuclear Binding Energy for Bh-280 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-280 (Bohrium, atomic number Z = 107, mass number A = 280).

  2. Atomic Mass and Nuclear Binding Energy for Bh-349 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-349 (Bohrium, atomic number Z = 107, mass number A = 349).

  3. Atomic Mass and Nuclear Binding Energy for Bh-325 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-325 (Bohrium, atomic number Z = 107, mass number A = 325).

  4. Atomic Mass and Nuclear Binding Energy for Bh-332 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-332 (Bohrium, atomic number Z = 107, mass number A = 332).

  5. Atomic Mass and Nuclear Binding Energy for Bh-306 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-306 (Bohrium, atomic number Z = 107, mass number A = 306).

  6. Atomic Mass and Nuclear Binding Energy for Bh-324 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-324 (Bohrium, atomic number Z = 107, mass number A = 324).

  7. Atomic Mass and Nuclear Binding Energy for Bh-293 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-293 (Bohrium, atomic number Z = 107, mass number A = 293).

  8. Atomic Mass and Nuclear Binding Energy for Bh-327 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-327 (Bohrium, atomic number Z = 107, mass number A = 327).

  9. Atomic Mass and Nuclear Binding Energy for Bh-350 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-350 (Bohrium, atomic number Z = 107, mass number A = 350).

  10. Atomic Mass and Nuclear Binding Energy for Bh-308 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-308 (Bohrium, atomic number Z = 107, mass number A = 308).

  11. Atomic Mass and Nuclear Binding Energy for Bh-358 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-358 (Bohrium, atomic number Z = 107, mass number A = 358).

  12. Atomic Mass and Nuclear Binding Energy for Bh-321 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-321 (Bohrium, atomic number Z = 107, mass number A = 321).

  13. Atomic Mass and Nuclear Binding Energy for Bh-345 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-345 (Bohrium, atomic number Z = 107, mass number A = 345).

  14. Atomic Mass and Nuclear Binding Energy for Bh-286 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-286 (Bohrium, atomic number Z = 107, mass number A = 286).

  15. Atomic Mass and Nuclear Binding Energy for Bh-307 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-307 (Bohrium, atomic number Z = 107, mass number A = 307).

  16. Atomic Mass and Nuclear Binding Energy for Bh-303 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-303 (Bohrium, atomic number Z = 107, mass number A = 303).

  17. Atomic Mass and Nuclear Binding Energy for Bh-312 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-312 (Bohrium, atomic number Z = 107, mass number A = 312).

  18. Atomic Mass and Nuclear Binding Energy for Bh-294 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-294 (Bohrium, atomic number Z = 107, mass number A = 294).

  19. Atomic Mass and Nuclear Binding Energy for Bh-326 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-326 (Bohrium, atomic number Z = 107, mass number A = 326).

  20. Atomic Mass and Nuclear Binding Energy for Bh-273 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-273 (Bohrium, atomic number Z = 107, mass number A = 273).

  1. Atomic Mass and Nuclear Binding Energy for Bh-284 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-284 (Bohrium, atomic number Z = 107, mass number A = 284).

  2. Atomic Mass and Nuclear Binding Energy for Bh-315 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-315 (Bohrium, atomic number Z = 107, mass number A = 315).

  3. Atomic Mass and Nuclear Binding Energy for Bh-328 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-328 (Bohrium, atomic number Z = 107, mass number A = 328).

  4. Atomic Mass and Nuclear Binding Energy for Bh-311 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-311 (Bohrium, atomic number Z = 107, mass number A = 311).

  5. Atomic Mass and Nuclear Binding Energy for Bh-353 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-353 (Bohrium, atomic number Z = 107, mass number A = 353).

  6. Atomic Mass and Nuclear Binding Energy for Bh-348 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-348 (Bohrium, atomic number Z = 107, mass number A = 348).

  7. Atomic Mass and Nuclear Binding Energy for Bh-360 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-360 (Bohrium, atomic number Z = 107, mass number A = 360).

  8. Atomic Mass and Nuclear Binding Energy for Bh-347 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-347 (Bohrium, atomic number Z = 107, mass number A = 347).

  9. Atomic Mass and Nuclear Binding Energy for Bh-277 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-277 (Bohrium, atomic number Z = 107, mass number A = 277).

  10. Atomic Mass and Nuclear Binding Energy for Bh-309 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-309 (Bohrium, atomic number Z = 107, mass number A = 309).

  11. Atomic Mass and Nuclear Binding Energy for Bh-340 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-340 (Bohrium, atomic number Z = 107, mass number A = 340).

  12. Atomic Mass and Nuclear Binding Energy for Bh-285 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-285 (Bohrium, atomic number Z = 107, mass number A = 285).

  13. Atomic Mass and Nuclear Binding Energy for Bh-341 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-341 (Bohrium, atomic number Z = 107, mass number A = 341).

  14. Atomic Mass and Nuclear Binding Energy for Bh-283 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-283 (Bohrium, atomic number Z = 107, mass number A = 283).

  15. Atomic Mass and Nuclear Binding Energy for Bh-305 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-305 (Bohrium, atomic number Z = 107, mass number A = 305).

  16. Atomic Mass and Nuclear Binding Energy for Bh-331 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-331 (Bohrium, atomic number Z = 107, mass number A = 331).

  17. Atomic Mass and Nuclear Binding Energy for Bh-342 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-342 (Bohrium, atomic number Z = 107, mass number A = 342).

  18. Atomic Mass and Nuclear Binding Energy for Bh-300 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-300 (Bohrium, atomic number Z = 107, mass number A = 300).

  19. Atomic Mass and Nuclear Binding Energy for Bh-330 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-330 (Bohrium, atomic number Z = 107, mass number A = 330).

  20. Atomic Mass and Nuclear Binding Energy for Bh-296 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-296 (Bohrium, atomic number Z = 107, mass number A = 296).

  1. Atomic Mass and Nuclear Binding Energy for Bh-338 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-338 (Bohrium, atomic number Z = 107, mass number A = 338).

  2. Atomic Mass and Nuclear Binding Energy for Bh-270 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-270 (Bohrium, atomic number Z = 107, mass number A = 270).

  3. Atomic Mass and Nuclear Binding Energy for Bh-320 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-320 (Bohrium, atomic number Z = 107, mass number A = 320).

  4. Atomic Mass and Nuclear Binding Energy for Bh-346 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-346 (Bohrium, atomic number Z = 107, mass number A = 346).

  5. Atomic Mass and Nuclear Binding Energy for Bh-357 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-357 (Bohrium, atomic number Z = 107, mass number A = 357).

  6. Atomic Mass and Nuclear Binding Energy for Bh-319 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-319 (Bohrium, atomic number Z = 107, mass number A = 319).

  7. Atomic Mass and Nuclear Binding Energy for Bh-337 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-337 (Bohrium, atomic number Z = 107, mass number A = 337).

  8. Atomic Mass and Nuclear Binding Energy for Bh-329 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-329 (Bohrium, atomic number Z = 107, mass number A = 329).

  9. Atomic Mass and Nuclear Binding Energy for Bh-276 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-276 (Bohrium, atomic number Z = 107, mass number A = 276).

  10. Atomic Mass and Nuclear Binding Energy for Bh-335 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-335 (Bohrium, atomic number Z = 107, mass number A = 335).

  11. Atomic Mass and Nuclear Binding Energy for Bh-314 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-314 (Bohrium, atomic number Z = 107, mass number A = 314).

  12. Atomic Mass and Nuclear Binding Energy for Bh-281 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-281 (Bohrium, atomic number Z = 107, mass number A = 281).

  13. Atomic Mass and Nuclear Binding Energy for Bh-282 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-282 (Bohrium, atomic number Z = 107, mass number A = 282).

  14. Atomic Mass and Nuclear Binding Energy for Bh-339 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-339 (Bohrium, atomic number Z = 107, mass number A = 339).

  15. Atomic Mass and Nuclear Binding Energy for Bh-275 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-275 (Bohrium, atomic number Z = 107, mass number A = 275).

  16. Atomic Mass and Nuclear Binding Energy for Bh-289 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-289 (Bohrium, atomic number Z = 107, mass number A = 289).

  17. Atomic Mass and Nuclear Binding Energy for Bh-316 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-316 (Bohrium, atomic number Z = 107, mass number A = 316).

  18. Atomic Mass and Nuclear Binding Energy for Bh-354 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-354 (Bohrium, atomic number Z = 107, mass number A = 354).

  19. Atomic Mass and Nuclear Binding Energy for Bh-355 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-355 (Bohrium, atomic number Z = 107, mass number A = 355).

  20. Atomic Mass and Nuclear Binding Energy for Bh-295 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-295 (Bohrium, atomic number Z = 107, mass number A = 295).

  1. Atomic Mass and Nuclear Binding Energy for Bh-272 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-272 (Bohrium, atomic number Z = 107, mass number A = 272).

  2. Atomic Mass and Nuclear Binding Energy for Bh-334 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-334 (Bohrium, atomic number Z = 107, mass number A = 334).

  3. Atomic Mass and Nuclear Binding Energy for Bh-279 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-279 (Bohrium, atomic number Z = 107, mass number A = 279).

  4. Atomic Mass and Nuclear Binding Energy for Bh-323 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-323 (Bohrium, atomic number Z = 107, mass number A = 323).

  5. Atomic Mass and Nuclear Binding Energy for Bh-352 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-352 (Bohrium, atomic number Z = 107, mass number A = 352).

  6. Atomic Mass and Nuclear Binding Energy for Bh-298 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-298 (Bohrium, atomic number Z = 107, mass number A = 298).

  7. Atomic Mass and Nuclear Binding Energy for Bh-317 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-317 (Bohrium, atomic number Z = 107, mass number A = 317).

  8. Atomic Mass and Nuclear Binding Energy for Bh-344 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-344 (Bohrium, atomic number Z = 107, mass number A = 344).

  9. Atomic Mass and Nuclear Binding Energy for Bh-302 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-302 (Bohrium, atomic number Z = 107, mass number A = 302).

  10. Atomic Mass and Nuclear Binding Energy for Bh-292 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-292 (Bohrium, atomic number Z = 107, mass number A = 292).

  11. Atomic Mass and Nuclear Binding Energy for Bh-287 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-287 (Bohrium, atomic number Z = 107, mass number A = 287).

  12. Atomic Mass and Nuclear Binding Energy for Bh-301 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-301 (Bohrium, atomic number Z = 107, mass number A = 301).

  13. Atomic Mass and Nuclear Binding Energy for Bh-291 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-291 (Bohrium, atomic number Z = 107, mass number A = 291).

  14. Atomic Mass and Nuclear Binding Energy for Bh-278 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-278 (Bohrium, atomic number Z = 107, mass number A = 278).

  15. Atomic Mass and Nuclear Binding Energy for Bh-290 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-290 (Bohrium, atomic number Z = 107, mass number A = 290).

  16. Atomic Mass and Nuclear Binding Energy for Bh-333 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-333 (Bohrium, atomic number Z = 107, mass number A = 333).

  17. Atomic Mass and Nuclear Binding Energy for Bh-268 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-268 (Bohrium, atomic number Z = 107, mass number A = 268).

  18. Atomic Mass and Nuclear Binding Energy for Bh-313 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-313 (Bohrium, atomic number Z = 107, mass number A = 313).

  19. Atomic Mass and Nuclear Binding Energy for Bh-271 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-271 (Bohrium, atomic number Z = 107, mass number A = 271).

  20. Atomic Mass and Nuclear Binding Energy for Bh-269 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-269 (Bohrium, atomic number Z = 107, mass number A = 269).

  1. Atomic Mass and Nuclear Binding Energy for Bh-297 (Bohrium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Bh-297 (Bohrium, atomic number Z = 107, mass number A = 297).

  2. 33 CFR 274.4 - Pesticide management. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Pesticide management. 274.4... DEFENSE PEST CONTROL PROGRAM FOR CIVIL WORKS PROJECTS Project Operation § 274.4 Pesticide management. (a... control management personnel prior to advertisement of the contract and procurement of services....

  3. Dicty_cDB: CHR274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR274 (Link to dictyBase) - G23014 DDB0205932 Contig-U11587-1 | Contig-U13150-1 CHR...274P (Link to Original site) CHR274F 618 CHR274Z 715 CHR274P 1313 - - Show CHR274 Libr...ary CH (Link to library) Clone ID CHR274 (Link to dictyBase) Atlas ID - NBRP ID G23014 dictyBase ID Representative seq. ID CHR274P (Link to Original site) ...Representative DNA sequence >CHR274 (CHR274Q) /CSM/CH/CHR2-D/CHR274Q.Seq.d/ GTAATAATAATTTTAAAAAATCAAATAGTAAT

  4. Dicty_cDB: VSD274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSD274 (Link to dictyBase) - - - Contig-U15476-1 VSD274P (Link to Original site) VSD2...74F 554 VSD274Z 516 VSD274P 1070 - - Show VSD274 Library VS (Link to library) Clone ID VSD2...e URL Representative seq. ID VSD2...74P (Link to Original site) Representative DNA sequence >VSD274 (VSD274Q) /CSM/VS/VSD2-D/VSD2...vsnlvksklsn Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VSD274 (VSD274Q) /CSM/VS/VSD2

  5. 33 CFR 274.5 - Certification. (United States)


    ... PEST CONTROL PROGRAM FOR CIVIL WORKS PROJECTS Project Operation § 274.5 Certification. Under the... certification of Civil Works personnel. Pending final approval of the DOD Agency Plan, all Corps of Engineers... and the Division Engineer....

  6. 32 CFR 274.1 - Purpose. (United States)


    ... GOVERNING COMPETITIVE BIDDING ON U.S. GOVERNMENT GUARANTEED MILITARY EXPORT LOAN AGREEMENTS § 274.1 Purpose... designee may, from time to time, by public notice, offer financial institutions the opportunity to bid...

  7. 40 CFR 27.4 - Investigation. (United States)


    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PROGRAM FRAUD CIVIL REMEDIES § 27.4... privilege. (b) If the investigating official concludes that an action under the Program Fraud Civil Remedies... official to avoid interference with a criminal investigation or prosecution. (d) Nothing in this...

  8. 21 CFR 558.274 - Hygromycin B. (United States)


    ....4 grams per pound to No. 051311 in § 510.600(c) of this chapter for use in swine feed as in... citations affecting § 558.274, see the List of CFR Sections Affected, which appears in the Finding...

  9. 48 CFR 211.274 - Item identification and valuation requirements. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Item identification and valuation requirements. 211.274 Section 211.274 Federal Acquisition Regulations System DEFENSE ACQUISITION... Requirements Documents 211.274 Item identification and valuation requirements....

  10. 48 CFR 211.274-3 - Policy for valuation. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Policy for valuation. 211.274-3 Section 211.274-3 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM... Documents 211.274-3 Policy for valuation. (a) It is DoD policy that contractors shall be required...

  11. 8 CFR 274a.3 - Continuing employment of unauthorized aliens. (United States)


    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Continuing employment of unauthorized aliens. 274a.3 Section 274a.3 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS CONTROL OF EMPLOYMENT OF ALIENS Employer Requirements § 274a.3 Continuing employment...

  12. Biosorption of Acid Red 274 (AR 274) on Enteromorpha prolifera in a batch system

    International Nuclear Information System (INIS)

    The biosorption of Acid Red 274 (AR 274) dye on Enteromorpha prolifera, a green algae grown on Mersin costs of the Mediterranean, Turkey, was studied as a function of initial pH, temperature, initial dye and biosorbent concentration. The experiments were conducted in a batch manner. The Langmuir and Freundlich isotherms were used for modelling the biosorption equilibrium. At optimum temperature 30 deg C and initial pH 2.0-3.0, the Langmuir isotherm fits best to the experimental equilibrium data with a maximum monolayer coverage of 244 mg/g. The equilibrium AR 274 concentration of the exit stream of a single batch was also obtained by using the experimental equilibrium curve and operating line graphically. The pseudosecond-order kinetic model and Weber-Morris model were applied to the experimental data and it was found that both the surface adsorption as well as intraparticle diffusion contribute to the actual adsorption process. The biosorption process follows a pseudosecond-order kinetics and activation energy was determined as -4.85 kJ/mol. Thermodynamic studies showed that the biosorption of AR 274 on E. prolifera is exothermic and spontaneous in nature

  13. Dicty_cDB: VHH274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHH274 (Link to dictyBase) - - - Contig-U11369-1 VHH274P (Link to Original ... sk*iflshckyylis*yeylerlvgrr*ssfssflq*nl gnvw*cslll*tlc **gryhstftfsiydf Frame B: l**ffncflivyclffif*liis*f ...

  14. Theoretical predictions on the low-lying excitation structure of super-heavy element bohrium (Z=107)

    International Nuclear Information System (INIS)

    The success of theoretical and experimental study of fermium (Z=100) enlightened authors to perform further investigation of heavy elements. The authors studied some low-lying absorption spectroscopy and the resonant absorption probability of bohrium (Z=107) by using MCDF method which included the correlation effects and relativistic effects systematically. The authors hope the results will be useful for the further experiments

  15. Theoretical predications on the low-lying excitation structure of super-heavy element bohrium (Z=107)

    International Nuclear Information System (INIS)

    The success of theoretical and experimental study of fermium (z=100) enlightened us to perform further investigation of heavy elements. We studied some low-lying absorption spectroscopy and the resonant absorption probability of bohrium (Z=107) by using MCDF method which considered the correlation effects and relativistic effects systematically. We hope our results will be useful for the further experiments. (authors)

  16. 8 CFR 274a.8 - Prohibition of indemnity bonds. (United States)


    ... EMPLOYMENT OF ALIENS Employer Requirements § 274a.8 Prohibition of indemnity bonds. (a) General. It is... of this section or, if the individual cannot be located, to the general fund of the Treasury....

  17. Test report - 241-AN-274 Caustic Pump Control Building

    Energy Technology Data Exchange (ETDEWEB)

    Paintner, G.P.


    This Acceptance Test Report documents the test results of test procedure WHC-SD-WM-ATP-135 `Acceptance Test Procedure for the 241-AN- 274 Caustic Pump Control Building.` The objective of the test was to verify that the 241-AN-274 Caustic Pump Control Building functions properly based on design specifications per applicable H-2-85573 drawings and associated ECN`s. The objective of the test was met.

  18. Test report - 241-AN-274 Caustic Pump Control Building

    International Nuclear Information System (INIS)

    This Acceptance Test Report documents the test results of test procedure WHC-SD-WM-ATP-135 'Acceptance Test Procedure for the 241-AN- 274 Caustic Pump Control Building.' The objective of the test was to verify that the 241-AN-274 Caustic Pump Control Building functions properly based on design specifications per applicable H-2-85573 drawings and associated ECN's. The objective of the test was met

  19. Dicty_cDB: VFA274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFA274 (Link to dictyBase) - - - Contig-U14973-1 VFA274P (Link to Original ... 868872 |CA868872.1 pw91b05.y1 Haemonchus contortus intestine ... pAMP1 v1 Haemonchus contortus cDNA 5' similar to S ... 869913 |CA869913.1 px13e02.y1 Haemonchus contortus intestine ... pAMP1 v1 Haemonchus contortus cDNA 5' similar to S ...

  20. 26 CFR 1.274-5A - Substantiation requirements. (United States)


    ....274-5A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX... which is of a type generally considered to constitute entertainment, amusement, or recreation, or with... evidence indicated a taxpayer incurred deductible travel or entertainment expense but the exact...

  1. 33 CFR 274.7 - Authorization of pesticide use. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Authorization of pesticide use... of pesticide use. (a) Programs approved in § 274.6(b) must be those as described on the pesticide label. Pesticide uses which are different from the registered use, require amendment of the...

  2. 40 CFR 180.274 - Propanil; tolerances for residues. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Propanil; tolerances for residues. 180... PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.274 Propanil; tolerances for residues. (a) General. Tolerances are established for the combined residues of...

  3. 26 CFR 1.274-6 - Expenditures deductible without regard to trade or business or other income producing activity. (United States)


    ... or business or other income producing activity. 1.274-6 Section 1.274-6 Internal Revenue INTERNAL... Deductible § 1.274-6 Expenditures deductible without regard to trade or business or other income producing activity. The provisions of §§ 1.274-1 through 1.274-5, inclusive, do not apply to any deduction...

  4. Dicty_cDB: CHE274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ary, clone:8230402C21, 3' end partial sequence, similar to ddbj:Z37164 M.musculus Cctq mRNA encoding cytosolic chaperone containing...M.musculus Cctq mRNA encoding cytosolic chaperone containing TCP-1, theta subunit (CCTtheta). 52 0.012 1 CD1... chaperonin containing ... 255 9e-67 AY823273_1( AY823273 |pid:none) Notothenia coriiceps...s CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CHE274 (CHE274Q) /CSM/CH/CHE2-D/...eq.d/ 1419 0.0 own update 2002. 9.27 Homology vs DNA Score E Sequences producing signi

  5. 17 CFR 274.201 - Form N-MFP, portfolio holdings of money market funds. (United States)


    ... of money market funds. 274.201 Section 274.201 Commodity and Securities Exchanges SECURITIES AND... Statements § 274.201 Form N-MFP, portfolio holdings of money market funds. This form shall be used by registered open-end management investment companies that are regulated as money market funds under §...

  6. Properties of an $\\alpha$ particle in a Bohrium $270$ Nucleus under the Generalized Symmetric Woods-Saxon Potential

    CERN Document Server

    Lütfüoğlu, B C


    The energy eigenvalues and the wave functions of an $\\alpha$ particle in a Bohrium $270$ nucleus were calculated by solving Schr\\"odinger equation for Generalized Symmetric Woods-Saxon potential. Using the energy spectrum by excluding and including the quasi-bound eigenvalues, entropy, internal energy, Helmholtz energy, and specific heat, as functions of reduced temperature were calculated. Stability and emission characteristics are interpreted in terms of the wave and thermodynamic functions. The kinetic energy of a decayed $\\alpha$ particle was calculated using the quasi-bound states, which is found close to the experimental value.

  7. Dicty_cDB: SLC274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ng significant alignments: (bits) Value N ( AU034219 ) Dictyostelium discoideum slug cDNA, clone SLC274. 642... 0.0 2 ( AU037813 ) Dictyostelium discoideum slug cDNA, clone SSE327. 634 0.0 2 (... AU052987 ) Dictyostelium discoideum slug cDNA, clone SLF452. 642 e-180 1 ( AU039141 ) Dictyostelium discoideum slug... cDNA, clone SSM439. 642 e-180 1 ( AU038903 ) Dictyostelium discoideum slug cDNA, clone SSM121. 642 ...e-180 1 ( AU038342 ) Dictyostelium discoideum slug cDNA, clone SSH587. 642 e-180 1 ( AU034237 ) Dictyostelium discoideum slug

  8. Dicty_cDB: CFK274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 5.2 AP008937_1820( AP008937 |pid:none) Lactobacillus fermentum IFO 395... 33 6.9 (Q5RDG2) RecName: Full=Armadillo repeat-containing... X-linked prot... 33 6.9 (Q6P1M9) RecName: Full=Armadillo repeat-containing X-linked...l*lvncql knwnfnctnsvnnnh*sly*lvn*ns*emqlnqplkmvpt*tiehppnvtmnilken*k* lvilqqifns*keminlpmhlenqc Hom...ology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CFK274 ...M/VH/VHO5-B/VHO528Q.Seq.d/ 34 2.9 own update 2004. 7.19 Homology vs DNA Score E Sequences producing signi

  9. 38 CFR 3.274 - Relationship of net worth to pension entitlement. (United States)


    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Relationship of net worth to pension entitlement. 3.274 Section 3.274 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation...

  10. 48 CFR 236.274 - Restriction on acquisition of steel for use in military construction projects. (United States)


    ..., Division E), do not acquire, or allow a contractor to acquire, steel for any construction project or... of steel for use in military construction projects. 236.274 Section 236.274 Federal Acquisition... CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Special Aspects of Contracting for Construction...

  11. 26 CFR 5e.274-8 - Travel expenses of Members of Congress. (United States)


    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Travel expenses of Members of Congress. 5e.274...) INCOME TAX (CONTINUED) TEMPORARY INCOME TAX REGULATIONS, TRAVEL EXPENSES OF MEMBERS OF CONGRESS § 5e.274-8 Travel expenses of Members of Congress. (a) In general. Members of Congress (including...

  12. 33 CFR Appendix A to Part 274 - Preventive Safety Measures in Handling of Pesticides (United States)


    ... Handling of Pesticides A Appendix A to Part 274 Navigation and Navigable Waters CORPS OF ENGINEERS... Appendix A to Part 274—Preventive Safety Measures in Handling of Pesticides 1. Follow the label on each... permitted while pesticides are being handled. 4. All pesticides must be handled in well-vetilated areas...

  13. H274Y's Effect on Oseltamivir Resistance: What Happens Before the Drug Enters the Binding Site. (United States)

    Yusuf, Muhammad; Mohamed, Nornisah; Mohamad, Suriyati; Janezic, Dusanka; Damodaran, K V; Wahab, Habibah A


    Increased reports of oseltamivir (OTV)-resistant strains of the influenza virus, such as the H274Y mutation on its neuraminidase (NA), have created some cause for concern. Many studies have been conducted in the attempt to uncover the mechanism of OTV resistance in H274Y NA. However, most of the reported studies on H274Y focused only on the drug-bound system, so the direct effects of the mutation on NA itself prior to drug binding still remain unclear. Therefore, molecular dynamics simulations of NA in apo form, followed by principal component analysis and interaction energy calculations, were performed to investigate the structural changes of the NA binding site as a result of the H274Y mutation. It was observed that the disruption of the NA binding site due to the H274Y mutation was initiated by the repulsive effect of Y274 on the 250-loop, which in turn altered the hydrogen-bonding network around residue 274. The rotated W295 side chain caused the upward movement of the 340-loop. Consequently, sliding box docking results suggested that the binding pathway of OTV was compromised because of the disruption of this binding site. This study also highlighted the importance of the functional group at C6 of the sialic acid mimicry. It is hoped that these results will improve the understanding of OTV resistance and shed some light on the design of a novel anti-influenza drug. PMID:26703840

  14. 17 CFR 274.130 - Form N-Q, quarterly schedule of portfolio holdings of registered management investment company. (United States)


    ... of portfolio holdings of registered management investment company. 274.130 Section 274.130 Commodity... INVESTMENT COMPANY ACT OF 1940 Forms for Reports § 274.130 Form N-Q, quarterly schedule of portfolio holdings of registered management investment company. This form shall be used by registered...

  15. 26 CFR 1.274-4 - Disallowance of certain foreign travel expenses. (United States)


    ... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Items Not Deductible § 1.274-4 Disallowance of certain... reference. For rules with respect to whether an expense is travel or entertainment, see paragraph...

  16. Atomic Mass and NuclearBinding Energy for Uup-274(Ununpentium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Uup-274 (Ununpentium, atomic number Z = 115, mass number A = 274).

  17. 40 CFR 81.274 - Mountain Counties Intrastate Air Quality Control Region. (United States)


    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Mountain Counties Intrastate Air... Air Quality Control Regions § 81.274 Mountain Counties Intrastate Air Quality Control Region. The Mountain Counties Intrastate Air Quality Control Region consists of the territorial area encompassed by...

  18. 26 CFR 1.274-1 - Disallowance of certain entertainment, gift and travel expenses. (United States)


    ... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Disallowance of certain entertainment, gift and... certain entertainment, gift and travel expenses. Section 274 disallows in whole, or in part, certain expenditures for entertainment, gifts and travel which would otherwise be allowable under Chapter 1 of the...

  19. 33 CFR 274.6 - Division/district pest control programs. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Division/district pest control..., DEPARTMENT OF DEFENSE PEST CONTROL PROGRAM FOR CIVIL WORKS PROJECTS Project Operation § 274.6 Division/district pest control programs. (a) Guides. Referenced technical manuals, and Engineer Circulars...

  20. 28 CFR 27.4 - Corrective action and other relief; Director, Office of Attorney Recruitment and Management. (United States)


    ...; Director, Office of Attorney Recruitment and Management. 27.4 Section 27.4 Judicial Administration..., Office of Attorney Recruitment and Management. (a) If, in connection with any investigation, the... recommendations for corrective action, to the Director, Office of Attorney Recruitment and Management...

  1. 26 CFR 1.274-7 - Treatment of certain expenditures with respect to entertainment-type facilities. (United States)


    ... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Treatment of certain expenditures with respect to entertainment-type facilities. 1.274-7 Section 1.274-7 Internal Revenue INTERNAL REVENUE SERVICE... Treatment of certain expenditures with respect to entertainment-type facilities. If deductions...

  2. 17 CFR 274.14 - Form N-8B-4, registration statements of face-amount certificate companies. (United States)


    ... N-8B-4, see the List of CFR Sections Affected, which appears in the Finding Aids section of the... statements of face-amount certificate companies. 274.14 Section 274.14 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) FORMS PRESCRIBED UNDER THE INVESTMENT COMPANY ACT OF...

  3. 17 CFR 274.218 - Form N-8F, application for deregistration of certain registered investment companies. (United States)


    ...) (15 U.S.C. 80a-3(c)(7)) of the Act; or (d) Has become a business development company. Editorial Note... registered investment company; (b) Has distributed substantially all of its assets to its shareholders and... deregistration of certain registered investment companies. 274.218 Section 274.218 Commodity and...

  4. Design and Implementation of a MAX274 - based Filter%基于MAX274的滤波器设计与实现

    Institute of Scientific and Technical Information of China (English)

    张淑娥; 王丹


    To meet the diversity requirement for filters in communication and signal processing systems, the paper analyzes the time- continuous active filter chip MAX274, which could be used to design many kinds of filters with different frequency ranges. It also gives the theoretical derivation of filter design. As an example, it designs an 8th-order Bessel active bandpass filter, of which the center frequency is 125kHz, to show the software design method. To verify its performance, the paper implements the design in a circuit board to be tested in the spectrum-characteristic-testing system. The experiment results show that this kind of filters feature high precision, low cost, simple devices and easy installation.%针对通信与信号处理系统中对滤波器多样性的需求,分析了MAXIM公司推出的能灵活设计各种类、各频段滤波器的连续时间、有源滤波器芯片MAX274,并对其设计滤波器的原理进行了推导。以设计一个中心频率为125kHz的八阶Bessel有源带通滤波器为例,给出了滤波器软件设计方法。最后为检验基于MAX274滤波器的性能,将该设计做成电路板,并用滤波器特性检测系统检验其频谱特性,实际测试结果表明该滤波器的设计频率具有精确度高、成本低等特性。

  5. The Reawakening of the Sleeping X-ray Pulsar XTE J1946+274 (United States)

    Mueller, Sebastian; Mueller, Sebastian; Kuechnel, Matthias; Fuerst, Felix; Kreykenbohm, Ingo; Sagredo, Macarena; Obst, Maria; Wilms, Joern; Caballero, Isabel; Potttschmidt, Katja; Ferrigno, Carlo; Rothschild, Richard E.


    We report on a series of outbursts of the high mass X-ray binary XTE 11946+274 in 2010/2011 as observed with INTEGRAL, RXTE, and Swift. We discuss possible mechanisms resulting in the extraordinary outburst behavior of this source. The X-ray spectra can be described by standard phenomenological models, enhanced by an absorption feature of unknown origin at about 10 keV and a narrow iron K alpha fluorescence line at 6.4keV, which are variable in flux and pulse phase. We find possible evidence for the presence of a cyclotron resonance scattering feature at about 25 keV at the 93% level. The presence of a strong cyclotron line at 35 keV seen in data from the source's 1998 outburst and confirmed by a reanalysis of these data can be excluded. This result indicates that the cyclotron line feature in XTE 11946+274 is variable between individual outbursts.

  6. The reawakening of the sleeping X-ray pulsar XTE J1946+274

    CERN Document Server

    Müller, Sebastian; Caballero, Isabel; Pottschmidt, Katja; Fürst, Felix; Kreykenbohm, Ingo; Sagredo, Macarena; Obst, Maria; Wilms, Jörn; Ferrigno, Carlo; Rothschild, Richard E; Staubert, Rüdiger


    We report on a series of outbursts of the high mass X-ray binary XTE J1946+274 in 2010/2011 as observed with INTEGRAL, RXTE, and Swift. We discuss possible mechanisms resulting in the extraordinary outburst behavior of this source. The X-ray spectra can be described by standard phenomenological models, enhanced by an absorption feature of unknown origin at about 10 keV and a narrow iron K alpha fluorescence line at 6.4 keV, which are variable in flux and pulse phase. We find possible evidence for the presence of a cyclotron resonance scattering feature at about 25 keV at the 93% level. The presence of a strong cyclotron line at 35 keV seen in data from the source's 1998 outburst and confirmed by a reanalysis of these data can be excluded. This result indicates that the cyclotron line feature in XTE J1946+274 is variable between individual outbursts.

  7. 17 CFR 274.24 - Form 24F-2, annual filing of securities sold pursuant to registration of certain investment... (United States)


    ... report filed by face amount certificate companies, open-end management companies, and unit investment.... Editorial Note: For Federal Register citations affecting Form 24F-2, see the List of CFR Sections Affected... securities sold pursuant to registration of certain investment company securities. 274.24 Section...

  8. 76 FR 9320 - Foreign-Trade Zone 274-Butte-Silver Bow, MT; Application for Manufacturing Authority REC Silicon... (United States)


    ... facility (300 employees, 3,450 metric ton capacity) is located within Site 1 of FTZ 274. The facility is used for the manufacturing of polysilicon and silane gas for the photovoltaic industry using domestic... duty orders into the facility and would accept a restriction on such admissions. FTZ procedures...

  9. 17 CFR 274.220 - Form N-17f-2, cover page for each certificate of accounting of securities and similar investments... (United States)


    ... the List of CFR Sections Affected, which appears in the Finding Aids section of the printed volume and... each certificate of accounting of securities and similar investments in the custody of a registered management investment company, filed pursuant to rule 17f-2. 274.220 Section 274.220 Commodity and...

  10. Kitten mortality in the United Kingdom: a retrospective analysis of 274 histopathological examinations (1986 to 2000). (United States)

    Cave, T A; Thompson, H; Reid, S W J; Hodgson, D R; Addie, D D


    The postmortem findings in 274 kittens were reviewed. The kittens were grouped by age at death: perinatal (kittens were postweaning and 38 (14 per cent) were preweaning. Infectious disease was identified in 55 per cent of the kittens, and 71 per cent of the infectious disease was viral and detected significantly more frequently in rescue shelter kittens than in kittens from private homes. Twenty-five per cent of all kitten mortality was due to feline parvovirus (FPV). During the neonatal and preweaning periods, the main viral infections were feline herpesvirus and calicivirus. Feline infectious peritonitis caused the death of 17 kittens in the postweaning period. The rescue shelter kittens were significantly younger than the kittens from private homes (median survival 49 and 56 days) and were more likely to have FPV. The non-pedigree kittens were significantly younger than the pedigree kittens (42 v 56 days), and the pedigree kittens were significantly less likely to originate from rescue shelters. There was no significant difference between the age distribution of the male and female kittens. No diagnosis could be found in 33 per cent of the kittens, and this failure was correlated significantly with the submission of tissue samples as opposed to the whole carcase. PMID:12430997

  11. Genome Sequencing and Comparative Analysis of the Biocontrol Agent Trichoderma harzianum sensu stricto TR274

    Energy Technology Data Exchange (ETDEWEB)

    Steindorff, Andrei S.; Noronha, Elilane F.; Ulhoa, Cirano J.; Kuo, Alan; Salamov, Asaf A.; Haridas, Sajeet; Riley, Robert W.; Druzhinina, Irina S.; Kubicek, Christian P.; Grigoriev, Igor V.


    Biological control is a complex process which requires many mechanisms and a high diversity of biochemical pathways. The species of Trichoderma harzianum are well known for their biocontrol activity against many plant pathogens. To gain new insights into the biocontrol mechanism used by T. harzianum, we sequenced the isolate TR274 genome using Illumina. The assembly was performed using AllPaths-LG with a maximum coverage of 100x. The assembly resulted in 2282 contigs with a N50 of 37033bp. The genome size generated was 40.8 Mb and the GC content was 47.7%, similar to other Trichoderma genomes. Using the JGI Annotation Pipeline we predicted 13,932 genes with a high transcriptome support. CEGMA tests suggested 100% genome completeness and 97.9% of RNA-SEQ reads were mapped to the genome. The phylogenetic comparison using orthologous proteins with all Trichoderma genomes sequenced at JGI, corroborates the Trichoderma (T. asperellum and T. atroviride), Longibrachiatum (T. reesei and T. longibrachiatum) and Pachibasium (T. harzianum and T. virens) section division described previously. The comparison between two Trichoderma harzianum species suggests a high genome similarity but some strain-specific expansions. Analyses of the secondary metabolites, CAZymes, transporters, proteases, transcription factors were performed. The Pachybasium section expanded virtually all categories analyzed compared with the other sections, specially Longibrachiatum section, that shows a clear contraction. These results suggests that these proteins families have an important role in their respective phenotypes. Future analysis will improve the understanding of this complex genus and give some insights about its lifestyle and the interactions with the environment.

  12. Geophysical logging and imaging of shallow drillholes ONK-PP262 and ONK-274 at Olkiluoto in 2010

    International Nuclear Information System (INIS)

    Suomen Malmi Oy conducted geophysical drillhole logging as well as optical and acoustic imaging of shallow drillholes ONK-PP262 and ONK-PP274 at ONKALO in the investigation niche ONK-TKU-4 (Hydco) in May and in December 2010. The survey is a part of Posiva Oy's detailed investigation program for the final disposal of spent nuclear fuel. The assignment included the field work and data processing. The report describes field operation, equipment as well as processing procedures and shows the obtained results and an analysis of their quality in the appendices. The raw and processed data are delivered digitally in WellCAD, PDF and Excel format. (orig.)

  13. Pressure, flow and hydraulic interference measurements in ONKALO at Olkiluoto, drillholes ONK-PP262 and ONK-PP274

    International Nuclear Information System (INIS)

    The general purpose of these studies is to characterize the fracture network and groundwater flow properties in a volume of rock, which is representative of the rock close to deposition holes. As a part of the studies hydraulic tests and flow measurements were applied in two drillholes in hydraulically poorly conductive bedrock. This report presents the principles of the methods as well as the results of the measurements carried out in the underground facilities of ONKALO. The measurements were conducted in drillholes ONK-PP262 and ONK-PP274 between May 9, 2010 and June 9, 2011. The aim of the measurements was to obtain pressure in the closed drillholes, to detect water yielding fractures by flow measurements, to obtain transmissivity with overpressure and drawdown tests and to study hydraulic interference between the drillholes by cross-hole hydraulic tests. The PFL DIFF probe was used to detect flow within single fractures in the drillhole. Transmissive water yielding fractures were found at depths 17.9 m, 16.9 m and 16.4 m in ONK-PP262 and at depths 19.8 m and 19.5 m in ONK-PP274. The cross-hole hydraulic tests included three basic phases. Flow was measured in one drillhole when the other drillhole was open, closed or overpressurized. The cross-hole hydraulic tests were carried out to both directions in the two drillholes. (orig.)

  14. Core drilling of hydco drillholes ONK-PP262 and ONK-PP274 in ONKALO at Olkiluoto 2010

    Energy Technology Data Exchange (ETDEWEB)

    Toropainen, V. [Suomen Malmi Oy, Espoo (Finland)


    Suomen Malmi Oy (Smoy) core drilled two drillholes for HYDCO-program in ONKALO at Eurajoki, Olkiluoto in 2010. The drillhole ONK-PP262 was drilled in May 2010 and the drillhole ONK-PP274 in December 2010. The lengths of the drillholes are 25.02 and 23.88 m respectively. The drillholes are 75.7 mm by diameter. The drillholes were drilled in the investigation niche 4 at the access tunnel chainage 3747. The hydraulic DE 130 drilling rig was used. The drilling water was taken from the ONKALO drilling water pipeline and premixed sodium fluorescein was used as a label agent in the drilling water. The drillholes were measured with EMS deviation survey tool. In addition to drilling the drillcores were logged and reported by geologist. Geological logging included the following parameters: lithology, foliation, fracture parameters, fractured zones, core loss, weathering, fracture frequency, RQD and rock quality. The main rock types in the drillholes are veined gneiss and pegmatitic granite. The average fracture frequencies in both drill cores are 1.4 pcs/m. The average RQD values in the drillcores are 97.2 % (ONK-PP262) and 98.6 % (ONK-PP274). (orig.)

  15. Detection of a large Be circumstellar disk during X-ray quiescence of XTE J1946+274

    CERN Document Server

    Arabaci, M Ozbey; Gutierrez-Soto, J; Zurita, C; Nespoli, E; Suso, J; Kiaeerad, F; Garcia-Rojas, J; Kiziloglu, U


    We present a multiwavelength study of the Be/X-ray binary system XTE J1946+274 with the main goal of better characterizing its behavior during X-ray quiescence. We aim to shed light on the mechanism which triggers the X-ray activity for this source. XTE J1946+274 was observed by Chandra-ACIS during quiescence in 2013 March 12. In addition, this source has been monitored from the ground-based astronomical observatories of El Teide (Tenerife, Spain), Roque de los Muchachos (La Palma, Spain) and Sierra Nevada (Granada, Spain) since 2011 September, and from the TUBITAK National Observatory (Antalya, Turkey) since 2005 April. We have performed spectral and photometric temporal analyses in order to investigate the quiescent state and transient behavior of this binary system. In 2006, a long mass ejection event took place from the Be star, lasting for about seven years. We also found that a large Be circumstellar disk was present during quiescence, although major X-ray activity was not observed. We made an attempt t...

  16. Competitive Fitness of Influenza B Viruses Possessing E119A and H274Y Neuraminidase Inhibitor Resistance-Associated Substitutions in Ferrets. (United States)

    Pascua, Philippe Noriel Q; Marathe, Bindumadhav M; Burnham, Andrew J; Vogel, Peter; Webby, Richard J; Webster, Robert G; Govorkova, Elena A


    Neuraminidase (NA) inhibitors (NAIs) are the only antiviral drugs recommended for influenza treatment and prophylaxis. Although NAI-resistant influenza B viruses that could pose a threat to public health have been reported in the field, their fitness is poorly understood. We evaluated in ferrets the pathogenicity and relative fitness of reverse genetics (rg)-generated influenza B/Yamanashi/166/1998-like viruses containing E119A or H274Y NA substitutions (N2 numbering). Ferrets inoculated with NAI-susceptible rg-wild-type (rg-WT) or NAI-resistant (rg-E119A or rg-H274Y) viruses developed mild infections. Growth of rg-E119A virus in the nasal cavities was delayed, but the high titers at 3 days post-inoculation (dpi) were comparable to those of the rg-WT and rg-H274Y viruses (3.6-4.1 log10TCID50/mL). No virus persisted beyond 5 dpi and replication did not extend to the trachea or lungs. Positive virus antigen-staining of the nasal turbinate epithelium was intermittent with the rg-WT and rg-H274Y viruses; whereas antigen-staining for the rg-E119A virus was more diffuse. Virus populations in ferrets coinoculated with NAI-susceptible and -resistant viruses (1:1 mixture) remained heterogeneous at 5 dpi but were predominantly rg-WT (>70%). Although the E119A substitution was associated with delayed replication in ferrets, the H274Y substitution did not measurably affect viral growth properties. These data suggest that rg-H274Y has undiminished fitness in single virus inoculations, but neither rg-E119A nor rg-H274Y gained a fitness advantage over rg-WT in direct competition experiments without antiviral drug pressure. Taken together, our data suggest the following order of relative fitness in a ferret animal model: rg-WT > rg-H274Y > rg-E119A. PMID:27466813

  17. The Real Time Mixing Module Design for HDTV Data of SMPTE 274M and PC Video Data

    Institute of Scientific and Technical Information of China (English)

    魏江力; 赵保军; 韩月秋


    A real time mixing module for high definition television (HDTV) data of SMPTE 274M and PC video data is designed. The hardware implementation, algorithm and simulation of the mixing module are given. In order to improve the capability of data processing, an anti-fuse FPGA chip and a mechanism of pipelining and modularization are adopted. With 6 parallel LUTs and a fast algorithm, it can mix 4∶2∶2 component signals in luminance and chrominance space respectively in real time. According to the simulation, the module has the ability to mix the uncompressed HDTV data with PC video data in real time, which can not be fulfilled by current ASIC chips. Furthermore, it can be extended to multi-stage mixing with the thoughts implied by the design. The mixing module can be widely used in HDTV production systems.

  18. 17 CFR 274.219 - Form N-17f-1, cover page for each certificate of accounting of securities and similar investments... (United States)


    ... each certificate of accounting of securities and similar investments of a management investment company.... Editorial Note: For Federal Register citations affecting Form N-17f-1, see the List of CFR Sections Affected... PRESCRIBED UNDER THE INVESTMENT COMPANY ACT OF 1940 Forms for Other Statements § 274.219 Form N-17f-1,...

  19. 17 CFR 274.302 - Form N-27I-1, notice of right of withdrawal and refund for variable life insurance... (United States)


    ... Federal Register citations affecting Form N-27I-1, see the List of CFR Sections Affected, which appears in... of withdrawal and refund for variable life insurance contractholders required pursuant to Rule 6e-2... for Exemptions § 274.302 Form N-27I-1, notice of right of withdrawal and refund for variable...

  20. Detection of a large Be circumstellar disk during X-ray quiescence of XTE J1946+274 (United States)

    Özbey Arabacı, M.; Camero-Arranz, A.; Zurita, C.; Gutiérrez-Soto, J.; Nespoli, E.; Suso, J.; Kiaeerad, F.; García-Rojas, J.; Kızıloǧlu, Ü.


    Aims: We present a multiwavelength study of the Be/X-ray binary system XTE J1946+274 with the main goal of better characterizing its behavior during X-ray quiescence. We also aim to shed light on the possible mechanisms which trigger the X-ray activity for this source. Methods: XTE J1946+274 was observed by Chandra-ACIS during quiescence in 2013 March 12. In addition, this source has been monitored from the ground-based astronomical observatories of El Teide (Tenerife, Spain), Roque de los Muchachos (La Palma, Spain) and Sierra Nevada (Granada, Spain) since 2011 September, and from the TÜBİTAK National Observatory (Antalya, Turkey) since 2005 April. We have performed spectral and photometric temporal analyses in order to investigate the quiescent state and transient behavior of this binary system. Results: Our optical study revealed that a long mass ejection event from the Be star took place in 2006, lasting for about seven years, and another one is currently ongoing. We also found that a large Be circumstellar disk is present during quiescence, although major X-ray activity is not observed. We made an attempt to explain this by assuming the permanently presence of a tilted (sometimes warped) Be decretion disk. The 0.3-10 keV X-ray spectrum of the neutron star during quiescence was well fitted with either an absorbed black-body or an absorbed power-law models. The main parameters obtained for these models were kT = 1.43 ± 0.17 and Γ = 0.9 ± 0.4 (with NH ~ 2-7 × 1022 cm-2). The 0.3-10 keV flux of the source was ~0.8-1 × 10-12 erg-1 cm-2 s-1. Pulsations were found with Ppulse = 15.757(1) s (epoch MJD 56 363.115) and an rms pulse fraction of 32.1(3)%. The observed X-ray luminosity during quiescent periods was close to that of expected in supersonic propeller regimen.

  1. Distal phalanx fractures in horses: a survey of 274 horses with radiographic assessment of healing in 36 horses

    International Nuclear Information System (INIS)

    The case records of 274 horses with fractures of the distal phalanx were reviewed. Fifty-two horses had bilateral forelimb fractures, for a total of 326 distal phalanx fractures. The fractures were classified into one of five previously described types, based on the radiographic anatomic configuration of the fracture. Solar margin fractures, which have been briefly described in other reports and previously classified as type V fractures, were identified in 132 horses. This type of fracture is distinct from other distal phalanx fractures. Due to the high incidence of solar margin fractures, these fractures were classified as a separate type (type VI). Follow-up radiographic examinations to assess fracture healing were available for 36 horses. Twenty-two horses with distal phalanx fractures (three type I, nine type II, two type III, one type IV, one type V, and six type VI) had radiographic evidence of complete bony union of the fracture at a mean of 11 months after injury. Eight horses with conplete type II fractures involving the articular surface had bony union of the body and solar margin, but not the subchondral bone at the articular surface, a mean of 11 months after injury. Six horses (four type II and two type IV) had little radiographic evidence of bony healing during the follow-up period. All fractures that eventually healed had evidence of progression toward bony union by 6 months after injury

  2. A missense mutation (p.G274R) in gene ASPA causes Canavan disease in a Pakistani family. (United States)

    Hussain, Rashida; Daud, Shakeela; Kakar, Naseebullah; Ahmad, Adeel; Baloch, Abdul Hameed; Tareen, Abdul Malik; Kakar, Muhammad Azam; Ahmad, Jamil


    Canavan disease (OMIM 271900) is an autosomal recessive lethal neurodegenerative disorder characterized by spongy degeneration of the brain. A highly consanguineous Pakistani family with Canavan disease was enrolled on the basis of diagnosis. All the affected individuals have mental retardation, megalocephaly and degradation of motor skills, poor head control, partial vision loss, weakness of the muscles and raised urinary concentration of N-acetyl aspartic acid in the urine. Blood samples were collected from affected as well as normal siblings and processed for DNA purification. Linkage analysis was performed by typing three short tandem repeat markers D17S1583 (7.19 cM), D17S1828 (10.02 cM) and D17S919 (14.69 cM) for an already-reported gene/locus ASPA at chromosome 17p13.2 causing Canavan disease. During linkage analysis, all the affected individuals were homozygous for short tandem repeat markers while the normal siblings were heterozygous showing co-segregation of the disease. Gene ASPA (NM_000049) was undertaken to sequence for mutation analysis. As a result of sequence analysis, we found missense substitution 740A→G (p.G274R) in exon 6 of gene ASPA. To our knowledge, this is the first report about Canavan disease on a Pakistani family. PMID:22219087

  3. Corrective Action Decision Document/Closure Report for Corrective Action Unit 274: Septic Systems, Nevada Test Site, Nevada, Rev. No.: 0

    Energy Technology Data Exchange (ETDEWEB)

    Grant Evenson


    This Corrective Action Decision Document/Closure Report has been prepared for Corrective Action Unit 274, Septic Systems, Nevada Test Site (NTS), Nevada in accordance with the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit (CAU) 274 is comprised of five corrective action sites (CASs): (1) CAS 03-02-01, WX-6 ETS Building Septic System; (2) CAS 06-02-01, Cesspool; (3) CAS 09-01-01, Spill Site; (4) CAS 09-05-01, Leaching Pit; and (5) CAS 20-05-01, Septic System. The purpose of this Corrective Action Decision Document/Closure Report is to provide justification and documentation supporting the closure of CAU 274 with no further corrective action. To achieve this, corrective action investigation (CAI) activities were performed from November 14 through December 17, 2005 as set forth in the CAU 274 Corrective Action Investigation Plan. The purpose of the CAI was to fulfill the following data needs as defined during the data quality objective (DQO) process: (1) Determine whether contaminants of concern (COCs) are present. (2) If contaminants of concern are present, determine their nature and extent. (3) Provide sufficient information and data to complete appropriate corrective actions. The CAU 274 dataset from the investigation results was evaluated based on the data quality indicator parameters. This evaluation demonstrated the quality and acceptability of the dataset for use in fulfilling the DQO data needs. Analytes detected during the CAI were evaluated against final action levels (FALs) established in this document. No analytes were detected at concentrations exceeding the FALs. No COCs have been released to the soil at CAU 274, and corrective action is not required. Therefore, the DQO data needs were met, and it was determined that no corrective action based on risk to human receptors is necessary for the site. All FALs were calculated using the industrial site worker scenario except for benzo(a)pyrene, which was

  4. 孕妇生殖道分离的274株无乳链球菌的耐药性分析%Resistance analysis of 274 strains of streptococcus agalactiae isolated from genitourinary tract in pregnant women

    Institute of Scientific and Technical Information of China (English)

    贾忠兰; 刘敏; 冯兵



  5. Physical and underway data collected aboard the THOMAS G. THOMPSON during cruise TN274 in the North Pacific Ocean and Philippine Sea from 2012-01-25 to 2012-02-21 (NODC Accession 0104371) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104371 includes physical and underway data collected aboard the THOMAS G. THOMPSON during cruise TN274 in the North Pacific Ocean and Philippine Sea...

  6. Accelerated partial breast irradiation with multi-catheter brachytherapy: Local control, side effects and cosmetic outcome for 274 patients. Results of the German-Austrian multi-centre trial

    International Nuclear Information System (INIS)

    Background and purpose: To evaluate the safety and effectiveness of accelerated partial breast irradiation (APBI) with multi-catheter brachytherapy. Patients and methods: Between 11/2000 and 04/2005, 274 patients participated. Patients were eligible for APBI if they had histologically confirmed breast cancer, a tumour diameter ≤3 cm, complete resection with clear margins ≥2 mm, negative axillary lymph nodes or singular nodal micro-metastasis, no distant metastases, hormone receptor-positive tumours, and were ≥35 years. Patients were excluded if mammographically they showed a multicentric invasive growth pattern, poorly differentiated tumours, residual diffuse micro-calcifications, extensive intraductal component, or vessel invasion. Median follow-up was 32 months (range; 8-68). Results: The local control rate was 99.3% (272/274), the 3 year-local-recurrence-free survival probability, 99.6%. Peri-operative complications occurred in 5.5% (15/274): 9 (3.3%) experienced implant infection and 6 (2.2%) hematoma. Acute toxicity (Grade 1/2 radio-dermatitis) was seen in 6.6% (18/274). Late side effects ≥ Grade 3 (fibrosis, telangiectasia) occurred in 1.8% (4/274). Cosmetic results were excellent/good in 94% (253/274). Conclusions: This analysis underlined the safety and effectiveness of APBI in a carefully selected subgroup with favourable disease characteristics. Of course, longer follow-up and randomised trials are necessary to conclusively assess the potential of APBI

  7. CD274/PD-L1 gene amplification and PD-L1 protein expression are common events in squamous cell carcinoma of the oral cavity (United States)

    Straub, Melanie; Drecoll, Enken; Pfarr, Nicole; Weichert, Wilko; Langer, Rupert; Hapfelmeier, Alexander; Götz, Carolin; Wolff, Klaus-Dietrich; Kolk, Andreas; Specht, Katja


    Immunomodulatory therapies, targeting the immune checkpoint receptor-ligand complex PD-1/PD-L1 have shown promising results in early phase clinical trials in solid malignancies, including carcinomas of the head and neck. In this context, PD-L1 protein expression has been proposed as a potentially valuable predictive marker. In the present study, expression of PD-L1 and PD-1 was evaluated by immunohistochemistry in 80 patients with predominantly HPV-negative oral squamous cell carcinomas and associated nodal metastasis. In addition, CD274/PD-L1 gene copy number status was assessed by fluorescence in situ hybridization analysis. PD-L1 expression was detected in 36/80 (45%) cases and concordance of PD-L1 expression in primary tumor and corresponding nodal metastasis was present in only 20/28 (72%) cases. PD-1 expression was found in tumor-infiltrating lymphocytes (TILs) but not in tumor cells. CD274/PD-L1 gene amplification was detected in 19% of cases, with high level PD-L1 amplification present in 12/80 (15%), and low level amplification in 3/80 (4%). Interestingly, CD274/PD-L1 gene amplification was associated with positive PD-L1 immunostaining in only 73% of cases. PD-L1 copy number status was concordant in primary tumor and associated metastases. Clinically, PD-L1 tumor immunopositivity was associated with a higher risk for nodal metastasis at diagnosis, overall tumor related death und recurrence. Based on our findings we propose to include PD-L1 copy number status in addition to protein status in screening programs for future clinical trials with immunotherapeutic strategies targeting the PD-1/PD-L1 axis. PMID:26918453

  8. CD274/PD-L1 gene amplification and PD-L1 protein expression are common events in squamous cell carcinoma of the oral cavity. (United States)

    Straub, Melanie; Drecoll, Enken; Pfarr, Nicole; Weichert, Wilko; Langer, Rupert; Hapfelmeier, Alexander; Götz, Carolin; Wolff, Klaus-Dietrich; Kolk, Andreas; Specht, Katja


    Immunomodulatory therapies, targeting the immune checkpoint receptor-ligand complex PD-1/PD-L1 have shown promising results in early phase clinical trials in solid malignancies, including carcinomas of the head and neck. In this context, PD-L1 protein expression has been proposed as a potentially valuable predictive marker. In the present study, expression of PD-L1 and PD-1 was evaluated by immunohistochemistry in 80 patients with predominantly HPV-negative oral squamous cell carcinomas and associated nodal metastasis. In addition, CD274/PD-L1 gene copy number status was assessed by fluorescence in situ hybridization analysis. PD-L1 expression was detected in 36/80 (45%) cases and concordance of PD-L1 expression in primary tumor and corresponding nodal metastasis was present in only 20/28 (72%) cases. PD-1 expression was found in tumor-infiltrating lymphocytes (TILs) but not in tumor cells. CD274/PD-L1 gene amplification was detected in 19% of cases, with high level PD-L1 amplification present in 12/80 (15%), and low level amplification in 3/80 (4%). Interestingly, CD274/PD-L1 gene amplification was associated with positive PD-L1 immunostaining in only 73% of cases. PD-L1 copy number status was concordant in primary tumor and associated metastases. Clinically, PD-L1 tumor immunopositivity was associated with a higher risk for nodal metastasis at diagnosis, overall tumor related death und recurrence. Based on our findings we propose to include PD-L1 copy number status in addition to protein status in screening programs for future clinical trials with immunotherapeutic strategies targeting the PD-1/PD-L1 axis. PMID:26918453

  9. Extended-Spectrum  -Lactamase CTX-M-15-Producing Klebsiella pneumoniae of Sequence Type ST274 in Companion Animals


    Poirel, L.; Nordmann, P.; Ducroz, S.; Boulouis, H.-J.; Arne, P.; Millemann, Y.


    Screening of extended-spectrum β-lactamase (ESBL)-producing Gram-negative bacteria in companion animals living in the Paris area in France identified a high rate of CTX-M-15-producing Klebsiella pneumoniae. Those isolates were recovered during the 2010-2011 period from both infections and asymptomatic colonizations. Sequence typing revealed that most of these isolates belonged to sequence type ST274. Interestingly, the blaCTX-M-15 gene was located on a specific and novel plasmid scaffold. The...

  10. Radiative capture and charge exchange of negative pions on protons at 27.4 and 39.3 MeV

    International Nuclear Information System (INIS)

    The π-p → γn and π-p → π0n reactions were studied at laboratory pion kinetic energies of 27.4 and 39.3 MeV for 9 angles. The differential cross-sections of the π-p → γn reaction are compared with previous data and with several calculations. The π-p → π0n differential cross-sections were obtained by unfolding the energy spectra of the π0 γ-ray decays. Pion-nucleon phase shifts and scattering lengths are deduced and good agreement is obtained with the elastic channels, supporting isospin invariance

  11. The Transient Accreting X-Ray Pulsar XTE J1946+274: Stability of X-Ray Properties at Low Flux and Updated Orbital Solution (United States)

    Marcu-Cheatham, Diana M.; Pottschmidt, Katja; Kühnel, Matthias; Müller, Sebastian; Falkner, Sebastian; Caballero, Isabel; Finger, Mark H.; Jenke, Peter J.; Wilson-Hodge, Colleen A.; Fürst, Felix; Grinberg, Victoria; Hemphill, Paul B.; Kreykenbohm, Ingo; Klochkov, Dmitry; Rothschild, Richard E.; Terada, Yukikatsu; Enoto, Teruaki; Iwakiri, Wataru; Wolff, Michael T.; Becker, Peter A.; Wood, Kent S.; Wilms, Jörn


    We present a timing and spectral analysis of the X-ray pulsar XTE J1946+274 observed with Suzaku during an outburst decline in 2010 October and compare with previous results. XTE J1946+274 is a transient X-ray binary consisting of a Be-type star and a neutron star with a 15.75 s pulse period in a 172 days orbit with 2-3 outbursts per orbit during phases of activity. We improve the orbital solution using data from multiple instruments. The X-ray spectrum can be described by an absorbed Fermi-Dirac cut-off power-law model along with a narrow Fe Kα line at 6.4 keV and a weak Cyclotron Resonance Scattering Feature (CRSF) at ˜35 keV. The Suzaku data are consistent with the previously observed continuum flux versus iron line flux correlation expected from fluorescence emission along the line of sight. However, the observed iron line flux is slightly higher, indicating the possibility of a higher iron abundance or the presence of non-uniform material. We argue that the source most likely has only been observed in the subcritical (non-radiation dominated) state since its pulse profile is stable over all observed luminosities and the energy of the CRSF is approximately the same at the highest (˜5 × 1037 erg s-1) and lowest (˜5 × 1036 erg s-1) observed 3-60 keV luminosities.

  12. The Transient Accereting X-Ray Pulsar XTE J1946+274: Stability of the X-Ray Properties at Low Flux and Updated Orbital Solution

    CERN Document Server

    Marcu-Cheatham, Diana M; Kühnel, Matthias; Müller, Sebastian; Falkner, Sebastian; Caballero, Isabel; Finger, Mark H; Jenke, Peter J; Wilson-Hodge, Colleen A; Fürst, Felix; Grinberg, Victoria; Hemphill, Paul B; Kreykenbohm, Ingo; Klochkov, Dmitry; Rothschild, Richard E; Terada, Yukikatsu; Enoto, Teruaki; Iwakiri, Wataru; Wolff, Michael T; Becker, Peter A; Wood, Kent S; Wilms, Jöern


    We present a timing and spectral analysis of the X-ray pulsar XTE J1946+274 observed with Suzaku during an outburst decline in 2010 October and compare with previous results. XTE J1946+274 is a transient X-ray binary consisting of a Be-type star and a neutron star with a 15.75 s pulse period in a 172 d orbit with 2-3 outbursts per orbit during phases of activity. We improve the orbital solution using data from multiple instruments. The X-ray spectrum can be described by an absorbed Fermi-Dirac cutoff power law model along with a narrow Fe K line at 6.4 keV and a weak Cyclotron Resonance Scattering Feature (CRSF) at ~35 keV. The Suzaku data are consistent with the previously observed continuum flux versus iron line flux correlation expected from fluorescence emission along the line of sight. However, the observed iron line flux is slightly higher, indicating the possibility of a higher iron abundance or the presence of non-uniform material. We argue that the source most likely has only been observed in the sub...

  13. Pan-cancer analysis of copy number changes in programmed death-ligand 1 (PD-L1, CD274) - associations with gene expression, mutational load, and survival. (United States)

    Budczies, Jan; Bockmayr, Michael; Denkert, Carsten; Klauschen, Frederick; Gröschel, Stefan; Darb-Esfahani, Silvia; Pfarr, Nicole; Leichsenring, Jonas; Onozato, Maristela L; Lennerz, Jochen K; Dietel, Manfred; Fröhling, Stefan; Schirmacher, Peter; Iafrate, A John; Weichert, Wilko; Stenzinger, Albrecht


    Inhibition of the PD-L1 (CD274) - PD-1 axis has emerged as a powerful cancer therapy that prevents evasion of tumor cells from the immune system. While immunohistochemical detection of PD-L1 was introduced as a predictive biomarker with variable power, much less is known about copy number alterations (CNA) affecting PD-L1 and their associations with expression levels, mutational load, and survival. To gain insight, we employed The Cancer Genome Atlas (TCGA) datasets to comprehensively analyze 22 major cancer types for PD-L1 CNAs. We observed a diverse landscape of PD-L1 CNAs, which affected focal regions, chromosome 9p or the entire chromosome 9. Deletions of PD-L1 were more frequent than gains (31% vs. 12%) with deletions being most prevalent in melanoma and non-small cell lung cancer. Copy number gains most frequently occurred in ovarian cancer, head and neck cancer, bladder cancer, cervical and endocervical cancer, sarcomas, and colorectal cancers. Fine-mapping of the genetic architecture revealed specific recurrently amplified and deleted core regions across cancers with putative biological and clinical consequences. PD-L1 CNAs correlated significantly with PD-L1 mRNA expression changes in many cancer types, and tumors with PD-L1 gains harbored significantly higher mutational load compared to non-amplified cases (median: 78 non-synonymous mutations vs. 40, P = 7.1e-69). Moreover, we observed that, in general, both PD-L1 amplifications and deletions were associated with dismal prognosis. In conclusion, PD-L1 CNAs, in particular PD-L1 copy number gains, represent frequent genetic alterations across many cancers, which influence PD-L1 expression levels, are associated with higher mutational loads, and may be exploitable as predictive biomarker for immunotherapy regimens. © 2016 Wiley Periodicals, Inc. PMID:27106868

  14. Neutron Diffraction Studies of a Class A beta-Lactamase Toho-1 E166A/R274N/R276N Triple Mutant

    Energy Technology Data Exchange (ETDEWEB)

    Blakeley, Matthew P. [Institut Laue-Langevin (ILL); Chen, Yu [ORNL; Afonine, Pavel [Lawrence Berkeley National Laboratory (LBNL)


    beta-Lactam antibiotics have been used effectively over several decades against many types of bacterial infectious diseases. However, the most common cause of resistance to the beta-lactam antibiotics is the production of beta-lactamase enzymes that inactivate beta-lactams by rapidly hydrolyzing the amide group of the beta-lactam ring. Specifically, the class A extended-spectrum beta-lactamases (ESBLs) and inhibitor-resistant enzymes arose that were capable of hydrolyzing penicillins and the expanded-spectrum cephalosporins and monobactams in resistant bacteria, which lead to treatment problems in many clinical settings. A more complete understanding of the mechanism of catalysis of these ESBL enzymes will impact current antibiotic drug discovery efforts. Here, we describe the neutron structure of the class A, CTX-M-type ESBL Toho-1 E166A/R274N/R276N triple mutant in its apo form, which is the first reported neutron structure of a beta-lactamase enzyme. This neutron structure clearly reveals the active-site protonation states and hydrogen-bonding network of the apo Toho-1 ESBL prior to substrate binding and subsequent acylation. The protonation states of the active-site residues Ser70, Lys73, Ser130, and Lys234 in this neutron structure are consistent with the prediction of a proton transfer pathway from Lys73 to Ser130 that is likely dependent on the conformation of Lys73, which has been hypothesized to be coupled to the protonation state of Glu166 during the acylation reaction. Thus, this neutron structure is in agreement with a proposed mechanism for acylation that identifies Glu166 as the general base for catalysis.

  15. The role of programmed cell death ligand-1 (PD-L1/CD274 in the development of graft versus host disease.

    Directory of Open Access Journals (Sweden)

    Heevy Al-Chaqmaqchi

    Full Text Available Programmed cell death ligand-1 (PD-L1/CD274 is an immunomodulatory molecule involved in cancer and complications of bone marrow transplantation, such as graft rejection and graft-versus-host disease. The present study was designed to assess the dynamic expression of this molecule after hematopoietic stem cell transplantation in relation to acute graft-versus-host disease. Female BALB/c mice were conditioned with busulfan and cyclophosphamide and transplanted with either syngeneic or allogeneic (male C57BL/6 mice bone marrow and splenic cells. The expression of PD-L1 was evaluated at different time points employing qPCR, western blot and immunohistochemistry. Allogeneic- but not syngeneic-transplanted animals exhibited a marked up-regulation of PD-L1 expression in the muscle and kidney, but not the liver, at days 5 and 7 post transplantation. In mice transplanted with allogeneic bone marrow cells, the enhanced expression of PD-L1 was associated with high serum levels of IFNγ and TNFα at corresponding intervals. Our findings demonstrate that PD-L1 is differently induced and expressed after allogeneic transplantation than it is after syngeneic transplantation, and that it is in favor of target rather than non-target organs at the early stages of acute graft-versus-host disease. This is the first study to correlate the dynamics of PD-L1 at the gene-, protein- and activity levels with the early development of acute graft-versus-host disease. Our results suggest that the higher expression of PD-L1 in the muscle and kidney (non-target tissues plays a protective role in skeletal muscle during acute graft-versus-host disease.

  16. Neutron Diffraction Studies of a Class A beta-Lactamase Toho-1 E166A/R274N/R276N Triple Mutant

    International Nuclear Information System (INIS)

    beta-Lactam antibiotics have been used effectively over several decades against many types of bacterial infectious diseases. However, the most common cause of resistance to the beta-lactam antibiotics is the production of beta-lactamase enzymes that inactivate beta-lactams by rapidly hydrolyzing the amide group of the beta-lactam ring. Specifically, the class A extended-spectrum beta-lactamases (ESBLs) and inhibitor-resistant enzymes arose that were capable of hydrolyzing penicillins and the expanded-spectrum cephalosporins and monobactams in resistant bacteria, which lead to treatment problems in many clinical settings. A more complete understanding of the mechanism of catalysis of these ESBL enzymes will impact current antibiotic drug discovery efforts. Here, we describe the neutron structure of the class A, CTX-M-type ESBL Toho-1 E166A/R274N/R276N triple mutant in its apo form, which is the first reported neutron structure of a beta-lactamase enzyme. This neutron structure clearly reveals the active-site protonation states and hydrogen-bonding network of the apo Toho-1 ESBL prior to substrate binding and subsequent acylation. The protonation states of the active-site residues Ser70, Lys73, Ser130, and Lys234 in this neutron structure are consistent with the prediction of a proton transfer pathway from Lys73 to Ser130 that is likely dependent on the conformation of Lys73, which has been hypothesized to be coupled to the protonation state of Glu166 during the acylation reaction. Thus, this neutron structure is in agreement with a proposed mechanism for acylation that identifies Glu166 as the general base for catalysis.

  17. Analysis on Current Situation and Influencing Factors of the New Generation of Peasant Workers Zeitgeist---Based on the Survey of 274 New Generation of Peasant Workers%新生代农民工时代精神现状及其影响因素分析--基于274名新生代农民工的调查

    Institute of Scientific and Technical Information of China (English)

    李恺; 罗丹; 刘亚平


    As the essence of the socialist core value system,the spirit of the times,an effective breakthrough point for the new generation of peasant workers to cultivate the socialist core values,must be vigorously promoted.Surveys show that the new generation of migrant workers generally advocates and possesses the spirit of the times which are chiefly influenced by the social environment,the family background and the individual factors.Among these factors,the environment of network media,individu-al values and innovative spirits,and intergenerational transmission of family cultural capital are decisive and positive.Therefore,to cultivate the time spirit of the new generation of peasant workers,social e-vents should be positively and objectively reported to guide the public opinions,the individual values and innovative spirits should be strengthened,the education resources should be better incorporated and the family cultural capital should be enriched.%时代精神作为社会主义核心价值体系的精髓,是培育和践行新生代农民工社会主义核心价值观的有效切入点,必须大力弘扬时代精神,培育新生代农民工核心价值观。基于274名新生代农民工的调查结果表明:新生代农民工普遍上赞成并拥有时代精神;新生代农民工的社会环境、家庭环境和个体因素等是影响新生代农民工时代精神的主要因素,其中,网络媒体环境、个体价值观和创新性、家庭文化资本代际传承的影响较关键且具有正向作用。培育新生代农民工的时代精神,应积极、正面、客观的报道社会事件,正确引导社会舆论;加强新生代农民工个体价值观的引导和个体创新性的培育;整合教育资源,丰富家庭文化资本。

  18. 50 CFR 216.274 - Mitigation. (United States)


    .... (F) Aircraft with deployed sonobuoys shall use only the passive capability of sonobuoys when marine... would be maintained throughout the exercise. Potential assets include sonobuoys, which can be utilized.... The sonobuoys shall be re-seeded as necessary throughout the exercise. Additionally, passive...

  19. 7 CFR 1150.274 - Certification standards. (United States)


    ... of active milk producers represented by the organization; (3) Evidence of stability and permanency of... processing of fluid milk and dairy products and promotion of the nutritional attributes of fluid milk...

  20. Dicty_cDB: SSD274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available one QHM6D05, mRNA sequence. 58 1e-04 1 CB084130 |CB084130.1 hq10c11.b1 Hedyotis centranthoides flower - Stage 2 (NYBG) Hedyotis... centranthoides cDNA clone hq10c11, mRNA sequence. 50 0.026 1 CB084528 |CB084528.1 hq16g12.b1 Hedyotis... centranthoides flower - Stage 2 (NYBG) Hedyotis centranthoides cDNA

  1. 47 CFR 27.4 - Terms and definitions. (United States)


    ....1201(c) contained in the edition of 47 CFR parts 20 to 39, revised as of October 1, 2005, or §§ 74.990 through 74.992 contained in the edition of 47 CFR parts 70 to 79, revised as of October 1, 2004, of this... in the National Geodetic Survey (NGS) data base. (Source: National Geodetic Survey, U.S....

  2. 40 CFR 52.274 - California air pollution emergency plan. (United States)


    ... power generation to non-source areas to the maximum extent consistent with the public health, safety... the List of CFR Sections Affected, which appears in the Finding Aids section of the printed volume and...) The measures for electric utilities to import power from outside the basin to the extent feasible....

  3. 26 CFR 1.274-5T - Substantiation requirements (temporary). (United States)


    ... expenditure, the corrobative evidence may be circumstantial evidence. (ii) Sampling—(A) In general. Except as... year or a portion thereof. (B) Exception for pooled vehicles. The sampling method of paragraph (c)(3... disallowed by section 280F(d)(3) because the use of such property is not for the convenience of the...

  4. Dicty_cDB: AFK274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available m cDNA clone cLED17D1, mRNA sequence. 74 4e-09 1 AW649196 |AW649196.1 EST327650 tomato germinating seedlings, TAMU cDNA clone cLEZ19K24 5', mRNA sequence. 74 4e-09 1 BE459798 |BE459798.1 EST415090 tomato developing/immature green fruit Lyco...eared DNA Entamoeba histolytica genomic, DNA sequence. 80 1e-17 3 BI921109 |BI921109.1 EST541012 tomato callus Lycopersico...e. 80 7e-11 1 AI782264 |AI782264.1 EST263143 tomato susceptible, Cornell Lycopersicon esculentum cDNA clone ...cLES18L5, mRNA sequence. 74 4e-09 1 AI489195 |AI489195.1 EST247534 tomato ovary, TAMU Lycopersicon esculentu

  5. Dicty_cDB: VSH274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available raspanin tspC; 173 4e-42 AE015928_2029( AE015928 |pid:none) Bacteroides thetaiotaomicron VP... 39 0.12 ...sdlcpkdgdkikyeghycgealsdqfsskiyavgaaglaigi ielvailfslfliiricrsprtrsxasilnk*ikqnk*...ces producing significant alignments: (bits) Value N ( AU267180 ) Dictyostelium discoideum vegetative cDNA c...7 ) Dictyostelium discoideum vegetative cDNA clone:VS... 1098 0.0 2 ( C84714 ) Di... Dictyostelium discoideum vegetative cDNA clone:VS... 658 0.0 2 ( C90221 ) Dictyostelium discoideum slug cDN

  6. 26 CFR 1.274-5 - Substantiation requirements. (United States)


    ..., of the amount of the expenses and as satisfying, with respect to the amount of the expenses, the... character of the expenditure. For example, a hotel receipt is sufficient to support expenditures...

  7. 48 CFR 1816.405-274 - Award fee evaluation factors. (United States)


    ... factor, if used, must include consideration of risk management (including mission success, safety... the contractor's accomplishment of its goals for subcontracting with small business, HUBZone small business, women-owned small business, veteran-owned small business, and service-disabled...

  8. Dicty_cDB: SLF274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 5215 |pid:none) Lymphocytic choriomeningitis virus... 39 0.20 AE014187_324( AE014187 |pid:none) Plasmodium f...alciparum 3D7 chromo... 37 0.75 EU480452_2( EU480452 |pid:none) Lymphocytic choriomeningitis... virus... 36 1.3 AF325214_2( AF325214 |pid:none) Lymphocytic choriomeningitis virus... 36 1.7 ( P...09992 ) RecName: Full=Nucleoprotein; AltName: Full=Nucleocapsid... 35 2.2 Y16308_1( Y16308 |pid:none) Lymphocytic choriomeningitis

  9. 7 CFR 274.1 - State agency issuance responsibility. (United States)


    ... reconciliation activities are properly conducted and accurately reported to FNS. (b) Contracting or delegating... point. A physical inventory of coupons shall be taken at each location and that count compared with perpetual inventory records and the monthly reports of the coupon issuer or bulk storage point. This...

  10. 7 CFR 274.6 - Replacement issuances to households. (United States)


    ...) Except for households certified under 7 CFR part 280, replacement issuances shall be provided in the... due to damage in the mail before delivery or by a discrepancy in the issuance unit's inventory; (2... hearing process. (h) Documentation and reconciliation of replacement issuances. (1) The State agency...

  11. 49 CFR 178.274 - Specifications for UN portable tanks. (United States)


    ... unrestricted to the safety device. No stop-valve may be installed between the shell and the pressure relief... meet the requirements of the CSC as amended and 49 CFR parts 450 through 453 and must have a CSC safety... from a fire (see § 178.275(g)). Jacket means the outer insulation cover or cladding which may be...

  12. Dicty_cDB: CFH274 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ry Canis familiaris genomic, genomic survey sequence. 40 0.11 2 BQ507132 |BQ507132.2 EST614547 Generation of...sequence, mRNA sequence. 42 0.33 2 BQ507131 |BQ507131.1 EST614546 Generation of a set of potato cDNA clones

  13. The Discoveries of Bohrium, Hassium, Meitnerium, and the new Region of Deformed Shell Nuclei

    CERN Document Server

    Münzenberg, G


    The investigation of the light trans-actinide elements was not only exciting as it included the discovery of a number of new chemical elements. It led also to the discovery of a new region of shell nuclei existing beyond the macroscopic stability limit. Theory explained this in terms of a new shell region of deformed nuclei which bridge the trans-uranium nuclei and the predicted superheavy elements. This contribution will give a brief historic overview over these discoveries, experimental developments, and the impact on ongoing and future superheavy-element research.

  14. The Discoveries of Bohrium, Hassium, Meitnerium, and the new Region of Deformed Shell Nuclei

    International Nuclear Information System (INIS)

    The investigation of the light trans-actinide elements was not only exciting as it included the discovery of a number of new chemical elements. It led also to the discovery of a new region of shell nuclei existing beyond the macroscopic stability limit. Theory explained this in terms of a new shell region of deformed nuclei which bridge the trans-uranium nuclei and the predicted superheavy elements. This contribution will give a brief historic overview over these discoveries, experimental developments, and the impact on ongoing and future superheavy-element research. (author)

  15. The Discoveries of Bohrium, Hassium, Meitnerium, and the New Region of Deformed Shell Nuclei (United States)

    Muenzenberg, Gottfried


    The investigation of the light trans-actinide elements was not only exciting as it included the discovery of a number of new chemical elements. It led also to the discovery of a new region of shell nuclei existing beyond the macroscopic stability limit. Theory explained this in terms of a new shell region of deformed nuclei which bridge the trans-uranium nuclei and the predicted superheavy elements. This contribution will give a brief historic overview over these discoveries, experimental developments, and the impact on ongoing and future superheavy-element research.

  16. Synthesis, crystal structures and ionic conductivities of Bi14P4O31 and Bi50V4O85. Two members of the series Bi18-4mM4mO27+4m (M=P, V) related to the fluorite-type structure

    International Nuclear Information System (INIS)

    The two hitherto unknown compounds Bi14P4O31 and Bi50V4O85 were prepared by the direct solid-state reaction of Bi2O3 and (NH4)H2PO4 or V2O5, respectively. Bi14P4O31 crystallizes in a C-centred monoclinic symmetry (C2/c space group) with the unit-cell parameters: a=19.2745(2)A, b=11.3698(1)A, c=52.4082(2)A and β=93.63(1)o (Z=16). The symmetry of Bi50V4O85 is also monoclinic (I2/m space group) with lattice parameters of a=11.8123(3)A, b=11.7425(2)A, c=16.5396(2)A and β=90.14(1)o (Z=2). Both structures correspond to a fluorite-type superstructure where the Bi and P or V atoms are ordered in the framework. An idealized structural model is proposed where the structures result of the stacking of mixed atomic layers of composition [Bi14M4O31] and [Bi18O27] respectively. This new family can be formulated Bi18-4mM4mO27+4m with M=P, V and where the parameter m (0=14M4O31] layers to the total number of layers in the sequence. Bi14P4O31 corresponds to m=1 when Bi50V8O85 corresponds to m=1/3. In this last case, the structural sequence is simply one [Bi14V4O31] layer to two [Bi18O27] layers. As predicted by the proposed structural building principle, Bi14P4O31 is not a good ionic conductor. The conductivity at 650 deg. C is 4 orders of magnitude lower from those found in Bi46M8O89 (M=P, V) (m=2/3) and Bi50V4O85 (m=1/3)

  17. 7 CFR 274.12 - Electronic Benefit Transfer issuance system approval standards. (United States)


    ... retailers and financial institutions for redeemed benefits. (i) Verifying electronic transactions flowing to.... If special lanes are designated for the purpose of accepting other electronic debit or credit cards... terminals that are capable of relaying electronic transactions to a central database computer...

  18. People and things. CERN Courier, May 1987, v. 27(4)

    International Nuclear Information System (INIS)

    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. The XIX General Assembly of the International Union of Pure and Applied Physics (IUPAP) is to be held at the US National Academy of Sciences, Washington DC, from 29 September - 3 October. The theme of the scientific programme will be 'Physics in a Technological World', reflecting the IUPAP General Council's aim of emphasizing the role of industrial physics and improving relations between industrial and academic physics. The CERN Accelerator School is organizing in collaboration with BESSY (the Berlin electron synchrotron radiation centre) the second of its biennial two-week courses on advanced accelerator physics

  19. Comparative genomics of 274 Vibrio cholerae genomes reveals mobile functions structuring three niche dimensions

    NARCIS (Netherlands)

    Dutilh, Bas E; Thompson, Cristiane C; Vicente, Ana C P; Marin, Michel A; Lee, Clarence; Silva, Genivaldo G Z; Schmieder, Robert; Andrade, Bruno G N; Chimetto, Luciane; Cuevas, Daniel; Garza, Daniel R; Okeke, Iruka N; Aboderin, Aaron Oladipo; Spangler, Jessica; Ross, Tristen; Dinsdale, Elizabeth A; Thompson, Fabiano L; Harkins, Timothy T; Edwards, Robert A


    BACKGROUND: Vibrio cholerae is a globally dispersed pathogen that has evolved with humans for centuries, but also includes non-pathogenic environmental strains. Here, we identify the genomic variability underlying this remarkable persistence across the three major niche dimensions space, time, and h

  20. 8 CFR 274a.12 - Classes of aliens authorized to accept employment. (United States)


    ... status as defined in section 101(a)(15)(V) of the Act and 8 CFR 214.15. (16) An alien authorized to be...; (17)-(18) (19) Any alien in U-1 nonimmigrant status, pursuant to 8 CFR 214.14, for the period of time.... (20) Any alien in U-2, U-3, U-4, or U-5 nonimmigrant status, pursuant to 8 CFR 214.14, for the...

  1. 17 CFR 274.128 - Form N-CSR, certified shareholder report. (United States)


    ... CFR Sections Affected, which appears in the Finding Aids section of the printed volume and on GPO... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form N-CSR, certified... Form N-CSR, certified shareholder report. This form shall be used by registered management...

  2. 7 CFR 274.11 - Issuance and inventory record retention, and forms security. (United States)


    ... of records. The State agency shall maintain issuance, inventory, reconciliation, and other... extended at the written request of FNS. (1) Issuance, inventory, reconciliation, and other accountability... 7 Agriculture 4 2010-01-01 2010-01-01 false Issuance and inventory record retention, and...


    Energy Technology Data Exchange (ETDEWEB)

    Ribaudo, Joseph; Lehner, Nicolas; Christopher Howk, J. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Werk, Jessica K.; Xavier Prochaska, J. [UCO/Lick Observatory, University of California at Santa Cruz, Santa Cruz, CA 95064 (United States); Tripp, Todd M.; Meiring, Joseph D. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Tumlinson, Jason [Space Telescope Science Institute, Baltimore, MD 21218 (United States)


    We present UV and optical observations from the Cosmic Origins Spectrograph on the Hubble Space Telescope and Keck of a z = 0.27395 Lyman limit system (LLS) seen in absorption against the QSO PG1630+377. We detect H I absorption with log N(H I) = 17.06 {+-} 0.05 as well as Mg II, C III, Si III, and O VI in this system. The column densities are readily explained if this is a multi-phase system, with the intermediate and low ions arising in a very low metallicity ([Mg/H] = -1.71 {+-} 0.06) photoionized gas. We identify via Keck spectroscopy and Large Binocular Telescope imaging a 0.3 L{sub *} star-forming galaxy projected 37 kpc from the QSO at nearly identical redshift (z = 0.27406 and {Delta}v = -26 km s{sup -1}) with near solar metallicity ([O/H] = -0.20 {+-} 0.15). The presence of very low metallicity gas in the proximity of a near-solar metallicity, sub-L{sub *} galaxy strongly suggests that the LLS probes gas infalling onto the galaxy. A search of the literature reveals that such low-metallicity LLSs are not uncommon. We found that 50% (4/8) of the well-studied z {approx}< 1 LLSs have metallicities similar to the present system and show sub-L{sub *} galaxies with {rho} < 100 kpc in those fields where redshifts have been surveyed. We argue that the properties of these primitive LLSs and their host galaxies are consistent with those of cold mode accretion streams seen in galaxy simulations.

  4. 7 CFR 274.10 - Use of identification cards and redemption of coupons by eligible households. (United States)


    ... to determine whether Photo IDs should be required in any specific parts of the project area. At the conclusion of this consultation, FNS shall inform the State agency whether the use of Photo IDs will be... mandate the use of Photo IDs in the project area. FNS shall also inform the State agency that it will...

  5. Regulation of the histone acetyltransferase activity of hMOF via autoacetylation of Lys274

    Institute of Scientific and Technical Information of China (English)

    Bingfa Sun; Shunling Guo; Qingyu Tang; Chen Li; Rong Zeng; Zhiqi Xiong; Chen Zhong; Jianping Ding


    Dear Editor, Males-absent-on-the-first (MOF, also called MYST1 or KAT8) is a histone acetyltransferase (HAT) belonging to the MOZ, Ybf2/Sas3, Sas2 and Tip60 (MYST) family.MOF has been shown to possess a specific HAT activity towards Lysl6 of histone H4 (H4K16) [1].Homozygous knockout of MOF in mice results in loss of H4K16 acetylation and embryonic lethality, indicating that MOF and H4K16 acetylation are essential for embryogenesis and genome stability in mammals [2].Downregulation of human MOF (hMOF) leads to dramatic nuclear morphological deformation and inhibition of cell cycle progression [3], and has recently been correlated with primary breast carcinoma and medulloblastoma [4].

  6. Corrigendum to “Geometric Arveson–Douglas conjecture” [Adv. Math. 274 (2015) 606–630

    Czech Academy of Sciences Publication Activity Database

    Engliš, Miroslav; Eschmeier, J.


    Roč. 278, June (2015), s. 254. ISSN 0001-8708 Institutional support: RVO:67985840 Keywords : Arveson-Douglas conjecture * generalized Toeplitz operator Subject RIV: BA - General Mathematics Impact factor: 1.294, year: 2014

  7. Investigation of elements 107, bohrium (Bh) and 108, hassium (Hs) in sulfuric acid solutions according to the test experiments with their homologs

    International Nuclear Information System (INIS)

    Ion-exchange behavior of Re and Os as homologs of Bh and Hs, respectively, has been studied in the sulfuric acid media. The distribution coefficients of 183Re and 185Os as well as of other radionuclides between Dowex-50 and H2SO4 solutions were determined as a function of the acid concentration. It was shown, that cation-exchange column may be used for the separation of Os, Re and W from elements of III group, whereas anion-exchange column for their concentration from diluted sulfuric acid solutions. The 0.05M H2SO4 was used for continuous on-line separation of short-lived Os isotopes produced in the nuclear reactions: nat.Dy(20Ne, xn)Os. Radionuclides of Os, Re and W were strongly sorbed on anion-exchange column only. (author)

  8. Ionization potentials and radii of neutral and ionized species of elements 107 (bohrium) and 108 (hassium) from extended multiconfiguration Dirac-Fock calculations (United States)

    Johnson, E.; Fricke, B.; Jacob, T.; Dong, C. Z.; Fritzsche, S.; Pershina, V.


    Large multiconfiguration Dirac-Fock calculations were performed for all neutral and up to 7 and 8 times ionized species of elements 107 and 108, respectively, as well as all the homologous elements Mn, Tc, Re, Fe, Ru, and Os for a number of different total angular momenta. Comparison of the resulting ionization potentials to the known values of the homologues allow an extrapolation and thus a prediction of the chemically important seven or eight ionization potentials of elements 107 or 108 as well as a prediction of some ionic radii.

  9. 77 FR 28588 - Proposed Priorities-American Overseas Research Centers Program; CFDA Number 84.274A (United States)


    ... Engagement; Strength through Global Leadership and Engagement: U.S. Higher Education in the 21st Century. The... edition of the Federal Register and the Code of Federal Regulations is available via the Federal Digital... research that is vital to understanding the history, culture, economy, languages, and other issues...

  10. Evidence for Cold Accretion: Discovery of Primitive Gas Flowing onto a Galaxy at z~0.274

    CERN Document Server

    Ribaudo, Joseph; Howk, J Christopher; Werk, Jessica K; Tripp, Todd M; Prochaska, Jason X; Meiring, Joseph D; Tumlinson, Jason


    We present UV and optical observations from the Cosmic Origins Spectrograph on the Hubble Space Telescope and Keck of a z = 0.27395 Lyman limit system (LLS) seen in absorption against the QSO PG1630+377. We detect H I with log N(HI) = 17.06 \\pm 0.05 as well as Mg II, C III, Si III, and O VI in this system while recording upper limits for several other ions. The column densities are readily explained if this is a multi-phase system, with the intermediate and low ions arising in a very low metallicity ([Mg/H] = -1.71\\pm0.06) photoionized gas. We identify via Keck spectroscopy and Large Binocular Telescope imaging a 0.3 L* star-forming galaxy projected 37 kpc from the QSO at nearly identical redshift (z = 0.27406, Delta_v = -26 km/s) with near solar metallicity ([O/H] = -0.20\\pm0.15). The properties of the gas and star-forming galaxy are consistent with models of cold-mode accretion streams, where the LLS traces infalling gas and the O VI arises due to its interaction with the galaxy halo. The gas cannot trace a...

  11. 26 CFR 1.274-2 - Disallowance of deductions for certain expenses for entertainment, amusement, recreation, or travel. (United States)


    ... section 4241 by section 301 of Public Law 89-44. However, for purposes of this section only, clubs... organizations exempt from taxation under section 501(c)(6) of the Code, such as business leagues, chambers...

  12. CRED Subsurface Temperature Recorder (STR); NWHI, PHR; Long: -175.89442, Lat: 27.91187 (WGS84); Sensor Depth: 2.74m; Data Range: 20080924-20100916. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series...

  13. 17 CFR 274.127f-1 - Form N-27F-1, notice to periodic payment plan certificate holders of 45-day withdrawal right with... (United States)


    ...: For Federal Register citations affecting Form N-27F-1, see the List of CFR Sections Affected, which... periodic payment plan certificate holders of 45-day withdrawal right with respect to periodic payment plan... COMMISSION (CONTINUED) FORMS PRESCRIBED UNDER THE INVESTMENT COMPANY ACT OF 1940 Forms for Reports §...

  14. 17 CFR 274.127e-1 - Form N-27E-1, notice to periodic payment plan certificate holders of 18-month surrender rights... (United States)


    .... Editorial Note: For Federal Register citations affecting Form N-27E-1, see the List of CFR Sections Affected... periodic payment plan certificate holders of 18-month surrender rights with respect to periodic payment... EXCHANGE COMMISSION (CONTINUED) FORMS PRESCRIBED UNDER THE INVESTMENT COMPANY ACT OF 1940 Forms for...

  15. 17 CFR 274.303 - Form N-27I-2, notice of withdrawal right and statement of charges for variable life insurance... (United States)


    ... variable life insurance contractholders required pursuant to Rule 6e-2 (§ 270.6e-2 of this chapter). Editorial Note: For Federal Register citations affecting Form N-27I-2, see the List of CFR Sections Affected... withdrawal right and statement of charges for variable life insurance contractholders required pursuant...

  16. NUCLEAR CHEMISTRY: Element 107 Leaves the Table Unturned. (United States)

    Service, R F


    This week, an international team of chemists reported on the first successful analysis of the chemical properties of bohrium, element 107. The results matched predictions, postponing scientists' hopes of seeing interesting deviations from theory among ultraheavy elements. PMID:17772986

  17. Mendeleev's principle against Einstein's relativity: news from the chemistry of superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Gaeggeler, Heinz W [Department of Chemistry and Biochemistry, University of Bern, Bern (Switzerland)


    The review briefly considers the problems of synthesis and chemical identification of superheavy elements. The specific features of their properties are determined by the relativistic effects. The synthesis and chemical investigations into bohrium and element 112 are discussed as examples.

  18. Mendeleev's principle against Einstein's relativity: news from the chemistry of superheavy elements

    International Nuclear Information System (INIS)

    The review briefly considers the problems of synthesis and chemical identification of superheavy elements. The specific features of their properties are determined by the relativistic effects. The synthesis and chemical investigations into bohrium and element 112 are discussed as examples.

  19. Mendeleev's principle against Einstein's relativity: news from the chemistry of superheavy elements (United States)

    Gäggeler, Heinz W.


    The review briefly considers the problems of synthesis and chemical identification of superheavy elements. The specific features of their properties are determined by the relativistic effects. The synthesis and chemical investigations into bohrium and element 112 are discussed as examples.

  20. O Papel da Justiça Transicional na construção da democracia na África do Sul - 10.5102/uri.v4i1.274

    Directory of Open Access Journals (Sweden)

    Jaqueline Richard


    Full Text Available The aim of this article is to emphasize the transitional justice ands the institutionalization of justice, as well as human rights respect to the citizenship in South Africa, after the apartheid. South Africa presented a large regime of segregation, placing the black population into exclusion. Nowadays the blacks are trying to get back their legal rights and have been trained to be inserted into formal jobs.

  1. Multibeam collection for TN274: Multibeam data collected aboard Thomas G. Thompson from 2012-01-25 to 2012-02-09, departing from Apra, Guam and returning to Apra, Guam (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  2. Observations on the downstream movements of brown trout fry (Salmo trutta L.)in the Lissuraga [Translation from: Bulletin Francais de la Pisciculture No.274 1-17, 1979


    Cuinat, R.; HELAND M.


    The phenomenon of the downstream movement of brown trout fry has been noticed for a very long time by fish biologists. The work presented here, and taking place in the framework of the hydrobiological research of the INRA, represents the results of three years' observation of the movement downstream in the Lissuraga, a small stream in the French Basque country, in connection with certain environmental factors, which are shown. The authors have used a live experiment to compare, in an artifici...

  3. Real-time PCR detection and quantification of fish probiotic Phaeobacter strain 27-4 and fish pathogenic Vibrio in microalgae, rotifer, Artemia and first feeding turbot (Psetta maxima) larvae

    DEFF Research Database (Denmark)

    Prol, M.J.; Bruhn, Jesper Bartholin; Pintado, J.; Gram, Lone


    presence of microalgae (Isochrysis galbana), rotifers (Brachionus plicatilis), Artemia nauplii or turbot (Psetta maxima) larvae by real-time PCR based on primers directed at genetic loci coding for antagonistic and virulence-related functions respectively. The optimized protocol was used to study...

  4. 78 FR 21850 - Federal Motor Vehicle Safety Standards; Matters Incorporated by Reference (United States)


    ... E274/E274M-11, ``Standard Test Method for Skid Resistance of Paved Surfaces Using a Full-Scale Tire... reference. * * * * * (d) * * * (28) ASTM E274-65T, ``Tentative Method of Test for Skid Resistance of... No. 301, Fuel System Integrity, reference ASTM E274-65T, ``Tentative Method of Test for...

  5. Understanding Infertility - The Basics

    Medline Plus

    Full Text Available ... here . Basic Infertility Evaluation 450 x 274 | Running Time: 3 min 40 sec Dr. Roger Lobo of ... Causes of Female Infertility 450 x 274 | Running Time: 2 min 35 sec Dr. Roger Lobo, of ...

  6. Understanding Infertility - The Basics (United States)

    ... Reproductive Medicine discusses the various methods to evaluate infertility. Causes of Female Infertility 450 x 274 | Running Time: 2 min 35 ... Society for Reproductive Medicine explains the causes of female infertility. Causes of Male Infertility 450 x 274 | Running ...

  7. Understanding Infertility - The Basics

    Medline Plus

    Full Text Available ... Basic Infertility Evaluation 450 x 274 | Running Time: 3 min 40 sec Dr. Roger Lobo of the ... Coping With Infertility 450 x 274 | Running Time: 3 min 31 sec Dr. Roger Lobo of the ...

  8. Understanding Infertility - The Basics

    Medline Plus

    Full Text Available ... explains the causes of female infertility. Causes of Male Infertility 450 x 274 | Running Time: 2 min ... American Society for Reproductive Medicine covers causes of male infertility. Coping With Infertility 450 x 274 | Running ...

  9. Understanding Infertility - The Basics

    Medline Plus

    Full Text Available ... discusses various methods of coping with infertility. Infertility Treatments 450 x 274 | Running Time: 4 min 42 ... American Society for Reproductive Medicine discusses the various treatments for infertility. Understanding Fertility 450 x 274 | Running ...

  10. Understanding Infertility - The Basics

    Medline Plus

    Full Text Available ... Videos here . Basic Infertility Evaluation 450 x 274 | Running Time: 3 min 40 sec Dr. Roger Lobo ... infertility. Causes of Female Infertility 450 x 274 | Running Time: 2 min 35 sec Dr. Roger Lobo, ...

  11. 8 CFR 1274a.1 - Employer requirements. (United States)


    ... Immigration and Nationality Act (Act) are contained in 8 CFR part 274a. (b) Adjudication of civil penalty... by DHS under section 274A of the Act are contained in 28 CFR part 68. The regulations governing employment eligibility and verification in 8 CFR part 274a are applicable to hearings before...

  12. 75 FR 18377 - Supplemental Nutrition Assistance Program, Regulation Restructuring: Issuance Regulation Update... (United States)


    ...(e). 274.12(n) 274.1(e). Implementation In accordance with the parameters set forth in 62 FR 55141... (48 FR 29115), this Program is excluded from the scope of Executive Order 12372, which requires... Service 7 CFR part 274 RIN 0584-AD48 Supplemental Nutrition Assistance Program, Regulation...

  13. Rock Art Glossary: A Multilingual Dictionary, Expanded Second Edition (First Edition 2001. Edited by Robert G. Bednarik, Ahmed Achrati, Tang Huisheng, Alfred Muzzolini, George Dimitriadis, Dario Seglie, Fernando Coimbra, Yakov A. Sher and Mario Consens. Australian Rock Art Research Association, Inc., Melbourne, 2010; 274 Pages, in English, Arabic, Chinese, French, German, Greek, Italian, Portuguese, Russian and Spanish, with Translation Tables. Price $A 38.00, ISBN 978-0-646-53471-8

    Directory of Open Access Journals (Sweden)

    Shu-Kun Lin


    Full Text Available This is the first dictionary compiled specifically for rock art research. It follows the publication of an English rock art glossary in the journal Rock Art Research in November 2000. To be adopted by the International Federation of Rock Art Organisations (IFRAO, it has been translated by some of the world’s foremost scholars in the field into Arabic, Chinese, French, German, Greek, Italian, Portuguese, Spanish and Russian. In a discipline that has hitherto been without an agreed terminology, even communication within a single language has been difficult. The proliferation of idiosyncratic terminologies of often academically isolated researchers, many of which have been used by only one scholar, has not only retarded progress and the transference of knowledge, it has led to countless misunderstandings and even personal feuds. The purpose of this dictionary is to create a single terminological standard as well as a cross-lingual uniformity of usage. It focuses particularly on scientific aspects, technical applications and epistemological rigour. It does not set out to create a terminological straitjacket for the discipline, but a common standard of reference, particularly in areas that have in the past been susceptible to greatly differing interpretations. This dictionary comprises sections in ten languages, each listing the same terms alphabetically. It also contains a table interlinking all of these languages, listing all terms explained. This translation table is organised alphabetically according to the English terms. The volume is indispensable for scientific translators, rock art scholars, archaeologists and others concerned with aspects of pre-Historic rock art, and is also intended for the guidance of students and authors working in this field.

  14. Chemical properties of transactinides (United States)

    Gäggeler, H. W.


    First investigations of chemical properties of bohrium (Z = 107) and hassium (Z = 108) showed an expected behaviour as ordinary members of groups 7 and 8 of the periodic table. Two attempts to study element 112 yielded some indication for a behaviour like a very volatile noble metal. However, a very recent experiment to confirm this preliminary observation failed. Two examples are described how chemical studies may help to support element discovery claims from purely physics experiments. The two examples are the discovery claims of the elements 112 and 115, respectively, where the progenies hassium and dubnium were chemically identified.

  15. Chemical properties of transactinides

    International Nuclear Information System (INIS)

    First investigations of chemical properties of bohrium (Z = 107) and hassium (Z = 108) showed an expected behaviour as ordinary members of groups 7 and 8 of the periodic table. Two attempts to study element 112 yielded some indication for a behaviour like a very volatile noble metal. However, a very recent experiment to confirm this preliminary observation failed. Two examples are described how chemical studies may help to support element discovery claims from purely physics experiments. The two examples are the discovery claims of the elements 112 and 115, respectively, where the progenies hassium and dubnium were chemically identified. (orig.)

  16. Chemical properties of transactinides

    Energy Technology Data Exchange (ETDEWEB)

    Gaeggeler, H.W. [Paul Scherrer Institut, Villigen (Switzerland); University of Bern, Bern (Switzerland)


    First investigations of chemical properties of bohrium (Z = 107) and hassium (Z = 108) showed an expected behaviour as ordinary members of groups 7 and 8 of the periodic table. Two attempts to study element 112 yielded some indication for a behaviour like a very volatile noble metal. However, a very recent experiment to confirm this preliminary observation failed. Two examples are described how chemical studies may help to support element discovery claims from purely physics experiments. The two examples are the discovery claims of the elements 112 and 115, respectively, where the progenies hassium and dubnium were chemically identified. (orig.)

  17. Chemistry of Transactinides (United States)

    Kratz, J. V.

    In this chapter, the chemical properties of the man-made transactinide elements rutherfordium, Rf (element 104), dubnium, Db (element 105), seaborgium, Sg (element 106), bohrium, Bh (element 107), hassium, Hs (element 108), and copernicium, Cn (element 112) are reviewed, and prospects for chemical characterizations of even heavier elements are discussed. The experimental methods to perform rapid chemical separations on the time scale of seconds are presented and comments are given on the special situation with the transactinides where chemistry has to be studied with single atoms. It follows a description of theoretical predictions and selected experimental results on the chemistry of elements 104 through 108, and element 112.

  18. Systematic study of Bh isotopes in a relativistic mean field formalism (United States)

    Mehta, M. S.; Raj, B. K.; Patra, S. K.; Gupta, Raj K.


    The binding energy, charge radius, and quadrupole deformation parameter for the isotopic chain of the superheavy element bohrium (107Bh), from proton to neutron drip line, are calculated by using an axially deformed relativistic mean field model. The potential energy surfaces for some of the selected nuclei are plotted and the various possible shapes are investigated. The rms radii, density distributions, and two-neutron separation energies are also evaluated and the single-particle energies for some illustrative cases are analyzed to see the magic structures. Furthermore, the α-decay rates are calculated and compared with the available experimental data for the recently observed new isotopes 266,267Bh.

  19. Systematic study of Bh isotopes in a relativistic mean field formalism

    International Nuclear Information System (INIS)

    The binding energy, charge radius, and quadrupole deformation parameter for the isotopic chain of the superheavy element bohrium (107Bh), from proton to neutron drip line, are calculated by using an axially deformed relativistic mean field model. The potential energy surfaces for some of the selected nuclei are plotted and the various possible shapes are investigated. The rms radii, density distributions, and two-neutron separation energies are also evaluated and the single-particle energies for some illustrative cases are analyzed to see the magic structures. Furthermore, the α-decay rates are calculated and compared with the available experimental data for the recently observed new isotopes 266,267Bh

  20. 75 FR 10059 - Money Market Fund Reform (United States)


    ... (Nov. 20, 2008) [73 FR 71919 (Nov. 26, 2008)]. \\17\\ See Press Release, U.S. Department of the Treasury... Exchange Commission 17 CFR Parts 270 and 274 Money Market Fund Reform; Final Rule #0;#0;Federal Register... COMMISSION 17 CFR Parts 270 and 274 RIN 3235-AK33 Money Market Fund Reform AGENCY: Securities and...

  1. 21 CFR 1314.30 - Recordkeeping for retail transactions. (United States)


    ... identification, is considered acceptable for purposes of 8 CFR 274a.2(b)(1)(v)(A) and 274a.2(b)(1)(v)(B). (2... Administrator, a written or electronic list of each scheduled listed chemical product sale that identifies the... the sales (referred to as the “logbook”). The logbook may be maintained on paper or in electronic...

  2. Understanding Infertility - The Basics

    Medline Plus

    Full Text Available ... Reproductive Medicine discusses the various methods to evaluate infertility. Causes of Female Infertility 450 x 274 | Running Time: 2 min 35 ... Society for Reproductive Medicine explains the causes of female infertility. Causes of Male Infertility 450 x 274 | Running ...

  3. Ecology, Inhibitory Activity, and Morphogenesis of a Marine Antagonistic Bacterium Belonging to the Roseobacter Clade

    DEFF Research Database (Denmark)

    Bruhn, Jesper Bartholin; Nielsen, Kristian Fog; Hjelm, Mette;


    Roseobacter strain 27-4 has been isolated from a turbot larval rearing unit and is capable of reducing mortality in turbot egg yolk sac larvae. Here, we demonstrate that the supernatant of Roseobacter 27-4 is lethal to the larval pathogens Vibrio anguillarum and Vibrio splendidus in a buffer syst...

  4. EST Table: FS914277 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS914277 E_FL_fufe_31M22_F_0 10/09/28 37 %/274 aa ref|XP_969699.1| PREDICTED: similar to fuzzy.../274 aa gi|91081315|ref|XP_969699.1| PREDICTED: similar to fuzzy CG13396-PA [Tribolium castaneum] CK514734 fufe ...

  5. 26 CFR 1.6851-2 - Certificates of compliance with income tax laws by departing aliens. (United States)


    ... training; (3) Income derived in accordance with the employment authorizations in 8 CFR 274a.12(b) and (c... accordance with the employment authorization in 8 CFR 274a.12(c)(6) or interest on deposits described in... 26 Internal Revenue 13 2010-04-01 2010-04-01 false Certificates of compliance with income tax...

  6. Phosphatidylcholine covalently linked to a methacrylate-based monolith as a biomimetic stationary phase for capillary liquid chromatography

    Czech Academy of Sciences Publication Activity Database

    Wiedmer, S. K.; Moravcová, Dana; Carrasco-Correa, E. J.; Planeta, Josef; Lämmerhofer, M.

    2015. s. 274-274. ISBN N. [HPLC 2015. International Symposium on High Performance Liquid Phase Separations and Related Techniques /43./. 21.09.2015-25.09.2015, Beijing] Institutional support: RVO:68081715 Keywords : capillary LC * immobilized artificial membrane * monolithic column * phospholipid Subject RIV: CB - Analytical Chemistry, Separation

  7. Solar flares: observation vs simulations

    Czech Academy of Sciences Publication Activity Database

    Rubio da Costa, F.; Zuccarello, F.; Labrosse, N.; Fletcher, L.; Prosecký, Tomáš; Kašparová, Jana

    Cambridge : Cambridge University Press, 2011 - (Bonanno, A.), s. 182-184 ISBN 9780521197410. ISSN 1743-9213. - (IAU Symposium Proceedings Series. S274). [Symposium of the International Astronomical Union /274./. Giardini Naxos (IT), 06.09.2010-10.09.2010] Institutional research plan: CEZ:AV0Z10030501 Keywords : numerical methods * radiative transfer * solar flares Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  8. Drug: D05273 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D05273 Drug Ormetoprim (USAN/INN) C14H18N4O2 274.143 274.3183 D05273.gif Antibacterial Component ... of Rofenaid (TN) veterinary ... medicine Trimethoprim [DR:D00145] derivative Antii ... r [KO:K13938] Trimethoprim derivatives Ormetoprim; Veterinary ... D05273 Ormetoprim (USAN/INN) CAS: 6981-18-6 PubChe ...

  9. 28 CFR 9.1 - Authority, purpose, and scope. (United States)


    ... grant remission and mitigation is delegated to the Chief, Asset Forfeiture and Money Laundering Section... inconsistent with this part. In particular, this part supersedes the provisions of 21 CFR 1316.79 and 1316.80... provisions of 8 CFR 274.13 through 274.19 and 28 CFR 8.10, which concern non-drug related forfeitures,...

  10. Short Term Prediction of Highway Travel Time using GUHA Data Mining Method

    Czech Academy of Sciences Publication Activity Database

    Coufal, David; Turunen, E.


    Roč. 14, - (2004), s. 221-231. ISSN 1210-0552 R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : data mining * many-valued logic Subject RIV: BA - General Mathematics

  11. Preparation of Holmium -166 Loaded Biodegradable Poly(L-Lactic Acid) Microspheres

    Czech Academy of Sciences Publication Activity Database

    Melichar, František; Kropáček, Martin; Konopková, Marie


    Roč. 32, Supplement 1 (2005), S274-S274. ISSN 1619-7070. [Annual Congress of European Association of Nuclear Medicine. 16.10.2005-19.10.2005, Istambul] R&D Projects: GA AV ČR(CZ) 1QS100480501 Institutional research plan: CEZ:AV0Z10480505 Keywords : holmium * raditherapy Subject RIV: CH - Nuclear ; Quantum Chemistry

  12. Paul Scherrer Institute Scientific Report 1999. Volume I: Particles and Matter

    International Nuclear Information System (INIS)

    Although originally planned for fundamental research in nuclear physics, the particle beams of pions, muons, protons and neutrons are now used in a large variety of disciplines in both natural science and medicine. The beams at PSI have the world's highest intensities and therefore allow certain experiments to be performed, which would not be possible elsewhere. The highlight of research this year was the first-ever determination of the chemical properties of the superheavy element 107 Bohrium. This was undertaken, by an international team led by H. Gaeggeler of PSI's Laboratory for Radiochemistry. Bohrium was produced by bombarding a Berkelium target with Neon ions from the Injector I cyclotron and six atoms were detected after having passed through an online gas chromatography device. At the Laboratory for Particle Physics the focus has shifted from nuclear physics to elementary particle physics with about a fifty-fifty split between investigations of rare processes or particle decays using the high intensity muon, pion and recently also polarized neutron beams of PSI, and research at the highest energy frontier at CERN (Geneva) and DESY (Hamburg). Important space instrumentation has been contributed by the Laboratory for Astrophysics to the European Space Agency and NASA satellite programmes. The Laboratory for Micro and Nanotechnology continued to focus on research into molecular nanotechnology and SiGeC nanostructures, the latter with the aim of producing silicon based optoelectronics. Progress in 1999 in these topical areas is described in this report. A list of scientific publications in 1999 is also provided

  13. Dicty_cDB: Contig-U12135-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available omosome number (1..6, M) 2 Chromosome length 8467578 Start point 4425571 End point 4424844 Strand (PLUS/MINU... Score = 801 bits (404), Expect = 0.0 Identities = 437/437 (100%) Strand = Plus / Plus Query: 1 ggtagttgtcga...taacc 437 ||||||||||||||||| Sbjct: 421 ttggagcaccaataacc 437 Score = 543 bits (274), Expect = e-154 Identities = 274/274 (100%) Stran...ttcacttggtaaaatgggaacaag 739 Score = 61.9 bits (31), Expect = 1e-09 Identities = 31/31 (100%) Strand = Plus ...attatttaatatttagtatt 803 Score = 60.0 bits (30), Expect = 4e-09 Identities = 30/30 (100%) Strand

  14. 78 FR 43002 - Proposed Collection; Comment Request for Revenue Procedure 2004-29 (United States)


    ... meal and entertainment expenses that are excepted from the 50% deduction disallowance of Sec. 274(n)(1... revenue law. Generally, tax returns and tax return information are confidential, as required by 26...

  15. Význam kapra v rybničním hospodářství

    Czech Academy of Sciences Publication Activity Database

    Matěna, Josef; Flajšhans, Martin


    Roč. 61, č. 6 (2013), s. 272-274. ISSN 0044-4812 Institutional support: RVO:60077344 ; RVO:67985904 Keywords : Cyprinus carpio * fish production * pond ecosystem * Czech Republic Subject RIV: EH - Ecology, Behaviour

  16. Odcházení politika a návrat dramatika (Poslední divadelní hra Václava Havla)

    Czech Academy of Sciences Publication Activity Database

    Hoffmannová, Jana; Hoffmann, B.

    Praha: Filozofická fakulta Univerzity Karlovy, 2009 - (Hasil, J.), s. 77-89 ISBN 978-80-7308-274-1 Institutional research plan: CEZ:AV0Z90610518 Keywords : identity * adaptability * stereotype Subject RIV: AI - Linguistics

  17. Revision Knee Surgery

    Medline Plus

    Full Text Available ... Tiarina [PH], Angie Weems [PH], and to my right, Roya Royo [PH]. Elise Bond Is our circulator. ... female, five- three, 274 pounds, who had this right knee replacement performed approximately ten years ago. Initially ...

  18. Czech Images and Stereotypes of a Neighbouring Nation: The Poles in the Renaissance and Reformation Age

    Czech Academy of Sciences Publication Activity Database

    Pánek, Jaroslav

    Praha : Filozofická fakulta Univerzity Karlovy, 2009 - (Hasil, J.), s. 151-170 ISBN 978-80-7308-274-1 Institutional research plan: CEZ:AV0Z80150510 Keywords : History * Czech nobility * Poles Subject RIV: AB - History

  19. 77 FR 54917 - Findings of Research Misconduct (United States)


    ... correctly read the goal-relevant gestures of a human agent.'' Proceedings of the Royal Society B 274:1913... with complete data sets and video records and published them in Proceedings Royal Society B...

  20. Understanding Infertility - The Basics

    Medline Plus

    Full Text Available ... Medicine discusses the various methods to evaluate infertility. Causes of Female Infertility 450 x 274 | Running Time: ... the American Society for Reproductive Medicine explains the causes of female infertility. Causes of Male Infertility 450 ...

  1. Asset stripping and firm survival in mass privatization: testing the Hoff-Stiglitz and Campos-Giovannoni models in Montenegro

    Czech Academy of Sciences Publication Activity Database

    Koman, M.; Lakićević, M.; Prašnikar, J.; Švejnar, Jan


    Roč. 43, č. 2 (2015), s. 274-289. ISSN 0147-5967 Institutional support: PRVOUK-P23 Keywords : asset stripping * mass privatization * firm survival Subject RIV: AH - Economics Impact factor: 1.170, year: 2014

  2. 29 CFR 500.51 - Refusal to issue or to renew, or suspension or revocation of certificate. (United States)


    ... any crime under State or Federal law relating to gambling, or to the sale, distribution or possession... (2) of section 274A(a) of the Immigration and Nationality Act (INA) by hiring, recruiting,...

  3. 76 FR 19468 - Notice of Determinations Regarding Eligibility To Apply for Worker Adjustment Assistance (United States)


    .... Division, Leased Workers Adecco, Employment Services and Kelly Services. 75,274 Abbott Laboratories, Abbott... Moines Billing Site. 75,156 Abbott Point of Care....... Princeton, NJ......... January 31, 2010....

  4. Profesor Bohumil Ryba, mezi vědou a vězením

    Czech Academy of Sciences Publication Activity Database

    Dvořáčková, Věra

    -, č. 8 (2010), s. 227-274. ISSN 2336-1387 Institutional support: RVO:68378092 Keywords : Bohumil Ryba * linguistics * history * classical philology * political persecution * political trials Subject RIV: AI - Linguistics

  5. Snowy plover survey: Great Salt Lake, UT: Summary report 2007 (United States)

    US Fish and Wildlife Service, Department of the Interior — The snowy plover survey was conducted in the Great Salt Lake ecosystem from 7 May 7 June 2007. A total of 274 clusters were surveyed and 659 birds counted. The...

  6. 17 CFR 270.23c-1 - Repurchase of securities by closed-end companies. (United States)


    ... losses realized from the sale of securities or other properties, was distributed to its shareholders... Commission, as an exhibit to Form N-CSR (§ 249.331 and § 274.128), a copy of any written solicitation...

  7. 78 FR 76293 - Combined Notice of Filings (United States)


    ...: RP14-274-000. Applicants: NGO Transmission, Inc. Description: NGO Transmission, Inc. submits tariff filing per 154.204: NGO Transmission, Inc.--Negotiated Rate Filing to be effective 1/1/2014. Filed...

  8. Treatment and disposal of radioactive wastes from nuclear power plants. Research programs 1993-1998

    International Nuclear Information System (INIS)

    Reports the research programs, development, and demonstration concerning the Aespoe laboratory in Sweden. The main topics are: Risk assessment, spent fuels, capsules, geology, chemistry, instruments, and radionuclide migration. (274 refs.)

  9. 22 CFR 62.20 - Professors and research scholars. (United States)


    ... visitor must act as an independent contractor, as such term is defined in 8 CFR 274a.1(j), and the... project under the direct sponsorship of a Federally Funded National Research and Development...

  10. Worldwide frequency distribution of the 'Gait keeper' mutation in the DMRT3 gene

    Czech Academy of Sciences Publication Activity Database

    Promerová, M.; Andersson, L.S.; Juras, R.; Penedo, M.C.T.; Reissmann, M.; Tozaki, T.; Bellone, R.; Dunner, S.; Hořín, P.; Imsland, F.; Imsland, P.; Mikko, S.; Modrý, David; Roed, K.H.; Schwochow, D.; Vega-Pla, J.L.; Mehrabani-Yeganeh, H.; Yousefi-Mashouf, N.; Cothran, E.G.; Lindgren, G.; Andersson, L.


    Roč. 45, č. 2 (2014), s. 274-282. ISSN 0268-9146 Institutional support: RVO:60077344 Keywords : ambling * domestication * horse * locomotion * pace * running walk Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.207, year: 2014

  11. Gas phase chemistry of the transactinides (United States)

    Türler, A.


    In the past few years the gas phase chemistry of the first three transactinide elements rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) has been studied experimentally using OLGA, the On-line Gas chemistry Apparatus, developed at Paul Scherrer Institute. In each experiment, the investigated transactinide element was identified by measuring the characteristic decay properties of its isotopes. In the chemistry of rutherfordium and dubnium evidence for relativistic effects were found, as predicted previously in theoretical calculations. For the first time, the volatility of Sg oxychlorides in comparison to its lighter homologues W and Mo was measured. Also, the half-lives and SF-branches of the nuclides 265Sg and 266Sg were determined. Finally, prospects for a chemical separation of bohrium (element 107) and hassium (element 108) using gas phase chemistry will be discussed.

  12. Gas phase chemistry of the transactinides

    International Nuclear Information System (INIS)

    In the past few years the gas phase chemistry of the first three transactinide elements Rutherfordium (element 104), Dubnium (element 105) and Seaborgium (element 106) has been studied experimentally using OLGA, the On-line Gas chemistry Apparatus, developed at Paul Scherrer Institute. In each experiment, the investigated transactinide element was identified by measuring the characteristic decay properties of its isotopes. In the chemistry of Rutherfordium and Dubnium evidence for relativistic effects were found, as predicted previously in theoretical calculations. For the first time, the volatility of Sg oxychlorides in comparison to its lighter homologues W and Mo was measured. Also, the half-lives and SF-branches of the nuclides 265Sg and 266Sg were determined. Finally, prospects for a chemical separation of Bohrium (element 107) and Hassium (108) using gas phase chemistry will be discussed. (author)

  13. Heavy-element chemistry - Status and perspectives

    International Nuclear Information System (INIS)

    In the past ten years, nuclear chemists have made considerable progress in developing fast on-line separation techniques, which allowed to chemically characterize the first four transactinide elements Rf (rutherfordium, Z=104), Db (dubnium, Z=105), Sg (seaborgium, Z=106), and recently also Bh (bohrium, Z=107). In all cases the isolated nuclides were unambiguously identified by observing genetically linked decay chains. Nuclides with production cross-sections of less than 100 pb and half-lives as short as a few seconds have been chemically isolated. Thus, chemists have discovered or significantly contributed to the characterization of the nuclear-decay properties of a number of transactinide nuclei. New techniques with greatly improved overall efficiencies should allow chemists to extend their studies to even heavier elements such as Hs (hassium, Z=108) and to the recently discovered superheavy elements with Z=112 and 114, which can be produced only with picobarn cross-sections. (orig.)

  14. Heavy-element chemistry --Status and perspectives (United States)

    Türler, A.

    In the past ten years, nuclear chemists have made considerable progress in developing fast on-line separation techniques, which allowed to chemically characterize the first four transactinide elements Rf (rutherfordium, Z = 104), Db (dubnium, Z = 105), Sg (seaborgium, Z = 106), and recently also Bh (bohrium, Z = 107). In all cases the isolated nuclides were unambiguously identified by observing genetically linked decay chains. Nuclides with production cross-sections of less than 100 pb and half-lives as short as a few seconds have been chemically isolated. Thus, chemists have discovered or significantly contributed to the characterization of the nuclear-decay properties of a number of transactinide nuclei. New techniques with greatly improved overall efficiencies should allow chemists to extend their studies to even heavier elements such as Hs (hassium, Z = 108) and to the recently discovered superheavy elements with Z = 112 and 114, which can be produced only with picobarn cross-sections.

  15. Gas phase chemistry of the transactinides

    International Nuclear Information System (INIS)

    In the past few years the gas phase chemistry of the first three transactinide elements rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) has been studied experimentally using OLGA, the On-line Gas chemistry Apparatus, developed at Paul Scherrer Institute. In each experiment, the investigated transactinide element was identified by measuring the characteristic decay properties of its isotopes. In the chemistry of rutherfordium and dubnium evidence for relativistic effects were found, as predicted previously in theoretical calculations. For the first time, the volatility of Sg oxychlorides in comparison to its lighter homologues W and Mo was measured. Also, the half-lives and SF-branches of the nuclides 265Sg and 266Sg were determined. Finally, prospects for a chemical separation of bohrium (element 107) and hassium (element 108) using gas phase chemistry will be discussed. (author)

  16. Heavy-element chemistry - Status and perspectives

    Energy Technology Data Exchange (ETDEWEB)

    Tuerler, A. [Paul Scherrer Institut, Villigen (Switzerland); Bern univ. (Switzerland)


    In the past ten years, nuclear chemists have made considerable progress in developing fast on-line separation techniques, which allowed to chemically characterize the first four transactinide elements Rf (rutherfordium, Z=104), Db (dubnium, Z=105), Sg (seaborgium, Z=106), and recently also Bh (bohrium, Z=107). In all cases the isolated nuclides were unambiguously identified by observing genetically linked decay chains. Nuclides with production cross-sections of less than 100 pb and half-lives as short as a few seconds have been chemically isolated. Thus, chemists have discovered or significantly contributed to the characterization of the nuclear-decay properties of a number of transactinide nuclei. New techniques with greatly improved overall efficiencies should allow chemists to extend their studies to even heavier elements such as Hs (hassium, Z=108) and to the recently discovered superheavy elements with Z=112 and 114, which can be produced only with picobarn cross-sections. (orig.)

  17. Production and chemistry of transactinide elements

    International Nuclear Information System (INIS)

    Recent progress in production and chemistry of the transactinide elements, element 107 bohrium (Bh) and element 104 rutherfordium (Rf), is reviewed. First information on chemical properties of Bh was obtained in gas chromatographic experiments on an atom-at-a-time basis. Chemical separation and characterization of 6 atoms of 267Bh produced in the bombardment of a 249Bk target with 22Ne beams are outlined. Aqueous chemistry of Rf being performed at JAERI (Japan Atomic Energy Research Institute) is briefly summarized. On-line anion-exchange experiments in acidic solutions on 261Rf produced in the 248Cm(18O,5n) reaction were conducted with a rapid ion-exchange separation apparatus. Characteristic anion-exchange behavior of Rf is discussed. (author)

  18. Transition metals and their carbides and nitrides: Trends in electronic and structural properties

    International Nuclear Information System (INIS)

    A study of the structural and electronic properties of selected transition metals and their carbides and nitrides is presented. We focus on assessing trends of possible importance for understanding their hardness. Lattice constants, bulk moduli (Bo), and charge densities are calculated using the local density approximation with a pseudopotential plane wave approach. An fcc lattice is employed for the transition metal elements in order to make comparisons and study trends relateable to their carbides and nitrides. Our results show that both increasing the number of valence d electrons and the presence of f electrons in the core lead to larger (Bo). Charge density plots and histograms enable us to explain the nature of the charge distribution in the interstitial region for the different compounds considered. In addition, we include the heavier elements seaborgium, bohrium, and hasnium in order to test further trends. Surprisingly, the calculated Bo for Hs is comparable to that of diamond. copyright 1999 The American Physical Society

  19. Transition metals and their carbides and nitrides: Trends in electronic and structural properties (United States)

    Grossman, Jeffrey C.; Mizel, Ari; Côté, Michel; Cohen, Marvin L.; Louie, Steven G.


    A study of the structural and electronic properties of selected transition metals and their carbides and nitrides is presented. We focus on assessing trends of possible importance for understanding their hardness. Lattice constants, bulk moduli (Bo), and charge densities are calculated using the local density approximation with a pseudopotential plane wave approach. An fcc lattice is employed for the transition metal elements in order to make comparisons and study trends relateable to their carbides and nitrides. Our results show that both increasing the number of valence d electrons and the presence of f electrons in the core lead to larger (Bo). Charge density plots and histograms enable us to explain the nature of the charge distribution in the interstitial region for the different compounds considered. In addition, we include the heavier elements seaborgium, bohrium, and hasnium in order to test further trends. Surprisingly, the calculated Bo for Hs is comparable to that of diamond.

  20. Palynomorphs, paleoenvironment and sequence stratigraphy in the boreholes of Cenomanian and Lower Turonian age from the Bohemian Cretaceous Basin, Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Marcela; Špičáková, Lenka; Uličný, David


    Roč. 2008, č. 2 (2008), s. 274-274. ISSN 0946-8978. [International Palynological Congress /12./ ; International Organisation of Palaeobotany Conference /8./. 30.08.2008-05.09.2008, Bonn] R&D Projects: GA ČR(CZ) GA205/06/1823 Institutional research plan: CEZ:AV0Z30130516; CEZ:AV0Z30120515 Keywords : palynology * sequence stratigraphy * lithology Subject RIV: DB - Geology ; Mineralogy

  1. The GUHA Method and Mining Association Rules

    Czech Academy of Sciences Publication Activity Database

    Hájek, Petr

    Canada : ICSC Academic Press, 2001 - (Kuncheva, L.), s. 533-539 ISBN 3-906454-26-6. [CIMA 2001. Bangor (GB), 19.06.2001-22.06.2001] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: AV0Z1030915 Keywords : GUHA * hypothesis generation * data mining * exploratory data analysis Subject RIV: BA - General Mathematics

  2. Coat colour and chromosome variation in cetral European populations of the weasel (Mustela nivalis)

    Czech Academy of Sciences Publication Activity Database

    Zima, Jan; Cenevová, E.


    Roč. 51, č. 4 (2002), s. 265-274. ISSN 0139-7893 R&D Projects: GA AV ČR KSK6005114 Institutional research plan: CEZ:AV0Z6093917 Keywords : weasel * pelage coloration * karyotype Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.234, year: 2002

  3. Separation of solar radio bursts in a complex spectrum

    Czech Academy of Sciences Publication Activity Database

    Mészárosová, Hana; Rybák, J.; Karlický, Marian; Jiřička, Karel

    Cambridge : Cambridge University Press, 2011 - (Bonanno, A.), s. 150-152 ISBN 9780521197410. ISSN 1743-9213. - (IAU Symposium Proceedings Series. S274). [Symposium of the International Astronomical Union /274./. Giardini Naxos (IT), 06.09.2010-10.09.2010] R&D Projects: GA AV ČR(CZ) IAA300030701 Institutional research plan: CEZ:AV0Z10030501 Keywords : Sun * flares * radio radiation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  4. Comparison between DSm and MinC Combination Rules. Chapter 10

    Czech Academy of Sciences Publication Activity Database

    Daniel, Milan

    Rehoboth : American Research Press, 2004 - (Smarandache, F.; Dezert, J.), s. 223-241 ISBN 1-931233-82-9 R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : belief functions * combination of belief functions * Dempster-Shafer theory * Dezert-Smarandache theory * minC combination Subject RIV: BA - General Mathematics

  5. ALMA and solar research

    Czech Academy of Sciences Publication Activity Database

    Karlický, Marian; Bárta, Miroslav

    Cambridge: Cambridge University Press, 2011 - (Bonanno, A.), s. 284-286. (IAU Symposium Proceedings Series. S274). ISBN 9780521197410. ISSN 1743-9213. [Symposium of the International Astronomical Union /274./. Giardini Naxos (IT), 06.09.2010-10.09.2010] R&D Projects: GA AV ČR(CZ) IAA300030701 Institutional research plan: CEZ:AV0Z10030501 Keywords : high angular resolution * interferometers * radio radiation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  6. Transformation of Deductive and Inductive Tasks between Models of Logic Programming with Imperfect Information

    Czech Academy of Sciences Publication Activity Database

    Vojtáš, Peter; Vomlelová, M.

    Roma: Editrice Universita La Sapienza, 2004, s. 839-846. ISBN 88-87242-54-2. [IPMU 2004 /10./. Perugia (IT), 04.07.2004-09.07.2004] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : imperfection of information * fuzzy, bayesian, classical logic programs * generalized annotated programs * deduction * induction * Bayesian networks Subject RIV: BA - General Mathematics

  7. 17 CFR 249.322 - Form 12b-25-Notification of late filing. (United States)


    ... CFR Sections Affected, which appears in the Finding Aids section of the printed volume and on GPO...-annual, annual, or transition report on Form N-SAR (§§ 249.330; 274.101) or Form N-CSR (§§ 249.331; 274... to electronic difficulties should comply with either Rule 201 or Rule 202 of Regulation S-T (§...

  8. Quasi-periodic oscillations in solar X-ray sources

    Czech Academy of Sciences Publication Activity Database

    Mészárosová, Hana; Karlický, Marian; Fárník, František

    Cambridge : Cambridge University Press, 2011 - (Bonanno, A.), s. 252-254 ISBN 9780521197410. ISSN 1743-9213. - (IAU Symposium Proceedings Series. S274). [Symposium of the International Astronomical Union /274./. Giardini Naxos (IT), 06.09.2010-10.09.2010] R&D Projects: GA AV ČR(CZ) IAA300030701 Institutional research plan: CEZ:AV0Z10030501 Keywords : Sun * flares * X-rays Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  9. Dorje Sherab's Illuminator, a Light of Gnosis

    DEFF Research Database (Denmark)

    Sobisch, Jan-Ulrich

    A faksimile print of a manuscript at the Musee Guimet, Paris, that was dated to 1267-1290. The true color reproduction is high quality, with a forword of 16 pages and 274 photographs.......A faksimile print of a manuscript at the Musee Guimet, Paris, that was dated to 1267-1290. The true color reproduction is high quality, with a forword of 16 pages and 274 photographs....

  10. Strategies for Combining Conflicting Dogmatic Beliefs

    Czech Academy of Sciences Publication Activity Database

    Josang, A.; Daniel, Milan; Vannoorenberghe, P.

    ISIF, 2003, s. 1133-1140. ISBN 0-9721844-3-0. [International Conference of Information Fusion. Cairns (AU), 08.07.2003-11.07.2003] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: AV0Z1030915 Keywords : probability * belief theory * subjective logic * dogmatic belief * conflict * Dempster's rule Subject RIV: BA - General Mathematics

  11. AcEST: DK962839 [AcEST

    Lifescience Database Archive (English)


  12. AcEST: DK957842 [AcEST

    Lifescience Database Archive (English)


  13. Fast sex identification in wild mammals using PCR amplification of the Sry gene

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Konečný, A.


    Roč. 52, č. 3 (2003), s. 269-274. ISSN 0139-7893 R&D Projects: GA ČR GA524/01/1316; GA ČR GP206/02/P068 Institutional research plan: CEZ:AV0Z6093917 Keywords : sex identification * Sry gene * rodents Subject RIV: EG - Zoology Impact factor: 0.494, year: 2003

  14. Short Term Prediction of Highway Travel Time using Data Mining and Neuro-Fuzzy Methods

    Czech Academy of Sciences Publication Activity Database

    Coufal, David; Turunen, E.

    Istanbul: Bogaziai University, 2003 - (Kaynak, O.), s. 175-182 ISBN 975-518-208-X. [IFSA 2003. International Fuzzy Systems Association World Congress /10./. Istanbul (TR), 30.06.2003-02.07.2003] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: AV0Z1030915 Keywords : data mining * neuro-fuzzy modelling Subject RIV: BA - General Mathematics

  15. Gas phase chemistry of technetium and rhenium oxychlorides

    Energy Technology Data Exchange (ETDEWEB)

    Eichler, R. [Bern Univ. (Switzerland). Abt. fuer Chemie und Biochemie; Eichler, B.; Jost, D.T.; Piguet, D.; Tuerler, A. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Gaeggeler, H.W. [Bern Univ. (Switzerland). Abt. fuer Chemie und Biochemie; Paul Scherrer Inst. (PSI), Villigen (Switzerland)


    The chloride and oxychloride chemistry of the group 7 elements TC and Re was investigated in order to develop an experimental approach to a gas chemical characterisation of bohrium (Bh, element 107). In thermochromatography experiments with trace amounts of {sup 101,104}Tc and {sup 183,184}Re the formation of one volatile compound was observed in O{sub 2}/HCl containing carrier gas, which was attributed to MO{sub 3}Cl (M=Tc, Re). From the measured deposition temperatures the adsorption enthalpies on quartz surfaces {delta}H{sub ads}(TcO{sub 3}Cl)=-51{+-}3 kJ/mol and {delta}H{sub ads}(ReO{sub 3}Cl)=-62{+-}3 kJ/mol were evaluated. The sublimation enthalpies were derived using an empirical correlation between {delta}H{sub ads} and {delta}H{sub subl}: {delta}H{sub subl}(TcO{sub 3}Cl)=49{+-}10 kJ/mol and {delta}H{sub subl}(ReO{sub 3}Cl)=67{+-}10 kJ/mol. A fast gas chemical separation technique for highly volatile compounds of short-lived isotopes based on isothermal gas solid adsorption chromatography (OLGA-principle) was developed. With a modified OLGA device, model studies with the short-lived nuclides {sup 106,107,108}Tc and {sup 169,170,174,176}Re were carried out in preparation of an experimental gas chemical investigation of bohrium (Bh, element 107). Separation times of less than 3 s were achieved. A good separation of the oxychlorides of group 7 elements from chloride and oxychloride compounds of {sup 152-155}Er, {sup 151-154}Ho (as models for actinide elements), {sup 98-101}Nb, {sup 99-102}Zr (as models for light transactinide elements), {sup 218}Po, and {sup 214}Bi was accomplished in this chemical system. (orig.)

  16. Gas phase chemistry of technetium and rhenium oxychlorides

    International Nuclear Information System (INIS)

    The chloride and oxychloride chemistry of the group 7 elements TC and Re was investigated in order to develop an experimental approach to a gas chemical characterisation of bohrium (Bh, element 107). In thermochromatography experiments with trace amounts of 101,104Tc and 183,184Re the formation of one volatile compound was observed in O2/HCl containing carrier gas, which was attributed to MO3Cl (M=Tc, Re). From the measured deposition temperatures the adsorption enthalpies on quartz surfaces ΔHads(TcO3Cl)=-51±3 kJ/mol and ΔHads(ReO3Cl)=-62±3 kJ/mol were evaluated. The sublimation enthalpies were derived using an empirical correlation between ΔHads and ΔHsubl: ΔHsubl(TcO3Cl)=49±10 kJ/mol and ΔHsubl(ReO3Cl)=67±10 kJ/mol. A fast gas chemical separation technique for highly volatile compounds of short-lived isotopes based on isothermal gas solid adsorption chromatography (OLGA-principle) was developed. With a modified OLGA device, model studies with the short-lived nuclides 106,107,108Tc and 169,170,174,176Re were carried out in preparation of an experimental gas chemical investigation of bohrium (Bh, element 107). Separation times of less than 3 s were achieved. A good separation of the oxychlorides of group 7 elements from chloride and oxychloride compounds of 152-155Er, 151-154Ho (as models for actinide elements), 98-101Nb, 99-102Zr (as models for light transactinide elements), 218Po, and 214Bi was accomplished in this chemical system. (orig.)

  17. Paul Scherrer Institute Scientific Report 1999. Volume I: Particles and Matter

    Energy Technology Data Exchange (ETDEWEB)

    Gobrecht, J.; Gaeggeler, H.; Herlach, D.; Junker, K.; Kettle, P.-R.; Kubik, P.; Zehnder, A. [eds.


    lthough originally planned for fundamental research in nuclear physics, the particle beams of pions, muons, protons and neutrons are now used in a large variety of disciplines in both natural science and medicine. The beams at PSI have the world's highest intensities and therefore allow certain experiments to be performed, which would not be possible elsewhere. The highlight of research this year was the first-ever determination of the chemical properties of the superheavy element {sup 107} Bohrium. This was undertaken, by an international team led by H. Gaeggeler of PSI's Laboratory for Radiochemistry. Bohrium was produced by bombarding a Berkelium target with Neon ions from the Injector I cyclotron and six atoms were detected after having passed through an online gas chromatography device. At the Laboratory for Particle Physics the focus has shifted from nuclear physics to elementary particle physics with about a fifty-fifty split between investigations of rare processes or particle decays using the high intensity muon, pion and recently also polarized neutron beams of PSI, and research at the highest energy frontier at CERN (Geneva) and DESY (Hamburg). Important space instrumentation has been contributed by the Laboratory for Astrophysics to the European Space Agency and NASA satellite programmes. The Laboratory for Micro and Nanotechnology continued to focus on research into molecular nanotechnology and SiGeC nanostructures, the latter with the aim of producing silicon based optoelectronics. Progress in 1999 in these topical areas is described in this report. A list of scientific publications in 1999 is also provided.

  18. Antipeptide antibodies that can distinguish specific subunit polypeptides of glutamine synthetase from bean (Phaseolus vulgaris L.) (United States)

    Cai, X.; Henry, R. L.; Takemoto, L. J.; Guikema, J. A.; Wong, P. P.; Spooner, B. S. (Principal Investigator)


    The amino acid sequences of the beta and gamma subunit polypeptides of glutamine synthetase from bean (Phaseolus vulgaris L.) root nodules are very similar. However, there are small regions within the sequences that are significantly different between the two polypeptides. The sequences between amino acids 2 and 9 and between 264 and 274 are examples. Three peptides (gamma 2-9, gamma 264-274, and beta 264-274) corresponding to these sequences were synthesized. Antibodies against these peptides were raised in rabbits and purified with corresponding peptide-Sepharose affinity chromatography. Western blot analysis of polyacrylamide gel electrophoresis of bean nodule proteins demonstrated that the anti-beta 264-274 antibodies reacted specifically with the beta polypeptide and the anti-gamma 264-274 and anti-gamma 2-9 antibodies reacted specifically with the gamma polypeptide of the native and denatured glutamine synthetase. These results showed the feasibility of using synthetic peptides in developing antibodies that are capable of distinguishing proteins with similar primary structures.

  19. Localization of the nic site of IncN conjugative plasmid pCU1 through formation of a hybrid oriT.


    Paterson, E S; Iyer, V. N.


    The N-type oriT of plasmid pMUR274 was cloned on a 474-bp RsaI-SspI fragment, and the nucleotide sequence was determined. A comparison of the pMUR274 oriT sequence and the sequence of the oriTs of IncN plasmid pCU1 and IncW plasmid R388 demonstrated 57 and 28% identity, respectively. Intramolecular, site-specific recombination between the pCU1 oriT and the oriT of pMUR274 resulted in the formation of a hybrid oriT containing one half of each parental sequence. The junction point of the hybrid...

  20. Accelerated Partial Breast Irradiation: 5-Year Results of the German-Austrian Multicenter Phase II Trial Using Interstitial Multicatheter Brachytherapy Alone After Breast-Conserving Surgery

    International Nuclear Information System (INIS)

    Purpose: To evaluate the impact of accelerated partial breast irradiation on local control, side effects, and cosmesis using multicatheter interstitial brachytherapy as the sole method for the adjuvant local treatment of patients with low-risk breast cancer. Methods and Materials: 274 patients with low-risk breast cancer were treated on protocol. Patients were eligible for the study if the tumor size was 35 years, hormone receptors were positive, and histologic grades were 1 or 2. Of the 274 patients, 175 (64%) received pulse-dose-rate brachytherapy (Dref = 50 Gy). and 99 (36%) received high-dose-rate brachytherapy (Dref = 32.0 Gy). Results: Median follow-up was 63 months (range, 9-103). Only 8 of 274 (2.9%) patients developed an ipsilateral in-breast tumor recurrence at the time of analysis. The 5-year actuarial local recurrence-free survival probability was 98%. The 5- year overall and disease-free survival probabilities of all patients were 97% and 96%, respectively. Contralateral in-breast malignancies were detected in 2 of 274 (0.7%) patients, and distant metastases occurred in 6 of 274 (2.2%). Late side effects ≥Grade 3 (i.e., breast tissue fibrosis and telangiectasia) occurred in 1 patient (0.4%, 95%CI:0.0-2.0%) and 6 patients (2.2%, 95%CI:0.8-4.7%), respectively. Cosmetic results were good to excellent in 245 of 274 patients (90%). Conclusions: The long-term results of this prospective Phase II trial confirm that the efficacy of accelerated partial breast irradiation using multicatheter brachytherapy is comparable with that of whole breast irradiation and that late side effects are negligible.

  1. Accelerated Partial Breast Irradiation With Interstitial Implants: Risk Factors Associated With Increased Local Recurrence

    International Nuclear Information System (INIS)

    Purpose: To analyze patient, disease, and treatment-related factors regarding their impact on local control after interstitial multicatheter accelerated partial breast irradiation (APBI). Methods and Materials: Between November 2000 and April 2005, 274 patients with early breast cancer were recruited for the German-Austrian APBI Phase II trial ( ( identifier: NCT00392184). In all, 64% (175/274) of the patients received pulsed-dose-rate (PDR) brachytherapy and 36% (99/274) received high-dose-rate (HDR) brachytherapy. Prescribed reference dose for HDR brachytherapy was 32 Gy in eight fractions of 4 Gy, twice daily. Prescribed reference dose in PDR brachytherapy was 49.8 Gy in 83 consecutive fractions of 0.6 Gy each hour. Total treatment time was 3 to 4 days. Results: The median follow-up time was 64 months (range, 9-110). The actuarial 5-year local recurrence free survival rate (5-year LRFS) was 97.7%. Comparing patients with an age <50 years (49/274) vs. ≥50 years (225/274), the 5-year LRFS resulted in 92.5% and 98.9% (exact p = 0.030; 99% confidence interval, 0.029-0.032), respectively. Antihormonal treatment (AHT) was not applied in 9% (24/274) of the study population. The 5-year LRFS was 99% and 84.9% (exact p = 0.0087; 99% confidence interval, 0.0079-0.0094) in favor of the patients who received AHT. Lobular histology (45/274) was not associated with worse local control compared with all other histologies (229/274). The 5-year LRFS rates were 97.6% and 97.8%, respectively. Conclusions: Local control at 5 years is excellent and comparable to therapeutic successes reported from corresponding whole-breast irradiation trials. Our data indicate that patients <50 years of age ought to be excluded from APBI protocols, and that patients with hormone-sensitive breast cancer should definitely receive adjuvant AHT when interstitial multicatheter APBI is performed. Lobular histology need not be an exclusion criterion for future APBI trials.

  2. Emotional and social intelligence in early adolescence by healthy and physically disabled people

    Czech Academy of Sciences Publication Activity Database

    Zacharová, Z.; Karaffová, Eva

    Brno: Institute of Psychology, Academy of Science of the Czech Republic, 2010 - (Blatný, M.; Hřebíčková, M.; Kouřilová, S.; Slezáčková, A.; Květoň, P.; Vobořil, D.). s. 274-274 ISBN 978-80-86174-16-7. [15th European Conference on Personality. 20.07.2010-24.07.2010, Brno] R&D Projects: GA ČR GA406/09/2096 Institutional research plan: CEZ:AV0Z70250504 Keywords : emotional and social intelligence * adolescence * disabilities Subject RIV: AN - Psychology

  3. On the Special Role of the Hamacher Product in Fuzzy Logics

    Czech Academy of Sciences Publication Activity Database

    Cintula, Petr; Klement, E.P.; Mesiar, Radko; Navara, M.

    Linz : Johannes Kepler Universität, 2005 - (Gottwald, S.; Hájek, P.; Höhle, U.; Klement, E.). s. 34-37 [Linz Seminar on Fuzzy Set Theory /26./. 01.02.2005-05.02.2005, Linz] R&D Projects: GA MŠk OC 274.001; GA ČR GA201/02/1504; GA MŠk 1M0545 Grant ostatní: COST(EU) Action 274 TARSKI; VEGA(SK) 1/0273/03; CEEPUS(SK) SK-042 Keywords : fuzzy logic * involutive negation * Hamacher product * t-norms Subject RIV: BA - General Mathematics

  4. Relations in Higher-Order Fuzzy Logic I,II

    Czech Academy of Sciences Publication Activity Database

    Běhounek, Libor; Cintula, Petr

    Linz : Johannes Kepler Universität, 2005 - (Gottwald, S.; Hájek, P.; Höhle, U.; Klement, E.). s. 10-15 [Linz Seminar on Fuzzy Set Theory /26./. 01.02.2005-05.02.2005, Linz] R&D Projects: GA MŠk OC 274.001; GA AV ČR KJB100300502 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z10300504 Keywords : formal fuzzy logic * fuzzy set * foundations of fuzzy mathematics * LPi logic * higher-order fuzzy logic * fuzzy type theory * multi-sorted fuzzy logic Subject RIV: BA - General Mathematics

  5. A Generalization of the Classic Rules for Belief Functions Combination

    Czech Academy of Sciences Publication Activity Database

    Daniel, Milan

    Jindřichův Hradec: Fakulta managementu VŠE Praha, 2005 - (Kroupa, T.; Vejnarová, J.), s. 14-23 ISBN 80-245-0915-6. [Czech-Japan Seminar on Data Analysis and Decision Making under Uncertainty /8./. Třešť (CZ), 18.09.2005-21.09.2005] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(EU) Action 274 TARSKI Institutional research plan: CEZ:AV0Z10300504 Keywords : belief functions * Demspter-Shafer theory * Dempster's rule * Yager's rule * Dubois-Prade's rule * DSm theory Subject RIV: BA - General Mathematics

  6. Combination of a Belief Functions on Two-element and on General n-element Frame of Discernment

    Czech Academy of Sciences Publication Activity Database

    Daniel, Milan

    Ostrava : University of Ostrava, 2003 - (Ramík, J.; Novák, V.), s. 6-11 [Czech-Japan Seminar on Data Analysis and Decision - Making under Uncertainty /6./. Valtice (CZ), 20.09.2003-23.09.2003] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: AV0Z1030915 Keywords : belief function * Dempster-Shafer theory * refinement * coarsening * belief combination * contradiction * conflict Subject RIV: BA - General Mathematics

  7. Electromagnetic emission by subsequent processes L→L'+S and L+L'→T

    Czech Academy of Sciences Publication Activity Database

    Karlický, Marian; Bárta, Miroslav

    Cambridge : Cambridge University Press, 2011 - (Bonanno, A.), s. 252-254 ISBN 9780521197410. ISSN 1743-9213. - (IAU Symposium Proceedings Series. S274). [Symposium of the International Astronomical Union /274./. Giardini Naxos (IT), 06.09.2010-10.09.2010] R&D Projects: GA AV ČR(CZ) IAA300030701; GA AV ČR IAA300030804; GA ČR GA205/07/1100 Institutional research plan: CEZ:AV0Z10030501 Keywords : waves * radiation mechanisms * radio radiation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  8. A Generalized Pignistic Transformation. Chapter 7

    Czech Academy of Sciences Publication Activity Database

    Dezert, J.; Smarandache, F.; Daniel, Milan

    Rehoboth : American Research Press, 2004 - (Smarandache, F.; Dezert, J.), s. 143-154 ISBN 1-931233-82-9 R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : Dezert-Smarandache theory ( DSm T) * Dempster-Shafer theory * pignistic transformation * subjective probability * pignistic probability * plausible and paradoxical reasoning * DSm cardinality * hybrid model * data fusion * decision-making * conflict * processing Subject RIV: BA - General Mathematics

  9. The Generalized Pignistic Transformation

    Czech Academy of Sciences Publication Activity Database

    Dezert, J.; Smarandache, F.; Daniel, Milan

    ISIF, 2004 - (Svensson, P.; Schubert, J.), s. 384-391 ISBN 91-7056-115-X. [International Conference of Information Fusion /7./. Stockholm (SE), 28.06.2004-01.07.2004] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : Dezert-Smarandache theory ( DSm T) * Dempster-Shafer theory * pignistic transformation * subjective probability * pignistic probability * plausible and paradoxical reasoning * DSm cardinality * hybrid model * data fusion * decision-making * conflict * processing Subject RIV: BA - General Mathematics

  10. Nasjonal innsjøundersøkelse 2004 - 2006, del 2: Sedimenter. Forurensning av metaller, PAH og PCB. National lake survey 2004 - 2006, part 2: Sediments. Pollution of metals, PAH and PCB


    Rognerud, S.; Fjeld, E; B. L. Skjelkvåle; Christensen, G.; Røyset, O.


    Denne undersøkelsen omfatter resultatene av sedimentanalysene fra en landsomfattende innsjøundersøkelse som pågikk i 2004 – 2006. Innsjøenes dominerende forurensningskilde er atmosfæriske avsetninger. Den er en av 4 rapporter fra prosjektet og omhandler forurensningsgraden av metaller, metalloider, PAH og PCB i 274 innsjøer vurdert ut fra konsentrasjoner i sedimenter som er avsatt i senere tid og i pre-industriell tid. This report covers results from sediment analysis in 274 lakes sampled in ...

  11. A Relation of Conjunctive and Disjunctive Rules of Combination on Bayesian Belief Functions

    Czech Academy of Sciences Publication Activity Database

    Daniel, Milan

    Kobe: University of Marketing and Distribution Sciences, 2004 - (Noguchi, H.; Ishii, H.; Inuiguchi, M.), s. 179-184 [Czech-Japan Seminar on Data Analysis and Decision Making under Uncertainty /7./. Awaji (JP), 31.08.2004-02.09.2004] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : belief function * Dempster's rule of combination * disjunctive rule of combination * probabilistic transformation * minC combination Subject RIV: BA - General Mathematics

  12. Weakening Lebesgue Measurability for Lattice-Valued Possibilistic Measures

    Czech Academy of Sciences Publication Activity Database

    Kramosil, Ivan

    Vol. 1. Roma: Editrice Universita La Sapienza, 2004, s. 359-366. ISBN 88-87242-54-2. [IPMU 2004 /10./. Perugia (IT), 04.07.2004-09.07.2004] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : posibilistic measures * complete lattices * sets measurable in the Lebesgue sense * almost measurable sets * classes of almost measurable sets Subject RIV: BA - General Mathematics

  13. Consistency of Probabilistic Transformations of Belief Functions

    Czech Academy of Sciences Publication Activity Database

    Daniel, Milan

    Roma: Editrice Universita La Sapienza, 2004, s. 1135-1142. ISBN 88-87242-54-2. [IPMU 2004 /10./. Perugia (IT), 04.07.2004-09.07.2004] R&D Projects: GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : belief function * combination of belief functions * Dempster-Shafer theory * probabilistic transformation * probabilization * Pignistic probability * proportional probabilistic transformations * belief-plausibility probabilistic transformation * ulb-consistency * combination consistency Subject RIV: BA - General Mathematics

  14. AcEST: DK945163 [AcEST

    Lifescience Database Archive (English)


  15. Fuzzy Hypotheses Testing in the Framework of Fuzzy Logic

    Czech Academy of Sciences Publication Activity Database

    Holeňa, Martin


    Roč. 145, - (2004), s. 229-252. ISSN 0165-0114 R&D Projects: GA AV ČR IAA1030004; GA MŠk OC 274.001 Grant ostatní: COST(XE) Action 274 TARSKI Institutional research plan: CEZ:AV0Z1030915 Keywords : non-classical logics * fuzzy predicate calculus * basic fuzzy logic * generalized quantifiers * fuzzy statistics and data analysis * vague hypotheses * vague significance level * method Guha Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 0.734, year: 2004

  16. Precise, contactless measurements of the surface tension of picolitre aerosol droplets

    Czech Academy of Sciences Publication Activity Database

    Bzdek, B. R.; Power, R. M.; Simpson, Stephen Hugh; Reid, J. P.; Royall, C. P.


    Roč. 7, č. 1 (2016), s. 274-285. ISSN 2041-6520 R&D Projects: GA MŠk(CZ) LO1212 Institutional support: RVO:68081731 Keywords : hygroscopicity model framework * organic-compounds * inorganic-compounds Subject RIV: BH - Optics, Masers, Lasers Impact factor: 9.211, year: 2014

  17. Temperature, salinity and transmissivity data from the Alpha Helix in the Arctic Ocean, 2000 - 2004 (NODC Accession 0059005) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This is calibrated CTD downcast data from five Alpha Helix cruises: HX235, 8/1/2000 - 9/30/2000 HX250, 9/1/2001 - 9/30/2001 HX260, 6/1/2002 - 6/30/2002 HX274,...

  18. Expressivity of apomixis in 2n + n hybrids from an apomictic and a sexual parent: insights into variation detected in Pilosella (Asteraceae: Lactuceae)

    Czech Academy of Sciences Publication Activity Database

    Krahulcová, Anna; Krahulec, František; Rosenbaumová, R.


    Roč. 24, č. 1 (2011), s. 263-274. ISSN 0934-0882 R&D Projects: GA ČR GA206/08/0890 Institutional research plan: CEZ:AV0Z60050516 Keywords : inheritance of apomixis * residual sexuality * unreduced hybrids Subject RIV: EF - Botanics Impact factor: 1.869, year: 2011

  19. Nano-level characterization of silicon thin films and solar cells

    Czech Academy of Sciences Publication Activity Database

    Fejfar, Antonín

    Tokyo: Ohmsha, 2013 - (Konagai, M.), s. 468-478 ISBN 978-4-274-21399-1 R&D Projects: GA MŠk(CZ) LM2011026 Grant ostatní: AVČR(CZ) M100101217 Institutional support: RVO:68378271 Keywords : silicon * thin films * atomic force microscopy * photoresponse Subject RIV: BM - Solid Matter Physics ; Magnetism

  20. File list: NoD.Neu.05.AllAg.Brain [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Neu.05.AllAg.Brain mm9 No description Neural Brain ERX161927,ERX161926,ERX16192...274,SRX298040,ERX402277,ERX402292,ERX402281 ...

  1. 78 FR 4766 - Adoption of Updated EDGAR Filer Manual (United States)


    ... From the Federal Register Online via the Government Publishing Office SECURITIES AND EXCHANGE COMMISSION 17 CFR Parts 232, 239, 249, 269, 274 Adoption of Updated EDGAR Filer Manual AGENCY: Securities and.... Along with the adoption of the Filer Manual, we are amending Rule 301 of Regulation S-T to provide...

  2. Effect of Fire on Pools of Mercury in Forest Soil, Central Europe

    Czech Academy of Sciences Publication Activity Database

    Navrátil, Tomáš; Hojdová, Maria; Rohovec, Jan; Penížek, V.; Vařilová, Z.


    Roč. 83, č. 2 (2009), s. 269-274. ISSN 0007-4861 R&D Projects: GA ČR GP526/07/P170 Institutional research plan: CEZ:AV0Z30130516 Keywords : Hg distribution in soil * Hg emissions * Hg soi pools Subject RIV: DD - Geochemistry Impact factor: 0.992, year: 2009

  3. A Middle Pennsylvanian (Bolsovian) peat-forming forest preserved in situ in volcanic ash of the Whetstone Horizon in the Radnice Basin, Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Opluštil, S.; Pšenička, J.; Libertín, M.; Bashforth, A. R.; Šimůnek, Z.; Drábková, J.; Dašková, Jiřina


    Roč. 155, 3-4 (2009), s. 234-274. ISSN 0034-6667 R&D Projects: GA ČR GA205/05/0105 Institutional research plan: CEZ:AV0Z30130516 Keywords : Pennsylvanian * tuff * in situ * plant taphonomy * palaeoecology * peat-forming mires Subject RIV: DB - Geology ; Mineralogy Impact factor: 2.145, year: 2009

  4. Pre-Service Teachers' Open-Minded Thinking Dispositions, Readiness to Learn, and Attitudes about Learning and Behavioural Difficulties in Students (United States)

    Elik, Nezihe; Wiener, Judith; Corkum, Penny


    This self-report study investigated 274 pre-service teachers' attitudes toward students with learning and behavioural difficulties (LBD) and the factors that predict their attitudes. Using four scenarios describing students with LBD, we investigated the degree to which pre-service teachers' open-minded thinking dispositions, readiness to learn…

  5. SPIDIA-DNA: An External Quality Assessment for the pre-analytical phase of blood samples used for DNA-based analyses

    Czech Academy of Sciences Publication Activity Database

    Malentacchi, F.; Pazzagli, M.; Simi, L.; Orlando, C.; Wyrich, R.; Hartmann, C.C.; Verderio, P.; Pizzamiglio, S.; Ciniselli, C.M.; Tichopád, Aleš; Kubista, Mikael; Gelmini, S.

    -, č. 424 (2013), s. 274-286. ISSN 0009-8981 Institutional research plan: CEZ:AV0Z50520701 Keywords : Pre-analytical phase * DNA quality * Blood samples Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.764, year: 2013

  6. 42 CFR 435.407 - Types of acceptable documentary evidence of citizenship. (United States)


    ...) Child Citizenship Act. Adopted or biological children born outside the United States may establish...), as amended by the Child Citizenship Act of 2000 (Pub. L. 106-395, enacted on October 30, 2000). The... documents described in 8 CFR 274a.2(b)(1)(v)(B)(1). (i) Driver's license issued by State or Territory...

  7. 42 CFR 436.407 - Types of acceptable documentary evidence of citizenship. (United States)


    ...) Child Citizenship Act. Adopted or biological children born outside the United States may establish...), as amended by the Child Citizenship Act of 2000 (Pub. L. 106-395, enacted on October 30, 2000). The...) of this section. (1) Identity documents described in 8 CFR 274a.2(b)(1)(v)(B)(1). (i)...

  8. Does the Country-of-Origin (COO) of food products influence consumer evaluations?

    DEFF Research Database (Denmark)

    Krystallis, Athanasios; Chryssohoidis, G.


    and confirmatory factor analyses. Data were collected though personal interviews with a sample of 274 respondents, which compared two food products of Greek origin (ham and yellow cheese) to their counterparts from Italy and the Netherlands. Results indicate that respondents exhibit a marginally ethnocentric...

  9. Monitoring of incidental catches of cetaceans by Dutch pelagic trawlers, July 2004 - December 2005

    NARCIS (Netherlands)

    Couperus, A.S.


    Dit rapport bevat de resultaten van het doorlopende waarnemersprogramma naar de bijvangst van dolfijnen in de Nederlandse pelagische visserij onder EU Verordening 812/2004 in de periode juni 2004 tot en met december 2005. In de jaren 2004 en 2005 zijn waarnemingen uitgevoerd van in totaal 274 trekke

  10. Influence of the dislocation core on the glide of the 1/2 < 111 >{110} edge dislocation in bcc-iron: An embedded atom method study

    Czech Academy of Sciences Publication Activity Database

    Haghighat, S.M.H.; von Pezold, J.; Race, C. P.; Kormann, F.; Friák, Martin; Neugebauer, J.; Raabe, D.


    Roč. 87, MAY (2014), s. 274-282. ISSN 0927-0256 Institutional support: RVO:68081723 Keywords : Molecular dynamics * Edge dislocation * Core structure * Dislocation glide * Iron Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.131, year: 2014

  11. Photo-production of neutral kaons on C-12 in the threshold region

    Czech Academy of Sciences Publication Activity Database

    Watanabe, T.; Bydžovský, Petr; Dobashi, K.; Endo, S.; Fujii, Y.; Hashimoto, O.; Ishikawa, T.; Itoh, K.; Kanda, H.


    Roč. 651, č. 4 (2007), s. 269-274. ISSN 0370-2693 R&D Projects: GA ČR GA202/05/2142 Institutional research plan: CEZ:AV0Z10480505 Keywords : photo-production * neutral kaon * quasi-free reaction Subject RIV: BE - Theoretical Physics Impact factor: 4.189, year: 2007

  12. Polarized infrared spectroscopy and quantum chemistry calculations studies on structure and orientation of C-H---O=C hydrogen bondings in biodegradable poly(3-hydroxybutyrate)

    Czech Academy of Sciences Publication Activity Database

    Sato, H.; Dybal, Jiří; Iwata, T.; Zhang, J.; Tashiro, K.; Noda, I.; Ozaki, Y.

    Delavan : International Steering Committee, 2005. s. 274. [International Conference on Advanced Vibrational Spectroscopy /3./. 14.8.2005-19.8.2005, Delavan] Institutional research plan: CEZ:AV0Z40500505 Keywords : UHMW- PHB * IR spectra Subject RIV: CD - Macromolecular Chemistry

  13. An Examination of Black Science Teacher Educators' Experiences with Multicultural Education, Equity, and Social Justice (United States)

    Atwater, Mary M.; Butler, Malcolm B.; Freeman, Tonjua B.; Carlton Parsons, Eileen R.


    Diversity, multicultural education, equity, and social justice are dominant themes in cultural studies (Hall in "Cultural Dialogues in Cultural Studies." Routledge, New York, pp 261-274, 1996; Wallace 1994). Zeichner ("Studying Teacher Education: The Report of the AERA Panel on Research and Teacher Education." Lawrence Erlbaum…

  14. Correction: Comparative Analysis of Fungal Genomes Reveals Different Plant Cell Wall Degrading Capacity in Fungi


    Zhao, Zhongtao; Liu, Huiquan; Wang, Chenfang; Xu, Jin-Rong


    Abstract The version of this article published in BMC Genomics 2013, 14: 274, contains 9 unpublished genomes (Botryobasidium botryosum, Gymnopus luxurians, Hypholoma sublateritium, Jaapia argillacea, Hebeloma cylindrosporum, Conidiobolus coronatus, Laccaria amethystina, Paxillus involutus, and P. rubicundulus) downloaded from JGI website. In this correction, we removed these genomes after discussion with editors and data producers whom we should have contacted before downloading these genomes...

  15. Score function of distribution and revival of the moment method

    Czech Academy of Sciences Publication Activity Database

    Fabián, Zdeněk


    Roč. 45, č. 4 (2016), s. 1118-1136. ISSN 0361-0926 R&D Projects: GA MŠk(CZ) LG12020 Institutional support: RVO:67985807 Keywords : score function * characteristics of distributions * parametric methods * general moment method * data characteristics * Huber moment estimator Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 0.274, year: 2014

  16. Language Learning Strategies of Language e-Learners in Turkey (United States)

    Solak, Ekrem; Cakir, Recep


    The purpose of this study was to determine the use of language learning strategies of e-learners and to understand whether there were any correlations between language learning strategies and academic achievement. Participants of the study were 274?e-learners, 132 males and 142 females, enrolled in an e-learning program from various majors and…

  17. Kuidas kirjutatakse ajalugu? / Roger Chartier ; interv. Marek Tamm

    Index Scriptorium Estoniae

    Chartier, Roger


    Kirjanduslikest tekstidest sotsiaalajaloo uurimisallikana, juhuse ja paratamatuse vahekorrast ajaloos ja Prantsuse revolutsiooni käsitlusest Pariisi õppe- ja teaduskeskuse Ecole des Hautes Etudes en Sciences Sociales professori R. Chartier'i teostes. Varem ilm.: Tekstid, praktikad ja lugejad : intervjuu Roger Chartier'ga // Chartier, Roger. Prantsuse revolutsiooni kultuurilised lätted. - Tallinn, 2002. - Lk. 274-290

  18. Tolerance to acute ischemia in adult male and female spontaneously hypertensive rats

    Czech Academy of Sciences Publication Activity Database

    Bešík, J.; Szárszoi, Ondrej; Kuneš, Jaroslav; Netuka, I.; Malý, J.; Kolář, František; Pirk, J.; Ošťádal, Bohuslav


    Roč. 56, č. 3 (2007), s. 267-274. ISSN 0862-8408 R&D Projects: GA MŠk(CZ) 1M0510; GA MZd ND7607 Institutional research plan: CEZ:AV0Z50110509 Keywords : cardiac tolerance * ischemia injury * gender differences Subject RIV: ED - Physiology Impact factor: 1.505, year: 2007

  19. EST Table: FS830202 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS830202 E_FL_fmgV_34C08_R_0 10/09/28 94 %/274 aa ref|NP_001040163.1| ischemia/repe...rfusion inducible protein [Bombyx mori] gb|ABD36179.1| ischemia/reperfusion inducible protein [Bombyx mori

  20. Morphogenesis and bone integration of the mouse mandibular third molar

    Czech Academy of Sciences Publication Activity Database

    Chlastáková, Ivana; Lungová, V.; Wells, K.; Tucker, A. S.; Radlanski, R.J.; Míšek, Ivan; Matalová, Eva


    Roč. 119, č. 4 (2011), s. 265-274. ISSN 0909-8836 R&D Projects: GA AV ČR IAA600450904; GA ČR GC524/08/J032 Institutional research plan: CEZ:AV0Z50450515 Keywords : 3D models * apoptosis * osteoclast activity Subject RIV: ED - Physiology Impact factor: 1.878, year: 2011

  1. Disease: H00259 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available Apparent mineralocorticoid excess (AME) syndrome is characterized by hypertension, low plasma renin and ald...rtension. Best Pract Res Clin Endocrinol Metab 20:337-53...071] Dexamethasone [DR:D00292] ICD-10: E27.4 I15.2 OMIM: 218030 207765 PMID:16980198 Hammer F, Stewart PM Cortisol metabolism in hype

  2. Autism Parenting Stress Index: Initial Psychometric Evidence (United States)

    Silva, Louisa M. T.; Schalock, Mark


    Data validating the Autism Parenting Stress Index (APSI) is presented for 274 children under age six. Cronbach's alpha was 0.827. As a measure of parenting stress specific to core and co-morbid symptoms of autism, the APSI is unique. It is intended for use by clinicians to identify areas where parents need support with parenting skills, and to…

  3. Similarity in General Mental Ability in Bedouin Full and Half Siblings. (United States)

    Elbedour, Salman; Hur, Yoon-Mi; Bouchard, Thomas J., Jr.


    A battery of "g" loaded mental ability tests was administered to 274 Bedouin children and adolescents, full and half siblings from 106 families. Results demonstrate internal validity for the tests in this cultural context and support the idea that shared family environment is a strong determinant of sibling similarity for children in the given age…

  4. 76 FR 28823 - Submission for OMB Review; Comment Request (United States)


    ... (17 CFR 274.14) is the form used by face-amount certificate companies to comply with the filing and...)). Form N-8B-4 requires disclosure about the face-amount certificate company's organization, controlling... are not derived from a comprehensive or even a representative survey or study of the costs of...

  5. Continuous brightening of IGR J17473-2721

    NARCIS (Netherlands)

    C. Baldovin Saavedra; J. Chenevez; E. Kuulkers; V. Beckmann; A. Bird; S. Brandt; T.J.L. Courvoisier; A. Domingo; K. Ebisawa; P. Jonker; P. Kretschmar; C. Markwardt; T. Oosterbroek; A. Paizis; D. Risquez; C. Sanchez-Fernandez; S. Shaw; R. Wijnands


    Renewed accretion activity has been reported by Swift/XRT (ATel #1459), XTE/PCA (ATel #1460) and INTEGRAL/IBIS/ISGRI (ATel #1461) from the RXTE transient IGR J17473-2721 (= XTE J1747-274; ATels #467, #498) after the detection of an X-ray burst by SuperAGILE (ATel #1445). From the on- going Galactic

  6. Cold exposure and associated metabolic changes in adult tropical beetles exposed to fluctuating thermal regimes

    Czech Academy of Sciences Publication Activity Database

    Lalouette, L.; Košťál, Vladimír; Colinet, H.; Gagneul, D.; Renault, D.


    Roč. 274, č. 7, (2007), s. 1759-1767. ISSN 1742-464X Grant ostatní: Biodiversity Research Centre of the Université Catholique de Louvain(BE) BRC 111 Institutional research plan: CEZ:AV0Z50070508 Keywords : amino acid * fluctuating thermal regime * insect Subject RIV: ED - Physiology Impact factor: 3.396, year: 2007

  7. Modulation and Coding Techniques in Wireless Communications


    Casares Giner, Vicente; Martínez Zaldívar, Francisco José


    This is a timely book on wireless communications, with twelve chapters covering theoretical results and material of standards. The first nine chapters, some 380 pages, are devoted to basic concepts on channel models, modulation, coding, equalization, MIMO techniques, and multiple access methods. The last three chapters extend up to 274 pages and cover the modern wireless communication standards

  8. 78 FR 44557 - Turnagain Arm Tidal Energy Corporation; Notice of Preliminary Permit Application Accepted for... (United States)


    ... Energy Regulatory Commission Turnagain Arm Tidal Energy Corporation; Notice of Preliminary Permit... February 1, 2013, the Turnagain Arm Tidal Energy Corporation, filed an application for a preliminary permit... Tidal Energy Corporation, 821 N. Street, Suite 207, Anchorage, Alaska 99501; phone: (907) 274-7571....

  9. Decomposition of Repetition Priming Processes in Word Translation (United States)

    Francis, Wendy S.; Duran, Gabriela; Augustini, Beatriz K.; Luevano, Genoveva; Arzate, Jose C.; Saenz, Silvia P.


    Translation in fluent bilinguals requires comprehension of a stimulus word and subsequent production, or retrieval and articulation, of the response word. Four repetition-priming experiments with Spanish-English bilinguals (N = 274) decomposed these processes using selective facilitation to evaluate their unique priming contributions and factorial…

  10. Medical Informatics Impact of Information Society in Health Care Development

    Czech Academy of Sciences Publication Activity Database

    Zvárová, Jana


    Roč. 9, - (2005), s. 269-274. ISSN 1335-2393. [YBERC 2005. Young Biomedical Engineers and Researchers Conference. Stará Lesná, 13.07.2005-15.07.2005] Institutional research plan: CEZ:AV0Z10300504 Keywords : medical informatics * information society * telemedicine * education * research and development Subject RIV: BD - Theory of Information

  11. The GUHA Method, Data Preprocessing and Mining

    Czech Academy of Sciences Publication Activity Database

    Hájek, Petr; Rauch, J.; Coufal, David; Feglar, T.

    Berlin: Springer-Verlag, 2004 - (Meo, R.; Lanzi, P.; Klemettinen, M.), s. 135-153. (Lecture Notes in Artificial Intelligence . 2682). ISBN 3-540-22479-3 R&D Projects: GA MŠk OC 274.001 Institutional research plan: CEZ:AV0Z1030915 Keywords : GUHA method * data preprocessing * data mining Subject RIV: BA - General Mathematics

  12. Německé podnikání Baťova koncernu. Studie k hospodářským a sociálním dějinám hornoslezského továrního města Ottmuth (Otmęt)

    Czech Academy of Sciences Publication Activity Database

    Jemelka, M.; Ševeček, Ondřej


    Roč. 111, č. 2 (2013), s. 237-274. ISSN 0037-6833 R&D Projects: GA ČR(CZ) GAP410/10/1995 Institutional support: RVO:67985955 Keywords : Baťa concern * Upper Silesia * Ottmuth (Otmęt) * shoe Industry Subject RIV: AB - History

  13. Solvent extraction of microamounts of strontium and barium from water into nitrobenzene using hydrogen dicarbollylcobaltate in the presence of benzo-18-crown-6

    Czech Academy of Sciences Publication Activity Database

    Makrlík, E.; Vančura, P.; Selucký, P.; Hálová, Jaroslava


    Roč. 274, č. 3 (2007), s. 625-629. ISSN 0236-5731 Institutional research plan: CEZ:AV0Z40320502 Keywords : unex proces * dicarbolide * separation Subject RIV: CA - Inorganic Chemistry Impact factor: 0.499, year: 2007

  14. The effect of Bt-corn on soil invertebrates, soil microbial community and decomposition rates of corn post-harvest residues under field and laboratory conditions

    Czech Academy of Sciences Publication Activity Database

    Frouz, Jan; Elhottová, Dana; Helingerová, M.; Kocourek, F.


    Roč. 32, č. 4 (2008), s. 645-655. ISSN 1044-0046 Institutional research plan: CEZ:AV0Z60660521 Keywords : Bt corn * soil biology * decomposition Subject RIV: EH - Ecology, Behaviour Impact factor: 0.274, year: 2008

  15. Evaluation of Pediatric Patients with Orbital and Preseptal Cellulitis

    Directory of Open Access Journals (Sweden)

    Eren Cagan


    Conclusion: Preseptal cellulitis is more frequently observed than orbital cellulitis. The most important predisposing factor for orbital cellulitis is sinusitis. Patients with preseptal cellulitis suspected clinically may be diagnosed with orbital cellulitis radiologically. As a result radiological imaging of preseptal cellulitis patients should be considered. [Cukurova Med J 2015; 40(2.000: 267-274

  16. Some new scales of weight characterizations of Hardy-type inequalities

    Czech Academy of Sciences Publication Activity Database

    Kufner, Alois; Persson, L. E.; Samko, N.

    1. Basel : Birkhäuser, 2013 - (Karlovich, Y.), s. 261-274 ISBN 978-3-0348-0536-0. - (Operator Theory: Advances and Applications. 228) Institutional support: RVO:67985840 Keywords : inequalities * Hardy's inequality * weights Subject RIV: BA - General Mathematics

  17. 20 CFR 655.15 - Required pre-filing recruitment. (United States)


    ... implementing regulations at 8 CFR 274a.6. (j) Recruitment report. (1) No fewer than 2 calendar days after the... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Required pre-filing recruitment. 655.15... States (H-2B Workers) § 655.15 Required pre-filing recruitment. (a) Time of filing of application....

  18. Dragonair- Year-on-Year Rises Continue For Passengers And Cargo

    Institute of Scientific and Technical Information of China (English)


    @@ Passenger numbers at Dragonair rose 13.2% while cargo volumes climbed 23.9%in April compared with the same month in 2004. The airline flew 431,860 passengers last month, 50,274 more than one year ago,and 7.3% up on March.

  19. On the pumping effect in a pipe/tank flow configuration with friction

    Czech Academy of Sciences Publication Activity Database

    Cid, J.A.; Propst, G.; Tvrdý, Milan

    273-274, April (2014), s. 28-33. ISSN 0167-2789 R&D Projects: GA ČR(CZ) GA14-06958S Institutional support: RVO:67985840 Keywords : valveless pumping * singular problem * periodic solution Subject RIV: BA - General Mathematics Impact factor: 1.636, year: 2014

  20. First clinical use of ofatumumab, a novel fully human anti-CD20 monoclonal antibody in relapsed or refractory follicular lymphoma

    DEFF Research Database (Denmark)

    Hagenbeek, Anton; Gadeberg, Ole Vestergaard; Johnson, Peter;


    lactate dehydrogenase. No safety concerns or maximum tolerated dose was identified. A total of 274 adverse events were reported; 190 were judged related to ofatumumab, most occurring on the first infusion day with Common Terminology Criteria grade 1 or 2. Eight related events were grade 3. Treatment...

  1. 77 FR 37035 - Goose River Hydro, Inc.; Independence Hydro, LLC; Notice of Application for Transfer of License... (United States)


    ... Energy Regulatory Commission Goose River Hydro, Inc.; Independence Hydro, LLC; Notice of Application for..., Inc. (transferor) and Independence Hydro, LLC (transferee) filed an application for the transfer of..., Independence Hydro, LLC, 220 Maine Mall Road, South Portland, ME 01406, (207) 274-0001. FERC Contact:...

  2. Textural characteristics of foreshore sediments along Karnataka shoreline, west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Dora, G.U.; SanilKumar, V.; Philip, C.S.; Johnson, G.; Vinayaraj, P.; Gowthaman, R.

    the three beaches. The median values varied in between −0.04phi and 2.74phi with an average value of 1.61phi. The beaches were characterized as well sorted, moderately well sorted and moderately sorted sediment environments. Sediments were identified as fine...

  3. Early warning score predicts acute mortality in stroke patients

    DEFF Research Database (Denmark)

    Liljehult, J; Christensen, T


    the Copenhagen University Hospital, Nordsjaellands Hospital, Denmark, from May to September 2012 were enrolled in a retrospective cohort study (n = 274). Vital signs were measured immediately after admission and consistently during the hospitalization period. Based on the vital signs, a single...

  4. On adaptive time stepping for large-scale parabolic problems: Computer simulation of heat and mass transfer in vacuum freeze-drying

    Czech Academy of Sciences Publication Activity Database

    Georgiev, K.; Kosturski, N.; Margenov, S.; Starý, Jiří


    Roč. 226, č. 2 (2009), s. 268-274. ISSN 0377-0427 Institutional research plan: CEZ:AV0Z30860518 Keywords : Vacuum freeze drying * Zeolites * Heat and mass transfer * Finite element method * MIC(0) preconditioning Subject RIV: BA - General Mathematics Impact factor: 1.292, year: 2009

  5. Interaction of Silver Nanopowder with Cooper Substrate

    Czech Academy of Sciences Publication Activity Database

    Sopoušek, J.; Buršík, Jiří; Zálešák, J.; Buršíková, V.; Brož, P.


    Roč. 43, - (2011), s. 33-38. ISSN 0350-820X R&D Projects: GA ČR(CZ) GA106/09/0700 Institutional research plan: CEZ:AV0Z20410507 Keywords : silver * copper * sintering Subject RIV: JG - Metallurgy Impact factor: 0.274, year: 2011

  6. Phosphorylation of Type IA restriction-modification complex enzyme EcoKI on the HsdR subunit

    Czech Academy of Sciences Publication Activity Database

    Cajthamlová, Kamila; Šišáková, Eva; Weiser, Jaroslav; Weiserová, Marie


    Roč. 270, - (2007), s. 171-177. ISSN 0378-1097 R&D Projects: GA ČR GA204/07/0325; GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : protein phosphorylation * restriction-modification * subcellular fraction Subject RIV: EE - Microbiology, Virology Impact factor: 2.274, year: 2007

  7. Quantitative analysis of HGF and EGF-dependent phosphotyrosine signaling networks

    DEFF Research Database (Denmark)

    Hammond, Dean E; Hyde, Russell; Kratchmarova, Irina;


    549 lung adenocarcinoma cells with EGF or HGF. In total, we obtained quantitative information for 274 proteins, which respond to either or both stimuli by >1.5 fold changes in enrichment, following immuno-precipitation with antiphosphotyrosine antibodies. The data reveal a high degree of overlap...

  8. Social Context of Smoking Hookah among College Students: Scale Development and Validation (United States)

    Sharma, Eva; Beck, Kenneth H.; Clark, Pamela I.


    Objective: To develop an instrument that measures the social context of hookah use among college students. Participants: A pool of 50 potential items, based on 44 in-depth interviews with regular college hookah smokers, was administered to a sample of 274 hookah users between October and December 2011. Methods: Participants were approached in…

  9. Czech way to broadband

    Czech Academy of Sciences Publication Activity Database

    Kuchar, Anton; Peterka, J.; Hrstka, J.; Hankiewiczová, H.

    -, August (2006), s. 274-278. ISSN 1106-2975. [FITCE Congress /45./. Athens, 30.08.2006-02.09.2006] Grant ostatní: BReATH Consortium EU(XE) EC FP6 1ST Programme Institutional research plan: CEZ:AV0Z20670512 Keywords : telecommunication networks * Internet * broadband networks Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  10. 22 CFR 62.2 - Definitions. (United States)


    ... but does not mean independent contractors, as defined in 8 CFR 274a.1(j). Exchange visitor means a... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 62.2 Section 62.2 Foreign... territories or possessions, or who has been lawfully admitted for permanent residence, within the meaning...

  11. Psychosocial and Psychophysiological Strain in Extended Spaceflight Simulation

    Czech Academy of Sciences Publication Activity Database

    Šolcová, Iva


    Roč. 46, č. 3 (2004), s. 179-186. ISSN 0039-3320 R&D Projects: GA ČR GA406/03/1168 Institutional research plan: CEZ:AV0Z7025918 Keywords : spaceflight simulation * enforced confinement * psychosocial burden Subject RIV: AN - Psychology Impact factor: 0.274, year: 2004

  12. Between Religion and Atheism: Hidden Religiosity of the Contemporary Czech Society

    Czech Academy of Sciences Publication Activity Database

    Nešpor, Zdeněk

    Bratislava : Ústav pre vzťahy štátu a cirkví, 2005 - (Jozefčiaková, S.), s. 254-274 ISBN 80-89096-23-9 Institutional research plan: CEZ:AV0Z70280505 Keywords : Sociology of Religion * Czech Republic * 1993- * Religion Subject RIV: AO - Sociology, Demography

  13. Locomotive System

    Institute of Scientific and Technical Information of China (English)


    2008477 Diagnostic value of dystrophin in childhood and adolescent muscular disorders. ZHANG Meng(张萌), et al. Dept pathol, 1st Affili Hosp, Sun Yat-sen Univ, Guangzhou 510080.Chin J Nerv Ment Dis 2008;34(5):274-277. Objective To explore the diagnostic values of dystrophin immunohistochemical reaction in childhood and adolescent muscular disorders.

  14. tmRDB (tmRNA database)

    DEFF Research Database (Denmark)

    Zwieb, Christian; Gorodkin, Jan; Knudsen, Bjarne;


    functional in all bacteria. In this release of tmRDB, 186 new entries from 10 bacterial groups for a total of 274 tmRNA sequences have been added. Lists of the tmRNAs and the corresponding tmRNA-encoded tag-peptides are presented in alphabetical and phylogenetic order. The tmRNA sequences are aligned...

  15. Asset stripping and firm survival in mass privatization: testing the Hoff-Stiglitz and Campos-Giovannoni models in Montenegro

    Czech Academy of Sciences Publication Activity Database

    Koman, M.; Lakićević, M.; Prašnikar, J.; Švejnar, Jan


    Roč. 43, č. 2 (2015), s. 274-289. ISSN 0147-5967 R&D Projects: GA ČR(CZ) GA15-24642S Institutional support: RVO:67985998 Keywords : asset stripping * mass privatization * firm survival Subject RIV: AH - Economics Impact factor: 1.170, year: 2014

  16. Spin Rate of Asteroid (54509) 2000 PH5 Increasing Due to the YORP Effect

    Czech Academy of Sciences Publication Activity Database

    Taylor, P.A.; Margot, J. L.; Vokrouhlický, D.; Scheeres, D.J.; Pravec, Petr; Lowry, S.C.; Fitzsimmons, A.; Nolan, M. C.; Ostro, S. J.; Benner, L. A. M.; Giorgini, J. D.; Magri, C.


    Roč. 316, č. 5822 (2007), s. 274-277. ISSN 0036-8075 Grant ostatní: GA ČR(CZ) GA205/99/0255 Institutional research plan: CEZ:AV0Z10030501 Keywords : asteroids rotation * near-Earth objects * radar observations Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 26.372, year: 2007

  17. The Children's Behavioral Classification Project: An Interim Report (United States)

    Dreger, Ralph Mason


    Described in the interim report of the Children's Behavioral Classification Project (CBCP) is the CBCP instrument, a duplicated list of 274 behavioral items and three demographic items which provides a profile of the emotionally disordered child based on observations by the parent or parent-surrogate. (SBH)

  18. Exposure to slim images in mass media: Television commercials as reminders of restriction in restrained eaters [reprint

    NARCIS (Netherlands)

    Anschutz, D.J.; Strien, T. van; Engels, R.C.M.E.


    This reprinted article originally appeared in Health Psychology, 2008 (Jul), Vol 27(4), 401-408. (The following abstract of the original article appeared in record 2008-09239-001). Objective: The aim of the present study was to explore the effects of exposure to slim images and diet-related products

  19. Domain Modeling: NP_065184.2 [SAHG[Archive

    Lifescience Database Archive (English)

    Full Text Available NP_065184.2 chr1 Solution structure of the tandem four zf-C2H2 domain repeats of mu...rine GLI-Kruppel family member HKR3 c2dlqa_ chr1/NP_065184.2/NP_065184.2_holo_267-376.pdb psi-blast 274A,276

  20. Problem of Coercion in the Relationship to Some Sexual Minorities in the Czech Society

    Czech Academy of Sciences Publication Activity Database

    Janošová, Pavlína

    Krakow : Instytut Psychologii Uniwersytetu Jagieloňskiego, 2005. s. 273-274. [Scientific Congress of the Polish Psychological Society /32./. 22.09.2005-25.09.2005, Krakow] R&D Projects: GA ČR GA406/05/0940 Institutional research plan: CEZ:AV0Z70250504 Keywords : intersexuality * transsexuality * gender identity disorder Subject RIV: AN - Psychology

  1. Strategie "zeleného růstu" a trh práce

    Czech Academy of Sciences Publication Activity Database

    Tošovská, Eva


    Roč. 59, č. 10 (2011), s. 987-1004. ISSN 0013-3035 Institutional research plan: CEZ:AV0Z70850503 Keywords : green growth strategy * environmental policy * employment Subject RIV: AH - Economics Impact factor: 0.274, year: 2011

  2. Proč se české ženy ženou na manažerské pozice?

    Czech Academy of Sciences Publication Activity Database

    Křížková, Alena

    Praha: Sociologické nakladatelství (SLON), 2010 - (Maříková, H.; Kostelecký, T.; Lebeda, T.; Škodová, M.), s. 274-288 ISBN 978-80-7419-025-4 Institutional research plan: CEZ:AV0Z70280505 Keywords : Women in management * gender inequalities * women entrepreneurs Subject RIV: AO - Sociology, Demography

  3. Relationship between starch and lipid accumulation induced by nutrient depletion and replenishment in the microalga Parachlorella kessleri

    Czech Academy of Sciences Publication Activity Database

    Fernandes, B.; Teixeira, J.; Dragone, G.; Vicente, A. A.; Kawano, S.; Bišová, Kateřina; Přibyl, Pavel; Zachleder, Vilém; Vítová, Milada


    Roč. 144, SEP 2013 (2013), s. 268-274. ISSN 0960-8524 R&D Projects: GA MŠk LH12145; GA TA ČR TE01020080 Institutional support: RVO:61388971 ; RVO:67985939 Keywords : Lipids * Nutrient depletion * Nutrient replenishment Subject RIV: EE - Microbiology, Virology Impact factor: 5.039, year: 2013

  4. Curating seeds and other genetic resources for ethnobiology. In: Salick,J.Konchar, K. and Nesbitt, M., editors. Curatring Biocultural Collections: A handbook (United States)

    The National Center for Genetic Resources Preservation (NCGRP) is one of the largest genebanks in the world, currently safeguarding over 875,000 plant collections and 652,295 animal collections, most with agriculture emphasis. This number represents 7,474 different plant species of 1,274 genera. T...

  5. 75 FR 27934 - Qualified Nonpersonal Use Vehicles (United States)


    ... Temporary Regulation Sec. 1.274-5T(k). (LR-145-84, 50 FR 46088, 1985-2 CB 809 (1985)). On June 9, 2008, proposed regulations (REG-106897-08) were published in the Federal Register (73 FR 32500). The proposed... arranges for the burial of indigent persons. D is provided with a vehicle for use by County N. The...

  6. Degradation of polycyclic aromatic hydrocarbons by hydrogen peroxide catalyzed by heterogeneous polymeric metal chelates

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Cajthaml, Tomáš; Merhautová, Věra; Gabriel, Jiří; Nerud, František; Stopka, P.; Hrubý, Martin; Beneš, Milan J.


    Roč. 59, - (2005), s. 267-274. ISSN 0926-3373 R&D Projects: GA AV ČR IBS5020306; GA ČR GA203/01/0944 Institutional research plan: CEZ:AV0Z7090911 Keywords : degradation * polycyclic aromatic hydrocarbon * hydrogen peroxide Subject RIV: EE - Microbiology, Virology Impact factor: 3.809, year: 2005

  7. 77 FR 751 - Federal Motor Vehicle Safety Standards; Matters Incorporated by Reference (United States)


    ...,'' revised 1966, into Sec. 571.116. (28) ASTM E274-65T, ``Tentative Method of Test for Skid Resistance of... of Test for Skid Resistance of Paved Surfaces Using a Full-Scale Tire,'' effective October 2, 1970... December 4, 2007, NHTSA published a final rule amending FMVSS No. 108 (72 FR 68234). The purpose of...

  8. Stoats (Mustela erminea) provide evidence of natural overland colonization of Ireland

    Czech Academy of Sciences Publication Activity Database

    Martínková, Natália; McDonald, R. A.; Searle, J. B.


    Roč. 274, č. 1616 (2007), s. 1387-1393. ISSN 0962-8452 Institutional research plan: CEZ:AV0Z60930519 Keywords : cytochrome b * D-loop * last glacial maximum * mitochondrial DNA * phylogeography Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.112, year: 2007

  9. 75 FR 8650 - Carbon and Certain Alloy Steel Wire Rod from Trinidad and Tobago; Final Results of Antidumping... (United States)


    ... this order is certain hot-rolled products of carbon steel and alloy steel, in coils, of approximately... International Trade Administration (A-274-804) Carbon and Certain Alloy Steel Wire Rod from Trinidad and Tobago... of the antidumping duty order on carbon and certain alloy steel wire rod from Trinidad and...

  10. Proces cum figuris

    Czech Academy of Sciences Publication Activity Database

    Hodrová, Daniela

    2., rozšířené. Praha : Malvern, 2014, s. 274-321 ISBN 978-80-87580-79-0 Institutional support: RVO:68378068 Keywords : theory of literature * novel of initiation * performance * individuation process * Jung, Carl Gustav Subject RIV: AJ - Letters, Mass-media, Audiovision

  11. Fungal diversity notes 111-252-taxonomic and phylogenetic contributions to fungal taxa

    Czech Academy of Sciences Publication Activity Database

    Ariyawansa, H. A.; Hyde, K. D.; Jayasiri, C.; Buyck, B.; Thilini Chethana, K. W.; Dai, D. Q.; Dai, Y. C.; Daranagama, D. A.; Jayawardena, R. S.; Lücking, R.; Ghobad-Nejhad, M.; Niskanen, T.; Thambugala, K. M.; Voigt, K.; Zhao, R. L.; Li, G. J.; Doilom, M.; Boonmee, S.; Yang, Z. L.; Cai, Q.; Cui, Y. Y.; Bahkali, A. H.; Chen, J.; Cui, B.K.; Chen, J.; Dayarathne, M. C.; Dissanayake, A. J.; Ekanayaka, A. H.; Hashimoto, A.; Hongsanan, S.; Gareth Jones, E. B.; Larsson, E.; Li, W. J.; Li, Q. R.; Liu, J. K.; Luo, Z. L.; Maharachchikumbura, S.S.; Mapook, A.; McKenzie, E.; Norphanphoun, C.; Konta, S.; Pang, K. L.; Perera, R. H.; Phookamsak, R.; Phukhamsakda, C.; Pinruan, U.; Randrianjohany, E.; Singtripop, C.; Tanaka, K.; Tian, C. M.; Tibpromma, S.; Abdel-Wahab, M. A.; Wanasinghe, N. N.; Zhang, J. F.; Zhang, H.; Abdel-Aziz, F. A.; Wedin, M.; Westberg, M.; Ammirati, J. F.; Bulgakov, T. S.; Lima, D. X.; Callaghan, T. M.; Callac, P.; Chang, C. H.; Coca, L. F.; Dal-Forno, M.; Dollhofer, V.; Fliegerová, Kateřina; Greiner, K.; Griffith, G. W.; Ho, H.M.; Hofstetter, V.; Jeewon, R.; Kang, J. C.; Wen, T. C.; Kirk, P.M.; Kytövuori, I.; Lawrey, J. D.; Xing, J. P.; Li, H.; Liu, X.; Liimatainen, K.; Thorsten Lumbsch, H.; Matsumura, M.; Moncada, B.; Nuankaew, S.; Parnmen, S.; de Azevedo Santiago, A. L. C. M.; Sommai, S.; Song, Y.; de Souza, C. A. F.; de Souza-Motta, C. M.; Su, H. Y.; Suetrong, S.; Wang, Y.; Wei, S. F.; Wen, T. Ch.; Yuan, H. S.; Zhou, L. W.; Réblová, Martina; Fournier, J.; Camporesi, E.; Luangsa-ard, J. J.; Tasanathai, K.; Khonsanit, A.; Thanakitpipattana, D.; Somrithipol, S.; Diederich, P.; Millanes, A. M.; Common, R. S.; Stadler, M.; Yan, J. Y.; Li, X. H.; Lee, H. W.; Nguyen, T. T. T.; Lee, H. B.; Battistin, E.; Marsico, O.; Vizzini, A.; Vila, J.; Ercole, E.; Eberhardt, U.; Simonini, G.; Wen, H. A.; Chen, X. H.; Miettinen, O.; Spirin, V.; Hernawati, Dr.


    Roč. 75, č. 1 (2015), s. 27-274. ISSN 1560-2745 R&D Projects: GA ČR GAP506/12/0038 Institutional support: RVO:67985904 ; RVO:67985939 Keywords : fungi * taxonomy * new genus Subject RIV: EE - Microbiology, Virology; EF - Botanics (BU-J) Impact factor: 6.221, year: 2014

  12. A method to measure the effect of food appearance factors on children´s visual preferences

    DEFF Research Database (Denmark)

    Kildegaard, Heidi; Olsen, A.; Gabrielsen, G.;


    The aim of the study was to examine children’s visual preferences for two food products; yoghurts and smoothies, by using a conjoint layout. In total, 274 children performed an incomplete ranking of 8 pictures formed by three factors each with two levels (23 design). The three food appearance...

  13. 48 CFR 252.211-7003 - Item identification and valuation. (United States)


    ... valuation. 252.211-7003 Section 252.211-7003 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.211-7003 Item identification and valuation. As prescribed in 211.274-6(a), use the following clause: Item Identification and Valuation (AUG 2008) (a) Definitions. As...

  14. Upstream-downstream gradient in infection levels by fish parasites: a common river pattern?

    Czech Academy of Sciences Publication Activity Database

    Blasco-Costa, Maria Isabel; Koehler, A.V.; Martin, A.; Poulin, R.


    Roč. 140, č. 2 (2013), s. 266-274. ISSN 0031-1820 Institutional support: RVO:60077344 Keywords : trematode abundance * unidirectional river flow * infection patterns * disease * River Continuum Concept * freshwater * Coitocaecum parvum * Telogaster opisthorchis * Stegodexamene anguillae * Apatemon sp. Subject RIV: EH - Ecology, Behaviour Impact factor: 2.350, year: 2013

  15. 76 FR 2808 - Procedures for the Handling of Retaliation Complaints Under the Employee Protection Provisions of... (United States)


    ... subcontractors; contractors and subcontractors of the Department of Energy, except those involved in naval nuclear propulsion work under Executive Order 12344; licensees of an ] agreement State under Section 274... part 24, 72 FR 44956-44969. In addition to promulgating the interim final rule, OSHA's notice...

  16. Diffusion-controlled reactions modeling in Geant4-DNA

    Czech Academy of Sciences Publication Activity Database

    Karamitros, M.; Luan, S.; Bernal, M. A.; Allison, J.; Baldacchino, G.; Davídková, Marie; Francis, Z.; Friedland, W.; Ivanchenko, A.; Ivanchenko, V.; Mantero, A.; Nieminen, P.; Santin, G.; Tran, H. N.; Stepan, V.; Incerti, S.


    Roč. 274, OCT (2014), s. 841-882. ISSN 0021-9991 Institutional support: RVO:61389005 Keywords : chemical kinetics simulation * radiation chemistry * Fokker-Planck equation * Smoluchowski diffusion equation * Brownian bridge * dynamical time steps * k-d tree * radiolysis * radiobiology * Geant4-DNA * Brownian dynamics Subject RIV: BO - Biophysics Impact factor: 2.434, year: 2014

  17. Gclust Server: 101015 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 101015 Pm9_NATL1_06731 Cluster Sequences Related Sequences(161) 274 Possible nitril...ase 1 9.98e-01 0.0 0.0 4.0 0.0 0.0 0.0 Show 101015 Cluster ID 101015 Sequence ID Pm9_NATL1_06731 Link to clu

  18. Gclust Server: 101017 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 101017 Pm5_PMN2A_0052 Cluster Sequences Related Sequences(161) 274 nitrilase homolo...g 1 9.98e-01 0.0 0.0 4.0 0.0 0.0 0.0 Show 101017 Cluster ID 101017 Sequence ID Pm5_PMN2A_0052 Link to cluste

  19. Maternal diabetes alters transcriptional programs in the developing embryo

    Czech Academy of Sciences Publication Activity Database

    Pavlínková, Gabriela; Salbaum, M.; Kappen, C.


    Roč. 10, č. 274 (2009), s. 1-12. ISSN 1471-2164 Institutional research plan: CEZ:AV0Z50520701 Keywords : Diabetic embryopathy * microarray * hypoxia Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.759, year: 2009

  20. 40 CFR 27.5 - Review by the reviewing official. (United States)


    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Review by the reviewing official. 27.5... REMEDIES § 27.5 Review by the reviewing official. (a) If, based on the report of the investigating official under § 27.4(b), the reviewing official determines that there is adequate evidence to believe that...

  1. 75 FR 64120 - Technical Amendments to Forms N-CSR and N-SAR in Connection With the Comprehensive Iran Sanctions... (United States)


    ... COMMISSION 17 CFR Parts 249 and 274 Technical Amendments to Forms N-CSR and N-SAR in Connection With the... adopting technical amendments to Forms N-CSR and N-SAR under the Securities Exchange Act of 1934 and the... Securities and Exchange Commission (``Commission'') is adopting technical amendments to Form N-CSR \\1\\...

  2. 48 CFR 952.223-72 - Radiation protection and nuclear criticality. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Radiation protection and....223-72 Radiation protection and nuclear criticality. As prescribed in 923.7003 the clause set forth... (including agreements with states under section 274 of the Atomic Energy Act): Radiation Protection...

  3. Ca2plus responses to thyrotropin-releasing hormone and angiotensin II: the role of plasma membrane integrity and effect of G11 protein overexpression on homologous and heterologous desensitization

    Czech Academy of Sciences Publication Activity Database

    Ostašov, Pavel; Krůšek, Jan; Durchánková, Dana; Svoboda, Petr; Novotný, Jiří


    Roč. 26, č. 2 (2008), s. 264-274. ISSN 0263-6484 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA309/06/0121 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium response * cholesterol depletion * desensitization Subject RIV: CE - Biochemistry Impact factor: 1.333, year: 2008

  4. 17 CFR 232.311 - Documents submitted in paper under cover of Form SE. (United States)


    ... English summary or English translation of the foreign language document in accordance with § 232.306(b) or... filing in electronic format an English translation of its latest annual budget submitted as Exhibit B to... SE (§§ 239.64, 249.444, 259.601, 269.8, and 274.403 of this chapter) no later than one business...

  5. Cultural Identity and Peer Influence as Predictors of Substance Use among Culturally Diverse Australian Adolescents (United States)

    Gazis, Nicki; Connor, Jason P.; Ho, Robert


    This study investigated cultural identity and peer influence on tobacco, alcohol, and cannabis use in a culturally diverse sample of Northern Australian adolescents. Middle school students (n = 274) completed the Multigroup Ethnic Identity Measure (MEIM) and measures of their own and perceived friends' substance use. Higher scores on the full…

  6. 77 FR 45520 - Reimbursed Entertainment Expenses (United States)


    ... Internal Revenue Service 26 CFR Part 1 RIN 1545-BI83 Reimbursed Entertainment Expenses AGENCY: Internal... expenses for entertainment, amusement, or recreation activities and for facilities used in connection with entertainment, amusement, or recreation activities. Section 274(n)(1) generally limits the amount allowable as...

  7. 26 CFR 1.48-1 - Definition of section 38 property. (United States)


    ... affecting § 1.48-1, see the List of CFR Sections Affected, which appears in the Finding Aids section of the... depreciation thereon is disallowed under section 274 (relating to disallowance of certain entertainment, etc..., railroad tracks and bridges), or in processing raw materials into the taxpayer's final product, would...

  8. Perturbation of m-isometries by nilpotent operators

    Czech Academy of Sciences Publication Activity Database

    Bermúdez, T.; Martinón, A.; Müller, Vladimír; Noda, J. A.


    Roč. 2014, September (2014), s. 745479. ISSN 1085-3375 R&D Projects: GA ČR(CZ) GA14-07880S Institutional support: RVO:67985840 Keywords : pertubation * m-isometries Subject RIV: BA - General Mathematics Impact factor: 1.274, year: 2013

  9. Study of ground and unground leached vermiculite II. Thermal behaviour of ground acid-treated vermiculite

    Czech Academy of Sciences Publication Activity Database

    Perez-Rodriguez, J. L.; Maqueda, C.; Murafa, Nataliya; Šubrt, Jan; Balek, Vladimír; Pulišová, Petra; Lančok, Adriana


    Roč. 51, č. 3 (2011), s. 274-282. ISSN 0169-1317 R&D Projects: GA MŠk LC523 Institutional research plan: CEZ:AV0Z40320502 Keywords : vermiculite * annealing * amorphous silica Subject RIV: CA - Inorganic Chemistry Impact factor: 2.474, year: 2011

  10. Od kritické revize k postmoderně

    Czech Academy of Sciences Publication Activity Database

    Čornej, Petr

    Praha: Scriptorium, 2015 - (Čornej, P.; Ledvinka, V.), s. 274-279, 285-286 ISBN 978-80-88013-14-3 R&D Projects: GA ČR(CZ) GBP405/12/G148 Institutional support: RVO:68378092 Keywords : Second Vatican Council * Jan Hus * Jan Palach * Hussitism * communists Subject RIV: AB - History

  11. On the Gause predator-prey model with a refuge: A fresh look at the history

    Czech Academy of Sciences Publication Activity Database

    Křivan, Vlastimil


    Roč. 274, č. 1 (2011), s. 67-73. ISSN 0022-5193 Grant ostatní: Department of Agriculture(US) EF-0832858 Institutional research plan: CEZ:AV0Z50070508 Keywords : discontinuous differential equations * Filippov solution * holling functional response Subject RIV: EH - Ecology, Behaviour Impact factor: 2.208, year: 2011

  12. One in a million, or one in thousand: What is the morbidity of rabies in India?

    Directory of Open Access Journals (Sweden)

    Janie M. Baxter


    Full Text Available Rabies is the 10th biggest cause of death due to infectious diseases worldwide. The annual death toll is around 50 000–60 000, with 99% occurring in tropical developing countries. Based on available evidence, a fair estimate of rabies burden in India is 2.74 rabies cases per 100 000 people annually.

  13. Candidate Pools or Puddles: Challenges and Trends in the Recruitment and Hiring of Resident Directors. (United States)

    Belch, Holley A.; Mueller, John A.


    Researchers examined the perspectives of 274 senior housing officers and 283 graduate students on the declining number of resident director candidates. Data from two separate surveys indicated that quality of life, remuneration, and interest in the residence life profession were significant issues. Implications for professional preparation,…

  14. In vitro fertilization (IVF) using semi-defined culture conditions from low or high antral follicle count pubertal beef heifers (United States)

    To compare the in vitro fertilization (IVF) and production (IVP) of embryos from low and high antral follicle count (AFC) heifers, AFC were determined on 106 heifers using transrectal ultrasonography. Ten heifers with the lowest AFC (avg. 13.2) and 10 heifers with the highest AFC (avg. 27.4) with ev...

  15. Technologické využití elektronového svazku

    Czech Academy of Sciences Publication Activity Database

    Zobač, Martin; Zobačová, Jitka; Vlček, Ivan


    Roč. 57, č. 10 (2012), s. 270-274. ISSN 0447-6441 Institutional support: RVO:68081731 Keywords : focused intense electron beam * welding * machining * heat treatment * surface modifica­tion * engraving * texturing * additive manufactu­ring Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  16. Capillary electrophoresis in an extended nanospray tip-electrospray as an electrophoretic column

    Czech Academy of Sciences Publication Activity Database

    Týčová, Anna; Foret, František


    Roč. 1388, APR (2015), s. 274-279. ISSN 0021-9673 R&D Projects: GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : mass spectrometry * interface * separation * capillary electrophoresis Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 4.169, year: 2014

  17. 10 CFR 150.4 - Communications. (United States)


    ... 10 Energy 2 2010-01-01 2010-01-01 false Communications. 150.4 Section 150.4 Energy NUCLEAR... OFFSHORE WATERS UNDER SECTION 274 General Provisions § 150.4 Communications. Except where otherwise specified in this part, all communications and reports concerning the regulations in this part should...

  18. College Students' Social Justice Interest and Commitment: A Social-Cognitive Perspective (United States)

    Miller, Matthew J.; Sendrowitz, Kerrin; Connacher, Christopher; Blanco, Susana; de La Pena, Cristina Muniz; Bernardi, Shaina; Morere, Lauren


    In this study, the authors examined the degree to which social-cognitive career theory (SCCT; R. W. Lent, S. D. Brown, & G. Hackett, 1994) explained the development of social justice interest and commitment. Data from 274 college students and latent variable path modeling were used to test theoretically and empirically derived SCCT direct and…

  19. Taxonomy of Late Jurassic - Early Cretaceous aptychi from Bulgaria

    Czech Academy of Sciences Publication Activity Database

    Vašíček, Zdeněk; Motchurova; Dekova, N.; Ilcheva, A.; Metodiev, L.


    Roč. 265, č. 3 (2012), s. 249-274. ISSN 0077-7749 Institutional research plan: CEZ:AV0Z30860518 Keywords : Late Jurassic * Early Cretaceous * Bulgaria * aptychi * ammonites * parataxonomy Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.923, year: 2012

  20. AcEST: DK955803 [AcEST

    Lifescience Database Archive (English)


  1. Role of traditions in tourism development in the Czech part of the Bohemian Forest

    Czech Academy of Sciences Publication Activity Database

    Kušová, Drahomíra; Těšitel, Jan; Bartoš, Michael


    Roč. 8, - (2002), s. 265-274. ISSN 1211-7420 Grant ostatní: GA-(EU) QLK5-CT-2000-01211-SPRITE; 960 72(US) RSS 358/1999 Institutional research plan: CEZ:AV0Z3042911 Keywords : rural tourism * Šumava Mts. region * traditions Subject RIV: AO - Sociology, Demography

  2. 75 FR 81831 - Supplemental Nutrition Assistance Program, Regulation Restructuring: Issuance Regulation Update... (United States)


    ... Food and Nutrition Service adopted as a final rule the direct final rule published at 75 FR 18377 on... 7 CFR part 274 and was published at 75 FR 18377 on April 12, 2010. Dated: November 24, 2010. Julia... tender as of June 18, 2009. Therefore, paper coupons no longer have any value and can no longer...

  3. Indicators of functional differentiation of the chick embryonic kidney

    Czech Academy of Sciences Publication Activity Database

    Zemanová, Zdeňka; Ujec, Evžen; Jirsová, Z.; Maňáková, E.


    Roč. 131, č. 4 (2002), s. 847-860. ISSN 1095-6433 R&D Projects: GA ČR GA304/98/0604 Institutional research plan: CEZ:AV0Z5011922 Keywords : Chick embryo * Mesonephros * Glomerular filtration Subject RIV: ED - Physiology Impact factor: 1.274, year: 2002

  4. Genetic Parameters for Endocrine Fertility Traits from In-line Milk Progesterone Records in Dairy Cows

    NARCIS (Netherlands)

    Tenghe, A.M.M.; Bouwman, A.C.; Berglund, B.; Strandberg, E.; Veerkamp, R.F.


    In-line milk progesterone records (n = 163,145) collected from June 2009 through November 2013 for 2,274 lactations of Holstein-Friesian cows in 12 commercial herds in the Netherlands were analyzed for commencement of luteal activity (CLA), luteal activity during first 60 days in milk (LA60), propor

  5. The Connor-Davidson Resilience Scale as a Positive Psychology Measure for People with Spinal Cord Injuries (United States)

    Fujikawa, Mayu; Lee, Eun-Jeong; Chan, Fong; Catalano, Denise; Hunter, Celeste; Bengtson, Kevin; Rahimi, Maryam


    The main objective of this study is to evaluate the measurement structure of the Connor-Davidson Resilience Scale (CD-RISC) as a positive psychology measure for people with spinal cord injuries (SCIs) using confirmatory factor analysis. The participants consisted of 274 Canadians with SCI living in the community. The result indicated that the…

  6. Spectral reflectance is a reliable water-quality estimator for small, highly turbid wetlands

    Czech Academy of Sciences Publication Activity Database

    Vinciková, H.; Hanuš, Jan; Pechar, L.


    Roč. 23, č. 5 (2015), s. 933-946. ISSN 0923-4861 R&D Projects: GA MŠk(CZ) LM2010007; GA MŠk 2B06068 Institutional support: RVO:67179843 Keywords : remote sensing * water quality * hyperspectral reflectance * turbid inland water s * chlorophyll * TSS Subject RIV: EH - Ecology, Behaviour Impact factor: 1.274, year: 2014

  7. Antimicrobial, Anthelmintic Activities and Characterisation of Functional Phenolic Acids of Achyranthes aspera Linn.: A Medicinal Plant Used for the Treatment of Wounds and Ringworm in East Africa

    Czech Academy of Sciences Publication Activity Database

    Ndhlala, A.R.; Ghebrehiwot, H.M.; Ncube, B.; Aremu, A.O.; Grúz, Jiří; Šubrtová, Michaela; Doležal, Karel; du Plooy, C.P.; Abdelgadir, H.A.; van Staden, J.


    Roč. 6, NOV 23 (2015), s. 274. ISSN 1663-9812 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Amaranthaceae * chlorogenic acid * genistein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.802, year: 2014

  8. Growth rate regulates membrane fluidity and membrane cold adaptation in .i.Bacillus subtilis./i

    Czech Academy of Sciences Publication Activity Database

    Beranová, J.; Jemiola-Rzeminska, M.; Elhottová, Dana; Strzalka, K.; Konopásek, I.


    Roč. 274, Suppl. 1 (2007), s. 362. ISSN 1742-464X. [Congress of the Federation-of-European-Biochemical-Societies /32./. 07.07.2007-12.07.2007, Vienna] Institutional research plan: CEZ:AV0Z60660521 Keywords : membrane fluidity * membrane cold adaptation * Bacillus subtilis Subject RIV: EH - Ecology, Behaviour

  9. Impairment of mitochondrial function of rat hepatocytes by high fat diet and oxidative stress

    Czech Academy of Sciences Publication Activity Database

    Garnol, T.; Endlicher, R.; Kučera, O.; Drahota, Zdeněk; Červinková, Z.


    Roč. 63, č. 2 (2014), s. 271-274. ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LL1204 Grant ostatní: Univerzita Karlova(CZ) PRVOUK P37/02 Institutional support: RVO:67985823 Keywords : hepatocytes * high fat diet * mitochondrial activities * ROS Subject RIV: ED - Physiology Impact factor: 1.293, year: 2014

  10. 75 FR 76485 - Certain Electronic Paper Towel Dispensing Devices and Components Thereof; Notice of Commission... (United States)


    ...,182,289; and 7,387,274. 75 FR 28651-2 (May 21, 2010). The complainant named as respondents Kruger... administrative law ] judge's (``ALJ'') initial determination (``ID'') (Order No. 23) granting complainant's... Kozmetik Sanayi, Ve Ticaret Ltd of Izmir, Turkey (``NetPak Turkey''); Paradigm Marketing Consortium,...

  11. 75 FR 51842 - In the Matter of Certain Electronic Paper Towel Dispensing Devices and Components Thereof; Notice... (United States)


    ... of United States Patent Nos. 6,871,815; 7,017,856; 7,182,289; and 7,387,274. 75 FR 28651-2 (May 21.... International Trade Commission has determined not to review the presiding administrative law judge's (``ALJ...Pak Chicago''); NetPak Electronik Plastik ve Kozmetik Sanayi, Ve Ticaret Ltd of Izmir, Turkey...

  12. AcEST: BP914519 [AcEST

    Lifescience Database Archive (English)

    Full Text Available erized ORF2/4 protein OS=Torque teno virus (isolate Human/Germany/KAV/2001) GN=ORF2/4 PE=4 SV=2 Length = 274...eno virus (isolate Human/Germany/KAV/2001) GN=ORF2/3 PE=3 SV=2 Length = 265 Score = 30.8 bits (68), Expect =

  13. Review of invasive grapevine aphid, Aphis illinoisensis Shimer, and native parasitoids in the Mediterranean (Hemiptera, Aphididae; Hymenoptera, Braconidae, Aphidiinae)

    Czech Academy of Sciences Publication Activity Database

    Havelka, Jan; Shukshuk, A. H.; Ghaliow, M. E.; Laamari, M.; Kavallieratos, N. G.; Tomanović, Ž.; Rakhshani, E.; Pons, X.; Starý, Petr


    Roč. 63, č. 1 (2011), s. 269-274. ISSN 0354-4664 Grant ostatní: Ministry of Science and Technological Development of the Republic of Serbia (CS) 43001 Institutional research plan: CEZ:AV0Z50070508 Keywords : invasions * Aphis illinoisensis * grapevine Subject RIV: EH - Ecology, Behaviour Impact factor: 0.360, year: 2011

  14. Non-stationarity of the quasi-perpendicular bow shock: comparison between Cluster observations and simulations

    Czech Academy of Sciences Publication Activity Database

    Comisel, H.; Scholer, M.; Souček, Jan; Matsukiyo, S.


    Roč. 29, č. 2 (2011), s. 263-274. ISSN 0992-7689 Institutional research plan: CEZ:AV0Z30420517 Keywords : bow shock * Cluster * plasma waves * shock waves Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.842, year: 2011

  15. 20 CFR 422.105 - Presumption of authority of nonimmigrant alien to engage in employment. (United States)


    ... work. (See 8 CFR 274a.12(c)(3).) (b) Exception to presumption for foreign academic students in immigration classification F-1. If you are an F-1 student and do not have a separate DHS employment... alien to engage in employment. 422.105 Section 422.105 Employees' Benefits SOCIAL...

  16. Multimammate rat (Mastomys natalensis), Tristram's jird (Meriones tristrami) and Wagner's gerbil (Gerbillus dasyurus) as laboratory models of acute neosporosis

    Czech Academy of Sciences Publication Activity Database

    Hůrková-Hofmannová, L.; Václavek, P.; Škorič, M.; Fictum, P.; Modrý, David


    Roč. 82, č. 3 (2007), s. 377-381. ISSN 0034-5288 R&D Projects: GA ČR GD524/03/H133 Institutional research plan: CEZ:AV0Z60220518 Keywords : Neosporosis * Apicomplexa * rodents * multimammate rat * jird * gerbil Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.274, year: 2007

  17. Optimization of Catalysts Using Specific, Description-Based Genetic Algorithms

    Czech Academy of Sciences Publication Activity Database

    Holeňa, Martin; Čukić, T.; Rodemerck, U.; Linke, D.


    Roč. 48, č. 2 (2008), s. 274-282. ISSN 1549-9596 R&D Projects: GA ČR GA201/08/1744 Institutional research plan: CEZ:AV0Z10300504 Keywords : optimization of catalytic materials * genetic algorithm s * mixed optimization * constrained optimization Subject RIV: IN - Informatics, Computer Science Impact factor: 3.643, year: 2008

  18. Secretory phospholipase A(2) induces delayed neuronal COX-2 expression compared with glutamate

    DEFF Research Database (Denmark)

    Nielsen, Marianne; Bazan, Nicolas G; Diemer, Nils H; Kolko, Miriam


    Agonists of the binding site for secretory phospholipase A(2) (sPLA(2)) potentiate glutamate-induced neuronal cell death in primary cell cultures and in vivo (Kolko et al. [1996] J. Biol. Chem. 271:32722; Kolko et al. [1999] Neurosci. Lett. 274:167]. Here, we tested the hypothesis that COX-2...

  19. Letter to the Editor

    Directory of Open Access Journals (Sweden)

    Thomas K. Karikari


    Full Text Available This article is a reaction to a previously published article in the Journal of Microbiology & Biology Education, “Gamification of the Laboratory Experience to Encourage Student Engagement” by Kevin Drace (JMBE 14(2:273–274, 2013.

  20. Avipoxvirus infection in wild birds: new findings from Slovakia and Poland

    Czech Academy of Sciences Publication Activity Database

    Literák, I.; Halouzka, R.; Hromádko, M.; Honza, Marcel; Pinowska, B.; Haman, A.


    Roč. 70, č. 3 (2001), s. 339-344. ISSN 0001-7213 Institutional research plan: CEZ:MSM 161700001 Keywords : cutaneous lesion Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.274, year: 2001

  1. Concentration of phytic acid in faeces of calves fed starter diets

    Czech Academy of Sciences Publication Activity Database

    Dušková, Dagmar; Dvořák, R.; Rada, V.; Doubek, J.; Marounek, Milan


    Roč. 70, č. 4 (2001), s. 381-385. ISSN 0001-7213 R&D Projects: GA ČR GA524/99/0101; GA AV ČR KSK5020115 Keywords : nutrition * concentrated feed * phosphorus Subject RIV: ED - Physiology Impact factor: 0.274, year: 2001

  2. Larvae of trombiculid mites (Acarina: Trombiculidae) in wild birds in Slovak and Polish Carpathians

    Czech Academy of Sciences Publication Activity Database

    Literák, I.; Honza, Marcel; Pinowska, B.; Haman, A.


    Roč. 70, č. 4 (2001), s. 479-483. ISSN 0001-7213 Institutional research plan: CEZ:MSM 161700001 Keywords : Passerines * parasites * Trombiculidae Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.274, year: 2001

  3. The effect of diazinon on haematological indices of common carp (Cyprinus carpio L.)

    Czech Academy of Sciences Publication Activity Database

    Svoboda, M.; Lusková, Věra; Drastichová, J.; Žlábek, V.


    Roč. 70, č. 4 (2001), s. 457-465. ISSN 0001-7213 Institutional research plan: CEZ:MSM 162700004 Keywords : common carp * acute toxicity * haematology Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.274, year: 2001

  4. 17 CFR 270.24f-2 - Registration under the Securities Act of 1933 of certain investment company securities. (United States)


    ... securities. (a) General. Any face-amount certificate company, open-end management company or unit investment... year during which it has publicly offered such securities, file Form 24F-2 (17 CFR 274.24) with the... 17 CFR part 240 to end, revised as of April 1, 1997) if the Successor Issuer: (1) had no assets...

  5. 77 FR 6971 - Establishment of User Fees for Filovirus Testing of Nonhuman Primate Liver Samples (United States)


    ... responsibilities among the various levels of government.'' H. Plain Language Act of 2010 Under Public Law 111-274 (October 13, 2010), executive Departments and Agencies are required to use plain language in documents that... has attempted to use plain language in promulgating this rule consistent with the Federal...

  6. Latino Adolescents' Mental Health: Exploring the Interrelations among Discrimination, Ethnic Identity, Cultural Orientation, Self-Esteem, and Depressive Symptoms (United States)

    Umana-Taylor, Adriana J.; Updegraff, Kimberly A.


    Guided by a risk and resilience framework, the current study used cross-sectional data to examine the degree to which Latino adolescents' (N=274; M age=16.3; 47.1% female) self-esteem, ethnic identity, and cultural orientations mediated or moderated the relation between perceived discrimination and depressive symptoms. Utilizing a multiple group…

  7. 10 CFR 150.11 - Critical mass. (United States)


    ... 10 Energy 2 2010-01-01 2010-01-01 false Critical mass. 150.11 Section 150.11 Energy NUCLEAR... OFFSHORE WATERS UNDER SECTION 274 Exemptions in Agreement States § 150.11 Critical mass. (a) For the purposes of this part, special nuclear material in quantities not sufficient to form a critical mass...

  8. Dicty_cDB: AFO860 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ( EF137905 |pid:none) Helianthus annuus plastid enolase ... 274 4e-72 DQ497988_1( DQ497988 |pid:none) Polypterus senegal...ectes natans enolase B mRNA... 273 7e-72 DQ497985_1( DQ497985 |pid:none) Polypterus senegalus enolase A mRN.

  9. Role of t-tubules in the control of trans-sarcolemmal ion flux and intracellular Ca2+ in a model of the rat cardiac ventricular myocyte

    Czech Academy of Sciences Publication Activity Database

    Pásek, Michal; Šimurda, J.; Orchard, C.


    Roč. 41, č. 6 (2012), s. 491-503. ISSN 0175-7571 Institutional research plan: CEZ:AV0Z20760514 Keywords : t-tubules * rat * cardiac myocyte * computer model * calcium Subject RIV: BO - Biophysics Impact factor: 2.274, year: 2012

  10. Solar radiation in atmospheric condition and possibility of nanotechnology to improve the efficiency of solar cells on the base of hydrogenated silicon

    Czech Academy of Sciences Publication Activity Database

    Stuchlík, Jiří; Pham, M.T.; Pham, K.T.; Müller, Martin; Purkrt, Adam; Remeš, Zdeněk; Stuchlíková, The-Ha

    Ho Chi Minh City: Viet Nam National University, 2015, s. 270-274. [International Workshop on Nanotechnology and Application /5./ (IWNA 2015). Vung Tau (VN), 11.11.2015-14.11.2015] R&D Projects: GA MŠk LH12236 Institutional support: RVO:68378271 Keywords : solar radiation * hydrogenated silicon * embedded nanoparticles Subject RIV: BM - Solid Matter Physics ; Magnetism

  11. Aporia in the information-processing paradigm of contemporary cognitive psychology

    Czech Academy of Sciences Publication Activity Database

    Sedláková, Miluše


    Roč. 41, č. 4 (1999), s. 274-279. ISSN 0039-3320 R&D Projects: GA AV ČR KSK3077601 Keywords : information-processing approach * paradigm * cognitive psychology Subject RIV: AN - Psychology Impact factor: 0.115, year: 1999

  12. Functional comparison of Cnh1 antiporters from different Candida species

    Czech Academy of Sciences Publication Activity Database

    Krauke, Yannick; Zimmermannová, Olga; Sychrová, Hana


    Roč. 274, Suppl.1 (2007), s. 127-127. ISSN 1742-464X. [FEBS Congress Molecular Machines /32./. 07.07.2007-12.07.2007, Vienna] Institutional research plan: CEZ:AV0Z50110509 Keywords : cpo1 * Na/H antiporter * Candida * plasma membrane Subject RIV: EE - Microbiology, Virology

  13. 17 CFR 270.8f-1 - Deregistration of certain registered investment companies. (United States)


    ... Commission on Form N-8F (17 CFR 274.218) if the investment company: (a) Has sold substantially all of its.... 80a-3(c)(7)) of the Act; or (d) Has become a business development company. Note to § 270.8f-1... investment company; (b) Has distributed substantially all of its assets to its shareholders and has...

  14. Phaeobacter grown in biofilters: a new strategy for the control of Vibrionaceae in aquaculture

    DEFF Research Database (Denmark)

    Prol García, María Jesús; Gomez, Marina; Sanchez, Lorenzo;


    Growth, biofilm formation, antagonism and residence time in green seawater tanks maintained under fish rearing conditions of Phaeobacter 27-4 were studied in commercial biofilters made from plastic, sintered glass and ceramic. Phaeobacter reached 10(8)-10(9)CFUcm(-3) and formed rosettes in all ma...

  15. Establishment of hemiparasitic Rhinanthus spp. in grassland restoration: lessons learned from sowing experiments

    Czech Academy of Sciences Publication Activity Database

    Mudrák, Ondřej; Mládek, J.; Blažek, P.; Lepš, J.; Doležal, Jiří; Nekvapilová, E.; Těšitel, J.


    Roč. 17, č. 2 (2014), s. 274-287. ISSN 1402-2001 R&D Projects: GA MŠk EE2.3.30.0048 Institutional support: RVO:67985939 Keywords : ecological restoration * hemiparasite * species-rich meadows Subject RIV: EH - Ecology, Behaviour Impact factor: 2.548, year: 2014

  16. Memorias del primer encuentro de investigación sobre mujeres y perspectiva de género. [Reseña


    Alejos-Grau, C.J. (Carmen José)


    Reseña de: Emilia RECÉNDEZ GUERRERO (coord.), Memorias del primer encuentro de investigación sobre mujeres y perspectiva de género, Centro Interinstitucional en Artes y Humanidades. UAZ-Consejo Zacatecano de Ciencia y Tecnología, Zacatecas 2005, 274 pp.

  17. Mathematical programs with equilibrium contraints. Theory and numerical methods

    Czech Academy of Sciences Publication Activity Database

    Outrata, Jiří

    Udine : Springer Wien New York, 2006 - (Haslinger, J.; Stavroulakis, G.), s. 221-274 ISBN 3-211-48241-5. - (Nonsmooth mechanics of solids. Courses and lectures. 485) R&D Projects: GA AV ČR IAA1075402 Institutional research plan: CEZ:AV0Z10750506 Keywords : variational analysis * shape optimization * contact problems Subject RIV: BA - General Mathematics

  18. Feeling hopeful inspires support for social change

    NARCIS (Netherlands)

    Greenaway, Katharine H.; Cichocka, Aleksandra; Veelen, van Ruth; Likki, Tiina; Branscombe, Nyla R.


    Hope is an emotion that has been implicated in social change efforts, yet little research has examined whether feeling hopeful actually motivates support for social change. Study 1 (N = 274) confirmed that hope is associated with greater support for social change in two countries with different poli

  19. Feeling Hopeful Inspires Support for Social Change

    NARCIS (Netherlands)

    Greenaway, Katharine H.; Cichocka, Aleksandra; van Veelen, Ruth; Likki, Tiina; Branscombe, Nyla R.


    Hope is an emotion that has been implicated in social change efforts, yet little research has examined whether feeling hopeful actually motivates support for social change. Study 1 (N=274) confirmed that hope is associated with greater support for social change in two countries with different politi

  20. Methods applied for the characterization of Si:H thin films with embedded nanoparticles

    Czech Academy of Sciences Publication Activity Database

    Stuchlíková, The-Ha; Remeš, Zdeněk; Purkrt, Adam; Stuchlík, Jiří; Král, Karel


    Roč. 7, č. 4 (2015), s. 270-274. ISSN 2164-6627 R&D Projects: GA MŠk LH12236 Institutional support: RVO:68378271 Keywords : electrical conductivity * activation energy * CPM * SEM * I - V characteristics * nanoparticles Subject RIV: BM - Solid Matter Physics ; Magnetism

  1. The Assumed Benefits and Hidden Costs of Adult Learners' College Enrollment (United States)

    Kim, Kyung-Nyun; Baker, Rose M.


    This study investigates the effects of adults' enrollment in and graduation from a two-year college on their hourly wages and occupational status in U.S. by employing a growth curve model and a piecewise model. College enrollment reduced hourly wages and occupational status by 13.8% and 2.74 points, respectively. Less-educated workers whose wages…

  2. Children's Self-Reports about Anger Regulation: Direct and Indirect Links to Social Preference and Aggression. (United States)

    Dearing, Karen F.; And Others


    Assessed direct relations between three aspects of self-reported anger regulation and peer-rated social preference and aggression as well as indirect relations between these constructs as mediated by observed anger expression. Interviewed 274 second-graders following anger-arousing games. Found that anger regulation was only indirectly related to…

  3. Alkene and Diene Complexes with [(C5Me4CnF2n+1)Rh] Fragment for Fluorous Biphase Catalysis

    Czech Academy of Sciences Publication Activity Database

    Čermák, Jan; Strašák, Tomáš; Krupková, Alena; Auerová, Kateřina

    -: -, 2008 - (Baxter, D.; Bay, B.), P 274 ISBN N. [16th International Symposium on Homogeneous Catalysis , ISHC-XVI. Florence (IT), 06.07.2008-11.07.2008] R&D Projects: GA MŠk(CZ) LC06070 Institutional research plan: CEZ:AV0Z40720504 Keywords : rhodium complexes * fluorous cyclopentadienes * alkene complexes Subject RIV: CC - Organic Chemistry

  4. Developing Sellars's Semantic Legacy: Meaning as a Role

    Czech Academy of Sciences Publication Activity Database

    Peregrin, Jaroslav

    Amsterdam : Rodopis, 2006 - (Wolf, M.; Lance, M.), s. 257-274 ISBN 978-9042021440. - (New Trends in Philosophy. 92) R&D Projects: GA AV ČR IAA9009204 Institutional research plan: CEZ:AV0Z90090514 Keywords : Sellars * semantics * inferentialism Subject RIV: AA - Philosophy ; Religion

  5. AcEST: DK957420 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST39A01NGRL0028_F06 603 Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0028_F06. 5' end seq ... oporphyrin IX:Mg Chelatase OS=Antirrhinum majus GN=olive ... PE=4 SV=1 Length = 1379 Score = 274 bits (701), Ex ...

  6. Prevalence of osteoporosis and factors associated with osteoporosis in women above 40 years in the Northern Part of Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Anitha Oommen


    Conclusion: Prevalence of osteopenia is higher than osteoporosis in the Saudi women above 40 years in the Northern part of Saudi Arabia. The major cause of low BMD is lack of exercise even though there is a high prevalence of Vitamin D deficiency. [Int J Res Med Sci 2014; 2(1.000: 274-278

  7. AcEST: DK957002 [AcEST

    Lifescience Database Archive (English)


  8. Morphometric and molecular characterization of Parapharyngodon echinatus (Nematoda, Pharyngodonidae) from the Senegal gecko ( Tarentola parvicarinata )

    Czech Academy of Sciences Publication Activity Database

    Mašová, Š.; Baruš, Vlastimil; Hodová, I.; Matějusová, I.; Koubek, Petr; Koubková, B.


    Roč. 53, č. 3 (2008), s. 274-283. ISSN 1230-2821 R&D Projects: GA AV ČR IAA6093404 Institutional research plan: CEZ:AV0Z60930519 Keywords : Nematoda * Senegal gecko * West Africa Subject RIV: EG - Zoology Impact factor: 0.748, year: 2008

  9. Evaluation of the innate immune response of Angus heifers with genetic marker variation for intramuscular fat deposition following a lipopolysaccharide challenge (United States)

    This study evaluated the effect of genetic selection for markers related to marbling deposition in Angus heifers on the immune response following a lipopolysaccharide (LPS) challenge. Fall-born heifers (n = 19; ~7 months of age, 274 +/- 24 kg) with genetic variation for marbling were utilized inclu...

  10. Attachment Style, Social Support, and Coping as Psychosocial Correlates of Happiness in Persons with Spinal Cord Injuries (United States)

    Wilson, Lisa; Catalano, Denise; Sung, Connie; Phillips, Brian; Chou, Chih-Chin; Chan, Jacob Yui Chung; Chan, Fong


    Objective: To examine the roles of attachment, social support, and coping as psychosocial correlates in predicting happiness in people with spinal cord injuries. Design: Quantitative descriptive research design using multiple regression and correlation techniques. Participants: 274 individuals with spinal cord injuries. Outcome Measures: Happiness…

  11. Temporal variation of trace elements in waters polluted by municipal solid waste landfill leachate

    Czech Academy of Sciences Publication Activity Database

    Ettler, V.; Mihaljevič, M.; Matura, M.; Skalková, M.; Šebek, O.; Bezdička, Petr


    Roč. 80, č. 3 (2008), s. 274-279. ISSN 0007-4861 R&D Projects: GA AV ČR KJB3111402 Institutional research plan: CEZ:AV0Z40320502 Keywords : trace elements * landfill leachate * temporal variation Subject RIV: DD - Geochemistry Impact factor: 0.609, year: 2008

  12. Strach napíná pavučiny

    Czech Academy of Sciences Publication Activity Database

    Bydžovská, Lenka

    Řevnice : Arbor vitae , 2011 - (Rousová, H.), s. 257-274 ISBN 978-80-87164-64-8 Institutional research plan: CEZ:AV0Z80330511 Keywords : Czech avant-garde * surrealism Subject RIV: AL - Art, Architecture, Cultural Heritage

  13. Burnout and Competency Development in Pre-Service Teacher Training (United States)

    Rodríguez-Hidalgo, Antonio J.; Calmaestra, Juan; Dios, Irene


    Introduction: The burnout syndrome negatively affects the students' academic performance. The relation between academic burnout and the self-perception of skills in initial teacher training is subjected to analysis. Method: A sample of 274 students (average age = 20,61 years old) from the Bachelor Degree in Early Childhood Education and the…

  14. 17 CFR 270.2a-7 - Money market funds. (United States)


    ... percent) of this section, the money market fund will file an exhibit to the Form N-SAR (17 CFR 274.101... Method of valuation means the method of calculating an investment company's net asset value whereby... objective of maintaining a stable net asset value per share or price per share; Provided, however, that...

  15. Ruptured ovarian artery aneurysm in puerperium: a rare occurrence

    Directory of Open Access Journals (Sweden)

    Bindu Bajaj


    Full Text Available We present a rare case of Ovarian Artery Aneurysm in a puerperium. It was managed by endocopic banding of the ovarian artery following failed attempts at endovascular embolisation. The patient remained stable on three months follow up. The pathogenesis of this rare condition is also discussed. [Int J Reprod Contracept Obstet Gynecol 2015; 4(1.000: 272-274

  16. Ruptured ovarian artery aneurysm in puerperium: a rare occurrence


    Bindu Bajaj; Sunil Kumar Bajaj; Ritu Misra; Rohini Gupta


    We present a rare case of Ovarian Artery Aneurysm in a puerperium. It was managed by endocopic banding of the ovarian artery following failed attempts at endovascular embolisation. The patient remained stable on three months follow up. The pathogenesis of this rare condition is also discussed. [Int J Reprod Contracept Obstet Gynecol 2015; 4(1.000): 272-274

  17. An Analysis of the Relationship between Organizational Communication and Organizational Cynicism According to Teachers' Perceptions in Turkey (United States)

    Ayik, Ahmet


    In this study, the relations between organizational communication and organizational cynicism have been analyzed. The sample of the study consists of 274 teachers working in state secondary schools in Palandöken County of Erzurum, in 2013-2014 academic year. "Organizational Cynicism Scale" and "Organizational Communication…

  18. 3-D inversion of magnetotelluric data in the Kakkonda geothermal field, northern Japan

    Czech Academy of Sciences Publication Activity Database

    Uchida, T.; Lee, T. J.; Červ, Václav

    Tokyo : SEGJ, 2003, s. 274-280. [SEGJ international symposium /6./. Tokyo (JP), 22.01.2003-24.01.2003] R&D Projects: GA MŠk ME 185 Institutional research plan: CEZ:AV0Z3012916 Keywords : magnetotelluric method * 3-D interpretation * geothermal field Subject RIV: DE - Earth Magnetism, Geodesy, Geography

  19. X-ray crystal structure of divalent metal-activated ß-xyloisdase, RS223BX (United States)

    We report the first X-ray structure of a glycoside hydrolase family 43 ß-xylosidase, RS223BX, which is strongly activated by the addition of divalent metal cations. The 2.69 Å structure reveals that the Ca2+ cation is located at the back of the active site pocket. The Ca2+ coordinates to H274 to sta...

  20. Selected aspects of the prehistoric and historic influence of relief in the northwest Brno vicinity

    Czech Academy of Sciences Publication Activity Database

    Kirchner, Karel; Kallabová, Eva; Kuča, M.

    Brno : Masarykova univerzita, 2008 - (Herber, V.), s. 274-280 ISBN 978-80-210-4780-8. [Fyzická geografie a trvalá udržitelnost. Brno (CZ), 30.01.2008-31.01.2008] Institutional research plan: CEZ:AV0Z30860518 Keywords : Svratka river * settlement colonization * historic traffic networks Subject RIV: DE - Earth Magnetism, Geodesy, Geography

  1. Dicty_cDB: Contig-U14809-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ) Plasmodium falciparum adhesive-like protein pseud... 40 0.10 2 ( CU302368 ) Pig...4B16 in... 36 0.10 4 ( AC079638 ) Genomic sequence for Mus musculus, clone RP23-274... 40 0.10 2 ( AF324831

  2. The Study of Relationship between Organizational Culture and Organizational Belonging in Employees of Varamin County Office of Education (United States)

    Tabatabaee, Seyed Mahmoud; Koohi, Amirhasan; Ghandali, Abbas; Tajik, Tayebeh


    The purpose of the present research is to study the relationship between organizational culture and organizational belonging among employees of Varamin County ministry of education. This is a descriptive-survey study. The statistical population is consisted of all 274 official and contract employees of ministry of education in Varamin County of…

  3. Dicty_cDB: VSD527 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ap 1685067-2090751 strain AX4, complete sequence. 274 e-120 10 AL473903 |AL473903.1 T. brucei sheared genomic DNA clone 173e12, forwa...rd sequence. 60 2e-05 1 AQ653406 |AQ653406.1 Sheared DNA

  4. Multiple novel prostate cancer susceptibility signals identified by fine-mapping of known risk loci among Europeans

    DEFF Research Database (Denmark)

    Amin Al Olama, Ali; Dadaev, Tokhir; Hazelett, Dennis J;


    Genome-wide association studies (GWAS) have identified numerous common prostate cancer (PrCa) susceptibility loci. We have fine-mapped 64 GWAS regions known at the conclusion of the iCOGS study using large-scale genotyping and imputation in 25 723 PrCa cases and 26 274 controls of European ancest...

  5. Geometric Arveson–Douglas conjecture

    Czech Academy of Sciences Publication Activity Database

    Engliš, Miroslav; Eschmeier, J.


    Roč. 274, April (2015), s. 606-630. ISSN 0001-8708 Institutional support: RVO:67985840 Keywords : Arveson-Douglas conjecture * generalized Toeplitz operator Subject RIV: BA - General Mathematics Impact factor: 1.294, year: 2014

  6. A constructive approach to boundary value problems with state-dependent impulses

    Czech Academy of Sciences Publication Activity Database

    Rachůnková, I.; Rachůnek, L.; Rontó, András; Rontó, M.


    Roč. 274, February (2016), s. 726-744. ISSN 0096-3003 Institutional support: RVO:67985840 Keywords : non-linear system of differential equation * impulse effect * parameterization * successive approximations Subject RIV: BA - General Mathematics Impact factor: 1.551, year: 2014

  7. Investigations into the Nature of Halogen Bonding Including Symmetry Adapted Perturbation Theory Analyses

    Czech Academy of Sciences Publication Activity Database

    Riley, Kevin Eugene; Hobza, Pavel


    Roč. 4, č. 2 (2008), s. 232-242. ISSN 1549-9618 R&D Projects: GA MŠk LC512; GA AV ČR IAA400550510 Institutional research plan: CEZ:AV0Z40550506 Keywords : halogen bonding * SAPT * molecular complexes Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.274, year: 2008

  8. Halogenated fatty acids

    DEFF Research Database (Denmark)

    Mu, Huiling; Wesén, Clas; Sundin, Peter


    . However, a natural production of halogenated fatty acids is also possible. In this paper we summarize the present knowledge of the occurrence of halogenated fatty acids in lipids and suggested ways of their formation. In Part II (Trends Anal. Chem. 16 (1997) 274) we deal with methods of their...

  9. Gclust Server: 201274 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 201274 Sme_SMc04237 Cluster Sequences - 82 hypothetical protein 1 1.00e-40 0.0 0.0 0.0 0.0 3.23 0.0 Show 201...274 Cluster ID 201274 Sequence ID Sme_SMc04237 Link to cluster sequences Cluster Se

  10. The effects of costless pre-play communication: experimental evidence from games with Pareto-ranked equilibria

    Czech Academy of Sciences Publication Activity Database

    Blume, A.; Ortmann, Andreas


    Roč. 132, č. 1 (2007), s. 274-290. ISSN 0022-0531 Institutional research plan: CEZ:MSM0021620846 Keywords : coordination games * order-statistic games * cheap talk Subject RIV: AH - Economics Impact factor: 1.353, year: 2007

  11. Ethnicity Knowledge and Attitudes toward Acquired Immune Deficiency Syndrome. (United States)

    Goh, David S.

    This study examined the effects of race/ethnicity and degree of acculturation on knowledge and attitudes about human immunodeficiency virus/Acquired Immune Deficiency Syndrome (HIV/AIDS). Subjects were 274 college students from 5 racial/ethnic groups (Whites, Blacks, Hispanics, Asian Americans, U.S. born, having an Asian origin with families that…

  12. Brno (K. Ú. Líšeň, okr. Brno-město). „Čtvrtě“. Aurignacien. Sídliště. Systematický výzkum

    Czech Academy of Sciences Publication Activity Database

    Škrdla, Petr; Tostevin, G.; Matějec, P.; Nývlt, D.; Hladilová, Š.; Kovanda, J.; Nejman, L.; Mlejnek, O.


    Roč. 2010, č. 51 (2010), s. 269-274. ISSN 1211-7250 R&D Projects: GA AV ČR IAA800010801 Institutional research plan: CEZ:AV0Z80010507 Keywords : Moravia * Aurignacian * Pierced shell Subject RIV: AC - Archeology , Anthropology, Ethnology

  13. Nonlinear ultrasonic spectroscopy and acoustic emission in SHM of aircrafts

    Czech Academy of Sciences Publication Activity Database

    Převorovský, Zdeněk; Chlada, Milan; Krofta, Josef


    Roč. 2012, SI (2012), s. 36-40. ISSN 1213-3825 R&D Projects: GA MPO(CZ) FR-TI1/274 Institutional support: RVO:61388998 Keywords : NDT * structural health monitoring * acoustic emission * nonlinear elastic wave spectroscopy * time reversal mirrors Subject RIV: BI - Acoustics

  14. A Study in Kuwait of Health Risks Associated with Using Cell Phones (United States)

    Al-Khamees, Nedaa


    Previous studies have suggested a link between cell phone use and various symptoms. Analysis of 3,274 completed questionnaires from throughout Kuwait show a significant effect of exposure to cell phones for burning sensation on the ear, temporal pain, pain in the back of the head, auricular pain, noises in the ear, ear numbness, heartbeat…

  15. Nonenzymatic pathway of PUFA oxidation. A first-principles study of the reactions of OH radical with 1,4-pentadiene and arachidonic acid

    Czech Academy of Sciences Publication Activity Database

    Szöri, Milan; Csizmadia, I. G.; Viskolcz, B.


    Roč. 4, č. 9 (2008), s. 1472-1479. ISSN 1549-9618 Institutional research plan: CEZ:AV0Z40550506 Keywords : OH radical * arachidonic acid * ab initio * nonenzymatic biosynthesis Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.274, year: 2008

  16. Experiments with Superheavy Nuclei (United States)

    Hofmann, S.


    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α -α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on these results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  17. The gas phase oxide and oxyhydroxide chemistry of trace amounts of rhenium

    International Nuclear Information System (INIS)

    In preparation of experiments to investigate the chemical properties of bohrium (Bh, element 107) the behaviour of Re, its lighter homologue in group 7, was studied in different oxidizing chemical systems. The adsorption data of Re oxide and oxyhydroxide compounds on quartz surfaces were evaluated from results of thermochromatography experiments and confirmed in isothermal gas chromatography experiments applying 1 cm as standard state for the simple gas adsorption process: X(g) ↔ X(ads) (X = ReO3, HReO4) ΔHads(ReO3) = -190 ± 10 kJ/mol; ΔSads(ReO3) = -179±30 J/mol K; ΔHads(HReO4) = -77 ± 5 kJ/mol; ΔSads(HReO4) = -187±50 J/mol K. An on-line separation method for oxides and oxyhydroxides of short lived Re isotopes using isothermal high temperature gas-solid adsorption chromatography was developed. Separation yields and times of group 7 elements from lanthanides (model for actinides), polonium and bismuth were determined using the model isotopes 169,170,174,176Re, 152-155Er, 151-154Ho, 218Po, and 214Bi. An updated correlation function between the microscopic adsorption enthalpy and the macroscopic sublimation enthalpy was calculated from the experimental adsorption data of this work and literature data. (orig.)

  18. Experiments with superheavy nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [Gesellschaft fuer Schwerionenforschung (GSI), Darmstadt (Germany)


    In two series of experiments at SHIP, six new elements (Z =107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Not fission, but alpha decay is the dominant= decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross-section of 1 pb was measured. Based on these results, it is likely that the production of isotopes of element 114 close to the island of spherical Super Heavy Elements (SHE) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed. (author) 34 refs, 7 figs

  19. Chemistry of superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Schaedel, M. [Japan Atomic Energy Agency, Tokai, Ibaraki (Japan). Advanced Science Research Center; GSI Helmholtz Center for Heavy Ion Research, Darmstadt (Germany)


    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  20. New elements produced at GSI (United States)

    Hofmann, Sigurd


    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.