
Sample records for bohrium 273

  1. From bohrium to copernicium and beyond SHE research at SHIP

    Energy Technology Data Exchange (ETDEWEB)

    Münzenberg, G., E-mail: [GSI Helmholtzzentrum für Schwerionenforschung, Planckstrasse 1, 64291 Darmstadt (Germany); Manipal Centre for Natural Sciences, Manipal University, Manipal 576104, Karnataka (India)


    Heavy-element research with SHIP at GSI is reviewed including the discovery of the chemical elements bohrium to copernicium, experimental developments, cold fusion of heavy ions, and the discovery of a shell region around hassium. Elements bohrium and heavier are located beyond the limit of liquid-drop stability. They exist by shell stabilization. A universal, sensitive, and fast method: in-flight separation and identification of single atomic nuclei has been developed with the velocity filter SHIP and the detector system to measure decay sequences of individual atoms. Research with single atomic nuclei including detection methods, identification, and physics results will be discussed. Experiments with actinide targets as well as prospects with NUSTAR at FAIR will be addressed.

  2. Properties of an α Particle in a Bohrium 270 Nucleus under the Generalized Symmetric Woods-Saxon Potential

    Directory of Open Access Journals (Sweden)

    Bekir Can LÜTFÜOĞLU


    Full Text Available The energy eigenvalues and the wave functions of an α particle in a Bohrium 270 nucleus have been calculated by solving Schrödinger equation for Generalized Symmetric Woods-Saxon potential. Using the energy spectrum by excluding and including the quasi-bound eigenvalues, entropy, internal energy, Helmholtz energy, and specific heat, as functions of reduced temperature have been calculated. Stability and emission characteristics have been interpreted in terms of the wave and thermodynamic functions. The kinetic energy of a decayed α particle was calculated using the quasi-bound states, which has been found close to the experimental value.

  3. Erratum: IJSNEM 27(3). (United States)


    The International Journal of Sport Nutrition and Exercise Metabolism 27(3), , was incorrectly paginated. The correct page range for this issue is 197-292. The online versions of these articles have been corrected.

  4. 40 CFR 273.13 - Waste management. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste management. 273.13 Section 273...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.13 Waste management. (a) Universal waste batteries. A small quantity handler of universal waste must manage...

  5. 40 CFR 273.52 - Waste management. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste management. 273.52 Section 273...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.52 Waste management. (a) A universal waste transporter must comply with all applicable U.S. Department of...

  6. 40 CFR 273.33 - Waste management. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste management. 273.33 Section 273...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.33 Waste management. (a) Universal waste batteries. A large quantity handler of universal waste must manage...

  7. 7 CFR 273.1 - Household concept. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Household concept. 273.1 Section 273.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM CERTIFICATION OF ELIGIBLE HOUSEHOLDS § 273.1 Household concept...

  8. 39 CFR 273.10 - Reports. (United States)


    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Reports. 273.10 Section 273.10 Postal Service... REMEDIES ACT § 273.10 Reports. (a) Not later than October 31 of each year, the Postmaster General shall prepare and transmit to the appropriate committees and subcommittees of the Congress an annual report...

  9. 40 CFR 265.273 - Waste analysis. (United States)


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.273 Section 265... FACILITIES Land Treatment § 265.273 Waste analysis. In addition to the waste analyses required by § 265.13... listed as a hazardous waste. As required by § 265.13, the waste analysis plan must include analyses...

  10. 40 CFR 273.16 - Employee training. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Employee training. 273.16 Section 273.16 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED... Employee training. A small quantity handler of universal waste must inform all employees who handle or have...

  11. 40 CFR 273.36 - Employee training. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Employee training. 273.36 Section 273.36 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED... Employee training. A large quantity handler of universal waste must ensure that all employees are...

  12. 43 CFR 27.3 - Discrimination prohibited. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Discrimination prohibited. 27.3 Section 27... ISSUED UNDER TITLE II OF PUBLIC LAW 93-153 § 27.3 Discrimination prohibited. (a) General. No person shall... through contractual or other arrangements, subject an individual to discrimination on the grounds of race...

  13. 39 CFR 273.2 - Definitions. (United States)


    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Definitions. 273.2 Section 273.2 Postal Service UNITED STATES POSTAL SERVICE ORGANIZATION AND ADMINISTRATION ADMINISTRATION OF PROGRAM FRAUD CIVIL... representation, certification, affirmation, document, record, or accounting or bookkeeping entry made: (1) With...

  14. 36 CFR 27.3 - Seashore District. (United States)


    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Seashore District. 27.3 Section 27.3 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR CAPE...' studio, for appropriate small scale home occupations as the making and selling of traditional Cape Cod...

  15. Dicty_cDB: SLH273 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH273 (Link to dictyBase) - - - Contig-U16280-1 SLH273P (Link to Original site) SLH2...73F 241 SLH273Z 294 SLH273P 535 - - Show SLH273 Library SL (Link to library) Clone ID SLH2... URL Representative seq. ID SLH2...73P (Link to Original site) Representative DNA sequence >SLH273 (SLH273Q) /CSM/SL/SLH2-D/SLH2...ducing significant alignments: (bits) Value SLH273 (SLH273Q) /CSM/SL/SLH2-D/SLH273Q.Seq.d/ 868 0.0 SSK467 (S

  16. Dicty_cDB: VHK273 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHK273 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...73F 620 - - - - - - Show VHK273 Library VH (Link to library) Clone ID VHK273 (Link to Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK273 (VHK273Q) /CSM/VH/VHK2-D/VHK273Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787

  17. Dicty_cDB: VFK273 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFK273 (Link to dictyBase) - - - Contig-U16028-1 | Contig-U16311-1 VFK2...73P (Link to Original site) VFK273F 633 VFK273Z 575 VFK273P 1188 - - Show VFK273 Library VF (Link to library) Clone ID VFK2...028-1 | Contig-U16311-1 Original site URL Representative seq. ID VFK273P (Link to Original site) Representative DNA sequence >VFK273 (VFK2...73Q) /CSM/VF/VFK2-D/VFK273Q.Seq.d/ AAATCTTTATTAATATTTTTCAAAATAAATAAATAAATAAATTAAAAATGAAAGTTTTAT

  18. An embedded circumnuclear disk in Mrk 273

    NARCIS (Netherlands)

    Klockner, HR; Baan, WA

    Radio observations using very long baseline interferometry (VLBI) and the Westerbork interferometer have been carried out to study the hydroxyl Megamaser emission in Mrk 273 at different spatial resolutions. Line and continuum observations were carried out by the European VLBI network (EVN) at 1.6

  19. 49 CFR 192.273 - General. (United States)



  20. 48 CFR 719.273-1 - Purpose. (United States)


    ... 719.273-1 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS The U.S. Agency for International Development (USAID) Mentor-ProtégÃ... developmental assistance to Protégé entities, fostering the establishment of long-term business relationships...

  1. 48 CFR 852.273-71 - Alternative negotiation techniques. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Alternative negotiation techniques. 852.273-71 Section 852.273-71 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 852.273-71 Alternative negotiation technique...

  2. 40 CFR 273.4 - Applicability-Mercury-containing equipment. (United States)


    ... equipment. 273.4 Section 273.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT General § 273.4 Applicability—Mercury...-containing components have been removed. (c) Generation of waste mercury-containing equipment. (1) Used...

  3. 48 CFR 719.273-6 - Application process. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Application process. 719.273-6 Section 719.273-6 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT...égé Program 719.273-6 Application process. Entities interested in becoming a Mentor firm must...

  4. 39 CFR 273.7 - Concurrence of Attorney General. (United States)


    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Concurrence of Attorney General. 273.7 Section 273... PROGRAM FRAUD CIVIL REMEDIES ACT § 273.7 Concurrence of Attorney General. (a) The Attorney General is... the Attorney General or his designee approves such action in a written statement which specifies: (1...

  5. 47 CFR 25.273 - Duties regarding space communications transmissions. (United States)


    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Duties regarding space communications transmissions. 25.273 Section 25.273 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Operations § 25.273 Duties regarding space...

  6. 40 CFR 273.2 - Applicability-batteries. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Applicability-batteries. 273.2 Section...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT General § 273.2 Applicability—batteries. (a) Batteries covered under 40 CFR part 273. (1) The requirements of this part apply to persons managing batteries, as...

  7. 40 CFR 273.3 - Applicability-pesticides. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Applicability-pesticides. 273.3... (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT General § 273.3 Applicability—pesticides. (a) Pesticides covered under this part 273. The requirements of this part apply to persons managing pesticides, as...

  8. 25 CFR 273.53 - Applicable procurement regulations. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Applicable procurement regulations. 273.53 Section 273.53 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT General Contract Requirements § 273.53...

  9. 48 CFR 852.273-70 - Late offers. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Late offers. 852.273-70... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 852.273-70 Late offers. As prescribed in 873.110(a), insert the following provision: Late Offers (JAN 2003) This provision replaces...

  10. 26 CFR 1.273-1 - Life or terminable interests. (United States)


    ....273-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Items Not Deductible § 1.273-1 Life or terminable interests. Amounts paid as income to the holder of a life or a terminable interest acquired by gift, bequest, or inheritance shall not...

  11. 7 CFR 273.6 - Social security numbers. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Social security numbers. 273.6 Section 273.6... normally uses the Receipt of Application for a Social Security Number, Form SSA-5028, as evidence that an... security numbers. (a) Requirements for participation. The State agency shall require that a household...

  12. 48 CFR 719.273-10 - Internal controls. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Internal controls. 719.273...égé Program 719.273-10 Internal controls. (a) OSDBU will oversee the Program and will work in... objectives. OSDBU will establish internal controls as checks and balances applicable to the Program. These...

  13. 40 CFR 273.17 - Response to releases. (United States)


    ... 273.17 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.17... of universal wastes and other residues from universal wastes. (b) A small quantity handler of...

  14. 40 CFR 273.37 - Response to releases. (United States)


    ... 273.37 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.37... of universal wastes and other residues from universal wastes. (b) A large quantity handler of...

  15. 40 CFR 273.54 - Response to releases. (United States)


    ... 273.54 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.54 Response to... other residues from universal wastes. (b) A universal waste transporter must determine whether any...

  16. 33 CFR 273.17 - Annual budget request. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Annual budget request. 273.17... DEFENSE AQUATIC PLANT CONTROL § 273.17 Annual budget request. The Aquatic Plant Control Program is a... to utilize within the budget year taking into account the foreseeable availability of local funds to...

  17. A modified stratified model for the 3C 273 jet

    International Nuclear Information System (INIS)

    Liu Wenpo; Shen Zhiqiang


    We present a modified stratified jet model to interpret the observed spectral energy distributions of knots in the 3C 273 jet. Based on the hypothesis of the single index of the particle energy spectrum at injection and identical emission processes among all the knots, the observed difference of spectral shape among different 3C 273 knots can be understood as a manifestation of the deviation of the equivalent Doppler factor of stratified emission regions in an individual knot from a characteristic one. The summed spectral energy distributions of all ten knots in the 3C 273 jet can be well fitted by two components: a low-energy component (radio to optical) dominated by synchrotron radiation and a high-energy component (UV, X-ray and γ-ray) dominated by inverse Compton scattering of the cosmic microwave background. This gives a consistent spectral index of α = 0.88 (S v ∝ v -α ) and a characteristic Doppler factor of 7.4. Assuming the average of the summed spectrum as the characteristic spectrum of each knot in the 3C 273 jet, we further get a distribution of Doppler factors. We discuss the possible implications of these results for the physical properties in the 3C 273 jet. Future GeV observations with GLAST could separate the γ-ray emission of 3C 273 from the large scale jet and the small scale jet (i.e. the core) through measuring the GeV spectrum.

  18. 7 CFR 273.9 - Income and deductions. (United States)


    ... Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM CERTIFICATION OF ELIGIBLE HOUSEHOLDS § 273.9 Income and...) Payments under Title I (VISTA, University Year for Action, etc.) of the Domestic Volunteer Service Act of...

  19. 40 CFR 273.18 - Off-site shipments. (United States)


    ....18 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.18... universal waste. (c) If a universal waste being offered for off-site transportation meets the definition of...

  20. 40 CFR 273.38 - Off-site shipments. (United States)


    ....38 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.38... universal waste. (c) If a universal waste being offered for off-site transportation meets the definition of...

  1. 40 CFR 273.55 - Off-site shipments. (United States)


    ....55 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.55 Off-site... universal waste being shipped off-site meets the Department of Transportation's definition of hazardous...

  2. 40 CFR 273.34 - Labeling/marking. (United States)


    ... distributed; and (2) The words “Universal Waste—Pesticide(s)” or “Waste—Pesticide(s);” (c) A container, tank...) The words “Universal Waste—Pesticide(s)” or “Waste—Pesticide(s).” (d) (1) Mercury-containing equipment...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.34...

  3. 39 CFR 273.6 - Evaluation by reviewing official. (United States)


    ... supports the allegations of liability; (4) An estimate of the amount of money or the value of property or...)(4) and (5) of this section, the Reviewing Official recommends be demanded from the person alleged to... PROGRAM FRAUD CIVIL REMEDIES ACT § 273.6 Evaluation by reviewing official. (a) Based upon the...

  4. 40 CFR 273.53 - Storage time limits. (United States)


    ...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.53 Storage time limits. (a) A universal waste transporter may only store the universal waste at a universal waste transfer facility for ten days or less. (b) If a universal waste transporter stores universal waste for...

  5. 25 CFR 273.18 - Additional requirements for education plan. (United States)


    ... EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Application Process § 273.18... of employees for each special program and number of Indian employees for that program. (k) State the...) Program goals and objectives related to the learning needs of potential target students. (2) Procedures...

  6. 40 CFR 273.14 - Labeling/marking. (United States)


    ... distributed; and (2) The words “Universal Waste-Pesticide(s)” or “Waste-Pesticide(s);” (c) A container, tank... administered or recognized by a state; and (2) The words “Universal Waste-Pesticide(s)” or “Waste-Pesticide(s...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.14...

  7. 49 CFR 40.273 - What is the effect of a cancelled alcohol test? (United States)


    ... 49 Transportation 1 2010-10-01 2010-10-01 false What is the effect of a cancelled alcohol test? 40.273 Section 40.273 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Alcohol Testing § 40.273 What is the...

  8. 25 CFR 273.16 - Powers and duties of Indian Education Committee. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Powers and duties of Indian Education Committee. 273.16 Section 273.16 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Application Process § 273.16...

  9. 40 CFR 273.8 - Applicability-household and conditionally exempt small quantity generator waste. (United States)


    ... conditionally exempt small quantity generator waste. 273.8 Section 273.8 Protection of Environment ENVIRONMENTAL....8 Applicability—household and conditionally exempt small quantity generator waste. (a) Persons... universal wastes defined at § 273.9; and/or (2) Conditionally exempt small quantity generator wastes that...


    Energy Technology Data Exchange (ETDEWEB)

    U, Vivian; Sanders, David; Kewley, Lisa [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Dr., Honolulu, HI 96822 (United States); Medling, Anne; Max, Claire [Department of Astronomy and Astrophysics, University of California, Santa Cruz, 1156 High Street, Santa Cruz, CA 95064 (United States); Armus, Lee [Spitzer Science Center, California Institute of Technology, 1200 E. California Blvd., Pasadena, CA 91125 (United States); Iwasawa, Kazushi [ICREA and Institut del Ciències del Cosmos, Universitat de Barcelona (IEEC-UB), Martí i Franquès, 1, E-08028 Barcelona (Spain); Evans, Aaron [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States); Fazio, Giovanni, E-mail: [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)


    There is X-ray, optical, and mid-infrared imaging and spectroscopic evidence that the late-stage ultraluminous infrared galaxy merger Mrk 273 hosts a powerful active galactic nucleus (AGN). However, the exact location of the AGN and the nature of the nucleus have been difficult to determine due to dust obscuration and the limited wavelength coverage of available high-resolution data. Here we present near-infrared integral-field spectra and images of the nuclear region of Mrk 273 taken with OSIRIS and NIRC2 on the Keck II Telescope with laser guide star adaptive optics. We observe three spatially resolved components, and analyze the nuclear molecular and ionized gas emission lines and their kinematics. We confirm the presence of the hard X-ray AGN in the southwest nucleus. In the north nucleus, we find a strongly rotating gas disk whose kinematics indicate a central black hole of mass 1.04 ± 0.1 × 10{sup 9} M{sub ☉}. The H{sub 2} emission line shows an increase in velocity dispersion along the minor axis in both directions, and an increased flux with negative velocities in the southeast direction; this provides direct evidence for a collimated molecular outflow along the axis of rotation of the disk. The third spatially distinct component appears to the southeast, 640 and 750 pc from the north and southwest nuclei, respectively. This component is faint in continuum emission but shows several strong emission line features, including [Si VI] 1.964 μm which traces an extended coronal-line region. The geometry of the [Si VI] emission combined with shock models and energy arguments suggest that [Si VI] in the southeast component must be at least partly ionized by the SW AGN or a putative AGN in the northern disk, either through photoionization or through shock-heating from strong AGN- and circumnuclear-starburst-driven outflows. This lends support to a scenario in which Mrk 273 may be a dual AGN system.

  11. Prediction of Chronic Kidney Disease Stage 3 by CKD273, a Urinary Proteomic Biomarker

    DEFF Research Database (Denmark)

    Pontillo, Claudia; Zhang, Zhen-Yu; Schanstra, Joost P


    Introduction: CKD273 is a urinary biomarker, which in advanced chronic kidney disease predicts further deterioration. We investigated whether CKD273 can also predict a decline of estimated glomerular filtration rate (eGFR) to ... threshold (P = 0.086). Discussion: In conclusion, while accounting for baseline eGFR, albuminuria, and covariables, CKD273 adds to the prediction of stage 3 chronic kidney disease, at which point intervention remains an achievable therapeutic target....

  12. 48 CFR 719.273-9 - Obligations under the Mentor-Protégé Program. (United States)


    ... Mentor-Protégé Program. 719.273-9 Section 719.273-9 Federal Acquisition Regulations System AGENCY FOR... Development (USAID) Mentor-Protégé Program 719.273-9 Obligations under the Mentor-Protégé Program. (a) A Mentor or Protégé may voluntarily withdraw from the Program. However, in no event shall such withdrawal...

  13. 25 CFR 273.72 - Appeal from decision to cancel contract for cause. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Appeal from decision to cancel contract for cause. 273.72 Section 273.72 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND... decision to cancel contract for cause. A contractor may appeal the decision of a Bureau official to cancel...

  14. 25 CFR 273.38 - Equal quality and standard of education. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Equal quality and standard of education. 273.38 Section... EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Funding Provisions § 273.38 Equal quality and standard of education. Contracts with State education agencies or school districts...

  15. 8 CFR 273.5 - General criteria used for reduction, refund, or waiver of fines. (United States)


    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false General criteria used for reduction, refund, or waiver of fines. 273.5 Section 273.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY..., liquidated damages, and user fee payment records; and, (3) The existence of any extenuating circumstances. ...

  16. Testing a double AGN hypothesis for Mrk 273 (United States)

    Iwasawa, K.; U, V.; Mazzarella, J. M.; Medling, A. M.; Sanders, D. B.; Evans, A. S.


    The ultra-luminous infrared galaxy (ULIRG) Mrk 273 contains two infrared nuclei, N and SW, separated by 1 arcsecond. A Chandra observation has identified the SW nucleus as an absorbed X-ray source with NH 4 × 1023 cm-2 but also hinted at the possible presence of a Compton-thick AGN in the N nucleus, where a black hole of 109 M⊙ is inferred from the ionized gas kinematics. The intrinsic X-ray spectral slope recently measured by NuSTAR is unusually hard (Γ 1.3) for a Seyfert nucleus, for which we seek an alternative explanation. We hypothesize a strongly absorbed X-ray source in N, of which X-ray emission rises steeply above 10 keV, in addition to the known X-ray source in SW, and test it against the NuSTAR data, assuming the standard spectral slope (Γ = 1.9). This double X-ray source model gives a good explanation of the hard continuum spectrum, deep Fe K absorption edge, and strong Fe K line observed in this ULIRG, without invoking the unusual spectral slope required for a single source interpretation. The putative X-ray source in N is found to be absorbed by NH = 1.4+0.7-0.4 × 1024 cm-2. The estimated 2-10 keV luminosity of the N source is 1.3 × 1043 erg s-1, about a factor of 2 larger than that of SW during the NuSTAR observation. Uncorrelated variability above and below 10 keV between the Suzaku and NuSTAR observations appears to support the double source interpretation. Variability in spectral hardness and Fe K line flux between the previous X-ray observations is also consistent with this picture.

  17. CKD273, a new proteomics classifier assessing CKD and its prognosis.

    Directory of Open Access Journals (Sweden)

    Ángel Argilés

    Full Text Available National Kidney Foundation CKD staging has allowed uniformity in studies on CKD. However, early diagnosis and predicting progression to end stage renal disease are yet to be improved. Seventy six patients with different levels of CKD, including outpatients and dialysed patients were studied for transcriptome, metabolome and proteome description. High resolution urinary proteome analysis was blindly performed in the 53 non-anuric out of the 76 CKD patients. In addition to routine clinical parameters, CKD273, a urinary proteomics-based classifier and its peptides were quantified. The baseline values were analyzed with regard to the clinical parameters and the occurrence of death or renal death during follow-up (3.6 years as the main outcome measurements. None of the patients with CKD2730.55. Unsupervised clustering analysis of the CKD273 peptides separated the patients into two main groups differing in CKD associated parameters. Among the 273 biomarkers, peptides derived from serum proteins were relatively increased in patients with lower glomerular filtration rate, while collagen-derived peptides were relatively decreased (p<0.05; Spearman. CKD273 was different in the groups with different renal function (p<0.003. The CKD273 classifier separated CKD patients according to their renal function and informed on the likelihood of experiencing adverse outcome. Recently defined in a large population, CKD273 is the first proteomic-based classifier successfully tested for prognosis of CKD progression in an independent cohort.

  18. High-voltage power supplies for traveling wave tube WV-273A; Vysokovol`tnye istochniki pitaniya dlya LBV UV-273A

    Energy Technology Data Exchange (ETDEWEB)

    Lebedev, N I; Fateev, A A


    Paper presents a description of two modifications of high-volt power sources described for preamplifier on UV-273A type travelling wave tube (TWT). Power source where anode power circuit contains semiconducting high-volt switch on thyristors was designed to average pulse mode of TWT operation. Time of switching-in this power circuit constitutes 20 mcs. 2 refs.

  19. 43 CFR 30.273 - What action will the judge take to record title? (United States)


    ... PROBATE HEARINGS PROCEDURES Tribal Purchase of Interests Under Special Statutes § 30.273 What action will...) File the complete record, including the decision, with the LTRO as provided in § 30.233; (c) Furnish a... decision to each interested party. ...

  20. The Multi-component X-ray Emission of 3C 273 (United States)

    Soldi, S.; Türler, M.; Paltani, S.; Courvoisier, T. J.-L.


    3C 273 is the brightest quasar in the sky and among the most extensively observed and studied AGN, therefore one of the most suitable targets for a long-term, multi-frequency study. The superposition of a thermal Comptonisation component, similar to that observed in Seyfert galaxies, and of a non-thermal component, related to the jet emission, seems to explain some of the spectral and timing properties of the X-ray emission of 3C 273. Yet, during some observations this dichotomy has not been observed and the variability properties could also be consistent with a single-component scenario, characterised by two parameters varying independently. In order to understand the nature of the X-ray emission in 3C 273, a series of observations up to 80-100 keV, possibly catching the source in different flux states, are essential. Simbol-X will be able to study the emission of 3C 273 in the broad 0.5-80 keV band with high sensitivity, allowing us to disentangle the emission from different spectral components, with 20-30 ks long observations. In addition, the shape and the origin of the high-energy emission of this quasar will be further constrained thanks to the AGILE and Fermi satellites, monitoring the γ-ray sky in the MeV-GeV energy domain.

  1. Simultaneous observations of the quasar 3C 273 with INTEGRAL, XMM-Newton and RXTE

    DEFF Research Database (Denmark)

    Courvoisier, T.J.L.; Beckmann, V.; Bourban, G.


    INTEGRAL has observed the bright quasar 3C 273 on 3 epochs in January 2003 as one of the first observations of the open programme. The observation on January 5 was simultaneous with RXTE and XMM-Newton observations. We present here a first analysis of the continuum emission as observed by these 3...

  2. 25 CFR 273.37 - Use of funds outside of schools. (United States)


    ... Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Funding Provisions § 273.37 Use of funds outside of schools. Nothing in these regulations shall prevent the Commissioner from contracting...

  3. 20 CFR 404.273 - When are automatic cost-of-living increases effective? (United States)


    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false When are automatic cost-of-living increases..., SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Cost-Of-Living Increases § 404.273 When are automatic cost-of-living increases effective? We make automatic cost-of-living...

  4. An X-Ray Luminous, Dwarf Seyfert Companion of Markarian 273 (ApJ, 496, L9 [1998]) (United States)

    Xia, X.-Y.; Boller, Th.; Wu, H.; Deng, Z.-G.; Gao, Y.; Zou, Z.-L.; Mao, S.; Börner, G.


    In the Letter ``An X-Ray Luminous, Dwarf Seyfert Companion of Markarian 273'' by X.-Y. Xia, Th. Boller, H. Wu, Z.-G. Deng, Y. Gao, Z.-L. Zou, S. Mao, and G. Börner (ApJ, 496, L9 [1998]), an observational error occurred that invalidates some of our conclusions. Since Mrk 273x was essentially invisible (B~21) in our acqusition image, in order to position the slit on the faint Mrk 273x, a slit rotation had to be applied. Unfortunately, the amount of rotation was applied incorrectly. As a result, the spectrum obtained (shown in Fig. 2) was not for the intended target, Mrk 273x, but for an object very close to, but northeast of, Mrk 273. A new spectrum of Mrk 273x indicates that Mrk 273x is at redshift 0.458, not at 0.0378 as quoted in the Letter. The larger redshift implies that both the optical and X-ray luminosity have to be revised upward by a factor of ~170. Mrk 273x is therefore not a dwarf galaxy optically. The X-ray properties of Mrk 273x remain the same except that its soft X-ray luminosity now reaches ~1044 ergs s-1 for H0=50 km s-1 Mpc-1. The new observations will be presented in a subsequent paper (X.-Y. Xia et al., in preparation [1998]) in order to make corrections and shed further insights on the objects in the Mrk 273 field.


    International Nuclear Information System (INIS)

    Fan, J. H.; Liu, Y.; Yuan, Y. H.; Kurtanidze, O.; Chanishvili, R.; Richter, G. M.


    Variability is one of the most observable characteristics of active galactic nuclei, and it is important when considering the emission mechanism. In this paper, we report optical photometry monitoring of two nearby brightest quasars, PHL 1811 and 3C 273, using the ST-6 camera attached to the Newtonian focus and the Ap6E CCD camera attached to the primary focus of the 70 cm meniscus telescope at the Abastumani Observatory, Georgia. PHL 1811 was monitored during the period from 2002 September to 2012 December, while 3C 273 was monitored during the period from 1998 February to 2008 May. During our monitoring period, the two sources did not show any significant intra-day variability. The largest detected variations are ΔR = 0.112 ± 0.010 mag. for PHL 1811, ΔB = 0.595 ± 0.099 mag, ΔV = 0.369 ± 0.028 mag, ΔR = 0.495 ± 0.076 mag, and ΔI = 0.355 ± 0.009 mag for 3C 273. When the periodicity analysis methods are adopted for the observations of the sources, a period of p = 5.80 ± 1.12 yr is obtained for PHL 1811 in the R light curve in the present work, and periods of p = 21.10 ± 0.14, 10.00 ± 0.14, 7.30 ± 0.09, 13.20 ± 0.09, 2.10 ± 0.06, and 0.68 ± 0.05 yr are obtained for 3C 273 based on the data in the present work combined with historical works


    Energy Technology Data Exchange (ETDEWEB)

    Fan, J. H.; Liu, Y.; Yuan, Y. H. [Center for Astrophysics, Guangzhou University, Guangzhou 510006 (China); Kurtanidze, O.; Chanishvili, R. [Abastumani Observatory, Mt. Kanobili, 0301 Abastumani, Georgia (United States); Richter, G. M. [Astrophysikalisches Institut Potsdam, An der Sternwarte 16, D-14482 Potsdam (Germany)


    Variability is one of the most observable characteristics of active galactic nuclei, and it is important when considering the emission mechanism. In this paper, we report optical photometry monitoring of two nearby brightest quasars, PHL 1811 and 3C 273, using the ST-6 camera attached to the Newtonian focus and the Ap6E CCD camera attached to the primary focus of the 70 cm meniscus telescope at the Abastumani Observatory, Georgia. PHL 1811 was monitored during the period from 2002 September to 2012 December, while 3C 273 was monitored during the period from 1998 February to 2008 May. During our monitoring period, the two sources did not show any significant intra-day variability. The largest detected variations are ΔR = 0.112 ± 0.010 mag. for PHL 1811, ΔB = 0.595 ± 0.099 mag, ΔV = 0.369 ± 0.028 mag, ΔR = 0.495 ± 0.076 mag, and ΔI = 0.355 ± 0.009 mag for 3C 273. When the periodicity analysis methods are adopted for the observations of the sources, a period of p = 5.80 ± 1.12 yr is obtained for PHL 1811 in the R light curve in the present work, and periods of p = 21.10 ± 0.14, 10.00 ± 0.14, 7.30 ± 0.09, 13.20 ± 0.09, 2.10 ± 0.06, and 0.68 ± 0.05 yr are obtained for 3C 273 based on the data in the present work combined with historical works.

  7. Ten Years of Monitoring 3C 273 with XMM–Newton Liu Liu ...

    Indian Academy of Sciences (India)

    Abstract. We present ten years optical/UV/X-ray observations of 3C. 273 performed using XMM–Newton between 2000 and 2009. The short- time scale variability behaviour of the soft and hard X-ray light curves may suggest different origins of the soft/hard X-ray emissions. We fit well the 0.2–10 keV X-ray spectrum with a ...

  8. 48 CFR 719.273-4 - Eligibility of Mentor and Protégé firms. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Eligibility of Mentor and... Development (USAID) Mentor-Protégé Program 719.273-4 Eligibility of Mentor and Protégé firms. Eligible business entities approved as Mentors may enter into agreements (hereafter referred to as “Mentor-Protégé...

  9. 48 CFR 719.273 - The U.S. Agency for International Development (USAID) Mentor-Protégé Program. (United States)


    ... International Development (USAID) Mentor-Protégé Program. 719.273 Section 719.273 Federal Acquisition.... Agency for International Development (USAID) Mentor-Protégé Program 719.273 The U.S. Agency for International Development (USAID) Mentor-Protégé Program. ...

  10. Gammay rays from Penrose powered black holes in centaurus A, 3C 273, and NGC 4151

    International Nuclear Information System (INIS)

    Kafatos, M.; and Laboratory for Astronomy and Solar Physics, NASA Goddard Space Flight Center)


    Gamma-ray observations of active galaxies have important consequences for theories of the activity in their nuclei. The observations of Cen A, 3C 273, and NGC 4151 are examined under the assumption that Penrose collision processes in the ergospheres of massive black holes power their nuclei. The observed sharp break in the MeV region of the NGC 4151 spectrum cannot be due to the γ-γ pair production process. We attribute this break to the Penrose Compton scattering (PCS), in which γ-rays escape from the ergosphere as a result of Penrose processes involving electrons and lower energy X-ray photons in the ergosphere of the black hole. The absence of an MeV break in the spectra of Cen A and 3C 273 argues in favor of the Penrose pair production (PPP), in which high-energy pairs (a few GeV in energy) escape as result of Penrose processes involving protons and γ-rays that are present in any hot, optically thin, vertically extended accretion disk. An intrinsic break in the GeV region is predicted for both Cen A and 3C 273 as well as any other PPP powered nucleus.If PPP is important for QSOs and radio galaxies and some Seyferts, powerful radio objects should also be powerful γ-ray objects. Nuclei in which the black hole is spinning slowly would still emit visible light, UV, and X-rays as result of accretion without Penrose processes but would be weak in radio or high-energy γ-rays. Future γ-ray observations should provide clues as to whether this scenario is correct. Besides spectral information at γ-ray frequencies, possible variability at γ-ray frequencies should be searched for


    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Eileen T.; Georganopoulos, Markos [University of Maryland Baltimore County, Baltimore, MD 21250 (United States); Sparks, William B. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Anderson, Jay; Marel, Roeland van der; Biretta, John; Chiaberge, Marco; Norman, Colin [Space Telescope Science Institute, Baltimore, MD 21210 (United States); Tony Sohn, Sangmo [Johns Hopkins University, Baltimore, MD 21210 (United States); Perlman, Eric, E-mail: [Florida Institute of Technology, Melbourne, FL 32901 (United States)


    The radio galaxy 3C 273 hosts one of the nearest and best-studied powerful quasar jets. Having been imaged repeatedly by the Hubble Space Telescope (HST) over the past twenty years, it was chosen for an HST program to measure proper motions in the kiloparsec-scale resolved jets of nearby radio-loud active galaxies. The jet in 3C 273 is highly relativistic on sub-parsec scales, with apparent proper motions up to 15c observed by very long baseline interferometry. In contrast, we find that the kiloparsec-scale knots are compatible with being stationary, with a mean speed of −0.2 ± 0.5c over the whole jet. Assuming the knots are packets of moving plasma, an upper limit of 1c implies a bulk Lorentz factor Γ < 2.9. This suggests that the jet has either decelerated significantly by the time it reaches the kiloparsec scale, or that the knots in the jet are standing shock features. The second scenario is incompatible with the inverse Compton off the Cosmic Microwave Background (IC/CMB) model for the X-ray emission of these knots, which requires the knots to be in motion, but IC/CMB is also disfavored in the first scenario due to energetic considerations, in agreement with the recent finding of Meyer and Georganopoulos which ruled out the IC/CMB model for the X-ray emission of 3C 273 via gamma-ray upper limits.

  12. Study on the KM capacitor base thermometers in the 42-273 K range

    International Nuclear Information System (INIS)

    Luzganov, V.S.; Mats'ko, A.A.


    Thermometric characteristics of the KM-5a-HZ0 monolithic capacitors in the 42-273 K temperature range are studied. Capacitors capacitance - temperature relation is considered in details. The data reproducibility after 5, 23, 34, 50, 51 and 57 days is studied, the accuracy of temperature measurements by the given thermometers is determined. Recommendations on selection of cpacitors, suitable for application as thermometer, are given. These capacitors permit temperature measurement in the 42-225 K range with the error of ± 0.5 K, and above 225 K the error is ± 1K. 8 refs.; 1 fig.; 1 tab

  13. The Physics of AGN, a Deep Understanding of the Quasar 3C 273 (United States)

    Courvoisier, T.; Bottcher, Markus


    Upon our successful AO-1 proposal no. 120023, the quasar 3C 273 has been observed with INTEGRAL in 3 epochs in January 2003. The first observation, on January 5, 2003, with a total INTEGRAL exposure of 1.2 x 10(exp 5) s, was simultaneous with RXTE and XMM- Newton observations. Two more INTEGRAL observations were carried out on January 11, 2003 (exposure: lo4 s) and January 17, 2003 (exposure: 1.1 x 10(exp 5) s). The source was detected with high significance by all INTEGRAL instruments, the OMC, JEM-X, SPI, and IBIS/ISGRI. Being one of the first INTEGRAL observations simultaneous with XMM and RXTE, our observations were also used to fix the cross calibration with those instruments. The combined spectrum resulting from the XMM-Newton, JEM-X, RXTE, SPI and ISGRI X-ray / soft gamma-ray observations is consistent with a straight power-law of photon index Gamma = (1.73 +/- 0.015) between 3 keV and at least 200 keV. A possible detection in the 200 keV - 500 keV band by SPI can not be confirmed with our observations. The normalization of the X/gamma-ray spectrum is (2.24 +/- 0.05) x 10(exp -2) photons /sq cm keV at 1 keV. The source showed a moderate amount of optical variability as observed with the OMC onboard INTEGRAL. No evidence for variability at X-rays and gamma-rays could be reported, which may have been a result of insufficient photon statistics. The X-/gamma-ray spectrum observed in our 2003 observations is consistent with previously measured and modelled broadband spectral energy distributions of 3C 273. It has been included in the U.S. lead Col's work on spectral and variability modelling of gamma-ray blazars, supporting the trend of flat-spectrum radio quasars such as 3C 273 being 7-ray dominated due to a strong contribution from Compton upscattering of external radiation by ultrarelativistic electrons in a relativistic jet. 3C 273 is a particularly convincing example for such a picture since it provides very direct evidence for a strong external radiation

  14. Yeast Interacting Proteins Database: YDL239C, YDR273W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle as prey (1) YDR273W DON1 Meiosis-specific component of the spindle pole body, part of the leading... edge protein (LEP) coat, forms a ring-like structure at the leading edge of the prospore...ption Protein required for spore wall formation, thought to mediate assembly of a Don1p-containing structure at the leading...description Meiosis-specific component of the spindle pole body, part of the leading edge protein (LEP) coat

  15. Effects of hyperoxia and caffeine on the expression of fragile site at Xq27.3

    Energy Technology Data Exchange (ETDEWEB)

    Rafi, S.K.; Surana, R.B.; Christopher, K.L. [Armed Forces Institute of Pathology, Washington, DC (United States)] [and others


    To enhance the cytogenetic expression of the fragile X chromosome, we studied the effects of hyperoxia and caffeine on the induction of fragile Xq27.3. A lymphoblastoid cell line (GM 06912) derived from a fragile X male proband was cultured in RPMI 1640 containing 16% dialyzed fetal calf serum. The cells were synchronously subjected to one of 3 different atmospheric oxygen tensions (21%, 21.3 kPa, hyperoxic) during the last 24 hours of the 72 hour culture, immediately after the addition of 2{prime}-deoxy-5-fluorouridine (FUdR) at 25 ng/ml. To study the enhancing effect of caffeine, with or without hyperoxia, a second set of cultures was additionally subjected to caffeine (2.5 mM) during the last 6 hours of the culture. When the fragility of hyperoxic cells (38.1 kPa dissolved oxygen) was compared to that of normoxic control cells (13.3 kPa dissolved oxygen), the difference was significant (P < 0.05). These data suggest that there is a mean increase in the fragile Xq27.3 expressivity as the dissolved oxygen tension increases. Additionally, we observed that caffeine, with or without hyperoxia, significantly (P <0.05) suppressed the expression of the fragile X site in this lymphoblastoid cell line. 34 refs., 2 tabs.

  16. Reaction of ammonium triphosphate with gadolinium nitrate in aqueous solution at 273K

    International Nuclear Information System (INIS)

    Rodicheva, G.V.; Tananaev, I.V.; Romanova, N.M.


    The solubility in the system (NW 4 ) 5 P 3 O 10 -Gd(NO 3 ) 3 - H 2 O (273 K) is studied. Depending on the reagent ratio formation of the compounds Gd 5 (P 3 O 10 ) 3 x22H 2 O, NH 4 Gd 3 (P 3 O 10 ) 2 x12H 2 O and (NH 4 ) 3 Gd 4 (P 3 O 10 ) 3 x14H 2 O is established. Gadolinium triphosphates, separated from solution, are studied using the methods of paper chromatography, X-ray diffractometry, thermography. Simultaneously with thermal dehydration of gadolinium triphosphates the processes of triphosphate decomposition and phosphate anion condensation take place. A mixture of crystalline ortho-phosphate and long- chain polyphosphate of gadolinium is the final product of thermal decomposition (1063 K) of normal and doubl e ammonium- containing gadolinium triphosphates [ru


    Energy Technology Data Exchange (ETDEWEB)

    Kovalev, Y. Y.; Kardashev, N. S.; Voitsik, P. A.; Kovalev, Yu. A.; Lisakov, M. M.; Sokolovsky, K. V. [Astro Space Center of Lebedev Physical Institute, Profsoyuznaya 84/32, 117997 Moscow (Russian Federation); Kellermann, K. I. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903-2475 (United States); Lobanov, A. P.; Zensus, J. A.; Anderson, J. M.; Bach, U.; Kraus, A. [Max-Planck-Institute for Radio Astronomy, Auf dem Hügel 69, D-53121 (Germany); Johnson, M. D. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Gurvits, L. I. [Joint Institute for VLBI ERIC, P.O. Box 2, 7990 AA Dwingeloo (Netherlands); Jauncey, D. L. [CSIRO Astronomy and Space Sciences, Epping, NSW 1710 (Australia); Ghigo, F. [National Radio Astronomy Observatory, Rt. 28/92, Green Bank, WV 24944-0002 (United States); Ghosh, T.; Salter, C. J. [Arecibo Observatory, NAIC, HC3 Box 53995, Arecibo, Puerto Rico, PR 00612 (United States); Petrov, L. Yu. [Astrogeo Center, 7312 Sportsman Drive, Falls Church, VA 22043 (United States); Romney, J. D. [National Radio Astronomy Observatory, P.O. Box O, 1003 Lopezville Road, Socorro, NM 87801-0387 (United States)


    Inverse Compton cooling limits the brightness temperature of the radiating plasma to a maximum of 10{sup 11.5} K. Relativistic boosting can increase its observed value, but apparent brightness temperatures much in excess of 10{sup 13} K are inaccessible using ground-based very long baseline interferometry (VLBI) at any wavelength. We present observations of the quasar 3C 273, made with the space VLBI mission RadioAstron on baselines up to 171,000 km, which directly reveal the presence of angular structure as small as 26 μas (2.7 light months) and brightness temperature in excess of 10{sup 13} K. These measurements challenge our understanding of the non-thermal continuum emission in the vicinity of supermassive black holes and require a much higher Doppler factor than what is determined from jet apparent kinematics.

  18. A cosmic double helix in the archetypical quasar 3C273. (United States)

    Lobanov, A P; Zensus, J A


    Finding direct evidence for plasma instability in extragalactic jets is crucial for understanding the nature of relativistic outflows from active galactic nuclei. Our radio interferometric observations of the quasar 3C273 made with the orbiting radio telescope, HALCA, and an array of ground telescopes have yielded an image in which the emission across the jet is resolved, revealing two threadlike patterns that form a double helix inside the jet. This double helical structure is consistent with a Kelvin-Helmholtz instability, and at least five different instability modes can be identified and modeled by a light jet with a Lorentz factor of 2 and Mach number of 3.5. The model reproduces in detail the internal structure of the jet on scales of up to 30 milli-arc seconds ( approximately 300 parsecs) and is consistent with the general morphology of the jet on scales of up to 1 kiloparsec.

  19. Rapid infrared and optical variability in the bright quasar 3C273

    International Nuclear Information System (INIS)

    Courvoisier, T.J.-L.; Robson, E.I.; Hughes, D.H.; Bouchet, P.; Schwarz, H.E.; Krisciunas, K.


    We have observed variations by a factor of two in the infrared flux from the bright quasar 3C273 on a timescale as short as one day. In February 1988, the behaviour of the source changed from having a stable infrared flux and slow optical variations to a state characterized by recurrent infrared and optical flaring. The optical variations were of several per cent per day, changing from increase to decrease approximately every week. The amplitude of the repeated optical flares was 30-40%. The data are consistent with re-injection/acceleration of electrons followed by rapid cooling. The inferred magnetic field is 0.7 gauss and the data are marginally consistent with no relativistic beaming. (author)

  20. 33 CFR Appendix C to Part 273 - Information Requirements for Aquatic Plant Control Program Environmental Impact Statements (United States)


    ... Aquatic Plant Control Program Environmental Impact Statements C Appendix C to Part 273 Navigation and... Environmental Impact Statements 1. Description of the problem. a. Pests. Identify the pest to be controlled by.... Relationship to environmental situation. Non-target organisms and integrated pest management programs. 2...

  1. 3C 273 with NuSTAR: Unveiling the Active Galactic Nucleus

    DEFF Research Database (Denmark)

    Madsen, Kristin K.; Fürst, Felix; Walton, Dominic J.


    We present results from a 244 ks NuSTAR observation of 3C 273 obtained during a cross-calibration campaign with the Chandra, INTEGRAL, Suzaku, Swift, and XMM-Newton observatories. We show that the spectrum, when fit with a power-law model using data from all observatories except INTEGRAL over the 1......-78 keV band, leaves significant residuals in the NuSTAR data between 30 and 78 keV. The NuSTAR 3-78 keV spectrum is well. described by an exponentially cutoff power law (Γ = 1.646± 0.006, Ecutoff = 202-34 +51 keV) with a weak reflection component from cold, dense material. There is also evidence......-energy power. law is consistent with the presence of a beamed jet, which begins to dominate over emission from the inner accretion flow at 30-40 keV. Modeling the jet locally (in the NuSTAR + INTEGRAL band) as a power. law, we find that the coronal component is fit by ΓAGN = 1.638 ± 0.045, Ecutoff = 47 ± 15 ke...

  2. Image of the Quasar 3C 273 Taken by the High Energy Astronomy Observatory (HEAO)-2 (United States)


    This image is an observation of Quasar 3C 273 by the High Energy Astronomy Observatory (HEAO)-2/Einstein Observatory. It reveals the presence of a new source (upper left) with a red shift that indicates that it is about 10 billion light years away. Quasars are mysterious, bright, star-like objects apparently located at the very edge of the visible universe. Although no bigger than our solar system, they radiate as much visible light as a thousand galaxies. Quasars also emit radio signals and were previously recognized as x-ray sources. The HEAO-2, the first imaging and largest x-ray telescope built to date, was capable of producing actual photographs of x-ray objects. Shortly after launch, the HEAO-2 was nicknamed the Einstein Observatory by its scientific experimenters in honor of the centernial of the birth of Albert Einstein, whose concepts of relativity and gravitation have influenced much of modern astrophysics, particularly x-ray astronomy. The HEAO-2 was designed and developed by TRW, Inc. under the project management of the Marshall Space Flight Center.

  3. Optical monitoring of BL Lac object S5 0716+714 and FSRQ 3C 273 from 2000 to 2014 (United States)

    Yuan, Yu-Hai; Fan, Jun-hui; Tao, Jun; Qian, Bo-Chen; Costantin, Denise; Xiao, Hu-Bing; Pei, Zhi-Yuan; Lin, Chao


    Context. Using the 1.56 m telescope at the Shanghai Observatory (ShAO), China, we monitored two sources, BL Lac object S5 0716+714 and flat spectrum radio quasar (FSRQ) 3C 273. For S5 0716+714, we report 4969 sets of CCD (Charge-coupled Device) photometrical optical observations (1369 for V band, 1861 for R band and 1739 for I band) in the monitoring time from Dec. 4, 2000 to Apr. 5, 2014. For 3C 273, we report 460 observations (138 for V band, 146 for R band and 176 for I band) in the monitoring time from Mar. 28, 2006 to Apr. 9, 2014. Aims: The observations provide us with a large amount of data to analyze the short-term and long-term optical variabilities. Based on the variable timescales, we can estimate the central black hole mass and the Doppler factor. An abundance of multi-band observations can help us to analyze the relations between the brightness and spectrum. Methods: We use Gaussian fitting to analyze the intra-day light curves and obtain the intra-day variability (IDV) timescales. We use the discrete correlation function (DCF) method and Jurkevich method to analyze the quasi-periodic variability. Based on the VRI observations, we use the linear fitting to analyze the relations between brightness and spectrum. Results: The two sources both show IDV properties for S5 0716+714. The timescales are in the range from 17.3 min to 4.82 h; for 3C 273, the timescale is ΔT = 35.6 min. Based on the periodic analysis methods, we find the periods PV = 24.24 ± 1.09 days, PR = 24.12 ± 0.76 days, PI = 24.82 ± 0.73 days for S5 0716+714, and P = 12.99 ± 0.72, 21.76 ± 1.45 yr for 3C 273. The two sources displayed the "bluer-when-brighter" spectral evolution properties. Conclusions: S5 0716+714 and 3C 273 are frequently studied objects. The violent optical variability and IDV may come from the jet. Gaussian fitting can be used to analyze IDVs. The relations between brightness (flux density) and spectrum are strongly influenced by the frequency. A table of the

  4. Constraining the location of rapid gamma-ray flares in the flat spectrum radio quasar 3C 273 [Constraining the location of rapid gamma-ray flares in the FSRQ 3C 273

    International Nuclear Information System (INIS)

    Rani, B.; Lott, B.; Krichbaum, T. P.; Fuhrmann, L.; Zensus, J. A.


    Here, we present a γ-ray photon flux and spectral variability study of the flat-spectrum radio quasar 3C 273 over a rapid flaring activity period between September 2009 to April 2010. Five major flares were observed in the source during this period. The most rapid flare observed in the source has a flux doubling time of 1.1 hr. The rapid γ-ray flares allow us to constrain the location and size of the γ-ray emission region in the source. The γγ-opacity constrains the Doppler factor δ_γ ≥ 10 for the highest energy (15 GeV) photon observed by the Fermi-Large Area Telescope (LAT). Causality arguments constrain the size of the emission region to 1.6 × 10"1"5 cm. The γ-ray spectra measured over this period show clear deviations from a simple power law with a break in the 1–2 GeV energy range. We discuss possible explanations for the origin of the γ-ray spectral breaks. Our study suggests that the γ-ray emission region in 3C 273 is located within the broad line region (< 1.6 pc). As a result, the spectral behavior and temporal characteristics of the individual flares indicate the presence of multiple shock scenarios at the base of the jet.

  5. Integral Field Spectroscopy of Markarian 273: Mapping High-Velocity Gas Flows and an Off-Nucleus Seyfert 2 Nebula. (United States)

    Colina; Arribas; Borne


    Integral field optical spectroscopy with the INTEGRAL fiber-based system is used to map the extended ionized regions and gas flows in Mrk 273, one of the closest ultraluminous infrared galaxies. The Hbeta and [O iii] lambda5007 maps show the presence of two distinct regions separated by 4&arcsec; (3.1 kpc) along position angle (P.A.) 240 degrees. The northeastern region coincides with the optical nucleus of the galaxy and shows the spectral characteristics of LINERs. The southwestern region is dominated by [O iii] emission and is classified as a Seyfert 2. Therefore, in the optical, Mrk 273 is an ultraluminous infrared galaxy with a LINER nucleus and an extended off-nucleus Seyfert 2 nebula. The kinematics of the [O iii] ionized gas shows (1) the presence of highly disturbed gas in the regions around the LINER nucleus, (2) a high-velocity gas flow with a peak-to-peak amplitude of 2.4x103 km s-1, and (3) quiescent gas in the outer regions (at 3 kpc). We hypothesize that the high-velocity flow is the starburst-driven superwind generated in an optically obscured nuclear starburst and that the quiescent gas is directly ionized by a nuclear source, similar to the ionization cones typically seen in Seyfert galaxies.

  6. Some observations on the use of the triple points of deuterium and xenon in interpolation schemes for platinum resistance thermometers below 273 K

    International Nuclear Information System (INIS)

    Kemp, R.C.


    The use of the triple points of deuterium and xenon is investigated in some interpolation schemes for platinum resistance thermometers between 13.8 K and 273 K. The use of these triple points together is shown to lead to a large sensitivity to errors in the realization of the boiling point of water or the triple point of gallium and of the triple point of xenon for interpolated temperatures below 25 K. The behaviour of these interpolation schemes is presented as evidence that the large non-uniqueness observed in temperature scales between 84 K and 273 K is due in part to measurement errors at the boiling point of water. The use of the triple point of xenon and in interpolation scheme between 25 K and 273 K is shown to lead to a large sensitivity to calibration errors in the triple points of xenon and gallium between 25 K and 54 K. (orig.)

  7. Results of the independent verification of radiological remedial action at 273 East 1st South Street, Monticello, Utah (MS00092)

    International Nuclear Information System (INIS)

    Crutcher, J.W.; Smuin, M.W.


    In 1980 the site of a vanadium and uranium mill at Monticello, Utah, was accepted into the US Department of Energy's (DOE's) Surplus Facilities Management Program, with the objectives of restoring the government-owned mill site to safe levels of radioactivity, disposing of or containing the tailings in an environmentally safe manner, and performing remedial actions on off-site (vicinity) properties that had been contaminated by radioactive material resulting from mill operations. During 1984 and 1985, UNC Geotech, the remedial action contractor designated by DOE, performed remedial action on the vicinity property at 273 East 1st South Street, Monticello, Utah. The Pollutant Assessments Group (PAG) of Oak Ridge National Laboratory was assigned the responsibility of verifying the data supporting the adequacy of remedial action and confirming the site's compliance with DOE guidelines. The PAG found that the site successfully meets the DOE remedial action objectives. Procedures used by PAG are described. 3 refs., 2 tabs


    International Nuclear Information System (INIS)

    Abdo, A. A.; Ackermann, M.; Ajello, M.; Bechtol, K.; Berenji, B.; Blandford, R. D.; Bloom, E. D.; Borgland, A. W.; Bouvier, A.; Baldini, L.; Bellazzini, R.; Bregeon, J.; Brez, A.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bonamente, E.; Brigida, M.; Bruel, P.; Burnett, T. H.


    We present the light curves and spectral data of two exceptionally luminous gamma-ray outbursts observed by the Large Area Telescope experiment on board the Fermi Gamma-ray Space Telescope from 3C 273 in 2009 September. During these flares, having a duration of a few days, the source reached its highest γ-ray flux ever measured. This allowed us to study, in some details, their spectral and temporal structures. The rise and the decay are asymmetric on timescales of 6 hr, and the spectral index was significantly harder during the flares than during the preceding 11 months. We also found that short, very intense flares put out the same time-integrated energy as long, less intense flares like that observed in 2009 August.

  9. Structural Investigation of the Oligosaccharide Portion Isolated from the Lipooligosaccharide of the Permafrost Psychrophile Psychrobacter arcticus 273-4. (United States)

    Casillo, Angela; Parrilli, Ermenegilda; Filomena, Sannino; Lindner, Buko; Lanzetta, Rosa; Parrilli, Michelangelo; Tutino, Maria Luisa; Corsaro, Maria Michela


    Psychrophilic microorganisms have successfully colonized all permanently cold environments from the deep sea to mountain and polar regions. The ability of an organism to survive and grow in cryoenviroments depends on a number of adaptive strategies aimed at maintaining vital cellular functions at subzero temperatures, which include the structural modifications of the membrane. To understand the role of the membrane in the adaptation, it is necessary to characterize the cell-wall components, such as the lipopolysaccharides, that represent the major constituent of the outer membrane. The aim of this study was to investigate the structure of the carbohydrate backbone of the lipooligosaccharide (LOS) isolated from the cold-adapted Psychrobacter arcticus 273-4. The strain, isolated from a 20,000-to-30,000-year-old continuously frozen permafrost in Siberia, was cultivated at 4 °C. The LOS was isolated from dry cells and analyzed by means of chemical methods. In particular, it was degraded either by mild acid hydrolysis or by hydrazinolysis and investigated in detail by (1)H and (13)C NMR spectroscopy and by ESI FT-ICR mass spectrometry. The oligosaccharide was characterized by the substitution of the heptose residue, usually linked to Kdo in the inner core, with a glucose, and for the unusual presence of N-acetylmuramic acid.

  10. Transesterification of waste cooking oil by an organic solvent-tolerant alkaline lipase from Streptomyces sp. CS273. (United States)

    Mander, Poonam; Yoo, Hah-Young; Kim, Seung Wook; Choi, Yun Hee; Cho, Seung Sik; Yoo, Jin Cheol


    The aim of this present study was to produce a microbial enzyme that can potentially be utilized for the enzymatic transesterification of waste cooking oil. To that end, an extracellular lipase was isolated and purified from the culture broth of Streptomyces sp. CS273. The molecular mass of purified lipase was estimated to be 36.55 kDa by SDS PAGE. The optimum lipolytic activity was obtained at alkaline pH 8.0 to 8.5 and temperature 40 °C, while the enzyme was stable in the pH range 7.0 ∼ 9.0 and at temperature ≤40 °C. The lipase showed highest hydrolytic activity towards p-nitrophenyl myristate (C14). The lipase activity was enhanced by several salts and detergents including NaCl, MnSo₄, and deoxy cholic acid, while phenylmethylsulfonyl fluoride at concentration 10 mM inhibited the activity. The lipase showed tolerance towards different organic solvents including ethanol and methanol which are commonly used in transesterification reactions to displace alcohol from triglycerides (ester) contained in renewable resources to yield fatty acid alkyl esters known as biodiesel. Applicability of the lipase in transesterification of waste cooking oil was confirmed by gas chromatography mass spectrometry analysis.

  11. Partial molar volumes of (acetonitrile + water) mixtures over the temperature range (273.15 to 318.15) K

    International Nuclear Information System (INIS)

    Yeow, Y. Leong; Leong, Yee-Kwong


    Isothermal molar volume data of (acetonitrile + water) mixtures, between T = 273.15 K and T = 318.15 K, extracted from different sources are combined and treated as a single set to even out minor differences between sources and to increase the number of data points for each temperature. Tikhonov regularization is applied to compute the isothermal first and second derivatives of these data with respect to molar composition. For the reference temperature of 298.15 K, this computation is extended to the third derivative. Generalized Cross Validation is used to guide the selection of the regularization parameter that keeps noise amplification under control. The resulting first derivatives are used to construct the partial molar volume curves which are then checked against published results. Properties of the partial molar volumes are analysed by examining their derivatives. Finally the general shape of the second derivative curve of molar volume is explained qualitatively in terms of tripartite segmentation of the molar composition interval but quantitative comparisons are required to confirm this explanation

  12. Recurrent Microdeletions at Xq27.3-Xq28 and Male Infertility: A Study in the Czech Population.

    Directory of Open Access Journals (Sweden)

    Blanka Chylíková

    Full Text Available Genetic causes of male infertility are hypothesized to involve multiple types of mutations, from single gene defects to complex chromosome rearrangements. Recently, several recurrent X-chromosome microdeletions (located in subtelomeric region of the long arm were reported to be associated with male infertility in Spanish and Italian males. The aim of our study was to test their prevalence and infertility association in population of men from the Czech Republic.107 males with pathological sperm evaluation resulting in nonobstructive infertility were compared to 131 males with normal fecundity. X-chromosome microdeletions were assessed by +/- PCR with three primer pairs for each region Xcnv64 (Xq27.3, Xcnv67 (Xq28 and Xcnv69 (Xq28. The latter microdeletion was further characterized by amplification across the deleted region, dividing the deletion into three types; A, B and C.We detected presence of isolated Xcnv64 deletion in 3 patients and 14 controls, and Xcnv69 in 3 patients and 6 controls (1 and 1 patient vs.4 and 1 control for types A and B respectively. There was one control with combined Xcnv64 and Xcnv69 type B deletions, and one patient with combination of Xcnv64 and Xcnv69 type C deletions. The frequency of the deletions was thus not higher in patient compared to control group, Xcnv64 was marginally associated with controls (adjusted Fisher´s exact test P = 0.043, Xcnv69 was not associated (P = 0.452. We excluded presence of more extensive rearrangements in two subjects with combined Xcnv64 and Xcnv69 deletions. There was no Xcnv67 deletion in our cohort.In conclusion, the two previously reported X-linked microdeletions (Xcnv64 and Xcnv69 do not seem to confer a significant risk to impaired spermatogenesis in the Czech population. The potential clinical role of the previously reported patient-specific Xcnv67 remains to be determined in a larger study population.

  13. Periodontitis and cancer mortality: Register-based cohort study of 68,273 adults in 10-year follow-up. (United States)

    Heikkilä, Pia; But, Anna; Sorsa, Timo; Haukka, Jari


    Periodontitis, a multifactorial infection-induced low-grade chronic inflammation, can influence the process of carcinogenesis. We studied with 10 years follow-up of 68,273 adults-based cohort the involvement of periodontitis as a risk factor for cancer mortality. Periodontal status was defined based on procedure codes of periodontal treatment. Rate ratios and absolute differences of overall and cancer mortality rates were assessed with respect to periodontal status using multiplicative and additive Poisson regression models, respectively. We adjusted for effect of age, sex, calendar time, socio-economic status, oral health, dental treatments and diabetes. Data about smoking or alcohol consumption were not available. Altogether 797 cancer deaths occurred during 664,020 person-years accumulated over a mean 10.1-year follow-up. Crude cancer mortality rate per 10,000 person-years for participants without and with periodontitis was 11.36 (95% CI 10.47-12.31) and 14.45 (95% CI 12.51-16.61), respectively. Crude rate ratios for periodontitis indicated an increased risk of overall (RR 1.27, 95% CI 1.08-1.39) and pancreatic cancer (RR 1.69, 95% CI 1.04-2.76) mortality. After adjustment, the results showed even stronger associations of periodontitis with increased overall (RR 1.33, 95% CI 1.10-1.58) and pancreatic cancer (RR 2.32, 95% CI 1.31-3.98) mortality. A higher pancreatic cancer mortality among individuals with periodontitis contributed considerably to the difference in overall cancer mortality, but this difference was not due to pancreatic cancer deaths alone. © 2018 UICC.

  14. The rate coefficient for the reaction NO2 + NO3 yielding NO + NO2 + O2 from 273 to 313 K (United States)

    Cantrell, Chris A.; Shetter, Richard E.; Mcdaniel, Anthony H.; Calvert, Jack G.


    The ratio of rate constants for the reaction NO3 + NO yielding 2 NO2 (k3) and the reaction NO2 + NO3 yielding NO + NO2 + O2 (k4) were determined by measuring of NO and NO2 concentrations of NO and NO2 in an N2O5/NO2/N2 mixture over the temperature range 273-313 K. The measured ratio was found to be expressed by the equation k3/k4 = 387 exp(-1375/T). The results are consistent with those of Hammer et al. (1986).


    Energy Technology Data Exchange (ETDEWEB)

    Madsen, Kristin K.; Forster, Karl [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Beardmore, Andrew P.; Page, Kim L. [X-ray and Observational Astronomy Group, Department of Physics and Astronomy, University of Leicester, Leicester LE1 7RH (United Kingdom); Guainazzi, Matteo [Japan Aerospace Exploration Agency, Institute of Space and Astronautical Science, 3-1-1, Yoshinodai, Sagamihara, Kanagawa, 252-5201 (Japan); Marshall, Herman L.; Miller, Eric D. [Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, 77 Massachusetts Ave., Cambridge, MA 02139 (United States); Stuhlinger, Martin [European Space Astronomy Centre (ESAC), P.O. Box 78, E-28691 Villanueva de la Caada, Madrid (Spain)


    On behalf of the International Astronomical Consortium for High Energy Calibration, we present results from the cross-calibration campaigns in 2012 on 3C 273 and in 2013 on PKS 2155-304 between the then active X-ray observatories Chandra , NuSTAR , Suzaku , Swift, and XMM-Newton . We compare measured fluxes between instrument pairs in two energy bands, 1–5 keV and 3–7 keV, and calculate an average cross-normalization constant for each energy range. We review known cross-calibration features and provide a series of tables and figures to be used for evaluating cross-normalization constants obtained from other observations with the above mentioned observatories.

  16. Emissions Inventory Report Summary: Reporting Requirements for the New Mexico Administrative code, Title 20, Chapter 2, Part 73 (20 NMAC 2.73) for Calendar Year 1997

    International Nuclear Information System (INIS)


    Los Alamos National Laboratory (the Laboratory) is subject to emissions reporting requirements for regulated air contaminants under Title 20 of the New Mexico Administrative Code, Chapter 2, Part 73, (20 NMAC 2.73), Notice of Intent and Emissions Inventory Requirements. The Laboratory has the potential to emit 100 tons per year of suspended particulate matter (PM), nitrogen oxides (NO x ), carbon monoxide (CO), and volatile organic compounds (VOCs). For 1997, combustion products from the industrial sources contributed the greatest amount of regulated air emissions from the Laboratory. Research and development activities contributed the greatest amount of VOCs. Emissions of beryllium and aluminum were reported for activities permitted under 20 NMAC 2.72, Construction Permits

  17. Mitochondrial protection by the mixed muscarinic/σ1 ligand ANAVEX2-73, a tetrahydrofuran derivative, in Aβ25-35 peptide-injected mice, a nontransgenic Alzheimer's disease model. (United States)

    Lahmy, Valentine; Long, Romain; Morin, Didier; Villard, Vanessa; Maurice, Tangui


    Alzheimer's disease (AD), the most prevalent dementia in the elderly, is characterized by progressive synaptic and neuronal loss. Mitochondrial dysfunctions have been consistently reported as an early event in AD and appear before Aβ deposition and memory decline. In order to define a new neuroprotectant strategy in AD targeting mitochondrial alterations, we develop tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (ANAVEX2-73, AE37), a mixed muscarinic receptor ligand and a sigma-1 receptor (σ1R) agonist. We previously reported that ANAVEX2-73 shows anti-amnesic and neuroprotective activities in mice injected intracerebroventricular (ICV) with oligomeric amyloid-β25-35 peptide (Aβ25-35). The σ1R is present at mitochondria-associated endoplasmic reticulum (ER) membranes, where it acts as a sensor/modulator of ER stress responses and local Ca(2+) exchanges with the mitochondria. We therefore evaluated the effect of ANAVEX2-73 and PRE-084, a reference σ1R agonist, on preservation of mitochondrial integrity in Aβ25-35-injected mice. In isolated mitochondria from hippocampus preparations of Aβ25-35 injected animals, we measured respiration rates, complex activities, lipid peroxidation, Bax/Bcl-2 ratios and cytochrome c release into the cytosol. Five days after Aβ25-35 injection, mitochondrial respiration in mouse hippocampus was altered. ANAVEX2-73 (0.01-1 mg/kg IP) restored normal respiration and PRE-084 (0.5-1 mg/kg IP) increased respiration rates. Both compounds prevented Aβ25-35-induced increases in lipid peroxidation levels, Bax/Bcl-2 ratio and cytochrome c release into the cytosol, all indicators of increased toxicity. ANAVEX2-73 and PRE-084 efficiently prevented the mitochondrial respiratory dysfunction and resulting oxidative stress and apoptosis. The σ1R, targeted selectively or non-selectively, therefore appears as a valuable target for protection against mitochondrial damages in AD.

  18. Probing the innermost regions of AGN jets and their magnetic fields with RadioAstron. II. Observations of 3C 273 at minimum activity (United States)

    Bruni, G.; Gómez, J. L.; Casadio, C.; Lobanov, A.; Kovalev, Y. Y.; Sokolovsky, K. V.; Lisakov, M. M.; Bach, U.; Marscher, A.; Jorstad, S.; Anderson, J. M.; Krichbaum, T. P.; Savolainen, T.; Vega-García, L.; Fuentes, A.; Zensus, J. A.; Alberdi, A.; Lee, S.-S.; Lu, R.-S.; Pérez-Torres, M.; Ros, E.


    Context. RadioAstron is a 10 m orbiting radio telescope mounted on the Spektr-R satellite, launched in 2011, performing Space Very Long Baseline Interferometry (SVLBI) observations supported by a global ground array of radio telescopes. With an apogee of 350 000 km, it is offering for the first time the possibility to perform μas-resolution imaging in the cm-band. Aims: The RadioAstron active galactic nuclei (AGN) polarization Key Science Project (KSP) aims at exploiting the unprecedented angular resolution provided by RadioAstron to study jet launching/collimation and magnetic-field configuration in AGN jets. The targets of our KSP are some of the most powerful blazars in the sky. Methods: We present observations at 22 GHz of 3C 273, performed in 2014, designed to reach a maximum baseline of approximately nine Earth diameters. Reaching an angular resolution of 0.3 mas, we study a particularly low-activity state of the source, and estimate the nuclear region brightness temperature, comparing with the extreme one detected one year before during the RadioAstron early science period. We also make use of the VLBA-BU-BLAZAR survey data, at 43 GHz, to study the kinematics of the jet in a 1.5-yr time window. Results: We find that the nuclear brightness temperature is two orders of magnitude lower than the exceptionally high value detected in 2013 with RadioAstron at the same frequency (1.4 × 1013 K, source-frame), and even one order of magnitude lower than the equipartition value. The kinematics analysis at 43 GHz shows that a new component was ejected 2 months after the 2013 epoch, visible also in our 22 GHz map presented here. Consequently this was located upstream of the core during the brightness temperature peak. Fermi-LAT observations for the period 2010-2014 do not show any γ-ray flare in conjunction with the passage of the new component by the core at 43 GHz. Conclusions: These observations confirm that the previously detected extreme brightness temperature in

  19. Gastric Medullary Carcinoma with Sporadic Mismatch Repair Deficiency and a TP53 R273C Mutation: An Unusual Case with Wild-Type BRAF

    Directory of Open Access Journals (Sweden)

    Brett M. Lowenthal


    Full Text Available Medullary carcinoma has long been recognized as a subtype of colorectal cancer associated with microsatellite instability and Lynch syndrome. Gastric medullary carcinoma is a very rare neoplasm. We report a 67-year-old male who presented with a solitary gastric mass. Total gastrectomy revealed a well-demarcated, poorly differentiated carcinoma with an organoid growth pattern, pushing borders, and abundant peritumoral lymphocytic response. The prior cytology was cellular with immunohistochemical panel consistent with upper gastrointestinal/pancreaticobiliary origin. Overall, the histopathologic findings were consistent with gastric medullary carcinoma. A mismatch repair panel revealed a mismatch repair protein deficient tumor with loss of MLH1 and PMS2 expression. BRAF V600E immunostain (VE1 and BRAF molecular testing were negative, indicating a wild-type gene. Tumor sequencing of MLH1 demonstrated a wild-type gene, while our molecular panel identified TP53 c.817C>T (p.R273C mutation. These findings were compatible with a sporadic tumor. Given that morphologically identical medullary tumors often occur in Lynch syndrome, it is possible that mismatch repair loss is an early event in sporadic tumors with p53 mutation being a late event. Despite having wild-type BRAF, this tumor is sporadic and unrelated to Lynch syndrome. This case report demonstrates that coordinate ancillary studies are needed to resolve sporadic versus hereditary rare tumors.

  20. Thermodynamic properties and equation of state of liquid di-isodecyl phthalate at temperature between (273 and 423) K and at pressures up to 140 MPa

    Energy Technology Data Exchange (ETDEWEB)

    Peleties, F. [Department of Chemical Engineering, Imperial College London, South Kensington Campus, London SW7 2AZ (United Kingdom); Segovia, J.J. [Grupo de Termodinamica y Calibracion (TERMOCAL), Dpto. Ingenieria Energetica y Fluidomecanica, E.T.S. de Ingenieros Industriales, Universidad de Valladolid, E-47011 Valladolid (Spain); Trusler, J.P.M., E-mail: [Department of Chemical Engineering, Imperial College London, South Kensington Campus, London SW7 2AZ (United Kingdom); Vega-Maza, D. [Grupo de Termodinamica y Calibracion (TERMOCAL), Dpto. Ingenieria Energetica y Fluidomecanica, E.T.S. de Ingenieros Industriales, Universidad de Valladolid, E-47011 Valladolid (Spain)


    We report measurements of the thermodynamic properties of liquid di-isodecyl phthalate (DIDP) and an equation of state determined therefrom. The speed of sound in DIDP was measured at temperatures between (293.15 and 413.15) K and a pressures between (0.1 and 140) MPa with a relative uncertainty of 0.1%. In addition, the isobaric specific heat capacity was measured at temperatures between (293.15 and 423.15) K at a pressure of 0.1 MPa with a relative uncertainty of 1%, and the density was measured at temperatures between (273.15 and 413.15) K at a pressure of 0.1 MPa with a relative uncertainty of 0.015%. The thermodynamic properties of DIDP were obtained from the measured speeds of sound by thermodynamic integration starting from the initial values of density and isobaric specific heat capacity obtained experimentally. The results have been represented by a new equation of state containing nine parameters with an uncertainty in density not worse than 0.025%. Comparisons with literature data are made.

  1. Thermodynamic properties and equation of state of liquid di-isodecyl phthalate at temperature between (273 and 423) K and at pressures up to 140 MPa

    International Nuclear Information System (INIS)

    Peleties, F.; Segovia, J.J.; Trusler, J.P.M.; Vega-Maza, D.


    We report measurements of the thermodynamic properties of liquid di-isodecyl phthalate (DIDP) and an equation of state determined therefrom. The speed of sound in DIDP was measured at temperatures between (293.15 and 413.15) K and a pressures between (0.1 and 140) MPa with a relative uncertainty of 0.1%. In addition, the isobaric specific heat capacity was measured at temperatures between (293.15 and 423.15) K at a pressure of 0.1 MPa with a relative uncertainty of 1%, and the density was measured at temperatures between (273.15 and 413.15) K at a pressure of 0.1 MPa with a relative uncertainty of 0.015%. The thermodynamic properties of DIDP were obtained from the measured speeds of sound by thermodynamic integration starting from the initial values of density and isobaric specific heat capacity obtained experimentally. The results have been represented by a new equation of state containing nine parameters with an uncertainty in density not worse than 0.025%. Comparisons with literature data are made.

  2. The X-ray emission mechanism of large scale powerful quasar jets: Fermi rules out IC/CMB for 3C 273.

    Directory of Open Access Journals (Sweden)

    Georganopoulos Markos


    Full Text Available The process responsible for the Chandra-detected X-ray emission from the large-scale jets of powerful quasars is not clear yet. The two main models are inverse Compton scattering off the cosmic microwave background photons (IC/CMB and synchrotron emission from a population of electrons separate from those producing the radio-IR emission. These two models imply radically different conditions in the large scale jet in terms of jet speed, kinetic power, and maximum energy of the particle acceleration mechanism, with important implications for the impact of the jet on the larger-scale environment. Georganopoulos et al. (2006 proposed a diagnostic based on a fundamental difference between these two models: the production of synchrotron X-rays requires multi-TeV electrons, while the EC/CMB model requires a cutoff in the electron energy distribution below TeV energies. This has significant implications for the γ-ray emission predicted by these two models. Here we present new Fermi observations that put an upper limit on the gamma-ray flux from the large-scale jet of 3C 273 that clearly violates the flux expected from the IC/CMB X-ray interpretation found by extrapolation of the UV to X-ray spectrum of knot A, thus ruling out the IC/CMB interpretation entirely for this source. Further, the upper limit from Fermi puts a limit on the Doppler beaming factor of at least δ <9, assuming equipartition fields, and possibly as low as δ <5 assuming no major deceleration of the jet from knots A through D1.

  3. Phase equilibrium measurements and thermodynamic modeling of aqueous solutions of polyamines CO_2 absorbents: 3-aminopropylmethylamine, 3-aminopropyldimethylamine and N,N-diethyl 1,3-propanediamine at temperatures from 273 K to 363 K

    International Nuclear Information System (INIS)

    Bouzina, Zahida; Mokbel, Ilham; Negadi, Amina; Jose, Jacques; Negadi, Latifa


    Highlights: • Experimental vapor pressures of pure MAPA, DMAPA, DEAPA and their aqueous solutions are reported. • The investigated temperatures are 273 K through 363 K. • The MAPA binary system exhibits negative deviations in G"E values. • The DMAPA and DEAPA systems exhibit negative, sinusoidal and positive deviations in G"E values. • The 3rd order Redlich–Kister, and NRTL or UNIQUAC models have been used to correlate the (P-x-y) data. - Abstract: The vapor pressures of the pure components 3-aminopropylmethylamine (MAPA), 3-aminopropyldimethylamine (DMAPA) and N,N-diethyl 1,3-propanediamine (DEAPA) along with the binary mixtures (MAPA + water), (DMAPA + water) and (DEAPA + water) were measured by means of a static apparatus at temperatures between (273 and 363) K. The data were correlated with the Antoine equation. From these data, excess Gibbs functions (G"E) were calculated for several constant temperatures, and fitted to a three parameters Redlich–Kister equation using the Barker’s method. Additionally, the NRTL and UNIQUAC models have been used for the correlation of the total pressure.

  4. Measurement of the D/H, 18O/16O, and 17O/16O Isotope Ratios in Water by Laser Absorption Spectroscopy at 2.73 μm

    Directory of Open Access Journals (Sweden)

    Tao Wu


    Full Text Available A compact isotope ratio laser spectrometry (IRLS instrument was developed for simultaneous measurements of the D/H, 18O/16O and 17O/16O isotope ratios in water by laser absorption spectroscopy at 2.73 μm. Special attention is paid to the spectral data processing and implementation of a Kalman adaptive filtering to improve the measurement precision. Reduction of up to 3-fold in standard deviation in isotope ratio determination was obtained by the use of a Fourier filtering to remove undulation structure from spectrum baseline. Application of Kalman filtering enables isotope ratio measurement at 1 s time intervals with a precision (<1‰ better than that obtained by conventional 30 s averaging, while maintaining a fast system response. The implementation of the filter is described in detail and its effects on the accuracy and the precision of the isotope ratio measurements are investigated.

  5. CCT-K2.1: NRC/VNIIFTRI bilateral comparison of capsule-type standard platinum resistance thermometers from 13.8 K to 273.16 K

    Energy Technology Data Exchange (ETDEWEB)

    Hill, K.D.; Steele, A.G. [National Research Council of Canada, Institute for National Measurement Standards, Ottawa, ON (Canada); Dedikov, Y.A.; Shkraba, V.T. [Institute for Physical-Technical and Radiotechnical Measurements (VNIIFTRI), Moscow (Russian Federation)


    The Consultative Committee for Thermometry Key Comparison 2 (CCT-K2) results were published two years ago (2002 Metrologia 39 551-71). NRC served as the pilot laboratory for CCT-K2 and remains able to provide a scale and measurement system suitable for performing bilateral comparisons linked to the original key comparison results. In March 2003, measurements of two VNIIFTRI 100 {omega} capsule-style platinum resistance thermometers (CSPRTs), S/N 356 and 476, were undertaken to relate their local calibration to the results from the CCT-K2 exercise. The NRC Leeds and Northrup (L and N) CSPRT S/N 1872174 provides the link to the CCT-K2 results. The three CSPRTs were compared at the eight defining cryogenic temperatures of the International Temperature Scale of 1990 (ITS-90) in the range from 13.8033 K to 273.16 K. The reader is referred to the full text of the CCT-K2 report for a detailed explanation of the methodology employed for the comparison. Only the details unique to the measurements reported here will be addressed in this article. The NRC/VNIIFTRI bilateral comparison of capsule-style platinum resistance thermometers over the range 13.8 K to 273.16 K has revealed calibrations at VNIIFTRI to be in agreement with the KCRV of CCT-K2 within the expanded uncertainty for all temperatures of the comparison with the exception of the triple point of hydrogen at 13.8033 K. One of the two CSPRTs supplied by VNIIFTRI was found to be discrepant as revealed by differences at the triple point of water and at the lowest temperatures of the comparison, and was therefore excluded from further analysis. The linkage to the CCT-K2 data supports the evaluation of the VNIIFTRI CMCs in Appendix C of the KCDB. (authors)

  6. KEY COMPARISON: CCT-K2.1: NRC/VNIIFTRI bilateral comparison of capsule-type standard platinum resistance thermometers from 13.8 K to 273.16 K (United States)

    Hill, K. D.; Steele, A. G.; Dedikov, Y. A.; Shkraba, V. T.


    The Consultative Committee for Thermometry Key Comparison 2 (CCT-K2) results were published two years ago (2002 Metrologia 39 551-71). NRC served as the pilot laboratory for CCT-K2 and remains able to provide a scale and measurement system suitable for performing bilateral comparisons linked to the original key comparison results. In March 2003, measurements of two VNIIFTRI 100 Ω capsule-style platinum resistance thermometers (CSPRTs), S/N 356 and 476, were undertaken to relate their local calibration to the results from the CCT-K2 exercise. The NRC Leeds and Northrup (L&N) CSPRT S/N 1872174 provides the link to the CCT-K2 results. The three CSPRTs were compared at the eight defining cryogenic temperatures of the International Temperature Scale of 1990 (ITS-90) in the range from 13.8033 K to 273.16 K. The reader is referred to the full text of the CCT-K2 report for a detailed explanation of the methodology employed for the comparison. Only the details unique to the measurements reported here will be addressed in this article. The NRC/VNIIFTRI bilateral comparison of capsule-style platinum resistance thermometers over the range 13.8 K to 273.16 K has revealed calibrations at VNIIFTRI to be in agreement with the KCRV of CCT-K2 within the expanded uncertainty for all temperatures of the comparison with the exception of the triple point of hydrogen at 13.8033 K. One of the two CSPRTs supplied by VNIIFTRI was found to be discrepant as revealed by differences at the triple point of water and at the lowest temperatures of the comparison, and was therefore excluded from further analysis. The linkage to the CCT-K2 data supports the evaluation of the VNIIFTRI CMCs in Appendix C of the KCDB. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database The final report has been peer-reviewed and approved for publication by the CCT, according to the provisions

  7. Solution of the Skyrme-Hartree–Fock–Bogolyubov equations in the Cartesian deformed harmonic-oscillator basis. (VIII) HFODD (v2.73y): A new version of the program

    International Nuclear Information System (INIS)

    Schunck, N.; Dobaczewski, J.


    Here, we describe the new version (v2.73y) of the code hfodd which solves the nuclear Skyrme Hartree–Fock or Skyrme Hartree–Fock–Bogolyubov problem by using the Cartesian deformed harmonic-oscillator basis. In the new version, we have implemented the following new features: (i) full proton–neutron mixing in the particle–hole channel for Skyrme functionals, (ii) the Gogny force in both particle–hole and particle–particle channels, (iii) linear multi-constraint method at finite temperature, (iv) fission toolkit including the constraint on the number of particles in the neck between two fragments, calculation of the interaction energy between fragments, and calculation of the nuclear and Coulomb energy of each fragment, (v) the new version 200d of the code hfbtho, together with an enhanced interface between HFBTHO and HFODD, (vi) parallel capabilities, significantly extended by adding several restart options for large-scale jobs, (vii) the Lipkin translational energy correction method with pairing, (viii) higher-order Lipkin particle-number corrections, (ix) interface to a program plotting single-particle energies or Routhians, (x) strong-force isospin-symmetry-breaking terms, and (xi) the Augmented Lagrangian Method for calculations with 3D constraints on angular momentum and isospin. Finally, an important bug related to the calculation of the entropy at finite temperature and several other little significant errors of the previous published version were corrected.

  8. Alternative synthetic route for the heterometallic CO-releasing [Sb@Rh12(CO27]3− icosahedral carbonyl cluster and synthesis of its new unsaturated [Sb@Rh12(CO24]4− and dimeric [{Sb@Rh12Sb(CO25}2Rh(CO2PPh3]7− derivatives

    Directory of Open Access Journals (Sweden)

    Cristina Femoni


    Full Text Available The hetero-metallic [Sb@Rh12(CO27]3− cluster has been known as for over three decades thanks to Vidal and co-workers, and represents the first example of an E-centered (E=heteroatom icosahedral rhodium carbonyl cluster. However, its synthesis required high temperature (140–160 °C and elevated CO pressure (400 atm. Applying the redox condensation method for cluster preparation, we herein report a new synthetic, high-yield route for preparing [Sb@Rh12(CO27]3− under much milder conditions of temperature and pressure. Notably, when the same synthesis was carried out under N2 instead of CO atmosphere, the new isostructural but unsaturated derivative [Sb@Rh12(CO24]4− was obtained, for which we report the full X-ray structural characterization. This species represents one of the few examples of an icosahedral cluster disobeying the electron-counting Wade-Mingos rules, possessing less than the expected 170 cluster valence electrons (CVEs. Judging from IR monitoring, the two species can be obtained one from the other by switching between N2 and CO atmosphere, making [Sb@Rh12(CO27]3− a spontaneous CO-releasing molecule. Finally, the study of the chemical reactivity of [Sb@Rh12(CO27]3− with PPh3 allowed us to obtain the new [{Sb@Rh12Sb(CO25}2Rh(CO2PPh3]7− dimeric compound, for which we herein report the full X-ray structural and 31P NMR analyses.

  9. Solubility measurement and correlation of 4-nitrophthalimide in (methanol, ethanol, or acetone) + N,N-dimethylformamide mixed solvents at temperatures from 273.15 K to 323.15 K

    International Nuclear Information System (INIS)

    Li, Rongrong; Han, Shuo; Du, Cunbin; Cong, Yang; Wang, Jian; Zhao, Hongkun


    Highlights: • Solubility of 4-nitrophthalimide in binary mixed solvents were determined. • Solubility data were correlated and calculated by four models. • The standard dissolution enthalpy for the dissolution processes were calculated. - Abstract: The solubility of 4-nitrophthalimide in binary (methanol + N,N-dimethylformamide (DMF), ethanol + DMF) and (acetone + DMF) solvent mixtures were investigated by the isothermal dissolution equilibrium method under atmosphere pressure. These studies were carried out at different mass fractions of methanol, ethanol or acetone ranging from 0.1 to 0.9 at temperature T = (273.15–323.15) K. For the nine groups of each solvent mixture studied, the solubility of 4-nitrophthalimide in mixed solutions increased with increasing temperature and mass fraction of methanol, ethanol or acetone for the three systems including (methanol + DMF), (ethanol + DMF) and (acetone + DMF). At the same temperature and mass fraction of methanol, ethanol or acetone, the mole fraction solubility of 4-nitrophthalimide in (acetone + DMF) was greater than that in the other two binary solvents. In addition, the experimental mole fraction solubility was correlated by four models (Jouyban–Acree model, van’t Hoff–Jouyban–Acree model, modified Apelblat–Jouyban–Acree model and Sun model). The Jouyban–Acree model gave best representation for the experimental solubility values. Furthermore, the standard molar enthalpies of 4-nitrophthalimide during the dissolving process (Δ sol H o ) were also obtained in this work, and the results show that the dissolution process is endothermic. The experimental solubility and the models used in this work will be helpful in separating 4-nitrophthalimide from its isomeric mixtures.

  10. 40 CFR 60.273 - Emission monitoring. (United States)


    ... sensor must provide output of relative particulate matter loadings and the owner or operator shall... system including quality assurance procedures; (iv) How the bag leak detection system will be maintained... stack, the bag leak detection sensor must be installed downstream of the baghouse and upstream of any...

  11. 7 CFR 273.15 - Fair hearings. (United States)


    ... in the event it is not possible for the household to attend the scheduled hearing. (2) Specify that... with due process to insure an orderly hearing; (v) Order, where relevant and useful, an independent..., shall constitute the exclusive record for a final decision by the hearing authority. This record shall...

  12. 8 CFR 273.3 - Screening procedures. (United States)


    ... this section apply to those owners, operators, or agents of carriers which transport passengers to the... examination of their travel documents to ensure that: (i) The passport or travel document presented is not...


    African Journals Online (AJOL)

    daar die neiging bestaan om die leksikografie eenvoudig te reduseer tot die toegepaste been van die .... vakgebied, wat dit uitsluit dat enige toegepaste taaldissipJine eenvoudig tot die praktiese komponent van die ..... examples of each phenomenon that they study, remaining oblivious to how large or small a set of lexical ...

  14. Suicide Prevention: 1-800-273-8255 (United States)

    ... Spanish: Informacion y Apoyo para los Sobrevivientes del Suicidio: Guía de Recursos del Departamento de Veteran Affairs para las familias que estén lidiando con el suicidio How to Talk to a Child about a ...

  15. 7 CFR 273.7 - Work provisions. (United States)


    ... office of the State employment services agency. (vi) A regular participant in a drug addiction or... and casework to facilitate the transition from economic dependency to self-sufficiency through work...

  16. 48 CFR 719.273-2 - Definitions. (United States)


    ..., small disadvantaged business, women-owned small business, veteran-owned and service-disabled veteran..., women-owned small business, HUBZone small business, veteran-owned small business or service-disabled... SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS The U.S. Agency for International Development (USAID) Mentor-Prot...

  17. 33 CFR 273.14 - Planning procedures. (United States)


    ... control project programs which involve pest control operations, such as aquatic plant control, and affect... Environmental Policy Act. (The information outlined in Appendix C should be included in the analysis section of...

  18. 7 CFR 273.5 - Students. (United States)


    ... one natural, adoptive or stepparent (regardless of marital status) is in the same food stamp household... participating in a State or federally financed work study program during the regular school year. (i) To qualify under this provision, the student must be approved for work study at the time of application for food...

  19. Publications | Page 273 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Visit the IDRC Digital Library now. ... initiative in Latin America and the Caribbean is tackling the environmental problem of e-waste disposal, providing computers for schools, and creating jobs at the same time. ... Several Latin American neighbours have toured this rural county in the mountains of Honduras to see.

  20. 3q27.3 microdeletional syndrome

    DEFF Research Database (Denmark)

    Thevenon, Julien; Callier, Patrick; Poquet, Hélène


    BACKGROUND: Since the advent of array-CGH, numerous new microdeletional syndromes have been delineated while others remain to be described. Although 3q29 subtelomeric deletion is a well-described syndrome, there is no report on 3q interstitial deletions. METHODS: We report for the first time seve...

  1. 40 CFR 273.9 - Definitions. (United States)


    ..., metal, or any combination of these materials. Battery means a device consisting of one or more... not limited to, fluorescent, high intensity discharge, neon, mercury vapor, high pressure sodium, and metal halide lamps. Large Quantity Handler of Universal Waste means a universal waste handler (as...

  2. 33 CFR 273.13 - Program policy. (United States)


    ... project. (iii) Analysis based on sound economic principles clearly demonstrates that the project will... Program is designed to deal primarily with weed infestations of major economic significance including... infestation should constitute a known problem of economic importance in the area involved. Initial planning...

  3. 12 CFR 27.3 - Recordkeeping requirements. (United States)


    ... work or profession for the applicant(s). (xii) Years on present job. Number of continuous years... accounts, stocks and bonds, cash value of life insurance, value of real estate owned, net worth of business... deposit balance is required, and if so, the amount. (iv) The note (simple) interest rate. (v) The number...

  4. 33 CFR 273.12 - References. (United States)


    ... pesticide chemicals, 2,4-D, subpart C (F) 16 December 1975. (d) Pub. L. 91-596, Occupational Safety and Health Act of 1970, (84 Stat. 1609, 29 U.S.C. 668), 29 December 1970. (e) 29 CFR 1960, Safety and Health... Management System.” (h) ER 1105-2-507, “Preparation and Coordination of Environmental Statements.” (33 CFR...

  5. Publications | Page 273 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)


    Seeking justice: Women's police stations in Latin America. On April 20, 2009, in the small town of Diriomo, Nicaragua, Luz Marina Lezama Suazo, aged 47, was shot dead, allegedly by her husband. According to her sister, “She'd been having problems with him for a while and we had told her to leave.

  6. 25 CFR 273.2 - Definitions. (United States)


    .... (e) “Economic enterprise” means any commercial, industrial, agricultural, or business activity that...) “Education plan” means a comprehensive plan for the programmatic and fiscal services of and accountability by.... 2203). (l) “Operational support” means those expenditures for school operational costs in order to meet...

  7. BPU Simulator

    DEFF Research Database (Denmark)

    Rehr, Martin; Skovhede, Kenneth; Vinter, Brian


    in that process. Our goal is to support all execution platforms, and in this work we introduce the Bohrium Processing Unit, BPU, which will be the FPGA backend for Bohrium. The BPU is modeled as a PyCSP application, and the clear advantages of using CSP for simulating a new CPU is described. The current Py...

  8. 77 FR 273 - Combined Notice of Filings #1 (United States)


    ... Numbers: QF12-120-000. Applicants: The Coca-Cola Company. Description: Form 556--Notice of self-certification of qualifying cogeneration facility status of The Coca-Cola Company. Filed Date: 12/21/2011...

  9. 14 CFR 21.273 - Airworthiness certificates other than experimental. (United States)


    ... TRANSPORTATION AIRCRAFT CERTIFICATION PROCEDURES FOR PRODUCTS AND PARTS Delegation Option Authorization... airworthiness certificate for aircraft manufactured under a delegation option authorization if he finds, on the... authorize any employee to sign airworthiness certificates if that employee— (1) Performs, or is in direct...

  10. All projects related to | Page 273 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)


    The Fifth International Conference on Information and Communication Technologies and Development (ICTD2012) will take place 12-15 March 2012 at the Georgia Institute of Technology (Georgia Tech) in Atlanta, USA. Start Date: January 10, 2012. End Date: January 10, 2013. Topic: RESEARCH RESULTS ...

  11. Veterans Crisis Line: 1-800-273-8255 (United States)

    Veterans Crisis Line Skip to Main Content Get Help Materials Get Involved Crisis Centers About Be There ... Line FAQs Veteran Suicide Welcome to the Veterans Crisis Line Website The Veterans Crisis Line connects Veterans ...

  12. 7 CFR 273.2 - Office operations and application processing. (United States)


    ... reservations, households with adult members who are not proficient in English, and households with earned... knowledge that the member in question is a U.S. citizen or non-citizen national. The signed statement must... because a household fits a profile of an error-prone household does not constitute lack of verification...

  13. 40 CFR 60.273a - Emission monitoring. (United States)


    ... sensor must provide output of relative particulate matter loadings and the owner or operator shall... the bag leak detection system including quality assurance procedures; (iv) How the bag leak detection... discharged to the atmosphere through a stack, the bag leak detection sensor must be installed downstream of...

  14. Flow-induced vibration -- 1994. PVP-Volume 273

    International Nuclear Information System (INIS)

    Au-Yang, M.K.; Fujita, K.


    Flow-induced vibration is a subject of practical interest to many engineering disciplines, including the power generation, process, and petrochemical industries. In the nuclear industry, flow-induced vibration reaches a higher level of concern because of safety issues and the huge cost associated with down time and site repair. Not surprisingly, during the last 25 years a tremendous amount of effort has been spent in the study of flow-induced vibration phenomena related to nuclear plant components, notably nuclear steam generator tube banks and nuclear fuel bundles. Yet, in spite of this concentrated effort, the industry is still not free from flow-induced vibration-related problems. This explains why in this volume almost half of the papers address the issue of cross-flow induced vibration in tube bundles, with applications to the nuclear steam generator and nuclear fuel bundles in mind. Unlike 10 or 15 years ago, when flow-induced vibration studies almost always involved experimentation and empirical studies, the advent of high-speed computers has enabled numerical calculation and simulation of this complex phenomenon to take place. Separate abstracts were prepared for 27 papers in this volume

  15. 33 CFR Appendix D to Part 273 - Work Progress Report (United States)


    ... difference. Not applicable. 4. Outlook for meeting programmed objectives. a. Programmed objectives. Full utilization of work allowance. b. Outlook. We expect to meet our programmed objectives. 5. Problems and.... Surplus funds in the amount of $21,700 will be revoked. ...

  16. 40 CFR 264.273 - Design and operating requirements. (United States)


    ... the facility permit how the owner or operator will design, construct, operate, and maintain the land..., construct, operate, and maintain the treatment zone to minimize run-off of hazardous constituents during the... maintain a run-on control system capable of preventing flow onto the treatment zone during peak discharge...

  17. 25 CFR 273.49 - Freedom of information. (United States)


    ... BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE... disclosure only when both of the following conditions exist: (1) The reports and information fall within one... where disclosure would be a clearly unwarranted invasion of personal privacy. (2) Disclosure is...

  18. 7 CFR 273.18 - Claims against households. (United States)


    ..., referrals to collection and/or other similar private and public sector agencies, state tax refund and... different type of claim (e.g., as an IHE rather than an IPV claim). (B) all adult household members die must... public service This form of payment must be ordered by a court and specifically be in lieu of paying any...

  19. 7 CFR 273.12 - Requirements for change reporting households. (United States)


    ... issue a supplementary ATP for the amount of the increase by June 10. (iii) The State agency may elect to...; (iii) Changes in residence and the resulting change in shelter costs; (iv) The acquisition of a... recertification. (iii) Failure to file a complete form by the specified filing date. If a household fails to file...

  20. 7 CFR 273.4 - Citizenship and alien status. (United States)


    ... the Indian Self-Determination and Education Assistance Act (25 U.S.C. 450b(e)) which is recognized as... verification. Until the alien provides information or verification necessary to carry out the provisions of... cooperate in providing information or verification, other adult members of the alien's household are...

  1. 31 CFR 27.3 - Assessment of civil penalties. (United States)


    ..., Tobacco and Firearms,” “Bureau of the Public Debt,” “Bureau of Engraving and Printing,” “Comptroller of the Currency,” “Federal Law Enforcement Training Center,” “Financial Crimes Enforcement Network... Engraving and Printing,” “Comptroller of the Currency,” “Director of the Federal Law Enforcement Training...

  2. 47 CFR 27.3 - Other applicable rule parts. (United States)


    ... standards and procedures concerning the marketing and importation of radio frequency devices, and for.... This part sets forth the requirements and conditions applicable to commercial mobile radio service providers. (h) Part 22. This part sets forth the requirements and conditions applicable to public mobile...

  3. Translations on Narcotics and Dangerous Drug No. 273 (United States)


    address Farahnaz Avenue, Mehrabad, age 25; Naser Aarakhani, butcher , age 2k; Mansur Sa’adatbakhsh; Da’ud Amini, age l8; Hoseyn Dastani...a police uniform was not to show off. Also arrested were: Hassan Nezam ’Ali, age 30, a poultry dealer living in Sarcheshmeh, with 3

  4. 14 CFR 171.273 - Maintenance and operations requirements. (United States)


    ... authorized persons. (3) FCC licensing requirements for operations and maintenance personnel. (4) Posting of..., with a maximum corrective maintenance time of not greater than 1.5 hours. This measure applies to... than 1,500 hours. This measure applies to unscheduled outages, out-of-tolerance conditions, and...

  5. 48 CFR 719.273-8 - Developmental assistance. (United States)


    ... relating to— (1) Financial management; (2) Organizational management; (3) Overall business management/planning; (4) Business development; and (5) Technical assistance. (b) Loans; (c) Rent-free use of... DEVELOPMENT SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS The U.S. Agency for International Development...

  6. 7 CFR 273.8 - Resource eligibility standards. (United States)


    ... by the Department of Housing and Urban Development through the individual and family grant program or... any business or corporation under the control, direction, or influence of a household member; and (iv...

  7. 40 CFR 273.81 - Factors for petitions to include other wastes under 40 CFR part 273. (United States)


    ... AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Petitions To Include... generic name to identify the waste category (e.g., batteries), the definition of universal waste in § 260..., and specific management standards proposed or referenced by the petitioner (e.g., waste management...

  8. Mendeleev's principle against Einstein's relativity: news from the chemistry of superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Gaeggeler, Heinz W [Department of Chemistry and Biochemistry, University of Bern, Bern (Switzerland)


    The review briefly considers the problems of synthesis and chemical identification of superheavy elements. The specific features of their properties are determined by the relativistic effects. The synthesis and chemical investigations into bohrium and element 112 are discussed as examples.

  9. Study of the solubility, viscosity and density in Na+, Zn2+/Cl− − H2O, Na+ − Zn2+ − (H2PO2)− − H2O, Na+, Cl−/(H2PO2)− − H2O, and Zn2+, Cl−/(H2PO2)− − H2O ternary systems, and in Na+, Zn2+/Cl−, (H2PO2)−//H2O reciprocal quaternary system at 273.15 K

    International Nuclear Information System (INIS)

    Adiguzel, Vedat; Erge, Hasan; Alisoglu, Vahit; Necefoglu, Hacali


    Highlights: • The physicochemical properties of ternary and one quaternary have been studied. • Reciprocal quaternary systems’ solubility and phase equilibrium have been studied. • In all systems the solid phases have been found. • It was found that Zn(H 2 PO 2 ) 2 salt contains 70% of the general crystallization field. - Abstract: The solubility and the physicochemical properties (density, viscosity) in the Na-Zn- Cl-H 2 O), (Na + Zn + H 2 PO 2 + H 2 O), (Na + Cl + H 2 PO 2 + H 2 O), and (Zn + Cl + H 2 PO 2 + H 2 O) ternaries, and in Na + , Zn 2+ /Cl − , (H 2 PO 2 ) − //H 2 O reciprocal quaternary systems at T = 273.15 K were investigated by using the isothermal method. The diagrams of ternary salts systems, (NaCl + ZnCl 2 + H 2 O), (NaCl + NaH 2 PO 2 + H 2 O), (NaH 2 PO 2 + Zn(H 2 PO 2 ) 2 + H 2 O), (ZnCl 2 + Zn(H 2 PO 2 ) 2 + H 2 O), are plotted in figures 1–4. However, whole ions of reciprocal quaternary salt systems are plotted in figure 5. Additionally, the density and viscosity values of ternary systems vs. their corresponding composition values in weight per cent are plotted in figures 6–10. At the (i) (ZnCl 2 + Zn(H 2 PO 2 ) 2 + H 2 O), (ii) (NaCl + ZnCl 2 + H 2 O), (iii) (NaCl + NaH 2 PO 2 + H 2 O), (iv) (NaH 2 PO 2 + Zn(H 2 PO 2 ) 2 + H 2 O) ternary systems the solid phase compositions have been determined as: (i) Zn(H 2 PO 2 ) 2 ⋅ H 2 O, Zn(H 2 PO 2 ) 2 , ZnCl 2 ⋅ 2H 2 O, (ii) NaCl, 2NaCl ⋅ ZnCl 2 ⋅ 2H 2 O, and ZnCl 2 ⋅ 2H 2 O, (iii) NaCl and NaH 2 PO 2 ⋅ H 2 O, (iv) Zn(H 2 PO 2 ) 2 ⋅ H 2 O and NaH 2 PO 2 ⋅ H 2 O, respectively. On the other hand reciprocal quaternary system was observed as: ZnCl 2 ⋅ 2H 2 O, 2NaCl ⋅ ZnCl 2 ⋅ 2H 2 O, Zn(H 2 PO 2 ) 2 ⋅ H 2 O, NaH 2 PO 2 ⋅ H 2 O, NaCl. According to results, the least soluble salt was Zn(H 2 PO 2 ) 2 . The crystallization field of this salt, being the largest in comparison with those of other salts, occupied 70% of the general crystallization field

  10. 7 CFR 2.73 - Director, Office of Energy Policy and New Uses. (United States)


    ... OF AGRICULTURE AND GENERAL OFFICERS OF THE DEPARTMENT Delegations of Authority by the Chief Economist... following delegations of authority are made by the Chief Economist to the Director, Office of Energy Policy... interagency agreements. (3) Representing the Chief Economist at conferences, meetings, and other contacts...

  11. Progress in Primary Acoustic Thermometry at NIST: 273 K to 505 K (United States)

    Strouse, G. F.; Defibaugh, D. R.; Moldover, M. R.; Ripple, D. C.


    The NIST Acoustic Thermometer determines the thermodynamic temperature by measuring the speed of sound of argon in a spherical cavity. We obtained the thermodynamic temperature of three fixed points on the International Temperature Scale of 1990: the melting point of gallium [T(Ga) = 302.9146 K] and the freezing points of indium [T(In) = 429.7485 K] and tin [T(Sn) = 505.078 K]. The deviations of thermodynamic temperature from the ITS-90 defined temperatures are T - T90 = (4.7 ± 0.6) mK at T(Ga) , T - T90 = (8.8 ± 1.5) mK at T(In) , and T - T90 = (10.7 ± 3.0) mK at T(Sn) , where the uncertainties are for a coverage factor of k = 1. Our results at T(In) and T(Sn) reduce the uncertainty of T - T90 by a factor of two in this range. Both T - T90 at T(Ga) and the measured thermal expansion of the resonator between the triple point of water and T(Ga) are in excellent agreement with the 1992 determination at NIST. The dominant uncertainties in the present data come from frequency-dependent and time-dependent crosstalk between the electroacoustic transducers. We plan to reduce these uncertainties and extend this work to 800 K.

  12. Soft X-ray Variability of the Bright Quasar 3C273

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    on the analysis of the Einstein data, it was argued that the broken power law or power law + black body model is ... power law ( soft) is 2.7 when the photon index ( hard) of the harder power law is fixed at 1.5, and there are small but ..... J. Trümper for the kind hospitality at the Max-Planck-Institut für. Extraterrestrische Physik ...

  13. Physics in a spin. CERN Courier, Apr 1987, v. 27(3)

    Energy Technology Data Exchange (ETDEWEB)



    The biennial international high energy spin physics meetings (Lausanne, 1980; Brookhaven, 1982; Marseille, 1984) provide a useful focus of attention for the enthusiastic community of followers of a sector of physics rarely lacking in interest and where the unexpected is increasingly expected.

  14. 7 CFR 273.24 - Time limit for able-bodied adults. (United States)


    ... unfitness is not obvious, provides a statement from a physician, physician's assistant, nurse, nurse...) of this section, within the 30 days subsequent to application; or (v) Becomes exempt. (2) An...

  15. Delta-function Approximation SSC Model in 3C 273 S. J. Kang1 ...

    Indian Academy of Sciences (India)

    Abstract. We obtain an approximate analytical solution using δ approximate calculation on the traditional one-zone synchrotron self-. Compton (SSC) model. In this model, we describe the electron energy distribution by a broken power-law function with a sharp cut-off, and non- thermal photons are produced by both ...

  16. 7 CFR 273.11 - Action on households with special circumstances. (United States)


    ... existence for less than a year, the income from that self-employment enterprise must be averaged over the...) Comparing the household's resources with the resource eligibility limits. (3) Ineligible alien. The State... containing an ineligible alien as follows: (i) The State agency must count all or, at the discretion of the...

  17. People and things. CERN Courier, Apr 1987, v. 27(3)

    Energy Technology Data Exchange (ETDEWEB)



    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. On Friday February 13, bulldozers began clearing a 200 acre (80 hectare) site at Newport News, Virginia, for the proposed US Continuous Electron Beam Accelerator Facility (CEBAF) to provide high energy electron beams for nuclear physics. The XI International Workshop on Weak Interactions will be held in Santa Fe, New Mexico, from 14- 19 June. Discussion sessions covering current topics in weak interaction physics will allow active participation by workshop attendees. The Division of Particles and Fields of the American Physical Society and the Central Design Group of the proposed US SSC Superconducting Supercollider are organizing a Workshop on Experiments, Detectors and Experimental Areas for the SSC, to be held at Berkeley from 7-17 July. As southern hemisphere astronomers witnessed a gigantic supernova explosion towards the end of February, underground neutrino detectors all over the world picked up bursts of particles.

  18. Soft X-ray Variability of the Bright Quasar 3C273

    Indian Academy of Sciences (India)


    Jan 27, 2016 ... The hardness ratio for hard and soft bands shows irregular variation but there was no correlation between them. There is no distinct variation of the photon index in the case of simple power law model fitting. For power law + free absorption model fitting, the average photon index () is 2.08.

  19. : tous les projets | Page 273 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Sujet: HIV, AIDS, PROPHYLAXIS, VACCINES, VACCINATION, Immunization. Région: North of Sahara, South of Sahara, Benin. Programme: Santé des mères et des enfants. Financement total : CA$ 369,100.00. Mise en place des préalables aux essais randomisés d'interventions préventives du VIH au Bénin. Projet.

  20. People and things. CERN Courier, Apr 1987, v. 27(3)

    International Nuclear Information System (INIS)



    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. On Friday February 13, bulldozers began clearing a 200 acre (80 hectare) site at Newport News, Virginia, for the proposed US Continuous Electron Beam Accelerator Facility (CEBAF) to provide high energy electron beams for nuclear physics. The XI International Workshop on Weak Interactions will be held in Santa Fe, New Mexico, from 14- 19 June. Discussion sessions covering current topics in weak interaction physics will allow active participation by workshop attendees. The Division of Particles and Fields of the American Physical Society and the Central Design Group of the proposed US SSC Superconducting Supercollider are organizing a Workshop on Experiments, Detectors and Experimental Areas for the SSC, to be held at Berkeley from 7-17 July. As southern hemisphere astronomers witnessed a gigantic supernova explosion towards the end of February, underground neutrino detectors all over the world picked up bursts of particles

  1. 7 CFR 273.10 - Determining household eligibility and benefit levels. (United States)


    ... merely because of changes in mailing cycles or pay dates or because weekends or holidays cause additional... for urban, rural I, and rural II Alaska as defined in § 272.7(c). The TFPs for Guam and the Virgin...

  2. On-ground characterization of the Euclid's CCD273-based readout chain (United States)

    Szafraniec, Magdalena; Azzollini, R.; Cropper, M.; Pottinger, S.; Khalil, A.; Hailey, M.; Hu, D.; Plana, C.; Cutts, A.; Hunt, T.; Kohley, R.; Walton, D.; Theobald, C.; Sharples, R.; Schmoll, J.; Ferrando, P.


    Euclid is a medium class European Space Agency mission scheduled for launch in 2020. The goal of the survey is to examine the nature of Dark Matter and Dark Energy in the Universe. One of the cosmological probes used to analyze Euclid's data, the weak lensing technique, measures the distortions of galaxy shapes and this requires very accurate knowledge of the system point spread function (PSF). Therefore, to ensure that the galaxy shape is not affected, the detector chain of the telescope's VISible Instrument (VIS) needs to meet specific performance performance requirements. Each of the 12 VIS readout chains consisting of 3 CCDs, readout electronics (ROE) and a power supply unit (RPSU) will undergo a rigorous on-ground testing to ensure that these requirements are met. This paper reports on the current status of the warm and cold testing of the VIS Engineering Model readout chain. Additionally, an early insight to the commissioning of the Flight Model calibration facility and program is provided.

  3. Antarctica: The Continuing Experiment. Foreign Policy Association Headline Series, No. 273. (United States)

    Quigg, Philip W.

    One of a series of booklets on world issues examines the sharpened differences between those nations that have declared sovereignty over parts of Antarctica and those that have not; between those nations that have arbitrarily assumed responsibility for the administration of Antarctica and the smaller, more numerous nations that believe their…

  4. 33 CFR Appendix E to Part 273 - Preventive Safety Measures in Handling of Herbicides (United States)


    .... Special care is required to prevent contamination of the inside of gloves. 9. Approved respirators must be... holes in top, bottom, and sides of metal containers or crush them so they cannot collect water or be...

  5. SU-E-J-273: Simulation of the Radiation Response of Hypoxic Tumors

    International Nuclear Information System (INIS)

    Espinoza, I; Peschke, P; Karger, C


    Purpose: In radiotherapy, it is important to predict the response of tumour to irradiation prior to the treatment. Mathematical modelling of tumour control probability (TCP) based on the dose distribution, medical imaging and other biological information may help to improve this prediction and to optimize the treatment plan. The aim of this work is to develop an image based 3D multiscale radiobiological model, which describes the growth and the response to radiotherapy of hypoxic tumors. Methods: The computer model is based on voxels, containing tumour, normal (including capillary) and dead cells. Killing of tumour cells due to irradiation is calculated by the Linear Quadratic Model (extended for hypoxia), and the proliferation and resorption of cells are modelled by exponential laws. The initial shape of the tumours is taken from CT images and the initial vascular and cell density information from PET and/or MR images. Including the fractionation regime and the physical dose distribution of the radiation treatment, the model simulates the spatial-temporal evolution of the tumor. Additionally, the dose distribution may be biologically optimized. Results: The model describes the appearance of hypoxia during tumour growth and the reoxygenation processes during radiotherapy. Among other parameters, the TCP is calculated for different dose distributions. The results are in accordance with published results. Conclusion: The simulation model may contribute to the understanding of the influence of biological parameters on tumor response during treatment, and specifically on TCP. It may be used to implement dose-painting approaches. Experimental and clinical validation is needed. This study is supported by a grant from the Ministry of Education of Chile, Programa Mece Educacion Superior (2)

  6. Characteristics of heterojunctions of amorphous LaAlO2.73 on Si

    International Nuclear Information System (INIS)

    Huang Yanhong; Zhao Kun; Lu Huibin; Jin Kuijuan; He Meng; Chen Zhenghao; Zhou Yueliang; Yang Guozhen


    High-quality heterojunctions consisting of n-type amorphous LaAlO 3- δ and p-type Si without Si interfacial layer were prepared using a thin film deposition system normally used for laser-molecular beam epitaxy. Good I-V rectifying property, ferroelectricity of interface enhancement and fast photovoltaic effect have been observed in the LaAlO 3- δ /Si p-n heterojunctions. We expect that the multifunctional properties of rectification, ferroelectricity and photovoltaic effect should open up new possibilities in device development and other applications

  7. BKR 27(3) pp. 123-128 (Lakshmikanth et al)

    African Journals Online (AJOL)

    Femi J. Olorunniji


    Sep 30, 2015 ... An International Journal of the Nigerian Society for Experimental Biology ... Department of Studies in Biochemistry, University of Mysore, Manasagangothri, Mysore – 570 006,. India ... many simple and rapid colorimetric methods of protein .... Samples of 1 and 2 µg of BSA and apparently purified BLP.

  8. SU-E-J-273: Simulation of the Radiation Response of Hypoxic Tumors

    Energy Technology Data Exchange (ETDEWEB)

    Espinoza, I [Pontificia Universidad Catolica de Chile, Santiago (Chile); Peschke, P; Karger, C [German Cancer Research Center (DKFZ), Heidelberg (Germany)


    Purpose: In radiotherapy, it is important to predict the response of tumour to irradiation prior to the treatment. Mathematical modelling of tumour control probability (TCP) based on the dose distribution, medical imaging and other biological information may help to improve this prediction and to optimize the treatment plan. The aim of this work is to develop an image based 3D multiscale radiobiological model, which describes the growth and the response to radiotherapy of hypoxic tumors. Methods: The computer model is based on voxels, containing tumour, normal (including capillary) and dead cells. Killing of tumour cells due to irradiation is calculated by the Linear Quadratic Model (extended for hypoxia), and the proliferation and resorption of cells are modelled by exponential laws. The initial shape of the tumours is taken from CT images and the initial vascular and cell density information from PET and/or MR images. Including the fractionation regime and the physical dose distribution of the radiation treatment, the model simulates the spatial-temporal evolution of the tumor. Additionally, the dose distribution may be biologically optimized. Results: The model describes the appearance of hypoxia during tumour growth and the reoxygenation processes during radiotherapy. Among other parameters, the TCP is calculated for different dose distributions. The results are in accordance with published results. Conclusion: The simulation model may contribute to the understanding of the influence of biological parameters on tumor response during treatment, and specifically on TCP. It may be used to implement dose-painting approaches. Experimental and clinical validation is needed. This study is supported by a grant from the Ministry of Education of Chile, Programa Mece Educacion Superior (2)

  9. 7 CFR 273.23 - Simplified application and standardized benefit projects. (United States)


    ... implementation costs and, on an annual basis, operating costs, administrative costs, error reduction, and benefit... Exchange (SDX) tape. TANF or Medicaid applications may need to be modified, or be subject to an addendum in... historical data on deductions claimed by such households. Such deductions must be updated, as necessary, on...

  10. 273 Etude de la culture en couloirs de manioc (Manihot esculenta ...

    African Journals Online (AJOL)


    La culture en couloirs pourrait constituer une solution intéressante de ..... pourrait s'expliquer par le type de fumure de fond utilisé lors de la mise en place des parcelles ..... performances des variétés améliorées de manioc ont été observées dans ... Organisation des Nations Unies pour l'alimentation et l'agriculture, Bureau ...

  11. 7 CFR 273.21 - Monthly Reporting and Retrospective Budgeting (MRRB). (United States)


    ..., it may omit the oral explanation of MRRB required under paragraph (c)(1). (ii) The State agency shall... understanding that the provided information may result in changes in the level of benefits, including reduction...

  12. VizieR Online Data Catalog: 22GHz image of 3C 273 (Bruni+, 2017) (United States)

    Bruni, G.; Gomez, J. L.; Casadio, C.; Lobanov, A.; Kovalev, Y. Y.; Sokolovsky, K. V.; Lisakov, M. M.; Bach, U.; Marscher, A.; Jorstad, S.; Anderson, J. M.; Krichbaum, T. P.; Savolainen, T.; Vega-Garcia, L.; Fuentes, A.; Zensus, J. A.; Alberdi, A.; Lee, S.-S.; Lu, R.-S.; Perez-Torres, M.; Ros, E.


    A global ground array of 22 antennas was used to perform observations, including VLBA (Sc, Hn, Nl, Fd, La, Kp, Pt, Ov, Br, Mk), EVN (Hh, Mc, Nt, Tr, Jb, Ef, Ys), Long Baseline Array (-LBA- At, Mp, Ho, Cd), and two Kvazar antennas (Sv, Zc), plus Kalyazin (managed by ASC, Russia), and Green Bank (NRAO, USA). The observations took place on January 18-19, 2014, for a total of 16.8 hours, and at three different frequencies: 15GHz, 22GHz, and 43GHz. RA was involved only for the 22GHz part, while for the other bands only the VLBA was used. Both the Green Bank and Pushchino tracking station took part in the experiment. A RA-compatible total bandwidth of 32MHz, split into two 16-MHz IFs, was used. RA was scheduled to observe three consecutive 9.5 minute scans every 1.25 hours, to allow for antenna cooling. (2 data files).

  13. Automatic Parallelization of Scientific Application

    DEFF Research Database (Denmark)

    Blum, Troels

    performance gains. Scientists working with computer simulations should be allowed to focus on their field of research and not spend excessive amounts of time learning exotic programming models and languages. We have with Bohrium achieved very promising results by starting out with a relatively simple approach...

  14. Srinivasan Natarajan

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Srinivasan Natarajan. Articles written in Resonance – Journal of Science Education. Volume 5 Issue 5 May 2000 pp 95-100 Research News. Bohrium - A New Element in the Periodic Table · Srinivasan Natarajan · More Details Fulltext PDF ...

  15. A simple formulation for thermodynamic properties of steam from 273 to 523 K, explicit in temperature and pressure

    Czech Academy of Sciences Publication Activity Database

    Pátek, Jaroslav; Klomfar, Jaroslav


    Roč. 32, č. 5 (2009), s. 1123-1125 ISSN 0140-7007 Institutional research plan: CEZ:AV0Z20760514 Keywords : absorption system * vapour * water * water-lithium bromide Subject RIV: BJ - Thermodynamics Impact factor: 1.537, year: 2009

  16. 75 FR 54880 - Eddie Floyd, Licensee of FM Translator Station K273AF, Carson City, NV, Facility ID No. 13529... (United States)


    ... relating to money laundering and his apparent failure to inform the Commission about such misconduct in the...), involving money laundering, and one count of violating 18 U.S.C. 2, aiding and abetting a felony crime, both... the company in exchange for $27,500. The court found these payments constituted money laundering by...

  17. SU-E-J-273: Skin Temperature Recovery Rate as a Potential Predictor for Radiation-Induced Skin Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Biswal, N C; Wu, Z; Chu, J [Rush University Medical Center, Chicago, IL (United States); Sun, J [Argonne National Laboratory, Lemont, IL (United States)


    Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy.

  18. SU-E-J-273: Skin Temperature Recovery Rate as a Potential Predictor for Radiation-Induced Skin Reactions

    International Nuclear Information System (INIS)

    Biswal, N C; Wu, Z; Chu, J; Sun, J


    Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy

  19. Battling memory requirements of array programming through streaming

    DEFF Research Database (Denmark)

    Kristensen, Mads Ruben Burgdorff; Avery, James Emil; Blum, Troels


    A barrier to efficient array programming, for example in Python/NumPy, is that algorithms written as pure array operations completely without loops, while most efficient on small input, can lead to explosions in memory use. The present paper presents a solution to this problem using array streaming......, implemented in the automatic parallelization high-performance framework Bohrium. This makes it possible to use array programming in Python/NumPy code directly, even when the apparent memory requirement exceeds the machine capacity, since the automatic streaming eliminates the temporary memory overhead...... by performing calculations in per-thread registers. Using Bohrium, we automatically fuse, JIT-compile, and execute NumPy array operations on GPGPUs without modification to the user programs. We present performance evaluations of three benchmarks, all of which show dramatic reductions in memory use from...

  20. Multibeam collection for TN273: Multibeam data collected aboard Thomas G. Thompson from 2011-12-22 to 2012-01-22, Apra, Guam to Apra, Guam (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  1. Emissions Inventory Report Summary: Reporting Requirements for the New Mexico Administrative Code, Title 20, Chapter 2, Part 73 (20 NMAC 2.73) for Calendar Year 2001

    International Nuclear Information System (INIS)

    Margorie Stockton


    Los Alamos National Laboratory is subject to annual emissions-reporting requirements for regulated air contaminants under Title 20 of the New Mexico Administrative Code, Chapter 2, Part 73 (20.2.73 NMAC), Notice of Intent and Emissions Inventory Requirements. The applicability of the requirements is based on the Laboratory's potential to emit 100 tons per year of suspended particulate matter, nitrogen oxides, carbon monoxide, sulfur oxides, or volatile organic compounds. For calendar year 2001, the Technical Area 3 steam plant was the primary source of criteria air pollutants from the Laboratory, while research and development activities were the primary source of volatile organic compounds. Emissions of beryllium and aluminum were reported for activities permitted under 20.2.72 NMAC. Hazardous air pollutant emissions from chemical use for research and development activities were also reported

  2. SU-F-T-273: Using a Diode Array to Explore the Weakness of TPS DoseCalculation Algorithm for VMAT and Sliding Window Techniques

    Energy Technology Data Exchange (ETDEWEB)

    Park, J; Lu, B; Yan, G; Park, J; Li, F; Li, J; Liu, C [University of Florida, Gainesville, FL (United States)


    Purpose: To identify the weakness of dose calculation algorithm in a treatment planning system for volumetric modulated arc therapy (VMAT) and sliding window (SW) techniques using a two-dimensional diode array. Methods: The VMAT quality assurance(QA) was implemented with a diode array using multiple partial arcs that divided from a VMAT plan; each partial arc has the same segments and the original monitor units. Arc angles were less than ± 30°. Multiple arcs delivered through consecutive and repetitive gantry operating clockwise and counterclockwise. The source-toaxis distance setup with the effective depths of 10 and 20 cm were used for a diode array. To figure out dose errors caused in delivery of VMAT fields, the numerous fields having the same segments with the VMAT field irradiated using different delivery techniques of static and step-and-shoot. The dose distributions of the SW technique were evaluated by creating split fields having fine moving steps of multi-leaf collimator leaves. Calculated doses using the adaptive convolution algorithm were analyzed with measured ones with distance-to-agreement and dose difference of 3 mm and 3%.. Results: While the beam delivery through static and step-and-shoot techniques showed the passing rate of 97 ± 2%, partial arc delivery of the VMAT fields brought out passing rate of 85%. However, when leaf motion was restricted less than 4.6 mm/°, passing rate was improved up to 95 ± 2%. Similar passing rate were obtained for both 10 and 20 cm effective depth setup. The calculated doses using the SW technique showed the dose difference over 7% at the final arrival point of moving leaves. Conclusion: Error components in dynamic delivery of modulated beams were distinguished by using the suggested QA method. This partial arc method can be used for routine VMAT QA. Improved SW calculation algorithm is required to provide accurate estimated doses.

  3. A computationally effective formulation of the thermodynamic properties of LiBr-H2O solutions from 273 to 500 K over full composition range

    Czech Academy of Sciences Publication Activity Database

    Pátek, Jaroslav; Klomfar, Jaroslav


    Roč. 29, č. 4 (2006), s. 566-578 ISSN 0140-7007 Institutional research plan: CEZ:AV0Z20760514 Keywords : water-lithium bromide * aqueous solution * thermodynamic properties Subject RIV: BJ - Thermodynamics Impact factor: 0.936, year: 2006

  4. SU-E-T-273: Radiation Shielding for a Fixed Horizontal-Beam Linac in a Shipping Container and a Conventional Treatment Vault

    International Nuclear Information System (INIS)

    Hsieh, M; Balter, P; Beadle, B; Chi, P; Stingo, F; Court, L


    Purpose: A fixed horizontal-beam linac, where the patient is treated in a seated position, could lower the overall costs of the treatment unit and room shielding substantially. This design also allows the treatment room and control area to be contained within a reduced space, such as a shipping container. The main application is the introduction of low-cost, high-quality radiation therapy to low- and middle-income regions. Here we consider shielding for upright treatments with a fixed-6MV-beam linac in a shipping container and a conventional treatment vault. Methods: Shielding calculations were done for two treatment room layouts using calculation methods in NCRP Report 151: (1) a shipping container (6m × 2.4m with the remaining space occupied by the console area), and (2) the treatment vault in NCRP 151 (7.8m by 5.4m by 3.4m). The shipping container has a fixed gantry that points in one direction at all times. For the treatment vault, various beam directions were evaluated. Results: The shipping container requires a primary barrier of 168cm concrete (4.5 TVL), surrounded by a secondary barrier of 3.6 TVL. The other walls require between 2.8–3.3 TVL. Multiple shielding calculations were done along the side wall. The results show that patient scatter increases in the forward direction and decreases dramatically in the backward direction. Leakage scatter also varies along the wall, depending largely on the distance between the gantry and the wall. For the treatment room, fixed-beam requires a slightly thicker primary barrier than the conventional linac (0.6 TVL), although this barrier is only needed in the center of one wall. The secondary barrier is different only by 0–0.2 TVL. Conclusion: This work shows that (1) the shipping container option is achievable, using indigenous materials for shielding and (2) upright treatments can be performed in a conventional treatment room with minimal additional shielding. Varian Medical Systems

  5. SU-E-T-273: Radiation Shielding for a Fixed Horizontal-Beam Linac in a Shipping Container and a Conventional Treatment Vault

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, M; Balter, P; Beadle, B; Chi, P; Stingo, F; Court, L [The University of Texas MD Anderson Cancer Center, Houston, TX (United States)


    Purpose: A fixed horizontal-beam linac, where the patient is treated in a seated position, could lower the overall costs of the treatment unit and room shielding substantially. This design also allows the treatment room and control area to be contained within a reduced space, such as a shipping container. The main application is the introduction of low-cost, high-quality radiation therapy to low- and middle-income regions. Here we consider shielding for upright treatments with a fixed-6MV-beam linac in a shipping container and a conventional treatment vault. Methods: Shielding calculations were done for two treatment room layouts using calculation methods in NCRP Report 151: (1) a shipping container (6m × 2.4m with the remaining space occupied by the console area), and (2) the treatment vault in NCRP 151 (7.8m by 5.4m by 3.4m). The shipping container has a fixed gantry that points in one direction at all times. For the treatment vault, various beam directions were evaluated. Results: The shipping container requires a primary barrier of 168cm concrete (4.5 TVL), surrounded by a secondary barrier of 3.6 TVL. The other walls require between 2.8–3.3 TVL. Multiple shielding calculations were done along the side wall. The results show that patient scatter increases in the forward direction and decreases dramatically in the backward direction. Leakage scatter also varies along the wall, depending largely on the distance between the gantry and the wall. For the treatment room, fixed-beam requires a slightly thicker primary barrier than the conventional linac (0.6 TVL), although this barrier is only needed in the center of one wall. The secondary barrier is different only by 0–0.2 TVL. Conclusion: This work shows that (1) the shipping container option is achievable, using indigenous materials for shielding and (2) upright treatments can be performed in a conventional treatment room with minimal additional shielding. Varian Medical Systems.

  6. James A. Mangan, Patricia Vertinsky, éd., Gender, Sport, Science. Selected Writings of Roberta J. Park, Londres, Routledge, 2009, 273 p.

    Directory of Open Access Journals (Sweden)

    Grégory Quin


    Full Text Available En France, l’éducation physique féminine et les réflexions sur l’éducation physique en termes de « genre » souffrent encore d’une assez large méconnaissance. L’outil d’analyse « genre » est à la fois peu employé et méconnu dans ses usages concrets réalisés notamment dans l’espace anglo-saxon. Les historiens, les psycho-sociologues ou même les sociologues - spécialisés ou non sur les thématiques des sports ou d’éducation physique - ont longtemps ignoré ces questions, et ce n’est que depuis une...

  7. Effects of using the simplified airway risk index vs usual airway assessment on unanticipated difficult tracheal intubation - a cluster randomized trial with 64,273 participants

    DEFF Research Database (Denmark)

    Nørskov, A K; Wetterslev, J; Rosenstock, C V


    departments vs 1.00% (302) in Non-SARI departments. Adjusted OR was 1.26 (0.68-2.34). CONCLUSIONS: Using the SARI compared with usual airway assessment we detected no statistical significant changes in unanticipated difficult- or easy intubations. CLINICAL TRIAL REGISTRATION: NCT01718561.......BACKGROUND: Unanticipated difficult intubation remains a challenge in anaesthesia. The Simplified Airway Risk Index (SARI) is a multivariable risk model consisting of seven independent risk factors for difficult intubation. Our aim was to compare preoperative airway assessment based on the SARI...

  8. Combining high productivity with high performance on commodity hardware

    DEFF Research Database (Denmark)

    Skovhede, Kenneth

    -like compiler for translating CIL bytecode on the CELL-BE. I then introduce a bytecode converter that transforms simple loops in Java bytecode to GPGPU capable code. I then introduce the numeric library for the Common Intermediate Language, NumCIL. I can then utilizing the vector programming model from Num......CIL and map this to the Bohrium framework. The result is a complete system that gives the user a choice of high-level languages with no explicit parallelism, yet seamlessly performs efficient execution on a number of hardware setups....

  9. Paul Scherrer Institute Scientific Report 1999. Volume I: Particles and Matter

    International Nuclear Information System (INIS)

    Gobrecht, J.; Gaeggeler, H.; Herlach, D.; Junker, K.; Kettle, P.-R.; Kubik, P.; Zehnder, A.


    Although originally planned for fundamental research in nuclear physics, the particle beams of pions, muons, protons and neutrons are now used in a large variety of disciplines in both natural science and medicine. The beams at PSI have the world's highest intensities and therefore allow certain experiments to be performed, which would not be possible elsewhere. The highlight of research this year was the first-ever determination of the chemical properties of the superheavy element 107 Bohrium. This was undertaken, by an international team led by H. Gaeggeler of PSI's Laboratory for Radiochemistry. Bohrium was produced by bombarding a Berkelium target with Neon ions from the Injector I cyclotron and six atoms were detected after having passed through an online gas chromatography device. At the Laboratory for Particle Physics the focus has shifted from nuclear physics to elementary particle physics with about a fifty-fifty split between investigations of rare processes or particle decays using the high intensity muon, pion and recently also polarized neutron beams of PSI, and research at the highest energy frontier at CERN (Geneva) and DESY (Hamburg). Important space instrumentation has been contributed by the Laboratory for Astrophysics to the European Space Agency and NASA satellite programmes. The Laboratory for Micro and Nanotechnology continued to focus on research into molecular nanotechnology and SiGeC nanostructures, the latter with the aim of producing silicon based optoelectronics. Progress in 1999 in these topical areas is described in this report. A list of scientific publications in 1999 is also provided

  10. Paul Scherrer Institute Scientific Report 1999. Volume I: Particles and Matter

    Energy Technology Data Exchange (ETDEWEB)

    Gobrecht, J; Gaeggeler, H; Herlach, D; Junker, K; Kettle, P -R; Kubik, P; Zehnder, A [eds.


    lthough originally planned for fundamental research in nuclear physics, the particle beams of pions, muons, protons and neutrons are now used in a large variety of disciplines in both natural science and medicine. The beams at PSI have the world's highest intensities and therefore allow certain experiments to be performed, which would not be possible elsewhere. The highlight of research this year was the first-ever determination of the chemical properties of the superheavy element {sup 107} Bohrium. This was undertaken, by an international team led by H. Gaeggeler of PSI's Laboratory for Radiochemistry. Bohrium was produced by bombarding a Berkelium target with Neon ions from the Injector I cyclotron and six atoms were detected after having passed through an online gas chromatography device. At the Laboratory for Particle Physics the focus has shifted from nuclear physics to elementary particle physics with about a fifty-fifty split between investigations of rare processes or particle decays using the high intensity muon, pion and recently also polarized neutron beams of PSI, and research at the highest energy frontier at CERN (Geneva) and DESY (Hamburg). Important space instrumentation has been contributed by the Laboratory for Astrophysics to the European Space Agency and NASA satellite programmes. The Laboratory for Micro and Nanotechnology continued to focus on research into molecular nanotechnology and SiGeC nanostructures, the latter with the aim of producing silicon based optoelectronics. Progress in 1999 in these topical areas is described in this report. A list of scientific publications in 1999 is also provided.

  11. 273. Remodelado de la pared de la aorta torácica después de la reparación de disección de aorta con la trompa de elefante congelada

    Directory of Open Access Journals (Sweden)

    C.A. Mestres


    Conclusión: La TEC promueve el remodelado aórtico con estabilización de LV, reducción de LF y aumento de relación LV/LF. Hay tendencia, sin llegar a la significación estadística, al año postoperatorio probablemente por el tamaño de la muestra. La TEC podría reducir la necesidad de intervenciones tardías para tratar la FL residual.

  12. Corrigendum to “Sorption/desorption of non-hydrophobic and ionisable pharmaceutical and personal care products from reclaimed water onto/from a natural sediment” Sci Total Environ 472 (2014) 273–281

    Energy Technology Data Exchange (ETDEWEB)

    Martínez-Hernández, Virtudes, E-mail: [IMDEA Agua, Madrid Institute for Advanced Studies in Water, Parque Científico Tecnológico de la Universidad de Alcalá, 28805 Alcalá de Henares, Madrid (Spain); Meffe, Raffaella; Herrera, Sonia [IMDEA Agua, Madrid Institute for Advanced Studies in Water, Parque Científico Tecnológico de la Universidad de Alcalá, 28805 Alcalá de Henares, Madrid (Spain); Arranz, Elena [University of Alcalá, Geography and Geology Department, 28871 Alcalá de Henares, Madrid (Spain); Bustamante, Irene de [IMDEA Agua, Madrid Institute for Advanced Studies in Water, Parque Científico Tecnológico de la Universidad de Alcalá, 28805 Alcalá de Henares, Madrid (Spain); University of Alcalá, Geography and Geology Department, 28871 Alcalá de Henares, Madrid (Spain)


    In the present work, the sorption of pharmaceutical and personal care products (PPCPs) (acetaminophen, atenolol, carbamazepine, caffeine, naproxen and sulphamethoxazole) onto the natural organic matter (NOM) and the inorganic surfaces of a natural sandy loam sediment was quantified separately. The quantification was based on the PPCP charge, their degree of ionisation, their octanol-water partitioning coefficient (K{sub OW}) and the sediment organic carbon fraction (ƒ{sub OC}). PPCP desorption from the sediment was examined under conditions of infiltrating water containing a high concentration of inorganic ions (mimicking infiltrating reclaimed water), and a low concentration (and smaller diversity) of inorganic ions (mimicking rainwater infiltration). Batch tests were performed using a sediment/water ratio of 1:4 and a PPCP initial concentration ranging from 1 to 100 μg L{sup −1}. The results showed the type and degree of PPCP ionisation to strongly influence the sorption of these compounds onto the sediment. The sorption of cationic species onto the sediment was higher than that of anionic species and mostly reversible; the sorption of neutral species was negligible with the exception of caffeine. The anionic species sorbed less onto the sediment, but also desorbed less easily. Most of the compounds showed a sorption that was highly influenced by interaction with mineral surfaces. The presence of inorganic ions had no impact on the desorption of the PPCPs from the sediment. According to the calculated percentages of removal, the mobility followed the order: carbamazepine > acetaminophen > naproxen > atenolol > sulphamethoxazole > caffeine.

  13. Corrigendum to “Sorption/desorption of non-hydrophobic and ionisable pharmaceutical and personal care products from reclaimed water onto/from a natural sediment” Sci Total Environ 472 (2014) 273–281

    International Nuclear Information System (INIS)

    Martínez-Hernández, Virtudes; Meffe, Raffaella; Herrera, Sonia; Arranz, Elena; Bustamante, Irene de


    In the present work, the sorption of pharmaceutical and personal care products (PPCPs) (acetaminophen, atenolol, carbamazepine, caffeine, naproxen and sulphamethoxazole) onto the natural organic matter (NOM) and the inorganic surfaces of a natural sandy loam sediment was quantified separately. The quantification was based on the PPCP charge, their degree of ionisation, their octanol-water partitioning coefficient (K OW ) and the sediment organic carbon fraction (ƒ OC ). PPCP desorption from the sediment was examined under conditions of infiltrating water containing a high concentration of inorganic ions (mimicking infiltrating reclaimed water), and a low concentration (and smaller diversity) of inorganic ions (mimicking rainwater infiltration). Batch tests were performed using a sediment/water ratio of 1:4 and a PPCP initial concentration ranging from 1 to 100 μg L −1 . The results showed the type and degree of PPCP ionisation to strongly influence the sorption of these compounds onto the sediment. The sorption of cationic species onto the sediment was higher than that of anionic species and mostly reversible; the sorption of neutral species was negligible with the exception of caffeine. The anionic species sorbed less onto the sediment, but also desorbed less easily. Most of the compounds showed a sorption that was highly influenced by interaction with mineral surfaces. The presence of inorganic ions had no impact on the desorption of the PPCPs from the sediment. According to the calculated percentages of removal, the mobility followed the order: carbamazepine > acetaminophen > naproxen > atenolol > sulphamethoxazole > caffeine

  14. 48 CFR 812.301 - Solicitation provisions and contract clauses for the acquisition of commercial items. (United States)


    ....216-70, Estimated quantities. (15) 852.228-71, Indemnification and insurance. (16) 852.229-70, Sales...) 852.273-71, Alternative negotiation techniques. (3) 852.273-72, Alternative evaluation. (4) 852.273-73...

  15. Paul Scherrer Institute Scientific Report 1999. Volume I: Particles and Matter

    Energy Technology Data Exchange (ETDEWEB)

    Gobrecht, J.; Gaeggeler, H.; Herlach, D.; Junker, K.; Kettle, P.-R.; Kubik, P.; Zehnder, A. [eds.


    lthough originally planned for fundamental research in nuclear physics, the particle beams of pions, muons, protons and neutrons are now used in a large variety of disciplines in both natural science and medicine. The beams at PSI have the world's highest intensities and therefore allow certain experiments to be performed, which would not be possible elsewhere. The highlight of research this year was the first-ever determination of the chemical properties of the superheavy element {sup 107} Bohrium. This was undertaken, by an international team led by H. Gaeggeler of PSI's Laboratory for Radiochemistry. Bohrium was produced by bombarding a Berkelium target with Neon ions from the Injector I cyclotron and six atoms were detected after having passed through an online gas chromatography device. At the Laboratory for Particle Physics the focus has shifted from nuclear physics to elementary particle physics with about a fifty-fifty split between investigations of rare processes or particle decays using the high intensity muon, pion and recently also polarized neutron beams of PSI, and research at the highest energy frontier at CERN (Geneva) and DESY (Hamburg). Important space instrumentation has been contributed by the Laboratory for Astrophysics to the European Space Agency and NASA satellite programmes. The Laboratory for Micro and Nanotechnology continued to focus on research into molecular nanotechnology and SiGeC nanostructures, the latter with the aim of producing silicon based optoelectronics. Progress in 1999 in these topical areas is described in this report. A list of scientific publications in 1999 is also provided.

  16. Subsequent bilateral comparison to CCT-K3, CIPM key comparison CCT-K3.1: Comparison of standard platinum resistance thermometers at the triple point of water (T = 273.16 K) and at the melting point of gallium (T = 302.9146 K) (United States)

    Picard, S.; Nonis, M.; Solve, S.; Allisy-Roberts, P. J.; Renaot, E.; Martin, C.


    A comparison of standard platinum resistance thermometers (SPRTs) has been carried out between the BIPM and the Laboratoire commun de métrologie LNE-CNAM using the melting point of gallium and the triple point of water. The temperature difference at Ga between the BIPM and the LNE-CNAM was determined as 108 µK with an associated combined standard uncertainty of 223 µK. This outcome indicates a present temperature difference of the BIPM of -65 µK with respect to an Average Reference Value from an earlier comparison, with an associated uncertainty of uc = 262 µK. It should be noted that the present BIPM scale is not independent, but traceable to cells used in KC7. The comparison results validate the re-establishment of thermometer calibrations at the BIPM for internal use. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database The final report has been peer-reviewed and approved for publication by the CCT, according to the provisions of the CIPM Mutual Recognition Arrangement (MRA).

  17. Report on the behalf of the Commission for finances, general economy and budgetary control on the finance bill project for 2018 (nr 235). Appendix Nr 18 - Ecology, sustainable development and mobility: energy, climate and after-mines, public service for energy, financing the support to communities for rural electrification, energy transition - Nr 273

    International Nuclear Information System (INIS)

    Giraud, Joel; Aubert, Julien


    After some general statements and recommendations regarding public policy issues expressed within the mission for Ecology, Sustainable Development and Mobility, and more particularly on some specific budgetary allocations related to the public policy for energy and its specific programmes, this report presents some key budget-related data. It outlines and discusses how the budget for 2018 commits the French energy policy in an ecological and supportive transition, and then states some critics about the bill project readability. It comments the adequacy between the budgetary effort and ambitions of the energy policy, notably by commenting the financing increase or decrease of some specific programmes. In the next part, the author focuses on the way to find a new momentum for nuclear energy in France. In this respect, he discusses known benefits of nuclear power, increasing risks which threaten the sector (ageing reactors, EPR construction delays, unresolved issue of management for some nuclear wastes, AREVA dismantling and EDF's fragile financial situation). He also discusses conditions to be met to find out sustainable solution to this crisis as the application of the energy transition trajectory will require a decrease of the number of operated nuclear reactors, ways to open perspectives by keeping on supporting research and by adopting a dynamic exporting approach, and the importance of a maintained attention in terms of nuclear safety. The report of Commission debates and hearing is provided

  18. Immunogenicity and safety of a novel MMR vaccine (live, freeze-dried) containing the Edmonston-Zagreb measles strain, the Hoshino mumps strain, and the RA 27/3 rubella strain: Results of a randomized, comparative, active controlled phase III clinical trial. (United States)

    Sood, Ashwani; Mitra, Monjori; Joshi, Himanshu Arvind; Nayak, Uma Siddhartha; Siddaiah, Prashanth; Babu, T Ramesh; Mahapatro, Samarendra; Sanmukhani, Jayesh; Gupta, Gaurav; Mittal, Ravindra; Glueck, Reinhard


    This phase III clinical trial was conducted to evaluate the immunogenicity and safety of the single-dose and multi-dose formulations of a novel MMR vaccine (live, freeze-dried) developed by M/s Cadila Healthcare Limited, India (Cadila MMR vaccine), containing the Hoshino mumps strain, compared to that of an existing MMR vaccine (live, freeze-dried) developed by M/s Serum Institute of India Limited, India (Serum MMR vaccine). These two vaccines have similar measles and rubella strains, but different mumps strains (Hoshino in Cadila MMR vaccine, and L-Zagreb in Serum MMR vaccine). Three hundred and twenty-eight subjects of either sex, aged 15-18 months, were randomized in a 2:1 ratio to receive either the Cadila or Serum MMR vaccine. Immunogenicity assessments (IgG antibodies against measles, mumps, and rubella viruses) were done at baseline and 42 d after vaccination. Solicited (local and systemic) and unsolicited adverse events were recorded for up to 42 d following vaccination. The Cadila MMR vaccine was found to be non-inferior to the Serum MMR vaccine in terms of end-of-study proportion of subjects seropositive for anti-measles antibodies (100.0% in both groups), anti-mumps antibodies (94.5% vs. 94.0%), and anti-rubella antibodies (95.5% vs. 91.0%). Both vaccines were well tolerated by all study participants; the most common adverse event reported in both groups was fever, followed by rash. The results of this phase III clinical trial show that the novel Cadila MMR vaccine is non-inferior to the Serum MMR vaccine.

  19. Birds of a Feather Flock Together: The Congruence of Personality Types within Librarians’ Subject Specialties. A Review of: Williamson, J.M., A.E. Pemberton, and J.W. Lounsbury. “Personality Traits of Individuals in Different Specialties of Librarianship.” Journal of Documentation 64.2 (2008: 273-86.

    Directory of Open Access Journals (Sweden)

    John Loy


    Full Text Available Objectives – To investigate the personality traits of a range of librarians and information professionals using the Personal Style Inventory (PSI, and to investigate whether the personality traits of those in person-orientated library specialties differ from those in technique-orientated specialties.Design – Self-selecting survey.Setting – Solicitations to complete the survey were sent out via 10 e-mail discussion lists, and paper copies were made available at the annual American Library Association conference in 2002.Subjects – 2,075 librarians and information science professionals.Methods – Participants completed the survey either in print format, as an e-mail attachment or a Web form. The survey format was an adaptation of the PSI scale using 13 of the accepted 16 scales, namely: adaptabilityassertivenessautonomyconscientiousnesscustomer service orientation emotional resilienceextraversionopennessoptimismteamworktough-mindednessvisionary-operational work stylework driveResponses were analysed using a two-step cluster analysis technique, and participants were grouped into seven clusters.Main Results – The largest group of respondents was cataloguers at 23.7%, followed by other (health or law 19.1%,academic reference librarians 13.2%, special librarians 12.3% with all other groups in single figures. Respondents were divided up into the following seven clusters. • Cluster 1, the “unadaptive” group -- so labelled because several unadaptive traits such as low emotional resilience, low optimism, low teamwork, and low work drive are included.• Cluster 2, “adaptive academic reference librarians” -- high on customer service orientation, extraversion and teamwork, and low on tough-mindedness.• Cluster 3, “adaptive cataloguers” -- low on customer service orientation and possessing a more operational work style.• Cluster 4, “adaptive special librarians” -- high on autonomy, customer service orientation and extraversion.• Cluster 5, “adaptive distance education librarians, public librarians, records managers, and school librarians” -- possessing a visionary work style and scoring high on adaptability, assertiveness,customer service orientation, emotional resilience, high extraversion, openness, optimism, and teamwork; scoring low on tough-mindedness.• Cluster 6, “adaptive other information professionals” -- also possessing a visionary work style and with high scores on adaptability, assertiveness, autonomy, customer service orientation, emotional resilience, extraversion, openness, optimism, teamwork, and work drive.• Cluster 7, “adaptive archivists and systems librarians” scoring high on assertiveness, openness, and toughmindedness.Most clusters were comprised of a single occupational group, with only Clusters 1 and 5 made up of individuals from more than one group.Conclusion – The results indicate that different librarianship subspecialties can be differentiated by personality traits, and that individuals are likely to be drawn to either person-orientated or technique-orientated library specialties depending on their personality traits.

  20. Quaderni di filologia e lingue romanze 7 (1992, Supplemento Terza serie, Attidel Convegno "Relazione di viaggi fra Italia e Spagna" Macerata, Università degli Studi, 15-17 dicembre 1992, 259 pp.; 8(1993, 273 pp.; 9(1994, 285 pp.; 10(1995, 346 pp.

    Directory of Open Access Journals (Sweden)

    Pavao Tekavčić


    Full Text Available Il periodico maceratese, nato nel 1979, continua ad apparire a ritmo annuale re­ golare. Avendo recensito i voll. 1985-1992 nel numero 34 di «Linguistica», presen­ tiamo qui le annate citate nel titolo, concentrandoci sempre sui contributi di interesse linguistico (o almeno filologico, che continuano ad essere in minoranza di fronte a quelli di argomento letterario.

  1. The gas phase oxide and oxyhydroxide chemistry of trace amounts of rhenium

    International Nuclear Information System (INIS)

    Eichler, R.; Eichler, B.; Jost, D.T.; Dressler, R.; Tuerler, A.; Gaeggeler, H.W.


    In preparation of experiments to investigate the chemical properties of bohrium (Bh, element 107) the behaviour of Re, its lighter homologue in group 7, was studied in different oxidizing chemical systems. The adsorption data of Re oxide and oxyhydroxide compounds on quartz surfaces were evaluated from results of thermochromatography experiments and confirmed in isothermal gas chromatography experiments applying 1 cm as standard state for the simple gas adsorption process: X(g) ↔ X(ads) (X = ReO 3 , HReO 4 ) ΔH ads (ReO 3 ) = -190 ± 10 kJ/mol; ΔS ads (ReO 3 ) = -179±30 J/mol K; ΔH ads (HReO 4 ) = -77 ± 5 kJ/mol; ΔS ads (HReO 4 ) = -187±50 J/mol K. An on-line separation method for oxides and oxyhydroxides of short lived Re isotopes using isothermal high temperature gas-solid adsorption chromatography was developed. Separation yields and times of group 7 elements from lanthanides (model for actinides), polonium and bismuth were determined using the model isotopes 169,170,174,176 Re, 152-155 Er, 151-154 Ho, 218 Po, and 214 Bi. An updated correlation function between the microscopic adsorption enthalpy and the macroscopic sublimation enthalpy was calculated from the experimental adsorption data of this work and literature data. (orig.)

  2. Road dust and its effect on human health: a literature review (United States)


    The purpose of this study was to determine the effects of road dust on human health. A PubMed search was used to extract references that included the words “road dust” and “health” or “fugitive dust” and “health” in the title or abstract. A total of 46 references were extracted and selected for review after the primary screening of 949 articles. The respiratory system was found to be the most affected system in the human body. Lead, platinum-group elements (platinum, rhodium, and bohrium), aluminum, zinc, vanadium, and polycyclic aromatic hydrocarbons were the components of road dust that were most frequently referenced in the articles reviewed. Road dust was found to have harmful effects on the human body, especially on the respiratory system. To determine the complex mechanism of action of various components of road dust on the human body and the results thereof, the authors recommend a further meta-analysis and extensive risk-assessment research into the health impacts of dust exposure. PMID:29642653

  3. Chemistry of superheavy elements

    International Nuclear Information System (INIS)

    Schaedel, M.


    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  4. Pediatric Residents and Interns in an Italian Hospital Perform Improved Bibliographic. A Review of: Gardois, P., Calabrese, R., Colombi, N., Lingua, C., Longo, F., Villanacci, M., Miniero, R., & Piga, A. (2011. Effectiveness of bibliographic searches performed by paediatric residents and interns assisted by librarian. A randomised controlled trial. Health Information and Libraries Journal, 28(4, 273-284. doi: 10.1111/j.1471-1842.2011.00957.x

    Directory of Open Access Journals (Sweden)

    Mathew Stone


    Full Text Available Objective – To establish whether the assistance of an experienced biomedical librarian delivers an improvement in the searching of bibliographic databases as performed by medical residents and interns.Design – Randomized controlled trial.Setting – The pediatrics department of a large Italian teaching hospital.Subjects – 18 pediatric residents and interns.Methods – 23 residents and interns from the pediatrics department of a large Italian teaching hospital were invited to participate inthis study, of which 18 agreed. Subjects were then randomized into two groups and asked to spend between 30 and 90 minutes searching bibliographic databases for evidence to answer a real-life clinical question which was randomly allocated to them. Each member ofthe intervention group was provided with an experienced biomedical librarian to provide assistance throughout the search session. The control group received no assistance. The outcome of the search was then measured using an assessment tool adapted for the purpose of this study from the Fresno test of competence in evidence based medicine. This adapted assessment tool rated the “global success” of the search and included criteria such as appropriate question formulation, number of PICO terms translated into search terms, use of Boolean logic, use of subject headings, use of filters, use of limits, and the percentage of citations retrieved that matched a gold standard set of citations found in a prior search by two librarians (who were not involved in assisting the subjects together with an expert clinician. Main Results – The intervention group scored a median average of 73.6 points out of a possible 100, compared with the control group which scored 50.4. The difference of 23.2 points in favour of the librarian assisted group was a statistically significant result (p value = 0.013 with a 95% confidence interval of between 4.8 and 33.2.Conclusion – This study presents credible evidence that assistance provided by an experienced biomedical librarian improves the quality of the bibliographic database searches performed by residents and interns using real-life clinical scenarios.

  5. ORF Alignment: NC_006155 [GENIUS II[Archive

    Lifescience Database Archive (English)


  6. ORF Alignment: NC_006370 [GENIUS II[Archive

    Lifescience Database Archive (English)


  7. ORF Alignment: NC_000913 [GENIUS II[Archive

    Lifescience Database Archive (English)


  8. ORF Alignment: NC_003198 [GENIUS II[Archive

    Lifescience Database Archive (English)


  9. ORF Alignment: NC_005810 [GENIUS II[Archive

    Lifescience Database Archive (English)


  10. ORF Alignment: NC_004547 [GENIUS II[Archive

    Lifescience Database Archive (English)


  11. ORF Alignment: NC_004603 [GENIUS II[Archive

    Lifescience Database Archive (English)


  12. ORF Alignment: NC_004347 [GENIUS II[Archive

    Lifescience Database Archive (English)


  13. ORF Alignment: NC_005126 [GENIUS II[Archive

    Lifescience Database Archive (English)


  14. ORF Alignment: NC_004337 [GENIUS II[Archive

    Lifescience Database Archive (English)


  15. ORF Alignment: NC_006905 [GENIUS II[Archive

    Lifescience Database Archive (English)


  16. ORF Alignment: NC_002695 [GENIUS II[Archive

    Lifescience Database Archive (English)


  17. ORF Alignment: NC_003143 [GENIUS II[Archive

    Lifescience Database Archive (English)


  18. ORF Alignment: NC_004088 [GENIUS II[Archive

    Lifescience Database Archive (English)


  19. ORF Alignment: NC_006511 [GENIUS II[Archive

    Lifescience Database Archive (English)


  20. ORF Alignment: NC_006512 [GENIUS II[Archive

    Lifescience Database Archive (English)


  1. ORF Alignment: NC_006840 [GENIUS II[Archive

    Lifescience Database Archive (English)


  2. ORF Alignment: NC_004431 [GENIUS II[Archive

    Lifescience Database Archive (English)


  3. ORF Alignment: NC_004741 [GENIUS II[Archive

    Lifescience Database Archive (English)


  4. 76 FR 80930 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Comment... (United States)


    ... Wastes include certain batteries, pesticides, mercury- containing lamps and thermostats. The Part 273... prevention and cleanup of releases to the environment during storage and transit. EPA believes these...

  5. ORF Alignment: NC_003888 [GENIUS II[Archive

    Lifescience Database Archive (English)


  6. Properties of Group Five and Group Seven transactinium elements

    Energy Technology Data Exchange (ETDEWEB)

    Wilk, Philip A. [Univ. of California, Berkeley, CA (United States)


    The detection and positive identification of the short-lived, low cross section isotopes used in the chemical studies of the heaviest elements are usually accomplished by measuring their alpha-decay, thus the nuclear properties of the heaviest elements must be examined simultaneously with their chemical properties. The isotopes 224 Pa and 266,267 Bh have been studied extensively as an integral part of the investigation of the heaviest members of the groups five and seven of the periodic table. The half-life of 224 Pa was determined to be 855 ±19 ms by measuring its alpha-decay using our rotating wheel, solid state detector system at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron. Protactinium was produced by bombardment of a bismuth target. New neutron rich isotopes, 267 Bh and 266 Bh, were produced in bombardments of a 249 Bk target and their decay was observed using the rotating wheel system. The 266 Bh that was produced decays with a half-life of approximately 1 s by emission of alpha particles with an average energy of 9.25 plus/minus 0.03 MeV. 267 Bh was observed to decay with a 17 s half-life by emission of alpha-particles with an average energy of 8.83 plus/minus 0.03 MeV. The chemical behavior of hafnium, Ha (element 105) was investigated using the fast on-line continuous liquid extraction and detection system SISAK-LISSY. Hafnium was not observed in this experiment following transport and extraction. Protactinium was used as on-line test of the apparatus to determine the experimental efficiency of the entire system. Unfortunately, the amount of protactinium observed after the extraction, compared to the amount produced, was extremely small, only 2.5%. The extraction of the protactinium isotope indicated the efficiency of the apparatus was too low to observe the extraction of hafnium. The chemical behavior of oxychloride compounds of bohrium was

  7. Properties of Group Five and Group Seven transactinium elements

    International Nuclear Information System (INIS)

    Wilk, Philip A.


    The detection and positive identification of the short-lived, low cross section isotopes used in the chemical studies of the heaviest elements are usually accomplished by measuring their alpha-decay, thus the nuclear properties of the heaviest elements must be examined simultaneously with their chemical properties. The isotopes 224 Pa and 266,267 Bh have been studied extensively as an integral part of the investigation of the heaviest members of the groups five and seven of the periodic table. The half-life of 224 Pa was determined to be 855 plus/minus19 ms by measuring its alpha-decay using our rotating wheel, solid state detector system at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron. Protactinium was produced by bombardment of a bismuth target. New neutron rich isotopes, 267 Bh and 266 Bh, were produced in bombardments of a 249 Bk target and their decay was observed using the rotating wheel system. The 266 Bh that was produced decays with a half-life of approximately 1 s by emission of alpha particles with an average energy of 9.25 plus/minus 0.03 MeV. 267 Bh was observed to decay with a 17 s half-life by emission of alpha-particles with an average energy of 8.83 plus/minus 0.03 MeV. The chemical behavior of hafnium, Ha (element 105) was investigated using the fast on-line continuous liquid extraction and detection system SISAK-LISSY. Hafnium was not observed in this experiment following transport and extraction. Protactinium was used as on-line test of the apparatus to determine the experimental efficiency of the entire system. Unfortunately, the amount of protactinium observed after the extraction, compared to the amount produced, was extremely small, only 2.5%. The extraction of the protactinium isotope indicated the efficiency of the apparatus was too low to observe the extraction of hafnium. The chemical behavior of oxychloride compounds of bohrium was investigated by isothermal gas adsorption chromatography in a quartz column at 180, 150

  8. NCBI nr-aa BLAST: CBRC-PHAM-01-0930 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-0930 ref|YP_264072.1| competence protein, ComEC [Psychrobacter arcticu...s 273-4] gb|AAZ18638.1| possible competence protein, ComEC [Psychrobacter arcticus 273-4] YP_264072.1 2.8 24% ...

  9. NCBI nr-aa BLAST: CBRC-PABE-13-0007 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PABE-13-0007 ref|YP_264072.1| possible competence protein, ComEC [Psychrobacte...r arcticus 273-4] gb|AAZ18638.1| possible competence protein, ComEC [Psychrobacter arcticus 273-4] YP_264072.1 2.2 24% ...

  10. L-Glutamic acid production by Bacillus spp. isolated from vegetable ...

    African Journals Online (AJOL)

    Ogiri” (fermented vegetable proteins) in Nigeria. The isolates were identified as Bacillus subtilis (6), (27.3%), Bacillus pumilus (5), (22.7%), Bacillus licheniformis (5), (27.3%) and Bacillus polymyxa (6), (22.7%). Four species of the Bacillus isolates ...

  11. Flight activity and habitat preference of bats in a karstic area, as revealed by bat detectors

    Czech Academy of Sciences Publication Activity Database

    Zukal, Jan; Řehák, Z.


    Roč. 55, č. 3 (2006), s. 273-281 ISSN 0139-7893 Institutional research plan: CEZ:AV0Z60930519 Keywords : Moravian Karst * echolocation calls * bat community * detectoring Subject RIV: EG - Zoology Impact factor: 0.529, year: 2006

  12. Are You Thinking about Suicide? How to Stay Safe and Find Treatment (United States)

    ... number — in the United States, call the National Suicide Prevention Lifeline at 800-273-TALK (800-273-8255) ... Accessed April 30, 2015. McDowell AK, et al. ...

  13. Chemical and biological evaluation of Sm-153 and Ho-166 complexes with tetraethylester of DOTP ( DOTPOEt )

    Czech Academy of Sciences Publication Activity Database

    Forsterová, Michaela; Margues, M. M.; Jandurová, Z.; Gano, L.; Hermann, P.; Melichar, František


    Roč. 50, č. 1 (2007), s. 273-273 ISSN 0362-4803 R&D Projects: GA AV ČR 1QS100480501 Institutional research plan: CEZ:AV0Z10480505 Keywords : Phosphonate Complexes Subject RIV: FR - Pharmacology ; Medidal Chemistry

  14. 76 FR 59927 - Treatment of Aliens Whose Employment Creation Immigrant (EB-5) Petitions Were Approved After... (United States)


    ...-0029] RIN 1615-AA90 Treatment of Aliens Whose Employment Creation Immigrant (EB-5) Petitions Were... qualifying aliens whose employment-creation immigrant petitions were approved by the former Immigration and...-273 Provisions C. Summary of the Adjudications Required by Public Law 107-273 III. Aliens Eligible To...

  15. Vaginal Yeast Infections (United States)

    ... Tract . Clinical Microbiology Reviews; 23(2): 253–273. Ferris, D.G., Nyirjesy, P., Sobel, J.D., Soper, ... Tract . Clinical Microbiology Reviews; 23(2): 253–273. Ferris, D.G., Nyirjesy, P., Sobel, J.D., Soper, ...

  16. The importance and measurement of new production

    Digital Repository Service at National Institute of Oceanography (India)

    Platt, T.; Jauhari, P.; Sathyendranath, S.

    stream_size 12 stream_content_type text/plain stream_name Primary_Prod_Biogeochem_Cycle_Sea_1992_273.pdf.txt stream_source_info Primary_Prod_Biogeochem_Cycle_Sea_1992_273.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  17. Spectral Variability in Hard X-rays and the Evidence for a 13.5 Years ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    fit in the X-ray and gamma ray energy bands points to a common origin of these photons and the ... relativistic jets in relation to BL Lac objects in general, and 3C273 in particular has ..... emission must also explain the long term period of ∼ 5000 days in 3C273 as discussed above. .... data available on public archives.

  18. Too large or too small? Returns to scale in a retail network

    Czech Academy of Sciences Publication Activity Database

    Brázdik, František; Druska, V.

    -, č. 273 (2005), s. 1-45 ISSN 1211-3298 Institutional research plan: CEZ:AV0Z70850503 Keywords : data envelopment analysis application * linear programming * retail units Subject RIV: AH - Economics

  19. Rozdíly v klinickém obraze a laboratorních nálezech v časné fázi aseptického zánětu CNS dle vyvolávajícího agens

    Czech Academy of Sciences Publication Activity Database

    Heinige, P.; Fajt, M.; Šilhánková, I.; Halašková, P.; Jiroušová, M.; Matějčková, Eva; Ješina, Pavel


    Roč. 61, č. 5 (2006), s. 273-273 ISSN 0069-2328. [Český pediatrický kongres s mezinárodní účastí /7./. 08.06.2006-11.06.2006, Praha] Keywords : CNS * aseptic inflammation Subject RIV: FG - Pediatrics

  20. Measurement of Aerosol Optical Properties by Integrating Cavity Ring-Down Spectroscopy and Nephelometry (United States)


    Getachew Tedela North Carolina A&T State University 1601 East Market Street Greensboro, NC 27411 -3209 REPORT DOCUMENTATION PAGE b. ABSTRACT UU c. THIS...2.1013 3.273 )( P TSTPgasKgasK  (18) Where, the standard temperature and pressure ( STP ) are 273.2 k and 1013.2 mb

  1. New elements - approaching Z=114

    International Nuclear Information System (INIS)

    Hofmann, S.


    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small α-, β- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross-sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical super heavy elements (SHE) could be achieved by fusion reactions using 208 Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. (orig.)

  2. MicroSISAK for the chemistry of the heaviest elements

    International Nuclear Information System (INIS)

    Hild, Daniel


    This thesis describes experiments with an apparatus called MicroSISAK which is able to perform liquid-liquid-extraction on a microliter-scale. Two immiscible liquids are mixed in a microstructured mixer unit and separated again via a Teflon membrane. In the first experiments, different extraction systems were explored for elements of the groups 4 and 7 of the periodic table. Their results were compared with those from batch experiments. The initial achieved extraction yields were insufficient for the envisaged experiments, for which reason different modifications were arranged to obtain improvements. With the aid of a heating element, which was connected to the MicroSISAK apparatus, one was able to rise the temperature for the extraction inside. This led to the expected increasing of the extraction yield. Furthermore the MikroSISAK apparatus was modified by the Institut fuer Mikrotechnik Mainz, which had developed and constructed this apparatus. The contact time of the two phases between the mixer and the separation unit was extended. This also led to an increased yield. Now the performance appeared to be sufficient to connect the apparatus to the TRIGAreactor Mainz to perform online-experiments. Fission products (technetium) produced in a nuclear reaction were guided to the MicroSISAK apparatus to separate them and to detect their decay in a γ-ray detector. Apart from the successful separations, the experiments also proved the functionality of a new degasser system and that an adequate detection system can be coupled to MicroSISAK. With this, the prerequisites for the vision of an application of MicroSISAK are realised: The investigation of the chemical properties of short-lived superheavy elements (SHE) at a heavy-ion accelerator. It is obvious to plan such an experiment for the heavy homolog of technetium, element 107, bohrium.

  3. Characterization of the diatomite binding domain in the ribosomal protein L2 from E. coli and functions as an affinity tag. (United States)

    Li, Junhua; Zhang, Yang; Yang, Yanjun


    The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.

  4. Synthesis, characterization, mucoadhesion and biocompatibility of thiolated carboxymethyl dextran-cysteine conjugate. (United States)

    Shahnaz, G; Perera, G; Sakloetsakun, D; Rahmat, D; Bernkop-Schnürch, A


    This study was aimed at improving the mucoadhesive properties of carboxymethyl dextran by the covalent attachment of cysteine. Mediated by a carbodiimide, l-cysteine was covalently attached to the polymer. The resulting CMD-cysteine conjugate (CMD-(273) conjugate) displayed 273+/-20 micromol thiol groups per gram of polymer (mean+/-S.D.; n=3). Within 2h the viscosity of an aqueous mucus/CMD-(273) conjugate mixture pH 7.4 increased at 37 degrees C by more than 85% compared to a mucus/carboxymethyl dextran mixture indicating enlarged interactions between the mucus and the thiolated polymer. Due to the immobilization of cysteine, the swelling velocity of the polymer was significantly accelerated (ppolymer disintegrated within 15 min, whereas tablets of the CMD-(273) conjugate remained stable for 160 min (means+/-S.D.; n=3). Results from LDH and MTT assays on Caco-2 cells revealed 4.96+/-0.98% cytotoxicity and 94.1+/-0.9% cell viability for the CMD-(273) conjugate, respectively. Controlled release of model compound from CMD-(273) conjugate tablets was observed over 6h. These findings suggest that CMD-(273) conjugate is a promising novel polymer for drug delivery systems providing improved mucoadhesive and cohesive properties, greater stability and biocompatibility. Copyright 2010 Elsevier B.V. All rights reserved.

  5. L’art. 27 ultimo capoverso del Concordato lateranense e la sua applicazione al Santuario della B. Vergine delle Grazie in Brescia

    Directory of Open Access Journals (Sweden)

    Maria Vismara Missiroli


    Full Text Available SOMMARIO: 1. Problemi interpretativi dell’art. 27.3 del Concordato Lateranense - 2. L'Istruzione della Congregazione del Concilio del 1930. - 3. La qualificazione di una chiesa come Santuario - 4. Requisiti per l’applicazione ai santuari dell’art. 27.3 - 4.1. Amministrazione civile - 4.2. Personalità giuridica - 5. La questione dei santuari di proprietà di persone fisiche o giuridiche - 6. Il Santuario della Beata Vergine delle Grazie di Brescia. Brevi cenni storici - 7. L’applicazione dell’art. 27.3 del Concordato lateranense al Santuario di S. Maria delle Grazie - 8. Conclusione.

  6. Fulltext PDF

    Indian Academy of Sciences (India)


    Variants in many genes have been found to be associated with CVD in ... involvement of multiple genes with variable effects from one family/population to another, limited .... The authors screened 6,273 individuals belonging to 107 ethnic.

  7. assessment of traffic flow on enugu highways using speed density

    African Journals Online (AJOL)


    Corresponding author, tel: +234 – 806 – 435 – 0200 ... construction, maintenance and optimization of the highways using the ...... Research Part A: Policy and Practice 29(4), 273-281. 1995. ... relationships: Quality and Theory of Traffic Flow.

  8. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... and the Brain" (18.9 MB) Close Video Help Problems viewing videos in pop up windows? See ... DC 20420 Last updated April 16, 2018 Get help from Veterans Crisis Line Call 1-800-273- ...

  9. African Zoology - Vol 11, No 2 (1976)

    African Journals Online (AJOL)

    Patterns in the Distribution of Southern African Terrestrial Tortoises (Cryptodira: Testudinidae) · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. John Comrie Greig, Peter D. Burdett, 251-273 ...

  10. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 273 ... ... testicular ectopia: a case report and review of the literature, Abstract PDF ... breast in an infant successfully managed with intralesional bleomycin: a .... Vol 11, No 2 (2015), Giant juvenile xanthogranuloma of the tongue ...

  11. 75 FR 25890 - Self-Regulatory Organizations; Notice of Filing and Immediate Effectiveness of Proposed Rule... (United States)


    ... MNKD MannKind Corp... 255 TM Toyota Motor Corp. 171 MDVN Medivation Inc.. 257 HK Petrohawk Energy Corp... Kinross Gold Corp. 213 MRVL Marvell 273 EP El Paso Corp. Technology Group Ltd. 215 XLP Consumer Staples...

  12. 75 FR 26301 - Self-Regulatory Organizations; BATS Exchange, Inc.; Notice of Filing and Immediate Effectiveness... (United States)


    ... SYMC Symantec Corp. 162 TIVO TiVo Inc 253 AMED Amedisys Inc. 163 MNKD MannKind Corp 255 TM Toyota Motor... Marvell Technology Group 273 EP El Paso Corp. Ltd. 215 XLP Consumer Staples Select 274 SEED Origin...

  13. 75 FR 26299 - Self-Regulatory Organizations; Notice of Filing and Immediate Effectiveness of Proposed Rule... (United States)


    ... AMED Amedisys Inc. 255 TM Toyota Motor Corp. 257 HK Petrohawk Energy Corp. 258 ENER Energy Conversion... Kinross Gold Corp. 273 EP El Paso Corp. 274 SEED Origin Agritech Ltd. 275 WIN Windstream Corp. 279 DHI DR...

  14. 75 FR 25895 - Self-Regulatory Organizations; Notice of Filing and Immediate Effectiveness of a Proposed Rule... (United States)


    ... Symantec Corp. 162 TIVO TiVo Inc 253 AMED Amedisys Inc. 163 MNKD MannKind Corp 255 TM Toyota Motor Corp... Marvell Technology Group 273 EP El Paso Corp. Ltd. 215 XLP Consumer Staples Select 274 SEED Origin...

  15. 75 FR 26312 - Self-Regulatory Organizations; NYSE Amex LLC; Notice of Filing and Immediate Effectiveness of... (United States)


    ... MannKind Corp. 255 TM Toyota Motor Corp. 171 MDVN Medivation Inc. 257 HK Petrohawk Energy Corp. 176... Gold Corp. 213 MRVL Marvell Technology 273 EP El Paso Corp. Group Ltd. 215 XLP Consumer Staples 274...

  16. The importance of being subtle: small changes in calcium homeostasis control cognitive decline in normal aging

    Czech Academy of Sciences Publication Activity Database

    Toescu, E.C.; Verkhratsky, Alexei


    Roč. 6, - (2007), s. 267-273 ISSN 1474-9718 Institutional research plan: CEZ:AV0Z50390512 Keywords : Aging * Ca homeostasis * Cognitive decline Subject RIV: FH - Neurology Impact factor: 5.854, year: 2007

  17. Abelovu cenu za matematiku získal v roce 2014 Jakov G. Sinaj

    Czech Academy of Sciences Publication Activity Database

    Křížek, Michal


    Roč. 59, č. 4 (2014), s. 265-273 ISSN 0032-2423 Institutional support: RVO:67985840 Keywords : billiards * entropy * binary sequences Subject RIV: BA - General Mathematics


    African Journals Online (AJOL)



    Apr 25, 2012 ... Unions and University Management in Nigeria. (Pp. 266-273) .... There is the need for an effective monitoring of the fund allocated to the sector. ... communication flow that may lead to difference in perceptions. Alibi (1999) ...

  19. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... Performance VA Plans, Budget, & Performance VA Center for Innovation (VACI) Agency Financial Report (AFR) Budget Submission Recovery ... Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required ...

  20. Light shines through the spindrift – Phylogeny of African torrent frogs (Amphibia, Anura, Petropedetidae)

    Czech Academy of Sciences Publication Activity Database

    Barej, M. F.; Rödel, M.-O.; Loader, S. P.; Menegon, M.; Gonwouo, N.L.; Penner, J.; Gvoždík, Václav; Günther, R.; Bell, R. C.; Nagel, B.; Schmitz, A.


    Roč. 71, č. 2 (2014), s. 261-273 ISSN 1055-7903 Institutional support: RVO:68081766 Keywords : Africa * Amphibians * Taxonomy * Arthroleptides * Petropedetes * Odontobatrachus gen. nov Subject RIV: EG - Zoology Impact factor: 3.916, year: 2014


    African Journals Online (AJOL)


    COUNTERFEIT CURRENCY IDENTIFICATION SYSTEM - A CASE STUDY ON. ETHIOPIAN BIRR NOTE .... for measuring the similarity measure between two images. ... DESIGN OF CCIS. Hence, two .... Applications, p.273-278, 1994.

  2. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... Us: Also see: VA Mental Health Connect with us return to top CONNECT Veterans Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required ...

  3. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... Plans, Budget, & Performance VA Center for Innovation (VACI) Agency Financial Report (AFR) Budget Submission Recovery Act Resources ... Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required ...

  4. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... PTSD Coach Online Tools to help you manage stress. Search Pilots Search PILOTS *, the largest citation database ... Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required ...

  5. Politicising curriculum implementation: The case of primary schools

    African Journals Online (AJOL)

    Department of Educational Leadership and Management, University of South Africa, Pretoria, South Africa ... primary school educators; South Africa; teacher unions ...... Science and Technology Education, 16(3):273–. 288.

  6. Characteristics of high- and low-risk individuals in the PRIORITY study

    DEFF Research Database (Denmark)

    Tofte, N; Lindhardt, M; Adamova, K


    variable. In a logistic regression model including clinical variables known to be associated with diabetic kidney disease, estimated GFR, gender, log urinary albumin:creatinine ratio and use of renin-angiotensin system-blocking agents remained significant determinants of the CKD273 high-risk group: area......AIM: To compare clinical baseline data in individuals with Type 2 diabetes and normoalbuminuria, who are at high or low risk of diabetic kidney disease based on the urinary proteomics classifier CKD273. METHODS: We conducted a prospective, randomized, double-blind, placebo-controlled international...... multicentre clinical trial and observational study in participants with Type 2 diabetes and normoalbuminuria, stratified into high- or low-risk groups based on CKD273 score. Clinical baseline data for the whole cohort and stratified by risk groups are reported. The associations between CKD273 and traditional...

  7. The immunomodulatory gene products of myxoma virus

    Indian Academy of Sciences (India)


    273. Keywords. Gene products; myxoma virus; Oryctolagus cuniculus; poxvirus; skin lesions ...... these data is that these viral proteins do not promote class .... Cudmore S, Reckmann I and Way M 1997 Viral manipulations of the actin ...

  8. sheltered creeks in Niger Delta, Nigeria

    African Journals Online (AJOL)



    Mar 18, 2015 ... 273 and 115,000 barrels, respectively, making the delta. *Corresponding author. .... content was transferred to savillex digestion bombs and concen- trated hydrochloric ... metals (Zn, Pb and Cu) by flame atomic absorption.

  9. Mental Health Concerns: Veterans & Active Duty (United States)

    ... dialing 1-800-273-8255 and pressing 1. Mental Health Concerns There are three primary mental health concerns ... care or call 911. How Will Asking for Mental Health Treatment Affect My Career? Military personnel have always ...

  10. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... Website Site Map Content Inventory Accessibility Privacy and Security Updating of Web Site Web Site Policies Important ... Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required ...

  11. an analysis of yam storage strategy to promote food security in asa

    African Journals Online (AJOL)



    Oct 17, 2012 ... plant materials (27.3%) were the common storage strategy used which are not capable of ensuring good storage for ... faced in marketing yam produce. .... characteristics. Frequency. Percentage. Gender. Male. Female. 80. 30.

  12. Letter to the Editor


    Thomas K. Karikari


    This article is a reaction to a previously published article in the Journal of Microbiology & Biology Education, “Gamification of the Laboratory Experience to Encourage Student Engagement” by Kevin Drace (JMBE 14(2):273–274, 2013).

  13. Vom work Book Journal 2011, 2010 4th Edition PDF

    African Journals Online (AJOL)


    affecting human and animal health (Arshad et al., 2006 ... were restreaked on EMB or sheep blood agar .... Ph D. 273. Ahmed et al, Studies of E. coli Isolates from Diarrhoeic lamb 271 - 274 .... In: AMS 5350 Large Animal Digestive System.

  14. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... 800-273-8255 (Press 1) Text to 838255 Chat confidentially now If you are in crisis or having thoughts of suicide, visit for more resources. Close this modal

  15. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... Awareness About the Website Site Map Content Inventory Accessibility Privacy and Security Updating of Web Site Web ... Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required ...

  16. Prevalence and risk factors for stillbirths in a tertiary hospital in Niger ...

    African Journals Online (AJOL)

    work is properly cited. Prevalence and risk ... women. There were 309(53.1%) male stillbirths and 273(46.9%) female stillbirths. Male foetuses ... Key words: Stillbirth, miscarriage, perinatal mortality, anaemia in pregnancy, obstructed labour ...

  17. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... List of All Measures Treatment Treatment Overview Early Intervention Veterans Cultural Considerations Women Children Older Adults Working ... Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required ...

  18. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 273 ... Vol 5, No 1 (2010), In vivo antitrypanosomal evaluation of some medicinal plant ... and polycyclic aromatic hydrocarbons (PAHs) compositional profile and ... Vol 10, No 3 (2015), An excel template for processing examination ...

  19. Financial Management: Existence of U.S. Army Corps of Engineers Buildings and Other Structures

    National Research Council Canada - National Science Library

    Granetto, Paul J; Pusey, Ryan W; Ventimiglia, Crmelo G; Zeh, William H; Bryant, Leon D; King, Calvin O; Kntor, Scott C; Kasseler, Trisha L


    ...) cost and the associated accumulated depreciation of the assets. As of September 30, 2003, USACE had about 40,000 structures located at about 1,273 field sites in the continental United States, Alaska, and Hawaii.

  20. Mysids (Crustacea) from the salt pans of Mumbai, India, with a description of a new species

    Digital Repository Service at National Institute of Oceanography (India)

    Biju, A.; Panampunnayil, S.U.

    on Marine Science, University of Tokyo 256–273. Quintero C, de Roa EZ. 1973. Notas bioecologicas sobre Metamysidopsis insularis Brattegard (Crusatacea-Mysidacea) en una laguna litoral de Venezuela. Acta Biologica Venezuelica 8: 245-278. Ramamoorthy K...

  1. Analysis of geodetic surveying on the margin of subsidence depression

    Czech Academy of Sciences Publication Activity Database

    Doležalová, Hana; Müller, Karel; Bláha, P.

    -, č. 273 (2006), s. 103-112 ISSN 0372-9508 Institutional research plan: CEZ:AV0Z30860518 Keywords : subsidence depression * levelling * height changes Subject RIV: DE - Earth Magnetism, Geodesy, Geography

  2. V roce 2013 získal Abelovu cenu Pierre Deligne za fundamentální práce svazující algebru a geometrii

    Czech Academy of Sciences Publication Activity Database

    Křížek, Michal; Markl, Martin; Somer, L.


    Roč. 58, č. 4 (2013), s. 265-273 ISSN 0032-2423 Institutional support: RVO:67985840 Keywords : Abel prize * algebra and geomtery Subject RIV: BA - General Mathematics

  3. Direct electrochemistry of hemoglobin entrapped in dextran film on ...

    Indian Academy of Sciences (India)


    28. Li et al used single- walled carbon nanotube (SWCNT) and 1-hexyl-3- ... Electrochemistry of dextran/hemoglobin/carbon ionic liquid electrode. 273. 2.4 Procedures ..... used for the construction of H2O2 biosensor. Acknowledgement.

  4. South African Journal of Animal Science - Vol 34, No 4 (2004)

    African Journals Online (AJOL)

    A genetic analysis of epistaxis as associated with EIPH in the Southern African Thoroughbred · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. H Weideman, SJ Schoeman, GF Jordaan, 265-273 ...

  5. 77 FR 21578 - Agency Information Collection Activities: Guam-CNMI Visa Waiver Agreement (United States)


    ... fine, pursuant to section 273 of the Immigration and Nationality Act (INA) (8 U.S.C. 1323), for...: . Current Actions: CBP proposes to extend the expiration...

  6. Kontroling jakości zarzadzania bezpieczeństwem pracy realizowany metoda audytu stanowiskowego

    Czech Academy of Sciences Publication Activity Database

    Doležalová, Hana; Doležal, M.; Mikoláš, M.; Kondras, I.; Korban, Z.

    -, č. 273 (2006), s. 95-102 ISSN 0372-9508 Institutional research plan: CEZ:AV0Z30860518 Keywords : work safety * controlling * post audit method Subject RIV: AQ - Safety, Health Protection, Human - Machine

  7. Screening of systemic fungicides and biochemicals against seed ...

    African Journals Online (AJOL)



    Jul 18, 2011 ... Aspergillus flavus showed highest percentage that is, 27.3% followed by Rhizopus stolonifer 17.98%,. Alternaria .... characteristics were cultured on PDA medium. ..... Fungi of Rice (Oryzae sativa L) Variety Faro 15 In Vitro.

  8. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... Crisis Line: 1-800-273-8255 (Press 1) Social Media Complete Directory EMAIL UPDATES Email Address Required Button to subscribe to email VA HOME Notices Privacy FOIA Regulations Web Policies No FEAR Act Whistleblower ...

  9. Human Rights and Internal Security in Malaysia: Rhetoric and Reality (United States)


    government is to integrate the population. According to Lauder and Mansor, population integration is seen as a sine qua non for nation building.273 Also, as...273 Kathleen Lauder and Norma Mansor, “Effective States and Engaged Societies: Capacity Development for Growth, Source Delivery...There are several reasons. People are not willing to lose what they have (property, money and good employment, for example). They are not willing

  10. Stability and Rheology of Dilute TiO2 – Water Nanofluids

    Czech Academy of Sciences Publication Activity Database

    Pěnkavová, Věra; Tihon, Jaroslav; Wein, Ondřej


    Roč. 6, č. 1 (2011), s. 273 ISSN 1931-7573 R&D Projects: GA ČR GA104/08/0428; GA ČR GA104/09/0972 Institutional research plan: CEZ:AV0Z40720504 Keywords : nanofluids * zeta potential * aws viscometry Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.726, year: 2011

  11. Mercury removal from natural gas and associated condensates

    Energy Technology Data Exchange (ETDEWEB)

    Hennico, A.; Barthel, Y.; Courty, P. (Institut Francais du Petrole, 31 - Rueil-Malmaison (France). Direction Industrielle)


    IFP mercury trapping systems are based on CMG 273, the recently developed Procatalyse product which is the heart of IFP's gas phase and liquid phase mercury removal technology. This material, made of highly macroporous alumina supporting a metal sulfide, presents a very high reactivity towards mecury within a broad range of operating conditions, including those operating in the liquid phase. Characteristics of CMG 273 are presented. (orig.).

  12. Acute, reproductive toxicity and two-generation teratology studies of a standardized quassinoid-rich extract of Eurycoma longifolia Jack in Sprague-Dawley rats. (United States)

    Low, Bin-Seng; Das, Prashanta Kumar; Chan, Kit-Lam


    The roots of Eurycoma longifolia Jack are popularly sought as herbal medicinal supplements to improve libido and general health amongst the local ethnic population. The major quassinoids of E. longifolia improved spermatogenesis and fertility but toxicity studies have not been well documented. The reproductive toxicity, two generation of foetus teratology and the up-and-down acute toxicity were investigated in Sprague-Dawley rats orally treated with quassinoid-rich E. longifolia extract (TAF273). The results showed that the median lethal dose (LD50 ) of TAF273 for female and male rats was 1293 and >2000 mg/kg, respectively. Fertility index and litter size of the TAF273 treated were significantly increased when compared with those of the non-treated animals. The TAF273-treated dams decreased in percentage of pre-implantation loss, post-implantation loss and late resorption. No toxic symptoms were observed on the TAF273-treated pregnant female rats and their foetuses were normal. The no-observed adverse effect level (NOAEL) obtained from reproductive toxicity and teratology studies of TAF273 in rats was 100 mg/kg body weight/day, being more than 10-fold lower than the LD50 value. Thus, any human dose derived from converting the rat doses of 100 mg/kg and below may be considered as safe for further clinical studies. Copyright © 2013 John Wiley & Sons, Ltd.

  13. Dynamics Determine Signaling in a Multicomponent System Associated with Rheumatoid Arthritis. (United States)

    Lindgren, Cecilia; Tyagi, Mohit; Viljanen, Johan; Toms, Johannes; Ge, Changrong; Zhang, Naru; Holmdahl, Rikard; Kihlberg, Jan; Linusson, Anna


    Strategies that target multiple components are usually required for treatment of diseases originating from complex biological systems. The multicomponent system consisting of the DR4 major histocompatibility complex type II molecule, the glycopeptide CII259-273 from type II collagen, and a T-cell receptor is associated with development of rheumatoid arthritis (RA). We introduced non-native amino acids and amide bond isosteres into CII259-273 and investigated the effect on binding to DR4 and the subsequent T-cell response. Molecular dynamics simulations revealed that complexes between DR4 and derivatives of CII259-273 were highly dynamic. Signaling in the overall multicomponent system was found to depend on formation of an appropriate number of dynamic intramolecular hydrogen bonds between DR4 and CII259-273, together with the positioning of the galactose moiety of CII259-273 in the DR4 binding groove. Interestingly, the system tolerated modifications at several positions in CII259-273, indicating opportunities to use analogues to increase our understanding of how rheumatoid arthritis develops and for evaluation as vaccines to treat RA.

  14. Odd-Z Transactinide Compound Nucleus Reactions Including the Discovery of 260Bh

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, Sarah L. [Univ. of California, Berkeley, CA (United States)


    Several reactions producing odd-Z transactinide compound nuclei were studiedwith the 88-Inch Cyclotron and the Berkeley Gas-Filled Separator at the Lawrence Berkeley National Laboratory. The goal was to produce the same compound nucleus ator near the same excitation energy with similar values of angular momentum via differentnuclear reactions. In doing so, it can be determined if there is a preference in entrancechannel, because under these experimental conditions the survival portion of Swiatecki, Siwek-Wilcznska, and Wilczynski's"Fusion By Diffusion" model is nearly identical forthe two reactions. Additionally, because the same compound nucleus is produced, theexit channel is the same. Four compound nuclei were examined in this study: 258Db, 262Bh, 266Mt, and 272Rg. These nuclei were produced by using very similar heavy-ion induced-fusion reactions which differ only by one proton in the projectile or target nucleus (e.g.: 50Ti + 209Bi vs. 51V + 208Pb). Peak 1n exit channel cross sections were determined for each reaction in each pair, and three of the four pairs' cross sections were identical within statistical uncertainties. This indicates there is not an obvious preference of entrancechannel in these paired reactions. Charge equilibration immediately prior to fusionleading to a decreased fusion barrier is the likely cause of this phenomenon. In addition to this systematic study, the lightest isotope of element 107, bohrium, was discovered in the 209Bi(52Cr,n) reaction. 260Bh was found to decay by emission of a 10.16 MeV alpha particle with a half-life of 35$+19\\atop{-9}$ ms. The cross section is 59 pb at an excitation energy of 15.0 MeV. The effect of the N = 152 shell is also seen in this isotope's alpha particle energy, the first evidence of such an effect in Bh. All reactions studied are also compared to model predictions by Swiatecki

  15. Odd-Z Transactinide Compound Nucleus Reactions Including the Discovery of 260Bh

    International Nuclear Information System (INIS)

    Nelson, Sarah L; Nelson, Sarah L


    Several reactions producing odd-Z transactinide compound nuclei were studied with the 88-Inch Cyclotron and the Berkeley Gas-Filled Separator at the Lawrence Berkeley National Laboratory. The goal was to produce the same compound nucleus at or near the same excitation energy with similar values of angular momentum via different nuclear reactions. In doing so, it can be determined if there is a preference in entrance channel, because under these experimental conditions the survival portion of Swiatecki, Siwek-Wilcznska, and Wilczynski's 'Fusion By Diffusion' model is nearly identical for the two reactions. Additionally, because the same compound nucleus is produced, the exit channel is the same. Four compound nuclei were examined in this study: 258Db, 262Bh, 266Mt, and 272Rg. These nuclei were produced by using very similar heavy-ion induced-fusion reactions which differ only by one proton in the projectile or target nucleus (e.g.: 50Ti + 209Bi vs. 51V + 208Pb). Peak 1n exit channel cross sections were determined for each reaction in each pair, and three of the four pairs; cross sections were identical within statistical uncertainties. This indicates there is not an obvious preference of entrance channel in these paired reactions. Charge equilibration immediately prior to fusion leading to a decreased fusion barrier is the likely cause of this phenomenon. In addition to this systematic study, the lightest isotope of element 107, bohrium, was discovered in the 209Bi(52Cr,n) reaction. 260Bh was found to decay by emission of a 10.16 MeV alpha particle with a half-life of 35 ms. The cross section is 59 pb at an excitation energy of 15.0 MeV. The effect of the N = 152 shell is also seen in this isotope's alpha particle energy, the first evidence of such an effect in Bh. All reactions studied are also compared to model predictions by Swiatecki, Siwek-Wilcznska, and Wilczynski's 'Fusion By Diffusion' theory

  16. Generation of a novel live rabies vaccine strain with a high level of safety by introducing attenuating mutations in the nucleoprotein and glycoprotein. (United States)

    Nakagawa, Keisuke; Nakagawa, Kento; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Mitake, Hiromichi; Okada, Kazuma; Yamaoka, Satoko; Takashima, Yasuhiro; Masatani, Tatsunori; Okadera, Kota; Ito, Naoto; Mizutani, Tetsuya; Sugiyama, Makoto


    The current live rabies vaccine SAG2 is attenuated by only one mutation (Arg-to-Glu) at position 333 in the glycoprotein (G333). This fact generates a potential risk of the emergence of a pathogenic revertant by a back mutation at this position during viral propagation in the body. To circumvent this risk, it is desirable to generate a live vaccine strain highly and stably attenuated by multiple mutations. However, the information on attenuating mutations other than that at G333 is very limited. We previously reported that amino acids at positions 273 and 394 in the nucleoprotein (N273/394) (Leu and His, respectively) of fixed rabies virus Ni-CE are responsible for the attenuated phenotype by enhancing interferon (IFN)/chemokine gene expressions in infected neural cells. In this study, we found that amino acid substitutions at N273/394 (Phe-to-Leu and Tyr-to-His, respectively) attenuated the pathogenicity of the oral live vaccine ERA, which has a virulent-type Arg at G333. Then we generated ERA-N273/394-G333 attenuated by the combination of the above attenuating mutations at G333 and N273/394, and checked its safety. Similar to the ERA-G333, which is attenuated by only the mutation at G333, ERA-N273/394-G333 did not cause any symptoms in adult mice after intracerebral inoculation, indicating a low level of residual pathogenicity of ERA-N273/394-G333. Further examination revealed that infection with ERA-N273/394-G333 induces IFN-β and CXCL10 mRNA expressions more strongly than ERA-G333 infection in a neuroblastoma cell line. Importantly, we found that the ERA-N273/394-G333 stain has a lower risk for emergence of a pathogenic revertant than does the ERA-G333. These results indicate that ERA-N273/394-G333 has a potential to be a promising candidate for a live rabies vaccine strain with a high level of safety. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Developments for transactinide chemistry experiments behind the gas-filled separator TASCA

    Energy Technology Data Exchange (ETDEWEB)

    Even, Julia


    synthesised carbonyl complexes were identified by nuclear decay spectroscopy. Some complexes were studied with isothermal chromatography or thermochromatography methods. The chromatograms were compared with Monte Carlo Simulations to determine the adsorption enthalpyrnon silicon dioxide and on gold. These simulations based on existing codes, that were modified for the different geometries of the chromatography channels. All observed adsorption enthalpies (on silcon oxide as well as on gold) are typical for physisorption. Additionally, the thermalstability of some of the carbonyl complexes was studied. This showed that at temperatures above 200 C therncomplexes start to decompose. It was demonstrated that carbonyl-complex chemistry is a suitable method to study rutherfordium, dubnium, seaborgium, bohrium, hassium, and meitnerium. Until now, only very simple, thermally stable compounds have been synthesized in the gas-phase chemistry of the transactindes. With the synthesis of transactinide-carbonyl complexes a new compound class would be discovered. Transactinide chemistry would reach the border between inorganic and metallorganic chemistry. Furthermore, the in-situ synthesised carbonyl complexes would allow nuclear spectroscopy studies under low background conditions making use of chemically prepared samples. [German] Die vorliegende Arbeit befasst sich mit der Entwicklung von Experimenten hinter dem gasgefuellten Separator TASCA (TransActinide Separator and Chemistry Apparatus) zur Studie des chemischen Verhaltens der Transactinide. Zum einen wurde die Moeglichkeit der elektrochemischen Abscheidung kurzlebiger Isotope der Elemente Ruthenium und Osmium auf Goldelektroden im Hinblick auf ein Experiment mit Hassium untersucht. Aus der Literatur ist bekannt, dass bei der elektrochemischen Abscheidung einzelner Atome das Abscheidepotential signifikant vom Nernst-Potential abweicht. Die Verschiebung des Potentials haengt von der Adsorptionsenthalpie des abzuscheidenden Elements

  18. Glutathionylation of Yersinia pestis LcrV and Its Effects on Plague Pathogenesis

    Directory of Open Access Journals (Sweden)

    Anthony Mitchell


    Full Text Available Glutathionylation, the formation of reversible mixed disulfides between glutathione and protein cysteine residues, is a posttranslational modification previously observed for intracellular proteins of bacteria. Here we show that Yersinia pestis LcrV, a secreted protein capping the type III secretion machine, is glutathionylated at Cys273 and that this modification promotes association with host ribosomal protein S3 (RPS3, moderates Y. pestis type III effector transport and killing of macrophages, and enhances bubonic plague pathogenesis in mice and rats. Secreted LcrV was purified and analyzed by mass spectrometry to reveal glutathionylation, a modification that is abolished by the codon substitution Cys273Ala in lcrV. Moreover, the lcrVC273A mutation enhanced the survival of animals in models of bubonic plague. Investigating the molecular mechanism responsible for these virulence attributes, we identified macrophage RPS3 as a ligand of LcrV, an association that is perturbed by the Cys273Ala substitution. Furthermore, macrophages infected by the lcrVC273A variant displayed accelerated apoptotic death and diminished proinflammatory cytokine release. Deletion of gshB, which encodes glutathione synthetase of Y. pestis, resulted in undetectable levels of intracellular glutathione, and we used a Y. pestis ΔgshB mutant to characterize the biochemical pathway of LcrV glutathionylation, establishing that LcrV is modified after its transport to the type III needle via disulfide bond formation with extracellular oxidized glutathione.

  19. Catalytic isotope exchange reaction between deuterium gas and water pre-adsorbed on platinum/alumina

    International Nuclear Information System (INIS)

    Iida, Itsuo; Kato, Junko; Tamaru, Kenzi.


    The catalytic isotope exchange reaction between deuterium gas and the water pre-adsorbed on Pt/Al 2 O 3 was studied. At reaction temperatures above 273 K, the exchange rate was proportional to the deuterium pressure and independent of the amount of adsorbed water, which suggests that the rate determining step is the supply of deuterium from the gas phase. Its apparent activation energy was 38 kJ mol -1 . Below freezing point of water, the kinetic behaviour was different from that above freezing point. At higher deuterium pressures the rate dropped abruptly at 273 K. Below the temperature the apparent activation energy was 54 kJ mol -1 and the exchange rate depended not on the deuterium pressure but on the amount of the pre-adsorbed water. At lower pressures, however, the kinetic behaviour was the same as the above 273 K, till the rate of the supply of deuterium from the gas phase exceeded the supply of hydrogen from adsorbed water to platinum surface. These results suggest that below 273 K the supply of hydrogen is markedly retarded, the state of the adsorbed water differing from that above 273 K. It was also demonstrated that when the adsorbed water is in the state of capillary condensation, the exchange rate becomes very small. (auth.)

  20. Interventional studies in childhood dystonia do not address the concerns of children and their carers. (United States)

    Lumsden, Daniel E; Gimeno, Hortensia; Tustin, Kylee; Kaminska, Margaret; Lin, Jean-Pierre


    This study aimed to determine the main concerns/priorities of the parents and carers of children with dystonia referred to our service and whether medical interventional studies addressed these concerns. Records of children assessed by our service from June 2005-December 2012 were reviewed and expressed parental/carer concerns at initial assessment categorized using the International Classification of Functioning (ICF) Framework. Medline, CINAHL and Embase databases were searched for outcome measures of medical and surgical interventional studies in childhood dystonia. Data was collected from 273 children and young people with dystonia. The most commonly expressed concerns were: pain (104/273, 38.1%); difficulties in delivering activities of daily-living (66/273, 24.2%), difficulties with hand-use (59/273, 21.6%) and seating (41/273, 15.0%). Literature review identified 70 interventional studies, 46 neurosurgical and 24 pharmacological. The majority of neurosurgical studies (34/46) used impairment scales to measure change, with pharmacological studies typically reporting more subjective changes in motor symptoms. Only a minority of studies used assessments or scales capable of objectively addressing the concerns reported by our cohort. Existing interventional studies in childhood dystonia poorly address the main concerns of children with dystonia and their carers, limiting the conclusions which may be drawn as to true impact of these interventions in childhood. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  1. Baseline characteristics in PRIORITY study: Proteomics and mineralocorticoid receptor antagonism for prevention of diabetic nephropathy in type 2 diabetes

    DEFF Research Database (Denmark)

    Tofte, Nete

    diabetic nephRopathy In TYpe 2 diabetic patients with normoalbuminuria) trial, the aim is to confirm that CKD273 can predict microalbuminuria prospectively, and to test whether mineralocorticoid receptor antagonism (MRA) delays progression to microalbuminuria. Here we report the association between CKD273...... and traditional risk factors for diabetic nephropathy at baseline. Materials and methods PRIORITY is an investigator-initiated, prospective, randomized, double blind, placebo-controlled multicentre clinical trial and observational study in normoalbuminuric type 2 diabetic patients. Patients are stratified...... is development of microalbuminuria. Results In total 2277 type 2 diabetic patients have been screened over a time period of 2.5 years and 1811 are included from 15 sites. Table 1 shows the baseline characteristics. 224 (12.4%) have the high-risk CKD273 pattern. The high- and low-risk populations differ...

  2. Electrically injected GaAsBi/GaAs single quantum well laser diodes

    Directory of Open Access Journals (Sweden)

    Juanjuan Liu


    Full Text Available We present electrically injected GaAs/GaAsBi single quantum well laser diodes (LDs emitting at a record long wavelength of 1141 nm at room temperature grown by molecular beam epitaxy. The LDs have excellent device performances with internal quantum efficiency of 86%, internal loss of 10 cm-1 and transparency current density of 196 A/cm2. The LDs can operate under continuous-wave mode up to 273 K. The characteristic temperature are extracted to be 125 K in the temperature range of 77∼150 K, and reduced to 90 K in the range of 150∼273 K. The temperature coefficient of 0.3 nm/K is extracted in the temperature range of 77∼273 K.

  3. Reactive oxygen metabolites (ROMs) are associated with cardiovascular disease in chronic hemodialysis patients. (United States)

    Bossola, Maurizio; Vulpio, Carlo; Colacicco, Luigi; Scribano, Donata; Zuppi, Cecilia; Tazza, Luigi


    The aim of our study was to measure reactive oxygen metabolites (ROMs) in chronic hemodialysis (HD) patients and evaluate the possible association with cardiovascular disease (CVD) and mortality. We measured ROMs in 76 HD patients and correlated with CVD, cardiovascular (CV) events in the follow-up and all-cause and CVD-related mortality. The levels of ROMs presented a median value of 270 (238.2-303.2) CARR U (interquartile range). We created a ROC curve (ROMs levels vs. CVD) and we identified a cut-off point of 273 CARR U. Patients with ROMs levels ≥273 CARR U were significantly older, had higher C-reactive protein levels and lower creatinine concentrations. The prevalence of CVD was higher in patients with ROMs levels ≥273 (87.1%) than in those with ROMs levels <273 CARR U (17.7%; p<0.0001). ROMs levels were significantly higher in patients with CVD (317±63.8) than in those without (242.7±49.1; p<0.0001). At multiple regression analysis, age, creatinine and C-reactive protein were independent factors associated with ROMs. At multiple logistic regression analysis the association between ROMs and CVD was independent (OR: 1.02, 95% CI: 1.00-1.05; p=0.03). Twenty six patients developed cardiovascular (CV) events during the follow-up. Of these, seven were in the group with ROMs levels <273 CARR U and 19 in the group with ROMs levels ≥273 CARR U. The logistic regression analysis showed that both age (OR: 1.06, 95% CI: 1.01-1.12; p=0.013) and ROMs levels (OR: 1.10, 95% CI: 1.00-1.02; p=0.045) were independently associated with CV events in the follow-up. ROMs are independently associated with CVD and predict CV events in chronic HD patients.

  4. Department of Defense Suicide Event Report (DoDSER) Calendar Year 2014 Annual Report (United States)


    diagnoses identified in suicide DoDSER reports included mood (n= 17, 28.3%), adjustment (n = 14, 23.3%) and anxiety (n = 13, 21.7%) disorders . For suicide ...n = 35, 27.3%) and substance abuse (n = 35, 27.3%) disorders . For suicide attempt DoDSER reports, the most common diagnoses identified were mood (n...diagnoses identified in suicide DoDSER reports included mood (n= 10, 17.2%), adjustment (n = 8, 13.8%) and substance abuse (n = 8, 13.8%) disorders . For

  5. Development of an Atmospheric Dispersion Model for Heavier-Than-Air Gas Mixtures. Volume 1. (United States)


    aspirated concentration sensor used a balanced Wheatstone bridge to measure the heat loss from a sensing element placed in the sample stream. Shaded...a semipermeable membrane and electrochemical cell. A fast response sensor (10 Hz) basically aspirated a sample past the cell membrane. Reported...ramp function around the freezing point of water by X11., X= vap for T 273.15 K vap fus 263.15 for 263.15 <T < 273.15 Xvap +x fus for T < 263.15 (A-4

  6. CO2 Separation and Capture Properties of Porous Carbonaceous Materials from Leather Residues (United States)

    Bermúdez, José M.; Dominguez, Pablo Haro; Arenillas, Ana; Cot, Jaume; Weber, Jens; Luque, Rafael


    Carbonaceous porous materials derived from leather skin residues have been found to have excellent CO2 adsorption properties, with interestingly high gas selectivities for CO2 (α > 200 at a gas composition of 15% CO2/85% N2, 273K, 1 bar) and capacities (>2 mmol·g−1 at 273 K). Both CO2 isotherms and the high heat of adsorption pointed to the presence of strong binding sites for CO2 which may be correlated with both: N content in the leather residues and ultrasmall pore sizes. PMID:28788352

  7. CO2 Separation and Capture Properties of Porous Carbonaceous Materials from Leather Residues

    Directory of Open Access Journals (Sweden)

    Ana Arenillas


    Full Text Available Carbonaceous porous materials derived from leather skin residues have been found to have excellent CO2 adsorption properties, with interestingly high gas selectivities for CO2 (α > 200 at a gas composition of 15% CO2/85% N2, 273K, 1 bar and capacities (>2 mmol·g−1 at 273 K. Both CO2 isotherms and the high heat of adsorption pointed to the presence of strong binding sites for CO2 which may be correlated with both: N content in the leather residues and ultrasmall pore sizes.

  8. CO₂ Separation and Capture Properties of Porous Carbonaceous Materials from Leather Residues. (United States)

    Bermúdez, José M; Dominguez, Pablo Haro; Arenillas, Ana; Cot, Jaume; Weber, Jens; Luque, Rafael


    Carbonaceous porous materials derived from leather skin residues have been found to have excellent CO₂ adsorption properties, with interestingly high gas selectivities for CO₂ (α > 200 at a gas composition of 15% CO₂/85% N₂, 273K, 1 bar) and capacities (>2 mmol·g -1 at 273 K). Both CO₂ isotherms and the high heat of adsorption pointed to the presence of strong binding sites for CO₂ which may be correlated with both: N content in the leather residues and ultrasmall pore sizes.

  9. Dollar Summary of Prime Contract Awards by Contractor, State or Country, and Place, FY83, Part 2 (Gillespie Delorenzo Asla & Assocs-Planning Analysis Corp). (United States)



  10. Effect of copper, tin, phosphorous and arsenic on the surface cracking of a 18-8 stainless steel during hot compression tests

    International Nuclear Information System (INIS)

    Botella, J.; Fernandez, M.T.; Fernandez de Castillo, I.


    The effect of certain different concentrations of Cu, Sn, P and As on the surface cracking of 18-8 austenitic stainless steel hot compressed specimens has been studied, at 1,123 and 1,273 K, in an oxidizing atmosphere (air). A procedure for determining surface cracking has been established, and the cracking factor obtained in this ways is correlated with the chemical composition of the materials at both temperatures. The cracking factors obtained at 1,273 K have been compared with the reduction of area drops obtained by hot tension tests at the same temperature. (Author) 5 refs

  11. Developments for transactinide chemistry experiments behind the gas-filled separator TASCA

    International Nuclear Information System (INIS)

    Even, Julia


    synthesised carbonyl complexes were identified by nuclear decay spectroscopy. Some complexes were studied with isothermal chromatography or thermochromatography methods. The chromatograms were compared with Monte Carlo Simulations to determine the adsorption enthalpyrnon silicon dioxide and on gold. These simulations based on existing codes, that were modified for the different geometries of the chromatography channels. All observed adsorption enthalpies (on silcon oxide as well as on gold) are typical for physisorption. Additionally, the thermalstability of some of the carbonyl complexes was studied. This showed that at temperatures above 200 C therncomplexes start to decompose. It was demonstrated that carbonyl-complex chemistry is a suitable method to study rutherfordium, dubnium, seaborgium, bohrium, hassium, and meitnerium. Until now, only very simple, thermally stable compounds have been synthesized in the gas-phase chemistry of the transactindes. With the synthesis of transactinide-carbonyl complexes a new compound class would be discovered. Transactinide chemistry would reach the border between inorganic and metallorganic chemistry. Furthermore, the in-situ synthesised carbonyl complexes would allow nuclear spectroscopy studies under low background conditions making use of chemically prepared samples. [de

  12. Soil salinity: Germination tolerance of alternative oilseed crops for soil health (United States)

    World-wide, saline soils contribute to over US$27.3 billion in agricultural losses annually by reducing plant growth through osmotic imbalances and ion toxicity. Nearly 800,000 ha of salt affected land is located in the northern Great Plains. Limited information is available on the germination of al...

  13. Evaluation of interspecific DNA variability in poplars using AFLP and ...

    African Journals Online (AJOL)



    Oct 19, 2009 ... Both markers crearly separated two distinct clusters, one included Populus nigra and the other ... Species of Populus used to test SSR and AFLP primer pair utility. ..... cluster NS001 and NS002 were closely related to 0.273.

  14. A new species of Rhabdochona Railliet, 1916 (Nematoda: Rhabdochonidae) from cyprinid fishes in the Western Ghats Region, India

    Czech Academy of Sciences Publication Activity Database

    González-Solís, David; Chavan, S. P.; Kannewad, P.; Gyananath, G.


    Roč. 87, č. 3 (2014), s. 273-281 ISSN 0165-5752 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : fresh water fishes * morphology * Thailand Subject RIV: EA - Cell Biology Impact factor: 1.336, year: 2014

  15. File list: Oth.ALL.50.Biotin.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.Biotin.AllCell mm9 TFs and others Biotin All cell types SRX477548,SRX273...57049,SRX1057045,SRX1057047,SRX019779,SRX1057043,SRX1057051 ...

  16. Resonance – Journal of Science Education | News

    Indian Academy of Sciences (India)

    pp 254-273 General Article. Symmetries and Conservation Laws in Classical and Quantum Mechanics - Quantum Mechanics · K S Mallesh S Chaturvedi V Balakrishnan R Simon N Mukunda ... T Padmanabhan · More Details Fulltext PDF. pp 279-292 Reflections. Darshana Jolts - Sound: The Vehicle for Speech and Music.

  17. Affected in the nightclub

    DEFF Research Database (Denmark)

    Demant, Jakob Johan


    simultaneously with the affects of love, joy, sympathy and so on. Alcohol, illicit drugs, bouncers, music and other human or non-human actants are part of the place. It is within this heterogeneous assemblage that affects become embodied. The data consists of 273 cases from a large Copenhagen nightclub where...

  18. Federal Research and Development Funding: FY2013 (United States)


    NIA ) 1,120 1,103 1,102 1,124 1,040 Arthritis/Musculoskeletal/Skin (NIAMS) 535 536 535 537 505 Deafness/Communication Disorders (NIDCD) 416 417...Secretary’s net transfer of $18.273 million for Alzheimer’s disease research to National Institute on Aging ( NIA ) from other ICs. FY2012 figures are shown on

  19. Eosinophils from patients with type 1 diabetes mellitus express high level of myeloid alpha-defensins and myeloperoxidase

    Czech Academy of Sciences Publication Activity Database

    Neuwirth, Aleš; Dobeš, Jan; Oujezdská, Jana; Ballek, Ondřej; Benešová, Martina; Sumnik, Z.; Včeláková, J.; Koloušková, S.; Obermannová, B.; Kolář, Michal; Štechová, K.; Filipp, Dominik


    Roč. 273, č. 2 (2012), s. 158-163 ISSN 0008-8749 R&D Projects: GA MŠk 2B08066 Institutional research plan: CEZ:AV0Z50520514 Keywords : type 1 diabetes * alpha-defensin * myeloperoxidase * granulocyte * eosinophil Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.743, year: 2012

  20. Consumer demand system estimation and value added tax reforms in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Janský, Petr


    Roč. 64, č. 3 (2014), s. 246-273 ISSN 0015-1920 R&D Projects: GA TA ČR(CZ) TD010033 Institutional support: RVO:67985998 Keywords : consumer behavior * Quadratic Almost Ideal Demand System * tax reforms Subject RIV: AH - Economics Impact factor: 0.420, year: 2014

  1. Prehistoric dark soils/sediments of Central Sudan, case study from the Mesolithic landscape at the Sixth Nile Cataract

    Czech Academy of Sciences Publication Activity Database

    Lisá, Lenka; Bajer, A.; Pacina, J.; McCool, J-P.; Cílek, Václav; Rohovec, Jan; Matoušková, Šárka; Kallistová, Anna; Gottvald, Z.


    Roč. 149, č. 1 (2017), s. 273-282 ISSN 0341-8162 Institutional support: RVO:67985831 Keywords : climate change * micromorphology * sahel * saprolite * soil chemistry Subject RIV: DB - Geology ; Mineralogy OBOR OECD: Geology Impact factor: 3.191, year: 2016

  2. Examination of Youth Team Athletes' Social Values According to Some Variables (United States)

    Özdenk, Serhat; Karabulut, Ebru Olcay


    In this study, it was aimed to examine of youth team athletes' social values according to some variables. The study was carried out by screening model and includes in range of 9-17 years 273 youth team athletes who take part in individual and team sports such as Taekwondo, Handball, Badminton, Wrestling, Volleyball and Football. "A Tool for…

  3. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 3. General Relativity and the Accelerated Expansion of the Universe. Patrick Das Gupta. General Article Volume 17 Issue 3 March 2012 pp 254-273. Fulltext. Click here to view fulltext PDF. Permanent link:

  4. Self- and Collateral Spouse-Reported Alcohol in Malawi: Exploring ...

    African Journals Online (AJOL)

    Adult (18+ years old) Malawian men and women's alcohol use and social drinking norms were examined. From 31,676 screened households, heads and spouses in 1,795 households with at least one alcohol user were interviewed. Alcohol use last 12 months was reported by 27.3% and 1.6% of all adult men and women ...

  5. Prevalence and characteristics of chronic kidney disease among Danish adults with cystic fibrosis

    DEFF Research Database (Denmark)

    Berg, Kristina H; Ryom, Lene; Faurholt-Jepsen, Daniel


    median duration of chronic pulmonary infection (28.3 (20.0-35.8) vs. 20.0 (9.9-34.7) years; p=0.008) and with longer intravenous aminoglycosides use (606 (IQR, 455-917) vs. 273 (IQR, 91-826) days, p=0.005). CONCLUSIONS: The CKD prevalence is high and related to age, diabetes, chronic infection...

  6. Wallstents for metastatic biliary obstruction

    NARCIS (Netherlands)

    van Berkel, A. M.; Bergman, J. J.; Waxman, I.; Andres, P.; Huibregtse, K.


    In patients with obstruction of the common bile duct caused by primary pancreaticoblliary tumors, Wallstents have been shown to remain patent for a median duration of 273 days (range: 14-363). However, in one study that included both patients with primary pancreaticobillary malignancies and patients

  7. Comparison of the effects of different linefishing methods on catch ...

    African Journals Online (AJOL)

    The effects of hook size, bait type, water depth and fishing effort on the selectivity and capture mortality of reef fish were investigated in a standardised fishing experiment on the temperate south coast of South Africa. A total of 2 406 fish was caught at 273 stations, distributed according to a random-stratified design.





    2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

  9. Nucleoside Inhibitors of Zika Virus

    Czech Academy of Sciences Publication Activity Database

    Eyer, L.; Nencka, Radim; Huvarová, I.; Palus, Martin; Alves, M. J.; Gould, E. A.; De Clercq, E.; Růžek, Daniel


    Roč. 214, č. 5 (2016), s. 707-711 ISSN 0022-1899 Institutional support: RVO:61388963 ; RVO:60077344 Keywords : Zika virus * flavivirus * nucleoside analogue * antiviral * therapy Subject RIV: CC - Organic Chemistry; EE - Microbiology, Virology (BC-A) Impact factor: 6.273, year: 2016

  10. Patterns of birth weight at a community level

    African Journals Online (AJOL)


    identified a one-year live birth cohort of 8,273 in Jimma, Illubabor and Keffa ... METHODS: This was a community-based longitudinal study, which attempts to ... RESULTS: The results of the study found an estimated low birth weight rate ... mothers' experience of previous child deaths. ... births occur at home. ..... assessment.

  11. Retribution or Reconciliation: Young Americans' Attitudes toward Peaceful Transitions of Power (United States)

    Gallay, Leslie; Flanagan, Constance A.; Duo, Samuel


    This exploratory study assessed the associations of age, gender, and a school climate of solidarity and pride with adolescents' endorsements of democratic regime change. Middle- and high-school students (N = 273) in the United States responded to three vignettes concerning how a society should transition from dictatorship to democracy and…

  12. The Effect of Herrmann Whole Brain Teaching Method on Students' Understanding of Simple Electric Circuits (United States)

    Bawaneh, Ali Khalid Ali; Nurulazam Md Zain, Ahmad; Salmiza, Saleh


    The purpose of this study was to investigate the effect of Herrmann Whole Brain Teaching Method over conventional teaching method on eight graders in their understanding of simple electric circuits in Jordan. Participants (N = 273 students; M = 139, F = 134) were randomly selected from Bani Kenanah region-North of Jordan and randomly assigned to…

  13. An Investigation of Academic Procrastination, Locus of Control, and Emotional Intelligence (United States)

    Deniz, M. Engin; Tras, Zeliha; Aydogan, Didem


    In this research, the effects of emotional intelligence on the academic procrastination and locus of control tendencies of a group of university students are investigated. The sample of this study consists of 435 university students including 273 female students and 162 male students who were randomly selected from the population of Selcuk…

  14. ISSN 2073-9990 East Cent. Afr. J. surg

    African Journals Online (AJOL)

    Valued eMachines Customer

    chose the type of anaesthesia after discussion with the surgeon before surgery. ... anesthesia was used in 273 patients in Lichtenstein group and 490 patients in the Desarda group. All those 763 (55.2%) .... The author made a search about the inguinal canal anatomy through books or publications made by stalwarts in this ...

  15. European Energy Security and Nord Stream: A Case Study of the Nord Stream Pipeline, Its Opportunities and Risks for Europe, and Its Impact on European Energy Security (United States)


    2010, 5.75% of all petrol -driven cars will run on bio- fuels. This target will not be achieved. 119 Ibid., 22–23. 120 Belkin, The European Union’s...insecurity, as is the case with Algeria, Egypt, Tunisia and Libya. This possible risk has already been identified by the European Commission in 2006.273

  16. Calcium alpha-ketoglutarate administration to malnourished hemodialysis patients improves plasma arginine concentrations. (United States)

    Riedel, E; Hampl, H; Steudle, V; Nündel, M


    Calcium alpha-ketoglutarate administration to 24 malnourished hemodialysis patients for 1 year leads to a significant increase in plasma concentrations of L-arginine from 53.6 +/- 18.3 (compared to a healthy control group: 87.5 +/- 27.3) to 71.1 +/- 15.9 mumol/l (p calcium alpha-ketoglutarate administration.

  17. Evaluation of Genotoxicity of CSE1034 by Ames and In vitro ...

    African Journals Online (AJOL)

    NADPH) was obtained from Himedia (Mumbai, India). Ames test. The test was ..... W, Passarge E. Toxicity of antibiotics cultured human skin fibroblast. Humangenetik 1975; 28: 273-267. 15. McCann J, Choi E, Yamasaki E, Ames BN. Detection of.

  18. African Zoology - Vol 39, No 2 (2004)

    African Journals Online (AJOL)

    Prey selection by a reintroduced lion population in the Greater Makalali Conservancy, South Africa · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Dave Druce, Heleen Genis, Jonathan Braak, Sophie Greatwood, Audrey Delsink, Ross Kettles, Luke Hunter, Rob Slotow, 273–284.

  19. Influence of Capillary Condensation Effects on Mass Transport through Porous Membranes

    Czech Academy of Sciences Publication Activity Database

    Uchytil, Petr; Petričkovič, Roman; Thomas, S.; Siedel-Morgenstern, A.


    Roč. 33, č. 3 (2003), s. 273-281 ISSN 1383-5866 R&D Projects: GA ČR GA104/01/0945 Institutional research plan: CEZ:AV0Z4072921 Keywords : capillary condensation * mass transport * gas separation Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.355, year: 2003

  20. Download this PDF file

    African Journals Online (AJOL)


    was achieved in 45.5% of cases and 27.3% conceived during the follow up period. No change in menstrual ... screening tests for intra-uterine adhesions, hysteroscopy remains .... Although the sample size in this study is small, there is need to ...

  1. Thermal inactivation of Escherichia coli 0157:H7 (ECOH) and non-0157 Shiga-toxin producing E.coli (STEC) in mechanically tenderized veal (United States)

    Among the veal samples tested by FSIS from June to September 2012, 3 of 11 (27.3%) were confirmed positive for STEC, compared to 5 of 729 (0.69%) beef trim samples. This difference in detection of confirmed positives from veal samples compared to that from beef is striking and raises the question of...

  2. Parturition difficulties in sheep

    NARCIS (Netherlands)

    Grommers, F. J.; Elving, L.; Eldik, P. van


    The incidence of difficult parturition was recorded in Texel Sheep lambs (224), Milk Sheep lambs (273) and various crossbreeds (1043) in ten spring lambing seasons. at lambing time the ewes were under 24-hour observation. Difficult parturition is defined as necessity for obstetrical assistance as

  3. Promoting Peer Acceptance of Females with Higher-Functioning Autism in a Mainstream Education Setting: A Replication and Extension of the Effects of an Autism Anti-Stigma Program (United States)

    Ranson, Natalia J.; Byrne, Mitchell K.


    This study evaluated the effects of an eight-session female higher-functioning autism anti-stigma program on the knowledge, attitudes and behavioural intentions of adolescent girls. Participants were seventh-, eighth- and ninth-grade students (N = 273) in a mainstream school. Two-eighth-grade classes were randomly allocated to the intervention…

  4. The Relationship among Transformational Teaching and Student Motivation and Learning (United States)

    Noland, Aaron; Richards, Keith


    Transformational leadership is a well-documented and validated leadership perspective studied in management and organizational contexts that has recently been applied to the instructional context. The current study predicted a positive relationship between teacher transformational leadership and learning, and motivation. A population of 273

  5. PTSD: National Center for PTSD

    Medline Plus

    Full Text Available ... updated April 16, 2018 Get help from Veterans Crisis Line Call 1-800-273-8255 (Press 1) ... 838255 Chat confidentially now If you are in crisis or having thoughts of suicide, visit ...

  6. Navigation Method for Autonomous Robots in a Dynamic Indoor Environment

    Czech Academy of Sciences Publication Activity Database

    Věchet, Stanislav; Chen, K.-S.; Krejsa, Jiří


    Roč. 3, č. 4 (2013), s. 273-277 ISSN 2223-9766 Institutional support: RVO:61388998 Keywords : particle filters * autonomous mobile robots * mixed potential fields Subject RIV: JD - Computer Applications, Robotics

  7. Preservice Teachers' Acceptance of ICT Integration in the Classroom: Applying the UTAUT Model (United States)

    Birch, A.; Irvine, V.


    In this study, the researchers explore the factors that influence preservice teachers' acceptance of information and communication technology (ICT) integration in the classroom. The Unified Theory of Acceptance and Use of Technology (UTAUT) was developed by Venkatesh et al. ["MIS Quarterly, 27"(3), 425-478] in 2003 and shown to…

  8. 75 FR 26310 - Self-Regulatory Organizations; International Securities Exchange, LLC; Notice of Filing and... (United States)


    ... Symantec Corp. 162 TIVO TiVo Inc. 253 AMED Amedisys Inc. 163 MNKD MannKind Corp. 255 TM Toyota Motor Corp... 273 EP El Paso Corp. Group Ltd. 215 XLP Consumer Staples 274 SEED Origin Agritech Select Sector SPDR...

  9. Sexual conflict, sexual selection and sperm competition in the spawning decisions of bitterling, Rhodeus sericeus

    Czech Academy of Sciences Publication Activity Database

    Smith, C.; Douglas, A.; Jurajda, Pavel


    Roč. 51, č. 5 (2002), s. 433-439 ISSN 0340-5443 Institutional research plan: CEZ:AV0Z6093917 Keywords : Acheilognathinae * alternative mating tactics * mate choice Subject RIV: EG - Zoology Impact factor: 2.273, year: 2002

  10. Enzyme production in the traps of aquatic Utricularia species

    Czech Academy of Sciences Publication Activity Database

    Adamec, Lubomír; Sirová, Dagmara; Vrba, J.; Rejmánková, E.


    Roč. 65, č. 2 (2010), s. 273-278 ISSN 0006-3088 R&D Projects: GA ČR GP206/05/P520 Institutional research plan: CEZ:AV0Z60050516; CEZ:AV0Z60170517 Keywords : aquatic carnivorous plants * extracellular enzyme activity * phosphatase Subject RIV: EF - Botanics Impact factor: 0.609, year: 2010

  11. Maďarský matematik Endre Szemerédi získal Abelovu cenu za rok 2012

    Czech Academy of Sciences Publication Activity Database

    Křížek, Michal; Pudlák, Pavel; Somer, L.


    Roč. 57, č. 4 (2012), s. 265-273 ISSN 0032-2423 R&D Projects: GA AV ČR(CZ) IAA100190803 Institutional support: RVO:67985840 Keywords : Szemeredi theorem * chaos * upper asymptotic density Subject RIV: BA - General Mathematics

  12. Validity and reliability of questionnaires measuring physical activity self-efficacy, enjoyment, social support among Hong Kong Chinese children (United States)

    Physical activity (PA) correlates have not been extensively studied in Hong Kong children. The aim of this study is to assess the validity and reliability of translated scales to measure PA related self-efficacy, enjoyment and social support in Hong Kong Chinese children. Sample 1 (n=273, aged 8–12 ...

  13. Marine mammal surveys in Dutch waters in 2014

    NARCIS (Netherlands)

    Geelhoed, S.C.V.; Lagerveld, S.; Verdaat, J.P.; Scheidat, M.


    In July 2014 aerial surveys to estimate the abundance of Harbour porpoises Phocoena phocoena on the Dutch Continental Shelf were conducted. In total, 229 sightings of 273 individual Harbour Porpoises were collected. Porpoise densities varied between 0.37-3.08 animals/km² in the (four) different

  14. Long-term Periodicity Analysis of Polarization Variation for Radio ...

    Indian Academy of Sciences (India)

    Kochanev, P. Yu., Gabuzda, D. C. 1998, In: Radio Emission From Galactic and Extragalactic. Compact Sources (eds) Zensus, J. A., Taylor, G. B., Wrobel, J. M., San Francisco: ASP, p. 273. Lomb, N. R. 1976, ApS&S, 39, 447. Mead, A. R. G., Ballard, K. R., Brand, P. W. J. L. et al. 1990, Astron. Astrophys. Suppl. Ser.,. 83, 183.

  15. A review of the distribution of Yellowhammer (Emberiza citrinella) dialects in Europe reveals the lack of a clear macrogeographic pattern

    Czech Academy of Sciences Publication Activity Database

    Petrusková, T.; Diblíková, L.; Pipek, P.; Frauendorf, E.; Procházka, Petr; Petrusek, A.


    Roč. 156, č. 1 (2015), s. 263-273 ISSN 0021-8375 Institutional support: RVO:68081766 Keywords : Emberiza citrinella * Song variation * Dialect nomenclature * Online sources * Macrogeographic patterns Subject RIV: EG - Zoology Impact factor: 1.419, year: 2015

  16. On the Consonant Structure of Rhyme in Czech Accentaul-Syllabic verse

    Czech Academy of Sciences Publication Activity Database

    Říha, Jakub


    Roč. 11, č. 2017 (2017), s. 273-277 ISSN 2311-150X R&D Projects: GA ČR GA15-19820S Institutional support: RVO:68378068 Keywords : Czech verse * rhyme * rhythm * sound * blank verse Subject RIV: AJ - Letters, Mass-media, Audiovision OBOR OECD: Specific literatures

  17. Shumwayite,[(UO.sub.2./sub.)(SO.sub.4./sub.)(H.sub.2./sub.O).sub.2./sub.].sub.2./sub.·H.sub.2./sub.O, a new uranyl sulfate mineral from Red Canyon, San Juan County, Utah, USA

    Czech Academy of Sciences Publication Activity Database

    Kampf, A.R.; Plášil, Jakub; Kasatkin, A.V.; Marty, J.; Čejka, J.; Lapčák, L.


    Roč. 81, č. 2 (2017), s. 273-285 ISSN 0026-461X R&D Projects: GA ČR GP13-31276P Institutional support: RVO:68378271 Keywords : shumwayite * new mineral * uranyl sulfate * crystal structure * infrared and Raman spectroscopy Subject RIV: DB - Geology ; Mineralogy OBOR OECD: Geology Impact factor: 1.285, year: 2016

  18. Nové minerály uranu popsané v nedávné minulosti

    Czech Academy of Sciences Publication Activity Database

    Plášil, Jakub


    Roč. 25, č. 3 (2017), s. 261-273 ISSN 1213-0710 R&D Projects: GA MŠk LO1603 Institutional support: RVO:68378271 Keywords : uranium minerals * Red Canyon area * Blue Lizard mine Subject RIV: DB - Geology ; Mineralogy OBOR OECD: Geology

  19. A rare severe enamel defect on an upper pig molar from an early medieval stronghold in Prague (Czech Republic) - short communication

    Czech Academy of Sciences Publication Activity Database

    Teegen, W.-R.; Kyselý, René


    Roč. 86, č. 2 (2016), s. 273-285 ISSN 0372-5480 Institutional support: RVO:67985912 Keywords : enamel hypoplasia * severe dental malformation * infection * pig (Sus domesticus) * Middle Ages * weaning Subject RIV: AC - Archeology, Anthropology, Ethnology Impact factor: 0.302, year: 2016

  20. 76 FR 60426 - Nondiscrimination on the Basis of Disability in Programs or Activities Receiving Federal... (United States)


    ... rules implementing section 504 of the Rehabilitation Act of 1973, which requires accessibility in... Accessibility Standards in 49 CFR 27.3(b) and change the language ``appendix A to part 37 of this title'' to... information to deaf or hard of hearing individuals in airports that they provide to other members of the...

  1. Download this PDF file

    African Journals Online (AJOL)

    This paper examines the quality of palm oil samples obtained from different locations in Abia State,. Nigeria in terms of their physicochemical properties. The results obtained showed that the saponification value (SV) ranged from 129.04 - 198,03KOH/g of oil. The free fatty acid (FFA) of the palm oil samples ranged from 2.73 ...

  2. Quality assessment of palm oil sold in major markets in Abia State ...

    African Journals Online (AJOL)

    This paper examines the quality of palm oil samples obtained from different locations in Abia State, Nigeria in terms of their physicochemical properties. The results obtained showed that the saponification value (SV) ranged from 129.04 – 198.03KOH/g of oil. The free fatty acid (FFA) of the palm oil samples ranged from 2.73 ...

  3. Lecithin microemulsions in dimethylether and propane for the generation of pharmaceutical aerosols containing polar solutes

    Czech Academy of Sciences Publication Activity Database

    Sommerville, M. L.; Johnson, C. S.; Cain, J. B.; Rypáček, František; Hickey, A. J.


    Roč. 7, č. 3 (2002), s. 273-288 ISSN 1083-7450 R&D Projects: GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : block copolymer micelles * poly(D,L-lactide-block-ethylene oxide) * biodistribution Subject RIV: CC - Organic Chemistry Impact factor: 0.627, year: 2002

  4. Rb–Sr and Sm–Nd study of granite–charnockite association in the ...

    Indian Academy of Sciences (India)

    tinent along the Cauvery Shear Zone (CSZ), a site ... affect the time-related accumulation of radiogenic isotopes of Sr and Nd in a ... KKPT shear zone separates these two domains of ..... In some patches, grain size increases from the margin ...... Petrol. 40(3) 259–273. Endo T, Tsunogae T and Santosh M 2012 Mineral equi-.

  5. Handbook of Accelerator Physics and Engineering (sections 2.7.1 - 2.7.5 and 7.6.2)

    Energy Technology Data Exchange (ETDEWEB)

    Roser, T.


    The sections written by this author are: 2.7.1- Thomas - BMT equation; 2.2.2- Spinor Algebra; 2.7.3- Spin Rotators and Siberian Snakes; 2.7.4- Ring with Spin Rotator and Siberian Snakes; 2.7.5- Depolarizing Resonances and Spin Flippers; & 7.6.2- Proton Beam Polarimeters

  6. Two new species of Philometra (Nematoda: Philometridae) from needlefishes (Belonidae) in Iraq, with a key to Philometra spp. parasitic in the host’s subcutaneous tissue, fins and musculature

    Czech Academy of Sciences Publication Activity Database

    Moravec, František; Ali, A. H.


    Roč. 52, č. 3 (2005), s. 267-273 ISSN 0015-5683 R&D Projects: GA ČR GA524/03/0061 Institutional research plan: CEZ:AV0Z60220518 Keywords : Philometra * marine fishes * Iraq Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.138, year: 2005

  7. The functional interactions between CD98, beta 1-integrins, and CD147 in the induction of U937 homotypic aggregation

    Czech Academy of Sciences Publication Activity Database

    Cho, J. Y.; Fox, D. A.; Hořejší, Václav; Sagawa, K.; Skubitz, K. M.; Katz, D. R.; Chain, B.


    Roč. 98, č. 2 (2001), s. 374-382 ISSN 0006-4971 R&D Projects: GA ČR GA310/99/0349 Institutional research plan: CEZ:AV0Z5052915 Keywords : integrin * CD98 * CD147 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.273, year: 2001

  8. Augmented Reality Mentor for Training Maintenance Procedures: Interim Assessment (United States)


    21 APPENDICES APPENDIX A: OBSERVATION PROTOCOL ........................................................... the Soldiers in that condition only (Appendix D). The observation protocol recorded the following performance data: time to complete three sub...2007). Event perception: a mind-brain perspective. Psychological Bulletin, 133(2), 273. 20 Appendix A: Observation Protocol OBSERVER

  9. Emotional Intelligence, Communication Competence, and Student Perceptions of Team Social Cohesion (United States)

    Troth, Ashlea C.; Jordan, Peter J.; Lawrence, Sandra A.


    Students generally report poor experiences of group work in university settings. This study examines whether individual student perceptions of team social cohesion are determined by their level of emotional intelligence (EI) and whether this relationship is mediated by their communication skills. Business students (N = 273) completed the 16-item…

  10. Post partum emotional distress in mothers of preterm infants: a ...

    African Journals Online (AJOL)

    More mothers of preterm neonates(27.3%) had GHQ-30 scores which categorised them as having significant emotional distress than mothers of full term normal infants(3.7%). Similarly more mothers of preterm neonates(15.1%) were more depressed than mothers of full term normal infants(3.7%). These differences were ...

  11. 77 FR 24726 - National Institute on Alcohol Abuse and Alcoholism; Notice of Meeting (United States)


    ... attendance limited to space available. Individuals who plan to attend and need special assistance, such as... applications and the discussions could disclose confidential trade secrets or commercial property such as... Assistance Program Nos. 93.273, Alcohol Research Programs; 93.701, ARRA Related Biomedical Research and...

  12. 77 FR 43604 - National Institute on Alcohol Abuse and Alcoholism; Notice of Meeting (United States)


    ... attendance limited to space available. Individuals who plan to attend and need special assistance, such as... and the discussions could disclose confidential trade secrets or commercial property such as.... (Catalogue of Federal Domestic Assistance Program Nos. 93.273, Alcohol Research Programs; 93.701, ARRA...

  13. 78 FR 45541 - National Institute on Alcohol Abuse and Alcoholism; Notice of Meeting (United States)


    ... attendance limited to space available. Individuals who plan to attend and need special assistance, such as... applications and the discussions could disclose confidential trade secrets or commercial property such as.... (Catalogue of Federal Domestic Assistance Program Nos. 93.273, Alcohol Research Programs, National Institutes...

  14. 78 FR 20932 - National Institute on Alcohol Abuse and Alcoholism; Notice of Meeting (United States)


    ... attendance limited to space available. Individuals who plan to attend and need special assistance, such as... applications and the discussions could disclose confidential trade secrets or commercial property such as... Assistance Program Nos. 93.273, Alcohol Research Programs, National Institutes of Health, HHS) Dated: April 2...

  15. Dysmenorrhea among female students at a teaching hospital in ...

    African Journals Online (AJOL)

    settings and Design: This is a cross‑sectional, observational study among female medical and nursing students at a tertiary ... Dysmenorrhea-related absenteeism occurs in 27.3% of sufferers in a Japanese study.[3] In Nigeria, a study from Eastern Nigeria reported a 25% prevalence of ... identifiable pathologic cause.

  16. Detection and characterization of feline Bartonella henselae in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Melter, O.; Hercík, Kamil; Weyant, R. S.; Janeček, Jiří; Němec, A.; Mecera, J.; Gonzorová, L.; Branny, Pavel


    Roč. 93, - (2003), s. 261-273 ISSN 0378-1135 R&D Projects: GA ČR GA310/98/0417; GA ČR GP204/02/D121 Institutional research plan: CEZ:AV0Z5020903 Keywords : bartonella henselae * cat * molecular typing Subject RIV: EE - Microbiology, Virology Impact factor: 1.571, year: 2003

  17. Highly sensitive urea sensing with ion-irradiated polymer foils

    Czech Academy of Sciences Publication Activity Database

    Fink, Dietmar; Hernandez, G. M.; Alfonta, L.


    Roč. 273, č. 2 (2012), s. 164-170 ISSN 0168-583X Institutional research plan: CEZ:AV0Z10480505 Keywords : NANOPORES * BIOSENSOR * SAMPLES Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 1.266, year: 2012

  18. Experiment list: SRX524973 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available SRX524973 hg19 Histone H3K4me1 Uterus Endometrial stromal cells NA 30874750,99.0,35....9,273 GSM1372865: H3K4me1 case2 w/ EP; Homo sapiens; ChIP-Seq source_name=Human endometrial stromal cells || tissue=Endometr

  19. K problému univerzalistických pretenzí v etice. Formalismus a některé pokusy o založení hodnotové etiky

    Czech Academy of Sciences Publication Activity Database

    Hála, Vlastimil


    Roč. 62, č. 4 (2007), s. 273-281 ISSN 0046-385X R&D Projects: GA MŠk(CZ) LC06013 Institutional research plan: CEZ:AV0Z90090514 Keywords : ethics * values * universalism Subject RIV: AA - Philosophy ; Religion

  20. In Vitro Digestibility of Aluminum from Hibiscus sabdariffa Hot Watery Infusion and Its Concentration in Urine of Healthy Individuals

    Czech Academy of Sciences Publication Activity Database

    Frankova, A.; Malik, J.; Drabek, O.; Szakova, J.; Sperlingova, I.; Kloucek, P.; Novy, P.; Tejnecky, V.; Landa, Přemysl; Leuner, O.; Kokoska, L.


    Roč. 174, č. 2 (2016), s. 267-273 ISSN 0163-4984 Institutional support: RVO:61389030 Keywords : dialysis dementia * tea * bioavailability * speciation * toxicity * Aluminum * In vitro digestion * Hot watery infusion * Urine * Hibiscus sabdariffa L Subject RIV: EF - Botanics Impact factor: 2.399, year: 2016

  1. Targeting the Checkpoint to Kill Cancer Cells

    Czech Academy of Sciences Publication Activity Database

    Benada, Jan; Macůrek, Libor


    Roč. 6, č. 3 (2015), s. 1912-1937 ISSN 2218-273X R&D Projects: GA ČR(CZ) GA14-34264S Institutional support: RVO:68378050 Keywords : checkpoint * DNA damage response * cancer Subject RIV: EB - Genetics ; Molecular Biology

  2. 49 CFR 192.150 - Passage of internal inspection devices. (United States)


    ... HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) PIPELINE SAFETY... transmission lines 103/4 inches (273 millimeters) or more in outside diameter on which construction begins... on investigation or experience, that there is no reasonably practical alternative under the design...

  3. Patients with physiological acid exposure and positive symptom association scores: a distinct group within the GORD spectrum

    NARCIS (Netherlands)

    de Vries, D. R.; van Herwaarden, M. A.; Smout, A. J. P. M.; Samsom, M.


    Studies comparing pH-metrically well-characterized gastro-oesophageal reflux disease (GORD) patients with physiological reflux to GORD patients with pathological reflux, with regard to clinical and epidemiological data, are lacking. We included 273 GORD patients with pathological 24-h pH-monitoring

  4. Gamma ray astronomy and the COS-B satellite

    International Nuclear Information System (INIS)

    Cesarsky, C.J.; Paul, J.A.


    The European satellite COS-B, operating in space for almost seven years, has produced a full chart of the sky in gamma radiation. This chart is discussed in detail, as well as gamma astronomy, high energy photons, gamma photons, strange stars, young pulsars, stars seething with activity and quasar 3C273. Other gamma astronomy programmes are briefly mentioned. (U.K.)

  5. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 273 ... Vol 25, No 1 (2017), Amblyopia in rural Nigerian school children, Abstract ... Vol 11, No 2 (2003), Amblyopia: Types, Presentation And Treatment – A Review ... Vol 16, No 2 (2008), Causse of Adult Blindness at ECWA Eye ...

  6. A kinetic study of the formation of organic solids from formaldehyde: Implications for the origin of extraterrestrial organic solids in primitive Solar System objects (United States)

    Kebukawa, Yoko; Cody, George D.


    Aqueous organic solid formation from formaldehyde via the formose reaction and subsequent reactions is a possible candidate for the origin of complex primitive chondritic insoluble organic matter (IOM) and refractory carbon in comets. The rate of formation of organic solids from formaldehyde was studied as a function of temperature and time, with and without ammonia, in order to derive kinetic expressions for polymer yield. The evolution in molecular structure as a function of time and temperature was studied using infrared spectroscopy. Using these kinetic expressions, the yield of organic solids is estimated for extended time and temperature ranges. For example, the half-life for organic solid formation is ∼5 days at 373 K, ∼200 days at 323 K, and ∼70 years at 273 K with ammonia, and ∼25 days at 373 K, ∼13 years at 323 K, and ∼2 × 104 years at 273 K without ammonia. These results indicate that organic solids could form during the aqueous alteration in meteorite parent bodies. If liquid water existed early in the interiors of Kuiper belt objects (KBOs), formaldehyde could convert into organic solids at temperatures close to 273 K, and possibly even below 273 K in the ammonia-water system.

  7. 40 CFR 262.58 - International agreements. (United States)


    ... universal waste management standards of 40 CFR Part 273, or subject to State requirements analogous to 40... waste meets the Federal definition of hazardous waste in 40 CFR 261.3 and is subject to either the Federal RCRA manifesting requirements at 40 CFR part 262, subpart B, the universal waste management...

  8. Possible Suppression of Magnetorotational Instability by Rapid Radial Flow

    Czech Academy of Sciences Publication Activity Database

    Abramowicz, M. A.; Horák, Jiří; Kluzniak, W.


    Roč. 63, č. 2 (2013), s. 267-273 ISSN 0001-5237 R&D Projects: GA ČR(CZ) GAP209/11/2004 Institutional support: RVO:67985815 Keywords : accretion disks * magnetohydrodynamics * black hole physics Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 1.955, year: 2013

  9. Physical Education Pedagogy Faculty Perceptions of Journal Quality (United States)

    Silverman, Stephen; Kulinna, Pamela Hodges; Phillips, Sharon R.


    This study examined perceived journal quality by physical education pedagogy faculty members. Participants (N = 273) were identified in three ways and recruited through e-mail. Based on research in other fields investigating journal quality and on publication patterns in physical education, a web-based survey was used to examine (a) whether…

  10. The efficacy of the skin delayed-type hypersensitivity using a brucellin prepared from a mucoid strain of Brucella abortus to detect brucellosis

    NARCIS (Netherlands)

    Bercovich, Z.; Muskens, J.A.M.


    Eight-hundred-and-ninety-six cattle belonging to herds officially designated Brucella-free, and 190 cattle belonging to infected herds were tested with the skin delayed-type hypersensitivity (SDTH) test, using brucellin (273) prepared from a rnucoid strain of Brucella abortus. An increase in

  11. Impact of Game-Based Training on Classroom Learning Outcomes (United States)


    Erwin, 2000). Several studies support the notion that GBT increases learners’ motivation. Massively multiple online role-playing games ( MMORPGs ) are...synthetic arenas where players interact, collaborate, and strategize with others. The nature of MMORPGs challenges players to think critically role-playing games ( MMORPGs ) foster intrinsic motivation. Educational Technology Research and Development, 55, 253-273. Dondi, C., & Moretti

  12. 75 FR 64692 - Green Technology Pilot Program (United States)


    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Green Technology Pilot Program ACTION: Proposed...- 0062 Green Technology Pilot Program comment'' in the subject line of the message. Fax: 571-273-0112... United States Patent and Trademark Office (USPTO) implemented a pilot program on December 8, 2009, that...

  13. Anti-cancer effects of blue-green alga Spirulina platensis, a natural source of bilirubin-like tetrapyrrolic compounds

    Czech Academy of Sciences Publication Activity Database

    Koníčková, R.; Vaňková, K.; Vaníková, J.; Váňová, K.; Muchová, L.; Subhanová, I.; Zadinová, M.; Zelenka, Jaroslav; Dvořák, Aleš; Kolář, Michal; Strnad, Hynek; Rimpelová, S.; Ruml, T.; Wong, R.J.; Vítek, L.


    Roč. 13, č. 2 (2014), s. 273-283 ISSN 1665-2681 Institutional support: RVO:67985823 ; RVO:68378050 Keywords : bilirubin * chlorophyll * heme oxygenase * phycocyanin * phycocyanobilin * Spirulina platensis * tetrapyrroles Subject RIV: FD - Oncology ; Hematology Impact factor: 2.065, year: 2014

  14. ORIGINAL ARTICLES Prevalence of drug-drug interactions of ...

    African Journals Online (AJOL)


    Feb 2, 2008 ... Table II. Frequency of level 2 interactions between ARVs and the other drugs. Interacting ARVs and other drugs. N. %*. Didanosine + ketoconazole. 1. 0.91. Didanosine + ofloxacin. 1. 0.91. Didanosine + ciprofloxacin. 2. 1.82. Didanosine + iraconazole. 3. 2.73. Didanosine + ketoconazole. 2. 1.82. Efavirenz ...

  15. Gclust Server: 103939 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 103939 PoTR_594761 Cluster Sequences Related Sequences(127) 273 eugene3.66280001 1 ...1.00e-60 14.29 0.0 0.0 0.0 0.0 0.0 Show 103939 Cluster ID 103939 Sequence ID PoTR_594761 Link to cluster seq

  16. Effects of learned flavour cues on short-term regulation of food intake in a realistic setting

    NARCIS (Netherlands)

    Zandstra, E.H.; Stubenitsky, K.; Graaf, de C.; Mela, D.J.


    The present study examined the effects of repeated midmorning consumption of novel-flavoured low- and high-energy yoghurt drinks on subsequent energy intake at lunch in 69 adults under actual use conditions. Subjects consumed 200 ml of low- and high-energy yoghurt drinks (67 and 273 kcal/200 ml,

  17. The role of Her2 and other oncogenes of the PI3K/AKT pathway in mitochondria

    Czech Academy of Sciences Publication Activity Database

    Rohlenová, Kateřina; Neužil, Jiří; Rohlena, Jakub


    Roč. 397, č. 7 (2016), s. 607-615 ISSN 1431-6730 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:86652036 Keywords : alpha-tocopheryl succinate * mitochondria * oxidase subunit-ii * protein-kinase b Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.273, year: 2016

  18. Dielectric spectroscopy of polymer nanocomposites based on tetrazol and KNO3

    International Nuclear Information System (INIS)

    Castro, R A; Lushin, E N


    For tetrazole polymers by dielectric spectroscopy the existence of three relaxation processes in the temperature range T=273-423 K is revealed, the values of relaxation and structural parameters are determined: activation energy E A and glass transition temperature T g

  19. Women's use of information and communication technology in ...

    African Journals Online (AJOL)

    Women's use of information and communication technology in accessing maternal and child health information in Nigeria. ... MCH information was accessed through mobile phones (76.0%), radio (66.9%), television (55.1%), the Internet (27.3%) and the public address system/projector (2.5%). The MCH information themes ...

  20. Direct, rapid quantitative analyses of BVOCs using SIFT-MS and PTR-MS obviating sample collection

    Czech Academy of Sciences Publication Activity Database

    Smith, D.; Španěl, Patrik


    Roč. 30, č. 7 (2011), s. 945-959 ISSN 0165-9936 Institutional research plan: CEZ:AV0Z40400503 Keywords : SIFT-MS * PTR-MS * Absolute quantification Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.273, year: 2011

  1. Human manipulative behavior in the Central European Late Eneolithic and Early Bronze Age: humeral bilateral asymmetry

    Czech Academy of Sciences Publication Activity Database

    Sládek, Vladimír; Berner, M.; Sosna, D.; Sailer, R.


    Roč. 133, č. 1 (2007), s. 669-681 ISSN 0002-9483 R&D Projects: GA ČR GP206/01/D018 Institutional research plan: CEZ:AV0Z60930519 Keywords : cross-sectional geometry * biomechanics * humerus * handedness * Eneolithic * Bronze Age Subject RIV: AC - Archeology, Anthropology, Ethnology Impact factor: 2.273, year: 2007

  2. Auxin inhibits endocytosis and promotes its own efflux from cells

    Czech Academy of Sciences Publication Activity Database

    Paciorek, T.; Zažímalová, Eva; Ruthardt, N.; Petrášek, Jan; Stierhof, Y. D.; Kleine-Vehn, J.; Morris, David; Emans, N.; Jürgens, G.; Geldner, N.; Friml, J.


    Roč. 435, č. 7046 (2005), s. 1251-1256 ISSN 0028-0836 R&D Projects: GA AV ČR IAA6038303 Institutional research plan: CEZ:AV0Z50380511 Keywords : Phytohormones * polar auxin transport * plasma membrane Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 29.273, year: 2005

  3. 12 CFR 27.6 - Substitute monitoring program. (United States)


    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Substitute monitoring program. 27.6 Section 27.6 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN... (12 CFR 202.13(d)). A bank collecting the data in compliance with § 27.3 of this part will be in...

  4. Nonuniform Grain Boundary Corrosion and the Local Electrode Potential in Crevicing. Types and Models of Precipitation Induced Nonuniform Grain Boundary Corrosion. Investigation of Sensitization and Grain Boundary Corrosion in Ferritic Stainless Steel. The Local Electrode Potential in Cavities, Crevices and Cracks and Its Role in Causing Degradation of Structural Materials. (United States)


    gratitude to the Instituto Universitario de Tecnologia - Regi6n Capital and to Consejo Nacional de Investigaciones Cientificas y Tecnologicas, both in...electrochemical and exposure pitting test with passive metals". Paper No. 273. CORROSION 66. National Association of Corrosion Engineers. 1986. 3D

  5. Descriptive survey of personal hygiene and knowledge of exposure ...

    African Journals Online (AJOL)

    Majority of the poultry workers have adequate personal hygiene while use of antiseptics as part of hand washing practices is relatively low. Forty-three percent of poultry workers have some knowledge of occupational exposure factors and 27.3% have some knowledge of non-occupational exposure factors to zoonotic ...

  6. Revisiting the Model of Creative Destruction: St. Jacobs, Ontario, a Decade Later (United States)

    Mitchell, Clare J. A.; de Waal, Sarah B.


    Ten years ago, the model of creative destruction was developed to predict the fate of communities that base their development on the commodification of rural heritage (Mitchell, C.J.A., 1998. Entrepreneurialism, commodification and creative destruction: a model of post-modern community development. Journal of Rural Studies 14, 273-286). Its…

  7. Contracting Improvements Still Needed in DoD’s FY 2011 Purchases Made Through the Department of Veterans Affairs (United States)


    693 Neiman Street Fort Detrick, MD 21702 Federal Supply Schedule 2) W81XWH-11-F-0091 273,679 Diode Laser US Army Medical Materiel Agency 693...Supply Schedule 8) W91YTZ-11-F-0049 190,470 Video Processor ( Surgical Scopes) PR Centralized ORG and INSTL PBO W2L6 Womack Army Medical Center

  8. Improvement of dynamic absorber by means of weak stops

    Czech Academy of Sciences Publication Activity Database

    Půst, Ladislav


    Roč. 48, č. 48 (2003), s. 273-299 ISSN 0001-7043 R&D Projects: GA AV ČR IBS2076301 Institutional research plan: CEZ:AV0Z2076919 Keywords : damping of vibrations * 2DOF system * Hert's Impacts Subject RIV: BI - Acoustics

  9. ORF Alignment: NC_006370 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_006370 gi|54310056 >1r0wC 45 273 39 283 1e-54 ... ref|YP_131076.1| putative ABC-type metal ion transports...ative ... ABC-type metal ion transportsystem, ATPase component ... [Photobacterium profundum

  10. Hypoxic versus normoxic external-beam irradiation of cervical carcinoma combined with californium-252 neutron brachytherapy. Comparative treatment results of a 5-year randomized study

    Czech Academy of Sciences Publication Activity Database

    Tačev, T.; Vacek, Antonín; Ptáčková, B.; Strnad, V.


    Roč. 181, č. 5 (2005), s. 273-284 ISSN 0179-7158 Institutional research plan: CEZ:AV0Z50040507 Keywords : cervical carcinoma * hypoxyradiotherapy * californium-252 Subject RIV: BO - Biophysics Impact factor: 3.490, year: 2005

  11. Sibship size, birth order, and personality. (United States)

    Abdel-Khalek, Ahmed; Lester, David


    In a sample of 273 American college students who were administered seven personality tests, only death obsession scores were consistently associated with sibship size and birth order (not optimism, pessimism, anxiety, a Taoist orientation, suicidal ideation, or obsessive-compulsive tendencies).

  12. A Cross-Sectional Study in Addis Ababa

    African Journals Online (AJOL)



    Jun 2, 2017 ... design, we interviewed 273 HIV-infected adolescents receiving ART from three hospitals in Addis Ababa. ... Bivariate and multivariate methods were used for analysis. ... found to be significantly associated with optimum ART adherence. ... Though earlier presentation of adolescents to care should be.

  13. Occurrence and fumonisin B2 producing potential of Aspergillus section Nigri in Brazil nuts

    DEFF Research Database (Denmark)

    Ferranti, Larissa S.; Correa, Benedito; Fungaro, Maria Helena P.


    and to verify the toxigenic potential for fumonisin B2 (FB2) production of these isolates along with the presence of this mycotoxin in Brazil nut samples. The fungal infection ranged from 0 to 80% at the different stages of the harvest and processing chain and the water activity of the nuts from 0.273 to 0...

  14. Aboveground biomass subdivisions in woody species of the savanna ecosystem project study area, Nylsvley

    CSIR Research Space (South Africa)

    Rutherford, MC


    Full Text Available Aboveground peak season biomass is given for 11 woody species in each of five belt transects under study. Mean aerial biomass for all species was 16 273 kg ha, made up of 14 937 kg ha wood, 236 kg ha current season's twigs and 1 100 kg ha leaves...

  15. Modifiable risk factors of coronary heart disease in male first time ...

    African Journals Online (AJOL)

    The following parameters were recorded: personal details, health status, smoking habits, mass, height, body composition, blood pressure, total cholesterol, physical working capacity and predicted aerobic capacity. The majority of subjects (50.9 %) displayed two or more, 27.3 % three or more and 8.2 % four or more, risk ...

  16. Early Exposures to Ecogenomics: Effects of Priming and Web Site Interactivity Among Adolescents

    NARCIS (Netherlands)

    Bos, Mark J.W.; Koolstra, Cees M.; Willems, J.T.J.M.


    In the context of public introductions to emerging technologies, this study examined effects of priming and Web site interactivity on adolescents’ attitude development and information processing. In a four (priming) by three (interactivity levels) experiment, participants (N = 273) were required to

  17. Early exposures to ecogenomics: Effects of priming and website interactivity among adolescents

    NARCIS (Netherlands)

    Bos, M.J.W.; Koolstra, C.M.; Willems, J.T.J.M.


    In the context of public introductions to emerging technologies, this study examined effects of priming and Web site interactivity on adolescents' attitude development and information processing. In a four (priming) by three (interactivity levels) experiment, participants (N = 273) were required to

  18. Early exposures to ecogenomics: Effects of priming and web site interactivity among adolescents

    NARCIS (Netherlands)

    Bos, M.J.W.; Koolstra, C.M.; Willems, J.T.J.M.


    In the context of public introductions to emerging technologies, this study examined effects of priming and Web site interactivity on adolescents' attitude development and information processing. In a four (priming) by three (interactivity levels) experiment, participants (N = 273) were required to

  19. An Exploration of Adlerian Lifestyle Themes and Alcohol-Related Behaviors among College Students (United States)

    Lewis, Todd F.; Osborn, Cynthia J.


    The aim of this study was to investigate college student drinking through the lens of Adlerian theory. In a sample of 273 participants, multiple regression analyses confirmed that certain lifestyle themes were associated with alcohol-related behaviors and that men and women who engage in drinking differ in their convictions and goals as defined by…

  20. Upper Abdominal Ultra-Sonography Findings in HIV Patients at ...

    African Journals Online (AJOL)

    Design: A descriptive cross-sectional study. Setting: Kenyatta National Hospital and the Defence Forces Memorial Hospital, Nairobi, Kenya. Subjects: HIV infected patients referred for upper abdominal sonography within the study duration of eight months. Results: Two hundred and seventy three (273) patients were ...

  1. Modeling and Evaluating Emotions Impact on Cognition (United States)


    Causality and Responsibility Judgment in Multi-Agent Interactions: Extended abstract. 23rd International Joint Conference on Artificial Inteligence ...responsibility judgment in multi-agent interactions." Journal of Artificial Intelligence Research v44(1), 223- 273. • Morteza Dehghani, Jonathan Gratch... Artificial Intelligence (AAAI’11). Grant related invited talks: • Keynote speaker, Workshop on Empathic and Emotional Agents at the International

  2. What Is Salvia? (United States)

    ... 273-TALK (they don't just talk about suicide—they cover a lot of issues and will help put you in touch with someone close by) If you need information on drug treatment and where you can find it, the Substance Abuse and Mental Health Services Administration can help. Call ...

  3. Prescription Pain Medications (Opioids) (United States)

    ... 273-TALK (they don't just talk about suicide—they cover a lot of issues and will help put you in touch with someone close by) If you need information on drug treatment and where you can find it, the Substance Abuse and Mental Health Services Administration can help. Call ...

  4. Heroin (United States)

    ... 273-TALK (they don't just talk about suicide—they cover a lot of issues and will help put you in touch with someone close by) If you need information on drug treatment and where you can find it, the Substance Abuse and Mental Health Services Administration can help. Call ...

  5. Climatic factors affecting radial growth of Betula ermanii and Betula platypylla in Kamchatka

    Czech Academy of Sciences Publication Activity Database

    Doležal, Jiří; Ishii, H.; Kyncl, Tomáš; Takahashi, K.; Vetrova, V. P.; Homma, K.; Sumida, A.; Hara, T.


    Roč. 40, č. 2 (2010), s. 273-285 ISSN 0045-5067 R&D Projects: GA ČR GA206/05/0119; GA AV ČR IAA600050802 Institutional research plan: CEZ:AV0Z60050516 Keywords : tree-ring widths * boreal forest * Central Japan Subject RIV: EF - Botanics Impact factor: 1.574, year: 2010

  6. Long-term adaptation of methanol-fed thermophilic (55°C) sulfate-reducing reactors to NaCl

    NARCIS (Netherlands)

    Vallero, M.V.G.; Lettinga, G.; Lens, P.N.L.


    A laboratory-scale upflow anaerobic sludge bed (UASB) reactor was operated during 273 days at increasing NaCl concentrations (0.5-12.5 g NaCl l(-1)) to assess whether the stepwise addition of the salt NaCl results in the acclimation of that sludge. The 6.5-1 thermophilic (55 degreesC), sulfidogenic

  7. Journal of Earth System Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Volume 121 Issue 2 April 2012 pp 273-285. Development of multimodel ensemble based district level medium range rainfall forecast system for Indian region .... 123 Issue 7 October 2014 pp 1637-1652. Forecasting of cyclone Viyaru and Phailin by NWP-based cyclone prediction system (CPS) of IMD – an evaluation.

  8. Motivations to Seek Science Videos on YouTube: Free-Choice Learning in a Connected Society (United States)

    Rosenthal, Sonny


    Do individuals use video sharing sites in their free time to learn about science, and if so, why? This study takes a preliminary look at individual differences that motivate online science video seeking. Among 273 Singapore Internet users who participated in an online survey, most reported using YouTube during the previous week, and one-third…

  9. 78 FR 19483 - Telemarketing Sales Rule Information Collection Activities; Proposed Collection; Comment Request (United States)


    ... telemarketers, data last appearing in the DMA 2009 Statistical Fact Book (February 2009), p. 18, shows that 17... available direct sales data for telephone marketing to consumers. See DMA Statistical Fact Book (2001), p... consumers with one or more credit cards (113,611,032) by the delinquency rate for credit cards (2.73...

  10. Letter to the Editor

    Directory of Open Access Journals (Sweden)

    Thomas K. Karikari


    Full Text Available This article is a reaction to a previously published article in the Journal of Microbiology & Biology Education, “Gamification of the Laboratory Experience to Encourage Student Engagement” by Kevin Drace (JMBE 14(2:273–274, 2013.

  11. The Codevelopment of Sympathy and Overt Aggression from Middle Childhood to Early Adolescence (United States)

    Zuffianò, Antonio; Colasante, Tyler; Buchmann, Marlis; Malti, Tina


    We assessed the extent to which feelings of sympathy and aggressive behaviors codeveloped from 6 to 12 years of age in a representative sample of Swiss children (N = 1,273). Caregivers and teachers reported children's sympathy and overt aggression in 3-year intervals. Second-order latent curve models indicated general mean-level declines in…

  12. Preventing Teen Pregnancy PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    This 60 second public service announcement is based on the April 2015 CDC Vital Signs report. Teen births in the U.S. have declined, but still, more than 273,000 infants were born to teens ages 15 to 19 in 2013. Learn about the most effective types of birth control.

  13. Vital Signs-Preventing Teen Pregnancy

    Centers for Disease Control (CDC) Podcasts

    This podcast is based on the April 2015 CDC Vital Signs report. Teen births in the U.S. have declined, but still, more than 273,000 infants were born to teens ages 15 to 19 in 2013. Learn about the most effective types of birth control.

  14. Regulation of Breast Cancer Stem Cell by Tissue Rigidity (United States)


    metastasis. Cancer Cell 20: 576– 590 . Ledford H. 2011. Cancer theory faces doubts. Nature 472: 273. Lee KE, Bar-Sagi D. 2010. Oncogenic KRas suppresses...blocks the cell cycle and confers resistance to cell death. Genes Dev 18: 1131–1143. Vesuna F, Lisok A, Kimble B, Raman V. 2009. Twist modulates

  15. Identifikační znaky samic čolků rodu Triturus podrodu Paleotriton, druhové skupiny vulgaris na území České republiky

    Czech Academy of Sciences Publication Activity Database

    Zavadil, V.; Piálek, Jaroslav


    Roč. 49, č. 3 (2000), s. 263-273 ISSN 0323-0627 R&D Projects: GA MŽP MR/610/1/96; GA MŠk VS97102 Institutional research plan: CEZ:AV0Z6093917 Keywords : genus Triturus * morphological traits Subject RIV: EG - Zoology

  16. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 200 of 273 ... Vol 38, No 3 (2012), New Glucopyranosylglyceryl-N-Octenyl Adipate and Bioactivity of Retro and Condensed Chalcones from Toussaintia Orientalis ... Vol 38, No 3 (2012), Organochlorine Pesticides and Degradation Products in Soil around a Former Formulation Plant in Morogoro Municipality, ...

  17. Host Response to Botulinum Neurotoxins for Developing Diagnostics and Antidotes (United States)


    Toxin: Chemistry , Pharmacology, Toxicity, and Immunology. Muscle and Nerve Suppl. (6), S1-S23. Cai, S., Sarkar, H. K., and Singh, B. R., 1999...subsequent refolding by a multichaperone network. J. Biol. Chem. 273, 11032-11037. Vickery, L. E., Silberg , J. J., and Ta, D. T. (1997). Hsc66


    African Journals Online (AJOL)


    Chem. Soc. Ethiop. 2016, 30(2), 273-282. ISSN 1011-3924. Printed in Ethiopia ... future [7]. CNSL is considered as one of the promising natural sources of phenolic compounds, useful as .... temperature on the rate of polymerization as well as the molecular weight of the polymer ..... John, G.; Vemula, P.K. Soft Matter. 2006, 2 ...

  19. Structure of the motor subunit of type I restriction-modification complex EcoR124I

    Czech Academy of Sciences Publication Activity Database

    Lapkouski, Mikalai


    Roč. 1, č. 16 (2009), s. 94-95 ISSN 1545-9985 Institutional research plan: CEZ:AV0Z60870520 Keywords : SWI2/SNF2 ATPASE * DNA * ENDONUCLEASE Subject RIV: CE - Biochemistry Impact factor: 12.273, year: 2009

  20. Structure of the motor subunit of type I restriction-modification complex EcoR124I

    Czech Academy of Sciences Publication Activity Database

    Lapkouski, Mikalai; Panjikar, S.; Janscak, P.; Kutá-Smatanová, Ivana; Carrey, J.; Ettrich, Rüdiger; Cséfalvay, Eva


    Roč. 16, č. 1 (2009), s. 94-95 ISSN 1545-9985 R&D Projects: GA MŠk LC06073 Institutional research plan: CEZ:AV0Z60870520 Keywords : SWI2/SNF2 ATPASE * DNA * endonuclease * protein * translocation * helicase * treckings * enzymes * core * time Subject RIV: CE - Biochemistry Impact factor: 12.273, year: 2009

  1. A RhoGDP dissociation inhibitor spatially regulates growth in root hair cells

    Czech Academy of Sciences Publication Activity Database

    Carol, R.J.; Takeda, S.; Linstead, P.; Durrant, M.C.; Toupalová, Hana; Derbyshire, P.; Drea, S.; Žárský, Viktor; Dolan, L.


    Roč. 438, č. 7070 (2005), s. 1013-1016 ISSN 0028-0836 R&D Projects: GA ČR GA204/02/1461 Institutional research plan: CEZ:AV0Z50380511 Keywords : NADPH OXIDASE * MEDICAGO-TRUNCATULA * TIP GROWTH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 29.273, year: 2005

  2. Editorial comment on “Testicular microlithiasis: Case report and ...

    African Journals Online (AJOL)

    ... Rubens DJ, Liao L. Benign intratesticular cystic lesions: US features. Radiographics 2001;21:S273–81. [2] Gooding GA, Leonhardt W, Stein R. Testicular cysts: US findings. Radi- ology 1987;163:537–8. [3] Hamm B, Fobbe F, Loy V. Testicular cysts: differentiation with US and clinical findings. Radiology 1988;168:19–23.

  3. Anionic catalyst binders based on trimethylamine-quaternized poly(2,6-dimethyl-1,4-phenylene oxide) for alkaline electrolyzers

    Czech Academy of Sciences Publication Activity Database

    Schauer, Jan; Hnát, J.; Brožová, Libuše; Žitka, Jan; Bouzek, K.


    Roč. 473, 1 January (2015), s. 267-273 ISSN 0376-7388 Institutional support: RVO:61389013 Keywords : poly(2,6-dimethyl-1,4-phenylene oxide) * bromination * trimethylamine Subject RIV: CD - Macromolecular Chemistry Impact factor: 5.557, year: 2015

  4. Dynamic Protocol Reverse Engineering: A Grammatical Inference Approach (United States)


    domain-specific languages”. OOPSLA ’05: Companion to the 20th annual ACM SIGPLAN conference on Object-oriented programming, systems, languages, and...Representation to k-TSS Lan- guage Models”. Computación y Sistemas , 3(4):273–244, 2000. ISSN 1405-5546. 256. Trakhtenbrot, B.A. and Y.M. Barzdin. Finite

  5. Pillai, Prof. Madhavan Radhakrishna

    Indian Academy of Sciences (India)

    Date of birth: 18 August 1960. Specialization: Tumour Biology, Tumour Virology Address: Director, Rajiv Gandhi Centre for Biotechnology, Jagathi, Thiruvananthapuram 695 014, Kerala Contact: Office: (0471) 234 7973, (0471) 234 1716. Residence: (0471) 273 3819. Mobile: 94471 45776. Fax: (0471) 234 9303

  6. A new [(1R,2R)-1,2-diaminocyclohexane]platinum(II) complex: formation by nitrate-acetonitrile ligand exchange

    Czech Academy of Sciences Publication Activity Database

    Pažout, R.; Housková, J.; Dušek, Michal; Maixner, J.; Cibulková, J.; Kačer, P.


    Roč. 66, Part 10 (2010), m273-m275 ISSN 0108-2701 Institutional research plan: CEZ:AV0Z10100521 Keywords : platinum complexes * structure analysis * disorder * cyclohexane * diamine Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.745, year: 2010

  7. Assignment of the porcine SKI and GABRD genes to chromosome 6q22-q23

    Czech Academy of Sciences Publication Activity Database

    Stratil, Antonín; Knorr, C.; Knoll, Aleš; Kubíčková, S.; Musilová, P.; Van Poucke, M.; Rubeš, J.; Brenig, B.; Peelman, L. J.


    Roč. 36, - (2005), s. 272-273 ISSN 0268-9146 R&D Projects: GA ČR GA523/03/0858 Institutional research plan: CEZ:AV0Z50450515 Keywords : SKI gene * GABRD gene Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.437, year: 2005

  8. Exploring the Impact of Historically Black Colleges in Promoting the Development of Undergraduates' Self-Concept. (United States)

    Berger, Joseph B.; Milem, Jeffrey F.


    Study explores how institutional context affects the development of self-concept in a sample of 273 African American college students. Findings suggest that students attending church affiliated historically Black colleges develop significantly higher self-ratings in three domains of self-concept-psychosocial wellness, academic, and achievement…

  9. Fulltext PDF

    Indian Academy of Sciences (India)

    Asteroseismology ofγ Scuti Stars: Problems and Prospects (M.-J. Goupil, M. A. Dupret,. R. Samadi, T. Boehm, E. Alecian, J. C. Suarez, Y. Lebreton & C. Catala), 249. Pulsations in Subdwarf B Stars (C. Simon Jeffery), 261. Lessons for Asteroseismology from White Dwarf Stars (Travis S. Metcalfe), 273. On the Analysis of Light ...

  10. Alternative Schools. An Analysis of Their Impact on Administrators: Part II (United States)

    Sachs, David; Codding, Judy


    Extensive interviews with school personnel of alternative programs reveal that it is in the process of defining their essence with regard to decision-making, admissions, policies, responsibility, freedom, calendars, and programs vs. school identity that planning problems arise. (A related document is EA 507 273.) (Author/MLF)

  11. Potential of the strain Raoultella sp KDF8 for removal of analgesics

    Czech Academy of Sciences Publication Activity Database

    Palyzová, Andrea; Zahradník, Jiří; Marešová, Helena; Sokolová, Lucie; Kyslíková, Eva; Grulich, Michal; Štěpánek, Václav; Řezanka, Tomáš; Kyslík, Pavel


    Roč. 63, č. 3 (2018), s. 273-282 ISSN 0015-5632 R&D Projects: GA TA ČR TH02030337 Institutional support: RVO:61388971 ; RVO:86652036 Keywords : Microbial degradation * Raoultella sp. * Analgesics Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.521, year: 2016

  12. East African Medical Journal - Vol 94, No 4 (2017)

    African Journals Online (AJOL)

    Sero prevalence of hepatitis B and C viruses among HIV infected patients in a HIV care program in Kenya: a cross sectional study · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. S.B. Okoth, O.F. Rehmani, M.J. Karoney, L Diero, P.O. Ayuo, 266-273 ...

  13. The variety, popularity and nutritional quality of tuck shop items ...

    African Journals Online (AJOL)

    Method: A cross-sectional tuck shop survey. Nutritional analyses were conducted using the ... Results: Savoury pies were the most popular lunch item for all learners for both breaks (n = 5, 45%, and n = 3, 27.3%), selling the most number of units (43) per day at eight schools (72.7%). Iced popsicles were sold at almost every ...

  14. 11

    African Journals Online (AJOL)

    a routine working week. Special ... day of the working week and retested after finishing work on ... 4. 3. Med. 11,8. 12. -ye. 0. 5. 5. Med. 27,3. 107. -ye. 2. 6. 6. Med. 17,1. 80. -Ye. 0. 7. 3 .... present hours after first exposure (e.g. at night), it is also.

  15. Cambodian Parental Involvement: The Role of Parental Beliefs, Social Networks, and Trust (United States)

    Eng, Sothy; Szmodis, Whitney; Mulsow, Miriam


    The role of social capital (parental beliefs, social networks, and trust) as a predictor of parental involvement in Cambodian children's education was examined, controlling for human capital (family socioeconomic status). Parents of elementary students (n = 273) were interviewed face to face in Cambodia. Teacher contact scored highest, followed by…

  16. Notch co-operates with Lozenge/Runx to lock hemocytes into a differentiation programme

    Czech Academy of Sciences Publication Activity Database

    Terriente-Felix, A.; Li, J.; Collins, S.; Mulligan, A.; Reekie, I.; Bernard, F.; Krejčí, Alena; Bray, S.


    Roč. 140, č. 4 (2013), s. 926-937 ISSN 0950-1991 R&D Projects: GA ČR(CZ) GAP305/11/0126 Grant - others:MRC programme(GB) G0800034 Institutional support: RVO:60077344 Keywords : Lozenge/Runx * Notch * chromatin immunoprecipitation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.273, year: 2013

  17. Viděno vlastníma očima. Nález neznámého konceptu autobiografie Pavla Janáka

    Czech Academy of Sciences Publication Activity Database

    Hnídková, Vendula


    Roč. 56, č. 3 (2008), s. 237-242, 273 ISSN 0049-5123 Institutional research plan: CEZ:AV0Z80330511 Keywords : Pavel Janák * Czech architecture of the 20th century * autobiography Subject RIV: AL - Art, Architecture, Cultural Heritage

  18. Subjective Happiness of Lebanese College Youth in Lebanon: Factorial Structure and Invariance of the Arabic Subjective Happiness Scale (United States)

    Moghnie, Lamia; Kazarian, Shahe S.


    The present study evaluated the subjective happiness of Lebanese college youth using a multi-item rather than a single-item subjective happiness measure. An Arabic translation of the Subjective Happiness Scale (SHS) was administered to 273 Lebanese college youth from state- and private-run higher institutions of learning, as was the Arabic Adult…

  19. Optical properties of self-polarized PZT ferroelectric films

    Czech Academy of Sciences Publication Activity Database

    Deineka, Alexander; Jastrabík, Lubomír; Suchaneck, G.; Gerlach, G.


    Roč. 273, - (2002), s. 155-160 ISSN 0015-0193 R&D Projects: GA MŠk LN00A015; GA ČR GA202/00/1425 Institutional research plan: CEZ:AV0Z1010914 Keywords : ferroelectric film * phase transition * band gap Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.408, year: 2002

  20. Data of evolutionary structure change: 1AIFL-2AI0L [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available /ss_2> 0 n> 1AIF L...n> 1AIFLn> VSSSI----SSSNL 2AI0 Ln> 2AI0L...1AIFL-2AI0L 1AIF 2AI0 L L DIQLTQSPAFMAASPGEKVTITCSVSSSI----SSSNLH...line> SER CA 273 SER CA 260 ASN CA 337 LEU CA 408

  1. Molecular diversity and genetic relationships in Secale

    Indian Academy of Sciences (India)

    Molecular diversity and genetic relationships in Secale. E. Santos, M. Matos, P. Silva, A. M. Figueiras, C. Benito and O. Pinto-Carnide. J. Genet. 95, 273–281. Table 1. RAPD and ISSR primers used in this study. Primer. 5 –3. Primer. 5 –3. RAPDs (Operon). A1. CAGGCCCTTC. C5. CATGACCGCC. A4. AATCGGGCTG. C6.

  2. Book Reviews | Wilson | Italian Studies in Southern Africa/Studi d ...

    African Journals Online (AJOL)

    M. Grazia Sumeli Weinberg, Invito alla lettura di Dacia Maraini, Pretoria: University of South Africa, 1993. pp. xvi & 273. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians ...

  3. A Plasmid Containing the Human Metallothionein II Gene Can Function as an Antibody-assisted Electrophoretic Biosensor for Heavy Metals (United States)


    Biol. Chem. 273:7127–7133. Brugnera, E., Georgiev, O., Radtke , F., et al. 1994. Cloning, chromosomal mapping and characterization of the human metal...Signaling events for metallothionein induction. Mutat. Res. 533:211–226. Heuchel, R., Radtke , F., Georgiev, O., et al. 1994. The transcription factor MTF

  4. Effects of nutrient and water level changes on the composition and size structure of zooplankton communities in shallow lakes under different climatic conditions: a pan-European mesocosm experiment

    Czech Academy of Sciences Publication Activity Database

    Tavşanoglu, Ü.N.; Šorf, Michal; Stefanidis, K.; Brucet, S.; Turkan, S.; Agasild, H.; Baho, D.L.; Scharfenberger, U.; Hejzlar, Josef; Papastergiadou, E.; Adrian, R.; Angeler, D.G.; Zingel, P.; Çakiroglu, A.I.; Ozen, A.; Drakare, S.; Sondergaard, M.; Jeppesen, E.; Beklioglu, M.


    Roč. 51, č. 2 (2017), s. 257-273 ISSN 1386-2588 EU Projects: European Commission(XE) 244121 - REFRESH Institutional support: RVO:60077344 Keywords : climate change * water level change * zooplankton * size structure * mesocosms Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 1.500, year: 2016

  5. Implications of Work Values to Job Satisfaction in the Maryland Cooperative Extension Service. (United States)

    Milliken, W. James; Whaples, Gene C.

    A study was done to determine if work values of the Maryland Cooperative Extension Service faculty were related to Herzberg's job satisfaction elements. The design was ex post facto, exploratory field research. Subjects included 273 extension faculty members. A mail questionnaire composed of Hughes and Flowers'"Values for Working" and an…

  6. Authors: G Ferreira and A Ferreira-Snyman

    African Journals Online (AJOL)


    question the theoretical explanation for their recourse to international law. ... so as to build a united and democratic South Africa able to take its rightful ..... Minister of State for Immigration and Ethnic Affairs v Teoh [1995] 183 CLR 273 286-287.

  7. 40 CFR 60.276 - Recordkeeping and reporting requirements. (United States)


    ... values exceeding ±15 percent of the value established under § 60.274(c) or operation at flow rates lower...; (4) Flow diagram of process and emission capture equipment including other equipment or process(es... or operator shall maintain records of all shop opacity observations made in accordance with § 60.273...

  8. Degradation of natural toxins by phthalocyanines-example of cyanobacterial toxin, microcystin

    Czech Academy of Sciences Publication Activity Database

    Jančula, D.; Blahová, L.; Karásková, M.; Maršálek, Blahoslav


    Roč. 62, č. 2 (2010), s. 273-278 ISSN 0273-1223 R&D Projects: GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : microcystin * phthalocyanine * singled oxygen Subject RIV: EF - Botanics Impact factor: 1.056, year: 2010

  9. Usutu Virus in Blackbirds (Turdus merula), Czech Republic, 2011-2012

    Czech Academy of Sciences Publication Activity Database

    Hubálek, Zdeněk; Rudolf, Ivo; Čapek, Miroslav; Bakonyi, T.; Betášová, Lenka; Nowotny, N.


    Roč. 61, č. 3 (2014), s. 273-276 ISSN 1865-1674 Institutional support: RVO:68081766 Keywords : Usutu virus * blackbird * Turdus merula * Czechland Subject RIV: GJ - Animal Vermins ; Diseases , Veterinary Medicine Impact factor: 2.944, year: 2014

  10. 78 FR 2669 - Waste Import and Export; Inquiry To Learn Whether Businesses Assert Business Confidentiality Claims (United States)


    ... definition of ``affected business,'' and are not covered by today's notice. They consist of any business that... waste'' is defined at 40 CFR 273.9. Certain businesses, however, do not meet the definition of...; Inquiry To Learn Whether Businesses Assert Business Confidentiality Claims AGENCY: Environmental...

  11. probing the cob(ii)alamin conductor hypothesis with glutamate ...

    African Journals Online (AJOL)


    Glutamate mutase activity was also demonstrated upon incubation of GlmS and E with 3',5'- ... overproduced in E.coli (Huhta et al. 2001,. Huhta et ..... Biochemistry. 37: 9704-9715. Buckel W 2001 Unusual enzymes involved in five pathways of glutamate fermentation. Appl. Microbiol. Biotechnol. 57: 263-273. Buckel W and ...

  12. Livestock associated epidemiological information profiling in New Sandwip Island (Jahajerchar of the Meghna estuary, Noakhali using participatory disease searching tool

    Directory of Open Access Journals (Sweden)

    SK Shaheenur Islam


    Conclusion: This place is potential for sheep and buffalo raising rather than cattle. The study has validated the significance of accepting participatory disease searching tool in order to capture voluntarily submitted epidemiological data towards establishing a cost effective, unique national disease surveillance system in Bangladesh. [J Adv Vet Anim Res 2017; 4(3.000: 267-273

  13. Zircon in highly evolved hercynian Homolka granite, Moldanubian zone, Czech Republic: indicator of magma source and petrogenesis

    Czech Academy of Sciences Publication Activity Database

    Uher, P.; Breiter, K.; Klečka, M.; Pivec, Edvín


    Roč. 49, č. 3 (1998), s. 151-160 ISSN 0016-7738 Grant - others:SK(CZ) VEGA 4078 Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.273, year: 1998

  14. Prevalence and economic loss of bovine tuberculosis in a municipal ...

    African Journals Online (AJOL)

    A 12 month cross-sectional study was carried out at Lafenwa Abattoir Abeokuta, Southwestern Nigeria from July, 2011 to June, 2012. This was to determine the prevalence and economic loss of bovine tuberculosis in this abattoir. A total of 928 cases of bovine tuberculosis out of 52,273 cattle slaughtered during this period ...

  15. Journal of Earth System Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... College Station, TX 77843. Present address: Barrens Consulting Co., 273 Pepe's Farm Road, Milford, CT 06470. Department of Physics, Sam Houston State University, Huntsville, TX 77341. Present address: SN4, NASA-JSC, Houston, TX 77858. Shell Development Corporation, P.O. Box 481, Houston, Texas 77001.

  16. Micro‐CT analyses of apical enlargement and molar root canal complexity

    DEFF Research Database (Denmark)

    Markvart, M.; Darvann, Tron Andre; Larsen, P.


    Markvart M, Darvann TA, Larsen P, Dalstra M, Kreiborg S, Bjørndal L. Micro‐CT analyses of apical enlargement and molar root canal complexity. International Endodontic Journal, 45, 273–281, 2012. Aim To compare the effectiveness of two rotary hybrid instrumentation techniques with focus on apical...

  17. Liquid and Gas Permeation Studies on the Structure and Properties of Polyamide Thin-Film Composite Membranes

    KAUST Repository

    Duan, Jintang


    layer by gas adsorption and gas permeation measurements. Gas adsorption isotherms (N2 at 77K, CO2 at 273K) confirmed the microporous nature of PA in comparison with dense CTA and polysulfone materials. Gas permeation through the commercial PA

  18. Quantitative Determination of Telomerase Activity in Breast Cancer and Benign Breast Diseases

    Czech Academy of Sciences Publication Activity Database

    Šimíčková, M.; Nekulová, M.; Pecen, Ladislav; Černoch, M.; Vagundová, M.; Pačovský, Z.


    Roč. 48, č. 4 (2001), s. 267-273 ISSN 0028-2685 R&D Projects: GA MZd NM17 Institutional research plan: AV0Z1030915 Keywords : telomerase activity * quantitative analysis * breast cancer * benign breast diseases * prognisis Subject RIV: BA - General Mathematics Impact factor: 0.637, year: 2001

  19. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 273 ... L sold at vegetable farms in Katsina Metropolis, Abstract PDF ... of optimum maturity of maize using image processing and artificial neural networks ... Vol 9, No 1 (2014), Determination of entrance skin dose from diagnostic ...

  20. Market-Based Housing Finance Efficiency in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Sunega, Petr; Lux, Martin


    Roč. 7, č. 3 (2007), s. 241-273 ISSN 1461-6718 R&D Projects: GA ČR GA403/06/0915 Institutional research plan: CEZ:AV0Z70280505 Keywords : housing finance * transition economies * finance efficiency Subject RIV: AO - Sociology, Demography

  1. Women's Issues and Epilepsy: A Look at Health Care Practitioners ...

    African Journals Online (AJOL)

    About thirty six percent of the respondents were neurologists, 27.3% were in Internal Medicine while the rest comprised of general practitioners, pediatric neurologists, neurosurgeons, neuroscience nurses and neurophysiologists. There was poor knowledge of the effect of sex hormones on seizure threshold during ...

  2. Performance of commercial laying hen genotypes on free range and organic farms in Switzerland, France and The Netherlands

    NARCIS (Netherlands)

    Leenstra, F.R.; Maurer, V.; Bestman, M.W.P.; Sambeek van, F.; Zeltner, E.; Reuvekamp, B.F.J.; Galea, F.; Niekerk, van T.G.C.M.


    1. A total of 257 farmers with free ranging laying hens (organic and conventional) in Switzerland, France and The Netherlands with 273 flocks were interviewed to determine the relationships between the genotype of the hens, management conditions and performance. 2. Almost 20 different genotypes

  3. Dicty_cDB: Contig-U13954-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 281 e-109 EU080331_1( EU080331 |pid:none) Phytophthora cuyabensis isolate PD... 294 e-109 EU079512_1( EU0795...D_0... 273 e-102 EU080357_1( EU080357 |pid:none) Phytophthora cuyabensis isolate PD... 271 e-102 CP000090_28

  4. The Mass Comm Type: Student Personality Traits, Motivations, and the Choice between News and Strategic Communication Majors (United States)

    Crawford, Elizabeth Crisp; Fudge, Julie; Hubbard, Glenn T.; Filak, Vincent F.


    A study of news media and strategic communication majors (n = 273) revealed differences in regard to personality indices and impetuses for selecting to pursue degrees. Showing overall agreement in the importance of openness, agreeableness, and conscientiousness, strategic communication students were significantly higher in their ratings of…

  5. Variation in genome composition of blue-aleurone wheat

    Czech Academy of Sciences Publication Activity Database

    Burešová, Veronika; Kopecký, David; Bartoš, Jan; Martinek, P.; Watanabe, N.; Vyhnánek, T.; Doležel, Jaroslav


    Roč. 128, č. 2 (2015), s. 273-282 ISSN 0040-5752 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : TRITICUM-AESTIVUM L * COMMON WHEAT * THINOPYRUM-PONTICUM Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.900, year: 2015

  6. A Proposed Mechanism of Neuronal Injury in Pilots and Aircrew Personnel with Hypobaric Exposure (United States)


    business with the government, then your presentation should have an ethics review. If your travel is being paid for (in whole or in part) by a non...lesions in the elderly : pathophysiological h ypothesis on the effect on brain plasticity and reserve. J Neural Sci. 2008; 273(1-2):3-9. Kochunov P

  7. Generativity in College Students: Comparing and Explaining the Impact of Mentoring (United States)

    Hastings, Lindsay J.; Griesen, James V.; Hoover, Richard E.; Creswell, John W.; Dlugosh, Larry L.


    Preparing college students to be active contributors to the next generation is an important function of higher education. This assumption about generativity forms a cornerstone in this mixed methods study that examined generativity levels among 273 college students at a 4-year public university. MANCOVA results indicated that college students who…

  8. The Developmental Characteristics of Engagement in Service-Learning for Chinese College Students (United States)

    Guo, Fangfang; Yao, Meilin; Zong, Xiaoli; Yan, Wenfan


    The purpose of this study was to investigate the development characteristics of Chinese college students' engagement during a service-learning project with a case study method: 273 reflective journals from 31 college students who participated in service-learning were analyzed. Results indicated that students' overall engagement showed 4…

  9. Highly Stable Porous Covalent Triazine-Piperazine Linked Nanoflower as a Feasible Adsorbent for Flue Gas CO2 Capture

    KAUST Repository

    Das, Swapan Kumar; Wang, Xinbo; Ostwal, Mayur; Zhao, Yunfeng; Han, Yu; Lai, Zhiping


    robustness under acidic and basic medium and high thermal stability up to 773 K. The CTPP possess high surface area (779 m2/g) and single-component gas adsorption study exhibited enhanced CO2 and CH4 uptake of 3.48 mmol/g, 1.09 mmol/g, respectively at 273 K

  10. Mahalanobis distance screening of Arabidopsis mutants with chlorophyll fluorescence

    Czech Academy of Sciences Publication Activity Database

    Codrea, C. C.; Hakala-Yatkin, M.; Karlund-Marttila, A.; Nedbal, Ladislav; Aittokallio, T.; Nevalainen, O. S.; Tyystjärvi, E.


    Roč. 105, č. 3 (2010), s. 273-283 ISSN 0166-8595 Institutional research plan: CEZ:AV0Z60870520 Keywords : arabidopsis thaliana * chlorophyll fluorescence * fluorescence imaging * mutant detection * outlier detection Subject RIV: EH - Ecology, Behaviour Impact factor: 2.410, year: 2010

  11. Browse Title Index

    African Journals Online (AJOL)

    Items 201 - 250 of 273 ... Vol 34 (2008), Seed longevity of dominant plant species from degraded savanna ... Vol 28 (2002), Structural evolution of the Kilombero rift basin in central ... Vol 34 (2008), Survey of wind power potential for wind-based ...

  12. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 273 ... Vol 43, No 1 (2017), Design of a Small Scale Wind Generator for Low ... Seeding and Seedling Treatments on Plant Species Recovery in Kondoa ... size structure and distribution in non-Trawlable areas of Lake Victoria ...

  13. New observations on Micropleura australiensis (Nematoda, Dracunculoidea), a parasite of crocodiles in Australia

    Czech Academy of Sciences Publication Activity Database

    Moravec, František; Spratt, D. M.; Kay, W. R.


    Roč. 51, č. 4 (2006), s. 273-278 ISSN 1230-2821 R&D Projects: GA ČR(CZ) GA524/06/0170 Institutional research plan: CEZ:AV0Z60220518 Keywords : Micropleura * Crocodylus * Australia Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.772, year: 2006

  14. Dovedně zvládnutá přítomnost přináší příjemnou budoucnost: Sociální reprezentace smrti na Srí Lance u Theravádových mnichů a jejich podpůrců

    Czech Academy of Sciences Publication Activity Database

    Hytych, Roman


    Roč. 50, č. 3 (2006), s. 273-284 ISSN 0009-062X Institutional research plan: CEZ:AV0Z70250504 Keywords : social representations * death * cultural psychology Subject RIV: AN - Psychology Impact factor: 0.279, year: 2006

  15. Newly isolated Nodularia phage influences cyanobacterial community dynamics

    Czech Academy of Sciences Publication Activity Database

    Coloma, S.E.; Dienstbier, Ana; Bamford, D.H.; Sivonen, K.; Roine, E.; Hiltunen, T.


    Roč. 19, č. 1 (2017), s. 273-286 ISSN 1462-2912 Institutional support: RVO:61388971 Keywords : Baltic sea cyanobacteria * Blue-green-algae * Nitrogen-fixation Subject RIV: EE - Microbiology , Virology OBOR OECD: Microbiology Impact factor: 5.395, year: 2016

  16. Herbal dietary supplements and knowledge of appropriate use ...

    African Journals Online (AJOL)

    %) and Aloe vera (32.2%). Fifty eight (71.6%) out of the 81 respondents on prescription drugs were using it alongside HDS. Respondents with poor, fair and good knowledge of appropriate use of HDS were 69.1%, 27.3% and 3.6% respectively.

  17. Social Connectedness, Discrimination, and Social Status as Mediators of Acculturation/Enculturation and Well-Being (United States)

    Yoon, Eunju; Hacker, Jason; Hewitt, Amber; Abrams, Matthew; Cleary, Sarah


    The present study proposed and tested a conceptual model of acculturation/enculturation and subjective well-being (SWB) by including social connectedness in mainstream society, social connectedness in the ethnic community, perceived discrimination, and expected social status as mediators. Survey data from 273 Asian American college students in the…

  18. 48 CFR 752.219-71 - Mentor requirements and evaluation. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Mentor requirements and....219-71 Mentor requirements and evaluation. As prescribed in AIDAR 719.273-11(b), insert the following clause: Mentor Requirements and Evaluation (July 13, 2007) (a) Mentor and Protégé firms shall submit an...

  19. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 200 of 273 ... Vol 11, No 4 (2016), Numerical solutions of fifth order boundary ... F – statistic: an example of sales distribution of pharmaceutical drugs, Abstract PDF ... Vol 12, No 4 (2017), Optimization of traffic light control system of an ...

  20. Effect of exogenous stress on UCP2 level and apoptosis in neonatal rat cardiomyocytes

    Czech Academy of Sciences Publication Activity Database

    Modrianský, M.; Psotová, J.; Smolková, Katarína; Šantorová, Jitka; Ježek, Petr


    Roč. 273, č. S1 (2006), s. 163-163 ISSN 1474-3833. [FEBS Congress /31./. 24.06.2006-29.06.2006, Istanbul] R&D Projects: GA ČR(CZ) GA301/05/0221 Keywords : mitochondrial uncoupling proteins * apoptosis * antioxidant defence Subject RIV: CE - Biochemistry