WorldWideScience

Sample records for bmi1 function independently

  1. MK3 modulation affects BMI1-dependent and independent cell cycle check-points.

    Directory of Open Access Journals (Sweden)

    Peggy Prickaerts

    Full Text Available Although the MK3 gene was originally found deleted in some cancers, it is highly expressed in others. The relevance of MK3 for oncogenesis is currently not clear. We recently reported that MK3 controls ERK activity via a negative feedback mechanism. This prompted us to investigate a potential role for MK3 in cell proliferation. We here show that overexpression of MK3 induces a proliferative arrest in normal diploid human fibroblasts, characterized by enhanced expression of replication stress- and senescence-associated markers. Surprisingly, MK3 depletion evokes similar senescence characteristics in the fibroblast model. We previously identified MK3 as a binding partner of Polycomb Repressive Complex 1 (PRC1 proteins. In the current study we show that MK3 overexpression results in reduced cellular EZH2 levels and concomitant loss of epigenetic H3K27me3-marking and PRC1/chromatin-occupation at the CDKN2A/INK4A locus. In agreement with this, the PRC1 oncoprotein BMI1, but not the PCR2 protein EZH2, bypasses MK3-induced senescence in fibroblasts and suppresses P16INK4A expression. In contrast, BMI1 does not rescue the MK3 loss-of-function phenotype, suggesting the involvement of multiple different checkpoints in gain and loss of MK3 function. Notably, MK3 ablation enhances proliferation in two different cancer cells. Finally, the fibroblast model was used to evaluate the effect of potential tumorigenic MK3 driver-mutations on cell proliferation and M/SAPK signaling imbalance. Taken together, our findings support a role for MK3 in control of proliferation and replicative life-span, in part through concerted action with BMI1, and suggest that the effect of MK3 modulation or mutation on M/SAPK signaling and, ultimately, proliferation, is cell context-dependent.

  2. p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

    Science.gov (United States)

    Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

    2015-01-01

    Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

  3. Reciprocal expression of Bmi1 and Mel-18 is associated with functioning of primitive hematopoietic cells.

    Science.gov (United States)

    Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao

    2009-07-01

    The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.

  4. Dysregulation of the Bmi-1/p16Ink4a pathway provokes an aging-associated decline of submandibular gland function

    Science.gov (United States)

    Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo

    2015-01-01

    Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744

  5. BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

    Science.gov (United States)

    Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

    2010-02-21

    The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

  6. GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

    Directory of Open Access Journals (Sweden)

    Bart A Westerman

    Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

  7. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  8. BMI-1, a promising therapeutic target for human cancer

    Science.gov (United States)

    WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN

    2015-01-01

    BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537

  9. Bmi-1: At the crossroads of physiological and pathological biology

    Science.gov (United States)

    Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

    2015-01-01

    Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

  10. BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

    Science.gov (United States)

    Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

    2006-01-01

    Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

  11. The Role of BMI1 in CRPC

    Science.gov (United States)

    2017-10-01

    that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA

  12. Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

    2010-01-01

    Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

  13. The Role of BMI1 in CRPC

    Science.gov (United States)

    2016-10-01

    we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

  14. The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

    Science.gov (United States)

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

    2016-01-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

  15. BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

    Science.gov (United States)

    Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

    2017-12-01

    Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

  16. Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.

    Directory of Open Access Journals (Sweden)

    Shunsuke Nakamura

    Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.

  17. The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

    Science.gov (United States)

    Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

    2018-02-01

    Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

  18. Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma

    Directory of Open Access Journals (Sweden)

    Sara Badodi

    2017-12-01

    Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin

  19. Analysis list: BMI1 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

  20. Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

    Science.gov (United States)

    Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

    2016-01-01

    Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

  1. Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance

    Science.gov (United States)

    Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun

    2014-01-01

    To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841

  2. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    International Nuclear Information System (INIS)

    Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

    2012-01-01

    The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

  3. CD133 and BMI1 expressions and its prognostic role in primary ...

    Indian Academy of Sciences (India)

    This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.

  4. Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

    Directory of Open Access Journals (Sweden)

    Hourinaz Behesti

    2013-01-01

    BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

  5. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  6. BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

    Science.gov (United States)

    Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

    2016-01-01

    Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

  7. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    Directory of Open Access Journals (Sweden)

    Jiang Lili

    2012-09-01

    Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

  8. Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

    Science.gov (United States)

    Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

    2014-01-01

    Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

  9. Quadratic independence of coordinate functions of certain ...

    Indian Academy of Sciences (India)

    ... are `quadratically independent' in the sense that they do not satisfy any nontrivial homogeneous quadratic relations among them. Using this, it is proved that there is no genuine compact quantum group which can act faithfully on C ( M ) such that the action leaves invariant the linear span of the above coordinate functions.

  10. Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.

    Science.gov (United States)

    López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís

    2015-01-01

    Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.

  11. Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

    Science.gov (United States)

    Liu, Jiaguo; Luo, Bin; Zhao, Meng

    2017-01-01

    Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

  12. Clathrin-independent endocytosis: mechanisms and function

    DEFF Research Database (Denmark)

    Sandvig, Kirsten; Pust, Sascha; Skotland, Tore

    2011-01-01

    It is now about 20 years since we first wrote reviews about clathrin-independent endocytosis. The challenge at the time was to convince the reader about its existence. Then the suggestion came up that caveolae might be responsible for the uptake. However, clearly this could not be the case since ...... having several functions of their own. This article aims at providing a brief update on the importance of clathrin-independent endocytic mechanisms, how the processes are regulated differentially, for instance on the poles of polarized cells, and the challenges in studying them....

  13. Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

    NARCIS (Netherlands)

    Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

    2005-01-01

    The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

  14. File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

  15. File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

  16. File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

  17. File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

  18. File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

  19. File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

  20. File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

  1. File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

  2. File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

  3. File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

  4. File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

  5. Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

    NARCIS (Netherlands)

    Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

    2008-01-01

    Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

  6. Expression of Bmi-1 is a prognostic marker in bladder cancer

    Directory of Open Access Journals (Sweden)

    Xu Li-Hua

    2009-02-01

    Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

  7. Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

    Directory of Open Access Journals (Sweden)

    Xiaodong Li

    2016-11-01

    Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

  8. Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

    Directory of Open Access Journals (Sweden)

    Lowell Evan Michael

    2008-12-01

    Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

  9. [PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

    Science.gov (United States)

    Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

    2016-01-01

    Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

  10. Expression of Bmi-1 is a prognostic marker in bladder cancer

    International Nuclear Information System (INIS)

    Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

    2009-01-01

    The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

  11. MicroRNA-330-3p Expression Indicates Good Prognosis and Suppresses Cell Proliferation by Targeting Bmi-1 in Osteosarcoma

    Directory of Open Access Journals (Sweden)

    Zhenxin Zheng

    2018-03-01

    Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.

  12. Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

    Science.gov (United States)

    Lu, You-Wei; Li, Jin; Guo, Wei-Jian

    2010-11-08

    The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

  13. Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

  14. Bmi-1 expression modulates non-small cell lung cancer progression

    Science.gov (United States)

    Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

    2015-01-01

    Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

  15. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Directory of Open Access Journals (Sweden)

    Mehdi Hayat Shahi

    Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  16. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Science.gov (United States)

    Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

    2015-01-01

    BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  17. Functional Independence Measure Penderita Cedera Servikal

    Directory of Open Access Journals (Sweden)

    Muhammad Zafrullah Arifin

    2013-09-01

    Full Text Available Cervical spine injury is one of the most common spinal cord injuries in trauma patients. From 100,000 spinal cord injury cases reported in the United States of America (2008, 2/3 involved cervical spine injury. American Spinal Cord Injury Association (ASIA Impairment Score is used as an initial assessment but further prognostic outcome of these patients is often not paid enough attention. The objective of this study was to find the value of functional independence measure (FIM cervical spine injury patients with conservative management and correlation with age, sex, type of trauma, onset of trauma, cervical bone abnormalities, type of spinal lesion and ASIA Impairment Score. A prospective cohort study was performed to all patients with cervical spine injury which fullfil the inclusion criteria treated in Neurosurgery Department of Dr. Hasan Sadikin Hospital Bandung. The subjects were classified based on age, sex, single/multiple trauma, acute/chronic, cervical bone abnormalities, complete/incomplete lesion, ASIA impairment score and initial complication. The patients were performed to FIM examination in Outpatient clinic of Neurosurgery. T-test and chi-square test with p<0.05 were done to analyze the data. There were 17 cervical spine injury patients treated in Neurosurgery Department of Dr. Hasan Sadikin Hospital Bandung during April 2009–April 2010. The average FIM value of cervical spine injury in those patients was 4+1.63 by cohort prospective study. There were no correlation between FIM value with age (p=0.064, sex (p=0.144, type of trauma (p=0.959, onset of trauma (p=0.220 and cervical bone abnormalities (p=0.869. We found a significant correlation between FIM value with type of cervical spine lesion (p=0.037 and ASIA Impairment Score (p<0.001 in cervical spine patients. In conclusion, type of cervical spine lesion and ASIA impairment score have significant correlation with FIM value of patients in 3 months after cervical injury.

  18. Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

    Directory of Open Access Journals (Sweden)

    Anthony Flamier

    2018-05-01

    Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

  19. Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

    Science.gov (United States)

    Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

    2017-04-01

    We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  20. Quadratic independence of coordinate functions of certain ...

    Indian Academy of Sciences (India)

    ... functions of certain homogeneous spaces and action of compact quantum groups ..... Let A be a unital commutative C∗ algebra and x1,...,xn be self-adjoint elements of A ..... 2 in the power series expansion of ξ(·). The coefficient of .... his work on coadjoint orbits, which gave the author the motivation to consider the prob-.

  1. Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.

    Science.gov (United States)

    Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio

    2015-10-26

    The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in

  2. Method of synchronizing independent functional unit

    Science.gov (United States)

    Kim, Changhoan

    2018-03-13

    A system for synchronizing parallel processing of a plurality of functional processing units (FPU), a first FPU and a first program counter to control timing of a first stream of program instructions issued to the first FPU by advancement of the first program counter; a second FPU and a second program counter to control timing of a second stream of program instructions issued to the second FPU by advancement of the second program counter, the first FPU is in communication with a second FPU to synchronize the issuance of a first stream of program instructions to the second stream of program instructions and the second FPU is in communication with the first FPU to synchronize the issuance of the second stream program instructions to the first stream of program instructions.

  3. Executive dysfunction is independently associated with reduced functional independence in heart failure.

    Science.gov (United States)

    Alosco, Michael L; Spitznagel, Mary Beth; Raz, Naftali; Cohen, Ronald; Sweet, Lawrence H; Colbert, Lisa H; Josephson, Richard; van Dulmen, Manfred; Hughes, Joel; Rosneck, Jim; Gunstad, John

    2014-03-01

    To examine the independent association between executive function with instrumental activities of daily living and health behaviours in older adults with heart failure. Executive function is an important contributor to functional independence as it consists of cognitive processes needed for decision-making, planning, organising and behavioural monitoring. Impairment in this domain is common in heart failure patients and associated with reduced performance of instrumental activities of daily living in many medical and neurological populations. However, the contribution of executive functions to functional independence and healthy lifestyle choices in heart failure patients has not been fully examined. Cross-sectional analyses. One hundred and seventy-five heart failure patients completed a neuropsychological battery and echocardiogram. Participants also completed the Lawton-Brody Instrumental Activities of Daily Living Scale and reported current cigarette use. Hierarchical regressions revealed that reduced executive function was independently associated with worse instrumental activity of daily living performance with a specific association for decreased ability to manage medications. Partial correlations showed that executive dysfunction was associated with current cigarette use. Our findings suggest that executive dysfunction is associated with poorer functional independence and contributes to unhealthy behaviours in heart failure. Future studies should examine whether heart failure patients benefit from formal organisation schema (i.e. pill organisers) to maintain independence. Screening of executive function in heart failure patients may provide key insight into their ability to perform daily tasks, including the management of treatment recommendations. © 2013 John Wiley & Sons Ltd.

  4. Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

    Science.gov (United States)

    Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

    2017-09-01

    The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

  5. Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1

    International Nuclear Information System (INIS)

    Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon

    2008-01-01

    Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1

  6. Contributory factors for the functional independence of oldest old

    Directory of Open Access Journals (Sweden)

    Dâmarys Kohlbeck de Melo Neu Ribeiro

    2015-02-01

    Full Text Available OBJECTIVE To investigate the socioeconomic and clinical factors that contribute to the functional independence of the oldest old of a community. METHOD Cross-sectional quantitative study whose sample consisted of 214 elderly people registered in Basic Health Units. Data were collected through structured interviews and application of the Functional Independence Measure. We used descriptive statistics, and for association of the variables we used the Student t-test, ANOVA and Tukey's test for multiple comparisons. RESULTS The significant variables that contributed to the functional independence were remaining economically active, practicing physical and leisure activities, having a social life, eating fruits, vegetables and meat. The orientation to conduct these practices reduces the demand for care and help needed in everyday activities. CONCLUSION Maintaining independence is primordial to delay disability and presents itself as an excellent field of work for nursing.

  7. EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

    NARCIS (Netherlands)

    Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

    2008-01-01

    Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

  8. MiR-495 Promotes Senescence of Mesenchymal Stem Cells by Targeting Bmi-1

    Directory of Open Access Journals (Sweden)

    Xiujun Li

    2017-06-01

    Full Text Available Background/Aims: Mesenchymal stem cells (MSCs play an important role in regulating angiogenesis and immune balance. Abnormal proliferation and function of MSCs were reported at maternal fetal interface in patients with pre-eclampsia (PE. Micro-RNA-495 was known to be upregulated in the MSCs derived from patients with PE. However, it is not clear whether the up-regulated miR-495 is related to the pathogenesis of PE. Methods: We analyzed the expression of miR-495 in MSCs and umbilical cords derived from healthy pregnancies (NC and PE, then we upregulated or downregulated the expression of miR-495 in MSCs derived from NC and tested the proliferation, apoptosis, migration, invasion, tube formation and senescence. Results: In the current study, we found that the expression of miR-495 was significantly increased in both umbilical cord tissues and MSCs in patients with severe PE. Overexpressing miR-495 arrested cell cycle in S phase and promoted cell apoptosis. The supernatants from miR-495-overexpressed-MSCs inhibited the migration of MSCs and HTR-8/SVneo, invasion of HTR-8/SVneo and tube formation of HUVEC, while si-miR-495 had the opposite effects. Furthermore, we analyzed the senescence related β-galactosidase activity and CD146 and found that miR-495 induced the senescence of MSCs. Molecular mechanism studies confirmed that Bmi-1 mediated these effects of miR-495 on MSCs. Conclusion: Taken together, our data demonstrated that miR-495 induced senescence of MSCs may be involved in the pathogenesis of PE.

  9. miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

    2015-01-02

    Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

  10. Fuel shipment experience, fuel movements from the BMI-1 transport cask

    International Nuclear Information System (INIS)

    Bauer, Thomas L.; Krause, Michael G.

    1986-01-01

    The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask

  11. Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

    Science.gov (United States)

    2011-01-01

    Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

  12. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

    Science.gov (United States)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-22

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

    International Nuclear Information System (INIS)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-01

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

  14. BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

    2018-02-01

    B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

  15. Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    Carolina Nör

    2014-02-01

    Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs

  16. Functional Independent Scaling Relation for ORR/OER Catalysts

    DEFF Research Database (Denmark)

    Christensen, Rune; Hansen, Heine Anton; Dickens, Colin F.

    2016-01-01

    reactions. Here, we show that the oxygen-oxygen bond in the OOH* intermediate is, however, not well described with the previously used class of exchange-correlation functionals. By quantifying and correcting the systematic error, an improved description of gaseous peroxide species versus experimental data...... and a reduction in calculational uncertainty is obtained. For adsorbates, we find that the systematic error largely cancels the vdW interaction missing in the original determination of the scaling relation. An improved scaling relation, which is fully independent of the applied exchange-correlation functional...

  17. Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

    Science.gov (United States)

    Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

    2017-10-06

    We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

  18. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  19. Anti-aging Effect of Transplanted Amniotic Membrane Mesenchymal Stem Cells in a Premature Aging Model of Bmi-1 Deficiency

    Science.gov (United States)

    Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun

    2015-01-01

    To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922

  20. Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

    Directory of Open Access Journals (Sweden)

    Justin W Leung

    2014-03-01

    Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

  1. MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence.

    Directory of Open Access Journals (Sweden)

    Sujatha Venkataraman

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.

  2. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  3. Colour-independent partition functions in coloured vertex models

    Energy Technology Data Exchange (ETDEWEB)

    Foda, O., E-mail: omar.foda@unimelb.edu.au [Dept. of Mathematics and Statistics, University of Melbourne, Parkville, VIC 3010 (Australia); Wheeler, M., E-mail: mwheeler@lpthe.jussieu.fr [Laboratoire de Physique Théorique et Hautes Energies, CNRS UMR 7589 (France); Université Pierre et Marie Curie – Paris 6, 4 place Jussieu, 75252 Paris cedex 05 (France)

    2013-06-11

    We study lattice configurations related to S{sub n}, the scalar product of an off-shell state and an on-shell state in rational A{sub n} integrable vertex models, n∈{1,2}. The lattice lines are colourless and oriented. The state variables are n conserved colours that flow along the line orientations, but do not necessarily cover every bond in the lattice. Choosing boundary conditions such that the positions where the colours flow into the lattice are fixed, and where they flow out are summed over, we show that the partition functions of these configurations, with these boundary conditions, are n-independent. Our results extend to trigonometric A{sub n} models, and to all n. This n-independence explains, in vertex-model terms, results from recent studies of S{sub 2} (Caetano and Vieira, 2012, [1], Wheeler, (arXiv:1204.2089), [2]). Namely, 1.S{sub 2}, which depends on two sets of Bethe roots, {b_1} and {b_2}, and cannot (as far as we know) be expressed in single determinant form, degenerates in the limit {b_1}→∞, and/or {b_2}→∞, into a product of determinants, 2. Each of the latter determinants is an A{sub 1} vertex-model partition function.

  4. Colour-independent partition functions in coloured vertex models

    International Nuclear Information System (INIS)

    Foda, O.; Wheeler, M.

    2013-01-01

    We study lattice configurations related to S n , the scalar product of an off-shell state and an on-shell state in rational A n integrable vertex models, n∈{1,2}. The lattice lines are colourless and oriented. The state variables are n conserved colours that flow along the line orientations, but do not necessarily cover every bond in the lattice. Choosing boundary conditions such that the positions where the colours flow into the lattice are fixed, and where they flow out are summed over, we show that the partition functions of these configurations, with these boundary conditions, are n-independent. Our results extend to trigonometric A n models, and to all n. This n-independence explains, in vertex-model terms, results from recent studies of S 2 (Caetano and Vieira, 2012, [1], Wheeler, (arXiv:1204.2089), [2]). Namely, 1.S 2 , which depends on two sets of Bethe roots, {b 1 } and {b 2 }, and cannot (as far as we know) be expressed in single determinant form, degenerates in the limit {b 1 }→∞, and/or {b 2 }→∞, into a product of determinants, 2. Each of the latter determinants is an A 1 vertex-model partition function

  5. Platelet size and age determine platelet function independently

    International Nuclear Information System (INIS)

    Thompson, C.B.; Jakubowski, J.A.; Quinn, P.G.; Deykin, D.; Valeri, C.R.

    1984-01-01

    A study was undertaken to examine the interaction of platelet size and age in determining in vitro platelet function. Baboon megakaryocytes were labeled in vivo by the injection of 75Se-methionine. Blood was collected when the label was predominantly associated with younger platelets (day 2) and with older platelets (day 9). Size-dependent platelet subpopulations were prepared on both days by counterflow centrifugation. The reactivity of each platelet subpopulation was determined on both days by measuring thrombin-induced aggregation. Platelets were fixed after partial aggregation had occurred by the addition of EDTA/formalin. After removal of the aggregated platelets by differential centrifugation, the supernatant medium was assayed for remaining platelets and 75Se radioactivity. Comparing day 2 and day 9, no significant difference was seen in the rate of aggregation of a given subpopulation. However, aggregation was more rapid in the larger platelet fractions than in the smaller ones on both days. A greater percentage of the 75Se radioactivity appeared in the platelet aggregates on day 2 than on day 9. This effect was independent of platelet size, as it occurred to a similar extent in the unfractionated platelets and in each of the size-dependent platelet subpopulations. The data indicate that young platelets are more active than older platelets. This study demonstrates that size and age are both determinants of platelet function, but by independent mechanisms

  6. Green close-quote s function method with energy-independent vertex functions

    International Nuclear Information System (INIS)

    Tsay Tzeng, S.Y.; Kuo, T.T.; Tzeng, Y.; Geyer, H.B.; Navratil, P.

    1996-01-01

    In conventional Green close-quote s function methods the vertex function Γ is generally energy dependent. However, a model-space Green close-quote s function method where the vertex function is manifestly energy independent can be formulated using energy-independent effective interaction theories based on folded diagrams and/or similarity transformations. This is discussed in general and then illustrated for a 1p1h model-space Green close-quote s function applied to a solvable Lipkin many-fermion model. The poles of the conventional Green close-quote s function are obtained by solving a self-consistent Dyson equation and model space calculations may lead to unphysical poles. For the energy-independent model-space Green close-quote s function only the physical poles of the model problem are reproduced and are in satisfactory agreement with the exact excitation energies. copyright 1996 The American Physical Society

  7. Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance

    International Nuclear Information System (INIS)

    Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia

    2012-01-01

    Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the

  8. MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

    Science.gov (United States)

    Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

    2018-03-01

    Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

  9. Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

    Directory of Open Access Journals (Sweden)

    Mohamed Abdouh

    Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

  10. FIG4 regulates lysosome membrane homeostasis independent of phosphatase function.

    Science.gov (United States)

    Bharadwaj, Rajnish; Cunningham, Kathleen M; Zhang, Ke; Lloyd, Thomas E

    2016-02-15

    FIG4 is a phosphoinositide phosphatase that is mutated in several diseases including Charcot-Marie-Tooth Disease 4J (CMT4J) and Yunis-Varon syndrome (YVS). To investigate the mechanism of disease pathogenesis, we generated Drosophila models of FIG4-related diseases. Fig4 null mutant animals are viable but exhibit marked enlargement of the lysosomal compartment in muscle cells and neurons, accompanied by an age-related decline in flight ability. Transgenic animals expressing Drosophila Fig4 missense mutations corresponding to human pathogenic mutations can partially rescue lysosomal expansion phenotypes, consistent with these mutations causing decreased FIG4 function. Interestingly, Fig4 mutations predicted to inactivate FIG4 phosphatase activity rescue lysosome expansion phenotypes, and mutations in the phosphoinositide (3) phosphate kinase Fab1 that performs the reverse enzymatic reaction also causes a lysosome expansion phenotype. Since FIG4 and FAB1 are present together in the same biochemical complex, these data are consistent with a model in which FIG4 serves a phosphatase-independent biosynthetic function that is essential for lysosomal membrane homeostasis. Lysosomal phenotypes are suppressed by genetic inhibition of Rab7 or the HOPS complex, demonstrating that FIG4 functions after endosome-to-lysosome fusion. Furthermore, disruption of the retromer complex, implicated in recycling from the lysosome to Golgi, does not lead to similar phenotypes as Fig4, suggesting that the lysosomal defects are not due to compromised retromer-mediated recycling of endolysosomal membranes. These data show that FIG4 plays a critical noncatalytic function in maintaining lysosomal membrane homeostasis, and that this function is disrupted by mutations that cause CMT4J and YVS. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. BMI-1 Mediates Estrogen-Deficiency-Induced Bone Loss by Inhibiting Reactive Oxygen Species Accumulation and T Cell Activation.

    Science.gov (United States)

    Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun

    2017-05-01

    Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and

  12. Relationship between theory of mind and functional independence is mediated by executive function.

    Science.gov (United States)

    Ahmed, Fayeza S; Miller, L Stephen

    2013-06-01

    Theory of mind (ToM) is the ability to comprehend another person's perspective. Although there is much literature of ToM in children, there is a limited and somewhat inconclusive amount of studies examining ToM in a geriatric population. This study examined ToM's relationship to functional independence. Two tests of ToM, tests of executive function, and a measure of functional ability were administered to cognitively intact older adults. Results showed that 1 test of ToM (Strange Stories test) significantly accounted for variance in functional ability, whereas the other did not (Faux Pas test). In addition, Strange Stories test performance was partially driven by a verbal abstraction-based executive function: proverb interpretation. A multiple mediation model was employed to examine whether executive functions explained the relationship between the Strange Stories test and functional ability. Results showed that both the combined and individual indirect effects of the executive function measures mediated the relationship. We argue that, although components of ToM are associated with functional independence, ToM does not appear to account for additional variance in functional independence beyond executive function measures. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  13. Association of ATM and BMI-1 genetic variation with breast cancer risk in Han Chinese.

    Science.gov (United States)

    Yue, Li-Ling; Wang, Fu-Chao; Zhang, Ming-Long; Liu, Dan; Chen, Ping; Mei, Qing-Bu; Li, Peng-Hui; Pan, Hong-Ming; Zheng, Li-Hong

    2018-04-24

    We tested the hypothesis that genetic variation in ATM and BMI-1 genes can alter the risk of breast cancer through genotyping 6 variants among 524 breast cancer cases and 518 cancer-free controls of Han nationality. This was an observational, hospital-based, case-control association study. Analyses of single variant, linkage, haplotype, interaction and nomogram were performed. Risk was expressed as odds ratio (OR) and 95% confidence interval (CI). All studied variants were in the Hardy-Weinberg equilibrium and were not linked. The mutant allele frequencies of rs1890637, rs3092856 and rs1801516 in ATM gene were significantly higher in cases than in controls (P = .005, ATM gene were significantly associated with 1.98-fold and 6.04-fold increased risk of breast cancer (95% CI: 1.36-2.90 and 1.65-22.08, respectively). Nomogram analysis estimated that the cumulative proportion of 3 significant variants in ATM gene was about 12.5%. Our findings collectively indicated that ATM gene was a candidate gene in susceptibility to breast cancer in Han Chinese. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  14. [Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

    Science.gov (United States)

    Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

    2014-06-01

    To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

  15. Correlation between demographic characteristics, cognitive functioning and functional independence in stroke patients

    Directory of Open Access Journals (Sweden)

    Arsić Slađana

    2016-01-01

    Full Text Available Introduction. It has been assumed that there is causality of the achieved level of functional independence with the degree of preservation of cognitive function in stroke patients. Demographic characteristics may be important for monitoring the achieved level of functional independence. Objective. The aim of this study was to examine the relationship of demographic characteristics and functional independence in regard to the level of cognitive impairment in stroke patients. Methods. The study included 50 stroke patients after rehabilitation, as well as age- and gender-matched 50 subjects selected randomly, according to the demographic characteristics of the studied sample, who in their medical history had no neurological disorders. For the assessment of functional independence, the Functional Independence Measure (FIM test was used. The general cognition was estimated by the Mini-Mental State Examination (MMSE test. The statistical analyses included the Mann-Whitney test, for two independent samples, measures of canonical correlation, and χ2 test. Results. There was a statistically significant difference between the groups in relation to risk factors, hypertension and diabetes mellitus type II (p<0.001; There was a statistically significant difference within the groups in relation to the cognitive impairment in all the examined demographic characteristics (p<0.001; the differences within the groups in relation to the cognitive impairment are present on all subscales of the FIM test (p<0.05; the differences within the groups in relation to handedness, hemiparesis, show that mild cognitive impairment is more common among left hemiparesis, while a more severe one is more common among right-sided hemiparesis (p<0.05; More severe cognitive impairment is common among women, the elderly and in persons with lower education (p<0.05. Conclusion. By prevention of risk factors, and prevention of possible cognitive impairment, consequences of stroke can be

  16. Executive functioning, motor programming, and functional independence: accounting for variance, people, and time.

    Science.gov (United States)

    Kraybill, Matthew L; Suchy, Yana

    2011-02-01

    Assessing functional independence is an important part of making diagnostic decisions and treatment recommendations but is often complicated by the limitations of self-report and behavioral measures. Alternatively, it may be worthwhile to investigate neurocognitive correlates of incipient functional declines including using tests of executive functioning (EF) and motor programming (MP). The current study examined an electronic MP task and pitted it against other assessment instruments to evaluate its relative utility in assessing both EF and functional independence. Participants were 72 community-dwelling older adults. Results of this study showed that the MP task was correlated with other measures of EF, an efficient and reliable predictor of functionality, useful for identifying at-risk patients, and comparable to a longer battery in terms of sensitivity and specificity.

  17. Decomposing a Utility Function Based on Discrete Distribution Independence

    DEFF Research Database (Denmark)

    He, Ying; Dyer, James; Butler, John

    2014-01-01

    For two-attribute decision-making problems, the multilinear utility model cannot be applied when the risk aversion on one attribute depends on the level of the other attribute. We propose a family of general preference conditions called nth-degree discrete distribution independence that can...... accommodate a variety of dependence relationships between two attributes. The special case of second-degree discrete distribution independence is equivalent to the utility independence condition. We focus on third-degree discrete distribution independence that leads to a decomposition formula that contains...

  18. Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

    2014-01-01

    Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

  19. The relationship between motor function, cognition, independence and quality of life in myelomeningocele patients.

    Science.gov (United States)

    Luz, Carolina Lundberg; Moura, Maria Clara Drummond Soares de; Becker, Karine Kyomi; Teixeira, Rosani Aparecida Antunes; Voos, Mariana Callil; Hasue, Renata Hydee

    2017-08-01

    Motor function, cognition, functional independence and quality of life have been described in myelomeningocele patients, but no study has investigated their relationships. We aimed to investigate the relationships between motor function, cognition, functional independence, quality of life, age, and lesion level in myelomeningocele patients, and investigate the influence of hydrocephalus on these variables. We assessed 47 patients with the Gross Motor Function Measure (motor function), Raven's Colored Progressive Matrices (cognition), Pediatric Evaluation of Disability Inventory (functional independence) and the Autoquestionnaire Qualité de vie Enfant Imagé (quality of life). Spearman's correlation tests determined relationships between the variables. The Friedman ANOVAs determined the influence of hydrocephalus. Motor function was strongly related to mobility and lesion level, and moderately related to cognition, self-care and social function. Cognition and quality of life were moderately related to functional independence. Age correlated moderately with functional independence and quality of life. Hydrocephalus resulted in poorer motor/cognitive outcomes and lower functional independence.

  20. Towards functional specification independent of control system suppliers

    International Nuclear Information System (INIS)

    Galara, D.; Leret, E.

    1997-01-01

    For the next nuclear power plant generation, REP 2000, the Engineering and construction Division (ED) and the Research and development Division (R and D) of Electricite de France are working together in the field of Instrumentation and Control (I and C) to improve its engineering method and tools. This method and these tools are defined on the basis of the experience feedback from the N4 nuclear power plant generation and the current information technology, to improve engineering competitiveness and quality of control applications. We intend to decouple the I and C processing from the I and C Human Machine Interface (HMI), because methods and tools are different. In this paper, we only focus on method and tools for I and C processing. We define the I and C processing life cycle into three phases. The first phase is the specification of the control application processing, the product of which is called Functional Requirement Diagrams (FRDs). The second phase is the design of the I and C system. This phase is subdivided into two steps. The step 1 is the distribution of the FRDs into an I and C architecture. The step 2 is the allocation of resources of the I and C system, to support the distributed FRDs. The third phase is the implementation of the distributed FRDs into I and C equipment. The aim of the Engineering Division is to achieve formal FRDs, independent of I and C suppliers. This allows a large improvement for the quality of the specification and the dimensioning of the I and C system before calls for tenders. For the specification phase, studies are almost completed. For the design and the implementation phases, studies and experiments are in progress with European I and C system suppliers. As a conclusion, we present the interest of EDF for standards and especially IEC 1131 improvements. (author). 5 figs

  1. Towards functional specification independent of control system suppliers

    Energy Technology Data Exchange (ETDEWEB)

    Galara, D; Leret, E [Electricite de France, Research and Development Div., Power Plant Control Branch, Chatou (France)

    1997-07-01

    For the next nuclear power plant generation, REP 2000, the Engineering and construction Division (ED) and the Research and development Division (R and D) of Electricite de France are working together in the field of Instrumentation and Control (I and C) to improve its engineering method and tools. This method and these tools are defined on the basis of the experience feedback from the N4 nuclear power plant generation and the current information technology, to improve engineering competitiveness and quality of control applications. We intend to decouple the I and C processing from the I and C Human Machine Interface (HMI), because methods and tools are different. In this paper, we only focus on method and tools for I and C processing. We define the I and C processing life cycle into three phases. The first phase is the specification of the control application processing, the product of which is called Functional Requirement Diagrams (FRDs). The second phase is the design of the I and C system. This phase is subdivided into two steps. The step 1 is the distribution of the FRDs into an I and C architecture. The step 2 is the allocation of resources of the I and C system, to support the distributed FRDs. The third phase is the implementation of the distributed FRDs into I and C equipment. The aim of the Engineering Division is to achieve formal FRDs, independent of I and C suppliers. This allows a large improvement for the quality of the specification and the dimensioning of the I and C system before calls for tenders. For the specification phase, studies are almost completed. For the design and the implementation phases, studies and experiments are in progress with European I and C system suppliers. As a conclusion, we present the interest of EDF for standards and especially IEC 1131 improvements. (author). 5 figs.

  2. Upper limb function and functional independence in patients with shoulder pain after stroke

    OpenAIRE

    Nickel, Renato; Lange, Marcos; Stoffel, Diane Priscila; Navarro, Elaine Janeczko; Zetola, Viviane F

    2017-01-01

    ABSTRACT Objective To examine the frequency of shoulder pain following stroke. Methods Stroke patient function was evaluated using the Functional Independence Measure (FIM) and Scale for Upper Limb Function in Stroke (SULFS). Function scores were examined and compared between the shoulder pain group (SPG) and the no shoulder pain group (No-SPG). Results A total of 58 patients, 22 women (37.9%), were included in this study. The mean patient age was 49.2±10.8 years and study evaluations w...

  3. 18 CFR 358.5 - Independent functioning rule.

    Science.gov (United States)

    2010-04-01

    ... its marketing function employees. (b) Separation of functions. (1) A transmission provider is prohibited from permitting its marketing function employees to: (i) Conduct transmission functions; or (ii... differs in any way from the access available to other transmission customers. (2) A transmission provider...

  4. On criteria for algebraic independence of collections of functions satisfying algebraic difference relations

    Directory of Open Access Journals (Sweden)

    Hiroshi Ogawara

    2017-01-01

    Full Text Available This paper gives conditions for algebraic independence of a collection of functions satisfying a certain kind of algebraic difference relations. As applications, we show algebraic independence of two collections of special functions: (1 Vignéras' multiple gamma functions and derivatives of the gamma function, (2 the logarithmic function, \\(q\\-exponential functions and \\(q\\-polylogarithm functions. In a similar way, we give a generalization of Ostrowski's theorem.

  5. Social Resources That Preserve Functional Independence After Memory Loss

    Science.gov (United States)

    2016-07-01

    Toward a common language for function, disability, and health. Physical therapy 86, 726 (May, 2006). 4. R. D. Tucker-Seeley, S. V. Subramanian, Y...20. Boyle PA, Buchman AS, Wilson RS, et al: Physical activity is asso- ciated with incident disability in community-based older persons. J Am Geriatr ...effects of physical activity on physical functioning, quality of life and depression in older people with dementia. Int J Geriatr Psychiatry. 2011

  6. Functional Independence in Late-Life: Maintaining Physical Functioning in Older Adulthood Predicts Daily Life Function after Age 80.

    Science.gov (United States)

    Vaughan, Leslie; Leng, Xiaoyan; La Monte, Michael J; Tindle, Hilary A; Cochrane, Barbara B; Shumaker, Sally A

    2016-03-01

    We examined physical functioning (PF) trajectories (maintaining, slowly declining, and rapidly declining) spanning 15 years in older women aged 65-80 and protective factors that predicted better current levels and less decline in functional independence outcomes after age 80. Women's Health Initiative extension participants who met criteria (enrolled in either the clinical trial or observational study cohort, >80 years at the data release cutoff, PF survey data from initial enrollment to age 80, and functional independence survey data after age 80) were included in these analyses (mean [SD] age = 84.0 [1.4] years; N = 10,478). PF was measured with the SF-36 (mean = 4.9 occasions). Functional independence was measured by self-reported level of dependence in basic and instrumental activities of daily living (ADLs and IADLs) (mean = 3.4 and 3.3 occasions). Maintaining consistent PF in older adulthood extends functional independence in ADL and IADL in late-life. Protective factors shared by ADL and IADL include maintaining PF over time, self-reported excellent or very good health, no history of hip fracture after age 55, and no history of cardiovascular disease. Better IADL function is uniquely predicted by a body mass index less than 25 and no depression. Less ADL and IADL decline is predicted by better self-reported health, and less IADL decline is uniquely predicted by having no history of hip fracture after age 55. Maintaining or improving PF and preventing injury and disease in older adulthood (ages 65-80) has far-reaching implications for improving late-life (after age 80) functional independence. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

    Science.gov (United States)

    Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

    2010-12-16

    Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

  8. DELLA genes restrict inflorescence meristem function independently of plant height.

    Science.gov (United States)

    Serrano-Mislata, Antonio; Bencivenga, Stefano; Bush, Max; Schiessl, Katharina; Boden, Scott; Sablowski, Robert

    2017-09-01

    DELLA proteins associate with transcription factors to control plant growth in response to gibberellin 1 . Semi-dwarf DELLA mutants with improved harvest index and decreased lodging greatly improved global food security during the 'green revolution' in the 1960-1970s 2 . However, DELLA mutants are pleiotropic and the developmental basis for their effects on plant architecture remains poorly understood. Here, we show that DELLA proteins have genetically separable roles in controlling stem growth and the size of the inflorescence meristem, where flowers initiate. Quantitative three-dimensional image analysis, combined with a genome-wide screen for DELLA-bound loci in the inflorescence tip, revealed that DELLAs limit meristem size in Arabidopsis by directly upregulating the cell-cycle inhibitor KRP2 in the underlying rib meristem, without affecting the canonical WUSCHEL-CLAVATA meristem size regulators 3 . Mutation of KRP2 in a DELLA semi-dwarf background restored meristem size, but not stem growth, and accelerated flower production. In barley, secondary mutations in the DELLA gain-of-function mutant Sln1d 4 also uncoupled meristem and inflorescence size from plant height. Our work reveals an unexpected and conserved role for DELLA genes in controlling shoot meristem function and suggests how dissection of pleiotropic DELLA functions could unlock further yield gains in semi-dwarf mutants.

  9. Independent contribution of individual white matter pathways to language function in pediatric epilepsy patients

    Directory of Open Access Journals (Sweden)

    Michael J. Paldino, M.D.

    2014-01-01

    Conclusions: Scalar metrics derived from the left uncinate, inferior fronto-occipital, and arcuate fasciculi were independently associated with language function. These results support the importance of these pathways in human language function in patients with MCDs.

  10. Apoptosis-Dependent and Apoptosis-Independent Functions Bim in Prostate Cancer Cells

    National Research Council Canada - National Science Library

    Liu, Junwei

    2004-01-01

    ... (death, survival, proliferation/division, etc). Our hypothesis is that, under normal, unstimulated conditions, with its apoptotic function blocked, the upregulated Bim in PCa cells play an apoptosis-independent function...

  11. Apoptosis-Dependent and Apoptosis-Independent Functions of Bim in Prostate Cancer Cells

    National Research Council Canada - National Science Library

    Tang, Dean; Liu, Junwei

    2005-01-01

    ... (death, survival, proliferation/division, etc.). Our hypothesis is that, under normal, unstimulated conditions, with its apoptotic function blocked, the upregulated Bim in PCa cells plays an apoptosis-independent function...

  12. Rate-distortion functions of non-stationary Markoff chains and their block-independent approximations

    OpenAIRE

    Agarwal, Mukul

    2018-01-01

    It is proved that the limit of the normalized rate-distortion functions of block independent approximations of an irreducible, aperiodic Markoff chain is independent of the initial distribution of the Markoff chain and thus, is also equal to the rate-distortion function of the Markoff chain.

  13. Co-Expression of Bmi-1 and Podoplanin Predicts Overall Survival in Patients With Squamous Cell Carcinoma of the Head and Neck Treated With Radio(chemo)therapy

    International Nuclear Information System (INIS)

    Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.

    2009-01-01

    Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy

  14. [In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

    Science.gov (United States)

    Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

    2018-03-28

    To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

  15. The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2011-09-01

    new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007

  16. The influence of demographic, environmental and physical factors on functional independence post stroke

    Directory of Open Access Journals (Sweden)

    M.V. Mamabolo

    2008-01-01

    Full Text Available Purpose: The magnitude of disability observed in strokesurvivors is believed to be dependent in part, on the severity of neurological deficits incurred. A s important but less well understood, is thecontribution of demographic, physical and environmental factors. The objective of this study was to establish what demographic, environmentaland physical factors influence functional independence post stroke. Method: Convenience sampling was used in the selection of subjects from four stroke outpatient public health facilities in the Gauteng Province of South Africa. The data were collected using a structured questionnaire. The analytical tools used included descriptive statistics to measure percentages and cross tabulations to measure the level of associations between functional independence and some of the demographic factors. The Barthel Index was computed to establish the degree of functional independence. Finally the influence of factors on functional independence was investigated using bivariate logistic regressions.Results: The results showed that younger patients (18 - 34 yrs may have a higher likelihood of functional independence compared to older patients at the time of discharge from hospital (18 - 34 years: Odds Ratio = 1. Patients without helpers were more likely to be functionally independent than those with a helper (p = 0.03. Involvement in household activities (p = 0.01, participation in community activities (p = 0.02 and bowel and bladder continence (p = 0.003 and p = 0.04 improved the likelihood of functional independence.Conclusion and im plications: Factors that influence functional independence post stroke are: age, bowel and bladder continence, the presence of a caregiver, participation in household and community activities. It is also of value to encourage patients to participate in household and community activities post stroke as well as being less dependent on helpers in an effort to attain functional independence post

  17. p38 MAPK-Mediated Bmi-1 Down-Regulation and Defective Proliferation in ATM-Deficient Neural Stem Cells Can Be Restored by Akt Activation

    Science.gov (United States)

    Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.

    2011-01-01

    A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053

  18. The Functional Independence of Mands and Tacts: Has It Been Demonstrated Empirically?

    Science.gov (United States)

    Gamba, Jonas; Goyos, Celso; Petursdottir, Anna Ingeborg

    2015-01-01

    Recently, there has been a proliferation of research on the functional independence of two of Skinner's (1957) verbal operants, the mand, and the tact. This research has produced highly variable results. In this article, we provide a critical review of the literature on mand-tact independence, a literature that has implications for both theory and…

  19. Reform of Kosovo Tax System after independence and its key functions

    OpenAIRE

    Dr.Sc. Bedri Peci

    2013-01-01

    In this paper we have analyzed the initial circumstances which characterize tax system in Kosovo after independence. After the Declaration of Independence, it is of the paramount importance that Kosovo has undergone through a reform of policy and tax system by exploring more seriously the economic functions. However, policy and tax system of Kosovo should be more in function of economic development by achieving equilibrium between direct and indirect taxes, increasing efficiency of public ...

  20. Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

    Directory of Open Access Journals (Sweden)

    Katarzyna Taran

    2016-02-01

    Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

  1. Measure of functional independence dominates discharge outcome prediction after inpatient rehabilitation for stroke.

    Science.gov (United States)

    Brown, Allen W; Therneau, Terry M; Schultz, Billie A; Niewczyk, Paulette M; Granger, Carl V

    2015-04-01

    Identifying clinical data acquired at inpatient rehabilitation admission for stroke that accurately predict key outcomes at discharge could inform the development of customized plans of care to achieve favorable outcomes. The purpose of this analysis was to use a large comprehensive national data set to consider a wide range of clinical elements known at admission to identify those that predict key outcomes at rehabilitation discharge. Sample data were obtained from the Uniform Data System for Medical Rehabilitation data set with the diagnosis of stroke for the years 2005 through 2007. This data set includes demographic, administrative, and medical variables collected at admission and discharge and uses the FIM (functional independence measure) instrument to assess functional independence. Primary outcomes of interest were functional independence measure gain, length of stay, and discharge to home. The sample included 148,367 people (75% white; mean age, 70.6±13.1 years; 97% with ischemic stroke) admitted to inpatient rehabilitation a mean of 8.2±12 days after symptom onset. The total functional independence measure score, the functional independence measure motor subscore, and the case-mix group were equally the strongest predictors for any of the primary outcomes. The most clinically relevant 3-variable model used the functional independence measure motor subscore, age, and walking distance at admission (r(2)=0.107). No important additional effect for any other variable was detected when added to this model. This analysis shows that a measure of functional independence in motor performance and age at rehabilitation hospital admission for stroke are predominant predictors of outcome at discharge in a uniquely large US national data set. © 2015 American Heart Association, Inc.

  2. Phase advance and β function measurements using model-independent analysis

    OpenAIRE

    Chun-xi Wang; Vadim Sajaev; Chih-Yuan Yao

    2003-01-01

    Phase advance and β function are basic lattice functions characterizing the linear properties of an accelerator lattice. Accurate and efficient measurements of these quantities are important for commissioning and operating a machine. For rings with little coupling, we report a new method to measure these lattice functions based on the model-independent analysis technique, which uses beam histories of excited betatron oscillations measured simultaneously at a large number of beam position moni...

  3. MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells.

    Science.gov (United States)

    Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee

    2017-12-15

    The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.

  4. Recombinant TAT-BMI-1 fusion protein induces ex vivo expansion of human umbilical cord blood-derived hematopoietic stem cells.

    Science.gov (United States)

    Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni

    2017-07-04

    Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.

  5. Functional Connectivity Parcellation of the Human Thalamus by Independent Component Analysis.

    Science.gov (United States)

    Zhang, Sheng; Li, Chiang-Shan R

    2017-11-01

    As a key structure to relay and integrate information, the thalamus supports multiple cognitive and affective functions through the connectivity between its subnuclei and cortical and subcortical regions. Although extant studies have largely described thalamic regional functions in anatomical terms, evidence accumulates to suggest a more complex picture of subareal activities and connectivities of the thalamus. In this study, we aimed to parcellate the thalamus and examine whole-brain connectivity of its functional clusters. With resting state functional magnetic resonance imaging data from 96 adults, we used independent component analysis (ICA) to parcellate the thalamus into 10 components. On the basis of the independence assumption, ICA helps to identify how subclusters overlap spatially. Whole brain functional connectivity of each subdivision was computed for independent component's time course (ICtc), which is a unique time series to represent an IC. For comparison, we computed seed-region-based functional connectivity using the averaged time course across all voxels within a thalamic subdivision. The results showed that, at p analysis, ICtc analysis revealed patterns of connectivity that were more distinguished between thalamic clusters. ICtc analysis demonstrated thalamic connectivity to the primary motor cortex, which has eluded the analysis as well as previous studies based on averaged time series, and clarified thalamic connectivity to the hippocampus, caudate nucleus, and precuneus. The new findings elucidate functional organization of the thalamus and suggest that ICA clustering in combination with ICtc rather than seed-region analysis better distinguishes whole-brain connectivities among functional clusters of a brain region.

  6. The oncoprotein and stem cell renewal factor BMI1 associates with poor clinical outcome in oesophageal cancer patients undergoing preoperative chemoradiotherapy

    Directory of Open Access Journals (Sweden)

    Yoshikawa Reigetsu

    2012-10-01

    Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.

  7. Variance gradients and uncertainty budgets for nonlinear measurement functions with independent inputs

    International Nuclear Information System (INIS)

    Campanelli, Mark; Kacker, Raghu; Kessel, Rüdiger

    2013-01-01

    A novel variance-based measure for global sensitivity analysis, termed a variance gradient (VG), is presented for constructing uncertainty budgets under the Guide to the Expression of Uncertainty in Measurement (GUM) framework for nonlinear measurement functions with independent inputs. The motivation behind VGs is the desire of metrologists to understand which inputs' variance reductions would most effectively reduce the variance of the measurand. VGs are particularly useful when the application of the first supplement to the GUM is indicated because of the inadequacy of measurement function linearization. However, VGs reduce to a commonly understood variance decomposition in the case of a linear(ized) measurement function with independent inputs for which the original GUM readily applies. The usefulness of VGs is illustrated by application to an example from the first supplement to the GUM, as well as to the benchmark Ishigami function. A comparison of VGs to other available sensitivity measures is made. (paper)

  8. Functional independence and health-related functional status following spinal cord injury : a prospective study of the association with physical capacity

    NARCIS (Netherlands)

    Haisma, Janneke A.; Post, Marcel W.; van der Woude, Lucas H.; Stam, Henk J.; Bergen, Michael P.; Sluis, Tebbe A.; van den Berg-Emons, Hendrika J.; Bussmann, Johannes B.

    2008-01-01

    Objective: To determine changes in functional independence following spinal cord injury and to evaluate the association between functional independence and physical capacity. Design: Multi-centre prospective cohort study. Subjects: Patients with spinal cord injury admitted for initial

  9. Detection of independent functional networks during music listening using electroencephalogram and sLORETA-ICA.

    Science.gov (United States)

    Jäncke, Lutz; Alahmadi, Nsreen

    2016-04-13

    The measurement of brain activation during music listening is a topic that is attracting increased attention from many researchers. Because of their high spatial accuracy, functional MRI measurements are often used for measuring brain activation in the context of music listening. However, this technique faces the issues of contaminating scanner noise and an uncomfortable experimental environment. Electroencephalogram (EEG), however, is a neural registration technique that allows the measurement of neurophysiological activation in silent and more comfortable experimental environments. Thus, it is optimal for recording brain activations during pleasant music stimulation. Using a new mathematical approach to calculate intracortical independent components (sLORETA-IC) on the basis of scalp-recorded EEG, we identified specific intracortical independent components during listening of a musical piece and scales, which differ substantially from intracortical independent components calculated from the resting state EEG. Most intracortical independent components are located bilaterally in perisylvian brain areas known to be involved in auditory processing and specifically in music perception. Some intracortical independent components differ between the music and scale listening conditions. The most prominent difference is found in the anterior part of the perisylvian brain region, with stronger activations seen in the left-sided anterior perisylvian regions during music listening, most likely indicating semantic processing during music listening. A further finding is that the intracortical independent components obtained for the music and scale listening are most prominent in higher frequency bands (e.g. beta-2 and beta-3), whereas the resting state intracortical independent components are active in lower frequency bands (alpha-1 and theta). This new technique for calculating intracortical independent components is able to differentiate independent neural networks associated

  10. Liver function tests and risk prediction of incident type 2 diabetes : evaluation in two independent cohorts

    NARCIS (Netherlands)

    Abbasi, Ali; Bakker, Stephan J. L.; Corpeleijn, Eva; van der A, Daphne L.; Gansevoort, Ron T.; Gans, Rijk O. B.; Peelen, Linda M.; van der Schouw, Yvonne T.; Stolk, Ronald P.; Navis, Gerjan; Spijkerman, Annemieke M. W.; Beulens, Joline W. J.

    2012-01-01

    Background: Liver function tests might predict the risk of type 2 diabetes. An independent study evaluating utility of these markers compared with an existing prediction model is yet lacking. Methods and Findings: We performed a case-cohort study, including random subcohort (6.5%) from 38,379

  11. Independent prognostic value of left ventricular mass, diastolic function, and fasting plasma glucose

    DEFF Research Database (Denmark)

    Pareek, Manan; Nielsen, Mette Lundgren; Leósdóttir, Margrét

    2016-01-01

    OBJECTIVE: To explore the independent prognostic value of left ventricular (LV) mass, diastolic function, and fasting plasma glucose (FPG) for the prediction of incident cardiac events in a random population sample. DESIGN AND METHOD: 415 women and 999 men aged 56-79 years, included between 2002...

  12. Functional independence and mobility in kidney transplanted patients: cross-sectional study

    Directory of Open Access Journals (Sweden)

    Tuíra O. Maia

    2017-12-01

    Full Text Available Abstract AIMS To assess functional independence, balance and mobility of kidney transplant recipients, to verify transplant time, donor type, regular exercise practice, musculoskeletal complaints, as well as association among these variables METHODS Observational study with 86 kidney transplant individuals, subjected to evaluation of the Functional Independence Measure (FIM and Timed Up and Go test (TUG. RESULTS The mean age of the study population was 43.98 years old, 50% of these individuals were between 5-10 years of transplantation and 50% between 10-15 years. Changes in mobility and balance (TUG were found in 9.3% of transplant patients, while 2.3% had deficits in functional independence (FIM. The association between TUG and the FIM (χ2= 19.964, p< 0.001 was found in 25% of the 9.3% of individuals who showed changes in TUG. It was found that only 20.9% of kidney transplant between 5-10 years and 14.0% between 11 and 15 years performed regular physical exercises (χ2= 0.727, p= 0.394 and 67.4% presented prevalent complaints on lower limbs musculoskeletal. CONCLUSION Although the level of dependence and impairments in mobility and balance found in renal transplants are low, deficits in mobility and balance may lead to changes in the ability to perform their functional activities independently.

  13. Investigation of Cool and Hot Executive Function in ODD/CD Independently of ADHD

    Science.gov (United States)

    Hobson, Christopher W.; Scott, Stephen; Rubia, Katya

    2011-01-01

    Background: Children with oppositional defiant disorder/conduct disorder (ODD/CD) have shown deficits in "cool" abstract-cognitive, and "hot" reward-related executive function (EF) tasks. However, it is currently unclear to what extent ODD/CD is associated with neuropsychological deficits, independently of attention deficit hyperactivity disorder…

  14. Conceptualizing Parental Autonomy Support: Adolescent Perceptions of Promotion of Independence versus Promotion of Volitional Functioning

    Science.gov (United States)

    Soenens, Bart; Vansteenkiste, Maarten; Lens, Willy; Luyckx, Koen; Goossens, Luc; Beyers, Wim; Ryan, Richard M.

    2007-01-01

    In current research on parenting, 2 ways of conceptualizing perceived parental autonomy support can be distinguished. Parental autonomy support can be defined in terms of promotion of independence (PI) or in terms of promotion of volitional functioning (PVF). This study aimed to establish the empirical distinctiveness of both conceptualizations…

  15. c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.

    Science.gov (United States)

    Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B

    2012-04-01

    Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.

  16. IMPROVING FUNCTIONAL INDEPENDENCE OF PATIENTS WITH MULTIPLE SCLEROSIS BY PHYSICAL THERAPY AND OCCUPATIONAL THERAPY

    Directory of Open Access Journals (Sweden)

    Ana-Maria Ticărat

    2011-06-01

    Full Text Available Introduction. Patients with multiple sclerosis can have a normal life despite of their real or possible disability and of the progressive nature of it. Scope. Patients who follow physical therapy and occupational therapy will have an increased quality of life and a greater functional independence.Methods. The randomized study was made on 7 patients with multiple sclerosis, from Oradea Day Centre, 3 times/week, ages between 35 – 55 years, functional level between mild and sever. Assessment and rehabilitation methods: inspection, BARTHEL Index. Frenkel method, brething exercises, weights exercises, gait exercises, writind exercises and games were used in the rehabilitation process. Group therapies: sociotherapy, arttherapy, music therapy. Results analysis consisted of the comparison of baseline and final means.Results. By analizing baseline and final means for Barthel Index for each functon separately, it was shown a mild improvement of functional independence for almost assessed functions, with at least 1-1,5 points.Conclusions. Persons with multiple sclerosis who follow physical therapy and occupational therapy presents a better functional independence after the treatment.

  17. Slimmer women's waist is associated with better erectile function in men independent of age.

    Science.gov (United States)

    Brody, Stuart; Weiss, Petr

    2013-10-01

    Previous research has indicated that men generally rate slimmer women as more sexually attractive, consistent with the increased morbidity risks associated with even mild abdominal adiposity. To assess the association of women's waist size with a more tangible measure of perceived sexual attractiveness (as well as reward value for both sexes), we examined the association of women's age and waist circumference with an index of men's erectile function (IIEF-5 scores), frequency of penile-vaginal intercourse (PVI), and sexual satisfaction in a representative sample of Czechs (699 men and 715 women) aged 35-65 years. Multivariate analyses indicated that better erectile function scores were independently associated with younger age of self and partner and women's slimmer waist. PVI frequency was independently associated with women's younger age and women's slimmer waist. Sexual satisfaction was independently associated with men's younger age and slimmer waist for both sexes. Better erectile function, greater PVI frequency, and greater sexual satisfaction were associated with women's slimmer waist, independently of both sexes' ages. Possible reasons for the waist effects were discussed, including women's abdominal body fat decreasing their own desire through neurohormonal mechanisms and decreasing their partner's desire through evolutionarily-related decreased sexual attractiveness.

  18. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    Energy Technology Data Exchange (ETDEWEB)

    Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

  19. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    International Nuclear Information System (INIS)

    Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

    2012-01-01

    Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

  20. Characterizing functional connectivity during rest in multiple sclerosis patients versus healthy volunteers using independent component analysis

    Energy Technology Data Exchange (ETDEWEB)

    Palacio Garcia, L.; Andrzejak, R.; Prchkovska, V.; Rodrigues, P.

    2016-07-01

    It is commonly thought that our brain is not active when it does not receive any external input. However, during rest, there are still certain distant regions of the brain that are functionally correlated between them: the so-called resting-state networks. This functional connectivity of the brain is disrupted in many neurological diseases. In particular, it has been shown that one of the most studied resting-state networks (the default-mode network) is affected in multiple sclerosis, which is the most common disabling neurological condition affecting the central nervous system of young adults. In this work, I focus on the study of the differences in the resting-state networks between multiple sclerosis patients and healthy volunteers. In order to study the effects of multiple sclerosis on the functional connectivity of the brain, a numerical method known as independent component analysis (ICA) is applied. This technique divides the resting-state fMRI data into independent components. Nonetheless, noise, which could be due to head motion or physiological artifacts, may corrupt the data by indicating a false activation. Therefore, I create a web user interface that allows the user to manually classify all the independent components for a given subject. Eventually, the components classified as noise should be removed from the functional data in order to prevent them from taking part in any further analysis. (Author)

  1. Trauma center designation correlates with functional independence after severe but not moderate traumatic brain injury.

    Science.gov (United States)

    Brown, Joshua B; Stassen, Nicole A; Cheng, Julius D; Sangosanya, Ayodele T; Bankey, Paul E; Gestring, Mark L

    2010-08-01

    The mortality of traumatic brain injury (TBI) continues to decline, emphasizing functional outcomes. Trauma center designation has been linked to survival after TBI, but the impact on functional outcomes is unclear. The objective was to determine whether trauma center designation influenced functional outcomes after moderate and severe TBI. Trauma subjects presenting to an American College of Surgeons (ACS) Level I or II trauma center with a Glasgow Coma Score (GCS) independence (FI) defined as a modified functional independence measure (FIM) of 12, and independent expression (IE) defined as a FIM component of 4. These were compared between Level I and Level II centers in subjects with both moderate (GCS 9-12) and severe (GCS

  2. Selective Attention, Working Memory, and Executive Function as Potential Independent Sources of Cognitive Dysfunction in Schizophrenia.

    Science.gov (United States)

    Gold, James M; Robinson, Benjamin; Leonard, Carly J; Hahn, Britta; Chen, Shuo; McMahon, Robert P; Luck, Steven J

    2017-11-11

    People with schizophrenia demonstrate impairments in selective attention, working memory, and executive function. Given the overlap in these constructs, it is unclear if these represent distinct impairments or different manifestations of one higher-order impairment. To examine this question, we administered tasks from the basic cognitive neuroscience literature to measure visual selective attention, working memory capacity, and executive function in 126 people with schizophrenia and 122 healthy volunteers. Patients demonstrated deficits on all tasks with the exception of selective attention guided by strong bottom-up inputs. Although the measures of top-down control of selective attention, working memory, and executive function were all intercorrelated, several sources of evidence indicate that working memory and executive function are separate sources of variance. Specifically, both working memory and executive function independently contributed to the discrimination of group status and independently accounted for variance in overall general cognitive ability as assessed by the MATRICS battery. These two cognitive functions appear to be separable features of the cognitive impairments observed in schizophrenia. © The Author 2017. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  3. [Active aging from the perspective of aged individuals who are functionally independent].

    Science.gov (United States)

    Ferreira, Olivia Galvão Lucena; Maciel, Silvana Carneiro; Silva, Antonia Oliveira; dos Santos, Walberto Silva; Moreira, Maria Adelaide Silva P

    2010-12-01

    The objective of this study was to identify the social representations of the elderly regarding active aging. Semi-structured interviews were performed with 100 functionally independent aged individuals from João Pessoa, Paraiba, Brazil. The data was organized and analyzed using Alceste software. Results showed that the aged individuals' statements about active aging are permeated with positive contents. However, when aging is not associated with the word active, it is still represented as losses and disabilities. Despite the existence of losses during the process, active aging should be encouraged among the elderly, as it means living a quality, plentiful life. Maintaining the elderly functionally independent is the first step to achieving active aging and thus improving their quality of life.

  4. Independent effects of both right and left ventricular function on plasma brain natriuretic peptide

    DEFF Research Database (Denmark)

    Vogelsang, Thomas Wiis; Jensen, Ruben J; Monrad, Astrid L

    2007-01-01

    BACKGROUND: Brain natriuretic peptide (BNP) is increased in heart failure; however, the relative contribution of the right and left ventricles is largely unknown. AIM: To investigate if right ventricular function has an independent influence on plasma BNP concentration. METHODS: Right (RVEF), left......, which is a strong prognostic marker in heart failure, independently depends on both left and right ventricular systolic function. This might, at least in part, explain why BNP holds stronger prognostic value than LVEF alone....... ventricular ejection fraction (LVEF), and left ventricular end-diastolic volume index (LVEDVI) were determined in 105 consecutive patients by first-pass radionuclide ventriculography (FP-RNV) and multiple ECG-gated equilibrium radionuclide ventriculography (ERNV), respectively. BNP was analyzed by immunoassay...

  5. LSD1 activates a lethal prostate cancer gene network independently of its demethylase function.

    Science.gov (United States)

    Sehrawat, Archana; Gao, Lina; Wang, Yuliang; Bankhead, Armand; McWeeney, Shannon K; King, Carly J; Schwartzman, Jacob; Urrutia, Joshua; Bisson, William H; Coleman, Daniel J; Joshi, Sunil K; Kim, Dae-Hwan; Sampson, David A; Weinmann, Sheila; Kallakury, Bhaskar V S; Berry, Deborah L; Haque, Reina; Van Den Eeden, Stephen K; Sharma, Sunil; Bearss, Jared; Beer, Tomasz M; Thomas, George V; Heiser, Laura M; Alumkal, Joshi J

    2018-05-01

    Medical castration that interferes with androgen receptor (AR) function is the principal treatment for advanced prostate cancer. However, clinical progression is universal, and tumors with AR-independent resistance mechanisms appear to be increasing in frequency. Consequently, there is an urgent need to develop new treatments targeting molecular pathways enriched in lethal prostate cancer. Lysine-specific demethylase 1 (LSD1) is a histone demethylase and an important regulator of gene expression. Here, we show that LSD1 promotes the survival of prostate cancer cells, including those that are castration-resistant, independently of its demethylase function and of the AR. Importantly, this effect is explained in part by activation of a lethal prostate cancer gene network in collaboration with LSD1's binding protein, ZNF217. Finally, that a small-molecule LSD1 inhibitor-SP-2509-blocks important demethylase-independent functions and suppresses castration-resistant prostate cancer cell viability demonstrates the potential of LSD1 inhibition in this disease.

  6. On Delay-Independent Criteria for Oscillation of Higher-Order Functional Differential Equations

    Directory of Open Access Journals (Sweden)

    Yuangong Sun

    2011-01-01

    Full Text Available We investigate the oscillation of the following higher-order functional differential equation: x(n(t+q(t|x(t-τ|λ-1x(t-τ=e(t, where q(t and e(t are continuous functions on [t0,∞, 1>λ>0 and τ≠0 are constants. Unlike most of delay-dependent oscillation results in the literature, two delay-independent oscillation criteria for the equation are established in both the case τ>0 and the case τ<0 under the assumption that the potentials q(t and e(t change signs on [t0,∞.

  7. Acute myeloid leukemia stem cell markers in prognosis and targeted therapy: potential impact of BMI-1, TIM-3 and CLL-1.

    Science.gov (United States)

    Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A

    2016-09-06

    Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.

  8. Which activities threaten independent living of elderly when becoming problematic: inspiration for meaningful service robot functionality.

    Science.gov (United States)

    Bedaf, Sandra; Gelderblom, Gert Jan; Syrdal, Dag Sverre; Lehmann, Hagen; Michel, Hervé; Hewson, David; Amirabdollahian, Farshid; Dautenhahn, Kerstin; de Witte, Luc

    2014-11-01

    In light of the increasing elderly population and the growing demand for home care, the potential of robot support is given increasing attention. In this paper, an inventory of activities was made that threaten independent living of elderly when becoming problematic. Results will guide the further development of an existing service robot, the Care-O-bot®. A systematic literature search of PubMed was performed, focused on the risk factors for institutionalization. Additionally, focus group sessions were conducted in the Netherlands, United Kingdom and France. In these focus group sessions, problematic activities threatening the independence of elderly people were discussed. Three separate target groups were included in the focus group sessions: (1) elderly persons (n = 41), (2) formal caregivers (n = 40) and (3) informal caregivers (n = 32). Activities within the International Classification of Functioning domains mobility, self-care, and interpersonal interaction and relationships were found to be the most problematic. A distinct set of daily activities was identified that may threaten independent living, but no single activity could be selected as the main activity causing a loss of independence as it is often a combination of problematic activities that is person-specific. Supporting the problematic activities need not involve a robotic solution.

  9. A Method of Calculating Functional Independence Measure at Discharge from Functional Independence Measure Effectiveness Predicted by Multiple Regression Analysis Has a High Degree of Predictive Accuracy.

    Science.gov (United States)

    Tokunaga, Makoto; Watanabe, Susumu; Sonoda, Shigeru

    2017-09-01

    Multiple linear regression analysis is often used to predict the outcome of stroke rehabilitation. However, the predictive accuracy may not be satisfactory. The objective of this study was to elucidate the predictive accuracy of a method of calculating motor Functional Independence Measure (mFIM) at discharge from mFIM effectiveness predicted by multiple regression analysis. The subjects were 505 patients with stroke who were hospitalized in a convalescent rehabilitation hospital. The formula "mFIM at discharge = mFIM effectiveness × (91 points - mFIM at admission) + mFIM at admission" was used. By including the predicted mFIM effectiveness obtained through multiple regression analysis in this formula, we obtained the predicted mFIM at discharge (A). We also used multiple regression analysis to directly predict mFIM at discharge (B). The correlation between the predicted and the measured values of mFIM at discharge was compared between A and B. The correlation coefficients were .916 for A and .878 for B. Calculating mFIM at discharge from mFIM effectiveness predicted by multiple regression analysis had a higher degree of predictive accuracy of mFIM at discharge than that directly predicted. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  10. Structural and Functional Diversity of Plant Virus 3'-Cap-Independent Translation Enhancers (3'-CITEs).

    Science.gov (United States)

    Truniger, Verónica; Miras, Manuel; Aranda, Miguel A

    2017-01-01

    Most of the positive-strand RNA plant viruses lack the 5'-cap and/or the poly(A)-tail that act synergistically to stimulate canonical translation of cellular mRNAs. However, they have RNA elements in the 5'- or 3'-untranslated regions of their RNAs that are required for their cap-independent translation. Cap-independent translation enhancers (CITEs) have been identified in the genomic 3'-end of viruses belonging to the family Tombusviridae and the genus Luteovirus . Seven classes of 3'-CITEs have been described to date based on their different RNA structures. They generally control the efficient formation of the translation initiation complex by varying mechanisms. Some 3'-CITEs bind eukaryotic translation initiation factors, others ribosomal subunits, bridging these to the 5'-end by different mechanisms, often long-distance RNA-RNA interactions. As previously proposed and recently found in one case in nature, 3'-CITEs are functionally independent elements that are transferable through recombination between viral genomes, leading to potential advantages for virus multiplication. In this review, the knowledge on 3'-CITEs and their functioning is updated. We also suggest that there is local structural conservation in the regions interacting with eIF4E of 3'-CITEs belonging to different classes.

  11. The independent contribution of executive functions to health related quality of life in older women

    Directory of Open Access Journals (Sweden)

    Marra Carlo A

    2010-04-01

    Full Text Available Abstract Background Cognition is a multidimensional construct and to our knowledge, no previous studies have examined the independent contribution of specific domains of cognition to health related quality of life. To determine whether executive functions are independently associated with health related quality of life assessed using Quality Adjusted Life Years (QALYs calculated from the EuroQol EQ-5D (EQ-5D in older women after adjusting for known covariates, including global cognition. Therefore, we conducted a secondary analysis of community-dwelling older women aged 65-75 years who participated in a 12-month randomized controlled trial of resistance training. We assessed global cognition using the Mini-Mental State Examination (MMSE and executive functions using the: 1 Stroop Test; 2 Trail Making Test (Part B and 3 Digits Verbal Span Backwards Test. We calculated QALYs from the EQ-5D administered at baseline, 6 months and 12 months. Results Our multivariate linear regression model demonstrated the specific executive processes of set shifting and working memory, as measured by Trail Making Test (Part B and Digits Verbal Span Backward Test (p Conclusions Our study highlights the specific executive processes of set shifting and working memory were independently associated with QALYs -- a measure of health related quality of life. Given that executive functions explain variability in QALYs, clinicians may need to consider assessing executive functions when measuring health related quality of life. Further, the EQ-5D may be used to track changes in health status over time and serve as a screening tool for clinicians. Trial Registration ClinicalTrials.gov Identifier: NCT00426881.

  12. Task-evoked brain functional magnetic susceptibility mapping by independent component analysis (χICA).

    Science.gov (United States)

    Chen, Zikuan; Calhoun, Vince D

    2016-03-01

    Conventionally, independent component analysis (ICA) is performed on an fMRI magnitude dataset to analyze brain functional mapping (AICA). By solving the inverse problem of fMRI, we can reconstruct the brain magnetic susceptibility (χ) functional states. Upon the reconstructed χ dataspace, we propose an ICA-based brain functional χ mapping method (χICA) to extract task-evoked brain functional map. A complex division algorithm is applied to a timeseries of fMRI phase images to extract temporal phase changes (relative to an OFF-state snapshot). A computed inverse MRI (CIMRI) model is used to reconstruct a 4D brain χ response dataset. χICA is implemented by applying a spatial InfoMax ICA algorithm to the reconstructed 4D χ dataspace. With finger-tapping experiments on a 7T system, the χICA-extracted χ-depicted functional map is similar to the SPM-inferred functional χ map by a spatial correlation of 0.67 ± 0.05. In comparison, the AICA-extracted magnitude-depicted map is correlated with the SPM magnitude map by 0.81 ± 0.05. The understanding of the inferiority of χICA to AICA for task-evoked functional map is an ongoing research topic. For task-evoked brain functional mapping, we compare the data-driven ICA method with the task-correlated SPM method. In particular, we compare χICA with AICA for extracting task-correlated timecourses and functional maps. χICA can extract a χ-depicted task-evoked brain functional map from a reconstructed χ dataspace without the knowledge about brain hemodynamic responses. The χICA-extracted brain functional χ map reveals a bidirectional BOLD response pattern that is unavailable (or different) from AICA. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Independent effects of bilingualism and socioeconomic status on language ability and executive functioning.

    Science.gov (United States)

    Calvo, Alejandra; Bialystok, Ellen

    2014-03-01

    One hundred and seventy-five children who were 6-years old were assigned to one of four groups that differed in socioeconomic status (SES; working class or middle class) and language background (monolingual or bilingual). The children completed tests of nonverbal intelligence, language tests assessing receptive vocabulary and attention based on picture naming, and two tests of executive functioning. All children performed equivalently on the basic intelligence tests, but performance on the language and executive functioning tasks was influenced by both SES and bilingualism. Middle-class children outperformed working-class children on all measures, and bilingual children obtained lower scores than monolingual children on language tests but higher scores than monolingual children on the executive functioning tasks. There were no interactions with either group factors or task factors. Thus, each of SES and bilingualism contribute significantly and independently to children's development irrespective of the child's level on the other factor. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Independence of Hot and Cold Executive Function Deficits in High-Functioning Adults with Autism Spectrum Disorder.

    Science.gov (United States)

    Zimmerman, David L; Ownsworth, Tamara; O'Donovan, Analise; Roberts, Jacqueline; Gullo, Matthew J

    2016-01-01

    Individuals with autistic spectrum disorder (ASD) display diverse deficits in social, cognitive and behavioral functioning. To date, there has been mixed findings on the profile of executive function deficits for high-functioning adults (IQ > 70) with ASD. A conceptual distinction is commonly made between "cold" and "hot" executive functions. Cold executive functions refer to mechanistic higher-order cognitive operations (e.g., working memory), whereas hot executive functions entail cognitive abilities supported by emotional awareness and social perception (e.g., social cognition). This study aimed to determine the independence of deficits in hot and cold executive functions for high-functioning adults with ASD. Forty-two adults with ASD (64% male, aged 18-66 years) and 40 age and gender matched controls were administered The Awareness of Social Inference Test (TASIT; emotion recognition and social inference), Letter Number Sequencing (working memory) and Hayling Sentence Completion Test (response initiation and suppression). Between-group analyses identified that the ASD group performed significantly worse than matched controls on all measures of cold and hot executive functions (d = 0.54 - 1.5). Hierarchical multiple regression analyses revealed that the ASD sample performed more poorly on emotion recognition and social inference tasks than matched controls after controlling for cold executive functions and employment status. The findings also indicated that the ability to recognize emotions and make social inferences was supported by working memory and response initiation and suppression processes. Overall, this study supports the distinction between hot and cold executive function impairments for adults with ASD. Moreover, it advances understanding of higher-order impairments underlying social interaction difficulties for this population which, in turn, may assist with diagnosis and inform intervention programs.

  15. Impact of cognitive function on oral perception in independently living older people.

    Science.gov (United States)

    Fukutake, Motoyoshi; Ogawa, Taiji; Ikebe, Kazunori; Mihara, Yusuke; Inomata, Chisato; Takeshita, Hajime; Matsuda, Kenichi; Hatta, Kodai; Gondo, Yasuyuki; Masui, Yukie; Inagaki, Hiroki; Arai, Yasumichi; Kamide, Kei; Ishizaki, Tatsuro; Maeda, Yoshinobu

    2018-04-10

    Oral tactile perception is important for better mastication, appetite, and enjoyment of food. However, previous investigations have not utilized comprehensible variables thought to have negative effect on oral perception, including aging, denture wearing, and cognitive function. The aim of this study was to elucidate the impact of cognitive function on oral perception in independently living older individuals. The study sample was comprised of 987 participants (466 males, 521 females; age 69-71 years). Oral examinations, assessments of cognitive function in preclinical level by Montreal Cognitive Assessment (MoCA)-J, and determination of oral stereognostic ability as an indicator of oral perception were performed. Related variables were selected by univariate analyses; then, multivariate logistic regression model analysis was conducted. Univariate analyses revealed that number of teeth, removable dentures usage, and cognitive function respectively had a significant relationship with stereognostic score. Next, the subjects were classified into good and poor perception groups (lowest 17.4%) according to oral stereognostic ability. Logistic regression analysis revealed that lower cognitive function was significantly associated with poor oral perception (OR = 0.934, p = 0.017) after controlling for other variables. Cognitive decline even in preclinical stage was associated with reduced oral perception after controlling for gender, tooth number and denture use in independent living older people. This study suggested that preclinical level of change in cognitive function affected oral perception. Dental practitioners and caregivers may need to pay attention to reduced oral perception among older people even if they do not have trouble in daily life.

  16. Functional analysis of the zebrafish ortholog of HMGCS1 reveals independent functions for cholesterol and isoprenoids in craniofacial development.

    Directory of Open Access Journals (Sweden)

    Anita M Quintana

    Full Text Available There are 8 different human syndromes caused by mutations in the cholesterol synthesis pathway. A subset of these disorders such as Smith-Lemli-Opitz disorder, are associated with facial dysmorphia. However, the molecular and cellular mechanisms underlying such facial deficits are not fully understood, primarily because of the diverse functions associated with the cholesterol synthesis pathway. Recent evidence has demonstrated that mutation of the zebrafish ortholog of HMGCR results in orofacial clefts. Here we sought to expand upon these data, by deciphering the cholesterol dependent functions of the cholesterol synthesis pathway from the cholesterol independent functions. Moreover, we utilized loss of function analysis and pharmacological inhibition to determine the extent of sonic hedgehog (Shh signaling in animals with aberrant cholesterol and/or isoprenoid synthesis. Our analysis confirmed that mutation of hmgcs1, which encodes the first enzyme in the cholesterol synthesis pathway, results in craniofacial abnormalities via defects in cranial neural crest cell differentiation. Furthermore targeted pharmacological inhibition of the cholesterol synthesis pathway revealed a novel function for isoprenoid synthesis during vertebrate craniofacial development. Mutation of hmgcs1 had no effect on Shh signaling at 2 and 3 days post fertilization (dpf, but did result in a decrease in the expression of gli1, a known Shh target gene, at 4 dpf, after morphological deficits in craniofacial development and chondrocyte differentiation were observed in hmgcs1 mutants. These data raise the possibility that deficiencies in cholesterol modulate chondrocyte differentiation by a combination of Shh independent and Shh dependent mechanisms. Moreover, our results describe a novel function for isoprenoids in facial development and collectively suggest that cholesterol regulates craniofacial development through versatile mechanisms.

  17. Dietary sodium loading impairs microvascular function independent of blood pressure in humans: role of oxidative stress

    Science.gov (United States)

    Greaney, Jody L; DuPont, Jennifer J; Lennon-Edwards, Shannon L; Sanders, Paul W; Edwards, David G; Farquhar, William B

    2012-01-01

    Animal studies have reported dietary salt-induced reductions in vascular function independent of increases in blood pressure (BP). The purpose of this study was to determine if short-term dietary sodium loading impairs cutaneous microvascular function in normotensive adults with salt resistance. Following a control run-in diet, 12 normotensive adults (31 ± 2 years) were randomized to a 7 day low-sodium (LS; 20 mmol day−1) and 7 day high-sodium (HS; 350 mmol day−1) diet (controlled feeding study). Salt resistance, defined as a ≤5 mmHg change in 24 h mean BP determined while on the LS and HS diets, was confirmed in all subjects undergoing study (LS: 84 ± 1 mmHg vs. HS: 85 ± 2 mmHg; P > 0.05). On the last day of each diet, subjects were instrumented with two microdialysis fibres for the local delivery of Ringer solution and 20 mm ascorbic acid (AA). Laser Doppler flowmetry was used to measure red blood cell flux during local heating-induced vasodilatation (42°C). After the established plateau, 10 mm l-NAME was perfused to quantify NO-dependent vasodilatation. All data were expressed as a percentage of maximal cutaneous vascular conductance (CVC) at each site (28 mm sodium nitroprusside; 43°C). Sodium excretion increased during the HS diet (P sodium loading impairs cutaneous microvascular function independent of BP in normotensive adults and suggest a role for oxidative stress. PMID:22907057

  18. Age-independent anti-Müllerian hormone (AMH) standard deviation scores to estimate ovarian function.

    Science.gov (United States)

    Helden, Josef van; Weiskirchen, Ralf

    2017-06-01

    To determine single year age-specific anti-Müllerian hormone (AMH) standard deviation scores (SDS) for women associated to normal ovarian function and different ovarian disorders resulting in sub- or infertility. Determination of particular year median and mean AMH values with standard deviations (SD), calculation of age-independent cut off SDS for the discrimination between normal ovarian function and ovarian disorders. Single-year-specific median, mean, and SD values have been evaluated for the Beckman Access AMH immunoassay. While the decrease of both median and mean AMH values is strongly correlated with increasing age, calculated SDS values have been shown to be age independent with the differentiation between normal ovarian function measured as occurred ovulation with sufficient luteal activity compared with hyperandrogenemic cycle disorders or anovulation associated with high AMH values and reduced ovarian activity or insufficiency associated with low AMH, respectively. These results will be helpful for the treatment of patients and the ventilation of the different reproductive options. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Telomere-independent functions of telomerase in nuclei, cytoplasm, and mitochondria

    Energy Technology Data Exchange (ETDEWEB)

    Chiodi, Ilaria; Mondello, Chiara, E-mail: mondello@igm.cnr.it [Istituto di Genetica Molecolare, Consiglio Nazionale delle Ricerche, Pavia (Italy)

    2012-09-28

    Telomerase canonical activity at telomeres prevents telomere shortening, allowing chromosome stability and cellular proliferation. To perform this task, the catalytic subunit (telomerase reverse transcriptase, TERT) of the enzyme works as a reverse transcriptase together with the telomerase RNA component (TERC), adding telomeric repeats to DNA molecule ends. Growing evidence indicates that, besides the telomeric-DNA synthesis activity, TERT has additional functions in tumor development and is involved in many different biological processes, among which cellular proliferation, gene expression regulation, and mitochondrial functionality. TERT has been shown to act independently of TERC in the Wnt-β-catenin signaling pathway, regulating the expression of Wnt target genes, which play a role in development and tumorigenesis. Moreover, TERT RNA-dependent RNA polymerase activity has been found, leading to the genesis of double-stranded RNAs that act as precursor of silencing RNAs. In mitochondria, a TERT TERC-independent reverse transcriptase activity has been described that could play a role in the protection of mitochondrial integrity. In this review, we will discuss some of the extra-telomeric functions of telomerase.

  20. Functional capacity, independence and home affordances of premature children attending daycare centers

    Directory of Open Access Journals (Sweden)

    Marcela Tamiasso Vieira

    Full Text Available Abstract Introduction: Child development is the result of the interaction between biological and environmental factors. Objective: The aim of this study is to evaluate and compare the Functional Capacity, Independence and Home Affordances Level of Stimulation of premature children between 18 and 42 months, attending or not daycare centers. Methods: Cross-sectional study with a convenience sample of 26 premature children between 18 and 42 months, paired and divided into two groups: attending (study group and not attending daycare centers (control group. Data was collected from the questionnaires AHEMD-SR, PEDI and an identification questionnaire. Data analysis was performed by descriptive statistics, and Chi-square, Fisher, Mann-Whitney and Univariate Analysis tests, considering the level of significance of α = 0.05 and tendency of differentiation when α < 010. Results: There was a significant difference in the AHEMD-SR`s Variety of Stimulation (p = 0.036, higher in the control group, and tendency in the Gross Motor Toys (p = 0.086, more available in the study group. In PEDI, there was significant difference in Self-care (p = 0.045 and tendency of differentiation in Mobility (0.068, both of the Caregiver Assistance part (greater to the study. The sample showed low stimulation opportunities regarding Fine and Gross Motor Toys and high percentages of delay in Functional Skills (Mobility and Independence (Self Care and Mobility, especially in the control group. Conclusion: Daycare centers seem to positively affect the Functional Capacity and Independence in premature children between 18 and 42 months.

  1. Child Functional Independence and Maternal Psychosocial Stress as Risk Factors Threatening Adaptation in Mothers of Physically or Sensorially Handicapped Children.

    Science.gov (United States)

    Wallander, Jan L; And Others

    1990-01-01

    Investigated contribution of child functional independence and maternal psychosocial stress to adaptation of 119 mothers of physically or sensorially handicapped children between the ages of 2 and 18. Child functional independence did not uniquely explain variation in mothers' adaptation. Maternal stress was uniquely associated with maternal…

  2. A Method of Approximating Expectations of Functions of Sums of Independent Random Variables

    OpenAIRE

    Klass, Michael J.

    1981-01-01

    Let $X_1, X_2, \\cdots$ be a sequence of independent random variables with $S_n = \\sum^n_{i = 1} X_i$. Fix $\\alpha > 0$. Let $\\Phi(\\cdot)$ be a continuous, strictly increasing function on $\\lbrack 0, \\infty)$ such that $\\Phi(0) = 0$ and $\\Phi(cx) \\leq c^\\alpha\\Phi(x)$ for all $x > 0$ and all $c \\geq 2$. Suppose $a$ is a real number and $J$ is a finite nonempty subset of the positive integers. In this paper we are interested in approximating $E \\max_{j \\in J} \\Phi(|a + S_j|)$. We construct a nu...

  3. Oral hygiene caregivers' educational programme improves oral health conditions in institutionalised independent and functional elderly.

    Science.gov (United States)

    Portella, Fernando F; Rocha, Aline W; Haddad, Daniel C; Fortes, Carmem B B; Hugo, Fernando N; Padilha, Dalva M P; Samuel, Susana M W

    2015-03-01

    The goal of this study was to determine the impact of an oral hygiene education programme for caregivers on the oral health of institutionalised elderly and to examine the effect of disability and low muscle strength on programme outcomes. The subjects of this study were geriatric patients (n = 80) from a nursing home. Katz Index for activities of daily living, handgrip strength and mucosal-plaque score (MPS) was evaluated at baseline and 1 year after intervention. The intervention consisted of an educational programme and specific guidelines for caregivers (to perform oral hygiene for dependent elderly and to supervise the independent elderly during oral hygiene practices). Differences on MPS were evaluated using a paired-sample t-test. A stratified analysis was carried out to identify differences in response to the programme according to the Katz Index and handgrip strength of elderly. The MPS was significantly reduced (p = 0.001) at follow-up; however, a separate analysis showed that only the independent elderly (p = 0.002) and those with normal muscle strength (p = 0.006) showed a reduction in MPS during the follow-up examination. The oral hygiene education programme for caregivers resulted in a positive impact on oral hygiene of the independent and functional elderly. © 2013 The Gerodontology Society and John Wiley & Sons A/S.

  4. Independent functional connectivity networks underpin food and monetary reward sensitivity in excess weight.

    Science.gov (United States)

    Verdejo-Román, Juan; Fornito, Alex; Soriano-Mas, Carles; Vilar-López, Raquel; Verdejo-García, Antonio

    2017-02-01

    Overvaluation of palatable food is a primary driver of obesity, and is associated with brain regions of the reward system. However, it remains unclear if this network is specialized in food reward, or generally involved in reward processing. We used functional magnetic resonance imaging (fMRI) to characterize functional connectivity during processing of food and monetary rewards. Thirty-nine adults with excess weight and 37 adults with normal weight performed the Willingness to Pay for Food task and the Monetary Incentive Delay task in the fMRI scanner. A data-driven graph approach was applied to compare whole-brain, task-related functional connectivity between groups. Excess weight was associated with decreased functional connectivity during the processing of food rewards in a network involving primarily frontal and striatal areas, and increased functional connectivity during the processing of monetary rewards in a network involving principally frontal and parietal areas. These two networks were topologically and anatomically distinct, and were independently associated with BMI. The processing of food and monetary rewards involve segregated neural networks, and both are altered in individuals with excess weight. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Crossed versus conventional pseudophakic monovision: Patient satisfaction, visual function, and spectacle independence.

    Science.gov (United States)

    Zhang, Fuxiang; Sugar, Alan; Arbisser, Lisa; Jacobsen, Gordon; Artico, Jessica

    2015-09-01

    To compare patient satisfaction, visual function, and spectacle independence in patients with crossed or conventional pseudophakic monovision. Department of Ophthalmology, Henry Ford Health System, Taylor, Michigan, USA. Retrospective comparative cohort study. Cataract surgery patient records from June 1999 to December 2013 were reviewed. Crossed monovision patients were identified. Control conventional monovision cases were matched for age, sex, general health, personal lifestyle/main hobbies, preoperative refractive status, postoperative refractive status, uncorrected distance visual acuity, uncorrected near visual acuity, astigmatism level, and anisometropia level. A survey was mailed to participants, and results were independently analyzed. The review comprised 7311 patient records. Forty-four crossed monovision patients were identified, and 30 of them were enrolled. Thirty matched pairs were surveyed. The mean anisometropia was 1.19 diopters (D) in the conventional and 1.12 D in the crossed monovision groups. No significant difference was identified for eye-hand coordination, eye-foot coordination, or sport-related depth perception, but satisfaction was slightly better in the crossed monovision group (P = .028). No significant difference was identified for 6 of 8 spectacle independence measures, but nighttime driving was a little easier for the crossed monovision group (P = .025). Seventy-seven percent of crossed and 50% of conventional monovision patients did not use glasses for intermediate distance activities (P = .037). Crossed pseudophakic monovision appears to work as well as conventional pseudophakic monovision in terms of patient satisfaction and spectacle independence in patients with a mild degree of anisometropic pseudophakia. No author has a financial or proprietary interest in any material or method mentioned. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  6. Independent effects of both right and left ventricular function on plasma brain natriuretic peptide.

    Science.gov (United States)

    Vogelsang, Thomas Wiis; Jensen, Ruben J; Monrad, Astrid L; Russ, Kaspar; Olesen, Uffe H; Hesse, Birger; Kjaer, Andreas

    2007-09-01

    Brain natriuretic peptide (BNP) is increased in heart failure; however, the relative contribution of the right and left ventricles is largely unknown. To investigate if right ventricular function has an independent influence on plasma BNP concentration. Right (RVEF), left ventricular ejection fraction (LVEF), and left ventricular end-diastolic volume index (LVEDVI) were determined in 105 consecutive patients by first-pass radionuclide ventriculography (FP-RNV) and multiple ECG-gated equilibrium radionuclide ventriculography (ERNV), respectively. BNP was analyzed by immunoassay. Mean LVEF was 0.51 (range 0.10-0.83) with 36% having a reduced LVEF (left and right ventricular systolic function. This might, at least in part, explain why BNP holds stronger prognostic value than LVEF alone.

  7. Defining ATM-Independent Functions of the Mre11 Complex with a Novel Mouse Model.

    Science.gov (United States)

    Balestrini, Alessia; Nicolas, Laura; Yang-Lott, Katherine; Guryanova, Olga A; Levine, Ross L; Bassing, Craig H; Chaudhuri, Jayanta; Petrini, John H J

    2016-02-01

    The Mre11 complex (Mre11, Rad50, and Nbs1) occupies a central node of the DNA damage response (DDR) network and is required for ATM activation in response to DNA damage. Hypomorphic alleles of MRE11 and NBS1 confer embryonic lethality in ATM-deficient mice, indicating that the complex exerts ATM-independent functions that are essential when ATM is absent. To delineate those functions, a conditional ATM allele (ATM(flox)) was crossed to hypomorphic NBS1 mutants (Nbs1(ΔB/ΔB) mice). Nbs1(ΔB/ΔB) Atm(-/-) hematopoietic cells derived by crossing to vav(cre) were viable in vivo. Nbs1(ΔB/ΔB) Atm(-/-) (VAV) mice exhibited a pronounced defect in double-strand break repair and completely penetrant early onset lymphomagenesis. In addition to repair defects observed, fragile site instability was noted, indicating that the Mre11 complex promotes genome stability upon replication stress in vivo. The data suggest combined influences of the Mre11 complex on DNA repair, as well as the responses to DNA damage and DNA replication stress. A novel mouse model was developed, by combining a vav(cre)-inducible ATM knockout mouse with an NBS1 hypomorphic mutation, to analyze ATM-independent functions of the Mre11 complex in vivo. These data show that the DNA repair, rather than DDR signaling functions of the complex, is acutely required in the context of ATM deficiency to suppress genome instability and lymphomagenesis. ©2015 American Association for Cancer Research.

  8. Independent value added by diffusion MRI for prediction of cognitive function in older adults

    Directory of Open Access Journals (Sweden)

    Julia A Scott

    2017-01-01

    Full Text Available The purpose of this study was to determine whether white matter microstructure measured by diffusion magnetic resonance imaging (dMRI provides independent information about baseline level or change in executive function (EF or memory (MEM in older adults with and without cognitive impairment. Longitudinal data was acquired from the Alzheimer's Disease Neuroimaging Initiative (ADNI study from phases GO and 2 (2009–2015. ADNI participants included were diagnosed as cognitively normal (n = 46, early mild cognitive impairment (MCI (n = 48, late MCI (n = 29, and dementia (n = 39 at baseline. We modeled the association between dMRI-based global white matter mean diffusivity (MD and baseline level and change in EF and MEM composite scores, in models controlling for baseline bilateral hippocampal volume, regional cerebral FDG PET metabolism and global cerebral AV45 PET uptake. EF and MEM composite scores were measured at baseline, 6, 12, 24 and 36 months. In the baseline late MCI and dementia groups, greater global MD was associated with lesser baseline EF, but not EF change nor MEM baseline or change. As expected, lesser hippocampal volume and lesser FDG PET metabolism was associated with greater rates of EF and MEM decline. In ADNI-GO/2 participants, white matter integrity provided independent information about current executive function, but was not sensitive to future cognitive change. Since individuals experiencing executive function declines progress to dementia more rapidly than those with only memory impairment, better biomarkers of future executive function decline are needed.

  9. Development of a multidimensional balance scale for use with functionally independent older adults.

    Science.gov (United States)

    Rose, Debra J; Lucchese, Nicole; Wiersma, Lenny D

    2006-11-01

    To develop and evaluate the validity and reliability of a multidimensional balance scale-the Fullerton Advanced Balance (FAB) scale-suitable for use with functionally independent older adults. Psychometric evaluation of the scale's content and convergent validity, test-retest and intra- and interrater reliability, and internal rater consistency. Urban community. Forty-six community-residing older adults (mean +/- standard deviation, 75 +/- 6.2 y), with (n = 31) and without identified balance problems (n = 15), participated in the study. Four physical therapists with expertise in the assessment and treatment of balance disorders in older adults also participated in the content validity and/or reliability phases of the study. Not applicable. Spearman rank correlation coefficients for convergent validity, test-retest, intra- and interrater reliability, and homogeneity coefficient values for rater consistency. Test-retest reliability for the total balance scale score was high (rho = .96). Interrater reliability for total score ranged from .94 to .97 whereas intrarater reliability coefficients ranged from .97 to 1.00. Homogeneity (H) coefficients were greater than .90 for 6 of the 10 individual test items and all 10 test items had H coefficients of greater than .75 for both rating sessions. Preliminary results suggest that the FAB scale is a valid and reliable assessment tool that is suitable for use with functionally independent older adults residing in the community.

  10. Personality traits, education, physical exercise, and childhood neurological function as independent predictors of adult obesity.

    Science.gov (United States)

    Cheng, Helen; Furnham, Adrian

    2013-01-01

    To investigate whether personality traits, education, physical exercise, parental socio-economic conditions, and childhood neurological function are independently associated with obesity in 50 year old adults in a longitudinal birth cohort study. The sample consisted of 5,921 participants born in Great Britain in 1958 and followed up at 7, 11, 33, 42, and 50 years with data on body mass index measured at 42 and 50 years. There was an increase of adult obesity from 14.2% at age 42 to 23.6% at 50 years. Cohort members who were reported by teachers on overall clumsiness as "certainly applied" at age 7 were more likely to become obese at age 50. In addition, educational qualifications, traits Conscientiousness and Extraversion, psychological distress, and physical exercise were all significantly associated with adult obesity. The associations remained to be significant after controlling for birth weight and gestation, maternal and paternal BMI, childhood BMI, childhood intelligence and behavioural adjustment, as well as diet. Neurological function in childhood, education, trait Conscientiousness, and exercise were all significantly and independently associated with adult obesity, each explained unique individual variability.

  11. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    Science.gov (United States)

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Variation in Functional Independence among Stroke Survivors Having Fatigue and Depression.

    Science.gov (United States)

    Badaru, Umaru Muhammad; Ogwumike, Omoyemi Olubunmi; Adeniyi, Ade Fatai; Olowe, Olajide Olubanji

    2013-01-01

    Objective. This study evaluated variation in functional independence in activities of daily living (ADL) and instrumental activities of daily living (IADL) among individuals with poststroke fatigue (PSF) and poststroke depression (PSD). Methods. A cross-sectional survey involved 65 consenting poststroke survivors who were purposively recruited from physiotherapy clinics of the University College Hospital, Ibadan, Adeoyo Maternity Teaching Hospital, Ibadan, and Federal Medical Center, Gusau. Participants were assessed for symptoms of PSD with short geriatric depression scale-15, PSF with fatigue severity scale, ADL with Barthel Index and IADL with Nottingham extended ADL scale. Data analysis was done using Chi-square and unpaired t-test with significance level being 0.05. Results. Participants' age ranged from 58 to 80 years. PSD alone (P = 0.002) and both PSF and PSD (P = 0.02) were significantly associated with ADL, while PSF alone was not (P = 0.233). PSD alone (P = 0.001) and both PSF and PSD (P = 0.001) significantly negatively affected IADL, while PSF alone had no significant effect (P = 0.2). Conclusions. Participants with PSD alone and those with both PSF and PSD had lower functional independence in ADL and IADL.

  13. P wave dispersion and maximum P wave duration are independently associated with rapid renal function decline.

    Science.gov (United States)

    Su, Ho-Ming; Tsai, Wei-Chung; Lin, Tsung-Hsien; Hsu, Po-Chao; Lee, Wen-Hsien; Lin, Ming-Yen; Chen, Szu-Chia; Lee, Chee-Siong; Voon, Wen-Chol; Lai, Wen-Ter; Sheu, Sheng-Hsiung

    2012-01-01

    The P wave parameters measured by 12-lead electrocardiogram (ECG) are commonly used as noninvasive tools to assess for left atrial enlargement. There are limited studies to evaluate whether P wave parameters are independently associated with decline in renal function. Accordingly, the aim of this study is to assess whether P wave parameters are independently associated with progression to renal end point of ≥25% decline in estimated glomerular filtration rate (eGFR). This longitudinal study included 166 patients. The renal end point was defined as ≥25% decline in eGFR. We measured two ECG P wave parameters corrected by heart rate, i.e. corrected P wave dispersion (PWdisperC) and corrected P wave maximum duration (PWdurMaxC). Heart function and structure were measured from echocardiography. Clinical data, P wave parameters, and echocardiographic measurements were compared and analyzed. Forty-three patients (25.9%) reached renal end point. Kaplan-Meier curves for renal end point-free survival showed PWdisperC > median (63.0 ms) (log-rank P = 0.004) and PWdurMaxC > median (117.9 ms) (log-rank Pfunction decline.

  14. Measurement of functional independence level and falls-risk in individuals with undiagnosed phenylketonuria.

    LENUS (Irish Health Repository)

    Mazur, Artur

    2009-01-01

    The aim of the study was to determine the level of functional independence in adult patients with previously undiagnosed or untreated phenylketonuria (PKU). The study was conducted among 400 intellectually impaired adult residents of Social Welfare Homes in South-Eastern Poland born prior to the introduction of neonatal PKU screening programs. PKU was screened by filter paper test using tandem mass spectrometry methods, and confirmed by gas chromatography-mass spectrometric analysis of PKU organic acids in urine. Degree of functional independence included the assessment of activities of daily living (Barthel Index) and measures of balance and gait (Tinetti scale). Eleven individuals with previously untreated PKU were identified whereby eight presented with moderate disability and three with mild disability. Six had a high risk of falls and five had a moderate risk of falls. This study indicates that there is considerable number of undiagnosed PKU patients within the Polish population who require assessment and management in order to reduce the impact of the neurological and neuropsychiatric problems associated with the condition. Appropriate therapy for those with undiagnosed PKU should, in particular, address the risk of falls.

  15. Variation in Functional Independence among Stroke Survivors Having Fatigue and Depression

    Directory of Open Access Journals (Sweden)

    Umaru Muhammad Badaru

    2013-01-01

    Full Text Available Objective. This study evaluated variation in functional independence in activities of daily living (ADL and instrumental activities of daily living (IADL among individuals with poststroke fatigue (PSF and poststroke depression (PSD. Methods. A cross-sectional survey involved 65 consenting poststroke survivors who were purposively recruited from physiotherapy clinics of the University College Hospital, Ibadan, Adeoyo Maternity Teaching Hospital, Ibadan, and Federal Medical Center, Gusau. Participants were assessed for symptoms of PSD with short geriatric depression scale-15, PSF with fatigue severity scale, ADL with Barthel Index and IADL with Nottingham extended ADL scale. Data analysis was done using Chi-square and unpaired t-test with significance level being 0.05. Results. Participants’ age ranged from 58 to 80 years. PSD alone (P=0.002 and both PSF and PSD (P=0.02 were significantly associated with ADL, while PSF alone was not (P=0.233. PSD alone (P=0.001 and both PSF and PSD (P=0.001 significantly negatively affected IADL, while PSF alone had no significant effect (P=0.2. Conclusions. Participants with PSD alone and those with both PSF and PSD had lower functional independence in ADL and IADL.

  16. MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

    Science.gov (United States)

    Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

    2015-01-01

    Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

  17. Reduced lung function is independently associated with increased risk of type 2 diabetes in Korean men

    Directory of Open Access Journals (Sweden)

    Kwon Chang-Hee

    2012-04-01

    Full Text Available Abstract Background Reduced lung function is associated with incident insulin resistance and diabetes. The aim of this study was to assess the relationship between lung function and incident type 2 diabetes in Korean men. Methods This study included 9,220 men (mean age: 41.4 years without type 2 diabetes at baseline who were followed for five years. Subjects were divided into four groups according to baseline forced vital capacity (FVC (% predicted and forced expiratory volume in one second (FEV1 (% predicted quartiles. The incidence of type 2 diabetes at follow-up was compared according to FVC and FEV1 quartiles. Results The overall incidence of type 2 diabetes was 2.2%. Reduced lung function was significantly associated with the incidence of type 2 diabetes after adjusting for age, BMI, education, smoking, exercise, alcohol, and HOMA-IR. Both FVC and FEV1 were negatively associated with type 2 diabetes (P 1 had a significantly higher odds ratio for type 2 diabetes compared with the highest quartile after adjusting for age and BMI (2.15 [95% CI 1.02-4.57] and 2.19 [95% CI 1.09-4.42]. Conclusions Reduced lung function is independently associated with the incidence of type 2 diabetes in Korean men.

  18. Poor sleep quality diminishes cognitive functioning independent of depression and anxiety in healthy young adults.

    Science.gov (United States)

    Benitez, Andreana; Gunstad, John

    2012-01-01

    Sufficient sleep is essential for optimum cognitive and psychological functioning. Diminished sleep quality is associated with depression and anxiety, but the extent to which poor sleep quality uniquely impacts attention and executive functions independent of the effects of the common underlying features of depression and anxiety requires further exploration. Here 67 healthy young adults were given the Minnesota Multiphasic Personality Inventory, second edition (MMPI-2), the Pittsburgh Sleep Quality Index (PSQI), and tests of attention and executive functions. Similar to findings from a previous study with healthy community-based older adults (Nebes, Buysse, Halligan, Houck, & Monk, 2009), participants who reported poor sleep quality on the PSQI endorsed significantly greater scores on MMPI-2 Restructured Clinical scales related to depression and anxiety (Cohen's d = 0.77-1.05). In addition, PSQI component scores indexing poor sleep quality, duration, and medication use were associated with diminished attention and executive functions, even after controlling for emotional reactivity or demoralization (rs = 0.21-0.27). These results add to the concurrent validity of the PSQI, and provide further evidence for subtle cognitive decrements related to insufficient sleep even in healthy young adults. Future extension of these findings is necessary with larger samples and clinical comparison groups, and using objective indices of sleep dysfunction such as polysomnography.

  19. Postoperative delirium: age and low functional reserve as independent risk factors.

    Science.gov (United States)

    Pinho, Cristiana; Cruz, Sofia; Santos, Alice; Abelha, Fernando J

    2016-09-01

    The aim of this study was to determine the incidence of postoperative delirium (POD) and the presence of previous conditions related to its development. Prospective observational study. The study was performed in adult patients (n=221) scheduled for elective surgery and admitted to the postanesthesia care unit (PACU). The presence of POD was assessed by the Nursing Delirium Screening Scale at discharge from the PACU and 24hours after surgery. Descriptive analyses were carried out, and statistical comparisons were performed with Mann-Whitney U, χ(2), or Fisher exact test. Logistic regression analysis was used for evaluation of independent determinants of POD. POD was found in 25 patients (11%). Patients who developed POD were older (median age, 69 vs 57years; P<.001); had a higher American Society of Anesthesiologists physical status score (≥3) (60% vs 19%, respectively, had American Society of Anesthesiologists physical status III/IV; P<.001); and showed higher incidences of ischemic heart disease (24% vs 6%; P=.001), chronic kidney disease (20% vs 5%; P=.005), hypertension (80% vs 45%; P=.001), chronic obstructive pulmonary disease (20% vs 6%; P=.009), and low functional reserve (LFR) (24% vs 2%; P<.001). Age (odds ratio, 1.06; 95% confidence interval, 1.02-1.10; P=.003) and LFR (odds ratio, 8.04; 95% confidence interval, 3.95-32.27; P=.003) were considered independent risk factors for POD. The incidence of POD in the study population (11%) is consistent with that described in the literature (5%-15%). The comorbidities associated with its development were ischemic heart disease, hypertension, chronic kidney disease, LFR, and chronic obstructive pulmonary disease. Age ≥65years and LFR were independent risk factors for POD development. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Plasminogen activator inhibitor-1 is elevated in patients with COPD independent of metabolic and cardiovascular function

    Science.gov (United States)

    Waschki, Benjamin; Watz, Henrik; Holz, Olaf; Magnussen, Helgo; Olejnicka, Beata; Welte, Tobias; Rabe, Klaus F; Janciauskiene, Sabina

    2017-01-01

    Introduction Plasminogen activator inhibitor-1 (PAI-1), a major inhibitor of fibrinolysis, is associated with thrombosis, obesity, insulin resistance, dyslipidemia, and premature aging, which all are coexisting conditions of chronic obstructive pulmonary disease (COPD). The role of PAI-1 in COPD with respect to metabolic and cardiovascular functions is unclear. Methods In this study, which was nested within a prospective cohort study, the serum levels of PAI-1 were cross-sectionally measured in 74 stable COPD patients (Global Initiative for Chronic Obstructive Lung Disease [GOLD] Stages I–IV) and 18 controls without lung disease. In addition, triglycerides, high-density lipoprotein cholesterol, fasting plasma glucose, waist circumference, blood pressure, smoking status, high-sensitive C-reactive protein (hs-CRP), adiponectin, ankle–brachial index, N-terminal pro-B-type natriuretic peptide, and history of comorbidities were also determined. Results The serum levels of PAI-1 were significantly higher in COPD patients than in controls, independent of a broad spectrum of possible confounders including metabolic and cardiovascular dysfunction. A multivariate regression analysis revealed triglyceride and hs-CRP levels to be the best predictors of PAI-1 within COPD. GOLD Stages II and III remained independently associated with higher PAI-1 levels in a final regression analysis. Conclusion The data from the present study showed that the serum levels of PAI-1 are higher in patients with COPD and that moderate-to-severe airflow limitation, hypertriglyceridemia, and systemic inflammation are independent predictors of an elevated PAI-1 level. PAI-1 may be a potential biomarker candidate for COPD-specific and extra-pulmonary manifestations. PMID:28356730

  1. An interactive algorithm for identifying multiattribute measurable value functions based on finite-order independence of structural difference

    International Nuclear Information System (INIS)

    Tamura, Hiroyuki; Hikita, Shiro

    1985-01-01

    In this paper, we develop an interactive algorithm for identifying multiattribute measurable value functions based on the concept of finite-order independence of structural difference. This concept includes Dyer and Sarin's weak difference independence as special cases. The algorithm developed is composed of four major parts: 1) formulation of the problem 2) assessment of normalized conditional value functions and structural difference functions 3) assessment of corner values 4) assessment of the order of independence of structural difference and selection of the model. A hypothetical numerical example of a trade-off analysis for siting a nuclear power plant is included. (author)

  2. Improved application of independent component analysis to functional magnetic resonance imaging study via linear projection techniques.

    Science.gov (United States)

    Long, Zhiying; Chen, Kewei; Wu, Xia; Reiman, Eric; Peng, Danling; Yao, Li

    2009-02-01

    Spatial Independent component analysis (sICA) has been widely used to analyze functional magnetic resonance imaging (fMRI) data. The well accepted implicit assumption is the spatially statistical independency of intrinsic sources identified by sICA, making the sICA applications difficult for data in which there exist interdependent sources and confounding factors. This interdependency can arise, for instance, from fMRI studies investigating two tasks in a single session. In this study, we introduced a linear projection approach and considered its utilization as a tool to separate task-related components from two-task fMRI data. The robustness and feasibility of the method are substantiated through simulation on computer data and fMRI real rest data. Both simulated and real two-task fMRI experiments demonstrated that sICA in combination with the projection method succeeded in separating spatially dependent components and had better detection power than pure model-based method when estimating activation induced by each task as well as both tasks.

  3. Some Convex Functions Based Measures of Independence and Their Application to Strange Attractor Reconstruction

    Directory of Open Access Journals (Sweden)

    Kazuyuki Aihara

    2011-04-01

    Full Text Available The classical information-theoretic measures such as the entropy and the mutual information (MI are widely applicable to many areas in science and engineering. Csiszar generalized the entropy and the MI by using the convex functions. Recently, we proposed the grid occupancy (GO and the quasientropy (QE as measures of independence. The QE explicitly includes a convex function in its definition, while the expectation of GO is a subclass of QE. In this paper, we study the effect of different convex functions on GO, QE, and Csiszar’s generalized mutual information (GMI. A quality factor (QF is proposed to quantify the sharpness of their minima. Using the QF, it is shown that these measures can have sharper minima than the classical MI. Besides, a recursive algorithm for computing GMI, which is a generalization of Fraser and Swinney’s algorithm for computing MI, is proposed. Moreover, we apply GO, QE, and GMI to chaotic time series analysis. It is shown that these measures are good criteria for determining the optimum delay in strange attractor reconstruction.

  4. Rapid production of functionalized recombinant proteins: marrying ligation independent cloning and in vitro protein ligation.

    Science.gov (United States)

    Kushnir, Susanna; Marsac, Yoann; Breitling, Reinhard; Granovsky, Igor; Brok-Volchanskaya, Vera; Goody, Roger S; Becker, Christian F W; Alexandrov, Kirill

    2006-01-01

    Functional genomics and proteomics have been very active fields since the sequencing of several genomes was completed. To assign a physiological role to the newly discovered coding genes with unknown function, new generic methods for protein production, purification, and targeted functionalization are needed. This work presents a new vector, pCYSLIC, that allows rapid generation of Escherichia coli expression constructs via ligation-independent cloning (LIC). The vector is designed to facilitate protein purification by either Ni-NTA or GSH affinity chromatography. Subsequent proteolytic removal of affinity tags liberates an N-terminal cysteine residue that is then used for covalent modification of the target protein with different biophysical probes via protein ligation. The described system has been tested on 36 mammalian Rab GTPases, and it was demonstrated that recombinant GTPases produced with pCYSLIC could be efficiently modified with fluorescein or biotin in vitro. Finally, LIC was compared with the recently developed In-Fusion cloning method, and it was demonstrated that In-Fusion provides superior flexibility in choice of expression vector. By the application of In-Fusion cloning Cys-Rab6A GTPase with an N-terminal cysteine residue was generated employing unmodified pET30a vector and TVMV protease.

  5. Acetylation of pregnane X receptor protein determines selective function independent of ligand activation

    International Nuclear Information System (INIS)

    Biswas, Arunima; Pasquel, Danielle; Tyagi, Rakesh Kumar; Mani, Sridhar

    2011-01-01

    Research highlights: → Pregnane X receptor (PXR), a major regulatory protein, is modified by acetylation. → PXR undergoes dynamic deacetylation upon ligand-mediated activation. → SIRT1 partially mediates PXR deacetylation. → PXR deacetylation per se induces lipogenesis mimicking ligand-mediated activation. -- Abstract: Pregnane X receptor (PXR), like other members of its class of nuclear receptors, undergoes post-translational modification [PTM] (e.g., phosphorylation). However, it is unknown if acetylation (a major and common form of protein PTM) is observed on PXR and, if it is, whether it is of functional consequence. PXR has recently emerged as an important regulatory protein with multiple ligand-dependent functions. In the present work we show that PXR is indeed acetylated in vivo. SIRT1 (Sirtuin 1), a NAD-dependent class III histone deacetylase and a member of the sirtuin family of proteins, partially mediates deacetylation of PXR. Most importantly, the acetylation status of PXR regulates its selective function independent of ligand activation.

  6. Spectral correlation functions of the sum of two independent complex Wishart matrices with unequal covariances

    International Nuclear Information System (INIS)

    Akemann, Gernot; Checinski, Tomasz; Kieburg, Mario

    2016-01-01

    We compute the spectral statistics of the sum H of two independent complex Wishart matrices, each of which is correlated with a different covariance matrix. Random matrix theory enjoys many applications including sums and products of random matrices. Typically ensembles with correlations among the matrix elements are much more difficult to solve. Using a combination of supersymmetry, superbosonisation and bi-orthogonal functions we are able to determine all spectral k -point density correlation functions of H for arbitrary matrix size N . In the half-degenerate case, when one of the covariance matrices is proportional to the identity, the recent results by Kumar for the joint eigenvalue distribution of H serve as our starting point. In this case the ensemble has a bi-orthogonal structure and we explicitly determine its kernel, providing its exact solution for finite N . The kernel follows from computing the expectation value of a single characteristic polynomial. In the general non-degenerate case the generating function for the k -point resolvent is determined from a supersymmetric evaluation of the expectation value of k ratios of characteristic polynomials. Numerical simulations illustrate our findings for the spectral density at finite N and we also give indications how to do the asymptotic large- N analysis. (paper)

  7. Functional independence of residents in urban and rural long-term care facilities in Taiwan.

    Science.gov (United States)

    Lin, Kwan-Hwa; Wu, Shiao-Chi; Hsiung, Chia-Ling; Hu, Ming-Hsia; Hsieh, Ching-Lin; Lin, Jau-Hong; Kuo, Mei-Ying

    2004-02-04

    To compare the score of functional independence measure (FIM) between urban and rural residents living in long-term care facilities (LTCF) in Taiwan. A total of 437 subjects in 112 licensed LTCF in Taiwan were randomly selected by stratification strategy. Physical therapists interviewed the subjects in nursing homes (NH) and intermediate care facilities (ICF) to obtain the basic data, and the FIM score. (1) There was no significant difference in basic demographic data between urban and rural LTC subjects. (2) Most of the subjects in urban and rural LTCF were males, less than 80 years old, single/widowed, having multiple diseases, using more than one assistive devices, and having social welfare financial support. (3) Motor abilities (eating, grooming, and transfer) and cognition (comprehension, social interaction and problem solving) in rural LTCF subjects were significantly (p institutions is better than those in urban areas. Our results may provide guidelines for the manpower and equipment supply estimation.

  8. Functional expression of a heterologous nickel-dependent, ATP-independent urease in Saccharomyces cerevisiae.

    Science.gov (United States)

    Milne, N; Luttik, M A H; Cueto Rojas, H F; Wahl, A; van Maris, A J A; Pronk, J T; Daran, J M

    2015-07-01

    In microbial processes for production of proteins, biomass and nitrogen-containing commodity chemicals, ATP requirements for nitrogen assimilation affect product yields on the energy producing substrate. In Saccharomyces cerevisiae, a current host for heterologous protein production and potential platform for production of nitrogen-containing chemicals, uptake and assimilation of ammonium requires 1 ATP per incorporated NH3. Urea assimilation by this yeast is more energy efficient but still requires 0.5 ATP per NH3 produced. To decrease ATP costs for nitrogen assimilation, the S. cerevisiae gene encoding ATP-dependent urease (DUR1,2) was replaced by a Schizosaccharomyces pombe gene encoding ATP-independent urease (ure2), along with its accessory genes ureD, ureF and ureG. Since S. pombe ure2 is a Ni(2+)-dependent enzyme and Saccharomyces cerevisiae does not express native Ni(2+)-dependent enzymes, the S. pombe high-affinity nickel-transporter gene (nic1) was also expressed. Expression of the S. pombe genes into dur1,2Δ S. cerevisiae yielded an in vitro ATP-independent urease activity of 0.44±0.01 µmol min(-1) mg protein(-1) and restored growth on urea as sole nitrogen source. Functional expression of the Nic1 transporter was essential for growth on urea at low Ni(2+) concentrations. The maximum specific growth rates of the engineered strain on urea and ammonium were lower than those of a DUR1,2 reference strain. In glucose-limited chemostat cultures with urea as nitrogen source, the engineered strain exhibited an increased release of ammonia and reduced nitrogen content of the biomass. Our results indicate a new strategy for improving yeast-based production of nitrogen-containing chemicals and demonstrate that Ni(2+)-dependent enzymes can be functionally expressed in S. cerevisiae. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  9. Analysis of the Functional Independence Measure Value of Cervical Spine Injury Patients with Conservative Management

    Directory of Open Access Journals (Sweden)

    M. Zafrullah Arifin

    2012-06-01

    Full Text Available Analysis of the Functional Independence Measure Value of Cervical Spine Injury Patients with Conservative Management. Cervical spine injury is one of the most common spinal cord injuries in trauma patients. From 100,000 spinal cord injury cases reported in the United States of America (2008, sixty seven percent involve cervical spine injury. American Spinal Cord Injury Association (ASIA impairment score is used as an initial assessment but not enough attention prognostic outcome of these patients was paid to. The objective of this study is to analyze the value of functional independence measure (FIM cervical spine injury patients with conservative management and its correlation with age, sex, type of trauma, onset of trauma, cervical abnormalities, type of cervical spine lesion and ASIA impairment score. A prospective cohort study was performed to all patients with cervical spine injury treated inNeurosurgery Department of Dr. Hasan Sadikin Hospital Bandung that fullfiled the inclusion criteria. The subjects were classified based on age, sex, single/multiple trauma, acute /chronic, cervical abnormalities, complete/incomplete lesion and ASIA impairment score. The FIM examination was performed in Outpatient clinic of Neurosurgery. T-test and chi-square test was done to analyze the data. There were 17 cervical spine injury patients treated in Neurosurgery Department of Dr. Hasan Sadikin Hospital during April 2009–April 2010. The average FIM value of cervical spine injury in those patients is 4+ 1.63 by cohort prospective study. There were no correlation between FIM value with age, sex, type of trauma, onset of trauma and cervical abnormalities. Significant correlations were found between FIM value with type of cervical spine lesion and ASIA impairment score in cervical spine patients. Type of cervical spine lesion and ASIA impairment score have significant correlation with FIM value of patients in 6 months after cervical injury.

  10. Micro-seismic imaging using a source function independent full waveform inversion method

    Science.gov (United States)

    Wang, Hanchen; Alkhalifah, Tariq

    2018-03-01

    At the heart of micro-seismic event measurements is the task to estimate the location of the source micro-seismic events, as well as their ignition times. The accuracy of locating the sources is highly dependent on the velocity model. On the other hand, the conventional micro-seismic source locating methods require, in many cases manual picking of traveltime arrivals, which do not only lead to manual effort and human interaction, but also prone to errors. Using full waveform inversion (FWI) to locate and image micro-seismic events allows for an automatic process (free of picking) that utilizes the full wavefield. However, full waveform inversion of micro-seismic events faces incredible nonlinearity due to the unknown source locations (space) and functions (time). We developed a source function independent full waveform inversion of micro-seismic events to invert for the source image, source function and the velocity model. It is based on convolving reference traces with these observed and modeled to mitigate the effect of an unknown source ignition time. The adjoint-state method is used to derive the gradient for the source image, source function and velocity updates. The extended image for the source wavelet in Z axis is extracted to check the accuracy of the inverted source image and velocity model. Also, angle gathers is calculated to assess the quality of the long wavelength component of the velocity model. By inverting for the source image, source wavelet and the velocity model simultaneously, the proposed method produces good estimates of the source location, ignition time and the background velocity for synthetic examples used here, like those corresponding to the Marmousi model and the SEG/EAGE overthrust model.

  11. Micro-seismic imaging using a source function independent full waveform inversion method

    KAUST Repository

    Wang, Hanchen

    2018-03-26

    At the heart of micro-seismic event measurements is the task to estimate the location of the source micro-seismic events, as well as their ignition times. The accuracy of locating the sources is highly dependent on the velocity model. On the other hand, the conventional micro-seismic source locating methods require, in many cases manual picking of traveltime arrivals, which do not only lead to manual effort and human interaction, but also prone to errors. Using full waveform inversion (FWI) to locate and image micro-seismic events allows for an automatic process (free of picking) that utilizes the full wavefield. However, full waveform inversion of micro-seismic events faces incredible nonlinearity due to the unknown source locations (space) and functions (time). We developed a source function independent full waveform inversion of micro-seismic events to invert for the source image, source function and the velocity model. It is based on convolving reference traces with these observed and modeled to mitigate the effect of an unknown source ignition time. The adjoint-state method is used to derive the gradient for the source image, source function and velocity updates. The extended image for the source wavelet in Z axis is extracted to check the accuracy of the inverted source image and velocity model. Also, angle gathers is calculated to assess the quality of the long wavelength component of the velocity model. By inverting for the source image, source wavelet and the velocity model simultaneously, the proposed method produces good estimates of the source location, ignition time and the background velocity for synthetic examples used here, like those corresponding to the Marmousi model and the SEG/EAGE overthrust model.

  12. Polycomb complex protein BMI-1 promotes invasion and metastasis of pancreatic cancer stem cells by activating PI3K/AKT signaling, an ex vivo, in vitro, and in vivo study

    Science.gov (United States)

    Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li

    2016-01-01

    Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020

  13. Unpolarized structure functions and the parton distributions for nucleon in an independent quark model

    International Nuclear Information System (INIS)

    Barik, N.; Mishra, R.N.

    2001-01-01

    Considering the nucleon as consisting entirely of its valence quarks confined independently in a scalar-vector harmonic potential; unpolarized structure functions F 1 (x, μ 2 ) and F 2 (x, μ 2 ) are derived in the Bjorken limit under certain simplifying assumptions; from which valence quark distribution functions u v (x, μ 2 ) and d v (x, μ 2 ) are appropriately extracted satisfying the normalization constraints. QCD-evolution of these input distributions from a model scale of μ 2 = 0.07 GeV 2 to a higher Q 2 scale of Q 0 2 = 15 GeV 2 yields xu v (x, Q 0 2 ) and xd v (x, Q 0 2 ) in good agreement with experimental data. The gluon and sea-quark distributions such as G (x, Q 0 2 ) and q s (x, Q 0 2 ) are dynamically generated with a reasonable qualitative agreement with the available data; using the leading order renormalization group equations with appropriate valence-quark distributions as the input. (author)

  14. Unpolarized structure functions and the parton distributions for nucleon in an independent quark model

    Energy Technology Data Exchange (ETDEWEB)

    Barik, N [Dept. of Physics, Utkal Univ., Bhubaneswar (India); Mishra, R N [Dept. of Physics, Dhenkanal College, Dhenkanal (India)

    2001-04-01

    Considering the nucleon as consisting entirely of its valence quarks confined independently in a scalar-vector harmonic potential; unpolarized structure functions F{sub 1} (x, {mu}{sup 2}) and F{sub 2} (x, {mu}{sup 2}) are derived in the Bjorken limit under certain simplifying assumptions; from which valence quark distribution functions u{sub v} (x, {mu}{sup 2}) and d{sub v} (x, {mu}{sup 2}) are appropriately extracted satisfying the normalization constraints. QCD-evolution of these input distributions from a model scale of {mu}{sup 2} = 0.07 GeV{sup 2} to a higher Q{sup 2} scale of Q{sub 0}{sup 2} = 15 GeV{sup 2} yields xu{sub v} (x, Q{sub 0}{sup 2}) and xd{sub v} (x, Q{sub 0}{sup 2}) in good agreement with experimental data. The gluon and sea-quark distributions such as G (x, Q{sub 0}{sup 2}) and q{sub s} (x, Q{sub 0}{sup 2}) are dynamically generated with a reasonable qualitative agreement with the available data; using the leading order renormalization group equations with appropriate valence-quark distributions as the input. (author)

  15. Attribution of emotions to body postures: an independent component analysis study of functional connectivity in autism.

    Science.gov (United States)

    Libero, Lauren E; Stevens, Carl E; Kana, Rajesh K

    2014-10-01

    The ability to interpret others' body language is a vital skill that helps us infer their thoughts and emotions. However, individuals with autism spectrum disorder (ASD) have been found to have difficulty in understanding the meaning of people's body language, perhaps leading to an overarching deficit in processing emotions. The current fMRI study investigates the functional connectivity underlying emotion and action judgment in the context of processing body language in high-functioning adolescents and young adults with autism, using an independent components analysis (ICA) of the fMRI time series. While there were no reliable group differences in brain activity, the ICA revealed significant involvement of occipital and parietal regions in processing body actions; and inferior frontal gyrus, superior medial prefrontal cortex, and occipital cortex in body expressions of emotions. In a between-group analysis, participants with autism, relative to typical controls, demonstrated significantly reduced temporal coherence in left ventral premotor cortex and right superior parietal lobule while processing emotions. Participants with ASD, on the other hand, showed increased temporal coherence in left fusiform gyrus while inferring emotions from body postures. Finally, a positive predictive relationship was found between empathizing ability and the brain areas underlying emotion processing in ASD participants. These results underscore the differential role of frontal and parietal brain regions in processing emotional body language in autism. Copyright © 2014 Wiley Periodicals, Inc.

  16. The Impact of Fear of Falling on Functional Independence Among Older Adults Receiving Home Health Services

    Directory of Open Access Journals (Sweden)

    Katherine A. Lawson OTR, LMSSW, PhD

    2014-07-01

    Full Text Available Background: Falls are the fifth leading cause of death for adults aged 65 years and older. Several intrinsic and extrinsic fall risk factors have been identified, butthere is less understanding of the impact of a fear of falling on falls. Seventy percent of recent fallers and 40% percent of non-fallers report a fear of falling. Therefore, the purpose of this study was to examine the correlation between a fear of falling and a history of falls, as well as the impact on the functional independence of community-dwelling older adults receiving home health services. Methods: The participants completed the Falls Efficacy Scale, the Modified Timed Up and Go Test, self- reported fear of falling, and the KATZ ADL-staircase. The participants were primarily Hispanic females. Results: There was not a significant correlation between a fear of falling and a history of falls. Only participants' age, gender, and the number of medical diagnoses were predictive of past falls. There was a moderate correlation between impaired functional mobility and dependence with activities of daily living (ADL. Additionally, a fear of falling was associated with dependence to perform ADLs as measured objectively. Conclusion: Future studies need to examine the effectiveness of interventions that include dual-task challenges during therapeutic interventions and ADL retraining to reduce fall risk among older adults.

  17. The independent and interacting effects of hedonic hunger and executive function on binge eating.

    Science.gov (United States)

    Manasse, Stephanie M; Espel, Hallie M; Forman, Evan M; Ruocco, Anthony C; Juarascio, Adrienne S; Butryn, Meghan L; Zhang, Fengqing; Lowe, Michael R

    2015-06-01

    Poor executive function (EF; pre-frontal cognitive control processes governing goal-directed behavior) and elevated hedonic hunger (i.e., preoccupation with palatable foods in the absence of physiological hunger) are theoretical risk and maintenance factors for binge eating (BE) distinct from general obesity. Recent theoretical models posit that dysregulated behavior such as BE may result from a combination of elevated appetitive drive (e.g., hedonic hunger) and decreased EF (e.g., inhibitory control and delayed discounting). The present study sought to test this model in distinguishing BE from general obesity by examining the independent and interactive associations of EF and hedonic hunger with BE group status (i.e., odds of categorization in BE group versus non-BE group). Treatment-seeking overweight and obese women with BE (n = 31) and without BE (OW group; n = 43) were assessed on measures of hedonic hunger and EF (inhibitory control and delay discounting). Elevated hedonic hunger increased the likelihood of categorization in the BE group, regardless of EF. When hedonic hunger was low, poor EF increased the likelihood of categorization in the BE group. Results indicate that the interplay of increased appetitive drives and decreased cognitive function may distinguish BE from overweight/obesity. Future longitudinal investigations of the combinatory effect of hedonic hunger and EF in increasing risk for developing BE are warranted, and may inform future treatment development to target these factors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Extracting functional components of neural dynamics with Independent Component Analysis and inverse Current Source Density.

    Science.gov (United States)

    Lęski, Szymon; Kublik, Ewa; Swiejkowski, Daniel A; Wróbel, Andrzej; Wójcik, Daniel K

    2010-12-01

    Local field potentials have good temporal resolution but are blurred due to the slow spatial decay of the electric field. For simultaneous recordings on regular grids one can reconstruct efficiently the current sources (CSD) using the inverse Current Source Density method (iCSD). It is possible to decompose the resultant spatiotemporal information about the current dynamics into functional components using Independent Component Analysis (ICA). We show on test data modeling recordings of evoked potentials on a grid of 4 × 5 × 7 points that meaningful results are obtained with spatial ICA decomposition of reconstructed CSD. The components obtained through decomposition of CSD are better defined and allow easier physiological interpretation than the results of similar analysis of corresponding evoked potentials in the thalamus. We show that spatiotemporal ICA decompositions can perform better for certain types of sources but it does not seem to be the case for the experimental data studied. Having found the appropriate approach to decomposing neural dynamics into functional components we use the technique to study the somatosensory evoked potentials recorded on a grid spanning a large part of the forebrain. We discuss two example components associated with the first waves of activation of the somatosensory thalamus. We show that the proposed method brings up new, more detailed information on the time and spatial location of specific activity conveyed through various parts of the somatosensory thalamus in the rat.

  19. Obsessive compulsive symptoms are associated with better functioning independently of cognition in schizophrenia.

    Science.gov (United States)

    Kontis, Dimitrios; Theochari, Eirini; Nikolakopoulou, Mary; Andreopoulou, Angeliki; Vassos, Dimitrios; Grigoriou, Vasileios; Vassilouli, Spyridoula; Giannakopoulou, Dimitra; Kouloumbi, Maria; Tsaltas, Eleftheria

    2016-10-01

    Although the relationship of obsessive-compulsive symptoms (OCSs) with both cognition and social functioning (SF) has already been the focus of research in schizophrenia, the moderation of the relationship of OCSs with SF by cognition has not been explored to date. We investigated the association of OCSs with SF and its interaction with cognition in schizophrenia. We recruited 110 schizophrenia patients and assessed OCSs (Yale-Brown Scale), schizophrenia symptoms (Positive and Negative Syndrome Scale), SF (Strauss-Carpenter Scale) and cognition. 51 patients had one obsessive-compulsive symptom or more, whereas 59 patients had no obsessive compulsive-symptom, according to the Yale-Brown Scale. We mainly investigated: a) the predictive effect of OCSs on SF, controlling for cognition, illness duration and symptoms' severity and b) the moderating effect of cognition on the OCSs-SF relationship. The mean score of OCSs for patients having at least one symptom was 13.43 (SD=8.32). Higher OCSs predicted increased SF (B=0.98, t=2.41, df=88, p=0.018). This relationship was driven by the association of compulsions with job functioning (B=0.074, t=2.029, df=88, p=0.046). Patients without OCSs demonstrated worse functioning compared with those having at least one obsessive-compulsive symptom (mean difference=2.496, t=3.732, df=88, p<0.001). We failed to find evidence that cognition moderates the effect of OCSs on SF. There may be a beneficial effect of OCSs on SF in patients with schizophrenia which is independent of their cognitive performance. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Plasminogen activator inhibitor-1 is elevated in patients with COPD independent of metabolic and cardiovascular function

    Directory of Open Access Journals (Sweden)

    Waschki B

    2017-03-01

    Full Text Available Benjamin Waschki,1–3 Henrik Watz,2,3 Olaf Holz,4,5 Helgo Magnussen,2,3 Beata Olejnicka,6 Tobias Welte,5,7 Klaus F Rabe,1,3 Sabina Janciauskiene5,7 1Pneumology, LungenClinic Grosshansdorf, Grosshansdorf, Germany; 2Pulmonary Research Institute at LungenClinic Grosshansdorf, Grosshansdorf, Germany; 3Airway Research Center North (ARCN, German Center for Lung Research (DZL, Grosshansdorf, Germany; 4Fraunhofer Institute for Toxicology and Experimental Medicine, Hannover, Germany; 5Biomedical Research in Endstage and Obstructive Lung Disease Hannover (BREATH, German Center for Lung Research (DZL, Hannover, Germany; 6Department of Medicine, Trelleborg Hospital, Trelleborg, Sweden; 7Department of Respiratory Medicine, Hannover Medical School, Hannover, Germany Introduction: Plasminogen activator inhibitor-1 (PAI-1, a major inhibitor of fibrinolysis, is associated with thrombosis, obesity, insulin resistance, dyslipidemia, and premature aging, which all are coexisting conditions of chronic obstructive pulmonary disease (COPD. The role of PAI-1 in COPD with respect to metabolic and cardiovascular functions is unclear. Methods: In this study, which was nested within a prospective cohort study, the serum levels of PAI-1 were cross-sectionally measured in 74 stable COPD patients (Global Initiative for Chronic Obstructive Lung Disease [GOLD] Stages I–IV and 18 controls without lung disease. In addition, triglycerides, high-density lipoprotein cholesterol, fasting plasma glucose, waist circumference, blood pressure, smoking status, high-sensitive C-reactive protein (hs-CRP, adiponectin, ankle–brachial index, N-terminal pro-B-type natriuretic peptide, and history of comorbidities were also determined. Results: The serum levels of PAI-1 were significantly higher in COPD patients than in controls, independent of a broad spectrum of possible confounders including metabolic and cardiovascular dysfunction. A multivariate regression analysis revealed

  1. Extracting intrinsic functional networks with feature-based group independent component analysis.

    Science.gov (United States)

    Calhoun, Vince D; Allen, Elena

    2013-04-01

    There is increasing use of functional imaging data to understand the macro-connectome of the human brain. Of particular interest is the structure and function of intrinsic networks (regions exhibiting temporally coherent activity both at rest and while a task is being performed), which account for a significant portion of the variance in functional MRI data. While networks are typically estimated based on the temporal similarity between regions (based on temporal correlation, clustering methods, or independent component analysis [ICA]), some recent work has suggested that these intrinsic networks can be extracted from the inter-subject covariation among highly distilled features, such as amplitude maps reflecting regions modulated by a task or even coordinates extracted from large meta analytic studies. In this paper our goal was to explicitly compare the networks obtained from a first-level ICA (ICA on the spatio-temporal functional magnetic resonance imaging (fMRI) data) to those from a second-level ICA (i.e., ICA on computed features rather than on the first-level fMRI data). Convergent results from simulations, task-fMRI data, and rest-fMRI data show that the second-level analysis is slightly noisier than the first-level analysis but yields strikingly similar patterns of intrinsic networks (spatial correlations as high as 0.85 for task data and 0.65 for rest data, well above the empirical null) and also preserves the relationship of these networks with other variables such as age (for example, default mode network regions tended to show decreased low frequency power for first-level analyses and decreased loading parameters for second-level analyses). In addition, the best-estimated second-level results are those which are the most strongly reflected in the input feature. In summary, the use of feature-based ICA appears to be a valid tool for extracting intrinsic networks. We believe it will become a useful and important approach in the study of the macro

  2. The relationship between multiple joint flexibility and functional performance in independent and physically active elderly women

    Directory of Open Access Journals (Sweden)

    Maria Joana de Carvalho

    2007-09-01

    Full Text Available Multi-joint flexibility assessment seems to be more appropriate for analyzing the association between fl exibility and functional fitness, but there is a lack of studies to confi rm this possibility in elderly people. The present study investigated the relationship between a multiple joint fl exibility assessment and the functional performance of 30 independent and physically active elderly women (age=68±1yr. Flexibility was assessed using the Chair Sit-and-Reach Test (CSRT. Functional performance was tested by a combination of three tasks: a Step Length (SL; b Time to Put on Sneakers (TPS; c Climbing Stairs (CS. The association between fl exibility and functional performance was tested by both simple and multiple correlation techniques. Pearson’s correlation was signifi cant for TPS (r = -.37; p ABSTRACT

  3. Pre- and Postintervention Factor Structure of Functional Independence Measure in Patients with Spinal Cord Injury

    Directory of Open Access Journals (Sweden)

    Mikhail Saltychev

    2017-01-01

    Full Text Available Objective. To evaluate the factor structure of Functional Independence Measure (FIM® scale amongst people with spinal cord injury (SCI. Methods. This was a retrospective, register-based cohort study on 155 rehabilitants with SCI. FIM was assessed at the beginning and at the end of multidisciplinary inpatient rehabilitation. The internal consistency of the FIM was assessed with Cronbach’s alpha and exploratory factor analysis was employed to approximate the construct structure of FIM. Results. The internal consistency demonstrated high Cronbach’s alpha of 0.95 to 0.96. For both pre- and postintervention assessments, the exploratory factor analysis resulted in 3-factor structures. Except for two items (“walking or using a wheelchair” and “expression”, the structures of the identified three factors remained the same from the beginning to the end of rehabilitation. The loadings of all items were sufficient, exceeding 0.3. Both pre- and postintervention chi-square tests showed significant p values < 0.0001. The “motor” domain was divided into two factors with this 2-factor structure enduring through the intervention period. Conclusions. Amongst rehabilitants with SCI, FIM failed to demonstrate unidimensionality. Instead, it showed a 3-factor structure that fluctuated only little depending on the timing of measurement. Additionally, when measured separately, also motor score was 2-dimensional, not 1-dimensional. Using a total or subscale FIM, scores seem to be unjustified in the studied population.

  4. UTX and UTY demonstrate histone demethylase-independent function in mouse embryonic development.

    Directory of Open Access Journals (Sweden)

    Karl B Shpargel

    2012-09-01

    Full Text Available UTX (KDM6A and UTY are homologous X and Y chromosome members of the Histone H3 Lysine 27 (H3K27 demethylase gene family. UTX can demethylate H3K27; however, in vitro assays suggest that human UTY has lost enzymatic activity due to sequence divergence. We produced mouse mutations in both Utx and Uty. Homozygous Utx mutant female embryos are mid-gestational lethal with defects in neural tube, yolk sac, and cardiac development. We demonstrate that mouse UTY is devoid of in vivo demethylase activity, so hemizygous X(Utx- Y(+ mutant male embryos should phenocopy homozygous X(Utx- X(Utx- females. However, X(Utx- Y(+ mutant male embryos develop to term; although runted, approximately 25% survive postnatally reaching adulthood. Hemizygous X(+ Y(Uty- mutant males are viable. In contrast, compound hemizygous X(Utx- Y(Uty- males phenocopy homozygous X(Utx- X(Utx- females. Therefore, despite divergence of UTX and UTY in catalyzing H3K27 demethylation, they maintain functional redundancy during embryonic development. Our data suggest that UTX and UTY are able to regulate gene activity through demethylase independent mechanisms. We conclude that UTX H3K27 demethylation is non-essential for embryonic viability.

  5. Determination of arterial input function in dynamic susceptibility contrast MRI using group independent component analysis technique

    International Nuclear Information System (INIS)

    Chen, S.; Liu, H.-L.; Yang Yihong; Hsu, Y.-Y.; Chuang, K.-S.

    2006-01-01

    Quantification of cerebral blood flow (CBF) with dynamic susceptibility contrast (DSC) magnetic resonance imaging (MRI) requires the determination of the arterial input function (AIF). The segmentation of surrounding tissue by manual selection is error-prone due to the partial volume artifacts. Independent component analysis (ICA) has the advantage in automatically decomposing the signals into interpretable components. Recently group ICA technique has been applied to fMRI study and showed reduced variance caused by motion artifact and noise. In this work, we investigated the feasibility and efficacy of the use of group ICA technique to extract the AIF. Both simulated and in vivo data were analyzed in this study. The simulation data of eight phantoms were generated using randomized lesion locations and time activity curves. The clinical data were obtained from spin-echo EPI MR scans performed in seven normal subjects. Group ICA technique was applied to analyze data through concatenating across seven subjects. The AIFs were calculated from the weighted average of the signals in the region selected by ICA. Preliminary results of this study showed that group ICA technique could not extract accurate AIF information from regions around the vessel. The mismatched location of vessels within the group reduced the benefits of group study

  6. Application of an excited state LDA exchange energy functional for the calculation of transition energy of atoms within time-independent density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Shamim, Md; Harbola, Manoj K, E-mail: sami@iitk.ac.i, E-mail: mkh@iitk.ac.i [Department of Physics, Indian Institute of Technology, Kanpur 208 016 (India)

    2010-11-14

    Transition energies of a new class of excited states (two-gap systems) of various atoms are calculated in time-independent density functional formalism by using a recently proposed local density approximation exchange energy functional for excited states. It is shown that the excitation energies calculated with this functional compare well with those calculated with exact exchange theories.

  7. Application of an excited state LDA exchange energy functional for the calculation of transition energy of atoms within time-independent density functional theory

    International Nuclear Information System (INIS)

    Shamim, Md; Harbola, Manoj K

    2010-01-01

    Transition energies of a new class of excited states (two-gap systems) of various atoms are calculated in time-independent density functional formalism by using a recently proposed local density approximation exchange energy functional for excited states. It is shown that the excitation energies calculated with this functional compare well with those calculated with exact exchange theories.

  8. Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT.

    Science.gov (United States)

    Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru

    2007-02-01

    Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.

  9. Regularization independent analysis of the origin of two loop contributions to N=1 Super Yang-Mills beta function

    Energy Technology Data Exchange (ETDEWEB)

    Fargnoli, H.G.; Sampaio, Marcos; Nemes, M.C. [Federal University of Minas Gerais, ICEx, Physics Department, P.O. Box 702, Belo Horizonte, MG (Brazil); Hiller, B. [Coimbra University, Faculty of Science and Technology, Physics Department, Center of Computational Physics, Coimbra (Portugal); Baeta Scarpelli, A.P. [Setor Tecnico-Cientifico, Departamento de Policia Federal, Lapa, Sao Paulo (Brazil)

    2011-05-15

    We present both an ultraviolet and an infrared regularization independent analysis in a symmetry preserving framework for the N=1 Super Yang-Mills beta function to two loop order. We show explicitly that off-shell infrared divergences as well as the overall two loop ultraviolet divergence cancel out, whilst the beta function receives contributions of infrared modes. (orig.)

  10. Regularization independent analysis of the origin of two loop contributions to N=1 Super Yang-Mills beta function

    International Nuclear Information System (INIS)

    Fargnoli, H.G.; Sampaio, Marcos; Nemes, M.C.; Hiller, B.; Baeta Scarpelli, A.P.

    2011-01-01

    We present both an ultraviolet and an infrared regularization independent analysis in a symmetry preserving framework for the N=1 Super Yang-Mills beta function to two loop order. We show explicitly that off-shell infrared divergences as well as the overall two loop ultraviolet divergence cancel out, whilst the beta function receives contributions of infrared modes. (orig.)

  11. Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

    Science.gov (United States)

    Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

    2018-02-01

    Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

  12. Do orphan G-protein-coupled receptors have ligand-independent functions? New insights from receptor heterodimers

    OpenAIRE

    Levoye, Angélique; Dam, Julie; Ayoub, Mohammed A; Guillaume, Jean-Luc; Jockers, Ralf

    2006-01-01

    G-protein-coupled receptors (GPCRs) are important drug targets and are involved in virtually every biological process. However, there are still more than 140 orphan GPCRs, and deciphering their function remains a priority for fundamental and clinical research. Research on orphan GPCRs has concentrated mainly on the identification of their natural ligands, whereas recent data suggest additional ligand-independent functions for these receptors. This emerging concept is connected with the observ...

  13. Associations between ankle-brachial index and cognitive function: results from the Lifestyle Interventions and Independence for Elders trial

    Science.gov (United States)

    OBJECTIVE: The objective of this study was to evaluate cross-sectional and longitudinal associations between ankle-brachial index (ABI) and indicators of cognitive function. DESIGN: Randomized clinical trial (Lifestyle Interventions and Independence for Elders Trial). SETTING: Eight US academic ce...

  14. Changes in executive functions and self-efficacy are independently associated with improved usual gait speed in older women

    Directory of Open Access Journals (Sweden)

    Hsu Chun

    2010-05-01

    Full Text Available Abstract Background Improved usual gait speed predicts substantial reduction in mortality. A better understanding of the modifiable factors that are independently associated with improved gait speed would ensure that intervention strategies are developed based on a valid theoretical framework. Thus, we examined the independent association of change in executive functions and change in falls-related self-efficacy with improved gait speed among community-dwelling senior women. Methods A secondary analysis of the 135 senior women aged 65 to 75 years old who completed a 12-month randomized controlled trial of resistance training. Usual gait speed was assessed using a 4-meter walk. Three executive processes were assessed by standard neuropsychological tests: 1 set shifting; 2 working memory; and 3 selective attention and response inhibition. A linear regression model was constructed to determine the independent association of change in executive functions and falls-related self-efficacy with change in gait speed. Results Improved selective attention and conflict resolution, and falls-related self-efficacy, were independently associated with improved gait speed after accounting for age, global cognition, baseline gait speed, and change in quadriceps strength. The total variance explained was 24%. Conclusions Interventions that target executive functions and falls-related self-efficacy, in addition to physical functions, to improve gait speed may be more efficacious than those that do not. Trial Registration ClinicalTrials.gov Identifier: NCT00426881

  15. Renin inhibition improves cardiac function and remodeling after myocardial infarction independent of blood pressure

    NARCIS (Netherlands)

    D. Westermann (Dirk); A. Riad (Alexander); O. Lettau (Olga); A.J.M. Roks (Anton); K. Sawatis (Konstantinos); P.M. Becher (Peter Moritz); F. Escher (Felicitas); A.H.J. Danser (Jan); H.P. Schultheiss (Heinz-Peter); C. Tschöpe (Carsten)

    2008-01-01

    textabstractPharmacological renin inhibition with aliskiren is an effective antihypertensive drug treatment, but it is currently unknown whether aliskiren is able to attenuate cardiac failure independent of its blood pressure-lowering effects. We investigated the effect of aliskiren on cardiac

  16. HDL function is impaired in acute myocardial infarction independent of plasma HDL cholesterol levels

    NARCIS (Netherlands)

    Annema, Wijtske; Willemsen, Hendrik M.; de Boer, Jan Freark; Dikkers, Arne; van der Giet, Markus; Nieuwland, Wybe; Muller Kobold, Anna; van Pelt, L. Joost; Slart, Riemer H. J. A.; van der Horst, Iwan C. C.; Dullaart, Robin P. F.; Tio, Rene A.; Tietge, Uwe J. F.

    2016-01-01

    BACKGROUND: High-density lipoproteins (HDLs) protect against the development of atherosclerotic cardiovascular disease. HDL function represents an emerging concept in cardiovascular research. OBJECTIVE: This study investigated the association between HDL functionality and acute myocardial infarction

  17. Exploring the relation between positive emotions and the functional status of older adults living independently: a systematic review.

    Science.gov (United States)

    Cabrita, Miriam; Lamers, Sanne M A; Trompetter, Hester R; Tabak, Monique; Vollenbroek-Hutten, Miriam M R

    2017-11-01

    Literature suggests that positive emotions positively influence physiological parameters but their relation to functioning in the daily life of older adults living independently remains unclear. The present work aims to investigate the relation between positive emotions and functional status in daily life of older people living independently. A systematic literature review was conducted using the PubMed, PsycINFO and Scopus electronic databases. Included works were peer-reviewed empirical studies that analysed the relation between positive emotions and ability to perform activities of daily living with older adults living independently. After removal of duplicates, 10 out of 963 papers met the inclusion criteria. Cross-sectional studies (n = 6) provided limited evidence about a relation between positive emotions and functioning in daily life. However, longitudinal studies (n = 4) provide significant evidence for an interaction between the two factors, suggesting that time influences this interaction. The variety on the design and samples of the studies included in this review does not allow a cohesive conclusion of the results. Nevertheless, limited evidence suggests that higher frequency in the experience of positive emotions might be associated with lower functional limitations. The issue of causality in emotions-functioning remains unclear from the review. Further observational studies are highly recommended, supported by innovative technologies.

  18. Covariant and background independent functional RG flow for the effective average action

    Energy Technology Data Exchange (ETDEWEB)

    Safari, Mahmoud; Vacca, Gian Paolo [Dipartimento di Fisica and INFN - Sezione di Bologna,via Irnerio 46, 40126 Bologna (Italy)

    2016-11-23

    We extend our prescription for the construction of a covariant and background-independent effective action for scalar quantum field theories to the case where momentum modes below a certain scale are suppressed by the presence of an infrared regulator. The key step is an appropriate choice of the infrared cutoff for which the Ward identity, capturing the information from single-field dependence of the ultraviolet action, continues to be exactly solvable, and therefore, in addition to covariance, manifest background independence of the effective action is guaranteed at any scale. A practical consequence is that in this framework one can adopt truncations dependent on the single total field. Furthermore we discuss the necessary and sufficient conditions for the preservation of symmetries along the renormalization group flow.

  19. Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

    Science.gov (United States)

    Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

    2017-12-01

    This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

  20. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  1. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  2. Extracting Intrinsic Functional Networks with Feature-Based Group Independent Component Analysis

    Science.gov (United States)

    Calhoun, Vince D.; Allen, Elena

    2013-01-01

    There is increasing use of functional imaging data to understand the macro-connectome of the human brain. Of particular interest is the structure and function of intrinsic networks (regions exhibiting temporally coherent activity both at rest and while a task is being performed), which account for a significant portion of the variance in…

  3. Hemispheric Division of Function Is the Result of Independent Probabilistic Biases

    Science.gov (United States)

    Whitehouse, Andrew J. O.; Bishop, Dorothy V. M.

    2009-01-01

    Verbal and visuospatial abilities are typically subserved by different cerebral hemispheres: the left hemisphere for the former and the right hemisphere for the latter. However little is known of the origin of this division of function. Causal theories propose that functional asymmetry is an obligatory pattern of organisation, while statistical…

  4. Surgery-Independent Language Function Decline in Patients Undergoing Awake Craniotomy.

    Science.gov (United States)

    Gonen, Tal; Sela, Gal; Yanakee, Ranin; Ram, Zvi; Grossman, Rachel

    2017-03-01

    Despite selection process before awake-craniotomy, some patients experience an unexpected decline in language functions in the operating room (OR), compared with their baseline evaluation, which may impair their functional monitoring. To investigate this phenomenon we prospectively compared language function the day before surgery and on entrance to the OR. Data were collected prospectively from consecutive patients undergoing awake-craniotomy with intraoperative cortical mapping for resection of gliomas affecting language areas. Language functions of 79 patients were evaluated and compared 1-2 days before surgery and after entering the OR. Changes in functional linguistic performance were analyzed with respect to demographic, clinical, and pathologic characteristics. There was a significant decline in language function, beyond sedation effect, after entering the OR, (from median/interquartile range: 0.94/0.72-0.98 to median/interquartile range: 0.86/0.51-0.94; Z = -7.19, P awake-craniotomy may experience a substantial decline in language functioning after entering the OR. Tumor grade and the presence of preoperative language deficits were significant risk factors for this phenomenon, suggesting a possible relation between cognitive reserve, psychobehavioral coping abilities and histologic features of a tumor involving language areas. Capturing and identifying this unique population of patients who are prone to experience such language decline may improve our ability in the future to select patients eligible for awake-craniotomy. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. MRI Study on the Functional and Spatial Consistency of Resting State-Related Independent Components of the Brain Network

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Bum Seok [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of); Choi, Jee Wook [Daejeon St. Mary' s Hospital, The Catholic University of Korea College of Medicine, Daejeon (Korea, Republic of); Kim, Ji Woong [College of Medical Science, Konyang University, Daejeon(Korea, Republic of)

    2012-06-15

    Resting-state networks (RSNs), including the default mode network (DMN), have been considered as markers of brain status such as consciousness, developmental change, and treatment effects. The consistency of functional connectivity among RSNs has not been fully explored, especially among resting-state-related independent components (RSICs). This resting-state fMRI study addressed the consistency of functional connectivity among RSICs as well as their spatial consistency between 'at day 1' and 'after 4 weeks' in 13 healthy volunteers. We found that most RSICs, especially the DMN, are reproducible across time, whereas some RSICs were variable in either their spatial characteristics or their functional connectivity. Relatively low spatial consistency was found in the basal ganglia, a parietal region of left frontoparietal network, and the supplementary motor area. The functional connectivity between two independent components, the bilateral angular/supramarginal gyri/intraparietal lobule and bilateral middle temporal/occipital gyri, was decreased across time regardless of the correlation analysis method employed, (Pearson's or partial correlation). RSICs showing variable consistency are different between spatial characteristics and functional connectivity. To understand the brain as a dynamic network, we recommend further investigation of both changes in the activation of specific regions and the modulation of functional connectivity in the brain network.

  6. MRI Study on the Functional and Spatial Consistency of Resting State-Related Independent Components of the Brain Network

    International Nuclear Information System (INIS)

    Jeong, Bum Seok; Choi, Jee Wook; Kim, Ji Woong

    2012-01-01

    Resting-state networks (RSNs), including the default mode network (DMN), have been considered as markers of brain status such as consciousness, developmental change, and treatment effects. The consistency of functional connectivity among RSNs has not been fully explored, especially among resting-state-related independent components (RSICs). This resting-state fMRI study addressed the consistency of functional connectivity among RSICs as well as their spatial consistency between 'at day 1' and 'after 4 weeks' in 13 healthy volunteers. We found that most RSICs, especially the DMN, are reproducible across time, whereas some RSICs were variable in either their spatial characteristics or their functional connectivity. Relatively low spatial consistency was found in the basal ganglia, a parietal region of left frontoparietal network, and the supplementary motor area. The functional connectivity between two independent components, the bilateral angular/supramarginal gyri/intraparietal lobule and bilateral middle temporal/occipital gyri, was decreased across time regardless of the correlation analysis method employed, (Pearson's or partial correlation). RSICs showing variable consistency are different between spatial characteristics and functional connectivity. To understand the brain as a dynamic network, we recommend further investigation of both changes in the activation of specific regions and the modulation of functional connectivity in the brain network.

  7. Cap-independent translation ensures mTOR expression and function upon protein synthesis inhibition.

    Science.gov (United States)

    Marques-Ramos, Ana; Candeias, Marco M; Menezes, Juliane; Lacerda, Rafaela; Willcocks, Margaret; Teixeira, Alexandre; Locker, Nicolas; Romão, Luísa

    2017-11-01

    The mechanistic/mammalian target of rapamycin (mTOR) is a conserved serine/threonine kinase that integrates cellular signals from the nutrient and energy status to act, namely, on the protein synthesis machinery. While major advances have emerged regarding the regulators and effects of the mTOR signaling pathway, little is known about the regulation of mTOR gene expression. Here, we show that the human mTOR transcript can be translated in a cap-independent manner, and that its 5' untranslated region (UTR) is a highly folded RNA scaffold capable of binding directly to the 40S ribosomal subunit. We further demonstrate that mTOR is able to bypass the cap requirement for translation both in normal and hypoxic conditions. Moreover, our data reveal that the cap-independent translation of mTOR is necessary for its ability to induce cell-cycle progression into S phase. These results suggest a novel regulatory mechanism for mTOR gene expression that integrates the global protein synthesis changes induced by translational inhibitory conditions. © 2017 Marques-Ramos et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. Bipartite structure and functional independence of adenovirus type 5 packaging elements.

    OpenAIRE

    Schmid, S I; Hearing, P

    1997-01-01

    Selectivity and polarity of adenovirus type 5 DNA packaging are believed to be directed by an interaction of putative packaging factors with the cis-acting adenovirus packaging domain located within the genomic left end (nucleotides 194 to 380). In previous studies, this packaging domain was mutationally dissected into at least seven functional elements called A repeats. These elements, albeit redundant in function, exhibit differences in the ability to support viral packaging, with elements ...

  9. A Layered Searchable Encryption Scheme with Functional Components Independent of Encryption Methods

    Science.gov (United States)

    Luo, Guangchun; Qin, Ke

    2014-01-01

    Searchable encryption technique enables the users to securely store and search their documents over the remote semitrusted server, which is especially suitable for protecting sensitive data in the cloud. However, various settings (based on symmetric or asymmetric encryption) and functionalities (ranked keyword query, range query, phrase query, etc.) are often realized by different methods with different searchable structures that are generally not compatible with each other, which limits the scope of application and hinders the functional extensions. We prove that asymmetric searchable structure could be converted to symmetric structure, and functions could be modeled separately apart from the core searchable structure. Based on this observation, we propose a layered searchable encryption (LSE) scheme, which provides compatibility, flexibility, and security for various settings and functionalities. In this scheme, the outputs of the core searchable component based on either symmetric or asymmetric setting are converted to some uniform mappings, which are then transmitted to loosely coupled functional components to further filter the results. In such a way, all functional components could directly support both symmetric and asymmetric settings. Based on LSE, we propose two representative and novel constructions for ranked keyword query (previously only available in symmetric scheme) and range query (previously only available in asymmetric scheme). PMID:24719565

  10. Dynamic Fault Diagnosis for Semi-Batch Reactor under Closed-Loop Control via Independent Radial Basis Function Neural Network

    OpenAIRE

    Abdelkarim M. Ertiame; D. W. Yu; D. L. Yu; J. B. Gomm

    2015-01-01

    In this paper, a robust fault detection and isolation (FDI) scheme is developed to monitor a multivariable nonlinear chemical process called the Chylla-Haase polymerization reactor, when it is under the cascade PI control. The scheme employs a radial basis function neural network (RBFNN) in an independent mode to model the process dynamics, and using the weighted sum-squared prediction error as the residual. The Recursive Orthogonal Least Squares algorithm (ROLS) is emplo...

  11. Independently evolved upper jaw protrusion mechanisms show convergent hydrodynamic function in teleost fishes.

    Science.gov (United States)

    Staab, Katie Lynn; Holzman, Roi; Hernandez, L Patricia; Wainwright, Peter C

    2012-05-01

    A protrusible upper jaw has independently evolved multiple times within teleosts and has been implicated in the success of two groups in particular: Acanthomorpha and Cypriniformes. We use digital particle image velocimetry (DPIV) to compare suction feeding flow dynamics in a representative of each of these clades: goldfish and bluegill. Using DPIV, we contrast the spatial pattern of flow, the temporal relationship between flow and head kinematics, and the contribution of jaw protrusion to the forces exerted on prey. As expected, the spatial patterns of flow were similar in the two species. However, goldfish were slower to reach maximal kinematic excursions, and were more flexible in the relative timing of jaw protrusion, other jaw movements and suction flows. Goldfish were also able to sustain flow speeds for a prolonged period of time as compared with bluegill, in part because goldfish generate lower peak flow speeds. In both species, jaw protrusion increased the force exerted on the prey. However, slower jaw protrusion in goldfish resulted in less augmentation of suction forces. This difference in force exerted on prey corresponds with differences in trophic niches and feeding behavior of the two species. The bluegill uses powerful suction to capture insect larvae whereas the goldfish uses winnowing to sort through detritus and sediment. The kinethmoid of goldfish may permit jaw protrusion that is independent of lower jaw movement, which could explain the ability of goldfish to decouple suction flows (due to buccal expansion) from upper jaw protrusion. Nevertheless, our results show that jaw protrusion allows both species to augment the force exerted on prey, suggesting that this is a fundamental benefit of jaw protrusion to suction feeders.

  12. Differential effects of water-based exercise on the cognitive function in independent elderly adults.

    Science.gov (United States)

    Sato, Daisuke; Seko, Chihiro; Hashitomi, Tatsuya; Sengoku, Yasuo; Nomura, Takeo

    2015-04-01

    Physical exercise has been reported to be the most effective method to improve cognitive function and brain health, but there is as yet no research on the effect of water-based exercise. The aim of the present study was to compare the effects of water-based exercise with and without cognitive stimuli on cognitive and physical functions. The design is a single-blind randomized controlled study. Twenty-one participants were randomly assigned to a normal water-based exercise (Nor-WE) group or a cognitive water-based exercise (Cog-WE) group. The exercise sessions were divided into two exercise series: a 10-min series of land-based warm-up, consisting of flexibility exercises, and a 50-min series of exercises in water. The Nor-WE consisted of 10 min of walking, 30 min of strength and stepping exercise, including stride over, and 10 min of stretching and relaxation in water. The Cog-WE consisted of 10 min of walking, 30 min of water-cognitive exercises, and 10 min of stretching and relaxation in water. Cognitive function, physical function, and ADL were measured before the exercise intervention (pre-intervention) and 10 weeks after the intervention (post-intervention). Participation in the Cog-WE performed significantly better on the pegboard test and the choice stepping reaction test and showed a significantly improved attention, memory, and learning, and in the general cognitive function (measured as the total score in the 5-Cog test). Participation in the Nor-WE dramatically improved walking ability and lower limb muscle strength. Our results reveal that the benefits elderly adults may obtain from water-based exercise depend on the characteristics of each specific exercise program. These findings highlight the importance of prescription for personalized water-based exercises to elderly adults to improve cognitive function.

  13. Cognitive abilities and functional capacity in older adults: results from the modified Scales of Independent Behavior-Revised.

    Science.gov (United States)

    Tan, Jing Ee; Hultsch, David F; Strauss, Esther

    2009-04-01

    The relationship between cognitive and functional abilities was examined in a sample of community-dwelling older adults. Self and informant (e.g., spouse) reports of participants' functional status were obtained on the modified Scales of Independent Behavior-Revised (mSIB-R). Participants also completed measures of processing speed, episodic memory, executive functioning, and verbal ability. Results showed that the mSIB-R correlated positively with cognitive variables. Hierarchical regression analyses suggested that each mSIB-R factor is predicted by somewhat different cognitive variables, after adjusting for demographic, health, and motor variables. This report-based measure was as accurate as a performance-based measure in classifying cognitive groups. Informant social/cognitive engagement and self physical/environment engagement factors showed the most promise in this regard. The findings reveal links between cognitive and functional abilities in a sample with varying degrees of cognitive impairment.

  14. Coronary Flow Reserve Predicts Cardiopulmonary Fitness in Patients with Coronary Artery Disease Independently of Systolic and Diastolic Function

    DEFF Research Database (Denmark)

    Snoer, Martin; Olsen, Rasmus Huan; Monk-Hansen, Tea

    2014-01-01

    Aims Despite revascularization and optimal medical treatment, patients with coronary artery disease (CAD) have reduced exercise capacity. In the absence of coronary artery stenosis, coronary flow reserve (CFR) is a measure of coronary microvascular function, and a marker of future poor outcome...... in CAD patients. The aim of this study was to examine the relationship among CFR, systolic and diastolic function, peripheral vascular function, and cardiopulmonary fitness in CAD patients. Methods and Results Forty patients with median left ventricular ejection fraction (LVEF) 49 (interquartile 46....... Conclusions Coronary flow reserve measured noninvasively predicts cardiopulmonary fitness independently of resting systolic and diastolic function in CAD patients, indicating that cardiac output during maximal exercise is dependent on the ability of the coronary circulation to adapt to the higher metabolic...

  15. Impulse-response function of splanchnic circulation with model-independent constraints: theory and experimental validation

    DEFF Research Database (Denmark)

    Munk, O L; Keiding, S; Bass, L

    2003-01-01

    Modeling physiological processes using tracer kinetic methods requires knowledge of the time course of the tracer concentration in blood supplying the organ. For liver studies, however, inaccessibility of the portal vein makes direct measurement of the hepatic dual-input function impossible...

  16. Tumor suppressor function of Bruton tyrosine kinase is independent of its catalytic activity

    NARCIS (Netherlands)

    S. Middendorp; A.J.E. Zijlstra (Esther); R. Kersseboom (Rogier); G.M. Dingjan (Gemma); H. Jumaa; R.W. Hendriks (Rudi)

    2005-01-01

    textabstractDuring B-cell development in the mouse, Bruton tyrosine kinase (Btk) and the adaptor protein SLP-65 (Src homology 2 [SH2] domain-containing leukocyte protein of 65 kDa) limit the expansion and promote the differentiation of pre-B cells. Btk is thought to mainly function

  17. Independent component analysis of high-resolution imaging data identifies distinct functional domains

    DEFF Research Database (Denmark)

    Reidl, Juergen; Starke, Jens; Omer, David

    2007-01-01

    be automatically detected. In the visual cortex orientation columns can be extracted. In all cases artifacts due to movement, heartbeat or respiration were separated from the functional signal by sICA and could be removed from the data set. sICA is therefore a powerful technique for data compression, unbiased...

  18. Adiposity, physical activity, and muscle quality are independently related to physical function performance in middle-aged postmenopausal women.

    Science.gov (United States)

    Ward-Ritacco, Christie L; Adrian, Amanda L; Johnson, Mary Ann; Rogers, Laura Q; Evans, Ellen M

    2014-10-01

    Poor physical function performance is associated with risks for disability in late life; however, determinants of physical function are not well characterized in middle-aged women. The aim of this cross-sectional study was to examine the contributions of body composition, physical activity, muscle capacity, and muscle quality to physical function performance. Postmenopausal women (N = 64; mean [SD] age, 58.6 [3.6] y) were assessed for body composition via dual-energy x-ray absorptiometry, for physical activity via accelerometer (steps per day), and for physical function via Timed Up and Go, 30-second chair stand, and 6-minute walk. Leg strength was assessed using isokinetic dynamometry at 60° second. Leg power was assessed with the Nottingham Leg Extensor Power Rig. Muscle quality was calculated as (1) the ratio of leg strength at 60° second to upper leg lean mass and (2) the ratio of leg power to total lower body lean mass. Regression analyses revealed the following: (1) age and muscle quality calculated with leg power are independently related to Timed Up and Go, explaining 12% and 11% of the variance, respectively (P quality calculated with leg strength are independently related to 30-second chair stand, explaining 12% and 10% of the variance, respectively (P quality calculated with leg strength, steps per day, and adiposity are independent predictors of 6-minute walk, collectively explaining 51% of the variance. In postmenopausal women, a more optimal body composition (including lower adiposity and higher lean mass) and higher levels of physical activity are associated with better physical function performance at midlife.

  19. Automatic denoising of functional MRI data: combining independent component analysis and hierarchical fusion of classifiers.

    Science.gov (United States)

    Salimi-Khorshidi, Gholamreza; Douaud, Gwenaëlle; Beckmann, Christian F; Glasser, Matthew F; Griffanti, Ludovica; Smith, Stephen M

    2014-04-15

    Many sources of fluctuation contribute to the fMRI signal, and this makes identifying the effects that are truly related to the underlying neuronal activity difficult. Independent component analysis (ICA) - one of the most widely used techniques for the exploratory analysis of fMRI data - has shown to be a powerful technique in identifying various sources of neuronally-related and artefactual fluctuation in fMRI data (both with the application of external stimuli and with the subject "at rest"). ICA decomposes fMRI data into patterns of activity (a set of spatial maps and their corresponding time series) that are statistically independent and add linearly to explain voxel-wise time series. Given the set of ICA components, if the components representing "signal" (brain activity) can be distinguished form the "noise" components (effects of motion, non-neuronal physiology, scanner artefacts and other nuisance sources), the latter can then be removed from the data, providing an effective cleanup of structured noise. Manual classification of components is labour intensive and requires expertise; hence, a fully automatic noise detection algorithm that can reliably detect various types of noise sources (in both task and resting fMRI) is desirable. In this paper, we introduce FIX ("FMRIB's ICA-based X-noiseifier"), which provides an automatic solution for denoising fMRI data via accurate classification of ICA components. For each ICA component FIX generates a large number of distinct spatial and temporal features, each describing a different aspect of the data (e.g., what proportion of temporal fluctuations are at high frequencies). The set of features is then fed into a multi-level classifier (built around several different classifiers). Once trained through the hand-classification of a sufficient number of training datasets, the classifier can then automatically classify new datasets. The noise components can then be subtracted from (or regressed out of) the original

  20. A factor analysis of Functional Independence and Functional Assessment Measure scores among focal and diffuse brain injury patients: The importance of bi-factor models.

    Science.gov (United States)

    Gunn, Sarah; Burgess, Gerald H; Maltby, John

    2018-04-28

    To explore the factor structure of the UK Functional Independence Measure and Functional Assessment Measure (FIM+FAM) among focal and diffuse acquired brain injury patients. Criterion standard. An NHS acute acquired brain injury inpatient rehabilitation hospital. Referred sample of 447 adults (835 cases after exclusions) admitted for inpatient treatment following an acquired brain injury significant enough to justify intensive inpatient neurorehabilitation. Not applicable. Functional Independence Measure and Functional Assessment Measure. Exploratory Factor Analysis suggested a two-factor structure to FIM+FAM scores, among both focal-proximate and diffuse-proximate acquired brain injury aetiologies. Confirmatory Factor Analysis suggested a three-factor bi-factor structure presented the best fit of the FIM+FAM score data across both aetiologies. However, across both analyses, a convergence was found towards a general factor, demonstrated by high correlations between factors in the Exploratory Factor Analysis, and by a general factor explaining the majority of the variance in scores on Confirmatory Factor Analysis. Our findings suggested that although factors describing specific functional domains can be derived from FIM+FAM item scores, there is a convergence towards a single factor describing overall functioning. This single factor informs the specific group factors (e.g. motor, psychosocial and communication function) following brain injury. Further research into the comparative value of the general and group factors as evaluative/prognostic measures is indicated. Copyright © 2018. Published by Elsevier Inc.

  1. Localization of Presynaptic Plasticity Mechanisms Enables Functional Independence of Synaptic and Ectopic Transmission in the Cerebellum

    Directory of Open Access Journals (Sweden)

    Katharine L. Dobson

    2015-01-01

    Full Text Available In the cerebellar molecular layer parallel fibre terminals release glutamate from both the active zone and from extrasynaptic “ectopic” sites. Ectopic release mediates transmission to the Bergmann glia that ensheathe the synapse, activating Ca2+-permeable AMPA receptors and glutamate transporters. Parallel fibre terminals exhibit several forms of presynaptic plasticity, including cAMP-dependent long-term potentiation and endocannabinoid-dependent long-term depression, but it is not known whether these presynaptic forms of long-term plasticity also influence ectopic transmission to Bergmann glia. Stimulation of parallel fibre inputs at 16 Hz evoked LTP of synaptic transmission, but LTD of ectopic transmission. Pharmacological activation of adenylyl cyclase by forskolin caused LTP at Purkinje neurons, but only transient potentiation at Bergmann glia, reinforcing the concept that ectopic sites lack the capacity to express sustained cAMP-dependent potentiation. Activation of mGluR1 caused depression of synaptic transmission via retrograde endocannabinoid signalling but had no significant effect at ectopic sites. In contrast, activation of NMDA receptors suppressed both synaptic and ectopic transmission. The results suggest that the signalling mechanisms for presynaptic LTP and retrograde depression by endocannabinoids are restricted to the active zone at parallel fibre synapses, allowing independent modulation of synaptic transmission to Purkinje neurons and ectopic transmission to Bergmann glia.

  2. Reform of Kosovo Tax System after independence and its key functions

    Directory of Open Access Journals (Sweden)

    Dr.Sc. Bedri Peci

    2013-12-01

    However, policy and tax system of Kosovo should be more in function of economic development by achieving equilibrium between direct and indirect taxes, increasing efficiency of public expenditures and to offer more tax incentives. Designers’ preliminary requirement is to analyze fiscal, economic, etc., effects of each tax form which aims to apply in accordance with tax policy objectives and to analyze the role and effects of tax incentives to each tax form. Taking into account that Kosovo regarding the application of tax incentives of CIT, compared with other countries is the last, designers by using the experiences of other countries should apply more tax incentives in order that tax policy to be more in function for economic development

  3. Application of independent component analysis for speech-music separation using an efficient score function estimation

    Science.gov (United States)

    Pishravian, Arash; Aghabozorgi Sahaf, Masoud Reza

    2012-12-01

    In this paper speech-music separation using Blind Source Separation is discussed. The separating algorithm is based on the mutual information minimization where the natural gradient algorithm is used for minimization. In order to do that, score function estimation from observation signals (combination of speech and music) samples is needed. The accuracy and the speed of the mentioned estimation will affect on the quality of the separated signals and the processing time of the algorithm. The score function estimation in the presented algorithm is based on Gaussian mixture based kernel density estimation method. The experimental results of the presented algorithm on the speech-music separation and comparing to the separating algorithm which is based on the Minimum Mean Square Error estimator, indicate that it can cause better performance and less processing time

  4. Long-term intensive gymnastic training induced changes in intra- and inter-network functional connectivity: an independent component analysis.

    Science.gov (United States)

    Huang, Huiyuan; Wang, Junjing; Seger, Carol; Lu, Min; Deng, Feng; Wu, Xiaoyan; He, Yuan; Niu, Chen; Wang, Jun; Huang, Ruiwang

    2018-01-01

    Long-term intensive gymnastic training can induce brain structural and functional reorganization. Previous studies have identified structural and functional network differences between world class gymnasts (WCGs) and non-athletes at the whole-brain level. However, it is still unclear how interactions within and between functional networks are affected by long-term intensive gymnastic training. We examined both intra- and inter-network functional connectivity of gymnasts relative to non-athletes using resting-state fMRI (R-fMRI). R-fMRI data were acquired from 13 WCGs and 14 non-athlete controls. Group-independent component analysis (ICA) was adopted to decompose the R-fMRI data into spatial independent components and associated time courses. An automatic component identification method was used to identify components of interest associated with resting-state networks (RSNs). We identified nine RSNs, the basal ganglia network (BG), sensorimotor network (SMN), cerebellum (CB), anterior and posterior default mode networks (aDMN/pDMN), left and right fronto-parietal networks (lFPN/rFPN), primary visual network (PVN), and extrastriate visual network (EVN). Statistical analyses revealed that the intra-network functional connectivity was significantly decreased within the BG, aDMN, lFPN, and rFPN, but increased within the EVN in the WCGs compared to the controls. In addition, the WCGs showed uniformly decreased inter-network functional connectivity between SMN and BG, CB, and PVN, BG and PVN, and pDMN and rFPN compared to the controls. We interpret this generally weaker intra- and inter-network functional connectivity in WCGs during the resting state as a result of greater efficiency in the WCGs' brain associated with long-term motor skill training.

  5. Structural and Functional Diversity of Plant Virus 3′-Cap-Independent Translation Enhancers (3′-CITEs

    Directory of Open Access Journals (Sweden)

    Verónica Truniger

    2017-11-01

    Full Text Available Most of the positive-strand RNA plant viruses lack the 5′-cap and/or the poly(A-tail that act synergistically to stimulate canonical translation of cellular mRNAs. However, they have RNA elements in the 5′- or 3′-untranslated regions of their RNAs that are required for their cap-independent translation. Cap-independent translation enhancers (CITEs have been identified in the genomic 3′-end of viruses belonging to the family Tombusviridae and the genus Luteovirus. Seven classes of 3′-CITEs have been described to date based on their different RNA structures. They generally control the efficient formation of the translation initiation complex by varying mechanisms. Some 3′-CITEs bind eukaryotic translation initiation factors, others ribosomal subunits, bridging these to the 5′-end by different mechanisms, often long-distance RNA–RNA interactions. As previously proposed and recently found in one case in nature, 3′-CITEs are functionally independent elements that are transferable through recombination between viral genomes, leading to potential advantages for virus multiplication. In this review, the knowledge on 3′-CITEs and their functioning is updated. We also suggest that there is local structural conservation in the regions interacting with eIF4E of 3′-CITEs belonging to different classes.

  6. Structural and Functional Diversity of Plant Virus 3′-Cap-Independent Translation Enhancers (3′-CITEs)

    Science.gov (United States)

    Truniger, Verónica; Miras, Manuel; Aranda, Miguel A.

    2017-01-01

    Most of the positive-strand RNA plant viruses lack the 5′-cap and/or the poly(A)-tail that act synergistically to stimulate canonical translation of cellular mRNAs. However, they have RNA elements in the 5′- or 3′-untranslated regions of their RNAs that are required for their cap-independent translation. Cap-independent translation enhancers (CITEs) have been identified in the genomic 3′-end of viruses belonging to the family Tombusviridae and the genus Luteovirus. Seven classes of 3′-CITEs have been described to date based on their different RNA structures. They generally control the efficient formation of the translation initiation complex by varying mechanisms. Some 3′-CITEs bind eukaryotic translation initiation factors, others ribosomal subunits, bridging these to the 5′-end by different mechanisms, often long-distance RNA–RNA interactions. As previously proposed and recently found in one case in nature, 3′-CITEs are functionally independent elements that are transferable through recombination between viral genomes, leading to potential advantages for virus multiplication. In this review, the knowledge on 3′-CITEs and their functioning is updated. We also suggest that there is local structural conservation in the regions interacting with eIF4E of 3′-CITEs belonging to different classes. PMID:29238357

  7. Fab-based inhibitors reveal ubiquitin independent functions for HIV Vif neutralization of APOBEC3 restriction factors.

    Directory of Open Access Journals (Sweden)

    Jennifer M Binning

    2018-01-01

    Full Text Available The lentiviral protein Viral Infectivity Factor (Vif counteracts the antiviral effects of host APOBEC3 (A3 proteins and contributes to persistent HIV infection. Vif targets A3 restriction factors for ubiquitination and proteasomal degradation by recruiting them to a multi-protein ubiquitin E3 ligase complex. Here, we describe a degradation-independent mechanism of Vif-mediated antagonism that was revealed through detailed structure-function studies of antibody antigen-binding fragments (Fabs to the Vif complex. Two Fabs were found to inhibit Vif-mediated A3 neutralization through distinct mechanisms: shielding A3 from ubiquitin transfer and blocking Vif E3 assembly. Combined biochemical, cell biological and structural studies reveal that disruption of Vif E3 assembly inhibited A3 ubiquitination but was not sufficient to restore its packaging into viral particles and antiviral activity. These observations establish that Vif can neutralize A3 family members in a degradation-independent manner. Additionally, this work highlights the potential of Fabs as functional probes, and illuminates how Vif uses a multi-pronged approach involving both degradation dependent and independent mechanisms to suppress A3 innate immunity.

  8. Evaluation of treatment in the Smart Home IRIS in terms of functional independence and occupational performance and satisfaction.

    Science.gov (United States)

    Ocepek, Julija; Roberts, Anne E K; Vidmar, Gaj

    2013-01-01

    The development of assistive technologies, home modifications, and smart homes has rapidly advanced in the last two decades. Health professionals have recognised the benefits of these technologies in improving individual's quality of life. The Smart Home IRIS was established in 2008 within the University Rehabilitation Institute in Ljubljana with the aim to enable persons with disabilities and elderly people to test various assistive technologies and technical solutions for their independent living. We investigated the effect of treatments in the Smart Home IRIS. A convenience sample of 59 persons with disabilities and elderly people (aged 24-81 years) who were treated in the Smart Home IRIS from April to December 2011 participated. Standardised instruments--the Canadian Occupational Performance Measure (COPM) and the Functional Independence Measure (FIM)--were administered at the first assessment in the Smart Home IRIS and at a second assessment at the participant's home after 6-12 months. All the outcomes statistically significantly improved from the first to the second assessment. The treatments in the Smart Home IRIS appeared to contribute to higher occupational performance and satisfaction with performance and higher functional independence of persons with disabilities and elderly people.

  9. Evaluation of Treatment in the Smart Home IRIS in terms of Functional Independence and Occupational Performance and Satisfaction

    Directory of Open Access Journals (Sweden)

    Julija Ocepek

    2013-01-01

    Full Text Available The development of assistive technologies, home modifications, and smart homes has rapidly advanced in the last two decades. Health professionals have recognised the benefits of these technologies in improving individual’s quality of life. The Smart Home IRIS was established in 2008 within the University Rehabilitation Institute in Ljubljana with the aim to enable persons with disabilities and elderly people to test various assistive technologies and technical solutions for their independent living. We investigated the effect of treatments in the Smart Home IRIS. A convenience sample of 59 persons with disabilities and elderly people (aged 24–81 years who were treated in the Smart Home IRIS from April to December 2011 participated. Standardised instruments—the Canadian Occupational Performance Measure (COPM and the Functional Independence Measure (FIM—were administered at the first assessment in the Smart Home IRIS and at a second assessment at the participant’s home after 6–12 months. All the outcomes statistically significantly improved from the first to the second assessment. The treatments in the Smart Home IRIS appeared to contribute to higher occupational performance and satisfaction with performance and higher functional independence of persons with disabilities and elderly people.

  10. Postural balance and functional independence of elderly people according to gender and age: cross-sectional study

    Directory of Open Access Journals (Sweden)

    Helen Benincasa Nakagawa

    Full Text Available ABSTRACT CONTEXT AND OBJECTIVE: Aging causes changes in men and women. Studies have shown that women have worse postural balance and greater functional dependence than men, but there is no consensus regarding this. The aim of this study was to compare the balance and functional independence of elderly people according to sex and age, and to evaluate the association between postural balance and the number of drugs taken. DESIGN AND SETTING: Cross-sectional at a state university. METHODS: 202 elderly people were evaluated regarding balance (Berg Scale, independence (Barthel Index, age, sex, number of medications and physical activity. RESULTS: The subjects comprised 117 women (70.2 ± 5.6 years old and 85 men (71.1 ± 6.9 years old. For balance, there was no significant difference regarding sex, but there was a difference regarding age (P < 0.0001. For functional independence, there was a difference regarding sex (P = 0.003, but not regarding age. The variables of age, medications and physical activity were significant for predicting the Berg score. For the Barthel index, only age and sex were significant. Elderly people who took three or more medications/day showed higher risk of falling than those who took up two drugs/day (odds ratio = 5.53, P < 0.0001, 95% confidence interval, 2.3-13.0. CONCLUSIONS: There was no sexual difference in relation to postural balance. However, people who were more elderly presented a high risk of falling. Functional dependence was worse among females. There was an association between the number of medication drugs and risk of falling.

  11. Cross-cultural validation of the Persian version of the Functional Independence Measure for patients with stroke.

    Science.gov (United States)

    Naghdi, Soofia; Ansari, Noureddin Nakhostin; Raji, Parvin; Shamili, Aryan; Amini, Malek; Hasson, Scott

    2016-01-01

    To translate and cross-culturally adapt the Functional Independence Measure (FIM) into the Persian language and to test the reliability and validity of the Persian FIM (PFIM) in patients with stroke. In this cross-sectional study carried out in an outpatient stroke rehabilitation center, 40 patients with stroke (mean age 60 years) were participated. A standard forward-backward translation method and expert panel validation was followed to develop the PFIM. Two experienced occupational therapists (OTs) assessed the patients independently in all items of the PFIM in a single session for inter-rater reliability. One of the OTs reassessed the patients after 1 week for intra-rater reliability. There were no floor or ceiling effects for the PFIM. Excellent inter-rater and intra-rater reliability was noted for the PFIM total score, motor and cognitive subscales (ICC(agreement)0.88-0.98). According to the Bland-Altman agreement analysis, there was no systematic bias between raters and within raters. The internal consistency of the PFIM was with Cronbach's alpha from 0.70 to 0.96. The principal component analysis with varimax rotation indicated a three-factor structure: (1) self-care and mobility; (2) sphincter control and (3) cognitive that jointly accounted for 74.8% of the total variance. Construct validity was supported by a significant Pearson correlation between the PFIM and the Persian Barthel Index (r = 0.95; p Persian patients with stroke. The Functional Independence Measure (FIM) is an outcome measure for disability based on the International Classification of Functioning, Disability and Health (ICF). The FIM was cross-culturally adapted and validated into Persian language. The Persian version of the FIM (PFIM) is reliable and valid for assessing functional status of patients with stroke. The PFIM can be used in Persian speaking countries to assess the limitations in activities of daily living of patients with stroke.

  12. Isoliquiritigenin exhibits anti-proliferative properties in the pituitary independent of estrogen receptor function

    International Nuclear Information System (INIS)

    Weis, Karen E.; Raetzman, Lori T.

    2016-01-01

    The plant flavonoid isoliquiritigenin (ISL) is a botanical estrogen widely taken as an herbal supplement to ease the symptoms of menopause. ISL has been also shown to have anti-tumor properties in a number of cancer cell backgrounds. However, the effects of ISL on normal cells are less well known and virtually unstudied in the context of the pituitary gland. We have established a pituitary explant culture model to screen chemical agents for gene expression changes within the pituitary gland during a period of active proliferation and differentiation. Using this whole-organ culture system we found ISL to be weakly estrogenic based on its ability to induce Cckar mRNA expression, an estrogen receptor (ER) mediated gene. Using a range of ISL from 200 nM to 200 μM, we discovered that ISL promoted cell proliferation at a low concentration, yet potently inhibited proliferation at the highest concentration. ICI 182,780 failed to antagonize ISL's repression of pituitary cell proliferation, indicating the effect is independent of ER signaling. Coincident with a decrease in proliferating cells, we observed down-regulation of transcript for cyclin D2 and E2 and a strong induction of mRNA and protein for the cyclin dependent kinase inhibitor Cdkn1a (p21). Importantly, high dose ISL did not alter the balance of progenitor vs. differentiated cell types within the pituitary explants and they seemed otherwise healthy; however, TUNEL staining revealed an increase in apoptotic cell death in ISL treated cultures. Our results merit further examination of ISL as an anti-tumor agent in the pituitary gland. - Highlights: • Isoliquiritigenin possesses weak estrogenic activity based on induction of Cckar. • ISL can be anti-proliferative in pituitary explants without altering cell lineages. • Anti-proliferative behavior of ISL is not estrogen receptor mediated. • ISL induces p21 expression leading to cell cycle arrest and apoptosis.

  13. Isoliquiritigenin exhibits anti-proliferative properties in the pituitary independent of estrogen receptor function

    Energy Technology Data Exchange (ETDEWEB)

    Weis, Karen E.; Raetzman, Lori T., E-mail: raetzman@life.illinois.edu

    2016-12-15

    The plant flavonoid isoliquiritigenin (ISL) is a botanical estrogen widely taken as an herbal supplement to ease the symptoms of menopause. ISL has been also shown to have anti-tumor properties in a number of cancer cell backgrounds. However, the effects of ISL on normal cells are less well known and virtually unstudied in the context of the pituitary gland. We have established a pituitary explant culture model to screen chemical agents for gene expression changes within the pituitary gland during a period of active proliferation and differentiation. Using this whole-organ culture system we found ISL to be weakly estrogenic based on its ability to induce Cckar mRNA expression, an estrogen receptor (ER) mediated gene. Using a range of ISL from 200 nM to 200 μM, we discovered that ISL promoted cell proliferation at a low concentration, yet potently inhibited proliferation at the highest concentration. ICI 182,780 failed to antagonize ISL's repression of pituitary cell proliferation, indicating the effect is independent of ER signaling. Coincident with a decrease in proliferating cells, we observed down-regulation of transcript for cyclin D2 and E2 and a strong induction of mRNA and protein for the cyclin dependent kinase inhibitor Cdkn1a (p21). Importantly, high dose ISL did not alter the balance of progenitor vs. differentiated cell types within the pituitary explants and they seemed otherwise healthy; however, TUNEL staining revealed an increase in apoptotic cell death in ISL treated cultures. Our results merit further examination of ISL as an anti-tumor agent in the pituitary gland. - Highlights: • Isoliquiritigenin possesses weak estrogenic activity based on induction of Cckar. • ISL can be anti-proliferative in pituitary explants without altering cell lineages. • Anti-proliferative behavior of ISL is not estrogen receptor mediated. • ISL induces p21 expression leading to cell cycle arrest and apoptosis.

  14. Comparing the loss of functional independence of older adults in the U.S. and China.

    Science.gov (United States)

    Fong, Joelle H; Feng, Jun

    2018-01-01

    Functional loss among older adults is known to follow a hierarchical sequence, but little is known about whether such sequences differ across socio-cultural contexts. The aim of this study is to construct activities of daily livings (ADL) scales for oldest-old adults in the United States and China so as to compare their functional loss sequences. We use data from the Asset and Health Dynamics of the Oldest Old (n=1607) and Chinese Longitudinal Healthy Longevity Survey (n=5570) for years 1998-2008. ADL items are calibrated within a scale using the Rasch measurement model. Rasch scores are averaged across survey waves to identify the ADL loss sequence for each study population. We also assess scale stability over measurement periods. Factor analyses confirm that the ADL items in each study population can be combined meaningfully to form a hierarchical sequence. Internal consistency assessed by Cronbach's alpha is high (0.81 to 0.95). We find that bathing is the first activity that both older Americans and Chinese have difficulty with, while eating is the last activity. There are, however, differences in the rank order for toileting (ranked more challenging in the Chinese sample) and dressing (ranked more challenging in the U.S. sample). Item orderings are stable over time. The results highlight the relative importance of bathing in the functional loss sequence for older adults, regardless of socio-cultural context. Health interventions are needed to address deficits in the bathroom environment, especially in developing countries like China. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Speech discrimination difficulties in High-Functioning Autism Spectrum Disorder are likely independent of auditory hypersensitivity.

    Directory of Open Access Journals (Sweden)

    William Andrew Dunlop

    2016-08-01

    Full Text Available Autism Spectrum Disorder (ASD, characterised by impaired communication skills and repetitive behaviours, can also result in differences in sensory perception. Individuals with ASD often perform normally in simple auditory tasks but poorly compared to typically developed (TD individuals on complex auditory tasks like discriminating speech from complex background noise. A common trait of individuals with ASD is hypersensitivity to auditory stimulation. No studies to our knowledge consider whether hypersensitivity to sounds is related to differences in speech-in-noise discrimination. We provide novel evidence that individuals with high-functioning ASD show poor performance compared to TD individuals in a speech-in-noise discrimination task with an attentionally demanding background noise, but not in a purely energetic noise. Further, we demonstrate in our small sample that speech-hypersensitivity does not appear to predict performance in the speech-in-noise task. The findings support the argument that an attentional deficit, rather than a perceptual deficit, affects the ability of individuals with ASD to discriminate speech from background noise. Finally, we piloted a novel questionnaire that measures difficulty hearing in noisy environments, and sensitivity to non-verbal and verbal sounds. Psychometric analysis using 128 TD participants provided novel evidence for a difference in sensitivity to non-verbal and verbal sounds, and these findings were reinforced by participants with ASD who also completed the questionnaire. The study was limited by a small and high-functioning sample of participants with ASD. Future work could test larger sample sizes and include lower-functioning ASD participants.

  16. The Feldenkrais Method(®) can enhance cognitive function in independent living older adults: A case-series.

    Science.gov (United States)

    Ullmann, Gerhild; Williams, Harriet G

    2016-07-01

    Poor cognitive health a major concern of aging individuals, can compromise independent living. More than 16 million people in the United States are affected by cognitive impairment. We have studied the effects of the Feldenkrais Method(®) on cognitive function. In this case series with three participants cognitive function was assessed with the Trail Making Test A and B at baseline and after the Feldenkrais intervention. All participants improved performance on Trail Making Test A and B after completing the Feldenkrais intervention indicating that Feldenkrais lessons may offset age-related decline in cognitive function. The results of this case series warrant larger scale studies on cognitive outcomes of Feldenkrais interventions in clinical and non-clinical populations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Assessment of executive functioning in binge-eating disorder independent of weight status.

    Science.gov (United States)

    Eneva, Kalina T; Arlt, Jean M; Yiu, Angelina; Murray, Susan M; Chen, Eunice Y

    2017-08-01

    Executive functioning (EF) problems may serve as vulnerability or maintenance factors for Binge-Eating Disorder (BED). However, it is unclear if EF problems observed in BED are related to overweight status or BED status. The current study extends this literature by examining EF in overweight and normal-weight BED compared to weight-matched controls. Participants were normal-weight women with BED (n = 23), overweight BED (n = 32), overweight healthy controls (n = 48), and normal-weight healthy controls (n = 29). The EF battery utilized tests from the National Institutes of Health (NIH) Toolbox and Delis-Kaplan Executive Function System (D-KEFS). After controlling for years of education and minority status, overweight individuals performed more poorly than normal-weight individuals on a task of cognitive flexibility requiring generativity (p < .01), and speed on psychomotor performance tasks (p = .01). Normal-weight and overweight BED performed worse on working memory tasks compared to controls (p = .04). Unexpectedly, normal-weight BED individuals out-performed all other groups on an inhibitory control task (p < .01). No significant differences were found between the four groups on tasks of planning. Regardless of weight status, BED is associated with working memory problems. Replication of the finding that normal-weight BED is associated with enhanced inhibitory control is needed. © 2017 Wiley Periodicals, Inc.

  18. Amyloid-independent functional neural correlates of episodic memory in amnestic mild cognitive impairment.

    Science.gov (United States)

    Seo, Eun Hyun; Choo, I L Han

    2016-06-01

    Although amnestic mild cognitive impairment (aMCI) could have various biological characteristics, little attention has been given to the nature of episodic memory decline in aMCI with pathophysiologies other than Alzheimer's disease (AD), i.e., aMCI with low beta-amyloid (Aβ) burden. This study aimed to identify the functional neural basis of episodic memory impairment in aMCI with Aβ burden negative (aMCI-Aβ-) and to compare these results with aMCI with Aβ burden positive (aMCI-Aβ+). Individuals with aMCI (n = 498) were selected from the Alzheimer's Disease Neuroimaging Initiative database. Based on the mean florbetapir standard uptake value ratio, participants were classified as aMCI-Aβ- or aMCI-Aβ+. Correlations between memory scores and regional cerebral glucose metabolism (rCMglc) were analyzed separately for the two subgroups using a multiple regression model. For aMCI-Aβ-, significant positive correlations between memory and rCMglc were found in the bilateral claustrum, right thalamus, left anterior cingulate cortex, left insula, and right posterior cingulate. For aMCI-Aβ+, significant positive correlations between memory and rCMglc were found in the temporoparietal areas. These correlation patterns remained unchanged when clinical severity was added as a covariate Our findings indicate that memory impairment in aMCI-Aβ- is related to multimodal integrative processing and the attentional control system, whereas memory impairment in aMCI-Aβ+ is related to the typical brain memory systems and AD signature. These results suggest that although the two subgroups are clinically in the same category as aMCI, the memory impairment process depends on completely different functional brain regions according to their Aβ burden level.

  19. Left ventricular long axis function assessed during cine-cardiovascular magnetic resonance is an independent predictor of adverse cardiac events.

    Science.gov (United States)

    Rangarajan, Vibhav; Chacko, Satish Jacob; Romano, Simone; Jue, Jennifer; Jariwala, Nikhil; Chung, Jaehoon; Farzaneh-Far, Afshin

    2016-06-07

    Left ventricular pump function requires a complex interplay involving myocardial fibers orientated in the longitudinal, oblique and circumferential directions. Long axis dysfunction appears to be an early marker for a number of pathological states. We hypothesized that mitral annular plane systolic excursion (MAPSE) measured during cine-cardiovascular magnetic resonance (CMR) reflects changes in long axis function and may be an early marker for adverse cardiovascular outcomes. The aims of this study were therefore: 1) To assess the feasibility and reproducibility of MAPSE measurements during routine cine-CMR; and 2) To assess whether MAPSE, as a surrogate for long axis function, is a predictor of major adverse cardiovascular events (MACE). Four hundred consecutive patients undergoing CMR were prospectively enrolled. MAPSE was measured in the 4-chamber cine view. Patients were prospectively followed for major adverse cardiac events (MACE) - death, non-fatal myocardial infarction, hospitalization for heart failure or unstable angina, and late revascularization. Cox proportional hazards regression modeling was used to identify factors independently associated with MACE. Net reclassification improvement (NRI) was calculated to assess whether addition of MAPSE resulted in improved risk reclassification of MACE. Seventy-two MACE occurred during a median follow-up of 14.5 months. By Kaplan-Meier analysis, patients with lateral MAPSE cine-CMR is an independent predictor of MACE.

  20. Short-term effects of upper extremity circuit resistance training on muscle strength and functional independence in patients with paraplegia.

    Science.gov (United States)

    Yildirim, Adem; Sürücü, Gülseren Dost; Karamercan, Ayşe; Gedik, Dilay Eken; Atci, Nermin; Dülgeroǧlu, Deniz; Özgirgin, Neşe

    2016-11-21

    A number of exercises to strengthen the upper extremities are recommended to increase functional independence and quality of life (QoL) in patients with paraplegia. Circuit resistance training (CRT) is a type of progressive resistive exercise performed repeatedly at fixed mechanical exercise stations. The aim of this study was to investigate the potential benefits of CRT for upper extremity muscle strength, functional independence, and QoL in patients with paraplegia. Twenty-six patients with paraplegia who were participating in a conventional rehabilitation program at a tertiary education and research hospital were enrolled in this study. The participants were randomly assigned to two groups. The exercise group participated in the CRT program, which consisted of repetitive exercises for the upper extremities performed at fixed mechanical stations 5 sessions per week for 6 weeks, in addition to conventional rehabilitation. Participants in the control group received only conventional rehabilitation over the same period. We compared the groups with respect to QoL, as well as isokinetic muscle test outcomes in the upper extremities, using the Functional Independence Measure (FIM) and Borg's scale. We observed significant increases in scores on the physical component of the FIM, Borg's scale, and QoL in both the exercise and control groups. Furthermore, the large majority of isokinetic values were significantly more improved in the exercise group compared to the control group. When post-treatment outcomes were compared between the groups, improvements in scores on the physical component of the FIM and in most isokinetic values were significantly greater in the exercise group. This study showed that CRT has positive effects on muscle strength in the upper extremities and the physical disability components of the FIM when added to conventional rehabilitation programs for paraplegic patients. However, we observed no significant improvement in QoL scores after adding CRT

  1. FIT: Computer Program that Interactively Determines Polynomial Equations for Data which are a Function of Two Independent Variables

    Science.gov (United States)

    Arbuckle, P. D.; Sliwa, S. M.; Roy, M. L.; Tiffany, S. H.

    1985-01-01

    A computer program for interactively developing least-squares polynomial equations to fit user-supplied data is described. The program is characterized by the ability to compute the polynomial equations of a surface fit through data that are a function of two independent variables. The program utilizes the Langley Research Center graphics packages to display polynomial equation curves and data points, facilitating a qualitative evaluation of the effectiveness of the fit. An explanation of the fundamental principles and features of the program, as well as sample input and corresponding output, are included.

  2. Circadian clock-dependent and -independent rhythmic proteomes implement distinct diurnal functions in mouse liver.

    Science.gov (United States)

    Mauvoisin, Daniel; Wang, Jingkui; Jouffe, Céline; Martin, Eva; Atger, Florian; Waridel, Patrice; Quadroni, Manfredo; Gachon, Frédéric; Naef, Felix

    2014-01-07

    Diurnal oscillations of gene expression controlled by the circadian clock underlie rhythmic physiology across most living organisms. Although such rhythms have been extensively studied at the level of transcription and mRNA accumulation, little is known about the accumulation patterns of proteins. Here, we quantified temporal profiles in the murine hepatic proteome under physiological light-dark conditions using stable isotope labeling by amino acids quantitative MS. Our analysis identified over 5,000 proteins, of which several hundred showed robust diurnal oscillations with peak phases enriched in the morning and during the night and related to core hepatic physiological functions. Combined mathematical modeling of temporal protein and mRNA profiles indicated that proteins accumulate with reduced amplitudes and significant delays, consistent with protein half-life data. Moreover, a group comprising about one-half of the rhythmic proteins showed no corresponding rhythmic mRNAs, indicating significant translational or posttranslational diurnal control. Such rhythms were highly enriched in secreted proteins accumulating tightly during the night. Also, these rhythms persisted in clock-deficient animals subjected to rhythmic feeding, suggesting that food-related entrainment signals influence rhythms in circulating plasma factors.

  3. Association of quality of life of carers with quality of life and functional independence of stroke survivors

    Directory of Open Access Journals (Sweden)

    Deepak Ganjiwale

    2016-01-01

    Full Text Available Background: Stroke has a great impact not only on patients′ but also on their caregivers′ lives. Carers may experience high levels of burden that can result in deterioration of their health status, social life, and well-being. Association between quality of life (QOL of carers and that of stroke survivors in Indian setting is not much researched. Aims and Settings: To find out QOL and mental health of caregivers of individuals with stroke visiting Physiotherapy Department of Tertiary Care Center in Western India. Design and Methodology: A cross-sectional survey to find QOL and mental health of caregiver of stroke survivors, self-administered screening instrument WHO-QOL BREF, functional independence measurement (FIM scale, and BRIEF COPE were used for data collection on adult populations. Statistical Analysis Used: The statistical analysis was performed by descriptive analysis and correlation. Result: Fifty-four stroke patients and their caregivers (all adults were included in the study. Average FIM score was 83.75 (18.46 while median was 90 (25. FIM score of patients did not much affect QOL of caregivers. Discussion: Analysis of QOL data showed that QOL of caregivers was good in all domains, but patient′s QOL was good only in social relations. There was no correlation found in QOL of carers and stroke survivors. Nine percent of change in caregivers social relationship scores can be attributed to patients′ sphincter scores. Conclusion: QOL of carers and stroke survivors may be independent. Stroke patients in the study required a moderate assistance for their functional independence which does not seem to affect the caregivers QOL significantly.

  4. WNT10B functional dualism: beta-catenin/Tcf-dependent growth promotion or independent suppression with deregulated expression in cancer.

    Science.gov (United States)

    Yoshikawa, Hirohide; Matsubara, Kenichi; Zhou, Xiaoling; Okamura, Shu; Kubo, Takahiko; Murase, Yaeko; Shikauchi, Yuko; Esteller, Manel; Herman, James G; Wei Wang, Xin; Harris, Curtis C

    2007-11-01

    We found aberrant DNA methylation of the WNT10B promoter region in 46% of primary hepatocellular carcinoma (HCC) and 15% of colon cancer samples. Three of 10 HCC and one of two colon cancer cell lines demonstrated low or no expression, and 5-aza-2'deoxycytidine reactivated WNT10B expression with the induction of demethylation, indicating that WNT10B is silenced by DNA methylation in some cancers, whereas WNT10B expression is up-regulated in seven of the 10 HCC cell lines and a colon cancer cell line. These results indicate that WNT10B can be deregulated by either overexpression or silencing in cancer. We found that WNT10B up-regulated beta-catenin/Tcf activity. However, WNT10B-overexpressing cells demonstrated a reduced growth rate and anchorage-independent growth that is independent of the beta-catenin/Tcf activation, because mutant beta-catenin-transduced cells did not suppress growth, and dominant-negative hTcf-4 failed to alleviate the growth suppression by WNT10B. Although WNT10B expression alone inhibits cell growth, it acts synergistically with the fibroblast growth factor (FGF) to stimulate cell growth. WNT10B is bifunctional, one function of which is involved in beta-catenin/Tcf activation, and the other function is related to the down-regulation of cell growth through a different mechanism. We suggest that FGF switches WNT10B from a negative to a positive cell growth regulator.

  5. Resting State Functional Connectivity in Mild Traumatic Brain Injury at the Acute Stage: Independent Component and Seed-Based Analyses

    Science.gov (United States)

    Iraji, Armin; Benson, Randall R.; Welch, Robert D.; O'Neil, Brian J.; Woodard, John L.; Imran Ayaz, Syed; Kulek, Andrew; Mika, Valerie; Medado, Patrick; Soltanian-Zadeh, Hamid; Liu, Tianming; Haacke, E. Mark

    2015-01-01

    Abstract Mild traumatic brain injury (mTBI) accounts for more than 1 million emergency visits each year. Most of the injured stay in the emergency department for a few hours and are discharged home without a specific follow-up plan because of their negative clinical structural imaging. Advanced magnetic resonance imaging (MRI), particularly functional MRI (fMRI), has been reported as being sensitive to functional disturbances after brain injury. In this study, a cohort of 12 patients with mTBI were prospectively recruited from the emergency department of our local Level-1 trauma center for an advanced MRI scan at the acute stage. Sixteen age- and sex-matched controls were also recruited for comparison. Both group-based and individual-based independent component analysis of resting-state fMRI (rsfMRI) demonstrated reduced functional connectivity in both posterior cingulate cortex (PCC) and precuneus regions in comparison with controls, which is part of the default mode network (DMN). Further seed-based analysis confirmed reduced functional connectivity in these two regions and also demonstrated increased connectivity between these regions and other regions of the brain in mTBI. Seed-based analysis using the thalamus, hippocampus, and amygdala regions further demonstrated increased functional connectivity between these regions and other regions of the brain, particularly in the frontal lobe, in mTBI. Our data demonstrate alterations of multiple brain networks at the resting state, particularly increased functional connectivity in the frontal lobe, in response to brain concussion at the acute stage. Resting-state functional connectivity of the DMN could serve as a potential biomarker for improved detection of mTBI in the acute setting. PMID:25285363

  6. Functions of the APC tumor suppressor protein dependent and independent of canonical WNT signaling: implications for therapeutic targeting.

    Science.gov (United States)

    Hankey, William; Frankel, Wendy L; Groden, Joanna

    2018-03-01

    The acquisition of biallelic mutations in the APC gene is a rate-limiting step in the development of most colorectal cancers and occurs in the earliest lesions. APC encodes a 312-kDa protein that localizes to multiple subcellular compartments and performs diverse functions. APC participates in a cytoplasmic complex that promotes the destruction of the transcriptional licensing factor β-catenin; APC mutations that abolish this function trigger constitutive activation of the canonical WNT signaling pathway, a characteristic found in almost all colorectal cancers. By negatively regulating canonical WNT signaling, APC counteracts proliferation, promotes differentiation, facilitates apoptosis, and suppresses invasion and tumor progression. APC further antagonizes canonical WNT signaling by interacting with and counteracting β-catenin in the nucleus. APC also suppresses tumor initiation and progression in the colorectal epithelium through functions that are independent of canonical WNT signaling. APC regulates the mitotic spindle to facilitate proper chromosome segregation, localizes to the cell periphery and cell protrusions to establish cell polarity and appropriate directional migration, and inhibits DNA replication by interacting directly with DNA. Mutations in APC are often frameshifts, insertions, or deletions that introduce premature stop codons and lead to the production of truncated APC proteins that lack its normal functions and possess tumorigenic properties. Therapeutic approaches in development for the treatment of APC-deficient tumors are focused on the inhibition of canonical WNT signaling, especially through targets downstream of APC in the pathway, or on the restoration of wild-type APC expression.

  7. The nutrient transceptor/PKA pathway functions independently of TOR and responds to leucine and Gcn2 in a TOR-independent manner.

    Science.gov (United States)

    Conrad, Michaela; Kankipati, Harish Nag; Kimpe, Marlies; Van Zeebroeck, Griet; Zhang, Zhiqiang; Thevelein, Johan M

    2017-08-01

    Two nutrient-controlled signalling pathways, the PKA and TOR pathway, play a major role in nutrient regulation of growth as well as growth-correlated properties in yeast. The relationship between the two pathways is not well understood. We have used Gap1 and Pho84 transceptor-mediated activation of trehalase and phosphorylation of fragmented Sch9 as a read-out for rapid nutrient activation of PKA or TORC1, respectively. We have identified conditions in which L-citrulline-induced activation of Sch9 phosphorylation is compromised, but not activation of trehalase: addition of the TORC1 inhibitor, rapamycin and low levels of L-citrulline. The same disconnection was observed for phosphate activation in phosphate-starved cells. The leu2 auxotrophic mutation reduces amino acid activation of trehalase, which is counteracted by deletion of GCN2. Both effects were also independent of TORC1. Our results show that rapid activation of the TOR pathway by amino acids is not involved in rapid activation of the PKA pathway and that effects of Gcn2 inactivation as well as leu2 auxotrophy all act independently of the TOR pathway. Hence, rapid nutrient signalling to PKA and TOR in cells arrested by nutrient starvation acts through parallel pathways. © FEMS 2017.

  8. Functional Independence and Quality of Life for Persons with Locomotor Disabilities in Institutional Based Rehabilitation and Community Based Rehabilitation - A Comparative Study

    Directory of Open Access Journals (Sweden)

    A Amarnath

    2012-12-01

    Full Text Available Purpose: To compare the functional independence and quality of life of persons with locomotor disabilities who undergo Institutional Based Rehabilitation (IBR and similar persons who undergo Community Based Rehabilitation (CBR. Methods: Purposive sampling was done. Thirty males with locomotor disabilities -15 from IBR and 15 from CBR- were selected. Both the groups were first administered the Functional Independence Measure (FIM questionnaire, followed by the Quality of Life (WHOQOL-BREF questionnaire.Results: There were no significant differencse between IBR and CBR with regard to functional independence  (t value = -1.810, P doi: 10.5463/dcid.v23i3.147

  9. TPC2 polymorphisms associated with a hair pigmentation phenotype in humans result in gain of channel function by independent mechanisms.

    Science.gov (United States)

    Chao, Yu-Kai; Schludi, Verena; Chen, Cheng-Chang; Butz, Elisabeth; Nguyen, O N Phuong; Müller, Martin; Krüger, Jens; Kammerbauer, Claudia; Ben-Johny, Manu; Vollmar, Angelika M; Berking, Carola; Biel, Martin; Wahl-Schott, Christian A; Grimm, Christian

    2017-10-10

    Two-pore channels (TPCs) are endolysosomal cation channels. Two members exist in humans, TPC1 and TPC2. Functional roles associated with the ubiquitously expressed TPCs include VEGF-induced neoangiogenesis, LDL-cholesterol trafficking and degradation, physical endurance under fasting conditions, autophagy regulation, the acrosome reaction in sperm, cancer cell migration, and intracellular trafficking of pathogens such as Ebola virus or bacterial toxins (e.g., cholera toxin). In a genome-wide association study for variants associated with human pigmentation characteristics two coding variants of TPC2, rs35264875 (encoding M484L) and rs3829241 (encoding G734E), have been found to be associated with a shift from brown to blond hair color. In two recent follow-up studies a role for TPC2 in pigmentation has been further confirmed. However, these human polymorphic variants have not been functionally characterized until now. The development of endolysosomal patch-clamp techniques has made it possible to investigate directly ion channel activities and characteristics in isolated endolysosomal organelles. We applied this technique here to scrutinize channel characteristics of the polymorphic TPC2 variants in direct comparison with WT. We found that both polymorphisms lead to a gain of channel function by independent mechanisms. We next conducted a clinical study with more than 100 blond- and brown/black-haired individuals. We performed a genotype/phenotype analysis and subsequently isolated fibroblasts from WT and polymorphic variant carriers for endolysosomal patch-clamp experimentation to confirm key in vitro findings.

  10. Association of ideomotor apraxia with lesion site, etiology, neglect, and functional independence in patients with first ever stroke.

    Science.gov (United States)

    Civelek, Gul Mete; Atalay, Ayce; Turhan, Nur

    2015-04-01

    Ideomotor apraxia (IMA) is characterized by the inability to correctly imitate hand gestures and voluntarily pantomime tool use. The relationship between IMA and characteristics of stroke has not been totally elucidated. This study aimed to find out associations between presence of IMA and stroke etiology, site of the lesions, neglect, and temporal and functional parameters of stroke in patients with first ever stroke. Thirty-nine patients with first ever stroke were included. Patients with severe cognitive deficits were excluded. Assessment tools included Ideomotor Apraxia Test, Functional Independence Measure (FIM), Brunnstrom recovery stages, Mini Mental Test (MMT), and star cancellation test. Etiology (hemorrhagic or ischemic) and site of stroke was assessed through brain imaging methods. Location and size of ischemic lesion was determined by using the Oxfordshire Community Stroke Project system. IMA was identified in 35.9% of the patients. Patients with IMA had significantly lower FIM scores both on admission and discharge (P = 0.001, P = 0.001). Presence of IMA was significantly associated with the presence of neglect (P = 0.004), total anterior circulation ischemia (TACI) (P stroke etiology had no impact on the presence of IMA. IMA was in concordance with poor cognitive and functional state and was not limited to left hemisphere lesions. The study revealed strong associations between IMA, neglect, and TACI. Every patient with stroke should be evaluated for the presence of IMA on admission to rehabilitation unit.

  11. Metacognition moderates the relationship between dysfunctional self-appraisal and social functioning in prolonged schizophrenia independent of psychopathology.

    Science.gov (United States)

    James, Alison V; Hasson-Ohayon, Ilanit; Vohs, Jenifer; Minor, Kyle S; Leonhardt, Bethany L; Buck, Kelly D; George, Sunita; Lysaker, Paul H

    2016-08-01

    Both dysfunctional self-appraisal and metacognitive deficits, or impairments in the ability to form complex and integrated ideas about oneself and others, may contribute to social deficits in schizophrenia. Little is known, however, about how they interact with each other. In this study, we examined the hypothesis that both higher metacognition and more positive self-appraisal are necessary for increased social functioning. Concurrent assessments of self-appraisal, metacognition, and social functioning were gathered from 66 adults with schizophrenia in a non-acute phase of disorder. Three forms of self-appraisal were used: self-esteem, hope and self-efficacy. Metacognition was assessed using the Metacognitive Assessment Scale-Abbreviated, and social functioning with the Quality of Life Scale. Measures of psychopathology, neurocognition and social cognition were also gathered for use as potential covariates. A single index of self-appraisal was generated from subjecting the assessments of self-appraisal to a principal components analysis. Linear regression analyses revealed that after controlling for severity of psychopathology, metacognition moderated the effect of the self-appraisal factor score upon social functioning. A median split of metacognition and the self-appraisal index yielded four groups. ANCOVA analyses revealed that participants with higher levels of metacognition and more positive self-appraisal had greater capacities for social relatedness than all other participants, regardless of levels of positive and negative symptoms. Correlational analyses revealed that metacognition but not self-appraisal was related to the frequencies of social contact independent of the effects of psychopathology. Assessments of social cognition and neurocognition were not significantly linked with social dysfunction. Greater social functioning is made possible by a combination of both more positive self-appraisals and greater metacognitive capacity. Individuals with

  12. Model-independent and fast determination of optical functions in storage rings via multiturn and closed-orbit data

    Directory of Open Access Journals (Sweden)

    Bernard Riemann

    2011-06-01

    Full Text Available Multiturn (or turn-by-turn data acquisition has proven to be a new source of direct measurements for Twiss parameters in storage rings. On the other hand, closed-orbit measurements are a long-known tool for analyzing closed-orbit perturbations with conventional beam position monitor (BPM systems and are necessarily available at every storage ring. This paper aims at combining the advantages of multiturn measurements and closed-orbit data. We show that only two multiturn BPMs and four correctors in one localized drift space in the storage ring (diagnostic drift are sufficient for model-independent and absolute measuring of β and φ functions at all BPMs, including the conventional ones, instead of requiring all BPMs being equipped with multiturn electronics.

  13. Model-independent and fast determination of optical functions in storage rings via multiturn and closed-orbit data

    Science.gov (United States)

    Riemann, Bernard; Grete, Patrick; Weis, Thomas

    2011-06-01

    Multiturn (or turn-by-turn) data acquisition has proven to be a new source of direct measurements for Twiss parameters in storage rings. On the other hand, closed-orbit measurements are a long-known tool for analyzing closed-orbit perturbations with conventional beam position monitor (BPM) systems and are necessarily available at every storage ring. This paper aims at combining the advantages of multiturn measurements and closed-orbit data. We show that only two multiturn BPMs and four correctors in one localized drift space in the storage ring (diagnostic drift) are sufficient for model-independent and absolute measuring of β and φ functions at all BPMs, including the conventional ones, instead of requiring all BPMs being equipped with multiturn electronics.

  14. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

    2016-08-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  15. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

    2016-01-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  16. Willingness to pay for quality of life technologies to enhance independent functioning among baby boomers and the elderly adults.

    Science.gov (United States)

    Schulz, Richard; Beach, Scott R; Matthews, Judith T; Courtney, Karen; Devito Dabbs, Annette; Person Mecca, Laurel; Sankey, Steadman Scott

    2014-06-01

    We report the results of a study designed to assess whether and how much potential individual end users are willing to pay for Quality of Life Technologies (QoLTs) designed to enhance functioning and independence. We carried out a web survey of a nationally representative sample of U.S. baby boomers (aged 45-64; N = 416) and older adults (aged 65 and greater, N = 114). Respondents were first instructed to assume that they needed help with kitchen activities/personal care and that technology was available to help with things like meal preparation/dressing, and then they were asked the most they would be willing to pay each month out of pocket for these technologies. We modeled willingness to pay some (72% of respondents) versus none (28%), and the most people were willing to pay. Those willing to pay something were on average willing to pay a maximum of $40.30 and $45.00 per month for kitchen and personal care technology assistance, respectively. Respondents concerned about privacy or who were currently using assistive technology were less willing to pay. Respondents with higher incomes, who were Hispanic, or who perceived a higher likelihood of needing help in the future were more willing to pay. Consumers' willingness to pay out of pocket for technologies to improve their well-being and independence is limited. In order to be widely adopted, QoLTs will have to be highly cost effective so that third party payers such as Medicare and private insurance companies are willing to pay for them.

  17. Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage.

    Science.gov (United States)

    Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X

    2014-07-01

    Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

  18. A novel tumor suppressor function of glycine N-methyltransferase is independent of its catalytic activity but requires nuclear localization.

    Directory of Open Access Journals (Sweden)

    Suchandra DebRoy

    Full Text Available Glycine N-methyltransferase (GNMT, an abundant cytosolic enzyme, catalyzes the transfer of a methyl group from S-adenosylmethionine (SAM to glycine generating S-adenosylhomocysteine and sarcosine (N-methylglycine. This reaction is regulated by 5-methyltetrahydrofolate, which inhibits the enzyme catalysis. In the present study, we observed that GNMT is strongly down regulated in human cancers and is undetectable in cancer cell lines while the transient expression of the protein in cancer cells induces apoptosis and results in the activation of ERK1/2 as an early pro-survival response. The antiproliferative effect of GNMT can be partially reversed by treatment with the pan-caspase inhibitor zVAD-fmk but not by supplementation with high folate or SAM. GNMT exerts the suppressor effect primarily in cells originated from malignant tumors: transformed cell line of non-cancer origin, HEK293, was insensitive to GNMT. Of note, high levels of GNMT, detected in regenerating liver and in NIH3T3 mouse fibroblasts, do not produce cytotoxic effects. Importantly, GNMT, a predominantly cytoplasmic protein, was translocated into nuclei upon transfection of cancer cells. The presence of GNMT in the nuclei was also observed in normal human tissues by immunohistochemical staining. We further demonstrated that the induction of apoptosis is associated with the GNMT nuclear localization but is independent of its catalytic activity or folate binding. GNMT targeted to nuclei, through the fusion with nuclear localization signal, still exerts strong antiproliferative effects while its restriction to cytoplasm, through the fusion with nuclear export signal, prevents these effects (in each case the protein was excluded from cytosol or nuclei, respectively. Overall, our study indicates that GNMT has a secondary function, as a regulator of cellular proliferation, which is independent of its catalytic role.

  19. Drosophila Clock Is Required in Brain Pacemaker Neurons to Prevent Premature Locomotor Aging Independently of Its Circadian Function.

    Directory of Open Access Journals (Sweden)

    Alexandra Vaccaro

    2017-01-01

    Full Text Available Circadian clocks control many self-sustained rhythms in physiology and behavior with approximately 24-hour periodicity. In many organisms, oxidative stress and aging negatively impact the circadian system and sleep. Conversely, loss of the clock decreases resistance to oxidative stress, and may reduce lifespan and speed up brain aging and neurodegeneration. Here we examined the effects of clock disruptions on locomotor aging and longevity in Drosophila. We found that lifespan was similarly reduced in three arrhythmic mutants (ClkAR, cyc0 and tim0 and in wild-type flies under constant light, which stops the clock. In contrast, ClkAR mutants showed significantly faster age-related locomotor deficits (as monitored by startle-induced climbing than cyc0 and tim0, or than control flies under constant light. Reactive oxygen species accumulated more with age in ClkAR mutant brains, but this did not appear to contribute to the accelerated locomotor decline of the mutant. Clk, but not Cyc, inactivation by RNA interference in the pigment-dispersing factor (PDF-expressing central pacemaker neurons led to similar loss of climbing performance as ClkAR. Conversely, restoring Clk function in these cells was sufficient to rescue the ClkAR locomotor phenotype, independently of behavioral rhythmicity. Accelerated locomotor decline of the ClkAR mutant required expression of the PDF receptor and correlated to an apparent loss of dopaminergic neurons in the posterior protocerebral lateral 1 (PPL1 clusters. This neuronal loss was rescued when the ClkAR mutation was placed in an apoptosis-deficient background. Impairing dopamine synthesis in a single pair of PPL1 neurons that innervate the mushroom bodies accelerated locomotor decline in otherwise wild-type flies. Our results therefore reveal a novel circadian-independent requirement for Clk in brain circadian neurons to maintain a subset of dopaminergic cells and avoid premature locomotor aging in Drosophila.

  20. Human Enterovirus Nonstructural Protein 2CATPase Functions as Both an RNA Helicase and ATP-Independent RNA Chaperone

    Science.gov (United States)

    Xia, Hongjie; Wang, Peipei; Wang, Guang-Chuan; Yang, Jie; Sun, Xianlin; Wu, Wenzhe; Qiu, Yang; Shu, Ting; Zhao, Xiaolu; Yin, Lei; Qin, Cheng-Feng; Hu, Yuanyang; Zhou, Xi

    2015-01-01

    RNA helicases and chaperones are the two major classes of RNA remodeling proteins, which function to remodel RNA structures and/or RNA-protein interactions, and are required for all aspects of RNA metabolism. Although some virus-encoded RNA helicases/chaperones have been predicted or identified, their RNA remodeling activities in vitro and functions in the viral life cycle remain largely elusive. Enteroviruses are a large group of positive-stranded RNA viruses in the Picornaviridae family, which includes numerous important human pathogens. Herein, we report that the nonstructural protein 2CATPase of enterovirus 71 (EV71), which is the major causative pathogen of hand-foot-and-mouth disease and has been regarded as the most important neurotropic enterovirus after poliovirus eradication, functions not only as an RNA helicase that 3′-to-5′ unwinds RNA helices in an adenosine triphosphate (ATP)-dependent manner, but also as an RNA chaperone that destabilizes helices bidirectionally and facilitates strand annealing and complex RNA structure formation independently of ATP. We also determined that the helicase activity is based on the EV71 2CATPase middle domain, whereas the C-terminus is indispensable for its RNA chaperoning activity. By promoting RNA template recycling, 2CATPase facilitated EV71 RNA synthesis in vitro; when 2CATPase helicase activity was impaired, EV71 RNA replication and virion production were mostly abolished in cells, indicating that 2CATPase-mediated RNA remodeling plays a critical role in the enteroviral life cycle. Furthermore, the RNA helicase and chaperoning activities of 2CATPase are also conserved in coxsackie A virus 16 (CAV16), another important enterovirus. Altogether, our findings are the first to demonstrate the RNA helicase and chaperoning activities associated with enterovirus 2CATPase, and our study provides both in vitro and cellular evidence for their potential roles during viral RNA replication. These findings increase our

  1. Micro-RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation.

    Science.gov (United States)

    Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J

    2010-07-01

    High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.

  2. SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.

    Directory of Open Access Journals (Sweden)

    Xiao-Peng Xiong

    2015-08-01

    Full Text Available microRNAs (miRNAs are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs that contain Argonaute (AGO family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be

  3. The H-Function and Probability Density Functions of Certain Algebraic Combinations of Independent Random Variables with H-Function Probability Distribution

    Science.gov (United States)

    1981-05-01

    Education, 10 (2), A45-A49 (1976). 48. Rain&, R. K., and C. L. Kaul (Koul), "Some inequalities involving the Fox’s H- function," Proceedings of the Indian...1973). 51. Srivastava , A., and K. C. Gupta, "On certain recurrence rela- tions," Mathematische Nachrichten, 46, 13- 23 (1970), 49, 187- 197 (1971). 52...34 Vilnana Parishad Anusandhan Patrika, 10, 205- 217 (1967). 69. Gupta, K. C., and A. Srivastava , "On finite expansions for the H- function," Indian Journal

  4. Does a Wii-based exercise program enhance balance control of independently functioning older adults? A systematic review.

    Science.gov (United States)

    Laufer, Yocheved; Dar, Gali; Kodesh, Einat

    2014-01-01

    Exercise programs that challenge an individual's balance have been shown to reduce the risk of falls among older adults. Virtual reality computer-based technology that provides the user with opportunities to interact with virtual objects is used extensively for entertainment. There is a growing interest in the potential of virtual reality-based interventions for balance training in older adults. This work comprises a systematic review of the literature to determine the effects of intervention programs utilizing the Nintendo Wii console on balance control and functional performance in independently functioning older adults. STUDIES WERE OBTAINED BY SEARCHING THE FOLLOWING DATABASES: PubMed, CINAHL, PEDro, EMBASE, SPORTdiscus, and Google Scholar, followed by a hand search of bibliographic references of the included studies. Included were randomized controlled trials written in English in which Nintendo Wii Fit was used to enhance standing balance performance in older adults and compared with an alternative exercise treatment, placebo, or no treatment. Seven relevant studies were retrieved. The four studies examining the effect of Wii-based exercise compared with no exercise reported positive effects on at least one outcome measure related to balance performance in older adults. Studies comparing Wii-based training with alternative exercise programs generally indicated that the balance improvements achieved by Wii-based training are comparable with those achieved by other exercise programs. The review indicates that Wii-based exercise programs may serve as an alternative to more conventional forms of exercise aimed at improving balance control. However, due to the great variability between studies in terms of the intervention protocols and outcome measures, as well as methodological limitations, definitive recommendations as to optimal treatment protocols and the potential of such an intervention as a safe and effective home-based treatment cannot be made at this

  5. Bold-Independent Computational Entropy Assesses Functional Donut-Like Structures in Brain fMRI Images.

    Science.gov (United States)

    Peters, James F; Ramanna, Sheela; Tozzi, Arturo; İnan, Ebubekir

    2017-01-01

    We introduce a novel method for the measurement of information level in fMRI (functional Magnetic Resonance Imaging) neural data sets, based on image subdivision in small polygons equipped with different entropic content. We show how this method, called maximal nucleus clustering (MNC), is a novel, fast and inexpensive image-analysis technique, independent from the standard blood-oxygen-level dependent signals. MNC facilitates the objective detection of hidden temporal patterns of entropy/information in zones of fMRI images generally not taken into account by the subjective standpoint of the observer. This approach befits the geometric character of fMRIs. The main purpose of this study is to provide a computable framework for fMRI that not only facilitates analyses, but also provides an easily decipherable visualization of structures. This framework commands attention because it is easily implemented using conventional software systems. In order to evaluate the potential applications of MNC, we looked for the presence of a fourth dimension's distinctive hallmarks in a temporal sequence of 2D images taken during spontaneous brain activity. Indeed, recent findings suggest that several brain activities, such as mind-wandering and memory retrieval, might take place in the functional space of a four dimensional hypersphere, which is a double donut-like structure undetectable in the usual three dimensions. We found that the Rényi entropy is higher in MNC areas than in the surrounding ones, and that these temporal patterns closely resemble the trajectories predicted by the possible presence of a hypersphere in the brain.

  6. Endocytosis-independent function of clathrin heavy chain in the control of basal NF-κB activation.

    Directory of Open Access Journals (Sweden)

    Man Lyang Kim

    Full Text Available BACKGROUND: Nuclear factor-κB (NF-κB is a transcription factor that regulates the transcription of genes involved in a variety of biological processes, including innate and adaptive immunity, stress responses and cell proliferation. Constitutive or excessive NF-κB activity has been associated with inflammatory disorders and higher risk of cancer. In contrast to the mechanisms controlling inducible activation, the regulation of basal NF-κB activation is not well understood. Here we test whether clathrin heavy chain (CHC contributes to the regulation of basal NF-κB activity in epithelial cells. METHODOLOGY: Using RNA interference to reduce endogenous CHC expression, we found that CHC is required to prevent constitutive activation of NF-κB and gene expression. Immunofluorescence staining showed constitutive nuclear localization of the NF-κB subunit p65 in absence of stimulation after CHC knockdown. Elevated basal p65 nuclear localization is caused by constitutive phosphorylation and degradation of inhibitor of NF-κB alpha (IκBα through an IκB kinase α (IKKα-dependent mechanism. The role of CHC in NF-κB signaling is functionally relevant as constitutive expression of the proinflammatory chemokine interleukin-8 (IL-8, whose expression is regulated by NF-κB, was found after CHC knockdown. Disruption of clathrin-mediated endocytosis by chemical inhibition or depletion of the μ2-subunit of the endocytosis adaptor protein AP-2, and knockdown of clathrin light chain a (CHLa, failed to induce constitutive NF-κB activation and IL-8 expression, showing that CHC acts on NF-κB independently of endocytosis and CLCa. CONCLUSIONS: We conclude that CHC functions as a built-in molecular brake that ensures a tight control of basal NF-κB activation and gene expression in unstimulated cells. Furthermore, our data suggest a potential link between a defect in CHC expression and chronic inflammation disorder and cancer.

  7. Does a Wii-based exercise program enhance balance control of independently functioning older adults? A systematic review

    Science.gov (United States)

    Laufer, Yocheved; Dar, Gali; Kodesh, Einat

    2014-01-01

    Background Exercise programs that challenge an individual’s balance have been shown to reduce the risk of falls among older adults. Virtual reality computer-based technology that provides the user with opportunities to interact with virtual objects is used extensively for entertainment. There is a growing interest in the potential of virtual reality-based interventions for balance training in older adults. This work comprises a systematic review of the literature to determine the effects of intervention programs utilizing the Nintendo Wii console on balance control and functional performance in independently functioning older adults. Methods Studies were obtained by searching the following databases: PubMed, CINAHL, PEDro, EMBASE, SPORTdiscus, and Google Scholar, followed by a hand search of bibliographic references of the included studies. Included were randomized controlled trials written in English in which Nintendo Wii Fit was used to enhance standing balance performance in older adults and compared with an alternative exercise treatment, placebo, or no treatment. Results Seven relevant studies were retrieved. The four studies examining the effect of Wii-based exercise compared with no exercise reported positive effects on at least one outcome measure related to balance performance in older adults. Studies comparing Wii-based training with alternative exercise programs generally indicated that the balance improvements achieved by Wii-based training are comparable with those achieved by other exercise programs. Conclusion The review indicates that Wii-based exercise programs may serve as an alternative to more conventional forms of exercise aimed at improving balance control. However, due to the great variability between studies in terms of the intervention protocols and outcome measures, as well as methodological limitations, definitive recommendations as to optimal treatment protocols and the potential of such an intervention as a safe and effective home

  8. Estrogen Therapy, Independent of Timing, Improves Cardiac Structure and Function in Oophorectomized mRen2.Lewis Rats

    Science.gov (United States)

    Jessup, Jewell A.; Wang, Hao; MacNamara, Lindsay M.; Presley, Tennille D.; Kim-Shapiro, Daniel B.; Zhang, Lili; Chen, Alex F.; Groban, Leanne

    2013-01-01

    Objective mRen2.Lewis Rats exhibit exacerbated increases in blood pressure, left ventricular (LV) remodeling, and diastolic impairment following the loss of estrogens. In this same model, depletion of estrogens has marked effects on the cardiac biopterin profile concomitant with suppressed nitric oxide (NO) release. With respect to the establishment of overt systolic hypertension after oophorectomy (OVX), we assessed the effects of timing chronic 17 β-estradiol (E2) therapy on myocardial function, structure, and the cardiac NO system. Methods Oophrectomy (OVX; n=24) or sham-operation (Sham; n=13) was performed in 4-week-old, female mRen2.Lewis rats. Following randomization, OVX rats received E2 immediately (OVX + early E2; n=7), E2 at 11 weeks of age (OVX + late E2 N=8), or no E2 at all (OVX N=9). Results Early E2 was associated with lower body weight, less hypertension-related cardiac remodeling, and decreased LV filling pressure compared to OVX rats without E2 supplementation. Late E2 similarly attenuated the adverse effects of ovarian hormone loss on tissue-Doppler derived LV filling pressures and perivascular fibrosis, and significantly improved myocardial relaxation, or mitral annular velocity (e′). Early and late exposure to E2 decreased dihydrobiopterin, but only late E2 yielded significant increases in cardiac nitrite concentrations. Conclusions Although there were some similarities between early and late E2 treatment on preservation of diastolic function and cardiac structure after OVX, the lusitropic potential of E2 was most consistent with late supplementation. The cardioprotective effects of late E2 were independent of blood pressure and may have occurred through regulation of cardiac biopterins and NO production. PMID:23481117

  9. EPO-independent functional EPO receptor in breast cancer enhances estrogen receptor activity and promotes cell proliferation

    International Nuclear Information System (INIS)

    Reinbothe, Susann; Larsson, Anna-Maria; Vaapil, Marica; Wigerup, Caroline; Sun, Jianmin; Jögi, Annika; Neumann, Drorit; Rönnstrand, Lars; Påhlman, Sven

    2014-01-01

    Highlights: • New anti-human EPOR antibody confirms full-length EPOR expression in breast cancer cells. • Proliferation of breast cancer cells is not affected by rhEPO treatment in vitro. • EPOR knockdown impairs proliferation of ERa positive breast cancer cells. • EPOR knockdown reduces AKT phosphorylation and ERa activity. - Abstract: The main function of Erythropoietin (EPO) and its receptor (EPOR) is the stimulation of erythropoiesis. Recombinant human EPO (rhEPO) is therefore used to treat anemia in cancer patients. However, clinical trials have indicated that rhEPO treatment might promote tumor progression and has a negative effect on patient survival. In addition, EPOR expression has been detected in several cancer forms. Using a newly produced anti-EPOR antibody that reliably detects the full-length isoform of the EPOR we show that breast cancer tissue and cells express the EPOR protein. rhEPO stimulation of cultured EPOR expressing breast cancer cells did not result in increased proliferation, overt activation of EPOR (receptor phosphorylation) or a consistent activation of canonical EPOR signaling pathway mediators such as JAK2, STAT3, STAT5, or AKT. However, EPOR knockdown experiments suggested functional EPO receptors in estrogen receptor positive (ERα + ) breast cancer cells, as reduced EPOR expression resulted in decreased proliferation. This effect on proliferation was not seen in ERα negative cells. EPOR knockdown decreased ERα activity further supports a mechanism by which EPOR affects proliferation via ERα-mediated mechanisms. We show that EPOR protein is expressed in breast cancer cells, where it appears to promote proliferation by an EPO-independent mechanism in ERα expressing breast cancer cells

  10. Promoting physical activity for elders with compromised function: the lifestyle Interventions and Independence for elders (LIFE) study physical activity intervention

    Science.gov (United States)

    Rejeski, W Jack; Axtell, Robert; Fielding, Roger; Katula, Jeffrey; King, Abby C; Manini, Todd M; Marsh, Anthony P; Pahor, Marco; Rego, Alvito; Tudor-Locke, Catrine; Newman, Mark; Walkup, Michael P; Miller, Michael E

    2013-01-01

    The Lifestyle Interventions and Independence for Elders (LIFE) Study is a Phase III randomized controlled clinical trial (Clinicaltrials.gov identifier: NCT01072500) that will provide definitive evidence regarding the effect of physical activity (PA) on major mobility disability in older adults (70–89 years old) who have compromised physical function. This paper describes the methods employed in the delivery of the LIFE Study PA intervention, providing insight into how we promoted adherence and monitored the fidelity of treatment. Data are presented on participants’ motives and self-perceptions at the onset of the trial along with accelerometry data on patterns of PA during exercise training. Prior to the onset of training, 31.4% of participants noted slight conflict with being able to meet the demands of the program and 6.4% indicated that the degree of conflict would be moderate. Accelerometry data collected during PA training revealed that the average intensity – 1,555 counts/minute for men and 1,237 counts/minute for women – was well below the cutoff point used to classify exercise as being of moderate intensity or higher for adults. Also, a sizable subgroup required one or more rest stops. These data illustrate that it is not feasible to have a single exercise prescription for older adults with compromised function. Moreover, the concept of what constitutes “moderate” exercise or an appropriate volume of work is dictated by the physical capacities of each individual and the level of comfort/stability in actually executing a specific prescription. PMID:24049442

  11. EPO-independent functional EPO receptor in breast cancer enhances estrogen receptor activity and promotes cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Reinbothe, Susann; Larsson, Anna-Maria; Vaapil, Marica; Wigerup, Caroline [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); CREATE Health, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Sun, Jianmin [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); Jögi, Annika [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); CREATE Health, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Neumann, Drorit [Department of Cell and Developmental Biology, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Rönnstrand, Lars [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); Påhlman, Sven, E-mail: sven.pahlman@med.lu.se [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); CREATE Health, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-02-28

    Highlights: • New anti-human EPOR antibody confirms full-length EPOR expression in breast cancer cells. • Proliferation of breast cancer cells is not affected by rhEPO treatment in vitro. • EPOR knockdown impairs proliferation of ERa positive breast cancer cells. • EPOR knockdown reduces AKT phosphorylation and ERa activity. - Abstract: The main function of Erythropoietin (EPO) and its receptor (EPOR) is the stimulation of erythropoiesis. Recombinant human EPO (rhEPO) is therefore used to treat anemia in cancer patients. However, clinical trials have indicated that rhEPO treatment might promote tumor progression and has a negative effect on patient survival. In addition, EPOR expression has been detected in several cancer forms. Using a newly produced anti-EPOR antibody that reliably detects the full-length isoform of the EPOR we show that breast cancer tissue and cells express the EPOR protein. rhEPO stimulation of cultured EPOR expressing breast cancer cells did not result in increased proliferation, overt activation of EPOR (receptor phosphorylation) or a consistent activation of canonical EPOR signaling pathway mediators such as JAK2, STAT3, STAT5, or AKT. However, EPOR knockdown experiments suggested functional EPO receptors in estrogen receptor positive (ERα{sup +}) breast cancer cells, as reduced EPOR expression resulted in decreased proliferation. This effect on proliferation was not seen in ERα negative cells. EPOR knockdown decreased ERα activity further supports a mechanism by which EPOR affects proliferation via ERα-mediated mechanisms. We show that EPOR protein is expressed in breast cancer cells, where it appears to promote proliferation by an EPO-independent mechanism in ERα expressing breast cancer cells.

  12. The Independent Gradient Model: A New Approach for Probing Strong and Weak Interactions in Molecules from Wave Function Calculations.

    Science.gov (United States)

    Lefebvre, Corentin; Khartabil, Hassan; Boisson, Jean-Charles; Contreras-García, Julia; Piquemal, Jean-Philip; Hénon, Eric

    2018-03-19

    Extraction of the chemical interaction signature from local descriptors based on electron density (ED) is still a fruitful field of development in chemical interpretation. In a previous work that used promolecular ED (frozen ED), the new descriptor, δg , was defined. It represents the difference between a virtual upper limit of the ED gradient (∇ρIGM , IGM=independent gradient model) that represents a noninteracting system and the true ED gradient (∇ρ ). It can be seen as a measure of electron sharing brought by ED contragradience. A compelling feature of this model is to provide an automatic workflow that extracts the signature of interactions between selected groups of atoms. As with the noncovalent interaction (NCI) approach, it provides chemists with a visual understanding of the interactions present in chemical systems. ∇ρIGM is achieved simply by using absolute values upon summing the individual gradient contributions that make up the total ED gradient. Hereby, we extend this model to relaxed ED calculated from a wave function. To this end, we formulated gradient-based partitioning (GBP) to assess the contribution of each orbital to the total ED gradient. We highlight these new possibilities across two prototypical examples of organic chemistry: the unconventional hexamethylbenzene dication, with a hexa-coordinated carbon atom, and β-thioaminoacrolein. It will be shown how a bond-by-bond picture can be obtained from a wave function, which opens the way to monitor specific interactions along reaction paths. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Time-limited home-care reablement services for maintaining and improving the functional independence of older adults.

    Science.gov (United States)

    Cochrane, Andy; Furlong, Mairead; McGilloway, Sinead; Molloy, David W; Stevenson, Michael; Donnelly, Michael

    2016-10-11

    Reablement, also known as restorative care, is one possible approach to home-care services for older adults at risk of functional decline. Unlike traditional home-care services, reablement is frequently time-limited (usually six to 12 weeks) and aims to maximise independence by offering an intensive multidisciplinary, person-centred and goal-directed intervention. To assess the effects of time-limited home-care reablement services (up to 12 weeks) for maintaining and improving the functional independence of older adults (aged 65 years or more) when compared to usual home-care or wait-list control group. We searched the following databases with no language restrictions during April to June 2015: the Cochrane Central Register of Controlled Trials (CENTRAL); MEDLINE (OvidSP); Embase (OvidSP); PsycINFO (OvidSP); ERIC; Sociological Abstracts; ProQuest Dissertations and Theses; CINAHL (EBSCOhost); SIGLE (OpenGrey); AgeLine and Social Care Online. We also searched the reference lists of relevant studies and reviews as well as contacting authors in the field. We included randomised controlled trials (RCTs), cluster randomised or quasi-randomised trials of time-limited reablement services for older adults (aged 65 years or more) delivered in their home; and incorporated a usual home-care or wait-list control group. Two authors independently assessed studies for inclusion, extracted data, assessed the risk of bias of individual studies and considered quality of the evidence using GRADE. We contacted study authors for additional information where needed. Two studies, comparing reablement with usual home-care services with 811 participants, met our eligibility criteria for inclusion; we also identified three potentially eligible studies, but findings were not yet available. One included study was conducted in Western Australia with 750 participants (mean age 82.29 years). The second study was conducted in Norway (61 participants; mean age 79 years).We are very uncertain as to

  14. Moderate Champagne consumption promotes an acute improvement in acute endothelial-independent vascular function in healthy human volunteers.

    Science.gov (United States)

    Vauzour, David; Houseman, Emily J; George, Trevor W; Corona, Giulia; Garnotel, Roselyne; Jackson, Kim G; Sellier, Christelle; Gillery, Philippe; Kennedy, Orla B; Lovegrove, Julie A; Spencer, Jeremy P E

    2010-04-01

    Epidemiological studies have suggested an inverse correlation between red wine consumption and the incidence of CVD. However, Champagne wine has not been fully investigated for its cardioprotective potential. In order to assess whether acute and moderate Champagne wine consumption is capable of modulating vascular function, we performed a randomised, placebo-controlled, cross-over intervention trial. We show that consumption of Champagne wine, but not a control matched for alcohol, carbohydrate and fruit-derived acid content, induced an acute change in endothelium-independent vasodilatation at 4 and 8 h post-consumption. Although both Champagne wine and the control also induced an increase in endothelium-dependent vascular reactivity at 4 h, there was no significant difference between the vascular effects induced by Champagne or the control at any time point. These effects were accompanied by an acute decrease in the concentration of matrix metalloproteinase (MMP-9), a significant decrease in plasma levels of oxidising species and an increase in urinary excretion of a number of phenolic metabolites. In particular, the mean total excretion of hippuric acid, protocatechuic acid and isoferulic acid were all significantly greater following the Champagne wine intervention compared with the control intervention. Our data suggest that a daily moderate consumption of Champagne wine may improve vascular performance via the delivery of phenolic constituents capable of improving NO bioavailability and reducing matrix metalloproteinase activity.

  15. Sensor monitoring to measure and support daily functioning for independently living older people: A systematic review and road map for further development

    NARCIS (Netherlands)

    Pol, M.C.; Poerbodipoero, S.; Robben, S.; Daams, J.; van Hartingsveldt, M.; de Vos, R.; de Rooij, S.E.; Kröse, B.; Buurman, B.M.

    2013-01-01

    Objectives To study sensor monitoring (use of a sensor network placed in the home environment to observe individuals' daily functioning (activities of daily living and instrumental activities of daily living)) as a method to measure and support daily functioning for older people living independently

  16. Sensor monitoring to measure and support daily functioning for independently living older people: a systematic review and road map for further development

    NARCIS (Netherlands)

    Pol, Margriet C.; Poerbodipoero, Soemitro; Robben, Saskia; Daams, Joost; van Hartingsveldt, Margo; de Vos, Rien; de Rooij, Sophia E.; Kröse, Ben; Buurman, Bianca M.

    2013-01-01

    To study sensor monitoring (use of a sensor network placed in the home environment to observe individuals' daily functioning (activities of daily living and instrumental activities of daily living)) as a method to measure and support daily functioning for older people living independently at home.

  17. Independent component analysis using prior information for signal detection in a functional imaging system of the retina

    NARCIS (Netherlands)

    Barriga, E. Simon; Pattichis, Marios; Ts’o, Dan; Abramoff, Michael; Kardon, Randy; Kwon, Young; Soliz, Peter

    2011-01-01

    Independent component analysis (ICA) is a statistical technique that estimates a set of sources mixed by an unknown mixing matrix using only a set of observations. For this purpose, the only assumption is that the sources are statistically independent. In many applications, some information about

  18. Does a Wii-based exercise program enhance balance control of independently functioning older adults? A systematic review

    Directory of Open Access Journals (Sweden)

    Laufer Y

    2014-10-01

    Full Text Available Yocheved Laufer, Gali Dar, Einat Kodesh Physical Therapy Department, Faculty of Social Welfare and Health Sciences, University of Haifa, Haifa, Israel Background: Exercise programs that challenge an individual’s balance have been shown to reduce the risk of falls among older adults. Virtual reality computer-based technology that provides the user with opportunities to interact with virtual objects is used extensively for entertainment. There is a growing interest in the potential of virtual reality-based interventions for balance training in older adults. This work comprises a systematic review of the literature to determine the effects of intervention programs utilizing the Nintendo Wii console on balance control and functional performance in independently functioning older adults.Methods: Studies were obtained by searching the following databases: PubMed, CINAHL, PEDro, EMBASE, SPORTdiscus, and Google Scholar, followed by a hand search of bibliographic references of the included studies. Included were randomized controlled trials written in English in which Nintendo Wii Fit was used to enhance standing balance performance in older adults and compared with an alternative exercise treatment, placebo, or no treatment.Results: Seven relevant studies were retrieved. The four studies examining the effect of Wii-based exercise compared with no exercise reported positive effects on at least one outcome measure related to balance performance in older adults. Studies comparing Wii-based training with alternative exercise programs generally indicated that the balance improvements achieved by Wii-based training are comparable with those achieved by other exercise programs.Conclusion: The review indicates that Wii-based exercise programs may serve as an alternative to more conventional forms of exercise aimed at improving balance control. However, due to the great variability between studies in terms of the intervention protocols and outcome measures, as

  19. Promoting physical activity for elders with compromised function: the Lifestyle Interventions and Independence for Elders (LIFE Study physical activity intervention

    Directory of Open Access Journals (Sweden)

    Rejeski WJ

    2013-09-01

    Full Text Available W Jack Rejeski,1 Robert Axtell,2 Roger Fielding,3 Jeffrey Katula,1 Abby C King,4 Todd M Manini,5 Anthony P Marsh,1 Marco Pahor,5 Alvito Rego,6 Catrine Tudor-Locke,7 Mark Newman,8 Michael P Walkup,9 Michael E Miller9  On behalf of the LIFE Study Investigator Group 1Department of Health and Exercise Science, Wake Forest University, Winston-Salem, NC, 2Exercise Science Department, Southern Connecticut State University, New Haven, CT, 3Nutrtion, Exercise Physiology, and Sarcopenia Laboratory, Jean Mayer US Department of Agriculture Human Nutrition Research Center on Aging at Tufts University, Boston, MA, 4Department of Health Research and Policy and Stanford Prevention Research Center, Department of Medicine, Stanford University School of Medicine, Palo Alto, CA, 5Department of Aging and Geriatric Research, College of Medicine, University of Florida, Gainesville, FL, 6Department of Internal Medicine, Northwestern School of Medicine, Chicago, IL, 7Pennington Biomedical Research Center, Baton Rouge, LA, 8Department of Epidemiology, University of Pittsburgh, Pittsburgh, PA, 9Department of Biostatistical Sciences, Division of Public Health Sciences, School of Medicine, Wake Forest University, Winston-Salem, NC, USA Abstract: The Lifestyle Interventions and Independence for Elders (LIFE Study is a Phase III randomized controlled clinical trial (Clinicaltrials.gov identifier: NCT01072500 that will provide definitive evidence regarding the effect of physical activity (PA on major mobility disability in older adults (70–89 years old who have compromised physical function. This paper describes the methods employed in the delivery of the LIFE Study PA intervention, providing insight into how we promoted adherence and monitored the fidelity of treatment. Data are presented on participants' motives and self-perceptions at the onset of the trial along with accelerometry data on patterns of PA during exercise training. Prior to the onset of training, 31.4% of

  20. Comparison of the sensitivity to change of the Functional Independence Measure with the Assessment of Motor and Process Skills within different rehabilitation populations.

    Science.gov (United States)

    Choo, Silvana X; Stratford, Paul; Richardson, Julie; Bosch, Jackie; Pettit, Susan M; Ansley, Barbara J; Harris, Jocelyn E

    2017-09-10

    To determine whether there was a difference in the sensitivity to change of the subscales of the Functional Independence Measure and the Assessment of Motor and Process Skills within three different post-acute inpatient rehabilitation populations. We conducted retrospective chart review of patients consecutively admitted to inpatient rehabilitation units, with both admission and discharge Functional Independence Measure and Assessment of Motor and Process Skills scores. A total of 276 participants were included and categorized into diagnostic groups (orthopedic, oncology, and geriatric). Within group, sensitivity to change was evaluated for the subscales of each measure by calculating the difference in standardized response means (SRM) and 95% confidence intervals (CI). The Functional Independence Measure motor subscale was more sensitive to change than the Assessment of Motor and Process Skills in the orthopedic and geriatric groups (SRM difference  = 1.53 [95% CI 0.93, 2.3] and 0.65 [95% CI 0.3, 1.02], respectively) but not in the oncology group (SRM difference  = 0.42 [95% CI -0.2, 1.04]). For the cognitive subscales, the Assessment of Motor and Process Skills was more sensitive to change than the Functional Independence Measure in all three groups (SRM difference  = 0.38 [95% CI 004, 0.74], 0.65 [95% CI 0.45, 0.90], and 1.15 [95% CI 0.77, 1.69] for orthopedic, geriatric, and oncology, respectively). The Functional Independence Measure is a mandated measure for all rehabilitation units in Canada. As the cognitive subscale of the Assessment of Motor and Process Skills is more sensitive to change than the Functional Independence Measure, we recommend also administering the Assessment of Motor and Process Skills to better detect changes in the cognitive aspect of function. Implications for rehabilitation When deciding between the Functional Independence Measure or the Assessment of Motor and Process Skills, it is important to consider whether patients

  1. Pursuing Perfection: Distress and Interpersonal Functioning among Adolescent Boys in Single-Sex and Co-Educational Independent Schools

    Science.gov (United States)

    Coren, Sidney A.; Luthar, Suniya S.

    2014-01-01

    This study extends past findings of heightened problems among affluent youth by examining adjustment patterns among boys in two academically elite, independent high schools: one for boys only and the other co-educational. Both samples manifested disproportionately high rates of internalizing and externalizing symptoms, but only the co-educational…

  2. The Impact of Multiple Concussions on Emotional Distress, Post-Concussive Symptoms, and Neurocognitive Functioning in Active Duty United States Marines Independent of Combat Exposure or Emotional Distress

    Science.gov (United States)

    Lathan, Corinna E.; Bleiberg, Joseph; Tsao, Jack W.

    2014-01-01

    Abstract Controversy exists as to whether the lingering effects of concussion on emotional, physical, and cognitive symptoms is because of the effects of brain trauma or purely to emotional factors such as post-traumatic stress disorder or depression. This study examines the independent effects of concussion on persistent symptoms. The Defense Automated Neurobehavioral Assessment, a clinical decision support tool, was used to assess neurobehavioral functioning in 646 United States Marines, all of whom were fit for duty. Marines were assessed for concussion history, post-concussive symptoms, emotional distress, neurocognitive functioning, and deployment history. Results showed that a recent concussion or ever having experienced a concussion was associated with an increase in emotional distress, but not with persistent post-concussive symptoms (PPCS) or neurocognitive functioning. Having had multiple lifetime concussions, however, was associated with greater emotional distress, PPCS, and reduced neurocognitive functioning that needs attention and rapid discrimination, but not for memory-based tasks. These results are independent of deployment history, combat exposure, and symptoms of post-traumatic stress disorder and depression. Results supported earlier findings that a previous concussion is not generally associated with post-concussive symptoms independent of covariates. In contrast with other studies that failed to find a unique contribution for concussion to PPCS, however, evidence of recent and multiple concussion was seen across a range of emotional distress, post-concussive symptoms, and neurocognitive functioning in this study population. Results are discussed in terms of implications for assessing concussion on return from combat. PMID:25003552

  3. Evaluation of Treatment in the Smart Home IRIS in terms of Functional Independence and Occupational Performance and Satisfaction

    OpenAIRE

    Ocepek, Julija; Roberts, Anne E. K.; Vidmar, Gaj

    2013-01-01

    The development of assistive technologies, home modifications, and smart homes has rapidly advanced in the last two decades. Health professionals have recognised the benefits of these technologies in improving individual's quality of life. The Smart Home IRIS was established in 2008 within the University Rehabilitation Institute in Ljubljana with the aim to enable persons with disabilities and elderly people to test various assistive technologies and technical solutions for their independent ...

  4. Pursuing Perfection: Distress and Interpersonal Functioning Among Adolescent Boys in Single-Sex and Co-Educational Independent Schools

    OpenAIRE

    Coren, Sidney A.; Luthar, Suniya S.

    2014-01-01

    This study extends past findings of heightened problems among affluent youth by examining adjustment patterns among boys in two academically elite, independent high schools: one for boys only and the other coeducational. Both samples manifested disproportionately high rates of internalizing and externalizing symptoms, but only the co-educational boys showed elevations in substance use. Boys in both schools showed elevations in a new outcome domain examined: exhibitionistic narcissism. Multiva...

  5. Are Independent Probes Truly Independent?

    Science.gov (United States)

    Camp, Gino; Pecher, Diane; Schmidt, Henk G.; Zeelenberg, Rene

    2009-01-01

    The independent cue technique has been developed to test traditional interference theories against inhibition theories of forgetting. In the present study, the authors tested the critical criterion for the independence of independent cues: Studied cues not presented during test (and unrelated to test cues) should not contribute to the retrieval…

  6. Does Duloxetine Improve Cognitive Function Independently of Its Antidepressant Effect in Patients with Major Depressive Disorder and Subjective Reports of Cognitive Dysfunction?

    Directory of Open Access Journals (Sweden)

    Tracy L. Greer

    2014-01-01

    Full Text Available Introduction. Cognitive deficits are commonly reported by patients with major depressive disorder (MDD. Duloxetine, a dual serotonin/noradrenaline reuptake inhibitor, may improve cognitive deficits in MDD. It is unclear if cognitive improvements occur independently of antidepressant effects with standard antidepressant medications. Methods. Thirty participants with MDD who endorsed cognitive deficits at screening received 12-week duloxetine treatment. Twenty-one participants completed treatment and baseline and posttreatment cognitive testing. The Cambridge Neuropsychological Test Automated Battery was used to assess the following cognitive domains: attention, visual memory, executive function/set shifting and working memory, executive function/spatial planning, decision making and response control, and verbal learning and memory. Results. Completers showed significant cognitive improvements across several domains on tasks assessing psychomotor function and mental processing speed, with additional improvements in visual and verbal learning and memory, and affective decision making and response control. Overall significance tests for executive function tasks were also significant, although individual tasks were not, perhaps due to the small sample size. Most notably, cognitive improvements were observed independently of symptom reduction on all domains except verbal learning and memory. Conclusions. Patients reporting baseline cognitive deficits achieved cognitive improvements with duloxetine treatment, most of which were independent of symptomatic improvement. This trial is registered with NCT00933439.

  7. Functional SNP associated with birth weight in independent populations identified with a permutation step added to GBLUP-GWAS

    Science.gov (United States)

    This study was conducted as an initial assessment of a newly available genotyping assay containing about 34,000 common SNP included on previous SNP chips, and 199,000 sequence variants predicted to affect gene function. Objectives were to identify functional variants associated with birth weight in...

  8. Independent-cluster parametrizations of wave functions in model field theories. 1. Introduction to their holomorphic representations

    International Nuclear Information System (INIS)

    Arponen, J.S.; Bishop, R.F.

    1991-01-01

    The configuration-interaction method (CIM), normal coupled-cluster method (NCCM), and extended coupled-cluster method (ECCM) form a rather natural hierarchy of formulations of increasing sophistication for describing interacting systems of quantum-mechanical particles or fields. They are denoted generically as independent-cluster (IC) parameterizations in a view of the way in which they incorporate the many-body correlations via sets of amplitudes that describe the various correlated clusters within the interacting system as mutually independent entities. They differ primarily by the way in which they incorporate the exact locality and separability properties. Each method is shown to provide, in principle, an exact mapping of the original quantum-mechanical problem into a corresponding classical Hamiltonian mechanics in terms of a set of multiconfigurational canonical field amplitudes. In perturbation-theoretic terms the IC methods incorporate infinite classes of diagrams at each order of approximation. The diagrams differ in their connectivity or linkedness properties. The structure of the ECCM in particular makes it capable of describing such phenomena as phase transitions, spontaneous symmetry breaking , and topological states. The authors address such fundamentally important questions as the existence and convergence properties of the three IC parameterizations by formulating the holomorphic representation of each one for the class of single-mode bosonic field theories which include the anharmonic oscillators

  9. Mxi1 and Mxi1-0 Antagonize N-Myc Function and Independently Mediate Apoptosis in Neuroblastoma

    Directory of Open Access Journals (Sweden)

    David A. Erichsen

    2015-02-01

    Full Text Available Neuroblastoma (NB is the third most common malignancy of childhood, and outcomes for children with advanced disease remain poor; amplification of the MYCN gene portends a particularly poor prognosis. Mxi1 antagonizes N-Myc by competing for binding to Max and E-boxes. Unlike N-Myc, Mxi1 mediates transcriptional repression and suppresses cell proliferation. Mxi1 and Mxi1-0 (an alternatively transcribed Mxi1 isoform share identical Max and DNA binding domains but differ in amino-terminal sequences. Because of the conservation of these critical binding domains, we hypothesized that Mxi1-0 antagonizes N-Myc activity similar to Mxi1. SHEP NB cells and SHEP cells stably transfected with MYCN (SHEP/MYCN were transiently transfected with vectors containing full-length Mxi1, full-length Mxi1-0, or the common Mxi domain encoded by exons 2 to 6 (ex2-6. After incubation in low serum, parental SHEP/MYCN cell numbers were reduced compared with SHEP cells. Activated caspase-3 staining and DNA fragmentation ELISA confirmed that SHEP/MYCN cells undergo apoptosis in low serum, while SHEP/MYCN cells transfected with Mxi1 or Mxi1-0 do not. However, SHEP/MYCN cells transfected with Mxi1 or Mxi1-0 and grown in normal serum showed proliferation rates similar to SHEP cells. Mxi ex2-6 did not affect cell number in low or normal serum, suggesting that amino terminal domains of Mxi1 and Mxi1-0 are critical for antagonism. In the absence of N-Myc, Mxi1 and Mxi1-0 induce apoptosis independently through the caspase-8–dependent extrinsic pathway, while N-Myc activates the caspase-9–dependent intrinsic pathway. Together, these data indicate that Mxi1 and Mxi1-0 antagonize N-Myc but also independently impact NB cell survival.

  10. Resting State Functional Connectivity in Mild Traumatic Brain Injury at the Acute Stage: Independent Component and Seed-Based Analyses

    OpenAIRE

    Iraji, Armin; Benson, Randall R.; Welch, Robert D.; O'Neil, Brian J.; Woodard, John L.; Imran Ayaz, Syed; Kulek, Andrew; Mika, Valerie; Medado, Patrick; Soltanian-Zadeh, Hamid; Liu, Tianming; Haacke, E. Mark; Kou, Zhifeng

    2015-01-01

    Mild traumatic brain injury (mTBI) accounts for more than 1 million emergency visits each year. Most of the injured stay in the emergency department for a few hours and are discharged home without a specific follow-up plan because of their negative clinical structural imaging. Advanced magnetic resonance imaging (MRI), particularly functional MRI (fMRI), has been reported as being sensitive to functional disturbances after brain injury. In this study, a cohort of 12 patients with mTBI were pr...

  11. Metformin Improves Endothelial Function and Reduces Blood Pressure in Diabetic Spontaneously Hypertensive Rats Independent from Glycemia Control : Comparison to Vildagliptin

    NARCIS (Netherlands)

    Hamidi Shishavan, Mahdi; Henning, Robert H; van Buiten, Azuwerus; Goris, Maaike; Deelman, Leo E; Buikema, Hendrik

    2017-01-01

    Metformin confers vascular benefits beyond glycemia control, possibly via pleiotropic effects on endothelial function. In type-1-diabetes-mellitus (T1DM-)patients metformin improved flow-mediated dilation but also increased prostaglandin(PG)-F-2 alpha, a known endothelial-contracting factor. To

  12. Depressive and conduct disorder symptoms in youth living with HIV: the independent and interactive roles of coping and neuropsychological functioning.

    Science.gov (United States)

    Salama, Christina; Morris, Mary; Armistead, Lisa; Koenig, Linda J; Demas, Penelope; Ferdon, Corinne; Bachanas, Pamela

    2013-01-01

    Emerging research suggests the importance of psychosocial characteristics (e.g., coping and social support) for positive adaptation among youth with behaviorally acquired HIV. However, little is known about how these traits interact with cognitive abilities to impact emotional and behavioral adjustment. This study examined whether coping skills and executive functioning interact in their association with psychological adjustment in HIV-positive youth. Data from Project Adolescents Living with HIV/AIDS (ALPHA), a study to examine psychosocial, behavioral and neuropsychological functioning of youth with behaviorally acquired HIV, were used. Fifty-nine participants, aged 14-23, diagnosed with HIV prior to age 20 and receiving care in one of two HIV clinics in Atlanta or New York City, were recruited, consented and enrolled. Participants completed measures of depressive symptoms (Beck Depression Inventory), conduct disorder (Adolescent Symptom Index), and use of positive and negative coping strategies (Kidcope). The Wisconsin Card Sorting Test (WCST) assessed abstract reasoning (categories completed) and cognitive inflexibility (perseverative errors). In this sample of HIV-positive youth, depressive symptoms were best predicted by an interactive combination of negative coping skills and poor neuropsychological functioning. Neuropsychological functioning (cognitive inflexibility) and negative coping skills were directly associated with conduct disorder symptoms. Results highlight the importance of including neuropsychological assessment in the evaluation of HIV-positive youth, particularly those with emotional or behavioral problems.

  13. Independent and Combined Effects of Exercise and Vitamin D on Muscle Morphology, Function and Falls in the Elderly

    Directory of Open Access Journals (Sweden)

    Robin M. Daly

    2010-09-01

    Full Text Available Regular exercise, particularly progressive resistance training (PRT, is recognized as one of the most effective strategies to prevent age-related muscle loss (sarcopenia, but its effects on muscle function are mixed. However, emerging data indicates that high velocity PRT (fast concentric muscle contractions is more effective for improving functional outcomes than traditional PRT. In terms of falls prevention, high-challenging balance training programs appear to be most effective. There is also compelling evidence that supplemental vitamin D is an effective therapeutic option for falls prevention. The findings from a recent meta-analysis revealed that supplemental vitamin D at a dose of at least 700–1,000 IU/d or an achieved serum 25(OHD level of at least 60 nmol/L was associated with reduced falls risk among older individuals. Based on these findings, it is possible that the combination of exercise and vitamin D could have a synergistic effect on muscle morphology and function, particularly since both interventions have been shown to have beneficial effects on type II “fast twitch” muscle fibers and systemic inflammation, which have both been linked to losses in muscle mass and function. Unfortunately however, the findings from the limited number of factorial 2 × 2 design RCTs indicate that additional vitamin D does not enhance the effects of exercise on measures of muscle morphology, function or falls risk. However, none of these trials were adequately powered to detect a “synergistic” effect between the two treatment strategies, but it is likely that if an exercise-by-vitamin D interaction does exist, it may be limited to situations when vitamin D deficiency/insufficiency is corrected. Further targeted research in “high risk” groups is still needed to address this question, and evaluate whether there is a threshold level of serum 25(OHD to maximize the effects of exercise on muscle and falls risk.

  14. Fundamental Evaluation of Adaptation and Human Capabilities in a Condition Using a System to Give a User an Artificial Oculomotor Function to Control Directions of Both Eyes Independently

    Directory of Open Access Journals (Sweden)

    Fumio Mizuno

    2011-10-01

    Full Text Available To investigate flexible adaptation of visual system, we developed a system to provide a user an artificial oculomotor function to control directions of both eyes. The system named “Virtual Chameleon” consists of two CCD cameras independently controlled and a head-mounted display. The user can control each tracking directions of two cameras with sensors set to both hands so that the user can get independent arbitrary view fields for both eyes. We performed fundamental experiments to evaluate capability to evaluate adaptation to use of Virtual Chameleon and effects on the user's capabilities. Eleven healthy volunteers with normal and corrected-to-normal vision participated in the experiments. The experiments were tests to find out each position of targets put in both side of a subject. In the experiments, a condition using Virtual Chameleon and a condition without it was adopted. We obtained accuracy rates and time intervals to find out target positions as experimental results. The experiments showed all of volunteers became able to actively control independent visual axes and correctly understood two different views by using Virtual Chameleon, even though two independent view fields yielded binocular rivalry to volunteers and binocular rivalry reduced human capabilities compared to cases without Virtual Chameleon.

  15. Functional drug screening reveals anticonvulsants as enhancers of mTOR-independent autophagic killing of Mycobacterium tuberculosis through inositol depletion.

    Science.gov (United States)

    Schiebler, Mark; Brown, Karen; Hegyi, Krisztina; Newton, Sandra M; Renna, Maurizio; Hepburn, Lucy; Klapholz, Catherine; Coulter, Sarah; Obregón-Henao, Andres; Henao Tamayo, Marcela; Basaraba, Randall; Kampmann, Beate; Henry, Katherine M; Burgon, Joseph; Renshaw, Stephen A; Fleming, Angeleen; Kay, Robert R; Anderson, Karen E; Hawkins, Phillip T; Ordway, Diane J; Rubinsztein, David C; Floto, Rodrigo Andres

    2015-02-01

    Mycobacterium tuberculosis (MTB) remains a major challenge to global health made worse by the spread of multidrug resistance. We therefore examined whether stimulating intracellular killing of mycobacteria through pharmacological enhancement of macroautophagy might provide a novel therapeutic strategy. Despite the resistance of MTB to killing by basal autophagy, cell-based screening of FDA-approved drugs revealed two anticonvulsants, carbamazepine and valproic acid, that were able to stimulate autophagic killing of intracellular M. tuberculosis within primary human macrophages at concentrations achievable in humans. Using a zebrafish model, we show that carbamazepine can stimulate autophagy in vivo and enhance clearance of M. marinum, while in mice infected with a highly virulent multidrug-resistant MTB strain, carbamazepine treatment reduced bacterial burden, improved lung pathology and stimulated adaptive immunity. We show that carbamazepine induces antimicrobial autophagy through a novel, evolutionarily conserved, mTOR-independent pathway controlled by cellular depletion of myo-inositol. While strain-specific differences in susceptibility to in vivo carbamazepine treatment may exist, autophagy enhancement by repurposed drugs provides an easily implementable potential therapy for the treatment of multidrug-resistant mycobacterial infection. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  16. Takifugu rubripes cation independent mannose 6-phosphate receptor: Cloning, expression and functional characterization of the IGF-II binding domain.

    Science.gov (United States)

    A, Ajith Kumar; Nadimpalli, Siva Kumar

    2018-07-01

    Mannose 6-phosphate/IGF-II receptor mediated lysosomal clearance of insulin-like growth factor-II is significantly associated with the evolution of placental mammals. The protein is also referred to as the IGF-II receptor. Earlier studies suggested relatively low binding affinity between the receptor and ligand in prototherian and metatherian mammals. In the present study, we cloned the IGF-II binding domain of the early vertebrate fugu fish and expressed it in bacteria. A 72000Da truncated receptor containing the IGF-II binding domain was obtained. Analysis of this protein (covering domains 11-13 of the CIMPR) for its affinity to fish and human IGF-II by ligand blot assays and ELISA showed that the expressed receptor can specifically bind to both fish and human IGF-II. Additionally, a peptide-specific antibody raised against the region of the IGF-II binding domain also was able to recognize the IGF-II binding regions of mammalian and non-mammalian cation independent MPR protein. These interactions were further characterized by Surface Plasma resonance support that the receptor binds to fish IGF-II, with a dissociation constant of 548nM. Preliminary analysis suggests that the binding mechanism as well as the affinity of the fish and human receptor for IGF-II may have varied according to different evolutionary pressures. Copyright © 2018. Published by Elsevier B.V.

  17. Pursuing Perfection: Distress and Interpersonal Functioning Among Adolescent Boys in Single-Sex and Co-Educational Independent Schools.

    Science.gov (United States)

    Coren, Sidney A; Luthar, Suniya S

    2014-11-01

    This study extends past findings of heightened problems among affluent youth by examining adjustment patterns among boys in two academically elite, independent high schools: one for boys only and the other coeducational. Both samples manifested disproportionately high rates of internalizing and externalizing symptoms, but only the co-educational boys showed elevations in substance use. Boys in both schools showed elevations in a new outcome domain examined: exhibitionistic narcissism. Multivariate analyses of predictors showed that parent criticism -- a defining feature of youths' maladaptive perfectionism -- and perceived maternal depression emerged as major vulnerability factors for both samples in relation to symptom levels. On other parenting dimensions, boys in the single-sex school seemed to be particularly sensitive to feelings of alienation from their fathers and perceived paternal depression. Envy of peers' attractiveness was associated with adolescent distress in both samples, but appeared to be especially critical for co-educational boys. Results are discussed, focusing on the costs and benefits of boys' attendance at a single-sex versus co-educational school, along with implications for practice and future research.

  18. Extraction of fast neuronal changes from multichannel functional near-infrared spectroscopy signals using independent component analysis

    Science.gov (United States)

    Morren, Geert; Wolf, Martin; Lemmerling, Philippe; Wolf, Ursula; Choi, Jee H.; Gratton, Enrico; De Lathauwer, Lieven; Van Huffel, Sabine

    2002-06-01

    Fast changes in the range of milliseconds in the optical properties of cerebral tissue, which are associated with brain activity, can be detected using non-invasive near-infrared spectroscopy (NIRS). These changes in light scattering are due to an alteration in the refractive index at neuronal membranes. The aim of this study was to develop highly sensitive data analysis algorithms to detect this fast signal, which is small compared to other physiological signals. A frequency-domain tissue oximeter, whose laser diodes were modulated at 110MHz was used. The amplitude, mean intensity and phase of the modulated optical signal was measured at 96Hz sample rate. The probe consisting of 4 crossed source detector pairs was placed above the motor cortex, contralateral to the hand performing a tapping exercise consisting of alternating rest- and tapping periods of 20s each. The tapping frequency, which was set to 3.55Hz or 2.5 times the heart rate of the subject to avoid the influence of harmonics on the signal, could not be observed in any of the individual signals measured by the detectors. An adaptive filter was used to remove the arterial pulsatility from the optical signals. Independent Component Analysis allowed to separate signal components in which the tapping frequency was clearly visible.

  19. Exercise training and antioxidant supplementation independently improve cognitive function in adult male and female GFAP-APOE mice

    OpenAIRE

    Kiran Chaudhari; Jessica M. Wong; Philip H. Vann; Nathalie Sumien

    2014-01-01

    Purpose: The purpose of this study was to determine if antioxidant supplementation, moderate exercise, and the combination of both treatments could ameliorate cognitive performance in adult mice and whether the apolipoprotein E (APOE) genotype as well as sex could influence the functional outcomes of the treatments. Methods: For a period of 16 weeks, separate groups of male and female mice expressing either the human APOE3 or APOE4 isoforms were fed either a control diet (NIH-31) or the co...

  20. Exercise training and antioxidant supplementation independently improve cognitive function in adult male and female GFAP-APOE mice

    Directory of Open Access Journals (Sweden)

    Kiran Chaudhari

    2014-09-01

    Conclusion: Exercise was the most effective treatment at improving cognitive function in both genotypes and sex, while antioxidants seemed to be effective only in the APOE4. In young adult mice only non-spatial learning and memory were improved. The combination of the two treatments did not yield further improvement in cognition, and there was no antagonistic action of the antioxidant supplementation on the beneficial effects of exercise.

  1. Accounting for Independent Schools.

    Science.gov (United States)

    Sonenstein, Burton

    The diversity of independent schools in size, function, and mode of operation has resulted in a considerable variety of accounting principles and practices. This lack of uniformity has tended to make understanding, evaluation, and comparison of independent schools' financial statements a difficult and sometimes impossible task. This manual has…

  2. Evaluating use of the Siebens Domain Management Model during inpatient rehabilitation to increase functional independence and discharge rate to home in stroke patients.

    Science.gov (United States)

    Kushner, David S; Peters, Kenneth M; Johnson-Greene, Doug

    2015-04-01

    To evaluate use of the Siebens Domain Management Model (SDMM) during stroke inpatient rehabilitation (IR) to increase functional independence and rate of discharge to home. Before and after study. IR facility. Before the intervention: 154 patients with ischemic/hemorrhagic strokes who were admitted to an IR facility in 2010; on average, they were admitted 9.1 days after receiving acute care. After the intervention: 151 patients with ischemic/hemorrhagic strokes who were admitted to an IR facility in 2012; on average they were admitted 7.3 days after receiving acute care. The comorbidity tier severity and prestroke living setting and living support appeared to be similar in both the preintervention and postintervention groups. Use of the SDMM involving weekly adjustments of IR care focused on potential barriers to discharge home including medical/surgical issues, cognitive/emotional coping issues, physical function, and living environment/community re-entry needs. Use of Functional Independence Measure (FIM) score change during IR length of stay (LOS; FIM-LOS efficiency) and rates of discharge to community/home, acute care, and long-term care (LTC) to compare 2010/preintervention data with postintervention data from 2012, along with comparison of facility data to national aggregate data from the Uniform Data System for Medical Rehabilitation (UDSMR) for both years. Preintervention 2010 FIM-LOS efficiency was 1.44 compared with a 2012 postintervention FIM-LOS efficiency of 2.24, which was significant (t = 4.3; P stroke IR may convey improvement in functional independence and is associated with an increased discharge rate to home/community and a reduction in institutionalization and acute-care transfers. Copyright © 2015 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

  3. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance.

    Science.gov (United States)

    Liu, Jiping; Magalhaes, Jurandir V; Shaff, Jon; Kochian, Leon V

    2009-02-01

    Aluminum-activated root malate and citrate exudation play an important role in plant Al tolerance. This paper characterizes AtMATE, a homolog of the recently discovered sorghum and barley Al-tolerance genes, shown here to encode an Al-activated citrate transporter in Arabidopsis. Together with the previously characterized Al-activated malate transporter, AtALMT1, this discovery allowed us to examine the relationship in the same species between members of the two gene families for which Al-tolerance genes have been identified. AtMATE is expressed primarily in roots and is induced by Al. An AtMATE T-DNA knockdown line exhibited very low AtMATE expression and Al-activated root citrate exudation was abolished. The AtALMT1 AtMATE double mutant lacked both Al-activated root malate and citrate exudation and showed greater Al sensitivity than the AtALMT1 mutant. Therefore, although AtALMT1 is a major contributor to Arabidopsis Al tolerance, AtMATE also makes a significant but smaller contribution. The expression patterns of AtALMT1 and AtMATE and the profiles of Al-activated root citrate and malate exudation are not affected by the presence or absence of the other gene. These results suggest that AtALMT1-mediated malate exudation and AtMATE-mediated citrate exudation evolved independently to confer Al tolerance in Arabidopsis. However, a link between regulation of expression of the two transporters in response to Al was identified through work on STOP1, a transcription factor that was previously shown to be necessary for AtALMT1 expression. Here we show that STOP1 is also required for AtMATE expression and Al-activated citrate exudation.

  4. Blood oxygen depletion is independent of dive function in a deep diving vertebrate, the northern elephant seal.

    Directory of Open Access Journals (Sweden)

    Jessica U Meir

    Full Text Available Although energetics is fundamental to animal ecology, traditional methods of determining metabolic rate are neither direct nor instantaneous. Recently, continuous blood oxygen (O2 measurements were used to assess energy expenditure in diving elephant seals (Mirounga angustirostris, demonstrating that an exceptional hypoxemic tolerance and exquisite management of blood O2 stores underlie the extraordinary diving capability of this consummate diver. As the detailed relationship of energy expenditure and dive behavior remains unknown, we integrated behavior, ecology, and physiology to characterize the costs of different types of dives of elephant seals. Elephant seal dive profiles were analyzed and O2 utilization was classified according to dive type (overall function of dive: transit, foraging, food processing/rest. This is the first account linking behavior at this level with in vivo blood O2 measurements in an animal freely diving at sea, allowing us to assess patterns of O2 utilization and energy expenditure between various behaviors and activities in an animal in the wild. In routine dives of elephant seals, the blood O2 store was significantly depleted to a similar range irrespective of dive function, suggesting that all dive types have equal costs in terms of blood O2 depletion. Here, we present the first physiological evidence that all dive types have similarly high blood O2 demands, supporting an energy balance strategy achieved by devoting one major task to a given dive, thereby separating dive functions into distinct dive types. This strategy may optimize O2 store utilization and recovery, consequently maximizing time underwater and allowing these animals to take full advantage of their underwater resources. This approach may be important to optimizing energy expenditure throughout a dive bout or at-sea foraging trip and is well suited to the lifestyle of an elephant seal, which spends > 90% of its time at sea submerged making diving its

  5. Executive functioning independently predicts self-rated health and improvement in self-rated health over time among community-dwelling older adults.

    Science.gov (United States)

    McHugh, Joanna Edel; Lawlor, Brian A

    2016-01-01

    Self-rated health, as distinct from objective measures of health, is a clinically informative metric among older adults. The purpose of our study was to examine the cognitive and psychosocial factors associated with self-rated health. 624 participants over the age of 60 were assessed at baseline, and of these, 510 were contacted for a follow-up two years later. Measures of executive function and self-rated health were assessed at baseline, and self-rated health was assessed at follow-up. We employed multiple linear regression analyses to investigate the relationship between executive functioning and self-rated health, while controlling for demographic, psychosocial and biological variables. Controlling for other relevant variables, executive functioning independently and solely predicted self-rated health, both at a cross-sectional level, and also over time. Loneliness was also found to cross-sectionally predict self-rated health, although this relationship was not present at a longitudinal level. Older adults' self-rated health may be related to their executive functioning and to their loneliness. Self-rated health appeared to improve over time, and the extent of this improvement was also related to executive functioning at baseline. Self-rated health may be a judgement made of one's functioning, especially executive functioning, which changes with age and therefore may be particularly salient in the reflections of older adults.

  6. Fractures as an independent predictor of functional decline in older people: a population-based study with an 8-year follow-up.

    Science.gov (United States)

    Piirtola, Maarit; Löppönen, Minna; Vahlberg, Tero; Isoaho, Raimo; Kivelä, Sirkka-Liisa; Räihä, Ismo

    2012-01-01

    Fractures among older people are common, but there is scant evidence about the impact of fractures on functional decline in an unselected older population. The objective of this study was to analyze the impact of lower and upper body fractures on functional performance among older adults during an 8-year follow-up. A population-based cohort of 616 Finnish persons aged 65 and over was followed for up to 8 years, and the association between fractures and the risk of short-term (0-2 years) and long-term (up to 8 years) functional decline was analyzed. Fractures were categorized according their functional influence on mobility and activities of daily living (ADL) into lower and upper body fractures. Multivariate cumulative logistic regression model was used in the analyses. During the 8-year follow-up, 112 (18%) persons sustained at least one fracture. In the multivariate analyses, lower body fractures predicted both short-term and long-term decline in mobility [cumulative odds ratio (COR) 4.7, 95% confidence interval (95% CI) 1.9-11.7 and COR 2.6, 95% CI 1.1-6.2, respectively] and in ADL performance (COR 3.1, 95% CI 1.3-7.6 and COR 4.7, 95% CI 2.0-11.4, respectively). Upper body fractures predicted decline in ADL performance during the long-term follow-up (COR 2.5, 95% CI 1.3-4.8). Pre-fracture functional decline and inactivity in leisure time physical exercise were independently associated with the risk of decline in extensive activities. Fractures have an independent influence on the development of functional decline in older persons regardless of the pre-fracture health. Prevention of falls and fractures and improvement of treatment, rehabilitation and follow-up process after fractures are needed. Copyright © 2011 S. Karger AG, Basel.

  7. Distinct roles of autophagy-dependent and -independent functions of FIP200 revealed by generation and analysis of a mutant knock-in mouse model

    Science.gov (United States)

    Chen, Song; Wang, Chenran; Yeo, Syn; Liang, Chun-Chi; Okamoto, Takako; Sun, Shaogang; Wen, Jian; Guan, Jun-Lin

    2016-01-01

    Autophagy is an evolutionarily conserved cellular process controlled through a set of essential autophagy genes (Atgs). However, there is increasing evidence that most, if not all, Atgs also possess functions independent of their requirement in canonical autophagy, making it difficult to distinguish the contributions of autophagy-dependent or -independent functions of a particular Atg to various biological processes. To distinguish these functions for FIP200 (FAK family-interacting protein of 200 kDa), an Atg in autophagy induction, we examined FIP200 interaction with its autophagy partner, Atg13. We found that residues 582–585 (LQFL) in FIP200 are required for interaction with Atg13, and mutation of these residues to AAAA (designated the FIP200-4A mutant) abolished its canonical autophagy function in vitro. Furthermore, we created a FIP200-4A mutant knock-in mouse model and found that specifically blocking FIP200 interaction with Atg13 abolishes autophagy in vivo, providing direct support for the essential role of the ULK1/Atg13/FIP200/Atg101 complex in the process beyond previous studies relying on the complete knockout of individual components. Analysis of the new mouse model showed that nonautophagic functions of FIP200 are sufficient to fully support embryogenesis by maintaining a protective role in TNFα-induced apoptosis. However, FIP200-mediated canonical autophagy is required to support neonatal survival and tumor cell growth. These studies provide the first genetic evidence linking an Atg's autophagy and nonautophagic functions to different biological processes in vivo. PMID:27013233

  8. BMP-2 functions independently of SHH signaling and triggers cell condensation and apoptosis in regenerating axolotl limbs

    Directory of Open Access Journals (Sweden)

    Finnson Kenneth

    2010-02-01

    Full Text Available Abstract Background Axolotls have the unique ability, among vertebrates, to perfectly regenerate complex body parts, such as limbs, after amputation. In addition, axolotls pattern developing and regenerating autopods from the anterior to posterior axis instead of posterior to anterior like all tetrapods studied to date. Sonic hedgehog is important in establishing this anterior-posterior axis of limbs in all tetrapods including axolotls. Interestingly, its expression is conserved (to the posterior side of limb buds and blastemas in axolotl limbs as in other tetrapods. It has been suggested that BMP-2 may be the secondary mediator of sonic hedgehog, although there is mounting evidence to the contrary in mice. Since BMP-2 expression is on the anterior portion of developing and regenerating limbs prior to digit patterning, opposite to the expression of sonic hedgehog, we examined whether BMP-2 expression was dependent on sonic hedgehog signaling and whether it affects patterning of the autopod during regeneration. Results The expression of BMP-2 and SOX-9 in developing and regenerating axolotl limbs corresponded to the first digits forming in the anterior portion of the autopods. The inhibition of sonic hedgehog signaling with cyclopamine caused hypomorphic limbs (during development and regeneration but did not affect the expression of BMP-2 and SOX-9. Overexpression of BMP-2 in regenerating limbs caused a loss of digits. Overexpression of Noggin (BMP inhibitor in regenerating limbs also resulted in a loss of digits. Histological analysis indicated that the loss due to BMP-2 overexpression was the result of increased cell condensation and apoptosis while the loss caused by Noggin was due to a decrease in cell division. Conclusion The expression of BMP-2 and its target SOX-9 was independent of sonic hedgehog signaling in developing and regenerating limbs. Their expression correlated with chondrogenesis and the appearance of skeletal elements has

  9. Analysis of C. elegans NR2E nuclear receptors defines three conserved clades and ligand-independent functions

    Directory of Open Access Journals (Sweden)

    Weber Katherine P

    2012-06-01

    Full Text Available Abstract Background The nuclear receptors (NRs are an important class of transcription factors that are conserved across animal phyla. Canonical NRs consist of a DNA-binding domain (DBD and ligand-binding domain (LBD. While most animals have 20–40 NRs, nematodes of the genus Caenorhabditis have experienced a spectacular proliferation and divergence of NR genes. The LBDs of evolutionarily-conserved Caenorhabditis NRs have diverged sharply from their Drosophila and vertebrate orthologs, while the DBDs have been strongly conserved. The NR2E family of NRs play critical roles in development, especially in the nervous system. In this study, we explore the phylogenetics and function of the NR2E family of Caenorhabditis elegans, using an in vivo assay to test LBD function. Results Phylogenetic analysis reveals that the NR2E family of NRs consists of three broadly-conserved clades of orthologous NRs. In C. elegans, these clades are defined by nhr-67, fax-1 and nhr-239. The vertebrate orthologs of nhr-67 and fax-1 are Tlx and PNR, respectively. While the nhr-239 clade includes orthologs in insects (Hr83, an echinoderm, and a hemichordate, the gene appears to have been lost from vertebrate lineages. The C. elegans and C. briggsae nhr-239 genes have an apparently-truncated and highly-diverged LBD region. An additional C. elegans NR2E gene, nhr-111, appears to be a recently-evolved paralog of fax-1; it is present in C. elegans, but not C. briggsae or other animals with completely-sequenced genomes. Analysis of the relatively unstudied nhr-111 and nhr-239 genes demonstrates that they are both expressed—nhr-111 very broadly and nhr-239 in a small subset of neurons. Analysis of the FAX-1 LBD in an in vivo assay revealed that it is not required for at least some developmental functions. Conclusions Our analysis supports three conserved clades of NR2E receptors, only two of which are represented in vertebrates, indicating three ancestral NR2E genes in the

  10. Coordinating structural and functional synapse development: postsynaptic p21-activated kinase independently specifies glutamate receptor abundance and postsynaptic morphology.

    Science.gov (United States)

    Albin, Stephanie D; Davis, Graeme W

    2004-08-04

    Here, we show that postsynaptic p21-activated kinase (Pak) signaling diverges into two genetically separable pathways at the Drosophila neuromuscular junction. One pathway controls glutamate receptor abundance. Pak signaling within this pathway is specified by a required interaction with the adaptor protein Dreadlocks (Dock). We demonstrate that Dock is localized to the synapse via an Src homology 2-mediated protein interaction. Dock is not necessary for Pak localization but is necessary to restrict Pak signaling to control glutamate receptor abundance. A second genetically separable function of Pak kinase signaling controls muscle membrane specialization through the regulation of synaptic Discs-large. In this pathway, Dock is dispensable. We present a model in which divergent Pak signaling is able to coordinate two different features of postsynaptic maturation, receptor abundance, and muscle membrane specialization.

  11. DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that is largely independent of the RAD51 pathway

    International Nuclear Information System (INIS)

    Dresser, M.E.; Ewing, D.J.; Conrad, M.N.; Dominguez, A.M.; Barstead, R.; Jiang, H.; Kodadek, T.

    1997-01-01

    Meiotic recombination in the yeast Saccharomyces cerevisiae requires two similar recA-like proteins, Dmc1p and Rad51p. A screen for dominant meiotic mutants provided DMC1-G126D, a dominant allele mutated in the conserved ATP-binding site (specifically, the A-loop motif) that confers a null phenotype. A recessive null allele, dmc1-K69E, was isolated as an intragenic suppressor of DMC1-G126D. Dmc1-K69Ep, unlike Dmc1p, does not interact homotypically in a two-hybrid assay, although it does interact with other fusion proteins identified by two-hybrid screen with Dmc1p. Dmc1p, unlike Rad51p, does not interact in the two-hybrid assay with Rad52p or Rad54p. However, Dmc1p does interact with Tid1p, a Rad54p homologue, with Tid4p, a Rad16p homologue, and with other fusion proteins that do not interact with Rad51p, suggesting that Dmc1p and Rad51p function in separate, though possibly overlapping, recombinational repair complexes. Epistasis analysis suggests that DMC1 and RAD51 function in separate pathways responsible for meiotic recombination. Taken together, our results are consistent with a requirement for DMC1 for meiosis-specific entry of DNA double-strand break ends into chromatin. Interestingly, the pattern on CHEF gels of chromosome fragments that result from meiotic DNA double-strand break formation is different in DMC1 mutant strains from that seen in rad50S strains. (author)

  12. Independence of protein kinase C-delta activity from activation loop phosphorylation: structural basis and altered functions in cells.

    Science.gov (United States)

    Liu, Yin; Belkina, Natalya V; Graham, Caroline; Shaw, Stephen

    2006-04-28

    Activation loop phosphorylation plays critical regulatory roles for many kinases. Unlike other protein kinase Cs (PKC), PKC-delta does not require phosphorylation of its activation loop (Thr-507) for in vitro activity. We investigated the structural basis for this unusual capacity and its relevance to PKC-delta function in intact cells. Mutational analysis demonstrated that activity without Thr-507 phosphorylation depends on 20 residues N-terminal to the kinase domain and a pair of phenylalanines (Phe-500/Phe-527) unique to PKC-delta in/near the activation loop. Molecular modeling demonstrated that these elements stabilize the activation loop by forming a hydrophobic chain of interactions from the C-lobe to activation loop to N-terminal (helical) extension. In cells PKC-delta mediates both apoptosis and transcription regulation. We found that the T507A mutant of the PKC-delta kinase domain resembled the corresponding wild type in mediating apoptosis in transfected HEK293T cells. But the T507A mutant was completely defective in AP-1 and NF-kappaB reporter assays. A novel assay in which the kinase domain of PKC-delta and its substrate (a fusion protein of PKC substrate peptide with green fluorescent protein) were co-targeted to lipid rafts revealed a major substrate-selective defect of the T507A mutant in phosphorylating the substrate in cells. In vitro analysis showed strong product inhibition on the T507A mutant with particular substrates whose characteristics suggest it contributes to the substrate selective defect of the PKC-delta T507A mutant in cells. Thus, activation loop phosphorylation of PKC-delta may regulate its function in cells in a novel way.

  13. Functional activity and white matter microstructure reveal the independent effects of age of acquisition and proficiency on second-language learning.

    Science.gov (United States)

    Nichols, Emily S; Joanisse, Marc F

    2016-12-01

    Two key factors govern how bilingual speakers neurally maintain two languages: the speakers' second language age of acquisition (AoA) and their subsequent proficiency. However, the relative roles of these two factors have been difficult to disentangle given that the two can be closely correlated, and most prior studies have examined the two factors in isolation. Here, we combine functional magnetic resonance imaging with diffusion tensor imaging to identify specific brain areas that are independently modulated by AoA and proficiency in second language speakers. First-language Mandarin Chinese speakers who are second language speakers of English were scanned as they performed a picture-word matching task in either language. In the same session we also acquired diffusion-weighted scans to assess white matter microstructure, along with behavioural measures of language proficiency prior to entering the scanner. Results reveal gray- and white-matter networks involving both the left and right hemisphere that independently vary as a function of a second-language speaker's AoA and proficiency, focused on the superior temporal gyrus, middle and inferior frontal gyrus, parahippocampal gyrus, and the basal ganglia. These results indicate that proficiency and AoA explain separate functional and structural networks in the bilingual brain, which we interpret as suggesting distinct types of plasticity for age-dependent effects (i.e., AoA) versus experience and/or predisposition (i.e., proficiency). Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  14. IFN-γ extends the immune functions of Guanylate Binding Proteins to inflammasome-independent antibacterial activities during Francisella novicida infection.

    Directory of Open Access Journals (Sweden)

    Pierre Wallet

    2017-10-01

    Full Text Available Guanylate binding proteins (GBPs are interferon-inducible proteins involved in the cell-intrinsic immunity against numerous intracellular pathogens. The molecular mechanisms underlying the potent antibacterial activity of GBPs are still unclear. GBPs have been functionally linked to the NLRP3, the AIM2 and the caspase-11 inflammasomes. Two opposing models are currently proposed to explain the GBPs-inflammasome link: i GBPs would target intracellular bacteria or bacteria-containing vacuoles to increase cytosolic PAMPs release ii GBPs would directly facilitate inflammasome complex assembly. Using Francisella novicida infection, we investigated the functional interactions between GBPs and the inflammasome. GBPs, induced in a type I IFN-dependent manner, are required for the F. novicida-mediated AIM2-inflammasome pathway. Here, we demonstrate that GBPs action is not restricted to the AIM2 inflammasome, but controls in a hierarchical manner the activation of different inflammasomes complexes and apoptotic caspases. IFN-γ induces a quantitative switch in GBPs levels and redirects pyroptotic and apoptotic pathways under the control of GBPs. Furthermore, upon IFN-γ priming, F. novicida-infected macrophages restrict cytosolic bacterial replication in a GBP-dependent and inflammasome-independent manner. Finally, in a mouse model of tularemia, we demonstrate that the inflammasome and the GBPs are two key immune pathways functioning largely independently to control F. novicida infection. Altogether, our results indicate that GBPs are the master effectors of IFN-γ-mediated responses against F. novicida to control antibacterial immune responses in inflammasome-dependent and independent manners.

  15. Ectodomains of the LDL receptor-related proteins LRP1b and LRP4 have anchorage independent functions in vivo.

    Directory of Open Access Journals (Sweden)

    Martin F Dietrich

    2010-04-01

    Full Text Available The low-density lipoprotein (LDL receptor gene family is a highly conserved group of membrane receptors with diverse functions in developmental processes, lipoprotein trafficking, and cell signaling. The low-density lipoprotein (LDL receptor-related protein 1b (LRP1B was reported to be deleted in several types of human malignancies, including non-small cell lung cancer. Our group has previously reported that a distal extracellular truncation of murine Lrp1b that is predicted to secrete the entire intact extracellular domain (ECD is fully viable with no apparent phenotype.Here, we have used a gene targeting approach to create two mouse lines carrying internally rearranged exons of Lrp1b that are predicted to truncate the protein closer to the N-terminus and to prevent normal trafficking through the secretary pathway. Both mutations result in early embryonic lethality, but, as expected from the restricted expression pattern of LRP1b in vivo, loss of Lrp1b does not cause cellular lethality as homozygous Lrp1b-deficient blastocysts can be propagated normally in culture. This is similar to findings for another LDL receptor family member, Lrp4. We provide in vitro evidence that Lrp4 undergoes regulated intramembraneous processing through metalloproteases and gamma-secretase cleavage. We further demonstrate negative regulation of the Wnt signaling pathway by the soluble extracellular domain.Our results underline a crucial role for Lrp1b in development. The expression in mice of truncated alleles of Lrp1b and Lrp4 with deletions of the transmembrane and intracellular domains leads to release of the extracellular domain into the extracellular space, which is sufficient to confer viability. In contrast, null mutations are embryonically (Lrp1b or perinatally (Lrp4 lethal. These findings suggest that the extracellular domains of both proteins may function as a scavenger for signaling ligands or signal modulators in the extracellular space, thereby

  16. Impaired left ventricular systolic function and increased brachial-ankle pulse-wave velocity are independently associated with rapid renal function progression.

    Science.gov (United States)

    Chen, Szu-Chia; Lin, Tsung-Hsien; Hsu, Po-Chao; Chang, Jer-Ming; Lee, Chee-Siong; Tsai, Wei-Chung; Su, Ho-Ming; Voon, Wen-Chol; Chen, Hung-Chun

    2011-09-01

    Heart failure and increased arterial stiffness are associated with declining renal function. Few studies have evaluated the association between left ventricular ejection fraction (LVEF) and brachial-ankle pulse-wave velocity (baPWV) and renal function progression. The aim of this study was to assess whether LVEFfunction was estimated by eGFR slope. The renal end point was defined as ≥25% decline in eGFR. Clinical and echocardiographic parameters were compared and analyzed. After a multivariate analysis, serum hematocrit was positively associated with eGFR slope, and diabetes mellitus, baPWV (P=0.031) and LVEFfunction decline and progression to the renal end point.

  17. Biological functionalization of drug delivery carriers to bypass size restrictions of receptor-mediated endocytosis independently from receptor targeting.

    Science.gov (United States)

    Ansar, Maria; Serrano, Daniel; Papademetriou, Iason; Bhowmick, Tridib Kumar; Muro, Silvia

    2013-12-23

    Targeting of drug carriers to cell-surface receptors involved in endocytosis is commonly used for intracellular drug delivery. However, most endocytic receptors mediate uptake via clathrin or caveolar pathways associated with ≤200-nm vesicles, restricting carrier design. We recently showed that endocytosis mediated by intercellular adhesion molecule 1 (ICAM-1), which differs from clathrin- and caveolae-mediated pathways, allows uptake of nano- and microcarriers in cell culture and in vivo due to recruitment of cellular sphingomyelinases to the plasmalemma. This leads to ceramide generation at carrier binding sites and formation of actin stress-fibers, enabling engulfment and uptake of a wide size-range of carriers. Here we adapted this paradigm to enhance uptake of drug carriers targeted to receptors associated with size-restricted pathways. We coated sphingomyelinase onto model (polystyrene) submicro- and microcarriers targeted to clathrin-associated mannose-6-phosphate receptor. In endothelial cells, this provided ceramide enrichment at the cell surface and actin stress-fiber formation, modifying the uptake pathway and enhancing carrier endocytosis without affecting targeting, endosomal transport, cell-associated degradation, or cell viability. This improvement depended on the carrier size and enzyme dose, and similar results were observed for other receptors (transferrin receptor) and cell types (epithelial cells). This phenomenon also enhanced tissue accumulation of carriers after intravenous injection in mice. Hence, it is possible to maintain targeting toward a selected receptor while bypassing natural size restrictions of its associated endocytic route by functionalization of drug carriers with biological elements mimicking the ICAM-1 pathway. This strategy holds considerable promise to enhance flexibility of design of targeted drug delivery systems.

  18. A phosphatase-independent gain-of-function mutation in PTEN triggers aberrant cell growth in astrocytes through an autocrine IGF-1 loop.

    Science.gov (United States)

    Fernández, S; Genis, L; Torres-Alemán, I

    2014-08-07

    Loss-of-function mutations in the phosphatase PTEN (phosphatase and tensin homolog deleted on chromosome10) contribute to aberrant cell growth in part through upregulation of the mitogenic IGF-1/PI3K/Akt pathway. In turn, this pathway exerts a homeostatic feedback over PTEN. Using mutagenesis analysis to explore a possible impact of this mutual control on astrocyte growth, we found that truncation of the C-terminal region of PTEN (Δ51) associates with a marked increase in NFκB activity, a transcription factor overactivated in astrocyte tumors. Whereas mutations of PTEN are considered to lead to a loss-of-function, PTENΔ51, a truncation that comprises a region frequently mutated in human gliomas, displayed a neomorphic (gain-of-function) activity that was independent of its phosphatase activity. This gain-of-function of PTENΔ51 includes stimulation of IGF-1 synthesis through protein kinase A activation of the IGF-1 promoter. Increased IGF-1 originates an autocrine loop that activates Akt and NFκB. Constitutive activation of NFκB in PTENΔ51-expressing astrocytes leads to aberrant cell growth; astrocytes expressing this mutant PTEN generate colonies in vitro and tumors in vivo. Mutations converting a tumor suppressor such as PTEN into a tumor promoter through a gain-of-function involving IGF-1 production may further our understanding of the role played by this growth factor in glioma growth and help us define druggable targets for personalized therapy.

  19. Low Intensity Extracorporeal Shock Wave Therapy Improves Erectile Function in a Model of Type II Diabetes Independently of NO/cGMP Pathway.

    Science.gov (United States)

    Assaly-Kaddoum, Rana; Giuliano, François; Laurin, Miguel; Gorny, Diane; Kergoat, Micheline; Bernabé, Jacques; Vardi, Yoram; Alexandre, Laurent; Behr-Roussel, Delphine

    2016-09-01

    Erectile dysfunction is highly prevalent in type II diabetes mellitus. Low intensity extracorporeal shock wave therapy improves erectile function in patients with erectile dysfunction of vasculogenic origin, including diabetes. However, its mode of action remains unknown. We investigated the effects of low intensity extracorporeal shock wave therapy compared to or combined with sildenafil on erectile dysfunction in a type II diabetes mellitus model. Our purpose was to test our hypothesis of a mode of action targeting the cavernous nitric oxide/cyclic guanosine monophosphate pathway. GK rats, a validated model of type II diabetes mellitus, and age matched Wistar rats were treated with low intensity extracorporeal shock wave therapy twice weekly for 3 weeks. Treatment was repeated after a 3-week no-treatment interval. The penis was stretched and dipped in a specifically designed water-filled cage. Shock waves were delivered by a calibrated probe yielding a controlled energy flux density (0.09 mJ/mm(2)). The probe was attached to an electrohydraulic unit with a focused shock wave source, allowing for accurate extrapolation to humans. Following a 4-week washout period erectile function was assessed as well as endothelium dependent and independent, and nitrergic relaxations of the corpus cavernosum of GK rats. Low intensity extracorporeal shock wave therapy significantly improved erectile function in GK rats to the same extent as sildenafil. Treatment effects were potentiated when combined with sildenafil. Shock wave effects were not associated with improved cavernous endothelium dependent or independent, or nitrergic reactivity. Low intensity extracorporeal shock wave therapy improved erectile function in GK rats. Unexpectedly, this was not mediated by a nitric oxide/cyclic guanosine monophosphate dependent mechanism. Sildenafil increased shock wave efficacy. This preclinical paradigm to deliver low intensity extracorporeal shock wave therapy to the rat penis should

  20. TCR-independent functions of Th17 cells mediated by the synergistic actions of cytokines of the IL-12 and IL-1 families.

    Directory of Open Access Journals (Sweden)

    Yun Kyung Lee

    Full Text Available The development of Th17 cells is accompanied by the acquisition of responsiveness to both IL-12 and IL-23, cytokines with established roles in the development and/or function of Th1 and Th17 cells, respectively. IL-12 signaling promotes antigen-dependent Th1 differentiation but, in combination with IL-18, allows the antigen-independent perpetuation of Th1 responses. On the other hand, while IL-23 is dispensable for initial commitment to the Th17 lineage, it promotes the pathogenic function of the Th17 cells. In this study, we have examined the overlap between Th1 and Th17 cells in their responsiveness to common pro-inflammatory cytokines and how this affects the antigen-independent cytokine responses of Th17 cells. We found that in addition to the IL-1 receptor, developing Th17 cells also up-regulate the IL-18 receptor. Consequently, in the presence of IL-1β or IL-18, and in the absence of TCR activation, Th17 cells produce Th17 lineage cytokines in a STAT3-dependent manner when stimulated with IL-23, and IFN© via a STAT4-dependent mechanism when stimulated with IL-12. Thus, building on previous findings of antigen-induced plasticity of Th17 cells, our results indicate that this potential of Th17 cells extends to their cytokine-dependent antigen-independent responses. Collectively, our data suggest a model whereby signaling via either IL-1β or IL-18 allows for bystander responses of Th17 cells to pathogens or pathogen products that differentially activate innate cell production of IL-12 or IL-23.

  1. Decoding the encoding of functional brain networks: An fMRI classification comparison of non-negative matrix factorization (NMF), independent component analysis (ICA), and sparse coding algorithms.

    Science.gov (United States)

    Xie, Jianwen; Douglas, Pamela K; Wu, Ying Nian; Brody, Arthur L; Anderson, Ariana E

    2017-04-15

    Brain networks in fMRI are typically identified using spatial independent component analysis (ICA), yet other mathematical constraints provide alternate biologically-plausible frameworks for generating brain networks. Non-negative matrix factorization (NMF) would suppress negative BOLD signal by enforcing positivity. Spatial sparse coding algorithms (L1 Regularized Learning and K-SVD) would impose local specialization and a discouragement of multitasking, where the total observed activity in a single voxel originates from a restricted number of possible brain networks. The assumptions of independence, positivity, and sparsity to encode task-related brain networks are compared; the resulting brain networks within scan for different constraints are used as basis functions to encode observed functional activity. These encodings are then decoded using machine learning, by using the time series weights to predict within scan whether a subject is viewing a video, listening to an audio cue, or at rest, in 304 fMRI scans from 51 subjects. The sparse coding algorithm of L1 Regularized Learning outperformed 4 variations of ICA (pcoding algorithms. Holding constant the effect of the extraction algorithm, encodings using sparser spatial networks (containing more zero-valued voxels) had higher classification accuracy (pcoding algorithms suggests that algorithms which enforce sparsity, discourage multitasking, and promote local specialization may capture better the underlying source processes than those which allow inexhaustible local processes such as ICA. Negative BOLD signal may capture task-related activations. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Effects of bioDensity Training and Power Plate Whole-Body Vibration on Strength, Balance, and Functional Independence in Older Adults.

    Science.gov (United States)

    Smith, Derek T; Judge, Stacey; Malone, Ashley; Moynes, Rebecca C; Conviser, Jason; Skinner, James S

    2016-01-01

    Reduced strength, balance, and functional independence diminish quality of life and increase health care costs. Sixty adults (82.2 ± 4.9 years) were randomized to a control or three 12-week intervention groups: bioDensity (bD); Power Plate (PP) whole-body vibration (WBV); or bD+PP. bD involved one weekly 5-s maximal contraction of four muscle groups. PP involved two 5-min WBV sessions. Primary outcomes were strength, balance, and Functional Independence Measure (FIM). No groups differed initially. Strength significantly increased 22-51% for three muscle groups in bD and bD+PP (P Balance significantly improved in PP and bD+PP but not in control or bD. bD, PP, and bD+PP differentially improved FIM self-care and mobility. Strength improvements from weekly 5-min sessions of bD may impart health/clinical benefits. Balance and leg strength improvements suggest WBV beneficially impacts fall risk and incidence. Improved FIM scores are encouraging and justify larger controlled trials on bD and bD+PP efficacy.

  3. Independent preferences

    DEFF Research Database (Denmark)

    Vind, Karl

    1991-01-01

    A simple mathematical result characterizing a subset of a product set is proved and used to obtain additive representations of preferences. The additivity consequences of independence assumptions are obtained for preferences which are not total or transitive. This means that most of the economic ...... theory based on additive preferences - expected utility, discounted utility - has been generalized to preferences which are not total or transitive. Other economic applications of the theorem are given...

  4. Prolonged Response and Restoration of Functional Independence with Bevacizumab plus Vinorelbine as Third-Line Treatment for Breast Cancer-Related Leptomeningeal Metastases

    Directory of Open Access Journals (Sweden)

    Emilie Le Rhun

    2015-02-01

    Full Text Available Background: Survival of patients with leptomeningeal metastases (LM and impaired functional status is limited to several months, and rarely does neurological function improve with treatment. Case Report: A 34-year-old female with hormone-negative and HER2-positive metastatic breast cancer was diagnosed with bulky radiographic LM 45 months after initial diagnosis. She was treated with intra-CSF trastuzumab followed by intra-CSF liposomal cytarabine; however, the cancer progressed 8 months after the diagnosis of LM. At the time of the third LM progression, the patient presented with a cauda equina syndrome and cerebellar impairment resulting in an inability to walk. She was treated with CNS-directed radiotherapy (lumbosacral and cerebellar and bevacizumab plus vinorelbine. Rapid functional improvement occurred, and the patient regained the ability to walk and independently manage her daily activities. Twelve months later, she presented with rapid progression of the LM resulting in death within several weeks. Conclusion: In radiographically defined bulky LM, the combination of systemic therapy and CNS-directed radiotherapy likely is more active than intra-CSF therapy only. In lieu of the rapid and significant improvement in neurological function combined with the prolonged response, bevacizumab alone or in combination with chemotherapy and CNS-directed radiotherapy may be considered in select patients with radiographically bulky breast cancer-related LM.

  5. Independent Directors

    DEFF Research Database (Denmark)

    Ringe, Wolf-Georg

    2013-01-01

    This paper re-evaluates the corporate governance concept of ‘board independence’ against the disappointing experiences during the 2007-08 financial crisis. Independent or outside directors had long been seen as an essential tool to improve the monitoring role of the board. Yet the crisis revealed...... that they did not prevent firms' excessive risk taking; further, these directors sometimes showed serious deficits in understanding the business they were supposed to control, and remained passive in addressing structural problems. A closer look reveals that under the surface of seemingly unanimous consensus...

  6. Are Independent Fiscal Institutions Really Independent?

    Directory of Open Access Journals (Sweden)

    Slawomir Franek

    2015-08-01

    Full Text Available In the last decade the number of independent fiscal institutions (known also as fiscal councils has tripled. They play an important oversight role over fiscal policy-making in democratic societies, especially as they seek to restore public finance stability in the wake of the recent financial crisis. Although common functions of such institutions include a role in analysis of fiscal policy, forecasting, monitoring compliance with fiscal rules or costing of spending proposals, their roles, resources and structures vary considerably across countries. The aim of the article is to determine the degree of independence of such institutions based on the analysis of the independence index of independent fiscal institutions. The analysis of this index values may be useful to determine the relations between the degree of independence of fiscal councils and fiscal performance of particular countries. The data used to calculate the index values will be derived from European Commission and IMF, which collect sets of information about characteristics of activity of fiscal councils.

  7. Probabilistic conditional independence structures

    CERN Document Server

    Studeny, Milan

    2005-01-01

    Probabilistic Conditional Independence Structures provides the mathematical description of probabilistic conditional independence structures; the author uses non-graphical methods of their description, and takes an algebraic approach.The monograph presents the methods of structural imsets and supermodular functions, and deals with independence implication and equivalence of structural imsets.Motivation, mathematical foundations and areas of application are included, and a rough overview of graphical methods is also given.In particular, the author has been careful to use suitable terminology, and presents the work so that it will be understood by both statisticians, and by researchers in artificial intelligence.The necessary elementary mathematical notions are recalled in an appendix.

  8. Diffusion Tensor Fractional Anisotropy in the Superior Longitudinal Fasciculus Correlates with Functional Independence Measure Cognition Scores in Patients with Cerebral Infarction.

    Science.gov (United States)

    Koyama, Tetsuo; Domen, Kazuhisa

    2017-08-01

    This study aimed to determine the relationship between fiber tract degeneration measured by diffusion-tensor imaging (DTI) and outcome of patients after cerebral infarction. Fractional anisotropy (FA) maps were generated by DTI in patients 14-21 days after the first infarction and were analyzed by tract-based spatial statistics (TBSS). Mean FA values within the corticospinal tract (CST) and the superior longitudinal fasciculus (SLF) were extracted from individual TBSS data. Relationships between FA ratios (rFAs, lesioned to non-lesioned hemisphere) and outcomes assessed by Brunnstrom stage (BRS) and Functional Independence Measure (FIM) motor and cognition scores were examined using Spearman's rank correlation test. Forty patients (21 left and 19 right hemisphere lesions) were entered into an analytical database. BRS ranged from 1 to 6 (median, 5) for shoulder, elbow, or forearm; from 2 to 6 (median, 4.5) for hand or finger; and from 3 to 6 (median, 5) for lower extremity. FIM motor ranged from 51 to 91 (median, 79.5), and FIM cognition ranged from 16 to 35 (median, 29). rFA values in the CST ranged from .692 to 1.053 (median, .933), and those in the SLF ranged from .778 to 1.076 (median, .965). Mann-Whitney U test (P cognition scores (r = .409, P cognitive function and extremity function, respectively. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  9. Functional connectivity analysis of the neural bases of emotion regulation: A comparison of independent component method with density-based k-means clustering method.

    Science.gov (United States)

    Zou, Ling; Guo, Qian; Xu, Yi; Yang, Biao; Jiao, Zhuqing; Xiang, Jianbo

    2016-04-29

    Functional magnetic resonance imaging (fMRI) is an important tool in neuroscience for assessing connectivity and interactions between distant areas of the brain. To find and characterize the coherent patterns of brain activity as a means of identifying brain systems for the cognitive reappraisal of the emotion task, both density-based k-means clustering and independent component analysis (ICA) methods can be applied to characterize the interactions between brain regions involved in cognitive reappraisal of emotion. Our results reveal that compared with the ICA method, the density-based k-means clustering method provides a higher sensitivity of polymerization. In addition, it is more sensitive to those relatively weak functional connection regions. Thus, the study concludes that in the process of receiving emotional stimuli, the relatively obvious activation areas are mainly distributed in the frontal lobe, cingulum and near the hypothalamus. Furthermore, density-based k-means clustering method creates a more reliable method for follow-up studies of brain functional connectivity.

  10. Androgen receptor gene CAG repeat polymorphism independently influences recovery of male sexual function after testosterone replacement therapy in postsurgical hypogonadotropic hypogonadism.

    Science.gov (United States)

    Tirabassi, Giacomo; Delli Muti, Nicola; Corona, Giovanni; Maggi, Mario; Balercia, Giancarlo

    2014-05-01

    Few and contradictory studies have evaluated the possible influence of androgen receptor (AR) gene CAG repeat polymorphism on male sexual function. In this study we evaluated the role of AR gene CAG repeat polymorphism in the recovery of sexual function after testosterone replacement therapy (TRT) in men affected by postsurgical hypogonadotropic hypogonadism, a condition which is often associated with hypopituitarism and in which the sexual benefits of TRT must be distinguished from those of pituitary-function replacement therapies. Fifteen men affected by postsurgical hypogonadotropic hypogonadism were retrospectively assessed before and after TRT. Main outcome measures included sexual parameters as assessed by the International Index of Erectile Function questionnaire, levels of pituitary dependent hormones (total testosterone, free T3, free T4, cortisol, insulin-like growth factor-1 [IGF-1], prolactin), and results of genetic analysis (AR gene CAG repeat number). Plasma concentrations of free T3, free T4, cortisol, and prolactin did not vary significantly between the two phases, while testosterone and IGF-1 increased significantly after TRT. A significant improvement in all sexual parameters studied was found. The number of CAG triplets was negatively and significantly correlated with changes in all the sexual parameters, while opposite correlations were found between changes in sexual parameters and changes in testosterone levels; no correlation of change in IGF1 with change in sexual parameters was reported. On multiple linear regression analysis, after correction for changes in testosterone, nearly all the associations between the number of CAG triplets and changes in sexual parameters were confirmed. Shorter length AR gene CAG repeat number is associated with the recovery of sexual function after TRT in postsurgical male hypogonadotropic hypogonadism, independently of the effects of concomitant pituitary-replacement therapies. © 2014 International Society

  11. A Rad53 independent function of Rad9 becomes crucial for genome maintenance in the absence of the Recq helicase Sgs1.

    Directory of Open Access Journals (Sweden)

    Ida Nielsen

    Full Text Available The conserved family of RecQ DNA helicases consists of caretaker tumour suppressors, that defend genome integrity by acting on several pathways of DNA repair that maintain genome stability. In budding yeast, Sgs1 is the sole RecQ helicase and it has been implicated in checkpoint responses, replisome stability and dissolution of double Holliday junctions during homologous recombination. In this study we investigate a possible genetic interaction between SGS1 and RAD9 in the cellular response to methyl methane sulphonate (MMS induced damage and compare this with the genetic interaction between SGS1 and RAD24. The Rad9 protein, an adaptor for effector kinase activation, plays well-characterized roles in the DNA damage checkpoint response, whereas Rad24 is characterized as a sensor protein also in the DNA damage checkpoint response. Here we unveil novel insights into the cellular response to MMS-induced damage. Specifically, we show a strong synergistic functionality between SGS1 and RAD9 for recovery from MMS induced damage and for suppression of gross chromosomal rearrangements, which is not the case for SGS1 and RAD24. Intriguingly, it is a Rad53 independent function of Rad9, which becomes crucial for genome maintenance in the absence of Sgs1. Despite this, our dissection of the MMS checkpoint response reveals parallel, but unequal pathways for Rad53 activation and highlights significant differences between MMS- and hydroxyurea (HU-induced checkpoint responses with relation to the requirement of the Sgs1 interacting partner Topoisomerase III (Top3. Thus, whereas earlier studies have documented a Top3-independent role of Sgs1 for an HU-induced checkpoint response, we show here that upon MMS treatment, Sgs1 and Top3 together define a minor but parallel pathway to that of Rad9.

  12. Aliskiren, a Direct Renin Inhibitor, Improves Vascular Endothelial Function in Patients on Hemodialysis Independent of Antihypertensive Effect ∼ a Pilot Study∼

    Directory of Open Access Journals (Sweden)

    Hidekazu Moriya

    2013-05-01

    Full Text Available Aims: Aliskiren inhibits the first step in the renin-angiotensin system (RAS and recently has been shown to modulate vascular diseases via RAS-dependent and independent pathways. This study aimed to determine the effect of aliskiren-associated direct renin inhibition on endothelial function in patients on hemodialysis via flow-mediated dilatation (FMD and platelet-derived microparticles (PDMP, as biomarkers of atherosclerosis. Methods: A 12-week prospective study was performed with 24 patients on hemodialysis who were administered 150 mg orally aliskiren once daily for 12 weeks. Results: No significant difference were observed between pre-dialysis, home, and weekly averaged blood pressure at baseline and at 12 weeks (151.5 ± 8.5/80.9 ± 12.9 mmHg vs 150.3 ± 15.3/78.9 ± 21.2 mmHg, 151.4 ± 9.7/82.3 ± 14.7 mmHg vs 151.2 ± 17.7/81.4 ± 10.6 mmHg, and 156.0 ± 18.3/81.9 ± 9.4 mmHg vs 152.5 ± 18.9/81.7 ± 12.3 mmHg, respectively. FMD significantly increased from 2.54% ± 1.45% at baseline to 3.11% ± 1.37% at 12 weeks (P = 0.0267, and PDMP significantly decreased from 13.9 ± 5.8 U/mL at baseline to 10.9 ± 4.5 U/mL at 12 weeks (P = 0.0002. Conclusion: Aliskiren improved vascular endothelial function and platelet-endothelium activation in patients on hemodialysis independent of antihypertensive effect.

  13. Identification of independent association signals and putative functional variants for breast cancer risk through fine-scale mapping of the 12p11 locus.

    Science.gov (United States)

    Zeng, Chenjie; Guo, Xingyi; Long, Jirong; Kuchenbaecker, Karoline B; Droit, Arnaud; Michailidou, Kyriaki; Ghoussaini, Maya; Kar, Siddhartha; Freeman, Adam; Hopper, John L; Milne, Roger L; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Agata, Simona; Ahmed, Shahana; Aittomäki, Kristiina; Andrulis, Irene L; Anton-Culver, Hoda; Antonenkova, Natalia N; Arason, Adalgeir; Arndt, Volker; Arun, Banu K; Arver, Brita; Bacot, Francois; Barrowdale, Daniel; Baynes, Caroline; Beeghly-Fadiel, Alicia; Benitez, Javier; Bermisheva, Marina; Blomqvist, Carl; Blot, William J; Bogdanova, Natalia V; Bojesen, Stig E; Bonanni, Bernardo; Borresen-Dale, Anne-Lise; Brand, Judith S; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Broeks, Annegien; Brüning, Thomas; Burwinkel, Barbara; Buys, Saundra S; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Carpenter, Jane; Chang-Claude, Jenny; Choi, Ji-Yeob; Claes, Kathleen B M; Clarke, Christine; Cox, Angela; Cross, Simon S; Czene, Kamila; Daly, Mary B; de la Hoya, Miguel; De Leeneer, Kim; Devilee, Peter; Diez, Orland; Domchek, Susan M; Doody, Michele; Dorfling, Cecilia M; Dörk, Thilo; Dos-Santos-Silva, Isabel; Dumont, Martine; Dwek, Miriam; Dworniczak, Bernd; Egan, Kathleen; Eilber, Ursula; Einbeigi, Zakaria; Ejlertsen, Bent; Ellis, Steve; Frost, Debra; Lalloo, Fiona; Fasching, Peter A; Figueroa, Jonine; Flyger, Henrik; Friedlander, Michael; Friedman, Eitan; Gambino, Gaetana; Gao, Yu-Tang; Garber, Judy; García-Closas, Montserrat; Gehrig, Andrea; Damiola, Francesca; Lesueur, Fabienne; Mazoyer, Sylvie; Stoppa-Lyonnet, Dominique; Giles, Graham G; Godwin, Andrew K; Goldgar, David E; González-Neira, Anna; Greene, Mark H; Guénel, Pascal; Haeberle, Lothar; Haiman, Christopher A; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V O; Hart, Steven; Hartikainen, Jaana M; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Hogervorst, Frans B L; Verhoef, Senno; Hendricks, Carolyn B; Hillemanns, Peter; Hollestelle, Antoinette; Hulick, Peter J; Hunter, David J; Imyanitov, Evgeny N; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jaworska-Bieniek, Katarzyna; Jensen, Uffe Birk; John, Esther M; Joly Beauparlant, Charles; Jones, Michael; Kabisch, Maria; Kang, Daehee; Karlan, Beth Y; Kauppila, Saila; Kerin, Michael J; Khan, Sofia; Khusnutdinova, Elza; Knight, Julia A; Konstantopoulou, Irene; Kraft, Peter; Kwong, Ava; Laitman, Yael; Lambrechts, Diether; Lazaro, Conxi; Le Marchand, Loic; Lee, Chuen Neng; Lee, Min Hyuk; Lester, Jenny; Li, Jingmei; Liljegren, Annelie; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Mai, Phuong L; Mannermaa, Arto; Manoukian, Siranoush; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; McGuffog, Lesley; Meindl, Alfons; Menegaux, Florence; Montagna, Marco; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L; Neuhausen, Susan L; Nevanlinna, Heli; Newcomb, Polly A; Nord, Silje; Nussbaum, Robert L; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I; Olswold, Curtis; Osorio, Ana; Papi, Laura; Park-Simon, Tjoung-Won; Paulsson-Karlsson, Ylva; Peeters, Stephanie; Peissel, Bernard; Peterlongo, Paolo; Peto, Julian; Pfeiler, Georg; Phelan, Catherine M; Presneau, Nadege; Radice, Paolo; Rahman, Nazneen; Ramus, Susan J; Rashid, Muhammad Usman; Rennert, Gad; Rhiem, Kerstin; Rudolph, Anja; Salani, Ritu; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schmidt, Marjanka K; Schmutzler, Rita K; Schoemaker, Minouk J; Schürmann, Peter; Seynaeve, Caroline; Shen, Chen-Yang; Shrubsole, Martha J; Shu, Xiao-Ou; Sigurdson, Alice; Singer, Christian F; Slager, Susan; Soucy, Penny; Southey, Melissa; Steinemann, Doris; Swerdlow, Anthony; Szabo, Csilla I; Tchatchou, Sandrine; Teixeira, Manuel R; Teo, Soo H; Terry, Mary Beth; Tessier, Daniel C; Teulé, Alex; Thomassen, Mads; Tihomirova, Laima; Tischkowitz, Marc; Toland, Amanda E; Tung, Nadine; Turnbull, Clare; van den Ouweland, Ans M W; van Rensburg, Elizabeth J; Ven den Berg, David; Vijai, Joseph; Wang-Gohrke, Shan; Weitzel, Jeffrey N; Whittemore, Alice S; Winqvist, Robert; Wong, Tien Y; Wu, Anna H; Yannoukakos, Drakoulis; Yu, Jyh-Cherng; Pharoah, Paul D P; Hall, Per; Chenevix-Trench, Georgia; Dunning, Alison M; Simard, Jacques; Couch, Fergus J; Antoniou, Antonis C; Easton, Douglas F; Zheng, Wei

    2016-06-21

    Multiple recent genome-wide association studies (GWAS) have identified a single nucleotide polymorphism (SNP), rs10771399, at 12p11 that is associated with breast cancer risk. We performed a fine-scale mapping study of a 700 kb region including 441 genotyped and more than 1300 imputed genetic variants in 48,155 cases and 43,612 controls of European descent, 6269 cases and 6624 controls of East Asian descent and 1116 cases and 932 controls of African descent in the Breast Cancer Association Consortium (BCAC; http://bcac.ccge.medschl.cam.ac.uk/ ), and in 15,252 BRCA1 mutation carriers in the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Stepwise regression analyses were performed to identify independent association signals. Data from the Encyclopedia of DNA Elements project (ENCODE) and the Cancer Genome Atlas (TCGA) were used for functional annotation. Analysis of data from European descendants found evidence for four independent association signals at 12p11, represented by rs7297051 (odds ratio (OR) = 1.09, 95 % confidence interval (CI) = 1.06-1.12; P = 3 × 10(-9)), rs805510 (OR = 1.08, 95 % CI = 1.04-1.12, P = 2 × 10(-5)), and rs1871152 (OR = 1.04, 95 % CI = 1.02-1.06; P = 2 × 10(-4)) identified in the general populations, and rs113824616 (P = 7 × 10(-5)) identified in the meta-analysis of BCAC ER-negative cases and BRCA1 mutation carriers. SNPs rs7297051, rs805510 and rs113824616 were also associated with breast cancer risk at P associations were statistically significant in African descendants. Multiple candidate functional variants are located in putative enhancer sequences. Chromatin interaction data suggested that PTHLH was the likely target gene of these enhancers. Of the six variants with the strongest evidence of potential functionality, rs11049453 was statistically significantly associated with the expression of PTHLH and its nearby gene CCDC91 at P association signals at

  14. Fatigue as Presenting Symptom and a High Burden of Premature Ventricular Contractions Are Independently Associated With Increased Ventricular Wall Stress in Patients With Normal Left Ventricular Function.

    Science.gov (United States)

    van Huls van Taxis, Carine F B; Piers, Sebastiaan R D; de Riva Silva, Marta; Dekkers, Olaf M; Pijnappels, Daniël A; Schalij, Martin J; Wijnmaalen, Adrianus P; Zeppenfeld, Katja

    2015-12-01

    High idiopathic premature ventricular contractions (PVC) burden has been associated with PVC-induced cardiomyopathy. Patients may be symptomatic before left ventricular (LV) dysfunction develops. N-terminal pro-B-type natriuretic peptide (NT-proBNP) and circumferential end-systolic wall stress (cESS) on echocardiography are markers for increased ventricular wall stress. This study aimed to evaluate the relation between presenting symptoms, PVC burden, and increased ventricular wall stress in patients with frequent PVCs and preserved LV function. Eighty-three patients (41 men; 49±15 years) with idiopathic PVCs and normal LV function referred for PVC ablation were included. Type of symptoms (palpitations, fatigue, and [near-]syncope), PVC burden on 24-hour Holter, NT-proBNP levels, and cESS on echocardiography were assessed before and 3 months after ablation. Sustained successful ablation was defined as ≥80% PVC burden reduction during follow-up. Patients were symptomatic for 24 months (Q1-Q3, 16-60); 73% reported palpitations, 47% fatigue, and 30% (near-)syncope. Baseline PVC burden was 23±13%, median NT-proBNP 92 pg/mL (Q1-Q3 50-156), and cESS 143±35 kdyne/cm(2). Fatigue was associated with higher baseline NT-proBNP and cESS (PFatigue was independently associated with a significantly larger reduction in NT-proBNP. In patients with nonsuccessful ablation, NT-proBNP and cESS remained unchanged. In patients with frequent PVCs and preserved LV function, fatigue was associated with higher baseline NT-proBNP and cESS, and with a significantly larger reduction in NT-proBNP after sustained successful ablation. These findings support a link between fatigue and PVC-induced increased ventricular wall stress, despite preserved LV function. © 2015 American Heart Association, Inc.

  15. Synergistic or independent impacts of low frequency of going outside the home and social isolation on functional decline: A 4-year prospective study of urban Japanese older adults.

    Science.gov (United States)

    Fujiwara, Yoshinori; Nishi, Mariko; Fukaya, Taro; Hasebe, Masami; Nonaka, Kumiko; Koike, Takashi; Suzuki, Hiroyuki; Murayama, Yoh; Saito, Masashige; Kobayashi, Erika

    2017-03-01

    Decreased frequency of going outside the home and being socially isolated are regarded as predictors of poor health. The object of the present study was to clarify whether these factors have synergistic or independent impacts on future functional decline. We examined a prospective cohort of 2427 community-dwelling persons, aged ≥65 years, who responded to the baseline mail survey in Wako City, in 2008. Participants were asked about the frequency of going outside the home, social isolation status (having contact less than once a week with anyone outside household), functional capacity (Tokyo Metropolitan Institute of Gerontology-Index of Competence), age, sex, annual income, self-rated health, depressive mood and mobility. Of 1575 persons (72.1%) who completely responded to the follow-up survey (T2) in 2012, we defined the groups as follows: group 1, not isolated and going outside the home every day (n = 897); group 2, not isolated and going outside the home less than every day (n = 311); group 3, isolated and going outside the home every day (n = 224); and group 4, isolated and going outside the home less than every day (n = 143). Multiple logistic regression analyses showed that the variables identifying group 3 for men and group 2 for women with reference to group 1 were predictors of subsequent functional decline even after adjustment for confounders (odds ratios 2.01, 1.63; 95% CI 1.20-3.38, 1.03-2.56, respectively). Social isolation regardless of going outside the home every day for men and going outside the home less than every day regardless of being not socially isolated for women might predict functional decline. Geriatr Gerontol Int 2017; 17: 500-508. © 2016 Japan Geriatrics Society.

  16. Peroxisome proliferator-activated receptors (PPARs-independent functions of fish oil on glucose and lipid metabolism in diet-induced obese mice

    Directory of Open Access Journals (Sweden)

    Wakutsu Masaki

    2010-09-01

    Full Text Available Abstract Background Fish oil is known to improve lifestyle-related diseases. These effects occur partly via activation of PPARs by the n-3 polyunsaturated fatty acids included abundantly in fish oil. We investigated fish oil functions on glucose and lipid metabolism that are both dependent on and independent of PPARs pathway. Methods Mice were fed a diet containing 30 en% beef tallow (B diet for twelve weeks to induce obesity. The mice were then divided into two groups which were fed either a B diet or a diet containing 30 en% fish oil (F diet. Each group was further divided into two groups which were administered PPARα and γ antagonists or vehicle once a day for three weeks. Results The F diet groups showed lower triglyceride levels in plasma and liver than the B diet groups, but PPARs antagonists did not affect the triglyceride levels in either diet groups. The F diet groups also showed improvement of glucose tolerance compared with the B diet groups. However, PPARs antagonists made glucose tolerance worse in the F diet group but improved it in the B diet group. Therefore, by the administration of antagonists, glucose tolerance was inversely regulated between the B and F diets, and hypolipidemic action in the plasma and liver of the F diet group was not affected. Conclusion These results suggest that fish oil decreases lipid levels in plasma and liver via PPARs pathway-independent mechanism, and that glucose tolerance is inversely regulated by PPARs antagonists under diets containing different oils.

  17. Ghrelin-induced hippocampal neurogenesis and enhancement of cognitive function are mediated independently of GH/IGF-1 axis: lessons from the spontaneous dwarf rats.

    Science.gov (United States)

    Li, Endan; Kim, Yumi; Kim, Sehee; Park, Seungjoon

    2013-01-01

    We recently have reported that ghrelin modulates adult hippocampal neurogenesis. However, there is a possibility that the action of ghrelin on hippocampal neurogenesis could be, in part, due to the ability of ghrelin to stimulate the GH/insulin-like growth factor (IGF)-1 axis, where both GH and IGF-1 infusions are known to increase hippocampal neurogenesis. To explore this possibility, we assessed the impact of ghrelin on progenitor cell proliferation and differentiation in the dentate gyrus (DG) of spontaneous dwarf rats (SDRs), a dwarf strain with a mutation of the GH gene resulting in total loss of GH. Double immunohistochemical staining revealed that Ki-67-positive progenitor cells and doublecortin (DCX)-positive neuroblasts in the DG of the SDRs expressed ghrelin receptors. We found that ghrelin treatment in the SDRs significantly increased the number of proliferating cell nuclear antigen- and BrdU-labeled cells in the DG. The number of DCX-labeled cells in the DG of ghrelin-treated SDRs was also significantly increased compared with the vehicle-treated controls. To test whether ghrelin has a direct effect on cognitive performance independently of somatotropic axis, hippocampus-dependent learning and memory were assessed using the Y-maze and novel object recognition (NOR) test in the SDRs. Ghrelin treatment for 4 weeks by subcutaneous osmotic pump significantly increased alternation rates in the Y-maze and exploration time for novel object in the NOR test compared to vehicle-treated controls. Our results indicate that ghrelin-induced adult hippocampal neurogenesis and enhancement of cognitive function are mediated independently of somatotropic axis.

  18. The relative and absolute reliability of the Functional Independence and Difficulty Scale in community-dwelling frail elderly Japanese people using long-term care insurance services.

    Science.gov (United States)

    Saito, Takashi; Izawa, Kazuhiro P; Watanabe, Shuichiro

    2017-06-01

    The newly developed Functional Independence and Difficulty Scale is a tool for assessing the performance of basic activities of daily living in terms of both independence and difficulty. The reliability of this new scale has not been assessed. The aim of this study was to examine the relative reliability and absolute reliability of the newly developed scale in community-dwelling frail elderly people in Japan. Participants were 47 community-dwelling elderly subjects (22 for assessing test-retest reliability and 25 for assessing inter-rater reliability). As relative reliability indices, intra-class correlation coefficients were used. From an absolute reliability perspective, we conducted Bland-Altman analysis and calculated the limit of agreement or minimal detectable change to determine the acceptable range of error. Intra-class correlation coefficients for test-retest and inter-rater reliability were 0.90 (P reliability was -5.2 to 1.8, representing an increase of over six points for improvement and a decrease of over two points for decline of basic activities of daily living ability. The minimal detectable change for inter-rater reliability was 3.7, indicating that a three-point difference might be existed between difference raters. The results of this study demonstrated that the FIDS appeared to be a reliable instrument for use in Japanese community-dwelling frail elderly people. While further research using a large and more diverse sample of participants is needed, our findings support the use of FIDS in clinical practice or clinical research targeting frail elderly Japanese people.

  19. Severity of unilateral spatial neglect is an independent predictor of functional outcome after acute inpatient rehabilitation in individuals with right hemispheric stroke.

    Science.gov (United States)

    Di Monaco, Marco; Schintu, Selene; Dotta, Manuela; Barba, Sonia; Tappero, Rosa; Gindri, Patrizia

    2011-08-01

    To investigate the relationship between severity of unilateral spatial neglect (USN) and functional recovery in activities of daily living after a right-hemisphere stroke. Observational study. Rehabilitation hospital in Italy. We investigated 107 of 131 inpatients with right-hemisphere stroke who were consecutively admitted to our rehabilitation hospital. Not applicable. To assess USN severity, conventional and nonconventional Behavioral Inattention Tests (BITs) were performed at admission to inpatient rehabilitation at a median of 19 days after stroke occurrence. FIM was performed both on admission to and discharge from inpatient rehabilitation to assess functional autonomy. FIM efficiency (improvement of FIM score per day of stay length) and FIM effectiveness (proportion of potential improvement achieved) were calculated. Fifty-four (50.5%) of the 107 patients were affected by USN. In these 54 patients, both conventional and nonconventional BIT scores were significantly correlated with FIM scores assessed at discharge from rehabilitation: ρ values were .385 (P=.004) and .396 (P=.003), respectively. After adjustment for 7 potential confounders, including FIM scores before rehabilitation, we found a significant positive association between either conventional or nonconventional BIT scores and FIM scores after rehabilitation (r=.276, P=.047 and r=.296, P=.033, respectively), FIM efficiency (r=.315, P=.022 and r=.307, P=.025, respectively), and FIM effectiveness (r=.371, P=.006 and r=.306, P=.026, respectively). Data support the independent prognostic role of USN severity assessed at admission to inpatient rehabilitation after a right-hemisphere stroke. Models aimed at predicting the functional outcome in stroke survivors may benefit from inclusion of USN severity. Copyright © 2011 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  20. Operative Versus Nonoperative Management of Civilian Gunshot Wounds to the Spinal Cord: Novel Use of the Functional Independence Measure for Validated Outcomes.

    Science.gov (United States)

    McCunniff, Peter T; Ramey, James S; Scott, Meredith L; Roach, Mary J; Vallier, Heather A; Moore, Timothy A; Kelly, Michael L

    2017-10-01

    Surgery for patients with gunshot wound spinal cord injury (GSCI) remains controversial. Few recent studies provide standardized follow-up and detailed functional outcomes. To our knowledge, the research we present in this study is unique in that we are the first to incorporate Functional Independence Measure (FIM) scores as an outcomes measure for neurologic recovery in patients with GSCI. Patients with GSCI were divided into surgical and nonsurgical groups. Neurologic function was measured according to the American Spinal Injury Association impairment scale and defined as either complete or incomplete injury. Outcomes were then analyzed separately for complete and incomplete GSCI groups during hospitalization and rehabilitation. Baseline admissions characteristics were similar between surgical and nonsurgical groups except for a greater median injury severity score in the nonsurgical group (34 vs. 27; P = 0.02). For complete GSCI, total length of stay (LOS) was significantly longer in the surgical group (52 vs. 42 days; P = 0.04), and no difference was observed in overall FIM scores (58 vs. 54; P = 0.7). For incomplete GSCI, rehabilitation LOS was longer (35 vs. 21; P = 0.02) and a trend towards longer total LOS was observed in the surgical group (40 vs. 32; P = 0.07). No difference was observed in overall FIM scores (61 vs. 62; P = 0.9). Surgery for patients with GSCI is associated with increased LOS and is not associated with improved FIM scores for patients with either complete or incomplete spinal cord injuries. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Effect of feeding a high-fat diet independently of caloric intake on reproductive function in diet-induced obese female rats

    Science.gov (United States)

    Hussain, Mona A.; Abogresha, Noha M.; Tamany, Dalia A.; Lotfy, Mariam

    2016-01-01

    Introduction Globally, the prevalence of overweight and obesity is increasing, predisposing females to health hazards including compromised reproductive capacity. Our objective was to investigate the effect of ad libitum, isocalorically and hypocalorically restricted high-fat diet (HFD) feeding on reproductive function in diet-induced obese female rats. Material and methods Twenty female albino Sprague Dawley rats were used; 5 rats were kept on a standard pellet animal diet to serve as a control group (A) and 15 rats were fed a HFD for 9 weeks to induce obesity. The HFD fed animals were equally divided into three groups: an ad libitum HFD group (B), an isocalorically restricted HFD group (C), and a hypocalorically restricted HFD group (D). Estrous cyclicity, hormonal levels, ovarian histopathology and caspase-3 immunoreactivity were evaluated. Results The HFD-fed rats in groups B, C and D had significant irregularity in estrous cyclicity Vs group A (p = 0.001, 0.003 and 0.034 respectively). Groups C and D had significant reduction in serum progesterone level (p = 0.006 and 0.018 Vs A). Isocaloric restriction of HFD feeding significantly increased serum LH. Groups B and C had a significant increase in caspase-3 expression in the ovary (p < 0.001). Conclusions Ad libitum HFD interfered with the normal estrous cycle and enhanced apoptosis of luteal cells in obese female rats. The HFD restriction interfered with the normal estrous cycle and caused functional insufficiency of the corpus luteum in obese female rats. These results suggest that HFD feeding determinately affects female reproductive function independently of caloric intake. PMID:27478474

  2. The responsiveness of the Lucerne ICF-based Multidisciplinary Observation Scale (LIMOS: a comparison with the Functional Independence Measure (FIM and the Barthel Index (BI

    Directory of Open Access Journals (Sweden)

    Tim Vanbellingen

    2016-09-01

    Full Text Available Background: Good responsive functional outcome measures are important to measure change in stroke patients. The aim of study was to compare the internal and external responsiveness, floor and ceiling effects of the motor, cognition & communication subscales of the Lucerne ICF-based Multidisciplinary Observation Scale (LIMOS with the motor and cognition subscales of the Functional Independence Measure (FIM, and the Barthel Index (BI, in a large cohort of stroke patients.Methods: One hundred and eighteen stroke patients participated in this study. Admission and discharge score distributions of the LIMOS motor, LIMOS cognition & communication, FIM motor and FIM cognition, and BI were analyzed based on skewness and kurtosis. Floor and ceiling effects of the scales were determined. Internal responsiveness was assessed with t-tests, effect sizes (ES and standardized response means (SRMs. External responsiveness was investigated with linear regression analyses.Results: The LIMOS motor and LIMOS cognition & communication subscales were more responsive, expressed by higher effect sizes (ES = 0.65, SRM = 1.17 and ES = 0.52, SRM = 1.17 respectively as compared with FIM motor (ES = 0.54, SRM = 0.96 and FIM cognition (ES = 0.41, SRM = 0.88, and the BI (ES = 0.41, SRM = 0.65. The LIMOS subscales showed neither floor nor ceiling effects at admission and discharge (all < 15%. In contrast, ceiling effects were found for the FIM motor (16%, FIM cognition (15% at discharge and the BI (at admission (22% and discharge (43%. LIMOS motor and LIMOS cognition & communication subscales significantly correlated (p < 0.0001 with a change in the FIM motor and FIM cognition subscales, suggesting good external responsiveness.Conclusions: We found that the LIMOS motor and LIMOS cognition & communication, which are ICF-based multidisciplinary standardized observation scales, might have the potential to better detect changes in functional outcome of stroke patients, compared to

  3. Cognitive Function in Normal-Weight, Overweight, and Obese Older Adults: An Analysis of the Advanced Cognitive Training for Independent and Vital Elderly Cohort

    Science.gov (United States)

    Kuo, Hsu-Ko; Jones, Richard N.; Milberg, William P.; Tennstedt, Sharon; Talbot, Laura; Morris, John N.; Lipsitz, Lewis A.

    2010-01-01

    OBJECTIVES To assess how elevated body mass index (BMI) affects cognitive function in elderly people. DESIGN Cross-sectional study. SETTING Data for this cross-sectional study were taken from a multicenter randomized controlled trial, the Advanced Cognitive Training for Independent and Vital Elderly trial. PARTICIPANTS The analytic sample included 2,684 normal-weight, overweight, or obese subjects aged 65 to 94. MEASUREMENTS Evaluation of cognitive abilities was performed in several domains: global cognition, memory, reasoning, and speed of processing. Cross-sectional association between body weight status and cognitive functions was analyzed using multiple linear regression. RESULTS Overweight subjects had better performance on a reasoning task (β = 0.23, standard error (SE) = 0.11, P = .04) and the Useful Field of View (UFOV) measure (β = −39.46, SE = 12.95, P = .002), a test of visuospatial speed of processing, after controlling for age, sex, race, years of education, intervention group, study site, and cardiovascular risk factors. Subjects with class I (BMI 30.0–34.9 kg/m2) and class II (BMI>35.0 kg/m2) obesity had better UFOV measure scores (β = −38.98, SE = 14.77, P = .008; β = −35.75, SE = 17.65, and P = .04, respectively) in the multivariate model than normal-weight subjects. The relationships between BMI and individual cognitive domains were nonlinear. CONCLUSION Overweight participants had better cognitive performance in terms of reasoning and visuospatial speed of processing than normal-weight participants. Obesity was associated with better performance in visuospatial speed of processing than normal weight. The relationship between BMI and cognitive function should be studied prospectively. PMID:16420204

  4. Function Modelling Of The Market And Assessing The Degree Of Similarity Between Real Properties - Dependent Or Independent Procedures In The Process Of Office Property Valuation

    Directory of Open Access Journals (Sweden)

    Barańska Anna

    2015-09-01

    Full Text Available Referring to the developed and presented in previous publications (e.g. Barańska 2011 two-stage algorithm for real estate valuation, this article addresses the problem of the relationship between the two stages of the algorithm. An essential part of the first stage is the multi-dimensional function modelling of the real estate market. As a result of selecting the model best fitted to the market data, in which the dependent variable is always the price of a real property, a set of market attributes is obtained, which in this model are considered to be price-determining. In the second stage, from the collection of real estate which served as a database in the process of estimating model parameters, the selected objects are those which are most similar to the one subject to valuation and form the basis for predicting the final value of the property being valued. Assessing the degree of similarity between real properties can be carried out based on the full spectrum of real estate attributes that potentially affect their value and which it is possible to gather information about, or only on the basis of those attributes which were considered to be price-determining in function modelling. It can also be performed by various methods. This article has examined the effect of various approaches on the final value of the property obtained using the two-stage prediction. In order fulfill the study aim precisely as possible, the results of each calculation step of the algorithm have been investigated in detail. Each of them points to the independence of the two procedures.

  5. Cultivation-Independent and Cultivation-Dependent Analysis of Microbes in the Shallow-Sea Hydrothermal System Off Kueishantao Island, Taiwan: Unmasking Heterotrophic Bacterial Diversity and Functional Capacity.

    Science.gov (United States)

    Tang, Kai; Zhang, Yao; Lin, Dan; Han, Yu; Chen, Chen-Tung A; Wang, Deli; Lin, Yu-Shih; Sun, Jia; Zheng, Qiang; Jiao, Nianzhi

    2018-01-01

    Shallow-sea hydrothermal systems experience continuous fluctuations of physicochemical conditions due to seawater influx which generates variable habitats, affecting the phylogenetic composition and metabolic potential of microbial communities. Until recently, studies of submarine hydrothermal communities have focused primarily on chemolithoautotrophic organisms, however, there have been limited studies on heterotrophic bacteria. Here, fluorescence in situ hybridization, high throughput 16S rRNA gene amplicon sequencing, and functional metagenomes were used to assess microbial communities from the shallow-sea hydrothermal system off Kueishantao Island, Taiwan. The results showed that the shallow-sea hydrothermal system harbored not only autotrophic bacteria but abundant heterotrophic bacteria. The potential for marker genes sulfur oxidation and carbon fixation were detected in the metagenome datasets, suggesting a role for sulfur and carbon cycling in the shallow-sea hydrothermal system. Furthermore, the presence of diverse genes that encode transporters, glycoside hydrolases, and peptidase indicates the genetic potential for heterotrophic utilization of organic substrates. A total of 408 cultivable heterotrophic bacteria were isolated, in which the taxonomic families typically associated with oligotrophy, copiotrophy, and phototrophy were frequently found. The cultivation-independent and -dependent analyses performed herein show that Alphaproteobacteria and Gammaproteobacteria represent the dominant heterotrophs in the investigated shallow-sea hydrothermal system. Genomic and physiological characterization of a novel strain P5 obtained in this study, belonging to the genus Rhodovulum within Alphaproteobacteria, provides an example of heterotrophic bacteria with major functional capacity presented in the metagenome datasets. Collectively, in addition to autotrophic bacteria, the shallow-sea hydrothermal system also harbors many heterotrophic bacteria with versatile

  6. Culture-dependent and culture-independent characterization of potentially functional biphenyl-degrading bacterial community in response to extracellular organic matter from Micrococcus luteus.

    Science.gov (United States)

    Su, Xiao-Mei; Liu, Yin-Dong; Hashmi, Muhammad Zaffar; Ding, Lin-Xian; Shen, Chao-Feng

    2015-05-01

    Biphenyl (BP)-degrading bacteria were identified to degrade various polychlorinated BP (PCB) congers in long-term PCB-contaminated sites. Exploring BP-degrading capability of potentially useful bacteria was performed for enhancing PCB bioremediation. In the present study, the bacterial composition of the PCB-contaminated sediment sample was first investigated. Then extracellular organic matter (EOM) from Micrococcus luteus was used to enhance BP biodegradation. The effect of the EOM on the composition of bacterial community was investigated by combining with culture-dependent and culture-independent methods. The obtained results indicate that Proteobacteria and Actinobacteria were predominant community in the PCB-contaminated sediment. EOM from M. luteus could stimulate the activity of some potentially difficult-to-culture BP degraders, which contribute to significant enhancement of BP biodegradation. The potentially difficult-to-culture bacteria in response to EOM addition were mainly Rhodococcus and Pseudomonas belonging to Gammaproteobacteria and Actinobacteria respectively. This study provides new insights into exploration of functional difficult-to-culture bacteria with EOM addition and points out broader BP/PCB degrading, which could be employed for enhancing PCB-bioremediation processes. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  7. Ptpn11 Deletion in CD4+ Cells Does Not Affect T Cell Development and Functions but Causes Cartilage Tumors in a T Cell-Independent Manner.

    Science.gov (United States)

    Miah, S M Shahjahan; Jayasuriya, Chathuraka T; Salter, Alexander I; Reilly, Emma C; Fugere, Céline; Yang, Wentian; Chen, Qian; Brossay, Laurent

    2017-01-01

    The ubiquitously expressed tyrosine phosphatase Src homology region 2 domain-containing phosphatase-2 (SHP-2, encoded by Ptpn11 ) is required for constitutive cellular processes including proliferation, differentiation, and the regulation of immune responses. During development and maturation, subsets of T cells express a variety of inhibitory receptors known to associate with phosphatases, which in turn, dephosphorylate key players of activating receptor signaling pathways. We hypothesized that SHP-2 deletion would have major effects on T cell development by altering the thresholds for activation, as well as positive and negative selection. Surprisingly, using mice conditionally deficient for SHP-2 in the T cell lineage, we show that the development of these lymphocytes is globally intact. In addition, our data demonstrate that SHP-2 absence does not compromise T cell effector functions, suggesting that SHP-2 is dispensable in these cells. Unexpectedly, in aging mice, Ptpn11 gene deletion driven by CD4 Cre recombinase leads to cartilage tumors in wrist bones in a T cell-independent manner. These tumors resemble miniature cartilaginous growth plates and contain CD4-lineage positive chondrocyte-like cells. Altogether these results indicate that SHP-2 is a cartilage tumor suppressor during aging.

  8. Ptpn11 Deletion in CD4+ Cells Does Not Affect T Cell Development and Functions but Causes Cartilage Tumors in a T Cell-Independent Manner

    Directory of Open Access Journals (Sweden)

    S. M. Shahjahan Miah

    2017-10-01

    Full Text Available The ubiquitously expressed tyrosine phosphatase Src homology region 2 domain-containing phosphatase-2 (SHP-2, encoded by Ptpn11 is required for constitutive cellular processes including proliferation, differentiation, and the regulation of immune responses. During development and maturation, subsets of T cells express a variety of inhibitory receptors known to associate with phosphatases, which in turn, dephosphorylate key players of activating receptor signaling pathways. We hypothesized that SHP-2 deletion would have major effects on T cell development by altering the thresholds for activation, as well as positive and negative selection. Surprisingly, using mice conditionally deficient for SHP-2 in the T cell lineage, we show that the development of these lymphocytes is globally intact. In addition, our data demonstrate that SHP-2 absence does not compromise T cell effector functions, suggesting that SHP-2 is dispensable in these cells. Unexpectedly, in aging mice, Ptpn11 gene deletion driven by CD4 Cre recombinase leads to cartilage tumors in wrist bones in a T cell-independent manner. These tumors resemble miniature cartilaginous growth plates and contain CD4-lineage positive chondrocyte-like cells. Altogether these results indicate that SHP-2 is a cartilage tumor suppressor during aging.

  9. Carbetocin is a Functional Selective Gq Agonist That Does Not Promote Oxytocin Receptor Recycling After Inducing β-Arrestin-Independent Internalisation.

    Science.gov (United States)

    Passoni, I; Leonzino, M; Gigliucci, V; Chini, B; Busnelli, M

    2016-04-01

    Carbetocin, a long-acting oxytocin analogue, has been reported to elicit interesting and peculiar behavioural effects. The present study investigated the molecular pharmacology of carbetocin, aiming to better understand the molecular basis of its action in the brain. Using bioluminescence resonance energy transfer biosensors, we characterised the effects of carbetocin on the three human oxytocin/vasopressin receptors expressed in the nervous system: the oxytocin receptor (OXTR) and the vasopressin V1a (V1aR) and V1b (V1bR) receptors. Our results indicate that (i) carbetocin activates the OXTR but not the V1aR and V1bR at which it may act as an antagonist; (ii) carbetocin selectively activates only the OXTR/Gq pathway displaying a strong functional selectivity; (iii) carbetocin is a partial agonist at the OXTR/Gq coupling; (iv) carbetocin promotes OXTR internalisation via a previously unreported β-arrestin-independent pathway; and (v) carbetocin does not induce OXTR recycling to the plasma membrane. Altogether, these molecular pharmacology features identify carbetocin as a substantially different analogue compared to the endogenous oxytocin and, consequently, carbetocin is not expected to mimic oxytocin in the brain. Whether these unique features of carbetocin could be exploited therapeutically remains to be established. © 2016 The Authors. Journal of Neuroendocrinology published by John Wiley & Sons Ltd on behalf of British Society for Neuroendocrinology.

  10. Tie2 signaling cooperates with TNF to promote the pro-inflammatory activation of human macrophages independently of macrophage functional phenotype.

    Science.gov (United States)

    García, Samuel; Krausz, Sarah; Ambarus, Carmen A; Fernández, Beatriz Malvar; Hartkamp, Linda M; van Es, Inge E; Hamann, Jörg; Baeten, Dominique L; Tak, Paul P; Reedquist, Kris A

    2014-01-01

    Angiopoietin (Ang) -1 and -2 and their receptor Tie2 play critical roles in regulating angiogenic processes during development, homeostasis, tumorigenesis, inflammation and tissue repair. Tie2 signaling is best characterized in endothelial cells, but a subset of human and murine circulating monocytes/macrophages essential to solid tumor formation express Tie2 and display immunosuppressive properties consistent with M2 macrophage polarization. However, we have recently shown that Tie2 is strongly activated in pro-inflammatory macrophages present in rheumatoid arthritis patient synovial tissue. Here we examined the relationship between Tie2 expression and function during human macrophage polarization. Tie2 expression was observed under all polarization conditions, but was highest in IFN-γ and IL-10 -differentiated macrophages. While TNF enhanced expression of a common restricted set of genes involved in angiogenesis and inflammation in GM-CSF, IFN-γ and IL-10 -differentiated macrophages, expression of multiple chemokines and cytokines, including CXCL3, CXCL5, CXCL8, IL6, and IL12B was further augmented in the presence of Ang-1 and Ang-2, via Tie2 activation of JAK/STAT signaling. Conditioned medium from macrophages stimulated with Ang-1 or Ang-2 in combination with TNF, sustained monocyte recruitment. Our findings suggest a general role for Tie2 in cooperatively promoting the inflammatory activation of macrophages, independently of polarization conditions.

  11. Genetic deletion of the bacterial sensor NOD2 improves murine Crohn’s disease-like ileitis independent of functional dysbiosis

    Energy Technology Data Exchange (ETDEWEB)

    Corridoni, D.; Rodriguez-Palacios, A.; Di Stefano, G.; Di Martino, L.; Antonopoulos, D. A.; Chang, E. B.; Arseneau, K. O.; Pizarro, T. T.; Cominelli, F.

    2016-11-16

    Although genetic polymorphisms in NOD2 (nucleotide-binding oligomerization domain-containing 2) have been associated with the pathogenesis of Crohn’s disease (CD), little is known regarding the role of wild-type (WT) NOD2 in the gut. To date, most murine studies addressing the role of WT Nod2 have been conducted using healthy (ileitis/colitis-free) mouse strains. Here, we evaluated the effects of Nod2 deletion in a murine model of spontaneous ileitis, i.e., the SAMP1Yit/Fc (SAMP) strain, which closely resembles CD. Remarkably, Nod2 deletion improved both chronic cobblestone ileitis (by 50% assessed, as the % of abnormal mucosa at 24 wks of age), as well as acute dextran sodium sulfate (DSS) colitis. Mechanistically, Th2 cytokine production and Th2-transcription factor activation (i.e., STAT6 phosphorylation) were reduced. Microbiologically, the effects of Nod2 deletion appeared independent of fecal microbiota composition and function, assessed by 16S rRNA and metatranscriptomics. Our findings indicate that pharmacological blockade of NOD2 signaling in humans could improve health in Th2-driven chronic intestinal inflammation.

  12. Structure of human POFUT1, its requirement in ligand-independent oncogenic Notch signaling, and functional effects of Dowling-Degos mutations

    Energy Technology Data Exchange (ETDEWEB)

    McMillan, Brian J.; Zimmerman, Brandon; Egan, Emily D.; Lofgren, Michael; Xu, Xiang; Hesser, Anthony; Blacklow, Stephen C.

    2017-03-17

    Protein O-fucosyltransferase-1 (POFUT1), which transfers fucose residues to acceptor sites on serine and threonine residues of epidermal growth factor-like repeats of recipient proteins, is essential for Notch signal transduction in mammals. Here, we examine the consequences of POFUT1 loss on the oncogenic signaling associated with certain leukemia-associated mutations of human Notch1, report the structures of human POFUT1 in free and GDP-fucose bound states, and assess the effects of Dowling-Degos mutations on human POFUT1 function. CRISPR-mediated knockout of POFUT1 in U2OS cells suppresses both normal Notch1 signaling, and the ligand-independent signaling associated with leukemogenic mutations of Notch1. Normal and oncogenic signaling are rescued by wild-type POFUT1 but rescue is impaired by an active-site R240A mutation. The overall structure of the human enzyme closely resembles that of the Caenorhabditis elegans protein, with an overall backbone RMSD of 0.93 Å, despite primary sequence identity of only 39% in the mature protein. GDP-fucose binding to the human enzyme induces limited backbone conformational movement, though the side chains of R43 and D244 reorient to make direct contact with the fucose moiety in the complex. The reported Dowling-Degos mutations of POFUT1, except for M262T, fail to rescue Notch1 signaling efficiently in the CRISPR-engineered POFUT1-/- background. Together, these studies identify POFUT1 as a potential target for cancers driven by Notch1 mutations and provide a structural roadmap for its inhibition.

  13. Validity of the stroke rehabilitation assessment of movement scale in acute rehabilitation: a comparison with the functional independence measure and stroke impact scale-16.

    Science.gov (United States)

    Ward, Irene; Pivko, Susan; Brooks, Gary; Parkin, Kate

    2011-11-01

    To demonstrate sensitivity to change of the Stroke Rehabilitation Assessment of Movement (STREAM) as well as the concurrent and predictive validity of the STREAM in an acute rehabilitation setting. Prospective cohort study. Acute, in-patient rehabilitation department within a tertiary-care teaching hospital in the United States. Thirty adults with a newly diagnosed, first ischemic stroke. Clinical assessments were conducted on admission and then again on discharge from the rehabilitation hospital with the STREAM (total STREAM and upper extremity, lower extremity, and mobility subscales), Functional Independence Measure (FIM), and Stroke Impact Scale-16 (SIS-16). Sensitivity to change was determined with the Wilcoxon signed rank test and by the calculation of standardized response means. Spearman correlations were used to assess concurrent validity of the total STREAM and STREAM subscales with the FIM and SIS-16 on admission and discharge. We determined predictive validity for all instruments by correlating admission scores with actual and predicted length of stay and by testing associations between admission scores and discharge destination (home vs subacute facility). Not applicable. For all instruments, there was statistically significant improvement from admission to discharge. The standardized response means for the total STREAM and STREAM subscales were large. Spearman correlations between the total STREAM and STREAM subscales and the FIM and SIS-16 were moderate to excellent, both on admission and discharge. Among change scores, only the SIS-16 correlated with the total STREAM. All 3 instruments were significantly associated with discharge destination; however, the associations were strongest for the total STREAM and STREAM subscales. All instruments showed moderate-to-excellent correlations with predicted and actual length of stay. The STREAM is sensitive to change and demonstrates good concurrent and predictive validity as compared with the FIM and SIS-16

  14. A Comparison between Two Instruments for Assessing Dependency in Daily Activities: Agreement of the Northwick Park Dependency Score with the Functional Independence Measure

    Directory of Open Access Journals (Sweden)

    Siv Svensson

    2012-01-01

    Full Text Available Background. There is a need for tools to assess dependency among persons with severe impairments. Objectives. The aim was to compare the Functional Independence Measure (FIM and the Northwick Park Dependency Score (NPDS, in a sample from in-patient rehabilitation. Material and Methods. Data from 115 persons (20 to 65 years of age with neurological impairments was gathered. Analyses were made of sensitivity, specificity, positive predictive value, and negative predictive value. Agreement of the scales was assessed with kappa and concordance with Goodman-Kruskal’s gamma. Scale structures were explored using the Rank-Transformable Pattern of Agreement (RTPA. Content validation was performed. Results. The sensitivity of the NPDS as compared to FIM varied between 0.53 (feeding and 1.0 (mobility and specificity between 0.64 (mobility and 1.0 (bladder. The positive predictive value varied from 0.62 (mobility to 1.0 (bladder, and the negative predictive value varied from 0.48 (bowel to 1.0 (mobility. Agreement between the scales was moderate to good (four items and excellent (three items. Concordance was good, with a gamma of −.856, an asymptotic error (ase of .025, and P<.000. The parallel reliability between the FIM and the NPDS showed a tendency for NPDS to be more sensitive (having more categories when dependency is high. Conclusion. FIM and NPDS complement each other. NPDS can be used as a measure for severely injured patients who are sensitive when there is a high need of nursing time.

  15. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    Science.gov (United States)

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  16. Independence in appearance

    DEFF Research Database (Denmark)

    Warming-Rasmussen, Bent; Quick, Reiner; Liempd, Dennis van

    2011-01-01

    In the wake of the financial crisis, the EU Commission has published a Green Paper on the future role of the audit function in Europe. The Green Paper lists a number of proposals for tighter rules for audits and auditors in order to contribute to stabilizing the financial system. The present...... article presents research contributions to the question whether the auditor is to continue to provide both audit and non-audit services (NAS) to an audit client. Research results show that this double function for the same audit client is a problem for stakeholders' confidence in auditor independence...

  17. Physical exercise and functional fitness in independently living vs institutionalized elderly women: a comparison of 60- to 79-year-old city dwellers

    Directory of Open Access Journals (Sweden)

    Furtado HL

    2015-04-01

    Full Text Available Hélio L Furtado,1 Nelson Sousa,2 Roberto Simão,3 Fabio Dutra Pereira,1 José Vilaça-Alves2 1Castelo Branco University, Rio de Janeiro, Brazil; 2Research Center for Sport, Health, and Human Development, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal; 3School of Physical Education and Sports, Rio de Janeiro Federal University, Rio de Janeiro, Brazil Purpose: To compare functional fitness (FF levels among independent-living (IL and day care (DC elderly women of different age groups and to analyze changes in FF after 8 months of participation in an exercise program intervention for the IL elderly women. Materials and methods: A total of 674 elderly women were divided into four IL groups with age in the range of 60–64 years (IL60–64, n=149, 65–69 years (IL65–69, n=138, 70–74 years (IL70–74, n=135, and 75–79 years (IL75–79, n=83, and four DC groups with age in the range of 60–64 years (DC60–64, n=35, 65–69 years (DC65–69, n=34, 70–74 years (DC70–74, n=47, and 75–79 years (DC75–79, n=53. The intervention consisted of a multimodal exercise training, 3 days per week for 8 months. Senior Fitness Test battery performances were obtained at baseline and after 8-month intervention. Results: Significant differences were identified between all IL groups and DC groups in all FF tests (P<0.001, except between IL70–74 and DC70–74 in the chair sit-and-reach. Analysis of covariance (ANCOVA identified significant improvements in all FF tests between pre- and posttests in the IL groups (P<0.001, except in the chair sit-and-reach for the IL70–74. ANCOVA also showed a significant declining performance in all FF tests for DC groups (P<0.001, except in the chair sit-and-reach for the DC70–74 and DC75–79. Conclusion: IL women are more fit than institutionalized DC elderly women. The multimodal training was effective in improving all FF components related to daily living activities, in all age groups

  18. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  19. Molecular and functional analysis of anchorage independent, treatment-evasive neuroblastoma tumorspheres with enhanced malignant properties: A possible explanation for radio-therapy resistance.

    Science.gov (United States)

    Abou-Antoun, Tamara J; Nazarian, Javad; Ghanem, Anthony; Vukmanovic, Stanislav; Sandler, Anthony D

    2018-01-01

    Despite significant advances in cancer treatment and management, more than 60% of patients with neuroblastoma present with very poor prognosis in the form of metastatic and aggressive disease. Solid tumors including neuroblastoma are thought to be heterogeneous with a sub-population of stem-like cells that are treatment-evasive with highly malignant characteristics. We previously identified a phenomenon of reversible adaptive plasticity (RAP) between anchorage dependent (AD) cells and anchorage independent (AI) tumorspheres in neuroblastoma cell cultures. To expand our molecular characterization of the AI tumorspheres, we sought to define the comprehensive proteomic profile of murine AD and AI neuroblastoma cells. The proteomic profiles of the two phenotypic cell populations were compared to each other to determine the differential protein expression and molecular pathways of interest. We report exclusive or significant up-regulation of tumorigenic pathways expressed by the AI tumorspheres compared to the AD cancer cells. These pathways govern metastatic potential, enhanced malignancy and epithelial to mesenchymal transition. Furthermore, radio-therapy induced significant up-regulation of specific tumorigenic and proliferative proteins, namely survivin, CDC2 and the enzyme Poly [ADP-ribose] polymerase 1. Bio-functional characteristics of the AI tumorspheres were resistant to sutent inhibition of receptor tyrosine kinases (RTKs) as well as to 2.5 Gy radio-therapy as assessed by cell survival, proliferation, apoptosis and migration. Interestingly, PDGF-BB stimulation of the PDGFRβ led to transactivation of EGFR and VEGFR in AI tumorspheres more potently than in AD cells. Sutent inhibition of PDGFRβ abrogated this transactivation in both cell types. In addition, 48 h sutent treatment significantly down-regulated the protein expression of PDGFRβ, MYCN, SOX2 and Survivin in the AI tumorspheres and inhibited tumorsphere self-renewal. Radio-sensitivity in AI

  20. Marked induction of the helix-loop-helix protein Id3 promotes the gammadelta T cell fate and renders their functional maturation Notch independent

    DEFF Research Database (Denmark)

    Lauritsen, Jens Peter Holst; Wong, Gladys W; Lee, Sang-Yun

    2009-01-01

    )-inhibitor of DNA binding 3 (Id3) pathway plays a defining role in this process. In particular, Id3 expression served to regulate adoption of the gammadelta fate. Moreover, Id3 was both necessary and sufficient to enable gammadelta-lineage cells to differentiate independently of Notch signaling and become competent...

  1. MEL-18 loss mediates estrogen receptor-α downregulation and hormone independence.

    Science.gov (United States)

    Lee, Jeong-Yeon; Won, Hee-Young; Park, Ji-Hye; Kim, Hye-Yeon; Choi, Hee-Joo; Shin, Dong-Hui; Kang, Ju-Hee; Woo, Jong-Kyu; Oh, Seung-Hyun; Son, Taekwon; Choi, Jin-Woo; Kim, Sehwan; Kim, Hyung-Yong; Yi, Kijong; Jang, Ki-Seok; Oh, Young-Ha; Kong, Gu

    2015-05-01

    The polycomb protein MEL-18 has been proposed as a tumor suppressor in breast cancer; however, its functional relevance to the hormonal regulation of breast cancer remains unknown. Here, we demonstrated that MEL-18 loss contributes to the hormone-independent phenotype of breast cancer by modulating hormone receptor expression. In multiple breast cancer cohorts, MEL-18 was markedly downregulated in triple-negative breast cancer (TNBC). MEL-18 expression positively correlated with the expression of luminal markers, including estrogen receptor-α (ER-α, encoded by ESR1). MEL-18 loss was also associated with poor response to antihormonal therapy in ER-α-positive breast cancer. Furthermore, whereas MEL-18 loss in luminal breast cancer cells resulted in the downregulation of expression and activity of ER-α and the progesterone receptor (PR), MEL-18 overexpression restored ER-α expression in TNBC. Consistently, in vivo xenograft experiments demonstrated that MEL-18 loss induces estrogen-independent growth and tamoxifen resistance in luminal breast cancer, and that MEL-18 overexpression confers tamoxifen sensitivity in TNBC. MEL-18 suppressed SUMOylation of the ESR1 transactivators p53 and SP1, thereby driving ESR1 transcription. MEL-18 facilitated the deSUMOylation process by inhibiting BMI-1/RING1B-mediated ubiquitin-proteasomal degradation of SUMO1/sentrin-specific protease 1 (SENP1). These findings demonstrate that MEL-18 is a SUMO-dependent regulator of hormone receptors and suggest MEL-18 expression as a marker for determining the antihormonal therapy response in patients with breast cancer.

  2. MEL-18 loss mediates estrogen receptor–α downregulation and hormone independence

    Science.gov (United States)

    Lee, Jeong-Yeon; Won, Hee-Young; Park, Ji-Hye; Kim, Hye-Yeon; Choi, Hee-Joo; Shin, Dong-Hui; Kang, Ju-Hee; Woo, Jong-Kyu; Oh, Seung-Hyun; Son, Taekwon; Choi, Jin-Woo; Kim, Sehwan; Kim, Hyung-Yong; Yi, Kijong; Jang, Ki-Seok; Oh, Young-Ha; Kong, Gu

    2015-01-01

    The polycomb protein MEL-18 has been proposed as a tumor suppressor in breast cancer; however, its functional relevance to the hormonal regulation of breast cancer remains unknown. Here, we demonstrated that MEL-18 loss contributes to the hormone-independent phenotype of breast cancer by modulating hormone receptor expression. In multiple breast cancer cohorts, MEL-18 was markedly downregulated in triple-negative breast cancer (TNBC). MEL-18 expression positively correlated with the expression of luminal markers, including estrogen receptor–α (ER-α, encoded by ESR1). MEL-18 loss was also associated with poor response to antihormonal therapy in ER-α–positive breast cancer. Furthermore, whereas MEL-18 loss in luminal breast cancer cells resulted in the downregulation of expression and activity of ER-α and the progesterone receptor (PR), MEL-18 overexpression restored ER-α expression in TNBC. Consistently, in vivo xenograft experiments demonstrated that MEL-18 loss induces estrogen-independent growth and tamoxifen resistance in luminal breast cancer, and that MEL-18 overexpression confers tamoxifen sensitivity in TNBC. MEL-18 suppressed SUMOylation of the ESR1 transactivators p53 and SP1, thereby driving ESR1 transcription. MEL-18 facilitated the deSUMOylation process by inhibiting BMI-1/RING1B-mediated ubiquitin-proteasomal degradation of SUMO1/sentrin-specific protease 1 (SENP1). These findings demonstrate that MEL-18 is a SUMO-dependent regulator of hormone receptors and suggest MEL-18 expression as a marker for determining the antihormonal therapy response in patients with breast cancer. PMID:25822021

  3. Change in body fat mass is independently associated with executive functions in older women: a secondary analysis of a 12-month randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Elizabeth Dao

    Full Text Available OBJECTIVES: To investigate the independent contribution of change in sub-total body fat and lean mass to cognitive performance, specifically the executive processes of selective attention and conflict resolution, in community-dwelling older women. METHODS: This secondary analysis included 114 women aged 65 to 75 years old. Participants were randomly allocated to once-weekly resistance training, twice-weekly resistance training, or twice-weekly balance and tone training. The primary outcome measure was the executive processes of selective attention and conflict resolution as assessed by the Stroop Test. Sub-total body fat and lean mass were measured by dual-energy x-ray absorptiometry (DXA to determine the independent association of change in both sub-total body fat and sub-total body lean mass with Stroop Test performance at trial completion. RESULTS: A multiple linear regression model showed reductions in sub-total body fat mass to be independently associated with better performance on the Stroop Test at trial completion after accounting for baseline Stroop performance, age, baseline global cognitive state, baseline number of comorbidities, baseline depression, and experimental group. The total variance explained was 39.5%; change in sub-total body fat mass explained 3.9% of the variance. Change in sub-total body lean mass was not independently associated with Stroop Test performance (P>0.05. CONCLUSION: Our findings suggest that reductions in sub-total body fat mass - not sub-total lean mass - is associated with better performance of selective attention and conflict resolution.

  4. Agent independent task planning

    Science.gov (United States)

    Davis, William S.

    1990-01-01

    Agent-Independent Planning is a technique that allows the construction of activity plans without regard to the agent that will perform them. Once generated, a plan is then validated and translated into instructions for a particular agent, whether a robot, crewmember, or software-based control system. Because Space Station Freedom (SSF) is planned for orbital operations for approximately thirty years, it will almost certainly experience numerous enhancements and upgrades, including upgrades in robotic manipulators. Agent-Independent Planning provides the capability to construct plans for SSF operations, independent of specific robotic systems, by combining techniques of object oriented modeling, nonlinear planning and temporal logic. Since a plan is validated using the physical and functional models of a particular agent, new robotic systems can be developed and integrated with existing operations in a robust manner. This technique also provides the capability to generate plans for crewmembers with varying skill levels, and later apply these same plans to more sophisticated robotic manipulators made available by evolutions in technology.

  5. An isomeric reaction benchmark set to test if the performance of state-of-the-art density functionals can be regarded as independent of the external potential.

    Science.gov (United States)

    Schwabe, Tobias

    2014-07-28

    Some representative density functionals are assessed for isomerization reactions in which heteroatoms are systematically substituted with heavier members of the same element group. By this, it is investigated if the functional performance depends on the elements involved, i.e. on the external potential imposed by the atomic nuclei. Special emphasis is placed on reliable theoretical reference data and the attempt to minimize basis set effects. Both issues are challenging for molecules including heavy elements. The data suggest that no general bias can be identified for the functionals under investigation except for one case - M11-L. Nevertheless, large deviations from the reference data can be found for all functional approximations in some cases. The average error range for the nine functionals in this test is 17.6 kcal mol(-1). These outliers depreciate the general reliability of density functional approximations.

  6. Long-term adherence to exercise: the relationship with functional fitness and personal motivation among community-dwelling independent-living older women

    Directory of Open Access Journals (Sweden)

    Philipe de Souto BarretoI

    2011-03-01

    Full Text Available OBJECTIVE: The aim of this study were to examine the relationships between functional fitness, self-esteem, aesthetic body care and long-term adherence to dance, and to identify other characteristics related to dance adherence in the elderly. METHODS: Seventeen women, aged 59-86 years-old, who practised a type of dance labeled "bodily expression". RESULTS: Functional fitness was correlated to dance adherence and was the only factor related to this variable in a linear regression analysis. Self-esteem and aesthetic body care seemed to play an indirect role on adherence. Functional fitness, specially upper-body flexibility and lower-body muscular function, and interest in dance (qualitative data were related to long-term adherence to dance. CONCLUSIONS: Functional fitness and interest in exercising were the main aspects related to participants' long-term adherence to dance.

  7. ZmCPK1, a calcium-independent kinase member of the Zea mays CDPK gene family, functions as a negative regulator in cold stress signalling.

    Science.gov (United States)

    Weckwerth, Philipp; Ehlert, Britta; Romeis, Tina

    2015-03-01

    Calcium-dependent protein kinases (CDPKs) have been shown to play important roles in plant environmental stress signal transduction. We report on the identification of ZmCPK1 as a member of the maize (Zea mays) CDPK gene family involved in the regulation of the maize cold stress response. Based upon in silico analysis of the Z. mays cv. B73 genome, we identified that the maize CDPK gene family consists of 39 members. Two CDPK members were selected whose gene expression was either increased (Zmcpk1) or decreased (Zmcpk25) in response to cold exposure. Biochemical analysis demonstrated that ZmCPK1 displays calcium-independent protein kinase activity. The C-terminal calcium-binding domain of ZmCPK1 was sufficient to mediate calcium independency of a previously calcium-dependent enzyme in chimeric ZmCPK25-CPK1 proteins. Furthermore, co-transfection of maize mesophyll protoplasts with active full-length ZmCPK1 suppressed the expression of a cold-induced marker gene, Zmerf3 (ZmCOI6.21). In accordance, heterologous overexpression of ZmCPK1 in Arabidopsis thaliana yielded plants with altered acclimation-induced frost tolerance. Our results identify ZmCPK1 as a negative regulator of cold stress signalling in maize. © 2014 John Wiley & Sons Ltd.

  8. Neuromuscular adaptations predict functional disability independently of clinical pain and psychological factors in patients with chronic non-specific low back pain.

    Science.gov (United States)

    Dubois, Jean-Daniel; Abboud, Jacques; St-Pierre, Charles; Piché, Mathieu; Descarreaux, Martin

    2014-08-01

    Patients with chronic low back pain exhibit characteristics such as clinical pain, psychological symptoms and neuromuscular adaptations. The purpose of this study was to determine the independent contribution of clinical pain, psychological factors and neuromuscular adaptations to disability in patients with chronic low back pain. Clinical pain intensity, pain catastrophizing, fear-avoidance beliefs, anxiety, neuromuscular adaptations to chronic pain and neuromuscular responses to experimental pain were assessed in 52 patients with chronic low back pain. Lumbar muscle electromyographic activity was assessed during a flexion-extension task (flexion relaxation phenomenon) to assess both chronic neuromuscular adaptations and neuromuscular responses to experimental pain during the task. Multiple regressions showed that independent predictors of disability included neuromuscular adaptations to chronic pain (β=0.25, p=0.006, sr(2)=0.06), neuromuscular responses to experimental pain (β=-0.24, p=0.011, sr(2)=0.05), clinical pain intensity (β=0.28, p=0.002, sr(2)=0.08) and psychological factors (β=0.58, ppain intensity and psychological factors, and contribute to inter-individual differences in patients' disability. This suggests that disability, in chronic low back pain patients, is determined by a combination of factors, including clinical pain, psychological factors and neuromuscular adaptations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. A study of depression, perceived loneliness, cognitive function and independence in daily activities in home and institution based older people: A cross sectional comparative study

    Directory of Open Access Journals (Sweden)

    Riddhi Desai

    2016-01-01

    Full Text Available Context: Old age homes are on the rise in India. Older people staying in such institutions have specific psychosocial issues that may affect their cognitive performance and daily living. Materials and Methods: 71 older people, 39 institution based and 32 community-based were recruited with serial sampling after screening on mini-mental state examination and were evaluated with geriatric depression scale, University of California, Los Angeles scale, Lawton′s instrumental activities of daily living scale and montreal cognitive assessment scale. Results: Prevalence of depression was significantly higher in older people who were institution based, widowers and females. The severity of perceived loneliness was higher in females, institution based and depressed older people. The severity of depression correlated with independence in daily activities, cognition, and perceived loneliness only in institution based older people. Discussion: Older people in institutions have a higher psychosocial burden than the community-based older people. Family support prevents the attrition effect of depression on cognition and independence in daily activities in the community-based older people.

  10. Defining and Selecting Independent Directors

    Directory of Open Access Journals (Sweden)

    Eric Pichet

    2017-10-01

    Full Text Available Drawing from the Enlightened Shareholder Theory that the author first developed in 2011, this theoretical paper with practical and normative ambitions achieves a better definition of independent director, while improving the understanding of the roles he fulfils on boards of directors. The first part defines constructs like firms, Governance system and Corporate governance, offering a clear distinction between the latter two concepts before explaining the four main missions of a board. The second part defines the ideal independent director by outlining the objective qualities that are necessary and adding those subjective aspects that have turned this into a veritable profession. The third part defines the ideal process for selecting independent directors, based on nominating committees that should themselves be independent. It also includes ways of assessing directors who are currently in function, as well as modalities for renewing their mandates. The paper’s conclusion presents the Paradox of the Independent Director.

  11. Impaired self-reflection in psychiatric disorders among adults: a proposal for the existence of a network of semi independent functions.

    Science.gov (United States)

    Dimaggio, Giancarlo; Vanheule, Stijn; Lysaker, Paul H; Carcione, Antonino; Nicolò, Giuseppe

    2009-09-01

    Self-reflection plays a key role in healthy human adaptation. Self-reflection might involve different capacities which may be impaired to different degrees relatively independently of one another. Variation in abilities for different forms of self-reflection are commonly seen as key aspects of many adult mental disorders. Yet little has been written about whether there are different kinds of deficits in self-reflection found in mental illness, how those deficits should be distinguished from one another and how to characterize the extent to which they are interrelated. We review clinical and experimental literature and suggest four different forms of deficits in self-reflection: (a) sense of ownership of one's own thoughts and actions, (b) emotional awareness, (c) distinction between fantasy and reality and (d) the integration of a range of different views of oneself and others. We propose how these different impairments in self-reflection are linked with one another.

  12. Kidney transplantation improves arterial function measured by pulse wave analysis and endothelium-independent dilatation in uraemic patients despite deterioration of glucose metabolism

    DEFF Research Database (Denmark)

    Hornum, Mads; Clausen, Peter; Idorn, Thomas

    2011-01-01

    for kidney transplantation (uraemic control group, age 47 ± 11 years). Arterial function was estimated by the pulse wave velocity (PWV) of the carotid-femoral pulse wave, aortic augmentation index (AIX), flow-mediated (FMD) and nitroglycerin-induced vasodilatation (NID) of the brachial artery performed......BACKGROUND: The aim of this study is to investigate the effect of kidney transplantation on arterial function in relation to changes in glucose metabolism. METHODS: Included were 40 kidney recipients (Tx group, age 38 ± 13 years) and 40 patients without known diabetes remaining on the waiting list...... before transplantation and after 12 months. PWV recorded sequentially at the carotid and femoral artery is an estimate of arterial stiffness; AIX is an integrated index of vascular and ventricular function. FMD and NID are the dilatory capacities of the brachial artery after increased flow (endothelium...

  13. Independence and Product Systems

    OpenAIRE

    Skeide, Michael

    2003-01-01

    Starting from elementary considerations about independence and Markov processes in classical probability we arrive at the new concept of conditional monotone independence (or operator-valued monotone independence). With the help of product systems of Hilbert modules we show that monotone conditional independence arises naturally in dilation theory.

  14. In the yeast Hansenula polymorpha, peroxisome formation from the ER is independent of Pex19p, but involves the function of p24 proteins

    NARCIS (Netherlands)

    Otzen, Marleen; Krikken, Arjen M; Ozimek, Paulina Z; Kurbatova, Elena; Nagotu, Shirisha; Veenhuis, Marten; van der Klei, Ida J

    2006-01-01

    The peroxin Pex19p is important for the formation of functional peroxisomal membranes. Here we show that Hansenula polymorpha Pex19p is also required for peroxisome inheritance. Peroxisome inheritance is partly defective when Pex19p farnesylation is blocked, whereas deletion of PEX19 resulted in a

  15. Elevation of IL-6 in the allergic asthmatic airway is independent of inflammation but associates with loss of central airway function

    Directory of Open Access Journals (Sweden)

    Bunn Janice Y

    2010-03-01

    Full Text Available Abstract Background Asthma is a chronic inflammatory disease of the airway that is characterized by a Th2-type of immune response with increasing evidence for involvement of Th17 cells. The role of IL-6 in promoting effector T cell subsets suggest that IL-6 may play a functional role in asthma. Classically IL-6 has been viewed as an inflammatory marker, along with TNFα and IL-1β, rather than as regulatory cytokine. Objective To investigate the potential relationship between IL-6 and other proinflammatory cytokines, Th2/Th17 cytokines and lung function in allergic asthma, and thus evaluate the potential role of IL-6 in this disease. Methods Cytokine levels in induced sputum and lung function were measured in 16 healthy control and 18 mild-moderate allergic asthmatic subjects. Results The levels of the proinflammatory biomarkers TNFα and IL-1β were not different between the control and asthmatic group. In contrast, IL-6 levels were specifically elevated in asthmatic subjects compared with healthy controls (p S = 0.53, p Conclusions In mild-moderate asthma, IL-6 dissociates from other proinflammatory biomarkers, but correlates with IL-13 levels. Furthermore, IL-6 may contribute to impaired lung function in allergic asthma.

  16. Left ventricular dyssynchrony assessed by gated SPECT phase analysis is an independent predictor of death in patients with advanced coronary artery disease and reduced left ventricular function not undergoing cardiac resynchronization therapy

    Energy Technology Data Exchange (ETDEWEB)

    Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)

    2012-10-15

    Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)

  17. Autonomy, Independence, Inclusion

    Directory of Open Access Journals (Sweden)

    Filippo Angelucci

    2015-04-01

    Full Text Available The living environment must not only meet the primary needs of living, but also the expectations of improvement of life and social relations and people’s work. The need for a living environment that responds to the needs of users with their different abilities, outside of standardizations, is increasingly felt as autonomy, independence and well-being are the result of real usability and adaptability of the spaces. The project to improve the inclusivity of living space and to promote the rehabilitation of fragile users need to be characterized as an interdisciplinary process in which the integration of specialized contributions leads to adaptive customization of space solutions and technological that evolve with the changing needs, functional capacities and abilities of individuals.

  18. DNA methylation affects the lifespan of honey bee (Apis mellifera L.) workers - Evidence for a regulatory module that involves vitellogenin expression but is independent of juvenile hormone function.

    Science.gov (United States)

    Cardoso-Júnior, Carlos A M; Guidugli-Lazzarini, Karina R; Hartfelder, Klaus

    2018-01-01

    The canonic regulatory module for lifespan of honey bee (Apis mellifera) workers involves a mutual repressor relationship between juvenile hormone (JH) and vitellogenin (Vg). Compared to vertebrates, however, little is known about a possible role of epigenetic factors. The full genomic repertoire of DNA methyltransferases (DNMTs) makes the honey bee an attractive emergent model for studying the role of epigenetics in the aging process of invertebrates, and especially so in social insects. We first quantified the transcript levels of the four DNMTs encoding genes in the head thorax and abdomens of workers of different age, showing that dnmt1a and dnmt3 expression is up-regulated in abdomens of old workers, whereas dnmt1b and dnmt2 are down-regulated in heads of old workers. Pharmacological genome demethylation by RG108 treatment caused an increase in worker lifespan. Next, we showed that the genomic DNA methylation status indirectly affects vitellogenin gene expression both in vitro and in vivo in young workers, and that this occurs independent of caloric restriction or JH levels, suggesting that a non-canonical circuitry may be acting in parallel with the JH/Vg module to regulate the adult life cycle of honey bee workers. Our data provide evidence that epigenetic factors play a role in regulatory networks associated with complex life history traits of a social insect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Identification of independent association signals and putative functional variants for breast cancer risk through fine-scale mapping of the 12p11 locus

    DEFF Research Database (Denmark)

    Zeng, Chenjie; Guo, Xingyi; Long, Jirong

    2016-01-01

    BACKGROUND: Multiple recent genome-wide association studies (GWAS) have identified a single nucleotide polymorphism (SNP), rs10771399, at 12p11 that is associated with breast cancer risk. METHOD: We performed a fine-scale mapping study of a 700 kb region including 441 genotyped and more than 1300...... Asians, but none of the associations were statistically significant in African descendants. Multiple candidate functional variants are located in putative enhancer sequences. Chromatin interaction data suggested that PTHLH was the likely target gene of these enhancers. Of the six variants...... with the strongest evidence of potential functionality, rs11049453 was statistically significantly associated with the expression of PTHLH and its nearby gene CCDC91 at P 

  20. Functional Independence and Interdependence of the Src Homology Domains of Phospholipase C-γ1 in B-Cell Receptor Signal Transduction

    Science.gov (United States)

    DeBell, Karen E.; Stoica, Bogdan A.; Verí, Maria-Concetta; Di Baldassarre, Angela; Miscia, Sebastiano; Graham, Laurie J.; Rellahan, Barbara L.; Ishiai, Masamichi; Kurosaki, Tomohiro; Bonvini, Ezio

    1999-01-01

    B-cell receptor (BCR)-induced activation of phospholipase C-γ1 (PLCγ1) and PLCγ2 is crucial for B-cell function. While several signaling molecules have been implicated in PLCγ activation, the mechanism coupling PLCγ to the BCR remains undefined. The role of PLCγ1 SH2 and SH3 domains at different steps of BCR-induced PLCγ1 activation was examined by reconstitution in a PLCγ-negative B-cell line. PLCγ1 membrane translocation required a functional SH2 N-terminal [SH2(N)] domain, was decreased by mutation of the SH3 domain, but was unaffected by mutation of the SH2(C) domain. Tyrosine phosphorylation did not require the SH2(C) or SH3 domains but depended exclusively on a functional SH2(N) domain, which mediated the association of PLCγ1 with the adapter protein, BLNK. Forcing PLCγ1 to the membrane via a myristoylation signal did not bypass the SH2(N) domain requirement for phosphorylation, indicating that the phosphorylation mediated by this domain is not due to membrane anchoring alone. Mutation of the SH2(N) or the SH2(C) domain abrogated BCR-stimulated phosphoinositide hydrolysis and signaling events, while mutation of the SH3 domain partially decreased signaling. PLCγ1 SH domains, therefore, have interrelated but distinct roles in BCR-induced PLCγ1 activation. PMID:10523627

  1. Relationship between sports experience and executive function in 6-12-year-old children: independence from physical fitness and moderation by gender.

    Science.gov (United States)

    Ishihara, Toru; Sugasawa, Shigemi; Matsuda, Yusuke; Mizuno, Masao

    2018-05-01

    The purpose of this study was to evaluate the relationship between sports experience (i.e., tennis experience) and executive function in children while controlling for physical activity and physical fitness. Sixty-eight participants (6-12 years old, 34 males and 34 females) were enrolled in regular tennis lessons (mean = 2.4 years, range = 0.1-7.3 years) prior to the study. Executive functions, including inhibitory control (the Stroop Color-Word Test), working memory (the 2-back Task), and cognitive flexibility (the Local-global Task) were evaluated. Participants' levels of daily physical activity, ranging from moderate to vigorous, were evaluated using triaxial accelerometers. The total score for physical fitness was assessed using the Tennis Field Test. Hierarchical multiple regression analyses revealed interaction effects between gender and tennis experience on participants' reaction time (RT) on the switch cost of the Local-global Task after controlling for age, BMI, gender, physical activity, physical fitness, and tennis experience. Longer tennis experience was associated with shorter switch cost in males but not in females. Higher scores on physical fitness were positively associated with lower interference scores on the Stroop Color-Word Test, RT on the 2-back Task, and RT in the switching condition of the Local-global Task, after controlling for age, BMI, gender, and physical activity. In conclusion, all three foundational components of executive function (i.e., inhibitory control, working memory, and cognitive flexibility) were more strongly related to physical fitness than to physical activity in males and females, whereas greater cognitive flexibility was related to tennis experience only in the males. © 2017 John Wiley & Sons Ltd.

  2. Use of Two-Body Correlated Basis Functions with van der Waals Interaction to Study the Shape-Independent Approximation for a Large Number of Trapped Interacting Bosons

    Science.gov (United States)

    Lekala, M. L.; Chakrabarti, B.; Das, T. K.; Rampho, G. J.; Sofianos, S. A.; Adam, R. M.; Haldar, S. K.

    2017-05-01

    We study the ground-state and the low-lying excitations of a trapped Bose gas in an isotropic harmonic potential for very small (˜ 3) to very large (˜ 10^7) particle numbers. We use the two-body correlated basis functions and the shape-dependent van der Waals interaction in our many-body calculations. We present an exhaustive study of the effect of inter-atomic correlations and the accuracy of the mean-field equations considering a wide range of particle numbers. We calculate the ground-state energy and the one-body density for different values of the van der Waals parameter C6. We compare our results with those of the modified Gross-Pitaevskii results, the correlated Hartree hypernetted-chain equations (which also utilize the two-body correlated basis functions), as well as of the diffusion Monte Carlo for hard sphere interactions. We observe the effect of the attractive tail of the van der Waals potential in the calculations of the one-body density over the truly repulsive zero-range potential as used in the Gross-Pitaevskii equation and discuss the finite-size effects. We also present the low-lying collective excitations which are well described by a hydrodynamic model in the large particle limit.

  3. Independent and Combined Association of Muscle Strength and Cardiorespiratory Fitness in Youth With Insulin Resistance and β-Cell Function in Young Adulthood

    DEFF Research Database (Denmark)

    Grøntved, Anders; Ried-Larsen, Mathias; Ekelund, Ulf

    2013-01-01

    ergometer test. Insulin resistance (homeostasis model assessment of insulin resistance [HOMA-IR]) and β-cell function (homeostasis model assessment of β-cell function [HOMA-B]) were estimated from fasting serum insulin and glucose that were obtained in youth and at follow-up in young adulthood.......RESULTSFor each 1-SD difference in isometric muscle strength (0.16 N/kg) in youth, fasting insulin, HOMA-IR, and HOMA-B in young adulthood changed with -11.3% (95% CI, -17.0 to -5.2), -12.2% (-18.2 to -5.7), and -8.9% (-14.4 to -3.0), respectively, in young adulthood after adjustment for CRF and personal...... lifestyle and demographic factors. Results for CRF were very similar in magnitude, and the magnitude of associations for both exposures was unchanged with additional adjustment for general or abdominal adiposity in youth. Combined associations of muscle strength and CRF with fasting insulin, HOMA-IR...

  4. ACE inhibition with spirapril improves diastolic function at rest independent of vasodilation during treatment with spirapril in mild to moderate hypertension

    DEFF Research Database (Denmark)

    Petersen, J R; Drabaek, H; Fornitz, Gitte Gleerup

    1996-01-01

    mass), and Doppler-derived atrial to early (A/E)-ratio velocity time integrals (VTI) were measured at the end of each of the four periods. Spirapril lowered the A/E-ratio VTIs (0.57, 0.12-1.00) (P ....44-1.25), and the drug normalized the A/E-ratio VTI in those patients with elevated values. The hemodynamic variables, left ventricular mass, and end-systolic wall stress were unchanged during all three treatments. There were no significant changes in mean blood pressure during the treatment periods. These results...... indicate that spirapril lowers A/E ratio within four weeks in patients with mild to moderate essential hypertension. It thereby seems able to improve left ventricular diastolic function. The effect is not dependent upon changes in hemodynamic variables, blood pressure, left ventricular mass, or end...

  5. ACE inhibition with spirapril improves diastolic function at rest independent of vasodilation during treatment with spirapril in mild to moderate hypertension

    DEFF Research Database (Denmark)

    Petersen, J R; Drabaek, H; Gleerup, Christian Peter-Ole G.

    1996-01-01

    the patients entered three periods lasting four weeks each, wherein they were treated with placebo, spirapril, or hydrochlorothiazide. Blood pressure, hemodynamic variables (stroke volume, heart rate, cardiac output, index of contractility, and systemic vascular resistance), echocardiography (left ventricular...... mass), and Doppler-derived atrial to early (A/E)-ratio velocity time integrals (VTI) were measured at the end of each of the four periods. Spirapril lowered the A/E-ratio VTIs (0.57, 0.12-1.00) (P ... indicate that spirapril lowers A/E ratio within four weeks in patients with mild to moderate essential hypertension. It thereby seems able to improve left ventricular diastolic function. The effect is not dependent upon changes in hemodynamic variables, blood pressure, left ventricular mass, or end...

  6. Tiotropium improves lung function, exacerbation rate, and asthma control, independent of baseline characteristics including age, degree of airway obstruction, and allergic status

    DEFF Research Database (Denmark)

    Kerstjens, Huib A M; Moroni-Zentgraf, Petra; Tashkin, Donald P

    2016-01-01

    performed in parallel in patients with severe symptomatic asthma. Exploratory subgroup analyses of peak forced expiratory volume in 1 s (FEV1), trough FEV1, time to first severe exacerbation, time to first episode of asthma worsening, and seven-question Asthma Control Questionnaire responder rate were......BACKGROUND: Many patients with asthma remain symptomatic despite treatment with inhaled corticosteroids (ICS) with or without long-acting β2-agonists (LABAs). Tiotropium add-on to ICS plus a LABA has been shown to improve lung function and reduce exacerbation risk in patients with symptomatic...... asthma. OBJECTIVE: To determine whether the efficacy of tiotropium add-on therapy is dependent on patients' baseline characteristics. METHODS: Two randomized, double-blind, parallel-group, twin trials (NCT00772538 and NCT00776984) of once-daily tiotropium Respimat(®) 5 μg add-on to ICS plus a LABA were...

  7. LH-21 and abnormal cannabidiol improve β-cell function in isolated human and mouse islets through GPR55-dependent and -independent signalling.

    Science.gov (United States)

    Ruz-Maldonado, Inmaculada; Pingitore, Attilio; Liu, Bo; Atanes, Patricio; Huang, Guo Cai; Baker, David; Alonso, Francisco José; Bermúdez-Silva, Francisco Javier; Persaud, Shanta J

    2018-04-01

    To examine the effects of Abn-CBD (GPR55 agonist) and LH-21 (CB1 antagonist) on human and mouse islet function, and to determine signalling via GPR55 using islets from GPR55 -/- mice. Islets isolated from human organ donors and mice were incubated in the absence or presence of Abn-CBD or LH-21, and insulin secretion, [Ca 2+ ] i, cAMP , apoptosis, β-cell proliferation and CREB and AKT phosphorylation were examined using standard techniques. Abn-CBD potentiated glucose-stimulated insulin secretion and elevated [Ca 2+ ] i in human islets and islets from both GPR55 +/+ and GPR55 -/- mice. LH-21 also increased insulin secretion and [Ca 2+ ] i in human islets and GPR55 +/+ mouse islets, but concentrations of LH-21 up to 0.1 μM were ineffective in islets from GPR55 -/- mice. Neither ligand affected basal insulin secretion or islet cAMP levels. Abn-CBD and LH-21 reduced cytokine-induced apoptosis in human islets and GPR55 +/+ mouse islets, and these effects were suppressed after GPR55 deletion. They also increased β-cell proliferation: the effects of Abn-CBD were preserved in islets from GPR55 -/- mice, while those of LH-21 were abolished. Abn-CBD and LH-21 increased AKT phosphorylation in mouse and human islets. This study showed that Abn-CBD and LH-21 improve human and mouse islet β-cell function and viability. Use of islets from GPR55 -/- mice suggests that designation of Abn-CBD and LH-21 as a GPR55 agonist and a CB1 antagonist, should be revised. © 2017 John Wiley & Sons Ltd.

  8. Gestational Diabetes Mellitus Worsens the Profile of Cardiometabolic Risk Markers and Decrease Indexes of Beta-Cell Function Independently of Insulin Resistance in Nondiabetic Women with a Parental History of Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Alina Sokup

    2014-01-01

    Full Text Available Background. Women with a history of both parental type 2 diabetes (pt2DM and previous gestational diabetes (pGDM represent a group at high risk of cardiovascular events. We hypothesized that pGDM changes cardiometabolic risk markers levels as well as theirs associations with glucose indices in nondiabetic pt2DM women. Methods. Anthropometric parameters, glucose regulation (OGTT, insulin resistance (HOMA-IR, beta-cell function, lipid levels, parameters of endothelial dysfunction, and inflammation were evaluated in 55 women with pt2DM, 40 with both pt2DM and pGDM 2–24 months postpartum, and 35 controls. Results. Prediabetes was diagnosed more frequently in women with both pt2DM and pGDM in comparison with women with only pt2DM (10 versus 8, P=0.04. The pGDM group had higher LDL-cholesterol, sICAM-1, tPa Ag, fibrinogen, and lower beta-cell function after adjustment for HOMA-IR, in comparison with pt2DM group. In pt2DM group postchallenge glucose correlated independently with hsCRP and in pGDM group fasting glucose with HOMA-IR. Conclusions. pGDM exerts a combined effect on cardiometabolic risk markers in women with pt2DM. In these women higher LDL-cholesterol, fibrinogen, sICAM-1, tPa Ag levels and decreased beta cell function are associated with pGDM independently of HOMA-IR index value. Fasting glucose is an important cardiometabolic risk marker and is independently associated with HOMA-IR.

  9. Commonwealth of (Independent States

    Directory of Open Access Journals (Sweden)

    Vrućinić Dušan

    2013-01-01

    Full Text Available Following the stages from the establishment itself to the present day of the functioning of such a specific regional organization as the Commonwealth of Independent States (CIS, the article seeks to further explain the meaning of its existence, efficiency and functioning. The CIS was created in order to make the dissolution of a major world super-power, which throughout the 20th century together with the USA defined the bipolar world, as painless as possible, especially for the new countries and its nationally and ethnically diverse population. During the early years after the dissolution of the USSR, the CIS played a major role in a more flexible and less severe dissolution of the Soviet empire, alleviating the consequences for its people. A more efficient functioning among the republics in all fields was also one of the tasks of the Commonwealth, to which it was devoted to the extent which was permitted by the then, not too favourable circumstances. Difficult years of economic crisis did not allow the CIS to mutually integrate its members as much as possible on the economy level. Thanks to the economic recovery of the post-Soviet states in the early 21st century, the Commonwealth has also been transformed, reformed, and renewed, and all this in order to achieve better and more fruitful cooperation between the members. The CIS may serve as a proper example of how the former Soviet Union states are inextricably linked by social, security-political, economic, cultural, communication-transport, and other ties, thanks to the centuries-long existence of the peoples of these states in this area, despite both internal and external factors which occasionally, but temporarily halt the post-Soviet integration. Mathematically expressed, the CIS members are naturally predisposed, to be reciprocally depended on each other, just as they also have the capacity for successful cooperation in the future times and epochs brought on by the modern world.

  10. Central Bank independence

    Directory of Open Access Journals (Sweden)

    Vasile DEDU

    2012-08-01

    Full Text Available In this paper we present the key aspects regarding central bank’s independence. Most economists consider that the factor which positively influences the efficiency of monetary policy measures is the high independence of the central bank. We determined that the National Bank of Romania (NBR has a high degree of independence. NBR has both goal and instrument independence. We also consider that the hike of NBR’s independence played an important role in the significant disinflation process, as headline inflation dropped inside the targeted band of 3% ± 1 percentage point recently.

  11. S1P1 receptor modulation preserves vascular function in mesenteric and coronary arteries after CPB in the rat independent of depletion of lymphocytes.

    Directory of Open Access Journals (Sweden)

    Iryna V Samarska

    Full Text Available BACKGROUND: Cardiopulmonary bypass (CPB may induce systemic inflammation and vascular dysfunction. Sphingosine 1-phosphate (S1P modulates various vascular and immune responses. Here we explored whether agonists of the S1P receptors, FTY720 and SEW2871 improve vascular reactivity after CPB in the rat. METHODS: Experiments were done in male Wistar rats (total n = 127. Anesthesia was induced by isoflurane (2.5-3% and maintained by fentanyl and midazolam during CPB. After catheterization of the left femoral artery, carotid artery and the right atrium, normothermic extracorporeal circulation was instituted for 60 minutes. In the first part of the study animals were euthanized after either 1 hour, 1 day, 2 or 5 days of the recovery period. In second part of the study animals were euthanized after 1 day of postoperative period. We evaluated the contractile response to phenylephrine (mesenteric arteries or to serotonin (coronary artery and vasodilatory response to acethylcholine (both arteries. RESULTS: Contractile responses to phenylephrine were reduced at 1 day recovery after CPB and Sham as compared to healthy control animals (Emax, mN: 7.9 ± 1.9, 6.5 ± 1.5, and 11.3 ± 1.3, respectively. Mainly FTY720, but not SEW2871, caused lymphopenia in both Sham and CPB groups. In coronary and mesenteric arteries, both FTY720 and SEW2871 normalized serotonin and phenylephrine-mediated vascular reactivity after CPB (p<0.05 and FTY720 increased relaxation to acetylcholine as compared with untreated rats that underwent CPB. CONCLUSION: Pretreatment with FTY720 or SEW2871 preserves vascular function in mesenteric and coronary artery after CPB. Therefore, pharmacological activation of S1P1 receptors may provide a promising therapeutic intervention to prevent CPB-related vascular dysfunction in patients.

  12. Zeaxanthin Has Enhanced Antioxidant Capacity with Respect to All Other Xanthophylls in Arabidopsis Leaves and Functions Independent of Binding to PSII Antennae1[C][W

    Science.gov (United States)

    Havaux, Michel; Dall'Osto, Luca; Bassi, Roberto

    2007-01-01

    The ch1 mutant of Arabidopsis (Arabidopsis thaliana) lacks chlorophyll (Chl) b. Leaves of this mutant are devoid of photosystem II (PSII) Chl-protein antenna complexes and have a very low capacity of nonphotochemical quenching (NPQ) of Chl fluorescence. Lhcb5 was the only PSII antenna protein that accumulated to a significant level in ch1 mutant leaves, but the apoprotein did not assemble in vivo with Chls to form a functional antenna. The abundance of Lhca proteins was also reduced to approximately 20% of the wild-type level. ch1 was crossed with various xanthophyll mutants to analyze the antioxidant activity of carotenoids unbound to PSII antenna. Suppression of zeaxanthin by crossing ch1 with npq1 resulted in oxidative stress in high light, while removing other xanthophylls or the PSII protein PsbS had no such effect. The tocopherol-deficient ch1 vte1 double mutant was as sensitive to high light as ch1 npq1, and the triple mutant ch1 npq1 vte1 exhibited an extreme sensitivity to photooxidative stress, indicating that zeaxanthin and tocopherols have cumulative effects. Conversely, constitutive accumulation of zeaxanthin in the ch1 npq2 double mutant led to an increased phototolerance relative to ch1. Comparison of ch1 npq2 with another zeaxanthin-accumulating mutant (ch1 lut2) that lacks lutein suggests that protection of polyunsaturated lipids by zeaxanthin is enhanced when lutein is also present. During photooxidative stress, α-tocopherol noticeably decreased in ch1 npq1 and increased in ch1 npq2 relative to ch1, suggesting protection of vitamin E by high zeaxanthin levels. Our results indicate that the antioxidant activity of zeaxanthin, distinct from NPQ, can occur in the absence of PSII light-harvesting complexes. The capacity of zeaxanthin to protect thylakoid membrane lipids is comparable to that of vitamin E but noticeably higher than that of all other xanthophylls of Arabidopsis leaves. PMID:17932304

  13. Zeaxanthin has enhanced antioxidant capacity with respect to all other xanthophylls in Arabidopsis leaves and functions independent of binding to PSII antennae.

    Science.gov (United States)

    Havaux, Michel; Dall'osto, Luca; Bassi, Roberto

    2007-12-01

    The ch1 mutant of Arabidopsis (Arabidopsis thaliana) lacks chlorophyll (Chl) b. Leaves of this mutant are devoid of photosystem II (PSII) Chl-protein antenna complexes and have a very low capacity of nonphotochemical quenching (NPQ) of Chl fluorescence. Lhcb5 was the only PSII antenna protein that accumulated to a significant level in ch1 mutant leaves, but the apoprotein did not assemble in vivo with Chls to form a functional antenna. The abundance of Lhca proteins was also reduced to approximately 20% of the wild-type level. ch1 was crossed with various xanthophyll mutants to analyze the antioxidant activity of carotenoids unbound to PSII antenna. Suppression of zeaxanthin by crossing ch1 with npq1 resulted in oxidative stress in high light, while removing other xanthophylls or the PSII protein PsbS had no such effect. The tocopherol-deficient ch1 vte1 double mutant was as sensitive to high light as ch1 npq1, and the triple mutant ch1 npq1 vte1 exhibited an extreme sensitivity to photooxidative stress, indicating that zeaxanthin and tocopherols have cumulative effects. Conversely, constitutive accumulation of zeaxanthin in the ch1 npq2 double mutant led to an increased phototolerance relative to ch1. Comparison of ch1 npq2 with another zeaxanthin-accumulating mutant (ch1 lut2) that lacks lutein suggests that protection of polyunsaturated lipids by zeaxanthin is enhanced when lutein is also present. During photooxidative stress, alpha-tocopherol noticeably decreased in ch1 npq1 and increased in ch1 npq2 relative to ch1, suggesting protection of vitamin E by high zeaxanthin levels. Our results indicate that the antioxidant activity of zeaxanthin, distinct from NPQ, can occur in the absence of PSII light-harvesting complexes. The capacity of zeaxanthin to protect thylakoid membrane lipids is comparable to that of vitamin E but noticeably higher than that of all other xanthophylls of Arabidopsis leaves.

  14. Organizing Independent Student Work

    Directory of Open Access Journals (Sweden)

    Zhadyra T. Zhumasheva

    2015-03-01

    Full Text Available This article addresses issues in organizing independent student work. The author defines the term “independence”, discusses the concepts of independent learner work and independent learner work under the guidance of an instructor, proposes a classification of assignments to be done independently, and provides methodological recommendations as to the organization of independent student work. The article discusses the need for turning the student from a passive consumer of knowledge into an active creator of it, capable of formulating a problem, analyzing the ways of solving it, coming up with an optimum outcome, and proving its correctness. The preparation of highly qualified human resources is the primary condition for boosting Kazakhstan’s competitiveness. Independent student work is a means of fostering the professional competence of future specialists. The primary form of self-education is independent work.

  15. Transfer functions for solid-solution partitioning of cadmium, copper, nickel, lead and zinc in soils. Derivation of relationships for free metal ion activities and validation with independent data

    Energy Technology Data Exchange (ETDEWEB)

    Groenenberg, J.E.; Roemkens, P.F.A.M.; De Vries, W. [Soil Science Centre, Wageningen University and Research Centre, P.O. Box 47, 6700 AA Wageningen (Netherlands); Comans, R.N.J. [Energy Research Centre of the Netherlands, P.O. Box 1, 1755 ZG Petten (Netherlands); Luster, J. [Research Unit Soil Sciences, Swiss Federal Institute for Forest, Snow and Landscape Research, Zuercherstrasse 111 CH-8903 Birmensdorf (Switzerland); Pampura, T. [Laboratory of Physical Chemistry of Soils, Institute of Physicochemical and Biological Problems in Soil Science RAS, Pushchino, Moscow Region, 142290 (Russian Federation); Shotbolt, L. [Department of Geography, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom); Tipping, E. [Centre for Ecology & Hydrology, Lancaster Environment Centre, Library Avenue, Bailrigg, Lancaster, LA1 4AP (United Kingdom)

    2010-07-01

    Models to predict the solid-solution partitioning of trace metals are important tools in risk assessment, providing information on the biological availability of metals and their leaching. Empirically based models, or transfer functions, published to date differ with respect to the mathematical model used, the optimization method, the methods used to determine metal concentrations in the solid and solution phases and the soil properties accounted for. Here we review these methodological aspects before deriving our own transfer functions that relate free metal ion activities to reactive metal contents in the solid phase. One single function was able to predict free-metal ion activities estimated by a variety of soil solution extraction methods. Evaluation of the mathematical formulation showed that transfer functions derived to optimize the Freundlich adsorption constant (Kf ), in contrast to functions derived to optimize either the solid or solution concentration, were most suitable for predicting concentrations in solution from solid phase concentrations and vice versa. The model was shown to be generally applicable on the basis of a large number of independent data, for which predicted free metal activities were within one order of magnitude of the observations. The model only over-estimated free-metal ion activities at alkaline pH (>7). The use of the reactive metal content measured by 0.43 m HNO3 rather than the total metal content resulted in a close correlation with measured data, particularly for nickel and zinc.

  16. On the k-independence required by linear probing and minwise independence

    DEFF Research Database (Denmark)

    Pǎtraşcu, Mihai; Thorup, Mikkel

    2016-01-01

    We show that linear probing requires 5-independent hash functions for expected constant-time performance, matching an upper bound of Pagh et al. [2009]. More precisely, we construct a random 4-independent hash function yielding expected logarithmic search time for certain keys. For (1 + ε......)-approximate minwise independence, we show that Ω(lg1 ε)-independent hash functions are required, matching an upper bound of Indyk [2001]. We also show that the very fast 2-independent multiply-shift scheme of Dietzfelbinger [1996] fails badly in both applications....

  17. Efeitos da natação sobre a independência funcional de pacientes com lesão medular Efectos de la natación sobre la independencia funcional de pacientes con lesión medular Effects of swimming on the functional independence of patients with spinal cord injury

    Directory of Open Access Journals (Sweden)

    Maurício Corte Real da Silva

    2005-08-01

    puntaje total. CONCLUSIÓN: La actividad de natación fue efectiva en la mejora de la condición física, trayendo beneficios motores sobre las habilidades funcionales de los participantes del grupo experimental.FUNDAMENTS AND OBJECTIVE: Sports play an important role in the physical rehabilitation of patients with spinal cord injury by broadening the therapeutic alternatives in addition to providing functional independence. The objective of this study is to determining the effects of swimming on the functional capacity of patients with spinal cord injury. METHODS: 16 patients with spinal cord injury were divided into two groups: experimental and control. The assessment of both groups was performed using the Functional Independence Measure (FIM scale before and after the trial, which consisted of swimming sessions performed twice a week during a period of four months. RESULTS: Both groups demonstrated noticeable gains related to body care, transference, overall and motor scores, even though the experimental group presented greater gains in transference, overall motor score and overall score. CONCLUSION: The swimming activity was effective in improving their physical condition, bringing motor benefits on the functional capacity of participants from the experimental group.

  18. NKG2D performs two functions in invariant NKT cells: direct TCR-independent activation of NK-like cytolysis and co-stimulation of activation by CD1d.

    Science.gov (United States)

    Kuylenstierna, Carlotta; Björkström, Niklas K; Andersson, Sofia K; Sahlström, Peter; Bosnjak, Lidija; Paquin-Proulx, Dominic; Malmberg, Karl-Johan; Ljunggren, Hans-Gustaf; Moll, Markus; Sandberg, Johan K

    2011-07-01

    Invariant NKT cells are important in the activation and regulation of immune responses. They can also function as CD1d-restricted killer cells. However, the role of activating innate NK-cell receptors expressed on NKT cells in triggering cytolytic function is poorly characterized. Here, we initially confirmed that the cellular stress-ligand receptor NKG2D is expressed on CD4- NKT cells, whereas most CD4+ NKT cells lack this receptor. Interestingly, NKG2D+ NKT cells frequently expressed perforin, and both NKG2D and perforin localized at the site of contact with NKG2D ligand-expressing target cells. CD4- NKT cells degranulated in response to NKG2D engagement in a redirected activation assay independent of stimulation via their invariant TCR. NKT cells killed P815 cells coated with anti-NKG2D mAb and CD1d-negative K562 tumor target cells in an NKG2D-dependent manner. Furthermore, NKG2D engagement co-stimulated TCR-mediated NKT-cell activation in response to endogenous CD1d-presented ligands or suboptimal levels of anti-CD3 triggering. These data indicate that the CD4- subset of human NKT cells can mediate direct lysis of target cells via NKG2D engagement independent of CD1d, and that NKG2D also functions as a co-stimulatory receptor in these cells. NKG2D thus plays both a direct and a co-stimulatory role in the activation of NKT cells. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Empirical validation of the triple-code model of numerical processing for complex math operations using functional MRI and group Independent Component Analysis of the mental addition and subtraction of fractions.

    Science.gov (United States)

    Schmithorst, Vincent J; Brown, Rhonda Douglas

    2004-07-01

    The suitability of a previously hypothesized triple-code model of numerical processing, involving analog magnitude, auditory verbal, and visual Arabic codes of representation, was investigated for the complex mathematical task of the mental addition and subtraction of fractions. Functional magnetic resonance imaging (fMRI) data from 15 normal adult subjects were processed using exploratory group Independent Component Analysis (ICA). Separate task-related components were found with activation in bilateral inferior parietal, left perisylvian, and ventral occipitotemporal areas. These results support the hypothesized triple-code model corresponding to the activated regions found in the individual components and indicate that the triple-code model may be a suitable framework for analyzing the neuropsychological bases of the performance of complex mathematical tasks. Copyright 2004 Elsevier Inc.

  20. Spatial imagery relies on a sensory independent, though sensory sensitive, functional organization within the parietal cortex: a fMRI study of angle discrimination in sighted and congenitally blind individuals.

    Science.gov (United States)

    Bonino, Daniela; Ricciardi, Emiliano; Bernardi, Giulio; Sani, Lorenzo; Gentili, Claudio; Vecchi, Tomaso; Pietrini, Pietro

    2015-02-01

    Although vision offers distinctive information to space representation, individuals who lack vision since birth often show perceptual and representational skills comparable to those found in sighted individuals. However, congenitally blind individuals may result in impaired spatial analysis, when engaging in 'visual' spatial features (e.g., perspective or angle representation) or complex spatial mental abilities. In the present study, we measured behavioral and brain responses using functional magnetic resonance imaging in sighted and congenitally blind individuals during spatial imagery based on a modified version of the mental clock task (e.g., angle discrimination) and a simple recognition control condition, as conveyed across distinct sensory modalities: visual (sighted individuals only), tactile and auditory. Blind individuals were significantly less accurate during the auditory task, but comparable-to-sighted during the tactile task. As expected, both groups showed common neural activations in intraparietal and superior parietal regions across visual and non-visual spatial perception and imagery conditions, indicating the more abstract, sensory independent functional organization of these cortical areas, a property that we named supramodality. At the same time, however, comparisons in brain responses and functional connectivity patterns across experimental conditions demonstrated also a functional lateralization, in a way that correlated with the distinct behavioral performance in blind and sighted individuals. Specifically, blind individuals relied more on right parietal regions, mainly in the tactile and less in the auditory spatial processing. In sighted, spatial representation across modalities relied more on left parietal regions. In conclusions, intraparietal and superior parietal regions subserve supramodal spatial representations in sighted and congenitally blind individuals. Differences in their recruitment across non-visual spatial processing in

  1. An architecture for device independent interfacing

    International Nuclear Information System (INIS)

    Pace, D.M.

    1990-01-01

    Achieving device independence for software applications is required for all but a small number of critical real time applications. Device independence is achieved by establishing protocols and building protocol interpreters for the specific devices. Data structures containing pointers to functions provide a flexible architecture for implementing protocol translation. 3 refs., 5 figs

  2. Convulxin, a C-type lectin-like protein, inhibits HCASMCs functions via WAD-motif/integrin-αv interaction and NF-κB-independent gene suppression of GRO and IL-8

    Energy Technology Data Exchange (ETDEWEB)

    Shih, Chun-Ho; Chiang, Tin-Bin [Chang Gung University of Science and Technology, Guishan Dist., Taoyuan City, Taiwan (China); Wang, Wen-Jeng, E-mail: wjwang@mail.cgust.edu.tw [Chang Gung University of Science and Technology, Guishan Dist., Taoyuan City, Taiwan (China); Department of Neurological Surgery, Chang Gung Memorial Hospital, Guishan Dist., Taoyuan City, Taiwan (China)

    2017-03-15

    Convulxin (CVX), a C-type lectin-like protein (CLPs), is a potent platelet aggregation inducer. To evaluate its potential applications in angiogenic diseases, the multimeric CVX were further explored on its mode of actions toward human coronary artery smooth muscle cells (HCASMCs). The N-terminus of β-chain of CVX (CVX-β) contains a putative disintegrin-like domain with a conserved motif upon the sequence comparison with other CLPs. Importantly, native CVX had no cytotoxic activity as examined by electrophoretic pattern. A Trp-Ala–Asp (WAD)-containing octapeptide, MTWADAEK, was thereafter synthesized and analyzed in functional assays. In the case of specific integrin antagonists as positive controls, the anti-angiogenic effects of CVX on HCASMCs were investigated by series of functional analyses. CVX showed to exhibit multiple inhibitory activities toward HCASMCs proliferation, adhesion and invasion with a dose- and integrin αvβ3-dependent fashion. However, the WAD-octapeptide exerting a minor potency could also work as an active peptidomimetic. In addition, flow cytometric analysis demonstrated both the intact CVX and synthetic peptide can specifically interact with integrin-αv on HCASMCs and CVX was shown to have a down-regulatory effect on the gene expression of CXC-chemokines, such as growth-related oncogene and interleukin-8. According to nuclear factor-κB (NF-κB) p65 translocation assay and Western blotting analysis, the NF-κB activation was not involved in the signaling events of CVX-induced gene expression. In conclusion, CVX may act as a disintegrin-like protein via the interactions of WAD-motif in CVX-β with integrin-αv on HCASMCs and it also is a gene suppressor with the ability to diminish the expression of two CXC-chemokines in a NF-κB-independent manner. Indeed, more extensive investigations are needed and might create a new avenue for the development of a novel angiostatic agent. - Highlights: • The tetrameric convulxin (CVX) with WAD

  3. Convulxin, a C-type lectin-like protein, inhibits HCASMCs functions via WAD-motif/integrin-αv interaction and NF-κB-independent gene suppression of GRO and IL-8

    International Nuclear Information System (INIS)

    Shih, Chun-Ho; Chiang, Tin-Bin; Wang, Wen-Jeng

    2017-01-01

    Convulxin (CVX), a C-type lectin-like protein (CLPs), is a potent platelet aggregation inducer. To evaluate its potential applications in angiogenic diseases, the multimeric CVX were further explored on its mode of actions toward human coronary artery smooth muscle cells (HCASMCs). The N-terminus of β-chain of CVX (CVX-β) contains a putative disintegrin-like domain with a conserved motif upon the sequence comparison with other CLPs. Importantly, native CVX had no cytotoxic activity as examined by electrophoretic pattern. A Trp-Ala–Asp (WAD)-containing octapeptide, MTWADAEK, was thereafter synthesized and analyzed in functional assays. In the case of specific integrin antagonists as positive controls, the anti-angiogenic effects of CVX on HCASMCs were investigated by series of functional analyses. CVX showed to exhibit multiple inhibitory activities toward HCASMCs proliferation, adhesion and invasion with a dose- and integrin αvβ3-dependent fashion. However, the WAD-octapeptide exerting a minor potency could also work as an active peptidomimetic. In addition, flow cytometric analysis demonstrated both the intact CVX and synthetic peptide can specifically interact with integrin-αv on HCASMCs and CVX was shown to have a down-regulatory effect on the gene expression of CXC-chemokines, such as growth-related oncogene and interleukin-8. According to nuclear factor-κB (NF-κB) p65 translocation assay and Western blotting analysis, the NF-κB activation was not involved in the signaling events of CVX-induced gene expression. In conclusion, CVX may act as a disintegrin-like protein via the interactions of WAD-motif in CVX-β with integrin-αv on HCASMCs and it also is a gene suppressor with the ability to diminish the expression of two CXC-chemokines in a NF-κB-independent manner. Indeed, more extensive investigations are needed and might create a new avenue for the development of a novel angiostatic agent. - Highlights: • The tetrameric convulxin (CVX) with WAD

  4. Independent technical review, handbook

    International Nuclear Information System (INIS)

    1994-02-01

    Purpose Provide an independent engineering review of the major projects being funded by the Department of Energy, Office of Environmental Restoration and Waste Management. The independent engineering review will address questions of whether the engineering practice is sufficiently developed to a point where a major project can be executed without significant technical problems. The independent review will focus on questions related to: (1) Adequacy of development of the technical base of understanding; (2) Status of development and availability of technology among the various alternatives; (3) Status and availability of the industrial infrastructure to support project design, equipment fabrication, facility construction, and process and program/project operation; (4) Adequacy of the design effort to provide a sound foundation to support execution of project; (5) Ability of the organization to fully integrate the system, and direct, manage, and control the execution of a complex major project

  5. Independent technical review, handbook

    Energy Technology Data Exchange (ETDEWEB)

    1994-02-01

    Purpose Provide an independent engineering review of the major projects being funded by the Department of Energy, Office of Environmental Restoration and Waste Management. The independent engineering review will address questions of whether the engineering practice is sufficiently developed to a point where a major project can be executed without significant technical problems. The independent review will focus on questions related to: (1) Adequacy of development of the technical base of understanding; (2) Status of development and availability of technology among the various alternatives; (3) Status and availability of the industrial infrastructure to support project design, equipment fabrication, facility construction, and process and program/project operation; (4) Adequacy of the design effort to provide a sound foundation to support execution of project; (5) Ability of the organization to fully integrate the system, and direct, manage, and control the execution of a complex major project.

  6. O envelhecimento ativo sob o olhar de idosos funcionalmente independentes El envejecimiento activo bajo la visión de ancianos funcionalmente independientes Active aging from the perspective of aged individuals who are functionally independent

    Directory of Open Access Journals (Sweden)

    Olívia Galvão Lucena Ferreira

    2010-12-01

    -structured interviews were performed with 100 functionally independent aged individuals from João Pessoa, Paraíba, Brazil. The data was organized and analyzed using Alceste software. Results showed that the aged individuals' statements about active aging are permeated with positive contents. However, when aging is not associated with the word active, it is still represented as losses and disabilities. Despite the existence of losses during the process, active aging should be encouraged among the elderly, as it means living a quality, plentiful life. Maintaining the elderly functionally independent is the first step to achieving active aging and thus improving their quality of life.

  7. Model-Independent Diffs

    DEFF Research Database (Denmark)

    Könemann, Patrick

    just contain a list of strings, one for each line, whereas the structure of models is defined by their meta models. There are tools available which are able to compute the diff between two models, e.g. RSA or EMF Compare. However, their diff is not model-independent, i.e. it refers to the models...

  8. All Those Independent Variables.

    Science.gov (United States)

    Meacham, Merle L.

    This paper presents a case study of a sixth grade remedial math class which illustrates the thesis that only the "experimental attitude," not the "experimental method," is appropriate in the classroom. The thesis is based on the fact that too many independent variables exist in a classroom situation to allow precise measurement. The case study…

  9. Bayesian Independent Component Analysis

    DEFF Research Database (Denmark)

    Winther, Ole; Petersen, Kaare Brandt

    2007-01-01

    In this paper we present an empirical Bayesian framework for independent component analysis. The framework provides estimates of the sources, the mixing matrix and the noise parameters, and is flexible with respect to choice of source prior and the number of sources and sensors. Inside the engine...

  10. Independent safety organization

    International Nuclear Information System (INIS)

    Kato, W.Y.; Weinstock, E.V.; Carew, J.F.; Cerbone, R.J.; Guppy, J.G.; Hall, R.E.; Taylor, J.H.

    1985-01-01

    Brookhaven National Laboratory has conducted a study on the need and feasibility of an independent organization to investigate significant safety events for the Office for Analysis and Evaluation of Operational Data, USNRC. The study consists of three parts: the need for an independent organization to investigate significant safety events, alternative organizations to conduct investigations, and legislative requirements. The determination of need was investigated by reviewing current NRC investigation practices, comparing aviation and nuclear industry practices, and interviewing a spectrum of representatives from the nuclear industry, the regulatory agency, and the public sector. The advantages and disadvantages of alternative independent organizations were studied, namely, an Office of Nuclear Safety headed by a director reporting to the Executive Director for Operations (EDO) of NRC; an Office of Nuclear Safety headed by a director reporting to the NRC Commissioners; a multi-member NTSB-type Nuclear Safety Board independent of the NRC. The costs associated with operating a Nuclear Safety Board were also included in the study. The legislative requirements, both new authority and changes to the existing NRC legislative authority, were studied. 134 references

  11. Securing financial independence in the legal basis of a central bank

    NARCIS (Netherlands)

    F. Amtenbrink (Fabian)

    2005-01-01

    textabstractTogether with institutional, functional and organizational independence, financial independence constitutes one of the cornerstones of central bank independence, the economic ratio of which has been demonstrated extensively in the literature. In broad terms financial independence may be

  12. Reduction of 99mTc-sestamibi and 99mTc-tetrofosmin uptake in MRP-expressing breast cancer cells under hypoxic conditions is independent of MRP function

    International Nuclear Information System (INIS)

    Kinuya, Seigo; Li, Xiao-Feng; Yokoyama, Kunihiko; Michigishi, Takatoshi; Tonami, Norihisa; Mori, Hirofumi; Shiba, Kazuhiro; Watanabe, Naoto; Shuke, Noriyuki; Bunko, Hisashi

    2003-01-01

    Hypoxia reduces the uptake of technetium-99m sestamibi (MIBI) in human cancer cell lines. In the current investigation, we attempted to identify the relationship between hypoxia-induced alteration of 99m Tc-MIBI accumulation and expression of multi-drug resistance-associated protein (MRP) in the MCF7/WT breast cancer cell line and its subclonal cell line, MCF7/VP, which expresses high levels of MRP1. A second cationic compound, 99m Tc-tetrofosmin (TF), was also examined. Cellular uptake of 99m Tc-MIBI and 99m Tc-TF was significantly higher in parental MCF7/WT cells than in MCF7/VP cells. Hypoxic conditions generated with a mixture of 95% N 2 and 5% CO 2 reduced cellular uptake of the two tracers in both parental MCF7/WT cells and MRP1-expressing MCF7/VP cells. Cell binding assay with iodine-125-labelled anti-MRP1 antibody demonstrated its specific binding to MCF7/VP cells. Hypoxia did not affect the amount of antibody bound to MCF7/VP cells. These results indicate that hypoxia-induced reduction of tracer uptake in tumour cells is a phenomenon independent of MRP function. (orig.)

  13. Type D personality is a predictor of poor emotional quality of life in primary care heart failure patients independent of depressive symptoms and New York Heart Association functional class.

    Science.gov (United States)

    Pedersen, Susanne S; Herrmann-Lingen, Christoph; de Jonge, Peter; Scherer, Martin

    2010-02-01

    Quality of life is an important patient-centered outcome and predictor of mortality in heart failure, but little is known about the role of personality as a determinant of quality of life in this patient group. We examined the influence of Type D personality (i.e., increased negative emotions paired with emotional non-expression) on quality of life in primary care heart failure patients, using a prospective study design. Heart failure patients (n = 251) recruited from 44 primary care practices in Germany completed standardized questionnaires at baseline and 9 months. The prevalence of Type D was 31.9%. Type D patients experienced poorer emotional (P emotional (P = .78) nor physical quality of life (P = .74) over time; neither the interaction for time by Type D for emotional (P = .31) nor physical quality of life (P = .91) was significant, indicating that Type D exerted a stable effect on quality of life over time. Adjusting for demographics, New York Heart Association functional class, and depressive symptoms, Type D remained an independent determinant of emotional (P = .03) but not physical quality of life (P = .29). Primary care heart failure patients with a Type D personality experienced poorer emotional but not physical quality of life compared to non-Type D patients. Patients with this personality profile should be identified in primary care to see if their treatment is optimal, as both Type D and poor quality of life have been associated with increased morbidity and mortality.

  14. (Independência funcional na dependente relação de homens tetraplégicos com seus (insubstituíveis pais/cuidadores (Independencia funcional en la relación dependiente de hombres cuadripléjicos con sus (insustituibles padres/cuidadores Functional (independence in the dependent relationship of quadriplegic men with their (unreplaceable parents/caregivers

    Directory of Open Access Journals (Sweden)

    Wiliam César Alves Machado

    2010-03-01

    del discapacitado; tecnología de apoyo: soporte tecnológico para optimizar la calidad de los cuidados; miedos; futuro incierto y pérdida de los padres: los umbrales y las fragilidades humanas; y ganancias funcionales: respuestas objetivas de las funciones corporales. Se concluyó en que el apoyo familiar y, en particular, la presencia de los padres, son fundamentales para enfrentar las limitaciones y reaccionar en la búsqueda de equilibrios en la deficiencia, incapacidad, desventajas y salud de tales pacientes, preparándolos para alcanzar en forma gradual mejoras funcionales e independencia para realizar actividades diarias y ocuparse del autocuidado.The objective of this study was to identify elements of the international classification of functioning, disability and health, applicable to quadriplegic men's home care, to reduce the dependence on their parents' help for activities of daily living and self-care. Data were collected from June 2004 to March 2005. Semi-structured interviews were performed with eight adults with high spinal cord lesions who were being cared for at home . Content analysis was performed based on the categories of meaning extrapolated and the following themes were discovered : family support: safety for the corporal functions of the disabled; supporting technology: inventiveness to promote quality care; fears, uncertain future and parents' loss: thresholds and human fragilities; and functional gains: objective response of body functions. In conclusion, family support, and especially the presence of parents, is fundamental to facing limitations and to reacting in the search for balance with the deficiency, disability, disadvantage and health of that population, preparing them to achieve gradual functional gain and independence for daily activities and self-care.

  15. Quantum independent increment processes

    CERN Document Server

    Franz, Uwe

    2005-01-01

    This volume is the first of two volumes containing the revised and completed notes lectures given at the school "Quantum Independent Increment Processes: Structure and Applications to Physics". This school was held at the Alfried-Krupp-Wissenschaftskolleg in Greifswald during the period March 9 – 22, 2003, and supported by the Volkswagen Foundation. The school gave an introduction to current research on quantum independent increment processes aimed at graduate students and non-specialists working in classical and quantum probability, operator algebras, and mathematical physics. The present first volume contains the following lectures: "Lévy Processes in Euclidean Spaces and Groups" by David Applebaum, "Locally Compact Quantum Groups" by Johan Kustermans, "Quantum Stochastic Analysis" by J. Martin Lindsay, and "Dilations, Cocycles and Product Systems" by B.V. Rajarama Bhat.

  16. Quantum independent increment processes

    CERN Document Server

    Franz, Uwe

    2006-01-01

    This is the second of two volumes containing the revised and completed notes of lectures given at the school "Quantum Independent Increment Processes: Structure and Applications to Physics". This school was held at the Alfried-Krupp-Wissenschaftskolleg in Greifswald in March, 2003, and supported by the Volkswagen Foundation. The school gave an introduction to current research on quantum independent increment processes aimed at graduate students and non-specialists working in classical and quantum probability, operator algebras, and mathematical physics. The present second volume contains the following lectures: "Random Walks on Finite Quantum Groups" by Uwe Franz and Rolf Gohm, "Quantum Markov Processes and Applications in Physics" by Burkhard Kümmerer, Classical and Free Infinite Divisibility and Lévy Processes" by Ole E. Barndorff-Nielsen, Steen Thorbjornsen, and "Lévy Processes on Quantum Groups and Dual Groups" by Uwe Franz.

  17. Independent random sampling methods

    CERN Document Server

    Martino, Luca; Míguez, Joaquín

    2018-01-01

    This book systematically addresses the design and analysis of efficient techniques for independent random sampling. Both general-purpose approaches, which can be used to generate samples from arbitrary probability distributions, and tailored techniques, designed to efficiently address common real-world practical problems, are introduced and discussed in detail. In turn, the monograph presents fundamental results and methodologies in the field, elaborating and developing them into the latest techniques. The theory and methods are illustrated with a varied collection of examples, which are discussed in detail in the text and supplemented with ready-to-run computer code. The main problem addressed in the book is how to generate independent random samples from an arbitrary probability distribution with the weakest possible constraints or assumptions in a form suitable for practical implementation. The authors review the fundamental results and methods in the field, address the latest methods, and emphasize the li...

  18. International exploration by independents

    International Nuclear Information System (INIS)

    Bertagne, R.G.

    1991-01-01

    Recent industry trends indicate that the smaller US independents are looking at foreign exploration opportunities as one of the alternatives for growth in the new age of exploration. It is usually accepted that foreign finding costs per barrel are substantially lower than domestic because of the large reserve potential of international plays. To get involved overseas requires, however, an adaptation to different cultural, financial, legal, operational, and political conditions. Generally foreign exploration proceeds at a slower pace than domestic because concessions are granted by the government, or are explored in partnership with the national oil company. First, a mid- to long-term strategy, tailored to the goals and the financial capabilities of the company, must be prepared; it must be followed by an ongoing evaluation of quality prospects in various sedimentary basins, and a careful planning and conduct of the operations. To successfully explore overseas also requires the presence on the team of a minimum number of explorationists and engineers thoroughly familiar with the various exploratory and operational aspects of foreign work, having had a considerable amount of onsite experience in various geographical and climatic environments. Independents that are best suited for foreign expansion are those that have been financially successful domestically, and have a good discovery track record. When properly approached foreign exploration is well within the reach of smaller US independents and presents essentially no greater risk than domestic exploration; the reward, however, can be much larger and can catapult the company into the big leagues

  19. International exploration by independent

    International Nuclear Information System (INIS)

    Bertragne, R.G.

    1992-01-01

    Recent industry trends indicate that the smaller U.S. independents are looking at foreign exploration opportunities as one of the alternatives for growth in the new age of exploration. Foreign finding costs per barrel usually are accepted to be substantially lower than domestic costs because of the large reserve potential of international plays. To get involved in overseas exploration, however, requires the explorationist to adapt to different cultural, financial, legal, operational, and political conditions. Generally, foreign exploration proceeds at a slower pace than domestic exploration because concessions are granted by a country's government, or are explored in partnership with a national oil company. First, the explorationist must prepare a mid- to long-term strategy, tailored to the goals and the financial capabilities of the company; next, is an ongoing evaluation of quality prospects in various sedimentary basins, and careful planning and conduct of the operations. To successfully explore overseas also requires the presence of a minimum number of explorationists and engineers thoroughly familiar with the various exploratory and operational aspects of foreign work. Ideally, these team members will have had a considerable amount of on-site experience in various countries and climates. Independents best suited for foreign expansion are those who have been financially successful in domestic exploration. When properly approached, foreign exploration is well within the reach of smaller U.S. independents, and presents essentially no greater risk than domestic exploration; however, the reward can be much larger and can catapult the company into the 'big leagues.'

  20. International exploration by independents

    International Nuclear Information System (INIS)

    Bertagne, R.G.

    1992-01-01

    Recent industry trends indicate that the smaller U.S. independents are looking at foreign exploration opportunities as one of the alternatives for growth in the new age of exploration. The problems of communications and logistics caused by different cultures and by geographic distances must be carefully evaluated. A mid-term to long-term strategy tailored to the goals and the financial capabilities of the company should be prepared and followed by a careful planning of the operations. This paper addresses some aspects of foreign exploration that should be considered before an independent venture into the foreign field. It also provides some guidelines for conducting successful overseas operations. When properly assessed, foreign exploration is well within the reach of smaller U.S. independents and presents no greater risk than domestic exploration; the rewards, however, can be much larger. Furthermore, the Oil and Gas Journal surveys of the 300 largest U.S. petroleum companies show that companies with a consistent foreign exploration policy have fared better financially during difficult times

  1. Quantum background independence in string theory

    International Nuclear Information System (INIS)

    Witten, E.

    1994-01-01

    Not only in physical string theories, but also in some highly simplified situations, background independence has been difficult to understand. It is argued that the ''holomorphic anomaly'' of Bershadsky, Cecotti, Ooguri and Vafa gives a fundamental explanation of some of the problems. Moreover, their anomaly equation can be interpreted in terms of a rather peculiar quantum version of background independence: in systems afflicted by the anomaly, background independence does not hold order by order in perturbation theory, but the exact partition function as a function of the coupling constants has a background independent interpretation as a state in an auxiliary quantum Hilbert space. The significance of this auxiliary space is otherwise unknown. (author). 23 refs

  2. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    Science.gov (United States)

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at

  3. Cav1.2 channel current block by the PKA inhibitor H-89 in rat tail artery myocytes via a PKA-independent mechanism: Electrophysiological, functional, and molecular docking studies.

    Science.gov (United States)

    Fusi, Fabio; Trezza, Alfonso; Spiga, Ottavia; Sgaragli, Giampietro; Bova, Sergio

    2017-09-15

    To characterize the role of cAMP-dependent protein kinase (PKA) in regulating vascular Ca 2+ current through Ca v 1.2 channels [I Ca1.2 ], we have documented a marked capacity of the isoquinoline H-89, widely used as a PKA inhibitor, to reduce current amplitude. We hypothesized that the I Ca1.2 inhibitory activity of H-89 was mediated by mechanisms unrelated to PKA inhibition. To support this, an in-depth analysis of H-89 vascular effects on both I Ca1.2 and contractility was undertaken by performing whole-cell patch-clamp recordings and functional experiments in rat tail main artery single myocytes and rings, respectively. H-89 inhibited I Ca1.2 with a pIC 50 (M) value of about 5.5, even under conditions where PKA activity was either abolished by both the PKA antagonists KT5720 and protein kinase inhibitor fragment 6-22 amide or enhanced by the PKA stimulators 6-Bnz-cAMP and 8-Br-cAMP. Inhibition of I Ca1.2 by H-89 appeared almost irreversible upon washout, was charge carrier- and voltage-dependent, and antagonised by the Ca v 1.2 channel agonist (S)-(-)-Bay K 8644. H-89 did not alter both potency and efficacy of verapamil, did not affect current kinetics or voltage-dependent activation, while shifting to the left the 50% voltage of inactivation in a concentration-dependent manner. H-89 docked at the α 1C subunit in a pocket region close to that of (S)-(-)-Bay K 8644 docking, forming a hydrogen bond with the same, key amino acid residue Tyr-1489. Finally, both high K + - and (S)-(-)-Bay K 8644-induced contractions of rings were fully reverted by H-89. In conclusion, these results indicate that H-89 inhibited vascular I Ca1.2 and, consequently, the contractile function through a PKA-independent mechanism. Therefore, caution is recommended when interpreting experiments where H-89 is used to inhibit vascular smooth muscle PKA. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Convulxin, a C-type lectin-like protein, inhibits HCASMCs functions via WAD-motif/integrin-αv interaction and NF-κB-independent gene suppression of GRO and IL-8.

    Science.gov (United States)

    Shih, Chun-Ho; Chiang, Tin-Bin; Wang, Wen-Jeng

    2017-03-15

    Convulxin (CVX), a C-type lectin-like protein (CLPs), is a potent platelet aggregation inducer. To evaluate its potential applications in angiogenic diseases, the multimeric CVX were further explored on its mode of actions toward human coronary artery smooth muscle cells (HCASMCs). The N-terminus of β-chain of CVX (CVX-β) contains a putative disintegrin-like domain with a conserved motif upon the sequence comparison with other CLPs. Importantly, native CVX had no cytotoxic activity as examined by electrophoretic pattern. A Trp-Ala-Asp (WAD)-containing octapeptide, MTWADAEK, was thereafter synthesized and analyzed in functional assays. In the case of specific integrin antagonists as positive controls, the anti-angiogenic effects of CVX on HCASMCs were investigated by series of functional analyses. CVX showed to exhibit multiple inhibitory activities toward HCASMCs proliferation, adhesion and invasion with a dose- and integrin αvβ3-dependent fashion. However, the WAD-octapeptide exerting a minor potency could also work as an active peptidomimetic. In addition, flow cytometric analysis demonstrated both the intact CVX and synthetic peptide can specifically interact with integrin-αv on HCASMCs and CVX was shown to have a down-regulatory effect on the gene expression of CXC-chemokines, such as growth-related oncogene and interleukin-8. According to nuclear factor-κB (NF-κB) p65 translocation assay and Western blotting analysis, the NF-κB activation was not involved in the signaling events of CVX-induced gene expression. In conclusion, CVX may act as a disintegrin-like protein via the interactions of WAD-motif in CVX-β with integrin-αv on HCASMCs and it also is a gene suppressor with the ability to diminish the expression of two CXC-chemokines in a NF-κB-independent manner. Indeed, more extensive investigations are needed and might create a new avenue for the development of a novel angiostatic agent. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Hardware independence checkout software

    Science.gov (United States)

    Cameron, Barry W.; Helbig, H. R.

    1990-01-01

    ACSI has developed a program utilizing CLIPS to assess compliance with various programming standards. Essentially the program parses C code to extract the names of all function calls. These are asserted as CLIPS facts which also include information about line numbers, source file names, and called functions. Rules have been devised to establish functions called that have not been defined in any of the source parsed. These are compared against lists of standards (represented as facts) using rules that check intersections and/or unions of these. By piping the output into other processes the source is appropriately commented by generating and executing parsed scripts.

  6. The importance of board independence

    NARCIS (Netherlands)

    Zijl, N.J.M.

    2012-01-01

    Although the attributed importance of board independence is high, a clear definition of independence does not exist. Furthermore, the aim and consequences of independence are the subject of discussion and empirical evidence about the impact of independence is weak and disputable. Despite this lack

  7. Ergodic theory independence and dichotomies

    CERN Document Server

    Kerr, David

    2016-01-01

    This book provides an introduction to the ergodic theory and topological dynamics of actions of countable groups. It is organized around the theme of probabilistic and combinatorial independence, and highlights the complementary roles of the asymptotic and the perturbative in its comprehensive treatment of the core concepts of weak mixing, compactness, entropy, and amenability. The more advanced material includes Popa's cocycle superrigidity, the Furstenberg-Zimmer structure theorem, and sofic entropy. The structure of the book is designed to be flexible enough to serve a variety of readers. The discussion of dynamics is developed from scratch assuming some rudimentary functional analysis, measure theory, and topology, and parts of the text can be used as an introductory course. Researchers in ergodic theory and related areas will also find the book valuable as a reference.

  8. Lessons from independence

    International Nuclear Information System (INIS)

    Hauptfuhrer, R.R.

    1990-01-01

    The recent history of Oryx provides invaluable lessons for those who plan future energy strategies, relates the author of this paper. When Oryx became an independent oil and gas company, its reserves were declining, its stock was selling below asset values, and the price of oil seemed stuck below $15 per barrel. The message from Oryx management to Oryx employees was: We are in charge of our own destiny. We are about to create our own future. Oryx had developed a new, positive corporate culture and the corporate credit required for growth. This paper points to two basic principles that have guided the metamorphosis in Oryx's performance. The first objective was to improve operational efficiency and to identify the right performance indicators to measure this improvement. It states that the most critical performance indicator for an exploration and production company must be replacement and expansion of reserves at a competitive replacement cost. Oryx has cut its finding costs from $12 to $5 per barrel, while the BP acquisition provided proven reserves at a cost of only $4 per barrel. Another performance indicator measures Oryx's standing in the financial markets

  9. Independents' group posts loss

    International Nuclear Information System (INIS)

    Sanders, V.; Price, R.B.

    1992-01-01

    Low oil gas prices and special charges caused the group of 50 U.S. independent producers Oil and Gas Journal tracks to post a combined loss in first half 1992. The group logged a net loss of $53 million in the first half compared with net earnings of $354 million in first half 1991, when higher oil prices during the Persian Gulf crisis buoyed earnings in spite of crude oil and natural gas production declines. The combined loss in the first half follows a 45% drop in the group's earnings in 1991 and compares with the OGJ group of integrated oil companies whose first half 1992 income fell 47% from the prior year. Special charges, generally related to asset writedowns, accounted for most of the almost $560 million in losses posted by about the third of the group. Nerco Oil and Gas Inc., Vancouver, Wash., alone accounted for almost half that total with charges related to an asset writedown of $238 million in the first quarter. Despite the poor first half performance, the outlook is bright for sharply improved group earnings in the second half, assuming reasonably healthy oil and gas prices and increased production resulting from acquisitions and in response to those prices

  10. PPARγ-Independent Mechanism

    Directory of Open Access Journals (Sweden)

    Christopher M. Hogan

    2011-01-01

    Full Text Available Acute and chronic lung inflammation is associated with numerous important disease pathologies including asthma, chronic obstructive pulmonary disease and silicosis. Lung fibroblasts are a novel and important target of anti-inflammatory therapy, as they orchestrate, respond to, and amplify inflammatory cascades and are the key cell in the pathogenesis of lung fibrosis. Peroxisome proliferator-activated receptor gamma (PPARγ ligands are small molecules that induce anti-inflammatory responses in a variety of tissues. Here, we report for the first time that PPARγ ligands have potent anti-inflammatory effects on human lung fibroblasts. 2-cyano-3, 12-dioxoolean-1, 9-dien-28-oic acid (CDDO and 15-deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2 inhibit production of the inflammatory mediators interleukin-6 (IL-6, monocyte chemoattractant protein-1 (MCP-1, COX-2, and prostaglandin (PGE2 in primary human lung fibroblasts stimulated with either IL-1β or silica. The anti-inflammatory properties of these molecules are not blocked by the PPARγ antagonist GW9662 and thus are largely PPARγ independent. However, they are dependent on the presence of an electrophilic carbon. CDDO and 15d-PGJ2, but not rosiglitazone, inhibited NF-κB activity. These results demonstrate that CDDO and 15d-PGJ2 are potent attenuators of proinflammatory responses in lung fibroblasts and suggest that these molecules should be explored as the basis for novel, targeted anti-inflammatory therapies in the lung and other organs.

  11. Media independence and dividend policy

    DEFF Research Database (Denmark)

    Farooq, Omar; Dandoune, Salma

    2012-01-01

    independence and dividend policies in emerging markets. Using a dataset from twenty three emerging markets, we show a significantly negative relationship between dividend policies (payout ratio and decision to pay dividend) and media independence. We argue that independent media reduces information asymmetries...... for stock market participants. Consequently, stock market participants in emerging markets with more independent media do not demand as high and as much dividends as their counterparts in emerging markets with less independent media. We also show that press independence is more important in defining......Can media pressurize managers to disgorge excess cash to shareholders? Do firms in countries with more independent media follow different dividend policies than firms with less independent media? This paper seeks to answer these questions and aims to document the relationship between media...

  12. The Independent Music Teacher: Practice and Preparation.

    Science.gov (United States)

    Uszler, Marienne

    1996-01-01

    Provides a concise overview of the working conditions and challenges faced by independent music teachers (IMT). Most IMTs function in a number of capacities, as performer, teacher, and entrepreneur. Discusses changing trends in employment, including computer technology and the move for national certification. (MJP)

  13. transformation of independent variables in polynomial regression ...

    African Journals Online (AJOL)

    Ada

    preferable when possible to work with a simple functional form in transformed variables rather than with a more complicated form in the original variables. In this paper, it is shown that linear transformations applied to independent variables in polynomial regression models affect the t ratio and hence the statistical ...

  14. From independence to expansion and back again

    DEFF Research Database (Denmark)

    Christiani, Tobias Lybecker; Pagh, Rasmus; Thorup, Mikkel

    2015-01-01

    We consider the following fundamental problems: • Constructing k-independent hash functions with a spacetime tradeoff close to Siegel’s lower bound. • Constructing representations of unbalanced expander graphs having small size and allowing fast computation of the neighbor function. It is not hard...... to show that these problems are intimately connected in the sense that a good solution to one of them leads to a good solution to the other one. In this paper we exploit this connection to present efficient, recursive constructions of k-independent hash functions (and hence expanders with a small...... representation). While the previously most efficient construction (Thorup, FOCS 2013) needed time quasipolynomial in Siegel’s lower bound, our time bound is just a logarithmic factor from the lower bound....

  15. Boards: Independent and Committed Directors?

    OpenAIRE

    Christophe Volonté

    2011-01-01

    Regulators, proxy advisors and shareholders are regularly calling for independent directors. However, at the same time, independent directors commonly engage in numerous outside activities potentially reducing their time and commitment with the particular firm. Using Tobin's Q as an approximation of market valuation and controlling for endogeneity, our empirical analysis reveals that neither is independence positively related to firm performance nor are outside activities negatively related t...

  16. Independent component analysis: recent advances

    OpenAIRE

    Hyv?rinen, Aapo

    2013-01-01

    Independent component analysis is a probabilistic method for learning a linear transform of a random vector. The goal is to find components that are maximally independent and non-Gaussian (non-normal). Its fundamental difference to classical multi-variate statistical methods is in the assumption of non-Gaussianity, which enables the identification of original, underlying components, in contrast to classical methods. The basic theory of independent component analysis was mainly developed in th...

  17. Comment on atomic independent-particle models

    International Nuclear Information System (INIS)

    Doda, D.D.; Gravey, R.H.; Green, A.E.S.

    1975-01-01

    The Hartree-Fock-Slater (HFS) independent-particle model in the form developed by Hermann and Skillman (HS) and the Green, Sellin, and Zachor (GSZ) analytic independent-particle model are being used for many types of applications of atomic theory to avoid cumbersome, albeit more rigorous, many-body calculations. The single-electron eigenvalues obtained with these models are examined and it is found that the GSZ model is capable of yielding energy eigenvalues for valence electrons which are substantially closer to experimental values than are the results of HS-HFS calculations. With the aid of an analytic representation of the equivalent HS-HFS screening function, the difficulty with this model is identified as a weakness of the potential in the neighborhood of the valence shell. Accurate representations of valence states are important in most atomic applications of the independent-particle model

  18. On independence in risk communication

    International Nuclear Information System (INIS)

    Lacronique, J. F.

    2006-01-01

    The term 'independence' is a common key word used by almost all stake holders in the field of nuclear safety regulation. The intention is to persuade the public that it can have more confidence and trust in the persons in charge, if their competence and judgment cannot be altered by any kind of political issue or personal interest. However, it is possible to discuss the reality of this claimed quality: how is it possible to verify that the organization that claim 'independence' really respect it? National expertise Institutions can show that they are independent from the industry, but can they claim total independence from the government? NGO have build a large part of their constituency on 'independence' from industry and governments, but are they independent from the ideological forces -sometimes very powerful - that support them? How can we achieve to make this noble word really meaningful? We will show through different examples, that 'independence' is by definition a fragile and versatile challenge, rather than a durable label. It has to be refreshed regularly and thoroughly. Risk communication, in that context, must respect principles which will build independence as a solid asset, and keep a certain distance with mere marketing purposes or candid wishful thinking

  19. Accounting for Non-Gaussian Sources of Spatial Correlation in Parametric Functi