In Nonobese Children, Fitness and BMI are Independent Predictors of Fasting Insulin.

Science.gov (United States)

Watson, Andrew M; Eickhoff, Jens; Nemeth, Blaise A; Carrel, Aaron L

2015-05-01

Although fitness and obesity have been shown to be independent predictors of cardiometabolic disease risk in obese children, this interaction is not well defined in nonobese children. The purpose of this study was to define the relationships between peak aerobic capacity, body composition, and fasting insulin levels in nonobese middle school children. 148 middle school children (mean age 11.0 ± 2.1 years, 49% male) underwent determination of body mass index (BMI) z-score, fasting glucose, fasting insulin, body composition by DXA scan (lean body mass and body fat percentage), and peak oxygen uptake per kg of lean body mass (VO2peak). Univariate correlations and multivariate regression analysis were used to identify independent predictors of fasting insulin using age, sex, percent body fat, body mass index z-score, and VO2peak. fasting insulin was significantly related to VO2peak (r =-0.37, p fasting insulin, while age (p = .39), sex (p = .49), and percent body fat (p = .72) did not. Among nonobese middle school children, fasting insulin is independently related to aerobic fitness after accounting for age, sex, and body composition. Public health efforts to reduce cardiometabolic disease risk among all adolescents should include exercise programs to increase cardiovascular fitness.

Low fitness is associated with abdominal adiposity and low-grade inflammation independent of BMI

DEFF Research Database (Denmark)

Wedell-Neergaard, Anne-Sophie; Eriksen, Louise; Grønbæk, Morten

2018-01-01

OBJECTIVE: Up to 30% of obese individuals are metabolically healthy. Metabolically healthy obese (MHO) individuals are characterized by having low abdominal adiposity, low inflammation level and low risk of developing metabolic comorbidity. In this study, we hypothesize that cardiorespiratory fit...... to be inversely associated with both abdominal adiposity and low-grade inflammation independent of BMI. These data suggest that, in spite of BMI, high fitness levels lead to a reduction in abdominal fat mass and low-grade inflammation.......OBJECTIVE: Up to 30% of obese individuals are metabolically healthy. Metabolically healthy obese (MHO) individuals are characterized by having low abdominal adiposity, low inflammation level and low risk of developing metabolic comorbidity. In this study, we hypothesize that cardiorespiratory...... fitness (fitness) is a determinant factor for the MHO individuals and aim to investigate the associations between fitness, abdominal adiposity and low-grade inflammation within different BMI categories. METHOD: Data from 10,976 individuals from the general population, DANHES 2007-2008, on waist...

BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

Science.gov (United States)

Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

2017-12-01

Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

CD133 and BMI1 expressions and its prognostic role in primary ...

Indian Academy of Sciences (India)

This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.

Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

Directory of Open Access Journals (Sweden)

Lowell Evan Michael

2008-12-01

Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

Prenatal risk factors influencing childhood BMI and overweight independent of birth weight and infancy BMI - a path analysis within the Danish National Birth Cohort

DEFF Research Database (Denmark)

Morgen, Camilla Schmidt; Ängquist, Lars; Lynn Baker, Jennifer

2018-01-01

BACKGROUND AND OBJECTIVES: Prenatal risk factors for childhood overweight may operate indirectly through development in body size in early life and/or directly independent hereof. We quantified the effects of maternal and paternal body mass index (BMI), maternal age, socioeconomic position (SEP),...... of Obesity advance online publication, 31 October 2017; doi:10.1038/ijo.2017.217....

Bmi-1 Regulates Extensive Erythroid Self-Renewal

Directory of Open Access Journals (Sweden)

Ah Ram Kim

2015-06-01

Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

Reduced lung function is independently associated with increased risk of type 2 diabetes in Korean men

Directory of Open Access Journals (Sweden)

Kwon Chang-Hee

2012-04-01

Full Text Available Abstract Background Reduced lung function is associated with incident insulin resistance and diabetes. The aim of this study was to assess the relationship between lung function and incident type 2 diabetes in Korean men. Methods This study included 9,220 men (mean age: 41.4 years without type 2 diabetes at baseline who were followed for five years. Subjects were divided into four groups according to baseline forced vital capacity (FVC (% predicted and forced expiratory volume in one second (FEV1 (% predicted quartiles. The incidence of type 2 diabetes at follow-up was compared according to FVC and FEV1 quartiles. Results The overall incidence of type 2 diabetes was 2.2%. Reduced lung function was significantly associated with the incidence of type 2 diabetes after adjusting for age, BMI, education, smoking, exercise, alcohol, and HOMA-IR. Both FVC and FEV1 were negatively associated with type 2 diabetes (P 1 had a significantly higher odds ratio for type 2 diabetes compared with the highest quartile after adjusting for age and BMI (2.15 [95% CI 1.02-4.57] and 2.19 [95% CI 1.09-4.42]. Conclusions Reduced lung function is independently associated with the incidence of type 2 diabetes in Korean men.

Venous and autonomic function in formerly pre-eclamptic women and BMI-matched controls.

Science.gov (United States)

Heidema, Wieteke M; van Drongelen, Joris; Spaanderman, Marc E A; Scholten, Ralph R

2018-03-25

Pre-pregnancy reduced plasma volume increases the risk on subsequent pre-eclamptic pregnancy. Reduced plasma volume is thought to reflect venous reserve capacity, especially when venous vasculature is constricted and sympathetic tone is elevated. As obesity might affect these variables and also relates to pre-eclampsia, increased body weight may underlie these observations. We hypothesized that the relationship between reduced venous reserve and preeclampsia is independent of body mass index (BMI). We compared the non-pregnant venous reserve capacity in 30 formerly pre-eclamptic women, equally divided in 3 BMI-classes (BMI 19.5-24.9, BMI 25-29.9, BMI ≥30) to 30 controls. Cases and controls were matched for BMI, age and parity. The venous reserve capacity was quantified by assessing plasma volume and venous compliance. The autonomic nervous system regulating the venous capacitance was evaluated with heart rate variability analysis in resting supine position and during positive head-up tilt (HUT). Formerly pre-eclamptic women had in supine position lower plasma volume than controls (1339 ± 79 vs 1547 ± 139 ml/m 2 (pBMI-matched controls, reduced venous reserve capacity. This is reflected by lower plasma volume and venous compliance, the autonomic balance is shifted towards sympathetic dominance and lower baroreceptor sensitivity. This suggests that not BMI, but underlying reduced venous reserve relates to pre-eclampsia. This article is protected by copyright. All rights reserved.

Expression of Bmi-1 is a prognostic marker in bladder cancer

International Nuclear Information System (INIS)

Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

2009-01-01

The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

Science.gov (United States)

Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

2016-01-01

Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

Bmi-1 expression modulates non-small cell lung cancer progression

Science.gov (United States)

Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

2015-01-01

Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

Expression of Bmi-1 is a prognostic marker in bladder cancer

Directory of Open Access Journals (Sweden)

Xu Li-Hua

2009-02-01

Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

The Role of BMI1 in CRPC

Science.gov (United States)

2016-10-01

we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

Hyaline cartilage calcification of the first metatarsophalangeal joint is associated with osteoarthritis but independent of age and BMI.

Science.gov (United States)

Hubert, Jan; Hawellek, Thelonius; Hischke, Sandra; Bertrand, Jessica; Krause, Matthias; Püschel, Klaus; Rüther, Wolfgang; Niemeier, Andreas

2016-11-15

Hyaline cartilage calcification (CC) is associated with osteoarthritis (OA) in hip and knee joints. The first metatarsophalangeal joint (1 st MTPJ) is frequently affected by OA, but it is unclear if CC occurs in the 1 st MTPJ. The aim of the present study was to analyze the prevalence of CC of the 1 st MTPJ in the general population by high-resolution digital contact radiography (DCR) and to determine its association with histological OA severity, age and body mass index (BMI). 168 metatarsal heads of 84 donors (n = 47 male, n = 37 female; mean age 62.73 years, SD ±18.8, range 20-93) were analyzed by DCR for the presence of CC. Histological OA grade (hOA) by OARSI was analyzed in the central load-bearing zone of the first metatarsal head (1 st MH). Structural equation modeling (SEM) was performed to analyze the interrelationship between CC, hOA, age and BMI. The prevalence of CC of 1 st MH was 48.8 % (41/84) (95 %-CI [37.7 %, 60.0 %]), independent of the affected side (p = 0.42), gender (p = 0.41) and BMI (p = 0.51). The mean amount of CC of one MH correlated significantly with that of the contralateral side (r s  = 0.4, 95 %-CI [0.26, 0.52], p cartilage area) of the MH correlated significantly with the severity of hOA (r s  = 0.51, 95 %-CI [0.32, 0.65], p studies.

BMI change during puberty and the risk of heart failure.

Science.gov (United States)

Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C

2018-03-12

Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.

Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

NARCIS (Netherlands)

Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

2008-01-01

Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance

Science.gov (United States)

Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun

2014-01-01

To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841

Overweight Is an Independent Risk Factor for Reduced Lung Volumes in Myotonic Dystrophy Type 1.

Directory of Open Access Journals (Sweden)

Charlotte G W Seijger

Full Text Available In this large observational study population of 105 myotonic dystrophy type 1 (DM1 patients, we investigate whether bodyweight is a contributor of total lung capacity (TLC independent of the impaired inspiratory muscle strength.Body composition was assessed using the combination of body mass index (BMI and fat-free mass index. Pulmonary function tests and respiratory muscle strength measurements were performed on the same day. Patients were stratified into normal (BMI < 25 kg/m(2 and overweight (BMI ≥ 25 kg/m(2 groups. Multiple linear regression was used to find significant contributors for TLC.Overweight was present in 59% of patients, and body composition was abnormal in almost all patients. In overweight patients, TLC was significantly (p = 2.40×10(-3 decreased, compared with normal-weight patients, while inspiratory muscle strength was similar in both groups. The decrease in TLC in overweight patients was mainly due to a decrease in expiratory reserve volume (ERV further illustrated by a highly significant (p = 1.33×10(-10 correlation between BMI and ERV. Multiple linear regression showed that TLC can be predicted using only BMI and the forced inspiratory volume in 1 second, as these were the only significant contributors.This study shows that, in DM1 patients, overweight further reduces lung volumes, as does impaired inspiratory muscle strength. Additionally, body composition is abnormal in almost all DM1 patients.

Waist circumference, BMI, and lung function in 8-year-old children : The PIAMA birth cohort study

NARCIS (Netherlands)

Bekkers, Marga B. M.; Wijga, Alet H.; de Jongste, Johan C.; Kerkhof, Marjan; Postma, Dirkje; Gehring, Ulrike; Smit, Henriette A.; Brunekreef, Bert

Background Body mass index (BMI) and waist circumference (WC) may be associated with lung function in children, as observed in adults. Methods Height, weight, waist circumference, and lung function (FVC and FEV1) were measured during a medical examination in 1,058 eight-year-old children

Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

Directory of Open Access Journals (Sweden)

Anthony Flamier

2018-05-01

Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

Science.gov (United States)

Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

2014-01-01

Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

Science.gov (United States)

Liu, Jiaguo; Luo, Bin; Zhao, Meng

2017-01-01

Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

International Nuclear Information System (INIS)

Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

2012-01-01

The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

Directory of Open Access Journals (Sweden)

Jiang Lili

2012-09-01

Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

BMI and BMI SDS in childhood: annual increments and conditional change

OpenAIRE

Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt

2016-01-01

Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...

Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

Directory of Open Access Journals (Sweden)

Xiaodong Li

2016-11-01

Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

BMI and BMI SDS in childhood: annual increments and conditional change.

Science.gov (United States)

Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt

2017-02-01

Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.

Personality traits, education, physical exercise, and childhood neurological function as independent predictors of adult obesity.

Science.gov (United States)

Cheng, Helen; Furnham, Adrian

2013-01-01

To investigate whether personality traits, education, physical exercise, parental socio-economic conditions, and childhood neurological function are independently associated with obesity in 50 year old adults in a longitudinal birth cohort study. The sample consisted of 5,921 participants born in Great Britain in 1958 and followed up at 7, 11, 33, 42, and 50 years with data on body mass index measured at 42 and 50 years. There was an increase of adult obesity from 14.2% at age 42 to 23.6% at 50 years. Cohort members who were reported by teachers on overall clumsiness as "certainly applied" at age 7 were more likely to become obese at age 50. In addition, educational qualifications, traits Conscientiousness and Extraversion, psychological distress, and physical exercise were all significantly associated with adult obesity. The associations remained to be significant after controlling for birth weight and gestation, maternal and paternal BMI, childhood BMI, childhood intelligence and behavioural adjustment, as well as diet. Neurological function in childhood, education, trait Conscientiousness, and exercise were all significantly and independently associated with adult obesity, each explained unique individual variability.

Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

2012-08-24

Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

LSD1 activates a lethal prostate cancer gene network independently of its demethylase function.

Science.gov (United States)

Sehrawat, Archana; Gao, Lina; Wang, Yuliang; Bankhead, Armand; McWeeney, Shannon K; King, Carly J; Schwartzman, Jacob; Urrutia, Joshua; Bisson, William H; Coleman, Daniel J; Joshi, Sunil K; Kim, Dae-Hwan; Sampson, David A; Weinmann, Sheila; Kallakury, Bhaskar V S; Berry, Deborah L; Haque, Reina; Van Den Eeden, Stephen K; Sharma, Sunil; Bearss, Jared; Beer, Tomasz M; Thomas, George V; Heiser, Laura M; Alumkal, Joshi J

2018-05-01

Medical castration that interferes with androgen receptor (AR) function is the principal treatment for advanced prostate cancer. However, clinical progression is universal, and tumors with AR-independent resistance mechanisms appear to be increasing in frequency. Consequently, there is an urgent need to develop new treatments targeting molecular pathways enriched in lethal prostate cancer. Lysine-specific demethylase 1 (LSD1) is a histone demethylase and an important regulator of gene expression. Here, we show that LSD1 promotes the survival of prostate cancer cells, including those that are castration-resistant, independently of its demethylase function and of the AR. Importantly, this effect is explained in part by activation of a lethal prostate cancer gene network in collaboration with LSD1's binding protein, ZNF217. Finally, that a small-molecule LSD1 inhibitor-SP-2509-blocks important demethylase-independent functions and suppresses castration-resistant prostate cancer cell viability demonstrates the potential of LSD1 inhibition in this disease.

File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

Science.gov (United States)

Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129

Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?

Science.gov (United States)

Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J

2017-05-01

We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.

File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.

Science.gov (United States)

Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio

2015-10-26

The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in

MicroRNA-330-3p Expression Indicates Good Prognosis and Suppresses Cell Proliferation by Targeting Bmi-1 in Osteosarcoma

Directory of Open Access Journals (Sweden)

Zhenxin Zheng

2018-03-01

Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.

Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

NARCIS (Netherlands)

Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

2005-01-01

The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

Endothelial function in young women with polycystic ovary syndrome (PCOS): Implications of body mass index (BMI) and insulin resistance.

Science.gov (United States)

El-Kannishy, Ghada; Kamal, Shaheer; Mousa, Amany; Saleh, Omayma; Badrawy, Adel El; Farahaty, Reham El; Shokeir, Tarek

2010-01-01

Evidence regarding endothelial function in both obese and nonobese women with PCOS is contradictory. It is unknown whether obese women with PCOS carry an increased risk related to body mass index (BMI). To identify endothelial function and investigate its relationship to body mass index and insulin resistance in young women with PCOS. Twenty-two obese women with PCOS (BMI 35.2 ± 3.2) as well as fourteen lean women (BMI 22.8 ± 2.1)with PCOS were included in the study. Fasting serum insulin, blood glucose were estimated and HOMA and Quicki index were calculated. All patients were subjected to ultrasound recording of brachial artery diameter at rest and after reactive hyperemia (FMD) for assessment of endothelial function. Ten age matched healthy females with normal BMI were chosen as a control group. There were higher basal insulin levels with lower Quicki index and higher HOMA index in women with PCOS than normal group, but the differences were significant only between obese PCOS subgroup and control. On the other hand, FMD was significantly and equally decreased in both groups of women with PCOS, compared with control subjects (3.7 ± 3.2% in the nonobese subgroup and 3.5 ± 2.8% in the obese one vs. 10.6 ± 4.1% in control subjects, P, 0.001). FMD was not correlated with BMI nor insulin resistance indices. Endothelial dysfunction is already present in young women with PCOS. In this patient group, it cannot be attributed to insulin resistance or obesity. © 2010 Asian Oceanian Association for the Study of Obesity . Published by Elsevier Ltd. All rights reserved.

BMI at birth and overweight at age four.

Science.gov (United States)

Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F

Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.

Science.gov (United States)

López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís

2015-01-01

Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.

Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

Science.gov (United States)

Lu, You-Wei; Li, Jin; Guo, Wei-Jian

2010-11-08

The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

Green close-quote s function method with energy-independent vertex functions

International Nuclear Information System (INIS)

Tsay Tzeng, S.Y.; Kuo, T.T.; Tzeng, Y.; Geyer, H.B.; Navratil, P.

1996-01-01

In conventional Green close-quote s function methods the vertex function Γ is generally energy dependent. However, a model-space Green close-quote s function method where the vertex function is manifestly energy independent can be formulated using energy-independent effective interaction theories based on folded diagrams and/or similarity transformations. This is discussed in general and then illustrated for a 1p1h model-space Green close-quote s function applied to a solvable Lipkin many-fermion model. The poles of the conventional Green close-quote s function are obtained by solving a self-consistent Dyson equation and model space calculations may lead to unphysical poles. For the energy-independent model-space Green close-quote s function only the physical poles of the model problem are reproduced and are in satisfactory agreement with the exact excitation energies. copyright 1996 The American Physical Society

The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.

LENUS (Irish Health Repository)

Elshorbagy, Amany K

2009-07-01

We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.

Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

Directory of Open Access Journals (Sweden)

Hourinaz Behesti

2013-01-01

BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Science.gov (United States)

Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

2015-01-01

BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Directory of Open Access Journals (Sweden)

Mehdi Hayat Shahi

Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

Science.gov (United States)

Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

2017-09-01

The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

Science.gov (United States)

Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

2017-04-01

We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

[PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

Science.gov (United States)

Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

2016-01-01

Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

Eating tasty food to cope. Longitudinal association with BMI.

Science.gov (United States)

Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D

2015-04-01

The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.

About BMI for Adults

Science.gov (United States)

... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...

miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

Energy Technology Data Exchange (ETDEWEB)

Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

2015-01-02

Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

Differential models of twin correlations in skew for body-mass index (BMI).

Science.gov (United States)

Tsang, Siny; Duncan, Glen E; Dinescu, Diana; Turkheimer, Eric

2018-01-01

Body Mass Index (BMI), like most human phenotypes, is substantially heritable. However, BMI is not normally distributed; the skew appears to be structural, and increases as a function of age. Moreover, twin correlations for BMI commonly violate the assumptions of the most common variety of the classical twin model, with the MZ twin correlation greater than twice the DZ correlation. This study aimed to decompose twin correlations for BMI using more general skew-t distributions. Same sex MZ and DZ twin pairs (N = 7,086) from the community-based Washington State Twin Registry were included. We used latent profile analysis (LPA) to decompose twin correlations for BMI into multiple mixture distributions. LPA was performed using the default normal mixture distribution and the skew-t mixture distribution. Similar analyses were performed for height as a comparison. Our analyses are then replicated in an independent dataset. A two-class solution under the skew-t mixture distribution fits the BMI distribution for both genders. The first class consists of a relatively normally distributed, highly heritable BMI with a mean in the normal range. The second class is a positively skewed BMI in the overweight and obese range, with lower twin correlations. In contrast, height is normally distributed, highly heritable, and is well-fit by a single latent class. Results in the replication dataset were highly similar. Our findings suggest that two distinct processes underlie the skew of the BMI distribution. The contrast between height and weight is in accord with subjective psychological experience: both are under obvious genetic influence, but BMI is also subject to behavioral control, whereas height is not.

Associations Between Sedentary Behaviors, Sleep Patterns, and BMI in Young Dancers Attending a Summer Intensive Dance Training Program.

Science.gov (United States)

Stracciolini, Andrea; Stein, Cynthia J; Kinney, Susan; McCrystal, Tara; Pepin, Michael J; Meehan Iii, William P

2017-09-15

The purpose of this study was to investigate associations between sedentary behaviors, sleep hours, and body mass index (BMI) in 12- to 17-year-old dancers. This was a cross sectional survey in which bivariate correlation and simple linear regression were used to determine associations between self-reported components. One hundred fifteen dancers were queried, 91.3% of whom were female. The mean BMI was 19.6 ± 2.3 kg/m2. Two-thirds of dancers fell below the 50th percentile for age-adjusted BMI, and 30.4% fell below the 25th percentile. Better than 12% of dancers reported a history of anxiety, and 2.6% reported depression. Mean hours of sleep per night was 7.8 ± 0.9, with 58% of the dancers getting less than 8 hours of sleep per night. The mean total screen time for dancers was 3.4 ± 2.1 hours/day, which consisted of tablet and computer usage: 1.6 ± 1.1 hours/day; texting: 0.5 ± 1.1 hours/day; watching television: 1.2 ± 1.1 hours/day; and playing video games 1.2 ± 1.1 hours/ day. Total screen time was independently associated positively with BMI, explaining nearly 10% of the variability in BMI. Age, hours dancing per day, and hours of sleep per night were not independently associated with BMI. To summarize: screen time was associated with increased BMI in this young dancer cohort; the majority of dancers slept less than 8 hours per night; anticipatory guidance addressing media use and sleep hygiene in the adolescent dancer population is needed.

Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

Directory of Open Access Journals (Sweden)

Justin W Leung

2014-03-01

Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells.

Science.gov (United States)

Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee

2017-12-15

The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.

BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

Science.gov (United States)

Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

2018-02-01

B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

Parental nonstandard work schedules during infancy and children's BMI trajectories

Directory of Open Access Journals (Sweden)

Afshin Zilanawala

2017-09-01

Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.

Associations of maternal macronutrient intake during pregnancy with infant BMI peak characteristics and childhood BMI.

Science.gov (United States)

Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng

2017-03-01

Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT

Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes

Directory of Open Access Journals (Sweden)

Andrew Fedor

2013-04-01

Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.

Higher BMI is associated with reduced cognitive performance in division I athletes.

Science.gov (United States)

Fedor, Andrew; Gunstad, John

2013-01-01

Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.

Functional analysis of the zebrafish ortholog of HMGCS1 reveals independent functions for cholesterol and isoprenoids in craniofacial development.

Directory of Open Access Journals (Sweden)

Anita M Quintana

Full Text Available There are 8 different human syndromes caused by mutations in the cholesterol synthesis pathway. A subset of these disorders such as Smith-Lemli-Opitz disorder, are associated with facial dysmorphia. However, the molecular and cellular mechanisms underlying such facial deficits are not fully understood, primarily because of the diverse functions associated with the cholesterol synthesis pathway. Recent evidence has demonstrated that mutation of the zebrafish ortholog of HMGCR results in orofacial clefts. Here we sought to expand upon these data, by deciphering the cholesterol dependent functions of the cholesterol synthesis pathway from the cholesterol independent functions. Moreover, we utilized loss of function analysis and pharmacological inhibition to determine the extent of sonic hedgehog (Shh signaling in animals with aberrant cholesterol and/or isoprenoid synthesis. Our analysis confirmed that mutation of hmgcs1, which encodes the first enzyme in the cholesterol synthesis pathway, results in craniofacial abnormalities via defects in cranial neural crest cell differentiation. Furthermore targeted pharmacological inhibition of the cholesterol synthesis pathway revealed a novel function for isoprenoid synthesis during vertebrate craniofacial development. Mutation of hmgcs1 had no effect on Shh signaling at 2 and 3 days post fertilization (dpf, but did result in a decrease in the expression of gli1, a known Shh target gene, at 4 dpf, after morphological deficits in craniofacial development and chondrocyte differentiation were observed in hmgcs1 mutants. These data raise the possibility that deficiencies in cholesterol modulate chondrocyte differentiation by a combination of Shh independent and Shh dependent mechanisms. Moreover, our results describe a novel function for isoprenoids in facial development and collectively suggest that cholesterol regulates craniofacial development through versatile mechanisms.

Trajectories of BMI change impact glucose and insulin metabolism.

Science.gov (United States)

Walsh, E I; Shaw, J; Cherbuin, N

2018-03-01

The aim of this study was to examine, in a community setting, whether trajectory of weight change over twelve years is associated with glucose and insulin metabolism at twelve years. Participants were 532 community-living middle-aged and elderly adults from the Personality and Total Health (PATH) Through Life study. They spanned the full weight range (underweight/normal/overweight/obese). Latent class analysis and multivariate generalised linear models were used to investigate the association of Body Mass Index (BMI, kg/m 2 ) trajectory over twelve years with plasma insulin (μlU/ml), plasma glucose (mmol/L), and HOMA2 insulin resistance and beta cell function at follow-up. All models were adjusted for age, gender, hypertension, pre-clinical diabetes status (normal fasting glucose or impaired fasting glucose) and physical activity. Four weight trajectories were extracted; constant normal (mean baseline BMI = 25; follow-up BMI = 25), constant high (mean baseline BMI = 36; follow-up BMI = 37), increase (mean baseline BMI = 26; follow-up BMI = 32) and decrease (mean baseline BMI = 34; follow-up BMI = 28). At any given current BMI, individuals in the constant high and increase trajectories had significantly higher plasma insulin, greater insulin resistance, and higher beta cell function than those in the constant normal trajectory. Individuals in the decrease trajectory did not differ from the constant normal trajectory. Current BMI significantly interacted with preceding BMI trajectory in its association with plasma insulin, insulin resistance, and beta cell function. The trajectory of preceding weight has an independent effect on blood glucose metabolism beyond body weight measured at any given point in time. Copyright © 2017 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier

Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

Science.gov (United States)

Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

2017-10-06

We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

BMI modulates calorie-dependent dopamine changes in accumbens from glucose intake.

Directory of Open Access Journals (Sweden)

Gene-Jack Wang

Full Text Available Dopamine mediates the rewarding effects of food that can lead to overeating and obesity, which then trigger metabolic neuroadaptations that further perpetuate excessive food consumption. We tested the hypothesis that the dopamine response to calorie intake (independent of palatability in striatal brain regions is attenuated with increases in weight.We used positron emission tomography with [11C]raclopride to measure dopamine changes triggered by calorie intake by contrasting the effects of an artificial sweetener (sucralose devoid of calories to that of glucose to assess their association with body mass index (BMI in nineteen healthy participants (BMI range 21-35.Neither the measured blood glucose concentrations prior to the sucralose and the glucose challenge days, nor the glucose concentrations following the glucose challenge vary as a function of BMI. In contrast the dopamine changes in ventral striatum (assessed as changes in non-displaceable binding potential of [11C]raclopride triggered by calorie intake (contrast glucose - sucralose were significantly correlated with BMI (r = 0.68 indicating opposite responses in lean than in obese individuals. Specifically whereas in normal weight individuals (BMI <25 consumption of calories was associated with increases in dopamine in the ventral striatum in obese individuals it was associated with decreases in dopamine.These findings show reduced dopamine release in ventral striatum with calorie consumption in obese subjects, which might contribute to their excessive food intake to compensate for the deficit between the expected and the actual response to food consumption.

Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

Science.gov (United States)

2011-01-01

Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

Executive dysfunction is independently associated with reduced functional independence in heart failure.

Science.gov (United States)

Alosco, Michael L; Spitznagel, Mary Beth; Raz, Naftali; Cohen, Ronald; Sweet, Lawrence H; Colbert, Lisa H; Josephson, Richard; van Dulmen, Manfred; Hughes, Joel; Rosneck, Jim; Gunstad, John

2014-03-01

To examine the independent association between executive function with instrumental activities of daily living and health behaviours in older adults with heart failure. Executive function is an important contributor to functional independence as it consists of cognitive processes needed for decision-making, planning, organising and behavioural monitoring. Impairment in this domain is common in heart failure patients and associated with reduced performance of instrumental activities of daily living in many medical and neurological populations. However, the contribution of executive functions to functional independence and healthy lifestyle choices in heart failure patients has not been fully examined. Cross-sectional analyses. One hundred and seventy-five heart failure patients completed a neuropsychological battery and echocardiogram. Participants also completed the Lawton-Brody Instrumental Activities of Daily Living Scale and reported current cigarette use. Hierarchical regressions revealed that reduced executive function was independently associated with worse instrumental activity of daily living performance with a specific association for decreased ability to manage medications. Partial correlations showed that executive dysfunction was associated with current cigarette use. Our findings suggest that executive dysfunction is associated with poorer functional independence and contributes to unhealthy behaviours in heart failure. Future studies should examine whether heart failure patients benefit from formal organisation schema (i.e. pill organisers) to maintain independence. Screening of executive function in heart failure patients may provide key insight into their ability to perform daily tasks, including the management of treatment recommendations. © 2013 John Wiley & Sons Ltd.

Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1

International Nuclear Information System (INIS)

Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon

2008-01-01

Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1

Changes in Adult BMI and Waist Circumference Are Associated with Increased Risk of Advanced Colorectal Neoplasia.

Science.gov (United States)

Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F

2017-11-01

Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2  = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2  = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.

Group-based developmental BMI trajectories, polycystic ovary syndrome, and gestational diabetes: a community-based longitudinal study.

Science.gov (United States)

Kakoly, Nadira Sultana; Earnest, Arul; Moran, Lisa J; Teede, Helena J; Joham, Anju E

2017-11-06

Obesity is common in young women, increasing insulin resistance (IR) and worsening pregnancy complications, including gestational diabetes (GDM). Women with polycystic ovary syndrome (PCOS) are commonly obese, which aggravates the severity of PCOS clinical expression. Relationships between these common insulin-resistant conditions, however, remain unclear. We conducted a secondary analysis of the Australian Longitudinal Study on Women's Health (ALSWH) database, including data from 8009 women aged 18-36 years across six surveys. We used latent-curve growth modelling to identify distinct body mass index (BMI) trajectories and multinomial logistic regression to explore sociodemographic and health variables characterizing BMI group membership. Logistic regression was used to assess independent risk of GDM. A total of 662 women (8.29%, 95% CI 7.68-8.89) reported PCOS. Three distinct BMI trajectories emerged, namely low stable (LSG) (63.8%), defined as an average trajectory remaining at ~25 kg/m 2 ; moderately rising (MRG) (28.8%), a curvilinear trajectory commencing in a healthy BMI and terminating in the overweight range; and high-rising (HRG) (7.4%), a curvilinear trajectory starting and terminating in the obese range. A high BMI in early reproductive life predicted membership in higher trajectories. The HRG BMI trajectory was independently associated with GDM (OR 2.50, 95% CI 1.80-3.48) and was a stronger correlate than PCOS (OR 1.89, 95% CI 1.41-2.54), maternal age, socioeconomic status, or parity. Our results suggest heterogeneity in BMI change among Australian women of reproductive age, with and without PCOS. Reducing early adult life weight represents an ideal opportunity to intervene at an early stage of reproductive life and decreases the risk of long-term metabolic complications such as GDM.

Independent functional connectivity networks underpin food and monetary reward sensitivity in excess weight.

Science.gov (United States)

Verdejo-Román, Juan; Fornito, Alex; Soriano-Mas, Carles; Vilar-López, Raquel; Verdejo-García, Antonio

2017-02-01

Overvaluation of palatable food is a primary driver of obesity, and is associated with brain regions of the reward system. However, it remains unclear if this network is specialized in food reward, or generally involved in reward processing. We used functional magnetic resonance imaging (fMRI) to characterize functional connectivity during processing of food and monetary rewards. Thirty-nine adults with excess weight and 37 adults with normal weight performed the Willingness to Pay for Food task and the Monetary Incentive Delay task in the fMRI scanner. A data-driven graph approach was applied to compare whole-brain, task-related functional connectivity between groups. Excess weight was associated with decreased functional connectivity during the processing of food rewards in a network involving primarily frontal and striatal areas, and increased functional connectivity during the processing of monetary rewards in a network involving principally frontal and parietal areas. These two networks were topologically and anatomically distinct, and were independently associated with BMI. The processing of food and monetary rewards involve segregated neural networks, and both are altered in individuals with excess weight. Copyright © 2016 Elsevier Inc. All rights reserved.

Biologic consequences of Stat1-independent IFN signaling

Science.gov (United States)

Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.

2001-01-01

Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on mononuclear phagocytes by regulating the expression of many genes. This result was confirmed by monitoring changes in expression and function of the corresponding gene products. Regulation of the expression of these genes requires the IFNγ receptor and Jak1. The physiologic relevance of IFN-dependent, Stat1-independent signaling was demonstrated by monitoring antiviral responses in Stat1-null mice. Thus, the IFN receptors engage alternative Stat1-independent signaling pathways that have important physiological consequences. PMID:11390995

Abdominal obesity and physical inactivity are associated with erectile dysfunction independent of body mass index.

Science.gov (United States)

Janiszewski, Peter M; Janssen, Ian; Ross, Robert

2009-07-01

Erectile dysfunction (ED) is common among men with an elevated body mass index (BMI). However, a high waist circumference (WC) and low levels of physical activity may predict ED independently of BMI. We investigated the independent relationships between BMI, WC, and physical activity with ED. Subjects consisted of 3,941 adult men (age > or = 20 years) with no history of prostate cancer from the 2001-2004 National Health and Nutrition Examination Survey. Logistic regression analyses were used to examine the relative odds of ED association with categories of BMI, WC, and physical activity. Established thresholds were used to divide subjects into three WC and BMI categories. Physical activity level was divided into active (> or =150 min/week), moderately active (30-149 min/week), and inactive (inactive men had an approximately 40-60% greater odds of ED compared with active men. When all three predictors (WC, BMI, and physical activity level) were entered into the same logistic regression model, both a high WC and low physical activity level (moderately active and inactive) were independently associated with a greater odds of ED, whereas BMI level was not. Maintaining a WC level below 102 cm and achieving the recommended amount of moderate-intensity physical activity (>or =150 min/week) is associated with the maintenance of proper erectile function, regardless of BMI level. These findings suggest that the clinical screening for ED risk should include the assessment of WC and physical activity level in addition to BMI.

Cognitive Function in Normal-Weight, Overweight, and Obese Older Adults: An Analysis of the Advanced Cognitive Training for Independent and Vital Elderly Cohort

Science.gov (United States)

Kuo, Hsu-Ko; Jones, Richard N.; Milberg, William P.; Tennstedt, Sharon; Talbot, Laura; Morris, John N.; Lipsitz, Lewis A.

2010-01-01

OBJECTIVES To assess how elevated body mass index (BMI) affects cognitive function in elderly people. DESIGN Cross-sectional study. SETTING Data for this cross-sectional study were taken from a multicenter randomized controlled trial, the Advanced Cognitive Training for Independent and Vital Elderly trial. PARTICIPANTS The analytic sample included 2,684 normal-weight, overweight, or obese subjects aged 65 to 94. MEASUREMENTS Evaluation of cognitive abilities was performed in several domains: global cognition, memory, reasoning, and speed of processing. Cross-sectional association between body weight status and cognitive functions was analyzed using multiple linear regression. RESULTS Overweight subjects had better performance on a reasoning task (β = 0.23, standard error (SE) = 0.11, P = .04) and the Useful Field of View (UFOV) measure (β = −39.46, SE = 12.95, P = .002), a test of visuospatial speed of processing, after controlling for age, sex, race, years of education, intervention group, study site, and cardiovascular risk factors. Subjects with class I (BMI 30.0–34.9 kg/m2) and class II (BMI>35.0 kg/m2) obesity had better UFOV measure scores (β = −38.98, SE = 14.77, P = .008; β = −35.75, SE = 17.65, and P = .04, respectively) in the multivariate model than normal-weight subjects. The relationships between BMI and individual cognitive domains were nonlinear. CONCLUSION Overweight participants had better cognitive performance in terms of reasoning and visuospatial speed of processing than normal-weight participants. Obesity was associated with better performance in visuospatial speed of processing than normal weight. The relationship between BMI and cognitive function should be studied prospectively. PMID:16420204

Physical Activity, BMI, and Blood Pressure in US Youth: NHANES 2003-2006.

Science.gov (United States)

Betz, Heather Hayes; Eisenmann, Joey C; Laurson, Kelly R; DuBose, Katrina D; Reeves, Mathew J; Carlson, Joseph J; Pfeiffer, Karin A

2018-03-15

The objective of this study was to examine the independent and combined association of physical activity and body mass index (BMI) with blood pressure in youth. Youth aged 8-18 years from the 2003-2006 National Health and Nutrition Examination Survey (NHANES) with BMI, blood pressure, and physical activity (accelerometer) were included in the analyses. A total of 2585 subjects (1303 males; 47% of all 8- to 18-year-olds) met these criteria. Obese youth had a systolic blood pressure that was 8 mm Hg higher than normal weight youth. A significant interaction between BMI and physical activity on blood pressure was found (P < .001), and group differences among the BMI/activity groups showed that the 3 obese groups and the overweight/least active group had significantly higher systolic blood pressure than the normal weight/active group across all analyses. The overweight/least active and normal weight/least active groups had significantly higher diastolic blood pressure than the normal weight/active group as well. This study showed a significant independent and combined association of BMI and physical activity with blood pressure in youth. Interventions need to focus on the reduction of fatness/BMI as a way to reduce the cardiovascular risk in youth.

Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study

Science.gov (United States)

Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.

2014-01-01

Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

Science.gov (United States)

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Adult BMI and Access to Built Environment Resources in a High-Poverty, Urban Geography.

Science.gov (United States)

Tung, Elizabeth L; Peek, Monica E; Makelarski, Jennifer A; Escamilla, Veronica; Lindau, Stacy T

2016-11-01

The purpose of this study is to examine the relationship between BMI and access to built environment resources in a high-poverty, urban geography. Participants (aged ≥35 years) were surveyed between November 2012 and July 2013 to examine access to common health-enabling resources (grocers, outpatient providers, pharmacies, places of worship, and physical activity resources). Survey data were linked to a contemporaneous census of built resources. Associations between BMI and access to resources (potential and realized) were examined using independent t-tests and multiple linear regression. Data analysis was conducted in 2014-2015. Median age was 53.8 years (N=267, 62% cooperation rate). Obesity (BMI ≥30) prevalence was 54.9%. BMI was not associated with potential access to resources located nearest to home. Nearly all participants (98.1%) bypassed at least one nearby resource type; half bypassed nearby grocers (realized access >1 mile from home). Bypassing grocers was associated with a higher BMI (p=0.03). Each additional mile traveled from home to a grocer was associated with a 0.9-higher BMI (95% CI=0.4, 1.3). Quality and affordability were common reasons for bypassing resources. Despite potential access to grocers in a high-poverty, urban region, half of participants bypassed nearby grocers to access food. Bypassing grocers was associated with a higher BMI. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

Relationship between theory of mind and functional independence is mediated by executive function.

Science.gov (United States)

Ahmed, Fayeza S; Miller, L Stephen

2013-06-01

Theory of mind (ToM) is the ability to comprehend another person's perspective. Although there is much literature of ToM in children, there is a limited and somewhat inconclusive amount of studies examining ToM in a geriatric population. This study examined ToM's relationship to functional independence. Two tests of ToM, tests of executive function, and a measure of functional ability were administered to cognitively intact older adults. Results showed that 1 test of ToM (Strange Stories test) significantly accounted for variance in functional ability, whereas the other did not (Faux Pas test). In addition, Strange Stories test performance was partially driven by a verbal abstraction-based executive function: proverb interpretation. A multiple mediation model was employed to examine whether executive functions explained the relationship between the Strange Stories test and functional ability. Results showed that both the combined and individual indirect effects of the executive function measures mediated the relationship. We argue that, although components of ToM are associated with functional independence, ToM does not appear to account for additional variance in functional independence beyond executive function measures. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.

Science.gov (United States)

Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S

2018-01-01

Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.

BMI-1 Mediates Estrogen-Deficiency-Induced Bone Loss by Inhibiting Reactive Oxygen Species Accumulation and T Cell Activation.

Science.gov (United States)

Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun

2017-05-01

Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and

Fuel shipment experience, fuel movements from the BMI-1 transport cask

International Nuclear Information System (INIS)

Bauer, Thomas L.; Krause, Michael G.

1986-01-01

The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask

DIFFERENCES IN PHYSICAL FITNESS AND CARDIOVASCULAR FUNCTION DEPEND ON BMI IN KOREAN MEN

OpenAIRE

Wi-Young So; Dai-Hyuk Choi

2010-01-01

We investigated the associations between cardiovascular function and both body mass index and physical fitness in Korean men. The subjects were 2,013 men, aged 20 to 83 years, who visited a health promotion center for a comprehensive medical and fitness test during 2006-2009. The WHO's Asia-Pacific Standard Report definition of BMI was used in this study. Fitness assessment of cardiorespiratory endurance, muscular strength, muscular endurance, flexibility, power, agility, and balance were eva...

Ethnicity influences BMI as evaluated from reported serum lipid values in Inuit and non-Inuit: raised upper limit of BMI in Inuit?

Science.gov (United States)

Noahsen, Paneeraq; Andersen, Stig

2013-01-01

To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.

Anti-aging Effect of Transplanted Amniotic Membrane Mesenchymal Stem Cells in a Premature Aging Model of Bmi-1 Deficiency

Science.gov (United States)

Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun

2015-01-01

To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922

Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

International Nuclear Information System (INIS)

Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

2017-01-01

The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

NARCIS (Netherlands)

Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and

Higher gestational weight gain is associated with increasing offspring birth weight independent of maternal glycemic control in women with type 1 diabetes

DEFF Research Database (Denmark)

Secher, Anna L; Parellada, Clara B; Ringholm, Lene

2014-01-01

; P = 0.02) and birth weight SD score (β = 0.06; P = 0.008) when adjusted for prepregnancy BMI, HbA1c at 36 weeks, smoking, parity, and ethnicity. CONCLUSIONS: Higher gestational weight gain in women with type 1 diabetes was associated with increasing offspring birth weight independent of glycemic......OBJECTIVE: We evaluate the association between gestational weight gain and offspring birth weight in singleton term pregnancies of women with type 1 diabetes. RESEARCH DESIGN AND METHODS: One hundred fifteen consecutive women referred at ... (prepregnancy BMI Women...

Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

Science.gov (United States)

Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

2017-01-22

The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

Directory of Open Access Journals (Sweden)

Mohamed Abdouh

Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

Science.gov (United States)

Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

2018-03-01

Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

Impact of HSD11B1 polymorphisms on BMI and components of the metabolic syndrome in patients receiving psychotropic treatments

KAUST Repository

Quteineh, Lina; Vandenberghe, Frederik; Saigi Morgui, Nuria; Delacré taz, Auré lie; Choong, Eva; Gholam-Rezaee, Mehdi; Magistretti, Pierre J.; Bondolfi, Guido; Von Gunten, Armin; Preisig, Martin A.; Castelao, Enrique; Vollenweider, Peter; Waeber, Gé rard; Bochud, Murielle; Kutalik, Zoltá n; Conus, Philippe O.; Eap, Chin Bin

2015-01-01

Background Metabolic syndrome (MetS) associated with psychiatric disorders and psychotropic treatments represents a major health issue. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme that catalyzes tissue regeneration of active cortisol from cortisone. Elevated enzymatic activity of 11β-HSD1 may lead to the development of MetS. Methods We investigated the association between seven HSD11B1 gene (encoding 11β-HSD1) polymorphisms and BMI and MetS components in a psychiatric sample treated with potential weight gain-inducing psychotropic drugs (n=478). The polymorphisms that survived Bonferroni correction were analyzed in two independent psychiatric samples (n R1 =168, n R2 =188) and in several large population-based samples (n 1 =5338; n 2 =123 865; n 3 >100 000). Results HSD11B1 rs846910-A, rs375319-A, and rs4844488-G allele carriers were found to be associated with lower BMI, waist circumference, and diastolic blood pressure compared with the reference genotype (P corrected <0.05). These associations were exclusively detected in women (n=257) with more than 3.1 kg/m 2, 7.5 cm, and 4.2 mmHg lower BMI, waist circumference, and diastolic blood pressure, respectively, in rs846910-A, rs375319-A, and rs4844488-G allele carriers compared with noncarriers (P corrected <0.05). Conversely, carriers of the rs846906-T allele had significantly higher waist circumference and triglycerides and lower high-density lipoprotein-cholesterol exclusively in men (P corrected =0.028). The rs846906-T allele was also associated with a higher risk of MetS at 3 months of follow-up (odds ratio: 3.31, 95% confidence interval: 1.53-7.17, P corrected =0.014). No association was observed between HSD11B1 polymorphisms and BMI and MetS components in the population-based samples. Conclusions Our results indicate that HSD11B1 polymorphisms may contribute toward the development of MetS in psychiatric patients treated with potential weight gain-inducing psychotropic drugs, but do not

Gender expression associated with BMI in a prospective cohort study of US adolescents.

Science.gov (United States)

Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A

2016-02-01

To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.

Uncomplicated obesity is associated with abnormal aortic function assessed by cardiovascular magnetic resonance

Directory of Open Access Journals (Sweden)

Channon Keith M

2008-02-01

Full Text Available Abstract Aims Obese subjects with insulin resistance and hypertension have abnormal aortic elastic function, which may predispose them to the development of left ventricular dysfunction. We hypothesised that obesity, uncomplicated by other cardiovascular risk factors, is independently associated with aortic function. Methods and results We used magnetic resonance imaging to measure aortic compliance, distensibility and stiffness index in 27 obese subjects (BMI 33 kg/m2 without insulin resistance and with normal cholesterol and blood pressure, and 12 controls (BMI 23 kg/m2. Obesity was associated with reduced aortic compliance (0.9 ± 0.1 vs. 1.5 ± 0.2 mm2/mmHg in controls, p -1 × 10-3, p Conclusion Aortic elastic function is abnormal in obese subjects without other cardiovascular risk factors. These findings highlight the independent importance of obesity in the development of cardiovascular disease.

Body Mass Index (BMI) Trajectories in Infancy Differ by Population Ancestry and May Presage Disparities in Early Childhood Obesity

Science.gov (United States)

Roy, Sani M.; Chesi, Alessandra; Mentch, Frank; Xiao, Rui; Chiavacci, Rosetta; Mitchell, Jonathan A.; Kelly, Andrea; Hakonarson, Hakon; Grant, Struan F.A.; Zemel, Babette S.

2015-01-01

Context: No consensus definition exists for excess adiposity during infancy. After age 2 years, high body mass index (BMI) is related to adverse cardiometabolic outcomes. Before age 2 years, the utility of BMI as a metric of excess adiposity is unknown. Objectives: The objective of the study was to characterize infant BMI trajectories in a diverse, longitudinal cohort and investigate the relationship between the infancy BMI trajectory and childhood obesity. Subjects: Healthy, nonpreterm infants (n = 2114) in the Genetic Causes for Complex Pediatric Disorders study (The Children's Hospital of Philadelphia) with six or more BMI measurements in the first 13.5 months participated in the study. Design: For each infant, the BMI trajectory was modeled using polynomial regression. Independent effects of clinical factors on magnitude and timing of peak BMI were assessed. The relationship between infancy BMI and early childhood BMI (age 4 y) was examined (n = 1075). Results: The cohort was 53% male and 61% African-American. Peak BMI was 18.6 ± 1.7 kg/m2 and occurred at 8.6 ± 1.4 months. In multivariate analysis, boys had a higher (0.50 kg/m2, P BMI than girls. The peak was higher (0.53 kg/m2, P ≤ .001) and occurred earlier (by 12 d, P BMI. Conclusions: We demonstrate sex- and ancestry-specific differences in infancy BMI and an association of infancy peak BMI with childhood BMI. These findings support the potential utility of infancy BMI to identify children younger than age 2 years with increased risk for later obesity. PMID:25636051

MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

Science.gov (United States)

Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

2015-01-01

Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

The impact of obesity on the relationship between epicardial adipose tissue, left ventricular mass and coronary microvascular function

International Nuclear Information System (INIS)

Bakkum, M.J.; Danad, I.; Romijn, M.A.J.; Stuijfzand, W.J.A.; Leonora, R.M.; Rossum, A.C. van; Knaapen, P.; Tulevski, I.I.; Somsen, G.A.; Lammertsma, A.A.; Kuijk, C. van; Raijmakers, P.G.

2015-01-01

Epicardial adipose tissue (EAT) has been linked to coronary artery disease (CAD) and coronary microvascular dysfunction. However, its injurious effect may also impact the underlying myocardium. This study aimed to determine the impact of obesity on the quantitative relationship between left ventricular mass (LVM), EAT and coronary microvascular function. A total of 208 (94 men, 45 %) patients evaluated for CAD but free of coronary obstructions underwent quantitative [ 15 O]H 2 O hybrid positron emission tomography (PET)/CT imaging. Coronary microvascular resistance (CMVR) was calculated as the ratio of mean arterial pressure to hyperaemic myocardial blood flow. Obese patients [body mass index (BMI) > 25, n = 133, 64 % of total] had more EAT (125.3 ± 47.6 vs 93.5 ± 42.1 cc, p < 0.001), a higher LVM (130.1 ± 30.4 vs 114.2 ± 29.3 g, p < 0.001) and an increased CMVR (26.6 ± 9.1 vs 22.3 ± 8.6 mmHg x ml -1 x min -1 x g -1 , p < 0.01) as compared to nonobese patients. Male gender (β = 40.7, p < 0.001), BMI (β = 1.61, p < 0.001), smoking (β = 6.29, p = 0.03) and EAT volume (β = 0.10, p < 0.01) were identified as independent predictors of LVM. When grouped according to BMI status, EAT was only independently associated with LVM in nonobese patients. LVM, hypercholesterolaemia and coronary artery calcium score were independent predictors of CMVR. EAT volume is associated with LVM independently of BMI and might therefore be a better predictor of cardiovascular risk than BMI. However, EAT volume was not related to coronary microvascular function after adjustments for LVM and traditional risk factors. (orig.)

The impact of obesity on the relationship between epicardial adipose tissue, left ventricular mass and coronary microvascular function

Energy Technology Data Exchange (ETDEWEB)

Bakkum, M.J.; Danad, I.; Romijn, M.A.J.; Stuijfzand, W.J.A.; Leonora, R.M.; Rossum, A.C. van; Knaapen, P. [VU University Medical Center, Department of Cardiology, Amsterdam (Netherlands); Tulevski, I.I.; Somsen, G.A. [Cardiology Centers of the Netherlands, Amsterdam (Netherlands); Lammertsma, A.A.; Kuijk, C. van; Raijmakers, P.G. [VU University Medical Center, Department of Radiology and Nuclear Medicine, Amsterdam (Netherlands)

2015-09-15

Epicardial adipose tissue (EAT) has been linked to coronary artery disease (CAD) and coronary microvascular dysfunction. However, its injurious effect may also impact the underlying myocardium. This study aimed to determine the impact of obesity on the quantitative relationship between left ventricular mass (LVM), EAT and coronary microvascular function. A total of 208 (94 men, 45 %) patients evaluated for CAD but free of coronary obstructions underwent quantitative [{sup 15}O]H{sub 2}O hybrid positron emission tomography (PET)/CT imaging. Coronary microvascular resistance (CMVR) was calculated as the ratio of mean arterial pressure to hyperaemic myocardial blood flow. Obese patients [body mass index (BMI) > 25, n = 133, 64 % of total] had more EAT (125.3 ± 47.6 vs 93.5 ± 42.1 cc, p < 0.001), a higher LVM (130.1 ± 30.4 vs 114.2 ± 29.3 g, p < 0.001) and an increased CMVR (26.6 ± 9.1 vs 22.3 ± 8.6 mmHg x ml{sup -1} x min{sup -1} x g{sup -1}, p < 0.01) as compared to nonobese patients. Male gender (β = 40.7, p < 0.001), BMI (β = 1.61, p < 0.001), smoking (β = 6.29, p = 0.03) and EAT volume (β = 0.10, p < 0.01) were identified as independent predictors of LVM. When grouped according to BMI status, EAT was only independently associated with LVM in nonobese patients. LVM, hypercholesterolaemia and coronary artery calcium score were independent predictors of CMVR. EAT volume is associated with LVM independently of BMI and might therefore be a better predictor of cardiovascular risk than BMI. However, EAT volume was not related to coronary microvascular function after adjustments for LVM and traditional risk factors. (orig.)

BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.

Science.gov (United States)

Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G

2018-01-01

Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.

Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance

International Nuclear Information System (INIS)

Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia

2012-01-01

Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the

Acute myeloid leukemia stem cell markers in prognosis and targeted therapy: potential impact of BMI-1, TIM-3 and CLL-1.

Science.gov (United States)

Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A

2016-09-06

Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.

Regularization independent analysis of the origin of two loop contributions to N=1 Super Yang-Mills beta function

Energy Technology Data Exchange (ETDEWEB)

Fargnoli, H.G.; Sampaio, Marcos; Nemes, M.C. [Federal University of Minas Gerais, ICEx, Physics Department, P.O. Box 702, Belo Horizonte, MG (Brazil); Hiller, B. [Coimbra University, Faculty of Science and Technology, Physics Department, Center of Computational Physics, Coimbra (Portugal); Baeta Scarpelli, A.P. [Setor Tecnico-Cientifico, Departamento de Policia Federal, Lapa, Sao Paulo (Brazil)

2011-05-15

We present both an ultraviolet and an infrared regularization independent analysis in a symmetry preserving framework for the N=1 Super Yang-Mills beta function to two loop order. We show explicitly that off-shell infrared divergences as well as the overall two loop ultraviolet divergence cancel out, whilst the beta function receives contributions of infrared modes. (orig.)

Regularization independent analysis of the origin of two loop contributions to N=1 Super Yang-Mills beta function

International Nuclear Information System (INIS)

Fargnoli, H.G.; Sampaio, Marcos; Nemes, M.C.; Hiller, B.; Baeta Scarpelli, A.P.

2011-01-01

We present both an ultraviolet and an infrared regularization independent analysis in a symmetry preserving framework for the N=1 Super Yang-Mills beta function to two loop order. We show explicitly that off-shell infrared divergences as well as the overall two loop ultraviolet divergence cancel out, whilst the beta function receives contributions of infrared modes. (orig.)

MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence.

Directory of Open Access Journals (Sweden)

Sujatha Venkataraman

Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.

Polycystic ovary syndrome patients with high BMI tend to have functional disorders of androgen excess: a prospective study.

Science.gov (United States)

Yuan, Chun; Liu, Xiaoqiang; Mao, Yundong; Diao, Feiyang; Cui, Yugui; Liu, Jiayin

2016-05-01

Biochemical or clinical changes of hyperandrogenism are important elements of polycystic ovary syndrome (PCOS). There is currently no consensus on the definition and diagnostic criteria of hyperandrogenism in PCOS. The aim of this study was to investigate the complex symptoms of hyperandrogenic disorders and the correlations between metabolism and hyperandrogenism in patients with PCOS from an outpatient reproductive medicine clinic in China. We conducted a case control study of 125 PCOS patients and 130 controls to evaluate differences in body mass index (BMI), total testosterone (TT), modified Ferriman-Gallwey hirsutism score, sex hormone binding globulin (SHBG), homeostasis model assessment-estimated insulin resistance (HOMA-IR) and free androgen index (FAI) between PCOS patients and controls and subgroups of PCOS. The prevalence of acne and hirsutism did not differ significantly between the hyperandrogenic and non-hyperandrogenic subgroup. Patients with signs of hyperandrogenism had significantly higher BMI (P PCOS patients. Our results suggest that PCOS patients with high BMI tend to have functional disorders of androgen excess; therefore, BMI may be a strong predictor of hyperandrogenism in PCOS. © 2016 the Journal of Biomedical Research. All rights reserved.

Influence of body mass index (BMI on functional improvements at 3 years following total knee replacement: a retrospective cohort study.

Directory of Open Access Journals (Sweden)

Paul Baker

Full Text Available BACKGROUND: The number of patients presenting for total knee replacement who are classified as obese is increasing. The functional benefits of performing TKR in these patients are unclear. AIM: To assess the influence pre-operative body mass index has upon knee specific function, general health status and patient satisfaction at 3 years following total knee replacement. DESIGN: Retrospective comparative cohort study using prospectively collected data from an institutional arthroplasty register. METHODS: 1367 patients were assessed using the Western Ontario and McMaster University Osteoarthritis Index (WOMAC and Medical Outcomes Trust Short Form-36 (SF-36 scores supplemented by a validated measure of satisfaction pre-operatively and subsequently at 1,2 and 3 year post-operatively. Comparisons were made by dividing the cohort into 4 groups based on body mass index (BMI 18.5-25.0 kg/m(2 (n = 253;>25.0-30.0 kg/m(2 (n = 559;>30.0-35.0 kg/m(2 (n = 373;>35.0 kg/m(2 (n = 182. RESULTS: Despite lower pre-operative, 1 and 3 year WOMAC and SF-36 scores patients with the highest BMIs >35.0 kg/m(2 experienced similar improvements to patients with a 'normal' BMI (18.5-25.0 kg/m(2 at 1 year (Difference in WOMAC improvement = 0.0 (95%CI -5.2 to 5.2, p = 1.00 and this improvement was sustained at up to 3 years (Difference in 1 year to 3 year improvement = 2.2 (95%CI: -2.1 to 6.5, p = 1.00. This effect was also observed for the SF-36 mental and physical component scores. Despite equivalent functional improvements levels of satisfaction in the >35.0 kg/m(2 group were lower than for any other BMI group (>35.0 kg/m(2 = 84.6% satisfied versus 18.5-5.0 kg/m(2 = 93.3% satisfied,p = 0.01 as was the proportion of patients who stated they would have the operation again (>35.0 kg/m(2 = 69.6% versus 18.5-25.0 kg/m(2 = 82.2%,p = 0.01. CONCLUSION: Obese and morbidly obese patients gain as much functional benefit from

Heartburn and other related symptoms are independent of body mass index in irritable bowel syndrome.

Science.gov (United States)

Schmulson, M; Pulido, D; Escobar, C; Farfán-Labone, B; Gutiérrez-Reyes, G; López-Alvarenga, J C

2010-04-01

increasing body mass index (BMI) is a risk factor for GERD but little is known about this association in the irritable bowel syndrome (IBS). to determine the presence of heartburn and other related symptoms in relation with BMI in IBS. volunteers (n = 483) answered the Rome II-Modular Questionnaire, and were divided into IBS and non-IBS (controls) groups. The frequency of heartburn, chest pain, epigastric pain, nausea, vomiting and belching was compared between the groups in the study sample and within three BMI categories. the IBS (23.7%) and controls (76.3%) were similar in gender (females: 68.1%), age (32.2 +/- 12.7 years), and BMI (25.4 +/- 4.4). Raw associations analysis showed that heartburn: OR: 1.62 (95%CI: 1.04-2.53), chest pain: 1.77 (1.13-2.77), epigastric pain: 1.75 (1.03-2.98) and nausea: 2.45 (1.10-5.32) were more frequent in IBS vs. controls. Meanwhile, according to BMI, in those with obesity, heartburn was more frequent in IBS and among those with overweight, epigastric pain and nausea were also more frequent in IBS. However, in an adjusted log linear model, no significant interaction was found between BMI and any other studied symptom and heartburn was found to be independent of IBS: 1,4 (0.9, 4.7). Finally, a logistic regression model found no interaction between BMI and the presence of heartburn or IBS. while heartburn and other reflux-related symptoms are more frequent in IBS than in controls, these associations are independent of BMI.

Body mass index (BMI) in the Saudi population of Gassim.

Science.gov (United States)

Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H

1998-01-01

In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.

Biologic consequences of Stat1-independent IFN signaling

OpenAIRE

Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.

2001-01-01

Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on m...

Using maleic anhydride functionalized graphene oxide for improving the interfacial properties of carbon fiber/BMI composites

Directory of Open Access Journals (Sweden)

W. Li

2016-11-01

Full Text Available Maleic anhydride functionalized graphene oxide (MAH-GO was synthesized and then introduced into carbon fiber (CF reinforced bismaleimide (BMI composites, with the aim of improving the interfacial adhesion strength between CF and BMI resin. Various characterization techniques including Fourier transform infrared spectroscopy (FT-IR, X-ray photoelectron spectra (XPS and thermogravimetric analysis (TGA demonstrated that the maleic anhydride has been successfully grafted onto the GO surfaces. The study showed that the interlaminar shear strength (ILSS and flexural properties of CF/BMI composites were all improved by the incorporation of GO and MAH-GO, and the MAH-GO showed the substantially improved effect due to the strong interaction between the MAH-GO and the resin matrix. The maximum increment of the ILSS, flexural strength and flexural modulus of composites were 24.4, 28.7 and 49.7%, respectively. Scanning electron microscope (SEM photographs of the fracture surfaces revealed that the interfacial bonding between CF and resin matrix was significantly strengthened by the addition of MAH-GO. The results suggest that this feasible method may be an ideal substitute for the traditional method in the interfacial modification of composites.

On criteria for algebraic independence of collections of functions satisfying algebraic difference relations

Directory of Open Access Journals (Sweden)

Hiroshi Ogawara

2017-01-01

Full Text Available This paper gives conditions for algebraic independence of a collection of functions satisfying a certain kind of algebraic difference relations. As applications, we show algebraic independence of two collections of special functions: (1 Vignéras' multiple gamma functions and derivatives of the gamma function, (2 the logarithmic function, \\(q\\-exponential functions and \\(q\\-polylogarithm functions. In a similar way, we give a generalization of Ostrowski's theorem.

Recombinant TAT-BMI-1 fusion protein induces ex vivo expansion of human umbilical cord blood-derived hematopoietic stem cells.

Science.gov (United States)

Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni

2017-07-04

Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.

Reduced cortical thickness associated with visceral fat and BMI

Directory of Open Access Journals (Sweden)

Ralf Veit

2014-01-01

Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.

Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

International Nuclear Information System (INIS)

Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

2014-01-01

Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

Prospective associations between sedentary lifestyle and BMI in midlife.

Science.gov (United States)

Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A

2006-08-01

A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.

[In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

Science.gov (United States)

Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

2018-03-28

To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

Plasminogen activator inhibitor-1 is elevated in patients with COPD independent of metabolic and cardiovascular function

Science.gov (United States)

Waschki, Benjamin; Watz, Henrik; Holz, Olaf; Magnussen, Helgo; Olejnicka, Beata; Welte, Tobias; Rabe, Klaus F; Janciauskiene, Sabina

2017-01-01

Introduction Plasminogen activator inhibitor-1 (PAI-1), a major inhibitor of fibrinolysis, is associated with thrombosis, obesity, insulin resistance, dyslipidemia, and premature aging, which all are coexisting conditions of chronic obstructive pulmonary disease (COPD). The role of PAI-1 in COPD with respect to metabolic and cardiovascular functions is unclear. Methods In this study, which was nested within a prospective cohort study, the serum levels of PAI-1 were cross-sectionally measured in 74 stable COPD patients (Global Initiative for Chronic Obstructive Lung Disease [GOLD] Stages I–IV) and 18 controls without lung disease. In addition, triglycerides, high-density lipoprotein cholesterol, fasting plasma glucose, waist circumference, blood pressure, smoking status, high-sensitive C-reactive protein (hs-CRP), adiponectin, ankle–brachial index, N-terminal pro-B-type natriuretic peptide, and history of comorbidities were also determined. Results The serum levels of PAI-1 were significantly higher in COPD patients than in controls, independent of a broad spectrum of possible confounders including metabolic and cardiovascular dysfunction. A multivariate regression analysis revealed triglyceride and hs-CRP levels to be the best predictors of PAI-1 within COPD. GOLD Stages II and III remained independently associated with higher PAI-1 levels in a final regression analysis. Conclusion The data from the present study showed that the serum levels of PAI-1 are higher in patients with COPD and that moderate-to-severe airflow limitation, hypertriglyceridemia, and systemic inflammation are independent predictors of an elevated PAI-1 level. PAI-1 may be a potential biomarker candidate for COPD-specific and extra-pulmonary manifestations. PMID:28356730

Colour-independent partition functions in coloured vertex models

Energy Technology Data Exchange (ETDEWEB)

Foda, O., E-mail: omar.foda@unimelb.edu.au [Dept. of Mathematics and Statistics, University of Melbourne, Parkville, VIC 3010 (Australia); Wheeler, M., E-mail: mwheeler@lpthe.jussieu.fr [Laboratoire de Physique Théorique et Hautes Energies, CNRS UMR 7589 (France); Université Pierre et Marie Curie – Paris 6, 4 place Jussieu, 75252 Paris cedex 05 (France)

2013-06-11

We study lattice configurations related to S{sub n}, the scalar product of an off-shell state and an on-shell state in rational A{sub n} integrable vertex models, n∈{1,2}. The lattice lines are colourless and oriented. The state variables are n conserved colours that flow along the line orientations, but do not necessarily cover every bond in the lattice. Choosing boundary conditions such that the positions where the colours flow into the lattice are fixed, and where they flow out are summed over, we show that the partition functions of these configurations, with these boundary conditions, are n-independent. Our results extend to trigonometric A{sub n} models, and to all n. This n-independence explains, in vertex-model terms, results from recent studies of S{sub 2} (Caetano and Vieira, 2012, [1], Wheeler, (arXiv:1204.2089), [2]). Namely, 1.S{sub 2}, which depends on two sets of Bethe roots, {b_1} and {b_2}, and cannot (as far as we know) be expressed in single determinant form, degenerates in the limit {b_1}→∞, and/or {b_2}→∞, into a product of determinants, 2. Each of the latter determinants is an A{sub 1} vertex-model partition function.

Colour-independent partition functions in coloured vertex models

International Nuclear Information System (INIS)

Foda, O.; Wheeler, M.

2013-01-01

We study lattice configurations related to S n , the scalar product of an off-shell state and an on-shell state in rational A n integrable vertex models, n∈{1,2}. The lattice lines are colourless and oriented. The state variables are n conserved colours that flow along the line orientations, but do not necessarily cover every bond in the lattice. Choosing boundary conditions such that the positions where the colours flow into the lattice are fixed, and where they flow out are summed over, we show that the partition functions of these configurations, with these boundary conditions, are n-independent. Our results extend to trigonometric A n models, and to all n. This n-independence explains, in vertex-model terms, results from recent studies of S 2 (Caetano and Vieira, 2012, [1], Wheeler, (arXiv:1204.2089), [2]). Namely, 1.S 2 , which depends on two sets of Bethe roots, {b 1 } and {b 2 }, and cannot (as far as we know) be expressed in single determinant form, degenerates in the limit {b 1 }→∞, and/or {b 2 }→∞, into a product of determinants, 2. Each of the latter determinants is an A 1 vertex-model partition function

Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

International Nuclear Information System (INIS)

Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

2012-01-01

Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

Neurodevelopmental problems and extremes in BMI

Directory of Open Access Journals (Sweden)

Nóra Kerekes

2015-07-01

Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than

Specific Sirt1 Activator-mediated Improvement in Glucose Homeostasis Requires Sirt1-Independent Activation of AMPK

Directory of Open Access Journals (Sweden)

Sung-Jun Park

2017-04-01

Full Text Available The specific Sirt1 activator SRT1720 increases mitochondrial function in skeletal muscle, presumably by activating Sirt1. However, Sirt1 gain of function does not increase mitochondrial function, which raises a question about the central role of Sirt1 in SRT1720 action. Moreover, it is believed that the metabolic effects of SRT1720 occur independently of AMP-activated protein kinase (AMPK, an important metabolic regulator that increases mitochondrial function. Here, we show that SRT1720 activates AMPK in a Sirt1-independent manner and SRT1720 activates AMPK by inhibiting a cAMP degrading phosphodiesterase (PDE in a competitive manner. Inhibiting the cAMP effector protein Epac prevents SRT1720 from activating AMPK or Sirt1 in myotubes. Moreover, SRT1720 does not increase mitochondrial function or improve glucose tolerance in AMPKα2 knockout mice. Interestingly, weight loss induced by SRT1720 is not sufficient to improve glucose tolerance. Therefore, contrary to current belief, the metabolic effects produced by SRT1720 require AMPK, which can be activated independently of Sirt1.

Analysis of the prognostic value of BMI and the difference in its impact according to age and sex in DLBCL patients.

Science.gov (United States)

Kanemasa, Yusuke; Shimoyama, Tatsu; Sasaki, Yuki; Tamura, Miho; Sawada, Takeshi; Omuro, Yasushi; Hishima, Tsunekazu; Maeda, Yoshiharu

2018-02-01

Studies that have evaluated the prognostic value of body mass index (BMI) in patients with diffuse large B-cell lymphoma have recently been reported. However, the impact of BMI on survival outcomes remains controversial. We retrospectively analyzed the data of 406 diffuse large B-cell lymphoma patients treated with R-CHOP or R-CHOP-like regimens. The number (%) of patients that were categorized into 1 of 4 groups according to BMI were underweight (BMI (BMI (≥25 kg/m 2 ) (5-y OS, 61.5% vs 85.7%; P = .039). In contrast, in young female patients (BMI had significantly better OS than those with a high BMI (5-y OS, 88.6% vs 46.4%; P BMI on OS between young and elderly patients. In this study, we demonstrated that being underweight and obese were independent prognostic factors compared with being normal weight. In female patients, BMI had a different impact on the prognosis of young and elderly patients, whereas in male patients, there was no difference in the effect of BMI on prognosis according to age. Copyright © 2017 John Wiley & Sons, Ltd.

Functional Independence in Late-Life: Maintaining Physical Functioning in Older Adulthood Predicts Daily Life Function after Age 80.

Science.gov (United States)

Vaughan, Leslie; Leng, Xiaoyan; La Monte, Michael J; Tindle, Hilary A; Cochrane, Barbara B; Shumaker, Sally A

2016-03-01

We examined physical functioning (PF) trajectories (maintaining, slowly declining, and rapidly declining) spanning 15 years in older women aged 65-80 and protective factors that predicted better current levels and less decline in functional independence outcomes after age 80. Women's Health Initiative extension participants who met criteria (enrolled in either the clinical trial or observational study cohort, >80 years at the data release cutoff, PF survey data from initial enrollment to age 80, and functional independence survey data after age 80) were included in these analyses (mean [SD] age = 84.0 [1.4] years; N = 10,478). PF was measured with the SF-36 (mean = 4.9 occasions). Functional independence was measured by self-reported level of dependence in basic and instrumental activities of daily living (ADLs and IADLs) (mean = 3.4 and 3.3 occasions). Maintaining consistent PF in older adulthood extends functional independence in ADL and IADL in late-life. Protective factors shared by ADL and IADL include maintaining PF over time, self-reported excellent or very good health, no history of hip fracture after age 55, and no history of cardiovascular disease. Better IADL function is uniquely predicted by a body mass index less than 25 and no depression. Less ADL and IADL decline is predicted by better self-reported health, and less IADL decline is uniquely predicted by having no history of hip fracture after age 55. Maintaining or improving PF and preventing injury and disease in older adulthood (ages 65-80) has far-reaching implications for improving late-life (after age 80) functional independence. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Gender and socioeconomic disparities in BMI trajectories in the Seychelles: a cohort analysis based on serial population-based surveys.

Science.gov (United States)

Rossi, Isabelle A; Rousson, Valentin; Viswanathan, Bharathi; Bovet, Pascal

2011-12-09

The relationship between body mass index (BMI) and socioeconomic status (SES) tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region). We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403). We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p < 0.001). The difference in BMI between men or women of high vs. low SES did not change significantly across successive cohorts (the interaction between SES and year of birth of cohort was statistically not significant). Smoking was associated with lower BMI in men and women (respectively -1.55 kg/m2 and 2.46 kg/m2, p < 0.001). Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.

Depression and BMI influences the serum vascular endothelial growth factor level

DEFF Research Database (Denmark)

Elfving, Betina; Buttenschøn, Henriette Nørmølle; Foldager, Leslie

2014-01-01

in serum by immunoassay and independent determinants of the serum VEGF level were assessed by generalized linear models.The main findings were that depression, severity of depression, previous depressive episodes, age and body mass index (BMI) were associated with higher serum VEGF levels. The genetic...... marker rs10434 was significantly associated with depression after correction for multiple testing, but not with the serum VEGF level. Our final model included depression and BMI as predictors of serum VEGF levels. Our study suggests a role for circulating serum VEGF in depression. Furthermore, our data...

BMI, total and abdominal fat distribution, and cardiovascular risk factors in school-age children.

Science.gov (United States)

Gishti, Olta; Gaillard, Romy; Durmus, Busra; Abrahamse, Marieke; van der Beek, Eline M; Hofman, Albert; Franco, Oscar H; de Jonge, Layla L; Jaddoe, Vincent W V

2015-05-01

More specific total body and abdominal fat mass measures might be stronger associated with cardiovascular risk factors in childhood, than BMI. We examined the independent associations of total and abdominal fat measures with cardiovascular risk factors in school age children. We performed a population-based cohort study among 6,523 children. At the age of 6 y, we measured childhood BMI, and general and abdominal fat mass, using dual-energy X-ray absorptiometry, and ultrasound and cardiovascular risk factors. Conditional on BMI, higher fat mass percentage and abdominal fat mass were associated with higher blood pressure, total- and low-density lipoprotein (LDL)-cholesterol, insulin and c-peptide levels, but with lower left ventricular mass and high-density lipoprotein (HDL)-cholesterol (P values children. Higher childhood adiposity measures were associated with increased odds of cardiovascular risk factors clustering, with the strongest effect for fat mass percentage (odds ratios: 3.01 (95% confidence interval: 2.67, 3.9). Our results suggest that general and abdominal fat measures are associated with cardiovascular risk factors in childhood, independent from BMI. These measures may provide additional information for identification of children with an adverse cardiovascular profile.

Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

Energy Technology Data Exchange (ETDEWEB)

Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

2012-05-25

Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

The oncoprotein and stem cell renewal factor BMI1 associates with poor clinical outcome in oesophageal cancer patients undergoing preoperative chemoradiotherapy

Directory of Open Access Journals (Sweden)

Yoshikawa Reigetsu

2012-10-01

Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.

Self-control mediates the relationship between time perspective and BMI.

Science.gov (United States)

Price, Menna; Higgs, Suzanne; Lee, Michelle

2017-01-01

Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

The influence of demographic, environmental and physical factors on functional independence post stroke

Directory of Open Access Journals (Sweden)

M.V. Mamabolo

2008-01-01

Full Text Available Purpose: The magnitude of disability observed in strokesurvivors is believed to be dependent in part, on the severity of neurological deficits incurred. A s important but less well understood, is thecontribution of demographic, physical and environmental factors. The objective of this study was to establish what demographic, environmentaland physical factors influence functional independence post stroke. Method: Convenience sampling was used in the selection of subjects from four stroke outpatient public health facilities in the Gauteng Province of South Africa. The data were collected using a structured questionnaire. The analytical tools used included descriptive statistics to measure percentages and cross tabulations to measure the level of associations between functional independence and some of the demographic factors. The Barthel Index was computed to establish the degree of functional independence. Finally the influence of factors on functional independence was investigated using bivariate logistic regressions.Results: The results showed that younger patients (18 - 34 yrs may have a higher likelihood of functional independence compared to older patients at the time of discharge from hospital (18 - 34 years: Odds Ratio = 1. Patients without helpers were more likely to be functionally independent than those with a helper (p = 0.03. Involvement in household activities (p = 0.01, participation in community activities (p = 0.02 and bowel and bladder continence (p = 0.003 and p = 0.04 improved the likelihood of functional independence.Conclusion and im plications: Factors that influence functional independence post stroke are: age, bowel and bladder continence, the presence of a caregiver, participation in household and community activities. It is also of value to encourage patients to participate in household and community activities post stroke as well as being less dependent on helpers in an effort to attain functional independence post

p38 MAPK-Mediated Bmi-1 Down-Regulation and Defective Proliferation in ATM-Deficient Neural Stem Cells Can Be Restored by Akt Activation

Science.gov (United States)

Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.

2011-01-01

A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053

Childhood maltreatment and BMI trajectories to mid-adult life: follow-up to age 50 y in a British birth cohort.

Directory of Open Access Journals (Sweden)

Chris Power

Full Text Available Childhood maltreatment including abuse and neglect has been associated with adult obesity, but evidence on life-course development of obesity or BMI gain is unclear. We aim to establish whether childhood maltreatments are related to obesity or BMI at different life-stages 7 y-50 y and to identify possible explanations for associations.Childhood physical, psychological and sexual abuse, neglect and BMI at seven ages were recorded in the 1958 birth cohort (n~15,000. Associations of child maltreatments with BMI at separate ages were tested using linear regression or logistic regression for obesity, and with rate of child-to-adult BMI gain using multilevel models. We adjusted for potential covariates.Abuse was reported in ~12% of the population. Abuse was not associated with elevated childhood BMI, but adult associations were observed: i.e. the abused had faster child-adult BMI gain than the non-abused; associations were independent of adult covariates. For physical abuse in both genders there was a positive linear association of ~0.006/y zBMI gain with age after adjustment for all covariates. Similarly, there was a linear association of physical abuse with obesity risk: e.g. among females from a low OR(adjusted of 0.34 (0.16,0.71 at 7 y to 1.67 (1.25,2.24 at 50 y. In females faster zBMI gains with age of ~0.0034/y were observed for sexual abuse and increases in obesity risk were faster: from a low OR(adjusted of 0.23 (0.06,0.84 at 7 y to 1.34 (0.86,2.10 at 50 y. Psychological abuse and neglect associations were less consistent.Childhood maltreatment associations with BMI or obesity varied across life: physical and, in females, sexual abuse were associated with faster lifetime BMI gains, which may have detrimental long-term health consequences.

Gender and socioeconomic disparities in BMI trajectories in the Seychelles: a cohort analysis based on serial population-based surveys

Directory of Open Access Journals (Sweden)

Rossi Isabelle A

2011-12-01

Full Text Available Abstract Background The relationship between body mass index (BMI and socioeconomic status (SES tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region. Methods We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403. We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. Results BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p 2 and 2.46 kg/m2, p Conclusions Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.

Body Composition within the First 3 Months: Optimized Correction for Length and Correlation with BMI at 2 Years.

Science.gov (United States)

Hawkes, Colin P; Zemel, Babette S; Kiely, Mairead; Irvine, Alan D; Kenny, Louise C; O'B Hourihane, Jonathan; Murray, Deirdre M

2016-01-01

Although early infant growth has implications for future health, body composition reference data in infancy are limited. The aim of this study was to describe reference data for fat mass (FM) and fat-free mass (FFM) corrected for length (L) within the first 3 months and to evaluate if these measures predict the body mass index (BMI) at 2 years. Term infants had air displacement plethysmography performed at birth (n = 1,063) and approximately 2 months later (n = 922, between 49 and 86 days). Age- and sex-specific reference data were generated for FM, FFM, FM/L 3 and FFM/L 2 and compared with BMI at 2 years. FM/L 3 and FFM/L 2 were the optimal indices independent of length. In the first 3 months, mean FM/L 3 increased (males, from 2.7 to 5.9 kg/m 3 ; females, from 3.2 to 6.1 kg/m 3 ), whereas FFM/L 2 remained relatively stable (males, from 11.8 to 12.7 kg/m 2 ; females, from 12.8 to 12.1 kg/m 2 ). The odds of a BMI Z-score ≥2 at 2 years increased with increasing FM (OR 2.7, 95% CI 1.97-3.7) and weight (OR 2.27, 95% CI 1.64-3.13) Z-scores at 2 months. FM/L 3 and FFM/L 2 provide length-independent measures of FM and FFM in infancy. During the first 3 months, there is an increase in FM/L 3 , but not in FFM/L 2 . The weight Z-score at 2 months is as good at predicting BMI at 2 years as body composition parameters. © 2016 S. Karger AG, Basel.

c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.

Science.gov (United States)

Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B

2012-04-01

Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.

Correlation between demographic characteristics, cognitive functioning and functional independence in stroke patients

Directory of Open Access Journals (Sweden)

Arsić Slađana

2016-01-01

Full Text Available Introduction. It has been assumed that there is causality of the achieved level of functional independence with the degree of preservation of cognitive function in stroke patients. Demographic characteristics may be important for monitoring the achieved level of functional independence. Objective. The aim of this study was to examine the relationship of demographic characteristics and functional independence in regard to the level of cognitive impairment in stroke patients. Methods. The study included 50 stroke patients after rehabilitation, as well as age- and gender-matched 50 subjects selected randomly, according to the demographic characteristics of the studied sample, who in their medical history had no neurological disorders. For the assessment of functional independence, the Functional Independence Measure (FIM test was used. The general cognition was estimated by the Mini-Mental State Examination (MMSE test. The statistical analyses included the Mann-Whitney test, for two independent samples, measures of canonical correlation, and χ2 test. Results. There was a statistically significant difference between the groups in relation to risk factors, hypertension and diabetes mellitus type II (p<0.001; There was a statistically significant difference within the groups in relation to the cognitive impairment in all the examined demographic characteristics (p<0.001; the differences within the groups in relation to the cognitive impairment are present on all subscales of the FIM test (p<0.05; the differences within the groups in relation to handedness, hemiparesis, show that mild cognitive impairment is more common among left hemiparesis, while a more severe one is more common among right-sided hemiparesis (p<0.05; More severe cognitive impairment is common among women, the elderly and in persons with lower education (p<0.05. Conclusion. By prevention of risk factors, and prevention of possible cognitive impairment, consequences of stroke can be

The Role of BMI in Hip Fracture Surgery.

Science.gov (United States)

Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry

2018-01-01

Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.

DIFFERENCES IN PHYSICAL FITNESS AND CARDIOVASCULAR FUNCTION DEPEND ON BMI IN KOREAN MEN

Directory of Open Access Journals (Sweden)

Wi-Young So

2010-06-01

Full Text Available We investigated the associations between cardiovascular function and both body mass index and physical fitness in Korean men. The subjects were 2,013 men, aged 20 to 83 years, who visited a health promotion center for a comprehensive medical and fitness test during 2006-2009. The WHO's Asia-Pacific Standard Report definition of BMI was used in this study. Fitness assessment of cardiorespiratory endurance, muscular strength, muscular endurance, flexibility, power, agility, and balance were evaluated by VO2max (ml/kg/min, grip strength (kg, sit-ups (reps/min, sit and reach (cm, vertical jump (cm, side steps (reps/30s, and standing on one leg with eyes closed (sec, respectively. For cardiovascular function, we evaluated systolic blood pressure (SBP, diastolic blood pressure (DBP, resting heart rate (RHR, double product (DP, and vital capacity. There were significant decreases in cardiorespiratory endurance (p < 0.001, power (p < 0.001, and balance (p < 0.001, and increases in muscular strength (p < 0.001. Further, cardiovascular function, including SBP (p < 0.001, DBP (p < 0.001, double product (p < 0.001, and vital capacity (p=0.006 appeared to be lower for the obesity group. We conclude that an obese person exhibits lower fitness level and weaker cardiovascular function than a normal person

Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI.

Science.gov (United States)

Carr, Katelyn A; Lin, Henry; Fletcher, Kelly D; Sucheston, Lara; Singh, Prashant K; Salis, Robbert J; Erbe, Richard W; Faith, Myles S; Allison, David B; Stice, Eric; Epstein, Leonard H

2013-06-01

Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight, and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin, and opioid systems, as well as food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314, in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model only influences one end of the outcome measure. The interaction with MAOA-LPR better fits the diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity, and support the hypothesis that genetics moderate the association between food reinforcement and BMI. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Scaling of adult body weight to height across sex and race/ethnic groups: relevance to BMI.

Science.gov (United States)

Heymsfield, Steven B; Peterson, Courtney M; Thomas, Diana M; Heo, Moonseong; Schuna, John M; Hong, Sangmo; Choi, Woong

2014-12-01

Body mass index (BMI) is formulated on the assumption that body weight (BW) scales to height with a power of 2 (BW∝height(2)), independent of sex and race-ethnicity. Powers differing from 2 are observed in studies of selected samples, thus raising the question if BMI is a generalizable metric that makes BW independent of height across populations. The objectives were to test the hypothesis that adult BW scales to height with a power of 2 independent of sex and race-ethnicity and to advance an understanding of BMI as a measure of shape by extending allometric analyses to waist circumference (WC). We conducted cross-sectional subject evaluations, including body composition, from the NHANES and the Korean NHANES (KNHANES). Variations of the allometric model (Y = αX(β)) were used to establish height scaling powers (β ± SE) across non-Hispanic white and black, Mexican American, and Korean men and women. Exploratory analyses in population samples established age and adiposity as important independent determinants of height scaling powers (i.e., β). After age and adiposity in the next series of analyses were controlled for, BW scaling powers were nonsignificantly different between race/ethnic groups within each sex group; WC findings were similar in women, whereas small but significant between-race differences were observed in the men. Sex differences in β values were nonsignificant except for BW in non-Hispanic blacks and WC in Koreans (P ethnic groups, an observation that makes BMI a generalizable height-independent measure of shape across most populations. WC also follows generalizable scaling rules, a finding that has implications for defining body shape in populations who differ in stature. © 2014 American Society for Nutrition.

Differences in the association between childhood trauma and BMI in ...

African Journals Online (AJOL)

However,independent of BMI group, there were significant differences in socioeconomic status (SES) between black and white women (P<0.01). Total CTQ score, as well as the sub-scales, physical and emotional neglect, and physical and sexual abuse were higher in black than white women (all P<0.05), but these scores ...

Do substantial BMI reduction episodes among Swedish schoolchildren have any impact on their final height?

Science.gov (United States)

Nilsen, Bente B; Yngve, Agneta; Werner, Bo

2018-02-06

This study investigated whether substantial body mass index (BMI) reductions in Swedish schoolchildren aged seven years to 19 years, caused by disease, healthy or unhealthy behaviour, had any impact on their final height. We used height and weight data on 6572 subjects from two nationally representative longitudinal samples of Swedish children born in 1973 and 1981. These provided information on their final height and any BMI reduction episodes. Of the 6572 subjects (50.9% boys), among individuals with information on final height, 1118 had a BMI reduction of 5% and BMI reduction of 10% or more. On a group level, there was no statistically significant difference in the final height of individuals with BMI reductions of 10% or more and those without. The findings were independent of age and the subject's BMI at the start of the reduction episode. However, there were a number of cases where a substantial BMI reduction probably had an impact on the subject's final height. Our study found no evidence that a substantial BMI reduction had any impact on final height on a group level, but further analyses of specific case studies are necessary to determine whether substantial BMI reduction might have an impact on final height. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

Contributory factors for the functional independence of oldest old

Directory of Open Access Journals (Sweden)

Dâmarys Kohlbeck de Melo Neu Ribeiro

2015-02-01

Full Text Available OBJECTIVE To investigate the socioeconomic and clinical factors that contribute to the functional independence of the oldest old of a community. METHOD Cross-sectional quantitative study whose sample consisted of 214 elderly people registered in Basic Health Units. Data were collected through structured interviews and application of the Functional Independence Measure. We used descriptive statistics, and for association of the variables we used the Student t-test, ANOVA and Tukey's test for multiple comparisons. RESULTS The significant variables that contributed to the functional independence were remaining economically active, practicing physical and leisure activities, having a social life, eating fruits, vegetables and meat. The orientation to conduct these practices reduces the demand for care and help needed in everyday activities. CONCLUSION Maintaining independence is primordial to delay disability and presents itself as an excellent field of work for nursing.

Pain and functional impairment as mediators of the link between medical symptoms and depression in type 2 diabetes.

Science.gov (United States)

Sacco, William P; Bykowski, Cathy A; Mayhew, Laura L

2013-03-01

Among people with diabetes, depression is more common and is associated with greater morbidity and mortality. A better understanding of mechanisms underlying the link between poor health and depression is needed. Pain and functional impairment may account for the effect of poor health on depression in diabetes. The purpose of the study was to examine whether pain and functional impairment mediate the association between diabetes-related medical symptoms and depression in type 2 diabetes. Adults diagnosed with type 2 diabetes (N = 77) completed the following measures: Patient Health Questionnaire (PHQ), Diabetes Symptom Checklist (DSC), and Medical Outcomes Study 12-item Short-Form Health Survey (SF-12). Body mass index (BMI) was computed using height and weight data from medical records. Mediation and linear regression analyses were conducted. Pain and functional impairment made significant, independent contributions to depression. Functional impairment mediated the link between diabetes-related medical symptoms and depression. Pain mediated the association between higher BMI and depression. Pain and functional impairment appear to play important, independent roles in depression in type 2 diabetes. Mediation analyses suggest the following: 1. diabetes-related medical problems increase functional impairment, which in turn leads to greater depression; and 2. the burden of carrying greater body mass (higher BMI) increases pain, which leads to increased depression.

Measure of functional independence dominates discharge outcome prediction after inpatient rehabilitation for stroke.

Science.gov (United States)

Brown, Allen W; Therneau, Terry M; Schultz, Billie A; Niewczyk, Paulette M; Granger, Carl V

2015-04-01

Identifying clinical data acquired at inpatient rehabilitation admission for stroke that accurately predict key outcomes at discharge could inform the development of customized plans of care to achieve favorable outcomes. The purpose of this analysis was to use a large comprehensive national data set to consider a wide range of clinical elements known at admission to identify those that predict key outcomes at rehabilitation discharge. Sample data were obtained from the Uniform Data System for Medical Rehabilitation data set with the diagnosis of stroke for the years 2005 through 2007. This data set includes demographic, administrative, and medical variables collected at admission and discharge and uses the FIM (functional independence measure) instrument to assess functional independence. Primary outcomes of interest were functional independence measure gain, length of stay, and discharge to home. The sample included 148,367 people (75% white; mean age, 70.6±13.1 years; 97% with ischemic stroke) admitted to inpatient rehabilitation a mean of 8.2±12 days after symptom onset. The total functional independence measure score, the functional independence measure motor subscore, and the case-mix group were equally the strongest predictors for any of the primary outcomes. The most clinically relevant 3-variable model used the functional independence measure motor subscore, age, and walking distance at admission (r(2)=0.107). No important additional effect for any other variable was detected when added to this model. This analysis shows that a measure of functional independence in motor performance and age at rehabilitation hospital admission for stroke are predominant predictors of outcome at discharge in a uniquely large US national data set. © 2015 American Heart Association, Inc.

Prediction of BMI by impulsivity, eating behavior and activity level

Directory of Open Access Journals (Sweden)

Jiang Xiaxia

2016-01-01

Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.

Clathrin-independent endocytosis: mechanisms and function

DEFF Research Database (Denmark)

Sandvig, Kirsten; Pust, Sascha; Skotland, Tore

2011-01-01

It is now about 20 years since we first wrote reviews about clathrin-independent endocytosis. The challenge at the time was to convince the reader about its existence. Then the suggestion came up that caveolae might be responsible for the uptake. However, clearly this could not be the case since ...... having several functions of their own. This article aims at providing a brief update on the importance of clathrin-independent endocytic mechanisms, how the processes are regulated differentially, for instance on the poles of polarized cells, and the challenges in studying them....

Independent effects of sleep duration and body mass index on the risk of a work-related injury: evidence from the US National Health Interview Survey (2004-2010).

Science.gov (United States)

Lombardi, David A; Wirtz, Anna; Willetts, Joanna L; Folkard, Simon

2012-06-01

Fatigue has been linked to adverse safety outcomes, and poor quality or decreased sleep has been associated with obesity (higher body mass index, BMI). Additionally, higher BMI is related to an increased risk for injury; however, it is unclear whether BMI modifies the effect of short sleep or has an independent effect on work-related injury risk. To answer this question, the authors examined the risk of a work-related injury as a function of total daily sleep time and BMI using the US National Health Interview Survey (NHIS). The NHIS is an in-person household survey using a multistage, stratified, clustered sample design representing the US civilian population. Data were pooled for the 7-yr survey period from 2004 to 2010 for 101 891 "employed" adult subjects (51.7%; 41.1 ± yrs of age [mean ± SEM]) with data on both sleep and BMI. Weighted annualized work-related injury rates were estimated across a priori defined categories of BMI: healthy weight (BMI: work-related injury. The initial model examined the interaction among daily sleep duration and BMI, controlling for weekly working hours, age, sex, race/ethnicity, education, type of pay, industry, and occupation. No significant interaction was found between usual daily sleep duration and BMI (p = .72); thus, the interaction term of the final logistic model included these two variables as independent predictors of injury, along with the aforementioned covariates. Statistically significant covariates (p ≤ .05) included age, sex, weekly work hours, occupation, and if the worker was paid hourly. The lowest categories of usual sleep duration (7-8 h did not significantly elevate risk. The adjusted injury risk odds ratio (OR) for a worker with a usual daily sleep of work-related injury risk for reduced sleep regardless of worker's body mass. However, being an overweight worker also increases work-injury risk regardless of usual daily sleep duration. The independent additive risk of these factors on work

Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.

Science.gov (United States)

Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena

2016-04-01

While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.

Are BMI and Sedentariness Correlated? A Multilevel Study in Children

Directory of Open Access Journals (Sweden)

Thayse Natacha Gomes

2015-07-01

Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.

BMI, waist circumference at 8 and 12 years of age and FVC and FEV1 at 12 years of age; the PIAMA birth cohort study

NARCIS (Netherlands)

Bekkers, Marga B; Wijga, Alet H; Gehring, Ulrike; Koppelman, Gerard H; de Jongste, Johan C; Smit, Henriette A; Brunekreef, Bert

2015-01-01

BACKGROUND: In adults, overweight is associated with reduced lung function, in children evidence on this association is conflicting. We examined the association of body mass index (BMI) and waist circumference (WC) at age 12, and of persistently (at ages 8 and 12 years) high BMI and large WC, with

ERD-based online brain-machine interfaces (BMI) in the context of neurorehabilitation: optimizing BMI learning and performance.

Science.gov (United States)

Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G

2011-10-01

Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.

IMPROVING FUNCTIONAL INDEPENDENCE OF PATIENTS WITH MULTIPLE SCLEROSIS BY PHYSICAL THERAPY AND OCCUPATIONAL THERAPY

Directory of Open Access Journals (Sweden)

Ana-Maria Ticărat

2011-06-01

Full Text Available Introduction. Patients with multiple sclerosis can have a normal life despite of their real or possible disability and of the progressive nature of it. Scope. Patients who follow physical therapy and occupational therapy will have an increased quality of life and a greater functional independence.Methods. The randomized study was made on 7 patients with multiple sclerosis, from Oradea Day Centre, 3 times/week, ages between 35 – 55 years, functional level between mild and sever. Assessment and rehabilitation methods: inspection, BARTHEL Index. Frenkel method, brething exercises, weights exercises, gait exercises, writind exercises and games were used in the rehabilitation process. Group therapies: sociotherapy, arttherapy, music therapy. Results analysis consisted of the comparison of baseline and final means.Results. By analizing baseline and final means for Barthel Index for each functon separately, it was shown a mild improvement of functional independence for almost assessed functions, with at least 1-1,5 points.Conclusions. Persons with multiple sclerosis who follow physical therapy and occupational therapy presents a better functional independence after the treatment.

Effect of national wealth on BMI: An analysis of 206,266 individuals in 70 low-, middle- and high-income countries.

Directory of Open Access Journals (Sweden)

Mohd Masood

Full Text Available This study explores the relationship between BMI and national-wealth and the cross-level interaction effect of national-wealth and individual household-wealth using multilevel analysis.Data from the World Health Survey conducted in 2002-2004, across 70 low-, middle- and high-income countries was used. Participants aged 18 years and over were selected using multistage, stratified cluster sampling. BMI was used as outcome variable. The potential determinants of individual-level BMI were participants' sex, age, marital-status, education, occupation, household-wealth and location(rural/urban at the individual-level. The country-level factors used were average national income (GNI-PPP and income inequality (Gini-index. A two-level random-intercepts and fixed-slopes model structure with individuals nested within countries was fitted, treating BMI as a continuous outcome.The weighted mean BMI and standard-error of the 206,266 people from 70-countries was 23.90 (4.84. All the low-income countries were below the 25.0 mean BMI level and most of the high-income countries were above. All wealthier quintiles of household-wealth had higher scores in BMI than lowest quintile. Each USD10000 increase in GNI-PPP was associated with a 0.4 unit increase in BMI. The Gini-index was not associated with BMI. All these variables explained 28.1% of country-level, 4.9% of individual-level and 7.7% of total variance in BMI. The cross-level interaction effect between GNI-PPP and household-wealth was significant. BMI increased as the GNI-PPP increased in first four quintiles of household-wealth. However, the BMI of the wealthiest people decreased as the GNI-PPP increased.Both individual-level and country-level factors made an independent contribution to the BMI of the people. Household-wealth and national-income had significant interaction effects.

Effect of national wealth on BMI: An analysis of 206,266 individuals in 70 low-, middle- and high-income countries

Science.gov (United States)

Reidpath, Daniel D.

2017-01-01

Background This study explores the relationship between BMI and national-wealth and the cross-level interaction effect of national-wealth and individual household-wealth using multilevel analysis. Methods Data from the World Health Survey conducted in 2002–2004, across 70 low-, middle- and high-income countries was used. Participants aged 18 years and over were selected using multistage, stratified cluster sampling. BMI was used as outcome variable. The potential determinants of individual-level BMI were participants’ sex, age, marital-status, education, occupation, household-wealth and location(rural/urban) at the individual-level. The country-level factors used were average national income (GNI-PPP) and income inequality (Gini-index). A two-level random-intercepts and fixed-slopes model structure with individuals nested within countries was fitted, treating BMI as a continuous outcome. Results The weighted mean BMI and standard-error of the 206,266 people from 70-countries was 23.90 (4.84). All the low-income countries were below the 25.0 mean BMI level and most of the high-income countries were above. All wealthier quintiles of household-wealth had higher scores in BMI than lowest quintile. Each USD10000 increase in GNI-PPP was associated with a 0.4 unit increase in BMI. The Gini-index was not associated with BMI. All these variables explained 28.1% of country-level, 4.9% of individual-level and 7.7% of total variance in BMI. The cross-level interaction effect between GNI-PPP and household-wealth was significant. BMI increased as the GNI-PPP increased in first four quintiles of household-wealth. However, the BMI of the wealthiest people decreased as the GNI-PPP increased. Conclusion Both individual-level and country-level factors made an independent contribution to the BMI of the people. Household-wealth and national-income had significant interaction effects. PMID:28662041

Executive functioning, motor programming, and functional independence: accounting for variance, people, and time.

Science.gov (United States)

Kraybill, Matthew L; Suchy, Yana

2011-02-01

Assessing functional independence is an important part of making diagnostic decisions and treatment recommendations but is often complicated by the limitations of self-report and behavioral measures. Alternatively, it may be worthwhile to investigate neurocognitive correlates of incipient functional declines including using tests of executive functioning (EF) and motor programming (MP). The current study examined an electronic MP task and pitted it against other assessment instruments to evaluate its relative utility in assessing both EF and functional independence. Participants were 72 community-dwelling older adults. Results of this study showed that the MP task was correlated with other measures of EF, an efficient and reliable predictor of functionality, useful for identifying at-risk patients, and comparable to a longer battery in terms of sensitivity and specificity.

Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.

Science.gov (United States)

Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y

2018-04-01

Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.

The Impact of maternal obesity and race/ethnicity on perinatal outcomes: Independent and joint effects.

Science.gov (United States)

Snowden, Jonathan M; Mission, John F; Marshall, Nicole E; Quigley, Brian; Main, Elliott; Gilbert, William M; Chung, Judith H; Caughey, Aaron B

2016-07-01

Independent and joint impacts of maternal race/ethnicity and obesity on adverse birth outcomes, including pre-eclampsia, low birth weight, and macrosomia, were characterized. Retrospective cohort study of all 2007 California births was conducted using vital records and claims data. Maternal race/ethnicity and maternal body mass index (BMI) were the key exposures; their independent and joint impact on outcomes using regression models was analyzed. Racial/ethnic minority women of normal weight generally had higher risk as compared with white women of normal weight (e.g., African-American women, pre-eclampsia adjusted odds ratio [aOR] 1.60, 95% confidence interval [CI]: 1.48-1.74 vs. white women). However, elevated BMI did not usually confer additional risk (e.g., pre-eclampsia aOR comparing African-American women with excess weight with white women with excess weight, 1.17, 95% CI: 0.89-1.54). Obesity was a risk factor for low birth weight only among white women (excess weight aOR, 1.24, 95% CI: 1.04-1.49 vs. white women of normal weight) and not among racial/ethnic minority women (e.g., African-American women, 0.95, 95% CI: 0.83-1.08). These findings add nuance to our understanding of the interplay between maternal race/ethnicity, BMI, and perinatal outcomes. While the BMI/adverse outcome gradient appears weaker in racial/ethnic minority women, this reflects the overall risk increase in racial/ethnic minority women of all body sizes. © 2016 The Obesity Society.

Childhood BMI and Adult Type 2 Diabetes, Coronary Artery Diseases, Chronic Kidney Disease, and Cardiometabolic Traits: A Mendelian Randomization Analysis.

Science.gov (United States)

Geng, Tingting; Smith, Caren E; Li, Changwei; Huang, Tao

2018-05-01

To test the causal effect of childhood BMI on adult cardiometabolic diseases using a Mendelian randomization analysis. We used 15 single nucleotide polymorphisms as instrumental variables for childhood BMI to test the causal effect of childhood BMI on cardiometabolic diseases using summary-level data from consortia. We found that a 1-SD increase in childhood BMI (kg/m 2 ) was associated with an 83% increase in risk of type 2 diabetes (odds ratio [OR] 1.83 [95% CI 1.46, 2.30]; P = 2.5 × 10 -7 ) and a 28% increase in risk of coronary artery disease (CAD) (OR 1.28 [95% CI 1.17, 1.39]; P = 2.1 × 10 -8 ) at the Bonferroni-adjusted level of significance ( P BMI was associated with a 0.587-SD increase in adulthood BMI (kg/m 2 ), a 0.062-SD increase in hip circumference (cm), a 0.602-SD increase in waist circumference (cm), a 0.111 pmol/L increase in log fasting insulin, a 0.068 increase in log-transformed HOMA of ß-cell function (%), a 0.126 increase in log-transformed HOMA of insulin resistance (%), and a 0.109-SD increase in triglyceride (mg/dL) but a 0.138-SD decrease in HDL (mg/dL) in adults at the Bonferroni-adjusted level of significance ( P BMI was associated with increased risk of type 2 diabetes and CAD in adult life. These results provide evidence supportive of a causal association between childhood BMI and these outcomes. © 2018 by the American Diabetes Association.

Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

Science.gov (United States)

Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

2018-02-01

Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.

Science.gov (United States)

Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A

2017-07-01

We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI

Circulating Spexin Levels Negatively Correlate With Age, BMI, Fasting Glucose, and Triglycerides in Healthy Adult Women.

Science.gov (United States)

Lin, Cheng-Yuan; Huang, Tao; Zhao, Ling; Zhong, Linda L D; Lam, Wai Ching; Fan, Bao-Min; Bian, Zhao-Xiang

2018-05-01

Spexin is a newly identified neuropeptide that is involved in satiety control, glucose, and lipids metabolism. It has also been related to human diseases, such as obesity and type 2 diabetes. However, whether spexin changes with age or not is still unclear. The aim of this study is to investigate the relationship between circulating spexin levels and age and to study their interaction effects on body mass index (BMI), fasting glucose, and -lipids. This is a cross-sectional study, including 68 healthy adult women whose ages are in a wide range (minimum: 23; median: 38.5; maximum: 64). The serum spexin levels were measured by an enzyme-linked immunosorbent assay. Fasting glucose, total cholesterol, triglycerides (TG), alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine were measured by routine biochemical test. Shapiro-Wilk's test, Spearman and Pearson correlation analyses, χ 2 test, and two-way analysis of variance were used to interpret the data. Serum spexin levels are significantly correlated with age (Spearman r = -0.277, P = 0.022), BMI (Spearman r = -0.445, P glucose (Spearman r = -0.302, P = 0.014), and TG (Spearman r = -0.324, P = 0.008). Spexin levels independently predict the risk of high BMI and high fasting glucose. No interaction effects of spexin and age on BMI and fasting glucose were found. Circulating spexin levels decrease with age, suggesting a possible role of this peptide in aging-related functions and disorders. Further investigations are needed to expand the clinical significance of this finding.

Behavioural patterns only predict concurrent BMI status and not BMI trajectories in a sample of youth in Ontario, Canada.

Science.gov (United States)

Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T

2018-01-01

Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.

SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.

Directory of Open Access Journals (Sweden)

Xiao-Peng Xiong

2015-08-01

Full Text Available microRNAs (miRNAs are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs that contain Argonaute (AGO family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be

IQ is an independent predictor of glycated haemoglobin level in young and middle-aged adults with intellectual disability.

Science.gov (United States)

Yano, T; Miki, T; Itoh, T; Ohnishi, H; Asari, M; Chihiro, S; Yamamoto, A; Aotsuka, K; Kawakami, N; Ichikawa, J; Hirota, Y; Miura, T

2015-01-01

Here we examined whether intellectual disability is independently associated with hyperglycaemia. We recruited 233 consecutive young and middle-aged adults with intellectual disability. After exclusion of subjects on medication for metabolic diseases or with severe intellectual disability (IQ IQ into a group with moderate intellectual disability (35 ≤ IQ ≤ 50), a mild intellectual disability group (51 ≤ IQ ≤ 70) and a borderline group (IQ > 70). HbA1c level was higher in subjects with moderate intellectual disability (42 ± 9 mmol/mol; 6.0 ± 0.8%) than those in the borderline group (36 ± 4 mmol/mol; 5.5 ± 0.3%) and mild intellectual disability group (37 ± 5 mmol/mol; 5.5 ± 0.5%) groups. HbA1c level was correlated with age, BMI, blood pressure, serum triglycerides and IQ in simple linear regression analysis. Multiple regression analysis indicated that IQ, age, BMI and diastolic blood pressure were independent explanatory factors of HbA1c level. An unfavourable effect of intellectual disability on lifestyle and untoward effect of hyperglycaemia on cognitive function may underlie the association of low IQ with hyperglycaemia. © 2014 The Authors. Diabetic Medicine © 2014 Diabetes UK.

PPARγ Pro12Ala and ACE ID polymorphisms are associated with BMI and fat distribution, but not metabolic syndrome

Directory of Open Access Journals (Sweden)

Passaro Angela

2011-12-01

Full Text Available Abstract Background Metabolic Syndrome (MetS results from the combined effect of environmental and genetic factors. We investigated the possible association of peroxisome proliferator-activated receptor-γ2 (PPARγ2 Pro12Ala and Angiotensin Converting Enzyme (ACE I/D polymorphisms with MetS and interaction between these genetic variants. Methods Three hundred sixty four unrelated Caucasian subjects were enrolled. Waist circumference, blood pressure, and body mass index (BMI were recorded. Body composition was estimated by impedance analysis; MetS was diagnosed by the NCEP-ATPIII criteria. A fasting blood sample was obtained for glucose, insulin, lipid profile determination, and DNA isolation for genotyping. Results The prevalence of MetS did not differ across PPARγ2 or ACE polymorphisms. Carriers of PPARγ2 Ala allele had higher BMI and fat-mass but lower systolic blood pressure compared with Pro/Pro homozygotes. A significant PPARγ2 gene-gender interaction was observed in the modulation of BMI, fat mass, and blood pressure, with significant associations found in women only. A PPARγ2-ACE risk genotype combination for BMI and fat mass was found, with ACE DD/PPARγ2 Ala subjects having a higher BMI (p = 0.002 and Fat Mass (p = 0.002. Pro12Ala was independently associated with waist circumference independent of BMI and gender. Conclusions Carriers of PPARγ2 Ala allele had higher BMI and fat-mass but not a worse metabolic profile, possibly because of a more favorable adipose tissue distribution. A gene interaction exists between Pro12Ala and ACE I/D on BMI and fat mass. Further studies are needed to assess the contribution of Pro12Ala polymorphism in adiposity distribution.

Plasminogen activator inhibitor-1 is elevated in patients with COPD independent of metabolic and cardiovascular function

Directory of Open Access Journals (Sweden)

Waschki B

2017-03-01

Full Text Available Benjamin Waschki,1–3 Henrik Watz,2,3 Olaf Holz,4,5 Helgo Magnussen,2,3 Beata Olejnicka,6 Tobias Welte,5,7 Klaus F Rabe,1,3 Sabina Janciauskiene5,7 1Pneumology, LungenClinic Grosshansdorf, Grosshansdorf, Germany; 2Pulmonary Research Institute at LungenClinic Grosshansdorf, Grosshansdorf, Germany; 3Airway Research Center North (ARCN, German Center for Lung Research (DZL, Grosshansdorf, Germany; 4Fraunhofer Institute for Toxicology and Experimental Medicine, Hannover, Germany; 5Biomedical Research in Endstage and Obstructive Lung Disease Hannover (BREATH, German Center for Lung Research (DZL, Hannover, Germany; 6Department of Medicine, Trelleborg Hospital, Trelleborg, Sweden; 7Department of Respiratory Medicine, Hannover Medical School, Hannover, Germany Introduction: Plasminogen activator inhibitor-1 (PAI-1, a major inhibitor of fibrinolysis, is associated with thrombosis, obesity, insulin resistance, dyslipidemia, and premature aging, which all are coexisting conditions of chronic obstructive pulmonary disease (COPD. The role of PAI-1 in COPD with respect to metabolic and cardiovascular functions is unclear. Methods: In this study, which was nested within a prospective cohort study, the serum levels of PAI-1 were cross-sectionally measured in 74 stable COPD patients (Global Initiative for Chronic Obstructive Lung Disease [GOLD] Stages I–IV and 18 controls without lung disease. In addition, triglycerides, high-density lipoprotein cholesterol, fasting plasma glucose, waist circumference, blood pressure, smoking status, high-sensitive C-reactive protein (hs-CRP, adiponectin, ankle–brachial index, N-terminal pro-B-type natriuretic peptide, and history of comorbidities were also determined. Results: The serum levels of PAI-1 were significantly higher in COPD patients than in controls, independent of a broad spectrum of possible confounders including metabolic and cardiovascular dysfunction. A multivariate regression analysis revealed

Correction of self-reported BMI based on objective measurements: a Belgian experience.

Science.gov (United States)

Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J

2018-01-01

Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.

Co-Expression of Bmi-1 and Podoplanin Predicts Overall Survival in Patients With Squamous Cell Carcinoma of the Head and Neck Treated With Radio(chemo)therapy

International Nuclear Information System (INIS)

Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.

2009-01-01

Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy

The Predictive Factors for Diabetic Remission in Chinese Patients with BMI > 30 kg/m2 and BMI < 30 kg/m2 Are Different.

Science.gov (United States)

Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel

2018-01-15

Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.

Prenatal exposure to maternal very severe obesity is associated with impaired neurodevelopment and executive functioning in children.

Science.gov (United States)

Mina, Theresia H; Lahti, Marius; Drake, Amanda J; Denison, Fiona C; Räikkönen, Katri; Norman, Jane E; Reynolds, Rebecca M

2017-07-01

BackgroundPrenatal maternal obesity has been associated with an increased risk of neurocognitive problems in childhood, but there are fewer studies on executive functioning.MethodsTests and questionnaires to assess neurodevelopment, executive functioning, and the ability to delay gratification were conducted in 113 children (mean (SD)=4.24 (0.63) years of age) born to mothers with very severe obesity (SO, body mass index (BMI)⩾40 kg/m 2 , n=51) or to lean mothers (BMI⩽25 kg/m 2 , n=62).ResultsPrenatal maternal SO predicted poorer neurodevelopment (unstandardized regression coefficient (B)=-0.42, 95% confidence interval (CI) (-0.82; -0.02)), worse problem-solving (odd ratio (OR)=0.60, 95% CI (1.13; 0.07)), and fine motor skills (OR=4.91, 95% CI (1.27; 19.04)), poorer executive functioning in areas of attention, inhibitory control, and working memory (standardized B=3.75, 95% CI (1.01; 13.93)) but not in self-gratification delay. The effects were independent of maternal concurrent psychological well-being and child's BMI, but not independent of maternal education.ConclusionFuture studies should investigate whether perinatal management of maternal obesity could prevent adverse outcomes in child neurodevelopment.

Functional Analysis of Kori Unit 1

International Nuclear Information System (INIS)

Choi, Seong Soo; Han, Jeong Hyun; Heo, Tae Young

2009-07-01

Function Analysis of Kori Unit 1 has been performed as a part of independent human factors review tasks for control room renovation of the plant. The top level goal defined for the scope of function analysis is 'Generate Electricity'. Through this function analysis of Kori Unit 1, the detailed sub-functions extracted from the existing design documents and procedures, functional relationships among the high level functions, functional classification of each hierarchical level, and tree diagrams of the hierarchical function structures of the plant were developed and identified as the result of the project. In addition, we investigated and compiled the specifications of MMIS devices used in Ulchin Nuclear Power Plant Unit 5,6 in accordance with the request from KAERI. The results of those researches will be used as basis data for independent review of the control room MMIS design of the Kori Unit 1

Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.

Science.gov (United States)

Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M

2013-12-01

Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.

Oxandrolone Improves Height Velocity and BMI in Patients with Cystic Fibrosis

Directory of Open Access Journals (Sweden)

Todd Varness

2009-01-01

Full Text Available Objective. To evaluate the effectiveness of oxandrolone in improving the nutritional status and linear growth of pediatric patients with cystic fibrosis (CF. Methods. Medical records of patients with CF treated with oxandrolone were reviewed for height z score, height velocity (HV, BMI z score, weight velocity (WV, Tanner stage, pulmonary function, liver enzyme levels, and any reported adverse events. Data were compared before (pre-Ox and after (Ox oxandrolone using a paired t-test. Results. 5 subjects (ages 8.5–14.5 years were treated with oxandrolone 2.5 mg daily for 8–38 months. After 8–12 months of treatment, there was a statistically significant improvement in HV (pre-Ox=5.3±1.4 cm/yr, Ox=8.3±1.2 cm/yr, P<.01 and BMI z score (pre-Ox=−0.61±1.04, Ox=−0.30±0.86, P=.02. Both height z score (pre-Ox=−1.64±0.63, Ox=−1.30±0.49, P=.057 and WV (pre-Ox=4.2±3.7 kg/yr, Ox =6.8±1.0 kg/yr, P=.072 showed beneficial trends that did not reach statistical significance. No adverse events were reported. Conclusions. In this brief clinical report, oxandrolone improved the HV and BMI z score in patients with CF. Larger studies are needed to determine if oxandrolone is an effective, safe, and affordable option to stimulate appetite, improve weight gain, and promote linear growth in patients with CF.

Maternal Metabolic Health Parameters During Pregnancy in Relation to Early Childhood BMI Trajectories.

Science.gov (United States)

Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini

2018-03-01

The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.

Body composition and pulmonary function in Cystic Fibrosis

Directory of Open Access Journals (Sweden)

Saba eSheikh

2014-04-01

Full Text Available Background: Lower body mass index (BMI is associated with worse pulmonary function in cystic fibrosis (CF. Hypothesis: Lean body mass (LBM is more strongly associated with pulmonary function than BMI is.Methods: Anthropometrics, body composition by dual x-ray absorptiometry, and pulmonary function were determined in pancreatic insufficient CF (PI-CF youth. Sex and age-adjusted Z-scores (BMI-Z, LBMI-Z, FMI-Z were generated for CF and controls. 1 Associations of BMI-Z with LBMI-Z and FMI-Z and 2 age-adjusted associations of BMI-Z, LBMI-Z, and FMI-Z with FEV1%-predicted were tested. Results: 208 PI-CF subjects had lower BMI-Z, LBMI-Z, FMI-Z compared to 390 controls. BMI-Z was associated with lower LBMI-Z (pConclusions: In PI-CF youth, deficits in LBM were apparent. At lower BMI percentiles, BMI may not accurately depict LBM in PI-CF. In under-nourished PI-CF youth this preservation of FM in preference to LBM is relevant since LBMI-Z, but not FMI-Z, is positively associated with FEV1%-predicted. LBMI is more strongly associated with lung function compared to BMI, especially in the undernourished child and adolescent with PI-CF.

Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.

Science.gov (United States)

Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo

2017-05-01

Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.

Is BMI a valid measure of obesity in postmenopausal women?

Science.gov (United States)

Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew

2018-03-01

Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.

The relationship between BMI and insulin resistance and progression from single to multiple autoantibody positivity and type 1 diabetes among TrialNet Pathway to Prevention participants.

Science.gov (United States)

Meah, Farah A; DiMeglio, Linda A; Greenbaum, Carla J; Blum, Janice S; Sosenko, Jay M; Pugliese, Alberto; Geyer, Susan; Xu, Ping; Evans-Molina, Carmella

2016-06-01

The incidence of type 1 diabetes is increasing at a rate of 3-5% per year. Genetics cannot fully account for this trend, suggesting an influence of environmental factors. The accelerator hypothesis proposes an effect of metabolic factors on type 1 diabetes risk. To test this in the TrialNet Pathway to Prevention (PTP) cohort, we analysed the influence of BMI, weight status and insulin resistance on progression from single to multiple islet autoantibodies (Aab) and progression from normoglycaemia to diabetes. HOMA1-IR was used to estimate insulin resistance in Aab-positive PTP participants. Cox proportional hazards models were used to evaluate the effects of BMI, BMI percentile (BMI%), weight status and HOMA1-IR on the progression of autoimmunity or the development of diabetes. Data from 1,310 single and 1,897 multiple Aab-positive PTP participants were included. We found no significant relationships between BMI, BMI%, weight status or HOMA1-IR and the progression from one to multiple Aabs. Similarly, among all Aab-positive participants, no significant relationships were found between BMI, weight status or HOMA1-IR and progression to diabetes. Diabetes risk was modestly increased with increasing BMI% among the entire cohort, in obese participants 13-20 years of age and with increasing HOMA1-IR in adult Aab-positive participants. Analysis of the accelerator hypothesis in the TrialNet PTP cohort does not suggest a broad influence of metabolic variables on diabetes risk. Efforts to identify other potentially modifiable environmental factors should continue.

Causal relationship between the AHSG gene and BMD through fetuin-A and BMI: multiple mediation analysis.

Science.gov (United States)

Sritara, C; Thakkinstian, A; Ongphiphadhanakul, B; Chailurkit, L; Chanprasertyothin, S; Ratanachaiwong, W; Vathesatogkit, P; Sritara, P

2014-05-01

Using mediation analysis, a causal relationship between the AHSG gene and bone mineral density (BMD) through fetuin-A and body mass index (BMI) mediators was suggested. Fetuin-A, a multifunctional protein of hepatic origin, is associated with bone mineral density. It is unclear if this association is causal. This study aimed at clarification of this issue. A cross-sectional study was conducted among 1,741 healthy workers from the Electricity Generating Authority of Thailand (EGAT) cohort. The alpha-2-Heremans-Schmid glycoprotein (AHSG) rs2248690 gene was genotyped. Three mediation models were constructed using seemingly unrelated regression analysis. First, the ln[fetuin-A] group was regressed on the AHSG gene. Second, the BMI group was regressed on the AHSG gene and the ln[fetuin-A] group. Finally, the BMD model was constructed by fitting BMD on two mediators (ln[fetuin-A] and BMI) and the independent AHSG variable. All three analyses were adjusted for confounders. The prevalence of the minor T allele for the AHSG locus was 15.2%. The AHSG locus was highly related to serum fetuin-A levels (P Multiple mediation analyses showed that AHSG was significantly associated with BMD through the ln[fetuin-A] and BMI pathway, with beta coefficients of 0.0060 (95% CI 0.0038, 0.0083) and 0.0030 (95% CI 0.0020, 0.0045) at the total hip and lumbar spine, respectively. About 27.3 and 26.0% of total genetic effects on hip and spine BMD, respectively, were explained by the mediation effects of fetuin-A and BMI. Our study suggested evidence of a causal relationship between the AHSG gene and BMD through fetuin-A and BMI mediators.

On the k-independence required by linear probing and minwise independence

DEFF Research Database (Denmark)

Pǎtraşcu, Mihai; Thorup, Mikkel

2016-01-01

We show that linear probing requires 5-independent hash functions for expected constant-time performance, matching an upper bound of Pagh et al. [2009]. More precisely, we construct a random 4-independent hash function yielding expected logarithmic search time for certain keys. For (1 + ε......)-approximate minwise independence, we show that Ω(lg1 ε)-independent hash functions are required, matching an upper bound of Indyk [2001]. We also show that the very fast 2-independent multiply-shift scheme of Dietzfelbinger [1996] fails badly in both applications....

Effect of Body Fat Distribution on Pulmonary Functions in Young Healthy Obese Students

Directory of Open Access Journals (Sweden)

Sowmya Timmanna Koraddi

2015-10-01

Full Text Available Background: Obesity is defined as “abnormal or excessive fat accumulation that may impair health”. WHO defines obesity as Body Mass Index (BMI ≥30 2 Kg/m . Obesity is becoming more prevalent in the world and has effects on different body systems. Main is the impact on respiratory function. Aim & Objectives: We have aimed to study the gender difference in obesity induced changes on pulmonary functions and determine adiposity marker which best predicts the pulmonary function in young adult obese individuals and age-matched non-obese young adult subjects. Materials and Methods: A cross sectional 2 study was conducted on obese (BMI ≥30 kg/m male (n=32 and female (n=18 students aged 18-25 years and compared with age matched non-obese (BMI 2 18.5–24.99 Kg/m male (n=23 and female subjects (n=27 as controls. Weight(kg, Height(cm, Body -2 Mass Index(BMI, kgm , Waist Circumference(WC, cm, Waist to Hip Ratio(WHR,Waist to Height Ratio (WHtR, Forced Vital Capacity (FVC, L, Forced Expiratory Volume in first second (FEV , L/min, 1 FEV , FEF (L/sec, Peak Expiratory Flow Rate 1% 25-75% (PEFR, L/min and Maximum Expiratory Pressure (MEP, mm Hg were recorded. Results: Systolic Blood Pressure, Diastolic Blood Pressure, Pulse Rate and Respiratory Rate were significantly higher in obese students when compared to their respective controls. We observed highly significant reduction in PEFR (p<0.001 and MEP (p<0.001 in both obese male and female groups compared to controls. FEV was 1% significantly lower in obese female students. Linear regression analysis revealed that BMI, WHR and WC were significant predictors of PEFR. BMI was only the significant predictor of MEP. WHtR and WHR were best predictors of FVC, FEF and FEV . 25-75% 1 Conclusion: Obesity and pattern of fat distribution have independent effect on pulmonary function.

Evidence for a relationship between VEGF and BMI independent of insulin sensitivity by glucose clamp procedure in a homogenous group healthy young men.

Directory of Open Access Journals (Sweden)

Michaela Loebig

Full Text Available BACKGROUND: This is the first study to experimentally explore the direct relationship between circulating VEGF levels and body mass index (BMI as well as to unravel the role of insulin sensitivity in this context under standardized glucose clamp conditions as the methodical gold-standard. In order to control for known influencing factors such as gender, medication, and arterial hypertension, we examined a highly homogeneous group of young male subjects. Moreover, to encompass also subjects beyond the normal BMI range, low weight and obese participants were additionally included and stress hormones as a main regulator of VEGF were assessed. METHODOLOGY/PRINCIPAL FINDINGS: Under euglycemic clamp conditions, VEGF was measured in 15 normal weight (BMI 20-25 kg/m(2, 15 low weight (BMI30 kg/m(2 male subjects aged 18-30 years and the insulin sensitivity index (ISI was calculated. Since stress axis activation promotes VEGF secretion, concentrations of ACTH, cortisol, and catecholamines were monitored. Despite of comparable ACTH (P = 0.145, cortisol (P = 0.840, and norepinephrine (P = 0.065 levels, VEGF concentrations differed significantly between BMI-groups (P = 0.008 with higher concentrations in obese subjects as compared to normal weight (P = 0.061 and low weight subjects (P = 0.002. Pearson's correlation analysis revealed a positive relationship between BMI and VEGF levels (r = 0.407; P = 0.010 but no correlation of VEGF with ISI (r = 0.224; P = 0.175. CONCLUSIONS/SIGNIFICANCE: Our data demonstrate a positive correlation between concentrations of circulating VEGF levels and BMI in healthy male subjects under highly controlled conditions. This relationship which is apparently disconnected from insulin sensitivity may be part of some pathogenetic mechanisms underlying obesity and type 2 diabetes.

The relationship between motor function, cognition, independence and quality of life in myelomeningocele patients.

Science.gov (United States)

Luz, Carolina Lundberg; Moura, Maria Clara Drummond Soares de; Becker, Karine Kyomi; Teixeira, Rosani Aparecida Antunes; Voos, Mariana Callil; Hasue, Renata Hydee

2017-08-01

Motor function, cognition, functional independence and quality of life have been described in myelomeningocele patients, but no study has investigated their relationships. We aimed to investigate the relationships between motor function, cognition, functional independence, quality of life, age, and lesion level in myelomeningocele patients, and investigate the influence of hydrocephalus on these variables. We assessed 47 patients with the Gross Motor Function Measure (motor function), Raven's Colored Progressive Matrices (cognition), Pediatric Evaluation of Disability Inventory (functional independence) and the Autoquestionnaire Qualité de vie Enfant Imagé (quality of life). Spearman's correlation tests determined relationships between the variables. The Friedman ANOVAs determined the influence of hydrocephalus. Motor function was strongly related to mobility and lesion level, and moderately related to cognition, self-care and social function. Cognition and quality of life were moderately related to functional independence. Age correlated moderately with functional independence and quality of life. Hydrocephalus resulted in poorer motor/cognitive outcomes and lower functional independence.

Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

Science.gov (United States)

Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

2017-01-01

Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

Obesity is independently associated with spinal anesthesia outcomes: a prospective observational study.

Directory of Open Access Journals (Sweden)

Hyo-Jin Kim

Full Text Available The influence of body-mass index (BMI on spinal anesthesia is still controversial, with discrepant results reported in previous studies. To compare spinal anesthesia in obese and non-obese subjects, the anesthesia profiles in patients who underwent spinal anesthesia using intrathecal hyperbaric bupivacaine were compared. A total of 209 patients undergoing elective total knee replacement arthroplasty (TKRA surgery under spinal anesthesia were divided into an NO (non-obese group (BMI < 30 kg/m2, n = 141 and an O (obese group (BMI ≥ 30 kg/m2, n = 68. Anesthesia was deemed successful if a bilateral T12 sensory block occurred within 15 minutes of intrathecal drug administration, and if the level of sensory block was higher than T12 when the surgery ended. Logistic regression analysis with multiple variables known to influence spinal anesthesia was performed to identify which parameters independently determined the spinal anesthesia outcome. Similar doses of bupivacaine were administered to the NO and O groups. The incidence of anesthesia failure was significantly lower in the O group [n = 43 (30.5% in the NO group vs. n = 10 (18.9% in the O group, p = 0.014]. The independent predictors for successful anesthesia in all patients were dose of hyperbaric bupivacaine [odds ratio (OR 2.12, 95% CI: 1.64-2.73] and obese status (BMI ≥ 30 kg/m2, OR 2.86, 95% CI: 1.25-6.52. Time to first report of postoperative pain and time to first self-void were significantly longer in the O group. These results suggest that the duration of block with hyperbaric bupivacaine is prolonged in obese patients and obesity is independently associated with spinal anesthesia outcomes, as is bupivacaine dosage. A further study enrolling patients with morbid obesity and using a fixed bupivacaine dosage is required to confirm the effect of obesity on spinal anesthesia.

Renal cortical volume measured using automatic contouring software for computed tomography and its relationship with BMI, age and renal function

International Nuclear Information System (INIS)

Muto, Natalia Sayuri; Kamishima, Tamotsu; Harris, Ardene A.; Kato, Fumi; Onodera, Yuya; Terae, Satoshi; Shirato, Hiroki

2011-01-01

Purpose: To evaluate the relationship between renal cortical volume, measured by an automatic contouring software, with body mass index (BMI), age and renal function. Materials and methods: The study was performed in accordance to the institutional guidelines at our hospital. Sixty-four patients (34 men, 30 women), aged 19 to 79 years had their CT scans for diagnosis or follow-up of hepatocellular carcinoma retrospectively examined by a computer workstation using a software that automatically contours the renal cortex and the renal parenchyma. Body mass index and estimated glomerular filtration rate (eGFR) were calculated based on data collected. Statistical analysis was done using the Student t-test, multiple regression analysis, and intraclass correlation coefficient (ICC). Results: The ICC for total renal and renal cortical volumes were 0.98 and 0.99, respectively. Renal volume measurements yielded a mean cortical volume of 105.8 cm 3 ± 28.4 SD, mean total volume of 153 cm 3 ± 39 SD and mean medullary volume of 47.8 cm 3 ± 19.5 SD. The correlation between body weight/height/BMI and both total renal and cortical volumes presented r = 0.6, 0.6 and 0.4, respectively, p < 0.05, while the correlation between renal cortex and age was r = -0.3, p < 0.05. eGFR showed correlation with renal cortical volume r = 0.6, p < 0.05. Conclusion: This study demonstrated that renal cortical volume had a moderate positive relationship with BMI, moderate negative relationship with age, and a strong positive relationship with the renal function, and provided a new method to routinely produce volumetric assessment of the kidney.

EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

NARCIS (Netherlands)

Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

2008-01-01

Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

Science.gov (United States)

Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

2010-12-16

Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

BMI trajectory groups in veterans of the Iraq and Afghanistan wars.

Science.gov (United States)

Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally

2011-09-01

The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.

Community-Specific BMI Cutoff Points for South Indian Females

Directory of Open Access Journals (Sweden)

K. B. Kishore Mohan

2011-01-01

Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.

Increased Visceral Adipose Tissue Is an Independent Predictor for Future Development of Atherogenic Dyslipidemia.

Science.gov (United States)

Hwang, You-Cheol; Fujimoto, Wilfred Y; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; Boyko, Edward J

2016-02-01

Atherogenic dyslipidemia is frequently observed in persons with a greater amount of visceral adipose tissue (VAT). However, it is still uncertain whether VAT is independently associated with the future development of atherogenic dyslipidemia. The aim of this study was to determine whether baseline and changes in VAT and subcutaneous adipose tissue (SAT) are associated with future development of atherogenic dyslipidemia independent of baseline lipid levels and standard anthropometric indices. Community-based prospective cohort study with 5 years of follow-up. A total of 452 Japanese Americans (240 men, 212 women), aged 34-75 years were assessed at baseline and after 5 years of follow-up. Abdominal fat areas were measured by computed tomography. Atherogenic dyslipidemia was defined as one or more abnormalities in high-density lipoprotein (HDL) cholesterol, triglycerides, or non-HDL cholesterol levels. Baseline VAT and change in VAT over 5 years were independently associated with log-transformed HDL cholesterol, log-transformed triglyceride, and non-HDL cholesterol after 5 years (standardized β = -0.126, 0.277, and 0.066 for baseline VAT, respectively, and -0.095, 0.223, and 0.090 for change in VAT, respectively). However, baseline and change in SAT were not associated with any future atherogenic lipid level. In multivariate logistic regression analysis, incremental change in VAT (odds ratio [95% confidence interval], 1.73 [1.20-2.48]; P = .003), triglycerides (4.01 [1.72-9.33]; P = .001), HDL cholesterol (0.32 [0.18-0.58]; P dyslipidemia independent of age, sex, diastolic blood pressure, homeostasis model assessment insulin resistance, body mass index (BMI), change in BMI, SAT, and baseline atherogenic lipid levels. Baseline and change in VAT were independent predictors for future development of atherogenic dyslipidemia. However, BMI, waist circumference, and SAT were not associated with future development of atherogenic dyslipidemia.

Obese Japanese Patients with Stroke Have Higher Functional Recovery in Convalescent Rehabilitation Wards: A Retrospective Cohort Study.

Science.gov (United States)

Nishioka, Shinta; Wakabayashi, Hidetaka; Yoshida, Tomomi; Mori, Natsumi; Watanabe, Riko; Nishioka, Emi

2016-01-01

A protective effect of excessive body mass index (BMI) on mortality or functional outcome in patients with stroke is not well established in the Asian population. This study aimed to explore whether obese patients with stroke have advantages for functional improvement in Japanese rehabilitation wards. This retrospective cohort study included consecutive patients with stroke admitted and discharged from convalescent rehabilitation wards between 2011 and 2015. Demographic data, BMI, Functional Independence Measure (FIM) score, and nutritional status were analyzed. Participants were classified into 4 groups according to BMI (underweight stroke may have some advantages for functional recovery in rehabilitation wards. Copyright © 2015 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.

Science.gov (United States)

Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran

2018-03-01

High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.

BMI, waist circumference at 8 and 12 years of age and FVC and FEV

NARCIS (Netherlands)

M.B.M. Bekkers (Marga); A.H. Wijga (Alet); U. Gehring (Ulrike); G.H. Koppelman (Gerard); J.C. de Jongste (Johan); H.A. Smit (Henriëtte); B. Brunekreef (Bert)

2015-01-01

textabstractBackground: In adults, overweight is associated with reduced lung function, in children evidence on this association is conflicting. We examined the association of body mass index (BMI) and waist circumference (WC) at age 12, and of persistently (at ages 8 and 12 years) high BMI and

Trauma center designation correlates with functional independence after severe but not moderate traumatic brain injury.

Science.gov (United States)

Brown, Joshua B; Stassen, Nicole A; Cheng, Julius D; Sangosanya, Ayodele T; Bankey, Paul E; Gestring, Mark L

2010-08-01

The mortality of traumatic brain injury (TBI) continues to decline, emphasizing functional outcomes. Trauma center designation has been linked to survival after TBI, but the impact on functional outcomes is unclear. The objective was to determine whether trauma center designation influenced functional outcomes after moderate and severe TBI. Trauma subjects presenting to an American College of Surgeons (ACS) Level I or II trauma center with a Glasgow Coma Score (GCS) independence (FI) defined as a modified functional independence measure (FIM) of 12, and independent expression (IE) defined as a FIM component of 4. These were compared between Level I and Level II centers in subjects with both moderate (GCS 9-12) and severe (GCS 1.16; confidence interval: 1.07-1.24, p < 0.01) and IE (1.10; 1.03-1.17, p < 0.01) after severe TBI. Trauma center designation was not associated with FI or IE after moderate TBI. ACS trauma center designation is significantly associated with FI and IE after severe, but not moderate TBI. Prospective study is warranted to verify and explore factors contributing to this discrepancy.

Image noise-based dose adaptation in dynamic volume CT of the heart: dose and image quality optimisation in comparison with BMI-based dose adaptation

Energy Technology Data Exchange (ETDEWEB)

Odedra, Devang [Queen' s University, School of Medicine, Kingston, ON (Canada); Blobel, Joerg [Toshiba Medical Systems Europe BV, Zoetermeer (Netherlands); University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada); AlHumayyd, Saad; Durand, Miranda; Jimenez-Juan, Laura; Paul, Narinder [University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada)

2014-01-15

To compare the image quality and radiation dose using image-noise (IN)-based determination of X-ray tube settings compared with a body mass index (BMI)-based protocol during CT coronary angiography (CTCA). Two hundred consecutive patients referred for CTCA to our institution were divided into two groups: BMI-based, 100 patients had CTCA with the X-ray tube current adjusted to the patient's BMI while maintaining a fixed tube potential of 120 kV; IN-based, 100 patients underwent imaging with the X-ray tube current and voltage adjusted to the IN measured within the mid-left ventricle on a pre-acquisition trans-axial image. Two independent cardiac radiologists performed blinded image quality assessment with quantification of the IN and signal-to-noise ratio (SNR) from the mid-LV and qualitative assessment using a three-point score. Radiation dose (CTDI and DLP) was recorded from the console. Results showed: IN (HU): BMI-based, 30.1 ± 9.9; IN-based, 33.1 ± 6.7; 32 % variation reduction (P = 0.001); SNR: BMI-based, 18.6 ± 7.1; IN-based, 15.4 ± 3.7; 48 % variation reduction (P < 0.0001). Visual scores: BMI-based, 2.3 ± 0.6; IN-based, 2.2 ± 0.5 (P = 0.54). Radiation dose: CTDI (mGy), BMI-based, 22.68 ± 8.9; IN-based, 17.16 ± 7.6; 24.3 % reduction (P < 0.001); DLP (mGy.cm), BMI-based, 309.3 ± 127.5; IN-based, 230.6 ± 105.5; 25.4 % reduction (P < 0.001). Image-noise-based stratification of X-ray tube parameters for CTCA results in 32 % improvement in image quality and 25 % reduction in radiation dose compared with a BMI-based protocol. (orig.)

Concordance between self-reported pre-pregnancy body mass index (BMI) and BMI measured at the first prenatal study contact.

Science.gov (United States)

Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A

2016-07-26

The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).

Aortic stiffness is associated with cardiac function and cerebral small vessel disease in patients with type 1 diabetes mellitus: assessment by magnetic resonance imaging

Energy Technology Data Exchange (ETDEWEB)

Elderen, Saskia G.C. van; Brandts, A.; Westenberg, J.J.M.; Grond, J. van der; Buchem, M.A. van; Kroft, L.J.M.; Roos, A. de [Leiden University Medical Center, Department of Radiology, Leiden (Netherlands); Tamsma, J.T.; Romijn, J.A.; Smit, J.W.A. [Leiden University Medical Center, Department of Endocrinology, Leiden (Netherlands)

2010-05-15

To evaluate, with the use of magnetic resonance imaging (MRI), whether aortic pulse wave velocity (PWV) is associated with cardiac left ventricular (LV) function and mass as well as with cerebral small vessel disease in patients with type 1 diabetes mellitus (DM). We included 86 consecutive type 1 DM patients (49 male, mean age 46.9 {+-} 11.7 years) in a prospective, cross-sectional study. Exclusion criteria included aortic/heart disease and general MRI contra-indications. MRI of the aorta, heart and brain was performed for assessment of aortic PWV, as a marker of aortic stiffness, systolic LV function and mass, as well as for the presence of cerebral white matter hyperintensities (WMHs), microbleeds and lacunar infarcts. Multivariate linear or logistic regression was performed to analyse the association between aortic PWV and outcome parameters, with covariates defined as age, gender, mean arterial pressure, heart rate, BMI, smoking, DM duration and hypertension. Mean aortic PWV was 7.1 {+-} 2.5 m/s. Aortic PWV was independently associated with LV ejection fraction (ss= -0.406, P = 0.006), LV stroke volume (ss=-0.407, P = 0.001), LV cardiac output (ss= -0.458, P = 0.001), and with cerebral WMHs (P < 0.05). There were no independent associations between aortic stiffness and LV mass, cerebral microbleeds or lacunar infarcts. Aortic stiffness is independently associated with systolic LV function and cerebral WMHs in patients with type 1 DM. (orig.)

Aortic stiffness is associated with cardiac function and cerebral small vessel disease in patients with type 1 diabetes mellitus: assessment by magnetic resonance imaging

International Nuclear Information System (INIS)

Elderen, Saskia G.C. van; Brandts, A.; Westenberg, J.J.M.; Grond, J. van der; Buchem, M.A. van; Kroft, L.J.M.; Roos, A. de; Tamsma, J.T.; Romijn, J.A.; Smit, J.W.A.

2010-01-01

To evaluate, with the use of magnetic resonance imaging (MRI), whether aortic pulse wave velocity (PWV) is associated with cardiac left ventricular (LV) function and mass as well as with cerebral small vessel disease in patients with type 1 diabetes mellitus (DM). We included 86 consecutive type 1 DM patients (49 male, mean age 46.9 ± 11.7 years) in a prospective, cross-sectional study. Exclusion criteria included aortic/heart disease and general MRI contra-indications. MRI of the aorta, heart and brain was performed for assessment of aortic PWV, as a marker of aortic stiffness, systolic LV function and mass, as well as for the presence of cerebral white matter hyperintensities (WMHs), microbleeds and lacunar infarcts. Multivariate linear or logistic regression was performed to analyse the association between aortic PWV and outcome parameters, with covariates defined as age, gender, mean arterial pressure, heart rate, BMI, smoking, DM duration and hypertension. Mean aortic PWV was 7.1 ± 2.5 m/s. Aortic PWV was independently associated with LV ejection fraction (ss= -0.406, P = 0.006), LV stroke volume (ss=-0.407, P = 0.001), LV cardiac output (ss= -0.458, P = 0.001), and with cerebral WMHs (P < 0.05). There were no independent associations between aortic stiffness and LV mass, cerebral microbleeds or lacunar infarcts. Aortic stiffness is independently associated with systolic LV function and cerebral WMHs in patients with type 1 DM. (orig.)

Longitudinal assessment of maternal endothelial function and markers of inflammation and placental function throughout pregnancy in lean and obese mothers.

Science.gov (United States)

Stewart, Frances M; Freeman, Dilys J; Ramsay, Jane E; Greer, Ian A; Caslake, Muriel; Ferrell, William R

2007-03-01

Obesity in pregnancy is increasing and is a risk factor for metabolic pathology such as preeclampsia. In the nonpregnant, obesity is associated with dyslipidemia, vascular dysfunction, and low-grade chronic inflammation. Our aim was to measure microvascular endothelial function in lean and obese pregnant women at intervals throughout their pregnancies and at 4 months after delivery. Plasma markers of endothelial function, inflammation, and placental function and their association with microvascular function were also assessed. Women in the 1st trimester of pregnancy were recruited, 30 with a body mass index (BMI) less than 30 kg/m(2) and 30 with a BMI more than or equal to 30 kg/m(2) matched for age, parity, and smoking status. In vivo endothelial-dependent and -independent microvascular function was measured using laser Doppler imaging in the 1st, 2nd, and 3rd trimesters of pregnancy and at 4 months postnatal. Plasma markers of endothelial activation [soluble intercellular cell adhesion molecule-1 (sVCAM-1), soluble vascular cell adhesion molecule-1 (sVCAM-1), von Willebrand factor (vWF), and plasminogen activator inhibitor (PAI)-1], inflammation (IL-6, TNFalpha, C-reactive protein, and IL-10), and placental function (PAI-1/PAI-2 ratio) were also assessed at each time point. The pattern of improving endothelial function during pregnancy was the same for lean and obese, but endothelial-dependent vasodilation was significantly lower (P lean women but declined to near 1st trimester levels in the obese (lean/obese difference, 115%; P lean response being greater than obese (P = 0.021), and response declined in both groups in the postpartum period. In multivariate analysis, time of sampling had the most impact on endothelial-independent function [18.5% (adjusted sum of squares expressed as a percentage of total means squared), P lean 0.30 (0.21-0.47), P lean counterparts. There was a higher PAI-1/ PAI-2 ratio in the 1st trimester in obese women, which improved later in

Early childhood BMI trajectories in monogenic obesity due to leptin, leptin receptor, and melanocortin 4 receptor deficiency.

Science.gov (United States)

Kohlsdorf, Katja; Nunziata, Adriana; Funcke, Jan-Bernd; Brandt, Stephanie; von Schnurbein, Julia; Vollbach, Heike; Lennerz, Belinda; Fritsch, Maria; Greber-Platzer, Susanne; Fröhlich-Reiterer, Elke; Luedeke, Manuel; Borck, Guntram; Debatin, Klaus-Michael; Fischer-Posovszky, Pamela; Wabitsch, Martin

2018-02-27

To evaluate whether early childhood body mass index (BMI) is an appropriate indicator for monogenic obesity. A cohort of n = 21 children living in Germany or Austria with monogenic obesity due to congenital leptin deficiency (group LEP, n = 6), leptin receptor deficiency (group LEPR, n = 6) and primarily heterozygous MC4 receptor deficiency (group MC4R, n = 9) was analyzed. A control group (CTRL) was defined that consisted of n = 22 obese adolescents with no mutation in the above mentioned genes. Early childhood (0-5 years) BMI trajectories were compared between the groups at selected time points. The LEP and LEPR group showed a tremendous increase in BMI during the first 2 years of life with all patients displaying a BMI >27 kg/m 2 (27.2-38.4 kg/m 2 ) and %BMI P95 (percentage of the 95th percentile BMI for age and sex) >140% (144.8-198.6%) at the age of 2 years and a BMI > 33 kg/m 2 (33.3-45.9 kg/m 2 ) and %BMI P95  > 184% (184.1-212.6%) at the age of 5 years. The MC4R and CTRL groups had a later onset of obesity with significantly lower BMI values at both time points (p BMI trajectories in this pediatric cohort with monogenic obesity we suggest that BMI values >27.0 kg/m 2 or %BMI P95  > 140% at the age of 2 years and BMI values >33.0 kg/m 2 or %BMI P95  > 184% at the age of 5 years may be useful cut points to identify children who should undergo genetic screening for monogenic obesity due to functionally relevant mutations in the leptin gene or leptin receptor gene.

Food Shopping and Acquisition Behaviors in Relation to BMI among Residents of Low-Income Communities in South Carolina

Directory of Open Access Journals (Sweden)

Angela D. Liese

2017-09-01

Full Text Available Low-income areas in which residents have poor access to healthy foods have been referred to as “food deserts.” It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI. We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc. with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m2. The vast majority of study participants shopped at supermarkets (61% or supercenters/warehouse clubs (27%. Shopping at a supercenter or warehouse club as one’s primary store was significantly associated with a 2.6 kg/m2 higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m2 lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should

Food Shopping and Acquisition Behaviors in Relation to BMI among Residents of Low-Income Communities in South Carolina

Science.gov (United States)

Liese, Angela D.; Ma, Xiaonan; Hutto, Brent; Sharpe, Patricia A.; Bell, Bethany A.; Wilcox, Sara

2017-01-01

Low-income areas in which residents have poor access to healthy foods have been referred to as “food deserts.” It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI). We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc.) with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m2. The vast majority of study participants shopped at supermarkets (61%) or supercenters/warehouse clubs (27%). Shopping at a supercenter or warehouse club as one’s primary store was significantly associated with a 2.6 kg/m2 higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m2 lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should consider assessing

Food Shopping and Acquisition Behaviors in Relation to BMI among Residents of Low-Income Communities in South Carolina.

Science.gov (United States)

Liese, Angela D; Ma, Xiaonan; Hutto, Brent; Sharpe, Patricia A; Bell, Bethany A; Wilcox, Sara

2017-09-16

Low-income areas in which residents have poor access to healthy foods have been referred to as "food deserts." It is thought that improving food access may help curb the obesity epidemic. Little is known about where residents of food deserts shop and if shopping habits are associated with body mass index (BMI). We evaluated the association of food shopping and acquisition (e.g., obtaining food from church, food pantries, etc.) with BMI among 459 residents of low-income communities from two South Carolina counties, 81% of whom lived in United States Department of Agriculture-designated food deserts. Participants were interviewed about food shopping and acquisition and perceptions of their food environment, and weight and height were measured. Distances to food retail outlets were determined. Multivariable linear regression analysis was employed. Our study sample comprising largely African-American women had an average BMI of 32.5 kg/m². The vast majority of study participants shopped at supermarkets (61%) or supercenters/warehouse clubs (27%). Shopping at a supercenter or warehouse club as one's primary store was significantly associated with a 2.6 kg/m² higher BMI compared to shopping at a supermarket, independent of demographics, socioeconomics, physical activity, and all other food shopping/acquisition behaviors. Persons who reported shopping at a small grocery store or a convenience or dollar store as their tertiary store had a 2.6 kg/m² lower BMI. Respondents who perceived lack of access to adequate food shopping in their neighborhoods as a problem had higher BMI. Living in a food desert census tract was not significantly associated with BMI. Other shopping attributes, including distance to utilized and nearest grocery stores, were not independently associated with BMI. These findings call into question the idea that poor spatial access to grocery stores is a key underlying factor affecting the obesity epidemic. Future research should consider assessing

BMI, waist circumference at 8 and 12 years of age and FVC and FEV

NARCIS (Netherlands)

Bekkers, Marga B.; Wijga, Alet H.; Gehring, Ulrike; Koppelman, Gerard H.; de Jongste, Johan C.; Smit, Henriette A.; Brunekreef, Bert

2015-01-01

Background: In adults, overweight is associated with reduced lung function, in children evidence on this association is conflicting. We examined the association of body mass index (BMI) and waist circumference (WC) at age 12, and of persistently (at ages 8 and 12 years) high BMI and large WC, with

TCR-independent functions of Th17 cells mediated by the synergistic actions of cytokines of the IL-12 and IL-1 families.

Directory of Open Access Journals (Sweden)

Yun Kyung Lee

Full Text Available The development of Th17 cells is accompanied by the acquisition of responsiveness to both IL-12 and IL-23, cytokines with established roles in the development and/or function of Th1 and Th17 cells, respectively. IL-12 signaling promotes antigen-dependent Th1 differentiation but, in combination with IL-18, allows the antigen-independent perpetuation of Th1 responses. On the other hand, while IL-23 is dispensable for initial commitment to the Th17 lineage, it promotes the pathogenic function of the Th17 cells. In this study, we have examined the overlap between Th1 and Th17 cells in their responsiveness to common pro-inflammatory cytokines and how this affects the antigen-independent cytokine responses of Th17 cells. We found that in addition to the IL-1 receptor, developing Th17 cells also up-regulate the IL-18 receptor. Consequently, in the presence of IL-1β or IL-18, and in the absence of TCR activation, Th17 cells produce Th17 lineage cytokines in a STAT3-dependent manner when stimulated with IL-23, and IFN© via a STAT4-dependent mechanism when stimulated with IL-12. Thus, building on previous findings of antigen-induced plasticity of Th17 cells, our results indicate that this potential of Th17 cells extends to their cytokine-dependent antigen-independent responses. Collectively, our data suggest a model whereby signaling via either IL-1β or IL-18 allows for bystander responses of Th17 cells to pathogens or pathogen products that differentially activate innate cell production of IL-12 or IL-23.

The relationship of body mass index and the functional status of community-dwelling female older people admitting to a geriatric outpatient clinic.

Science.gov (United States)

Bahat, Gulistan; Tufan, Asli; Aydin, Yucel; Tufan, Fatih; Bahat, Zumrut; Akpinar, Timur Selcuk; Soyluk, Ozlem; Erten, Nilgun; Karan, Mehmet Akif

2015-06-01

The relationship of body mass index (BMI) with functional status differs in diversified geriatric population and various settings. In this study, we aimed to investigate whether BMI is related to functional status independent of age, nutritional status, multimorbidity, and polypharmacy in a group of Turkish community-dwelling female elderly. This study was conducted using a cross-sectional study design. Geriatric outpatient clinic of a university hospital. There were 438 female patients aged 60 years or older included in the analysis. Body mass indexes were calculated from weight (kg) divided by the square of height (m). Functional status was assessed with the evaluation of activities of daily living (ADL) and instrumental activities of daily living (IADL) scales. Diseases and drugs were determined after the evaluation of the patients with comprehensive geriatric assessment, physical examination, first-line biochemical tests, and using the patients' self-report and current medication lists. In total, 438 subjects comprised our study cohort. Mean age was 73.3 ± 6.9 years. Mean BMI was 27.8 ± 5.2 kg/m(2). Linear regression analysis revealed significant and independent association of lower BMI with higher ADL and IADL scores (p = 0.02, B = -0.10; p < 0.001, B = -0.17, respectively). ADL and IADL were significantly negatively correlated with BMI in subjects with normal nutrition (p = 0.03, r = -0.122; p = 0.001, r = -0.183) but not in subjects with malnutrition risk or malnutrition. We suggest that lower BMI is associated with better functional status in Turkish community-dwelling female older people. This association is prominent in the subjects with normal nutritional status. Our study recommends the need for further studies accounting for the nutritional status on the relationship between BMI and functionality in different populations and in different settings. It represents an important example for diversity in BMI-functionality relationship.

Muscle mass, BMI, and mortality among adults in the United States: A population-based cohort study.

Science.gov (United States)

Abramowitz, Matthew K; Hall, Charles B; Amodu, Afolarin; Sharma, Deep; Androga, Lagu; Hawkins, Meredith

2018-01-01

The level of body-mass index (BMI) associated with the lowest risk of death remains unclear. Although differences in muscle mass limit the utility of BMI as a measure of adiposity, no study has directly examined the effect of muscle mass on the BMI-mortality relationship. Body composition was measured by dual-energy x-ray absorptiometry in 11,687 participants of the National Health and Nutrition Examination Survey 1999-2004. Low muscle mass was defined using sex-specific thresholds of the appendicular skeletal muscle mass index (ASMI). Proportional hazards models were created to model associations with all-cause mortality. At any level of BMI ≥22, participants with low muscle mass had higher body fat percentage (%TBF), an increased likelihood of diabetes, and higher adjusted mortality than other participants. Increases in %TBF manifested as 30-40% smaller changes in BMI than were observed in participants with preserved muscle mass. Excluding participants with low muscle mass or adjustment for ASMI attenuated the risk associated with low BMI, magnified the risk associated with high BMI, and shifted downward the level of BMI associated with the lowest risk of death. Higher ASMI was independently associated with lower mortality. Effects were similar in never-smokers and ever-smokers. Additional adjustment for waist circumference eliminated the risk associated with higher BMI. Results were unchanged after excluding unintentional weight loss, chronic illness, early mortality, and participants performing muscle-strengthening exercises or recommended levels of physical activity. Muscle mass mediates associations of BMI with adiposity and mortality and is inversely associated with the risk of death. After accounting for muscle mass, the BMI associated with the greatest survival shifts downward toward the normal range. These results provide a concrete explanation for the obesity paradox.

Does more education cause lower BMI, or do lower-BMI individuals become more educated? Evidence from the National Longitudinal Survey of Youth 1979.

Science.gov (United States)

Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L

2017-03-21

More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.

The role of a FADS1 polymorphism in the association of fatty acid blood levels, BMI and blood pressure in young children-Analyses based on path models.

Directory of Open Access Journals (Sweden)

Maike Wolters

Full Text Available The recent obesity epidemic in children also showed an increase in the prevalence of hypertension. As blood pressure (BP is associated with (long-chain polyunsaturated fatty acids (LC PUFA, genetic variation in desaturase enzymes being involved in the synthesis of LC PUFA may be associated with BP. This study aimed to investigate the direct effects (independent of mediating variables and indirect effects (mediated through intermediate variables of a common variant in the FADS1 gene, rs174546, known to affect delta-5 desaturase (D5D activity on PUFA level, body mass index (BMI and BP.A subsample of the IDEFICS (Identification and prevention of dietary- and lifestyle-induced health effects in children and infants baseline survey including 520 children aged 2 to <10 years from six European countries was included. The association between rs174546 (TBMI z-score were investigated through path model analyses, adjusting for sex, age, educational level of parents, family history of hypertension, lifestyle factors and blood levels of saturated and monounsaturated fatty acids, triglycerides and low density lipoprotein cholesterol. Whole blood fatty acids were measured by a validated gas chromatographic method and recorded as percentage of weight of all fatty acids detected.Minor allele carriers of the SNP rs174546 had significantly higher DGLA and lower ARA and EPA levels as well as a lower D5D index. Via ARA and BMI z-score, the polymorphism had an indirect lowering effect on systolic BP z-score for each additional T allele (standardized effect estimate -0.057, p = 0.007. For DGLA, EPA and D5D index, the indirect effects of rs174546 on systolic BP were also negative but did not reach significance. DGLA and EPA had an increasing indirect effect on

A novel zinc finger protein Zfp277 mediates transcriptional repression of the Ink4a/arf locus through polycomb repressive complex 1

DEFF Research Database (Denmark)

Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu

2010-01-01

. METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....

Circulating alpha1-antitrypsin in the general population: Determinants and association with lung function

Directory of Open Access Journals (Sweden)

Berger Wolfgang

2008-04-01

Full Text Available Abstract Background Severe alpha1-antitrypsin (AAT deficiency associated with low AAT blood concentrations is an established genetic COPD risk factor. Less is known about the respiratory health impact of variation in AAT serum concentrations in the general population. We cross-sectionally investigated correlates of circulating AAT concentrations and its association with FEV1. Methods In 5187 adults (2669 females with high-sensitive c-reactive protein (CRP levels ≤ 10 mg/l from the population-based Swiss SAPALDIA cohort, blood was collected at the time of follow-up examination for measuring serum AAT and CRP. Results Female gender, hormone intake, systolic blood pressure, age in men and in postmenopausal women, as well as active and passive smoking were positively, whereas alcohol intake and BMI inversely correlated with serum AAT levels, independent of CRP adjustment. We observed an inverse association of AAT with FEV1 in the total study population (p Conclusion The results of this population-based study reflect a complex interrelationship between tobacco exposure, gender related factors, circulating AAT, systemic inflammatory status and lung function.

Mxi1 and Mxi1-0 Antagonize N-Myc Function and Independently Mediate Apoptosis in Neuroblastoma

Directory of Open Access Journals (Sweden)

David A. Erichsen

2015-02-01

Full Text Available Neuroblastoma (NB is the third most common malignancy of childhood, and outcomes for children with advanced disease remain poor; amplification of the MYCN gene portends a particularly poor prognosis. Mxi1 antagonizes N-Myc by competing for binding to Max and E-boxes. Unlike N-Myc, Mxi1 mediates transcriptional repression and suppresses cell proliferation. Mxi1 and Mxi1-0 (an alternatively transcribed Mxi1 isoform share identical Max and DNA binding domains but differ in amino-terminal sequences. Because of the conservation of these critical binding domains, we hypothesized that Mxi1-0 antagonizes N-Myc activity similar to Mxi1. SHEP NB cells and SHEP cells stably transfected with MYCN (SHEP/MYCN were transiently transfected with vectors containing full-length Mxi1, full-length Mxi1-0, or the common Mxi domain encoded by exons 2 to 6 (ex2-6. After incubation in low serum, parental SHEP/MYCN cell numbers were reduced compared with SHEP cells. Activated caspase-3 staining and DNA fragmentation ELISA confirmed that SHEP/MYCN cells undergo apoptosis in low serum, while SHEP/MYCN cells transfected with Mxi1 or Mxi1-0 do not. However, SHEP/MYCN cells transfected with Mxi1 or Mxi1-0 and grown in normal serum showed proliferation rates similar to SHEP cells. Mxi ex2-6 did not affect cell number in low or normal serum, suggesting that amino terminal domains of Mxi1 and Mxi1-0 are critical for antagonism. In the absence of N-Myc, Mxi1 and Mxi1-0 induce apoptosis independently through the caspase-8–dependent extrinsic pathway, while N-Myc activates the caspase-9–dependent intrinsic pathway. Together, these data indicate that Mxi1 and Mxi1-0 antagonize N-Myc but also independently impact NB cell survival.

Adjusting to motherhood. The importance of BMI in predicting maternal well-being, eating behaviour and feeding practice within a cross cultural setting.

Science.gov (United States)

Shloim, Netalie; Rudolf, Mary; Feltbower, Richard; Hetherington, Marion

2014-10-01

Maternal body mass index (BMI) is associated with negative body image and restrained eating which are experienced differently across cultures. The present study aimed to: 1) examine if self-esteem, eating behaviours and body satisfaction changed from early pregnancy to 2-6 months after giving birth; 2) explore changes according to country (Israel vs. UK) and BMI; and 3) determine any relationship between these measurements and infant feeding. Participants completed questionnaires assessing self-esteem, body image and eating/feeding behaviours. Multilevel linear modelling was used to account for change and to assess the independent impact of BMI on outcomes. Seventy-three women and infants participated in the study in early pregnancy and again 16 (9) weeks following birth. Women gained 1.5 kg (range -12 + 23) and UK mothers reported significantly greater body dissatisfaction, but self-esteem and eating behaviours remained stable. BMI was the main predictor of self-esteem, eating behaviours and body satisfaction. Mothers' perceptions of infant's eating did not vary according to BMI or country; however, heavier mothers reported feeding their infants according to a schedule. The first months after giving birth are a key time to assess adjustment to motherhood but later assessments are necessary in order to track changes beyond the early period post-pregnancy. Copyright © 2014 Elsevier Ltd. All rights reserved.

Raldh1 promotes adiposity during adolescence independently of retinal signaling.

Directory of Open Access Journals (Sweden)

Di Yang

Full Text Available All-trans-retinoic acid (RA inhibits adipogenesis in established preadipocyte cell lines. Dosing pharmacological amounts of RA reduces weight gain in mice fed a high-fat diet, i.e. counteracts diet-induced obesity (DIO. The aldehyde dehydrogenase Raldh1 (Aldh1a1 functions as one of three enzymes that converts the retinol metabolite retinal into RA, and one of many proteins that contribute to RA homeostasis. Female Raldh1-ablated mice resist DIO. This phenotype contrasts with ablations of other enzymes and binding-proteins that maintain RA homeostasis, which gain adiposity. The phenotype observed prompted the conclusion that loss of Raldh1 causes an increase in adipose tissue retinal, and therefore, retinal functions independently of RA to prevent DIO. A second deduction proposed that low nM concentrations of RA stimulate adipogenesis, in contrast to higher concentrations. Using peer-reviewed LC/MS/MS assays developed and validated for quantifying tissue RA and retinal, we show that endogenous retinal and RA concentrations in adipose tissues from Raldh1-null mice do not correlate with the phenotype. Moreover, male Raldh1-null mice resist weight gain regardless of dietary fat content. Resistance to weight gain occurs during adolescence in both sexes. We show that RA concentrations as low as 1 nM, i.e. in the sub-physiological range, impair adipogenesis of embryonic fibroblasts from wild-type mice. Embryonic fibroblasts from Raldh1-null mice resist differentiating into adipocytes, but retain ability to generate RA. These fibroblasts remain sensitive to an RA receptor pan-agonist, and are not affected by an RA receptor pan-antagonist. Thus, the data do not support the hypothesis that retinal itself represses weight gain and adipogenesis independently of RA. Instead, the data indicate that Raldh1 functions as a retinal and atRA-independent promoter of adiposity during adolescence, and enhances adiposity through pre-adipocyte cell autonomous actions.

An interactive algorithm for identifying multiattribute measurable value functions based on finite-order independence of structural difference

International Nuclear Information System (INIS)

Tamura, Hiroyuki; Hikita, Shiro

1985-01-01

In this paper, we develop an interactive algorithm for identifying multiattribute measurable value functions based on the concept of finite-order independence of structural difference. This concept includes Dyer and Sarin's weak difference independence as special cases. The algorithm developed is composed of four major parts: 1) formulation of the problem 2) assessment of normalized conditional value functions and structural difference functions 3) assessment of corner values 4) assessment of the order of independence of structural difference and selection of the model. A hypothetical numerical example of a trade-off analysis for siting a nuclear power plant is included. (author)

Quadratic independence of coordinate functions of certain ...

Indian Academy of Sciences (India)

... are `quadratically independent' in the sense that they do not satisfy any nontrivial homogeneous quadratic relations among them. Using this, it is proved that there is no genuine compact quantum group which can act faithfully on C ( M ) such that the action leaves invariant the linear span of the above coordinate functions.

Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.

Science.gov (United States)

Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L

2018-02-01

Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.

Difficulty buying food, BMI, and eating habits in young children.

Science.gov (United States)

Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S

2018-01-22

To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.

Socioeconomic differences in childhood BMI trajectories in Belarus.

Science.gov (United States)

Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M

2018-02-28

To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location,  children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic

Effects of Body Mass Index on Lung Function Index of Chinese Population

Science.gov (United States)

Guo, Qiao; Ye, Jun; Yang, Jian; Zhu, Changan; Sheng, Lei; Zhang, Yongliang

2018-01-01

To study the effect of body mass index (BMI) on lung function indexes in Chinese population. A cross-sectional study was performed on 10, 592 participants. The linear relationship between lung function and BMI was evaluated by multivariate linear regression analysis, and the correlation between BMI and lung function was assessed by Pearson correlation analysis. Correlation analysis showed that BMI was positively related with the decreasing of forced vital capacity (FVC), forced expiratory volume in one second (FEV1) and FEV1/FVC (P <0.05), the increasing of FVC% predicted value (FVC%pre) and FEV1% predicted value (FEV1%pre). These suggested that Chinese people can restrain the decline of lung function to prevent the occurrence and development of COPD by the control of BMI.

Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer

Directory of Open Access Journals (Sweden)

Carolina Nör

2014-02-01

Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs

Proinflammatory cytokine levels in fibromyalgia patients are independent of body mass index.

Science.gov (United States)

Hernandez, Maria E; Becerril, Enrique; Perez, Mayra; Leff, Philippe; Anton, Benito; Estrada, Sergio; Estrada, Iris; Sarasa, Manuel; Serrano, Enrique; Pavon, Lenin

2010-06-03

Fibromyalgia (FM) is characterized by chronic, widespread muscular pain and tenderness and is generally associated with other somatic and psychological symptoms. Further, circulatory levels of proinflammatory cytokines (IL-1beta, TNF-alpha, and IL-6) may be altered in FM patients, possibly in association with their symptoms. Recently, rises in BMI have been suggested to contribute to increased circulating levels of proinflammatory cytokines in FM patients. Our aim was to measure the circulatory levels of proinflammatory cytokines to determine the influence of BMI on these levels in FM patients and healthy volunteers (HVs). In Spanish FM patients (n = 64) and HVs (n = 25), we measured BMI and serum concentrations of proinflammatory cytokines by capture ELISA. There were significant differences in BMI levels between FM patients (26.40 +/- 4.46) and HVs (23.64 +/- 3.45) and significant increase in IL-6 in FM patients (16.28 +/- 8.13 vs 0.92 +/- 0.32 pg/ml) (P BMI and TNF-alpha (F = 0.098, p = 0.75) or IL-6 (F = 0.221, p = 0.63) levels in FM patients. Our analysis in FM patients of BMI as a covariate of proinflammatory cytokines levels showed that serum TNF-alpha and IL-6 levels are independent of BMI. Further studies are necessary to dissect these findings and their implication in future therapeutic approaches for FM patients.

The effect of standardized food intake on the association between BMI and 1H-NMR metabolites

NARCIS (Netherlands)

Schutte, A.M.; Akker, van den Erik B.; Deelen, Joris; Rest, van de O.; Heemst, van D.; Feskens, E.J.M.; Beekman, M.; Slagboom, P.E.

2016-01-01

Multiple studies have shown that levels of 1H-NMR metabolites are associated with disease and risk factors of disease such as BMI. While most previous investigations have been performed in fasting samples, meta-analysis often includes both cohorts with fasting and non-fasting blood samples. In the

Proinflammatory cytokine levels in fibromyalgia patients are independent of body mass index

Directory of Open Access Journals (Sweden)

Estrada Iris

2010-06-01

Full Text Available Abstract Background Fibromyalgia (FM is characterized by chronic, widespread muscular pain and tenderness and is generally associated with other somatic and psychological symptoms. Further, circulatory levels of proinflammatory cytokines (IL-1β, TNF-α, and IL-6 may be altered in FM patients, possibly in association with their symptoms. Recently, rises in BMI have been suggested to contribute to increased circulating levels of proinflammatory cytokines in FM patients. Our aim was to measure the circulatory levels of proinflammatory cytokines to determine the influence of BMI on these levels in FM patients and healthy volunteers (HVs. In Spanish FM patients (n = 64 and HVs (n = 25, we measured BMI and serum concentrations of proinflammatory cytokines by capture ELISA. Findings There were significant differences in BMI levels between FM patients (26.40 ± 4.46 and HVs (23.64 ± 3.45 and significant increase in IL-6 in FM patients (16.28 ± 8.13 vs 0.92 ± 0.32 pg/ml (P Conclusions Our analysis in FM patients of BMI as a covariate of proinflammatory cytokines levels showed that serum TNF-α and IL-6 levels are independent of BMI. Further studies are necessary to dissect these findings and their implication in future therapeutic approaches for FM patients.

Upper limb function and functional independence in patients with shoulder pain after stroke

OpenAIRE

Nickel, Renato; Lange, Marcos; Stoffel, Diane Priscila; Navarro, Elaine Janeczko; Zetola, Viviane F

2017-01-01

ABSTRACT Objective To examine the frequency of shoulder pain following stroke. Methods Stroke patient function was evaluated using the Functional Independence Measure (FIM) and Scale for Upper Limb Function in Stroke (SULFS). Function scores were examined and compared between the shoulder pain group (SPG) and the no shoulder pain group (No-SPG). Results A total of 58 patients, 22 women (37.9%), were included in this study. The mean patient age was 49.2±10.8 years and study evaluations w...

BMI and breast cancer prognosis benefit: mammography screening reveals differences between normal weight and overweight women.

Science.gov (United States)

Crispo, Anna; Grimaldi, Maria; D'Aiuto, Massimiliano; Rinaldo, Massimo; Capasso, Immacolata; Amore, Alfonso; D'Aiuto, Giuseppe; Giudice, Aldo; Ciliberto, Gennaro; Montella, Maurizio

2015-02-01

Few studies are available on the potential impact of body weight on breast cancer prognosis in screen-detected patients. Moreover, it is not known whether body mass index (BMI) could have a different prognostic impact in screen-detected versus symptomatic breast cancer patients. To investigate these unsolved issues, we carried out a retrospective study evaluating the effect of BMI on breast cancer prognosis in screen-detected vs symptomatic breast cancer patients. We conducted a follow-up study on 448 women diagnosed with incident, histologically-confirmed breast cancer. Patients were categorized according to their BMI as normal weight, overweight and obese. Disease free survival (DFS), overall survival (OS), and BMI curves were compared according to mode of cancer detection. Among screen-detected patients, higher BMI was associated with a significant lower DFS, whereas no significant difference was observed among symptomatic patients. OS showed similar results. In the multivariate analysis adjusting for age, education, tumor size, nodal status, estrogen receptor (ER), progesterone receptor (PR) and menopausal status, the risk for high level of BMI among screen-detected patients did not reach the statistical significance for either recurrence or survival. Our study highlights the potential impact of high bodyweight in breast cancer prognosis, the findings confirm that obesity plays a role in women breast cancer prognosis independently from diagnosis mode. Copyright © 2014 Elsevier Ltd. All rights reserved.

Design and Optimization of an EEG-Based Brain Machine Interface (BMI) to an Upper-Limb Exoskeleton for Stroke Survivors

Science.gov (United States)

Bhagat, Nikunj A.; Venkatakrishnan, Anusha; Abibullaev, Berdakh; Artz, Edward J.; Yozbatiran, Nuray; Blank, Amy A.; French, James; Karmonik, Christof; Grossman, Robert G.; O'Malley, Marcia K.; Francisco, Gerard E.; Contreras-Vidal, Jose L.

2016-01-01

This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG)-based brain machine interface (BMI). Intent was inferred from movement related cortical potentials (MRCPs) measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II), to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: (1) an adaptive time window was used for extracting features during BMI calibration; (2) training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and (3) BMI predictions were gated by residual electromyography (EMG) activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR) = 62.7 ± 21.4% on day 4 and 67.1 ± 14.6% on day 5. The overall false positive rate (FPR) across subjects was 27.74 ± 37.46% on day 4 and 27.5 ± 35.64% on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10%). On average, motor intent was detected −367 ± 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration. PMID:27065787

Design and optimization of an EEG-based brain machine interface (BMI to an upper-limb exoskeleton for stroke survivors

Directory of Open Access Journals (Sweden)

Nikunj Arunkumar Bhagat

2016-03-01

Full Text Available This study demonstrates the feasibility of detecting motor intent from brain activity of chronic stroke patients using an asynchronous electroencephalography (EEG-based brain machine interface (BMI. Intent was inferred from movement related cortical potentials (MRCPs measured over an optimized set of EEG electrodes. Successful intent detection triggered the motion of an upper-limb exoskeleton (MAHI Exo-II, to guide movement and to encourage active user participation by providing instantaneous sensory feedback. Several BMI design features were optimized to increase system performance in the presence of single-trial variability of MRCPs in the injured brain: 1 an adaptive time window was used for extracting features during BMI calibration; 2 training data from two consecutive days were pooled for BMI calibration to increase robustness to handle the day-to-day variations typical of EEG, and 3 BMI predictions were gated by residual electromyography (EMG activity from the impaired arm, to reduce the number of false positives. This patient-specific BMI calibration approach can accommodate a broad spectrum of stroke patients with diverse motor capabilities. Following BMI optimization on day 3, testing of the closed-loop BMI-MAHI exoskeleton, on 4th and 5th days of the study, showed consistent BMI performance with overall mean true positive rate (TPR = 62.7 +/- 21.4 % on day 4 and 67.1 +/- 14.6 % on day 5. The overall false positive rate (FPR across subjects was 27.74 +/- 37.46 % on day 4 and 27.5 +/- 35.64 % on day 5; however for two subjects who had residual motor function and could benefit from the EMG-gated BMI, the mean FPR was quite low (< 10 %. On average, motor intent was detected -367 +/- 328 ms before movement onset during closed-loop operation. These findings provide evidence that closed-loop EEG-based BMI for stroke patients can be designed and optimized to perform well across multiple days without system recalibration.

Food and drinking patterns as predictors of 6-year BMI-adjusted changes in waist circumference

DEFF Research Database (Denmark)

Halkjær, Jytte; Sørensen, Thorkild I A; Tjønneland, Anne

2004-01-01

Few studies have investigated the prospective associations between diet or drinking patterns and abdominal obesity; we therefore investigated whether food and beverage groups or patterns predicted 6-year changes in waist circumference (WC) and whether these associations were independent...... of concurrent changes in BMI as a measure of general obesity. The subjects were 2300 middle-aged men and women with repeated measurements of dietary intake, BMI and WC from 1982 to 1993. Intakes from ten food groups and from coffee, tea, wine, beer and spirits were assessed; gender-specific food factors were......, but the associations were weakened, especially for women, after adjustment for BMI changes. None of the food factors was associated with WC changes. Based on the present study, we conclude that very few food items and no food patterns seem to predict changes in WC, whereas high intakes of beer and spirits among women...

Insulin resistance is associated with larger thyroid volume in adults with type 1 diabetes independently from presence of thyroid autoimmunity.

Science.gov (United States)

Rogowicz-Frontczak, Anita; Pilacinski, Stanislaw; Chwialkowska, Anna Teresa; Naskret, Dariusz; Zozulinska-Ziolkiewicz, Dorota

2018-04-19

To investigate the effect of insulin resistance (IR) on thyroid function, thyroid autoimmunity (AIT) and thyroid volume in type 1 diabetes (T1DM). 100 consecutive patients with T1DM aged 29 (±6) years with diabetes duration 13 (±6) years were included. Exclusion criteria were: history of thyroid disease, current treatment with L-thyroxin or anti-thyroid drugs. Evaluation of thyroid stimulating hormone (TSH), free thyroid hormones and anti-thyroid antibodies was performed. Thyroid volume was measured by ultrasonography. IR was assessed using the estimated glucose disposal rate (eGDR) formula. In the study group 22% of subjects had insulin resistance defined as eGDR lower or equal to 7.5 mg/kg/min. The prevalence of thyroid autoimmunity (positivity for ATPO or ATg or TRAb) in the study group was 37%. There were no significant differences in the concentration of TSH, FT3, FT4, the prevalence of AIT and hypothyroidism between IR and insulin sensitive (IS) group. Mean (±SD) thyroid volume was 15.6 (±6.2) mL in patients with IR and 11.7 (±4.7) mL in IS subjects (p = .002). Thyroid volume correlated inversely with eGDR (r = -0.35, p < .001). In a multivariate linear regression model the association between thyroid volume and eGDR was independent of sex, age, duration of diabetes, daily insulin dose, BMI, cigarette smoking, TSH value and presence of thyroid autoimmunity (beta: -0.29, p = .012). Insulin resisance is associated with larger thyroid volume in patients with type 1 diabetes independently of sex, body mass index, TSH value and presence of autoimmune thyroid disease.

On Delay-Independent Criteria for Oscillation of Higher-Order Functional Differential Equations

Directory of Open Access Journals (Sweden)

Yuangong Sun

2011-01-01

Full Text Available We investigate the oscillation of the following higher-order functional differential equation: x(n(t+q(t|x(t-τ|λ-1x(t-τ=e(t, where q(t and e(t are continuous functions on [t0,∞, 1>λ>0 and τ≠0 are constants. Unlike most of delay-dependent oscillation results in the literature, two delay-independent oscillation criteria for the equation are established in both the case τ>0 and the case τ<0 under the assumption that the potentials q(t and e(t change signs on [t0,∞.

The Report Card on BMI Report Cards.

Science.gov (United States)

Thompson, Hannah R; Madsen, Kristine A

2017-06-01

Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.

Polycomb complex protein BMI-1 promotes invasion and metastasis of pancreatic cancer stem cells by activating PI3K/AKT signaling, an ex vivo, in vitro, and in vivo study

Science.gov (United States)

Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li

2016-01-01

Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020

[Sedentary lifestyle is associated with metabolic and cardiovascular risk factors independent of physical activity].

Science.gov (United States)

Leiva, Ana María; Martínez, María Adela; Cristi-Montero, Carlos; Salas, Carlos; Ramírez-Campillo, Rodrigo; Díaz Martínez, Ximena; Aguilar-Farías, Nicolás; Celis-Morales, Carlos

2017-04-01

Sedentary behavior is a main risk factor for cardiovascular disease and mortality. To investigate the association between sedentary behavior and metabolic and cardiovascular risk factors. We assessed 322 participants aged between 18 to 65 years. Physical activity and sedentary behavior were measured with accelerometers (Actigraph®). Body mass index (BMI), waist circumference, percentage of body fat, diet and blood markers (glucose, lipid profile, insulin and HOMA-IR) were measured with standardized protocols. Thirty four percent of participants were physically inactive and spent on average 8.7 h/day on sedentary activities. Per one hour increase in sedentary behavior there were significant adverse changes in glucose (4.79 mg/dl), insulin (2.73 pmol/l), HOMA-IR (0.75), BMI (0.69 kg/m²), waist circumference (1.95 cm), fat mass (1.03%), total cholesterol (9.73 mg/dl), HDL-cholesterol (-3.50 mg/dl), LDL-cholesterol (10.7 mg/dl) and triglycerides (12.4 mg/dl). These findings were independent of main confounding factors including total physical activity, dietary factors, BMI and socio-demographics. The detrimental effect of sedentary behaviors on cardiometabolic and obesity-related traits is independent of physical activity levels. Therefore, reducing sedentary time should be targeted in the population apart from increasing their physical activity levels.

Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

Directory of Open Access Journals (Sweden)

Katarzyna Taran

2016-02-01

Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

Hypovitaminosis D is independently associated with metabolic syndrome in obese patients.

Directory of Open Access Journals (Sweden)

Ilaria Barchetta

Full Text Available BACKGROUND: Metabolic syndrome (MS and hypovitaminosis D represent two of the most diffuse condition worldwide, reaching pandemic proportions in industrialized countries, and are both strongly associated with obesity. This study set out to evaluate the presence of an independent association between hypovitaminosis D and MS in an adult population of obese subjects with/without MS. METHODS: We recruited 107 consecutive obese subjects, 61 with MS (age(mean±SD 45.3±13.3 years, BMI(mean±SD: 43.1±8.3 kg/m(2 and 46 without MS (age: 41.8±11.5, p = n.s., BMI:41.6±6.5 kg/m(2, p = n.s. comparable for sex, BMI, waist circumference and body fat mass, evaluated by bioimpedentiometry. 25(OH vitamin D3 levels were measured by colorimetric method. Insulin resistance was estimated by fasting blood insulin, HOMA-IR and ISI. RESULTS: Serum 25(OHD3 levels were significantly lower in MS obese patients than in obese subjects without MS (median(range 13.5(3.3-32 vs 17.4(5.1-37.4, p<0.007. Low 25(OHD3 levels correlated with glycaemia (p<0.007, phosphate (p<0.03, PTH (p<0.003 and the MS (p<0.001. Multivariate model confirmed that low 25(OHD3 levels were associated with the diagnosis of MS in obese patients independently from gender, age, serum PTH and body fat mass. After stratifying the study population according to 25(OHD3 concentrations, patients in the lowest quartile showed a markedly increased prevalence of MS compared to those in the highest quartile (OR = 4.1, CI 1.2-13.7, p = 0.02. CONCLUSIONS: A powerful association exists between hypovitaminosis D and MS in obese patients independently from body fat mass and its clinical correlates. This indicates that the association between low 25(OH D3 levels and MS is not merely induced by vitamin D deposition in fat tissue and reinforces the hypothesis that hypovitaminosis D represent a crucial independent determinant of MS.

BMI Trajectories from Birth to Young Adulthood.

Science.gov (United States)

McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K

2018-04-19

This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.

Regulation of P2Y1 receptor traffic by sorting Nexin 1 is retromer independent.

Science.gov (United States)

Nisar, Shaista; Kelly, Eamonn; Cullen, Pete J; Mundell, Stuart J

2010-04-01

The activity and traffic of G-protein coupled receptors (GPCRs) is tightly controlled. Recent work from our laboratory has shown that P2Y(1) and P2Y(12) responsiveness is rapidly and reversibly modulated in human platelets and that the underlying mechanism requires receptor trafficking as an essential part of this process. However, little is known about the molecular mechanisms underlying P2Y receptor traffic. Sorting nexin 1 (SNX1) has been shown to regulate the endosomal sorting of cell surface receptors either to lysosomes where they are downregulated or back to the cell surface. These functions may in part be due to interactions of SNX1 with the mammalian retromer complex. In this study, we investigated the role of SNX1 in P2Y receptor trafficking. We show that P2Y(1) receptors recycle via a slow recycling pathway that is regulated by SNX1, whereas P2Y(12) receptors return to the cell surface via a rapid route that is SNX1 independent. SNX1 inhibition caused a dramatic increase in the rate of P2Y(1) receptor recycling, whereas inhibition of Vps26 and Vps35 known to be present in retromer had no effect, indicating that SNX1 regulation of P2Y(1) receptor recycling is retromer independent. In addition, inhibition of SNX4, 6 and 17 proteins did not affect P2Y(1) receptor recycling. SNX1 has also been implicated in GPCR degradation; however, we provide evidence that P2Y receptor degradation is SNX1 independent. These data describe a novel function of SNX1 in the regulation of P2Y(1) receptor recycling and suggest that SNX1 plays multiple roles in endocytic trafficking of GPCRs.

Know Your Body Mass Index (BMI)

Science.gov (United States)

... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...

Reform of Kosovo Tax System after independence and its key functions

OpenAIRE

Dr.Sc. Bedri Peci

2013-01-01

In this paper we have analyzed the initial circumstances which characterize tax system in Kosovo after independence. After the Declaration of Independence, it is of the paramount importance that Kosovo has undergone through a reform of policy and tax system by exploring more seriously the economic functions. However, policy and tax system of Kosovo should be more in function of economic development by achieving equilibrium between direct and indirect taxes, increasing efficiency of public ...

Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

Energy Technology Data Exchange (ETDEWEB)

Guebitz, Raphael [Asklepios Hospital Altona, Hamburg (Germany). Dept. of Radiology and Neuroradiology; Lange, Tobias; Gosheger, Georg [University Hospital Muenster (Germany). Dept. of Orthopaedics and Tumor Orthopaedics; Heindel, Walter; Allkemper, Thomas [University Hospital Muenster (Germany). Dept. of Clinical Radiology; Stehling, Christoph [Sankt-Barbara Hospital Ham-Heessen, Hamm (Germany). Clinic for Radiology and Neuroradiology; Gerss, Joachim [Muenster Univ. (Germany). Inst. of Biostatistics and Clinical Research; Kanthak, Christian [Fraunhofer MEVIS, Bremen (Germany). Inst. for Medical Image Computing; Schulte, Tobias L. [Bochum Univ. St. Josef Hospital (Germany). Dept. of Orthopaedics and Trauma Surgery

2018-02-15

To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

International Nuclear Information System (INIS)

Guebitz, Raphael; Lange, Tobias; Gosheger, Georg; Heindel, Walter; Allkemper, Thomas; Stehling, Christoph; Gerss, Joachim; Kanthak, Christian; Schulte, Tobias L.

2018-01-01

To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

Science.gov (United States)

2014-03-01

8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

Science.gov (United States)

Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

2017-12-01

This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

Dinner rituals that correlate with child and adult BMI.

Science.gov (United States)

Wansink, Brian; van Kleef, Ellen

2014-05-01

What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.

The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.

Science.gov (United States)

Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale

2018-02-01

Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.

Apoptosis-Dependent and Apoptosis-Independent Functions Bim in Prostate Cancer Cells

National Research Council Canada - National Science Library

Liu, Junwei

2004-01-01

... (death, survival, proliferation/division, etc). Our hypothesis is that, under normal, unstimulated conditions, with its apoptotic function blocked, the upregulated Bim in PCa cells play an apoptosis-independent function...

FUNCTIONAL ASSESSMENT OF OLDER OBESE PATIENTS CANDIDATES FOR BARIATRIC SURGERY

Directory of Open Access Journals (Sweden)

Denis PAJECKI

2014-03-01

Full Text Available Context Obesity in the elderly is associated with exacerbation of functional decline (dependency, that occurs with aging, because of decreased muscle mass and strength, and increased joint dysfunction. Consequently, there is progressive loss of independence, autonomy, chronic pain and impaired quality of life. The weight loss can bring benefits in all these aspects, especially when accompanied by exercises. Elderly patients with morbid obesity may be submitted to surgical treatment, taking into account that the massive weight loss, eventually caused by bariatric surgery, may exacerbate the loss of muscle mass and nutritional complications that may bring harm to the overall health and quality of life of these patients. The functional assessment of elderly patients, candidates for bariatric surgery and the extent to which surgery can bring benefits to the patients, in the field of functionality, has still to be determined. Objective To describe profile functionality in obese elderly referred to a bariatric surgery program. Methods Patients with age ≥60 and BMI ≥35 underwent comprehensive geriatric assessment that evaluates co morbidities, medication use, ability to perform basic activities of daily living and instrumental activities of daily living, and the “Timedupandgo” test to evaluate mobility, whose cut-off point was ≤10 seconds. Statistical analysis was performed in order to see if there is a positive correlation of dependency with BMI and age (over or under 65 years. Results Forty subjects have completed evaluation. The mean age was 64.1 years (60-72 and 75% were women. They had an average weight of 121.1 kg (72.7-204 and a mean BMI of 47.2 kg/m2 (35.8-68.9. 16 patients (40% have shown dependency for activities of daily living, 19 (47,5% for instrumental activities of daily living and 20 patients (50% had a “Timedupandgo” test over 10 seconds. Statistical analysis (t-Student, Mann-Whitney, Binary Logistic Regression has shown

Functional independence and mobility in kidney transplanted patients: cross-sectional study

Directory of Open Access Journals (Sweden)

Tuíra O. Maia

2017-12-01

Full Text Available Abstract AIMS To assess functional independence, balance and mobility of kidney transplant recipients, to verify transplant time, donor type, regular exercise practice, musculoskeletal complaints, as well as association among these variables METHODS Observational study with 86 kidney transplant individuals, subjected to evaluation of the Functional Independence Measure (FIM and Timed Up and Go test (TUG. RESULTS The mean age of the study population was 43.98 years old, 50% of these individuals were between 5-10 years of transplantation and 50% between 10-15 years. Changes in mobility and balance (TUG were found in 9.3% of transplant patients, while 2.3% had deficits in functional independence (FIM. The association between TUG and the FIM (χ2= 19.964, p< 0.001 was found in 25% of the 9.3% of individuals who showed changes in TUG. It was found that only 20.9% of kidney transplant between 5-10 years and 14.0% between 11 and 15 years performed regular physical exercises (χ2= 0.727, p= 0.394 and 67.4% presented prevalent complaints on lower limbs musculoskeletal. CONCLUSION Although the level of dependence and impairments in mobility and balance found in renal transplants are low, deficits in mobility and balance may lead to changes in the ability to perform their functional activities independently.

A phosphatase-independent gain-of-function mutation in PTEN triggers aberrant cell growth in astrocytes through an autocrine IGF-1 loop.

Science.gov (United States)

Fernández, S; Genis, L; Torres-Alemán, I

2014-08-07

Loss-of-function mutations in the phosphatase PTEN (phosphatase and tensin homolog deleted on chromosome10) contribute to aberrant cell growth in part through upregulation of the mitogenic IGF-1/PI3K/Akt pathway. In turn, this pathway exerts a homeostatic feedback over PTEN. Using mutagenesis analysis to explore a possible impact of this mutual control on astrocyte growth, we found that truncation of the C-terminal region of PTEN (Δ51) associates with a marked increase in NFκB activity, a transcription factor overactivated in astrocyte tumors. Whereas mutations of PTEN are considered to lead to a loss-of-function, PTENΔ51, a truncation that comprises a region frequently mutated in human gliomas, displayed a neomorphic (gain-of-function) activity that was independent of its phosphatase activity. This gain-of-function of PTENΔ51 includes stimulation of IGF-1 synthesis through protein kinase A activation of the IGF-1 promoter. Increased IGF-1 originates an autocrine loop that activates Akt and NFκB. Constitutive activation of NFκB in PTENΔ51-expressing astrocytes leads to aberrant cell growth; astrocytes expressing this mutant PTEN generate colonies in vitro and tumors in vivo. Mutations converting a tumor suppressor such as PTEN into a tumor promoter through a gain-of-function involving IGF-1 production may further our understanding of the role played by this growth factor in glioma growth and help us define druggable targets for personalized therapy.

ATLANTIC-DIP: raised maternal body mass index (BMI) adversely affects maternal and foetal outcomes in glucose tolerant women classified using International Association of Diabetes and Pregnancy Study Groups (IADPSG) criteria

LENUS (Irish Health Repository)

Dennedy, MC

2011-09-15

Background and aims: Raised maternal body mass index (BMI), in association with hyperglycaemia is associated with adverse pregnancy outcome. Whether BMI has an independent effect on adverse pregnancy outcome is not clear. We aimed to investigate the effects of raised maternal BMI on pregnancy outcome in glucose tolerant women, classified using the IADPSG criteria.\\r\

Body size estimation of self and others in females varying in BMI.

Directory of Open Access Journals (Sweden)

Anne Thaler

Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Body size estimation of self and others in females varying in BMI.

Science.gov (United States)

Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J

2018-01-01

Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Malnutrition is independently associated with skin tears in hospital inpatient setting-Findings of a 6-year point prevalence audit.

Science.gov (United States)

Munro, Emma L; Hickling, Donna F; Williams, Damian M; Bell, Jack J

2018-05-24

Skin tears cause pain, increased length of stay, increased costs, and reduced quality of life. Minimal research reports the association between skin tears, and malnutrition using robust measures of nutritional status. This study aimed to articulate the association between malnutrition and skin tears in hospital inpatients using a yearly point prevalence of inpatients included in the Queensland Patient Safety Bedside Audit, malnutrition audits and skin tear audits conducted at a metropolitan tertiary hospital between 2010 and 2015. Patients were excluded if admitted to mental health wards or were <18 years. A total of 2197 inpatients were included, with a median age of 71 years. The overall prevalence of skin tears was 8.1%. Malnutrition prevalence was 33.5%. Univariate analysis demonstrated associations between age (P ˂ .001), body mass index (BMI) (P < .001) and malnutrition (P ˂ .001) but not gender (P = .319). Binomial logistic regression analysis modelling demonstrated that malnutrition diagnosed using the Subjective Global Assessment was independently associated with skin tear incidence (odds ratio, OR: 1.63; 95% confidence interval, CI: 1.13-2.36) and multiple skin tears (OR 2.48 [95% CI 1.37-4.50]). BMI was not independently associated with skin tears or multiple skin tears. This study demonstrated independent associations between malnutrition and skin tear prevalence and multiple skin tears. It also demonstrated the limitations of BMI as a nutritional assessment measure. © 2018 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

Gene-diet interaction effects on BMI levels in the Singapore Chinese population.

Science.gov (United States)

Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat

2018-02-24

Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction  = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.

Nutritional Intake in Low Body Mass Index (BMI Males with Type 1 Diabetes and Fibrocalcific Pancreatic Diabetes: What are the Unmet Needs? A Cross-Sectional Study from a South Indian Tertiary Care Hospital

Directory of Open Access Journals (Sweden)

Mini Joseph

2017-10-01

Full Text Available Introduction: There is paucity of data on the nutritional intake in low Body Mass Index (BMI Asian Indians with diabetes. Aim: To study the difference in the nutrient intake pattern in low-BMI Type 1 Diabetes Mellitus (T1DM and Fibrocalcific Pancreatic Diabetes (FCPD patients. Materials and Methods: This cross-sectional study consisted of T1DM (n=40 and FCPD (n=20 male patients with similar BMI. Nutritional data was collected using the 24 hour recall method and food diaries. Fasting blood samples were analysed for lipid profile, serum creatinine, glycosylated haemoglobin, albumin, calcium and vitamin D. Stool samples were analysed for pancreatic elastase. Percentage analysis, Independent sample t-test and Pearson coefficient correlation were used to analyse the data. A p-value<0.05 was considered as statistically significant. Results: The FCPD patients, on biochemical analysis, had significantly lower vitamin D levels compared to the T1DM group (p=0.035. However, haemoglobin, triglycerides, low density lipoproteins, creatinine, albumin and calcium were similar between the groups. In the nutrient data, FCPD patients had a significant higher intake of fat (p=0.039, fibre (p<0.001, calcium (p=0.047, phosphorous (p=0.035, and niacin (p=0.001 and calories from fat (p=0.047. The T1DM group had a significantly higher intake of thiamine (p=0.047 and carbohydrates (p=0.014. Conclusion: T1DM and FCPD groups have similar dietary pattern deficit in fibre, calories, macronutrients and micronutrients. Malabsorption and poor glycaemic control in FCPD patients can be attributed to a higher dietary fat intake. A balanced diet can ensure better glycaemic control.

Rate-distortion functions of non-stationary Markoff chains and their block-independent approximations

OpenAIRE

Agarwal, Mukul

2018-01-01

It is proved that the limit of the normalized rate-distortion functions of block independent approximations of an irreducible, aperiodic Markoff chain is independent of the initial distribution of the Markoff chain and thus, is also equal to the rate-distortion function of the Markoff chain.

A low frequency variant within the GWAS locus of MTNR1B affects fasting glucose concentrations: genetic risk is modulated by obesity.

Science.gov (United States)

Been, L F; Hatfield, J L; Shankar, A; Aston, C E; Ralhan, S; Wander, G S; Mehra, N K; Singh, J R; Mulvihill, J J; Sanghera, D K

2012-11-01

Two common variants (rs1387153, rs10830963) in MTNR1B have been reported to have independent effects on fasting blood glucose (FBG) levels with increased risk to type 2 diabetes (T2D) in recent genome-wide association studies (GWAS). In this investigation, we report the association of these two variants, and an additional variant (rs1374645) within the GWAS locus of MTNR1B with FBG, 2h glucose, insulin resistance (HOMA IR), β-cell function (HOMA B), and T2D in our sample of Asian Sikhs from India. Our cohort comprised 2222 subjects [1201 T2D, 1021 controls]. None of these SNPs was associated with T2D in this cohort. Our data also could not confirm association of rs1387153 and rs10830963 with FBG phenotype. However, upon stratifying data according to body mass index (BMI) (low ≤ 25 kg/m(2) and high > 25 kg/m(2)) in normoglycemic subjects (n = 1021), the rs1374645 revealed a strong association with low FBG levels in low BMI group (β = -0.073, p = 0.002, Bonferroni p = 0.01) compared to the high BMI group (β = 0.015, p = 0.50). We also detected a strong evidence of interaction between rs1374645 and BMI with respect to FBG levels (p = 0.002). Our data provide new information about the significant impact of another MTNR1B variant on FBG levels that appears to be modulated by BMI. Future confirmation on independent datasets and functional studies will be required to define the role of this variant in fasting glucose variation. Published by Elsevier B.V.

Defining ATM-Independent Functions of the Mre11 Complex with a Novel Mouse Model.

Science.gov (United States)

Balestrini, Alessia; Nicolas, Laura; Yang-Lott, Katherine; Guryanova, Olga A; Levine, Ross L; Bassing, Craig H; Chaudhuri, Jayanta; Petrini, John H J

2016-02-01

The Mre11 complex (Mre11, Rad50, and Nbs1) occupies a central node of the DNA damage response (DDR) network and is required for ATM activation in response to DNA damage. Hypomorphic alleles of MRE11 and NBS1 confer embryonic lethality in ATM-deficient mice, indicating that the complex exerts ATM-independent functions that are essential when ATM is absent. To delineate those functions, a conditional ATM allele (ATM(flox)) was crossed to hypomorphic NBS1 mutants (Nbs1(ΔB/ΔB) mice). Nbs1(ΔB/ΔB) Atm(-/-) hematopoietic cells derived by crossing to vav(cre) were viable in vivo. Nbs1(ΔB/ΔB) Atm(-/-) (VAV) mice exhibited a pronounced defect in double-strand break repair and completely penetrant early onset lymphomagenesis. In addition to repair defects observed, fragile site instability was noted, indicating that the Mre11 complex promotes genome stability upon replication stress in vivo. The data suggest combined influences of the Mre11 complex on DNA repair, as well as the responses to DNA damage and DNA replication stress. A novel mouse model was developed, by combining a vav(cre)-inducible ATM knockout mouse with an NBS1 hypomorphic mutation, to analyze ATM-independent functions of the Mre11 complex in vivo. These data show that the DNA repair, rather than DDR signaling functions of the complex, is acutely required in the context of ATM deficiency to suppress genome instability and lymphomagenesis. ©2015 American Association for Cancer Research.

Functional Independent Scaling Relation for ORR/OER Catalysts

DEFF Research Database (Denmark)

Christensen, Rune; Hansen, Heine Anton; Dickens, Colin F.

2016-01-01

reactions. Here, we show that the oxygen-oxygen bond in the OOH* intermediate is, however, not well described with the previously used class of exchange-correlation functionals. By quantifying and correcting the systematic error, an improved description of gaseous peroxide species versus experimental data...... and a reduction in calculational uncertainty is obtained. For adsorbates, we find that the systematic error largely cancels the vdW interaction missing in the original determination of the scaling relation. An improved scaling relation, which is fully independent of the applied exchange-correlation functional...

Smoking and Socio-demographic correlates of BMI

Directory of Open Access Journals (Sweden)

Peizhi Wang

2016-06-01

Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.

Functional Connectivity Parcellation of the Human Thalamus by Independent Component Analysis.

Science.gov (United States)

Zhang, Sheng; Li, Chiang-Shan R

2017-11-01

As a key structure to relay and integrate information, the thalamus supports multiple cognitive and affective functions through the connectivity between its subnuclei and cortical and subcortical regions. Although extant studies have largely described thalamic regional functions in anatomical terms, evidence accumulates to suggest a more complex picture of subareal activities and connectivities of the thalamus. In this study, we aimed to parcellate the thalamus and examine whole-brain connectivity of its functional clusters. With resting state functional magnetic resonance imaging data from 96 adults, we used independent component analysis (ICA) to parcellate the thalamus into 10 components. On the basis of the independence assumption, ICA helps to identify how subclusters overlap spatially. Whole brain functional connectivity of each subdivision was computed for independent component's time course (ICtc), which is a unique time series to represent an IC. For comparison, we computed seed-region-based functional connectivity using the averaged time course across all voxels within a thalamic subdivision. The results showed that, at p analysis, ICtc analysis revealed patterns of connectivity that were more distinguished between thalamic clusters. ICtc analysis demonstrated thalamic connectivity to the primary motor cortex, which has eluded the analysis as well as previous studies based on averaged time series, and clarified thalamic connectivity to the hippocampus, caudate nucleus, and precuneus. The new findings elucidate functional organization of the thalamus and suggest that ICA clustering in combination with ICtc rather than seed-region analysis better distinguishes whole-brain connectivities among functional clusters of a brain region.

E2F-1-Induced p53-independent apoptosis in transgenic mice

DEFF Research Database (Denmark)

Holmberg, Christian Henrik; Helin, K.; Sehested, M.

1998-01-01

The E2F transcription factors are key targets for the retinoblastoma protein, pRB. By inactivation of E2Fs, pRB prevents progression to the S phase. To test proliferative functions of E2F, we generated transgenic mice expressing human E2F-1 and/or human DP-1. When the hydroxymethyl glutaryl...... involving increased apoptosis in the germinal epithelium. This effect was potentiated by simultaneous overexpression of DP-1. Testicular atrophy as a result of overexpression of E2F-1 and DP-1 is independent of functional p53, since p53-nullizygous transgenic mice overexpressing E2F-1 and DP-1 also suffered...

Right heart structural changes are independently associated with exercise capacity in non-severe COPD.

Directory of Open Access Journals (Sweden)

Michael J Cuttica

Full Text Available Pulmonary hypertension (PH occurs frequently and results in functional limitation in advanced COPD. Data regarding the functional consequence of PH in less severe COPD are limited. Whether echocardiographic evidence of right sided heart pathology is associated with functional outcomes in patients with non-severe COPD is unknown.We evaluated pulmonary function, six minute walk distance, and echocardiography in 74 consecutive patients with non-severe COPD. We performed multivariable linear regression to evaluate the association between right heart echocardiographic parameters and six minute walk distance adjusting for lung function, age, sex, race, and BMI.The mean six minute walk distance was 324±106 meters. All subjects had preserved left ventricular (LV systolic function (LV ejection fraction 62.3%±6.1%. 54.1% had evidence of some degree of diastolic dysfunction. 17.6% of subjects had evidence of right ventricular enlargement and 36.5% had right atrial enlargement. In univariate analysis RV wall thickness (β = -68.6; p = 0.002, log right atrial area (β = -297.9; p = 0.004, LV mass index (β = -1.3; p = 0.03, E/E' ratio (β = -5.5; p = 0.02, and degree of diastolic dysfunction (β = -42.8; p = 0.006 were associated with six minute walk distance. After adjustment for co-variables, the associations between right atrial area (log right atrial area β = -349.8; p = 0.003 and right ventricular wall thickness (β = -43.8; p = 0.04 with lower six minute walk distance remained significant independent of forced expiratory volume in one second (FEV1. LV mass index, E/E' ratio, and degree of diastolic dysfunction were not independent predictors of six minute walk distance.In patients with non-severe COPD right sided cardiac structural changes are associated with lower six minute walk distance independent of lung function. These findings may indicate that echocardiographic evidence of pulmonary

Meta-analysis of genome-wide linkage studies in BMI and obesity.

Science.gov (United States)

Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A

2007-09-01

The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.

Cognitive function predicts 24-month weight loss success after bariatric surgery.

Science.gov (United States)

Spitznagel, Mary Beth; Alosco, Michael; Strain, Gladys; Devlin, Michael; Cohen, Ronald; Paul, Robert; Crosby, Ross D; Mitchell, James E; Gunstad, John

2013-01-01

Clinically significant cognitive impairment, particularly in attention/executive and memory function, is found in many patients undergoing bariatric surgery. These difficulties have previously been linked to decreased weight loss 12 months after surgery, but more protracted examination of this relationship has not yet been conducted. The present study prospectively examined the independent contribution of cognitive function to weight loss 24 months after bariatric surgery. Given the rapid rate of cognitive improvement observed after surgery, postoperative cognitive function (i.e., cognition 12 weeks after surgery, controlling for baseline cognition) was expected to predict lower body mass index (BMI) and higher percent total weight loss (%WL) at 24-month follow-up. Data were collected by 3 sites of the Longitudinal Assessment of Bariatric Surgery (LABS) parent project. Fifty-seven individuals enrolled in the LABS project who were undergoing bariatric surgery completed cognitive evaluation at baseline, 12 weeks, and 24 months. BMI and %WL were calculated for 24-month postoperative follow-up. Better cognitive function 12 weeks after surgery predicted higher %WL and lower BMI at 24 months, and specific domains of attention/executive and memory function were robustly related to decreased BMI and greater %WL at 24 months. Results show that cognitive performance shortly after bariatric surgery predicts greater long-term %WL and lower BMI 24 months after bariatric surgery. Further work is needed to clarify the degree to which this relationship is mediated by adherence to postoperative guidelines. Copyright © 2013 American Society for Bariatric Surgery. Published by Elsevier Inc. All rights reserved.

Functional independence and health-related functional status following spinal cord injury : a prospective study of the association with physical capacity

NARCIS (Netherlands)

Haisma, Janneke A.; Post, Marcel W.; van der Woude, Lucas H.; Stam, Henk J.; Bergen, Michael P.; Sluis, Tebbe A.; van den Berg-Emons, Hendrika J.; Bussmann, Johannes B.

2008-01-01

Objective: To determine changes in functional independence following spinal cord injury and to evaluate the association between functional independence and physical capacity. Design: Multi-centre prospective cohort study. Subjects: Patients with spinal cord injury admitted for initial

Human milk insulin is related to maternal plasma insulin and BMI: but other components of human milk do not differ by BMI.

Science.gov (United States)

Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F

2017-09-01

The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.

Overweight young female kidney donors have low renal functional reserve post-donation.

Science.gov (United States)

van Londen, Marco; Schaeffers, Anouk W M A; de Borst, Martin H; Joles, Jaap A; Navis, Gerjan; Lely, A Titia

2018-01-03

Maintenance of adequate renal function after living kidney donation is important for donor outcome. Overweight donors in particular may have an increased risk for end stage kidney disease (ESKD), and young female donors have an increased preeclampsia risk. Both of these risks may associate with low post-donation renal functional reserve (RFR). Because we previously found that higher BMI and lower post-donation RFR were associated, we now studied the relationship between BMI and RFR in young female donors. RFR, the rise in GFR (125I-Iothalamate clearance) during dopamine, was measured in female donors (donation. Donors who are overweight (BMI>25) and non-overweight donors were compared by t-test; the association was subsequently explored with regression analysis. We included 105 female donors (age 41 [36-44] (median[IQR])) with a BMI of 25 [22-27] kg/m2. Pre-donation GFR was 118 (17) ml/min (mean(SD)) rising to 128 (19) ml/min during dopamine; mean RFR was 10 (10) ml/min. Post-donation GFR was 76 (13) ml/min, rising to 80 (12); RFR was 4 (6) ml/min (pdonation). In overweight donors, RFR was fully lost after donation (1 ml/min vs. 10 ml/min pre-donation, pdonation, independent of confounders (St. β 0.37, p=0.02). Reduced RFR might associate with the risk of preeclampsia and ESKD in kidney donors. Prospective studies should explore whether RFR is related to preeclampsia and whether BMI reduction prior to conception is of benefit to overweight female kidney donors during and after pregnancy.

Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.

Science.gov (United States)

Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M

Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for

Optimum BMI cut points to screen asian americans for type 2 diabetes.

Science.gov (United States)

Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y

2015-05-01

Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Associations between parity and maternal BMI in a population-based cohort study.

Science.gov (United States)

Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G

2018-02-07

We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.

Slow graft function and related risk factors in living donor kidney transplantation

Directory of Open Access Journals (Sweden)

Lesan Pezeshki M.

2008-03-01

Full Text Available Background: While excellent organ quality and ideal transplant conditions eliminate many of the known factors that compromise initial graft function (IGF, slow graft function (SGF, still occurs after living donor kidney transplantation (LDKT. The aim of our current study is determination SGF frequency and its risk factors in LDKT Methods: In this prospective study, between April 2004 and March 2006, data were collected on 340 LDKT, in Baghiyattallah Hospital, Tehran. Recipients were analyzed in two groups based on initial graft function (IGF: Creatinine <3 mg/dl 5 day after transplantation, SGF: Creatinine ≥ 3 mg/dl 5 day after transplantation with out dialysis in the first week. Donors' and recipients' characteristics and recipient lab. data were compared in two groups by chi-square, Mann-whitney & independent samples T-test.Results: The incidence of SGF was 22 (6.2% and IGF 318 (89.8%, Recipients' BMI in IGF were 22.1±3.9 and in SGF were 25.3±3.8 (P=0.001 95% Cl 1.097-1.401 OR= 1.24. SGF relative frequency in female donors is more than male donors. A multivariate analysis model confirms this significant difference. (P=0.044 95% Cl 1.028-7.971 OR= 2.862. SGF relative frequency in PRA (Panel Reactive Antibody positive recipients are more than negative ones. A multivariate analysis model confirms this significant difference. (P=0.007 95%Cl 1.755-35.280 OR= 7.849. Recipients' age and donors' BMI are significant in univariate analysis (P=0.002 & P=0.029 respectively but multivariate analysis model dose not confirm those significance. Serum ca & P & PTH levels don't have significant difference between IGF & SGF. Using calcium channels blockers have not a protective effect. Conclusions: We conclude that negative PRA and lower recipient BMI have protective effects on SGF. Recipients with female donors have higher chance to develop SGF. We recommend recipients reduce their BMI before transplantation. The male donors

HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients.

Science.gov (United States)

Grasso, Alessandro; Malfatti, Federica; Andraghetti, Gabriella; Marenco, Simona; Mazzucchelli, Chiara; Labanca, Sara; Cordera, Renzo; Testa, Roberto; Picciotto, Antonino

2015-01-01

Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P = 0.033 and 0.048, resp.) in patients who achieved an early viral load decay (EVR), a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients

Directory of Open Access Journals (Sweden)

Alessandro Grasso

2015-01-01

Full Text Available Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P=0.033 and 0.048, resp. in patients who achieved an early viral load decay (EVR, a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

Eating frequency in relation to BMI in very young children: a longitudinal analysis.

Science.gov (United States)

Taylor, Rachael W; Iosua, Ella; Heath, Anne-Louise M; Gray, Andrew R; Taylor, Barry J; Lawrence, Julie A; Hanna, Maha; Cameron, Sonya L; Sayers, Rachel; Galland, Barbara

2017-06-01

Eating less frequently is associated with increased obesity risk in older children but data are potentially confounded by reverse causation, where bigger children eat less often in an effort to control their weight. Longitudinal data, particularly in younger children, are scarce. We aimed to determine whether eating frequency (meals and snacks) at 2 years of age is associated with past, current or subsequent BMI. Cohort analysis of a randomised controlled trial. Eating frequency at 2 years of age was estimated using 48 h diaries that recorded when each child ate meals and snacks (parent-defined) in five-minute blocks. Body length/height and weight were measured at 1, 2 and 3·5 years of age. Linear regression assessed associations between the number of eating occasions and BMI Z-score, before and after adjustment for potential confounding variables. Prevention of Overweight in Infancy (POI) study, Dunedin, New Zealand. Children (n 371) aged 1-3·5 years. On average, children ate 5·5 (sd 1·2) times/d at 2 years of age, with most children (88-89 %) eating 4-7 times/d. Eating frequency at 2 years was not associated with current (difference in BMI Z-score per additional eating occasion; 95 % CI: -0·02; -0·10, 0·05) or subsequent change (0·02; -0·03, 0·06) in BMI. Similarly, BMI at age 1 year did not predict eating frequency at 2 years of age (difference in eating frequency per additional BMI Z-score unit; 95 % CI: -0·03; -0·19, 0·13). Number of eating occasions per day was not associated with BMI in young children in the present study.

A Rad53 independent function of Rad9 becomes crucial for genome maintenance in the absence of the Recq helicase Sgs1.

Directory of Open Access Journals (Sweden)

Ida Nielsen

Full Text Available The conserved family of RecQ DNA helicases consists of caretaker tumour suppressors, that defend genome integrity by acting on several pathways of DNA repair that maintain genome stability. In budding yeast, Sgs1 is the sole RecQ helicase and it has been implicated in checkpoint responses, replisome stability and dissolution of double Holliday junctions during homologous recombination. In this study we investigate a possible genetic interaction between SGS1 and RAD9 in the cellular response to methyl methane sulphonate (MMS induced damage and compare this with the genetic interaction between SGS1 and RAD24. The Rad9 protein, an adaptor for effector kinase activation, plays well-characterized roles in the DNA damage checkpoint response, whereas Rad24 is characterized as a sensor protein also in the DNA damage checkpoint response. Here we unveil novel insights into the cellular response to MMS-induced damage. Specifically, we show a strong synergistic functionality between SGS1 and RAD9 for recovery from MMS induced damage and for suppression of gross chromosomal rearrangements, which is not the case for SGS1 and RAD24. Intriguingly, it is a Rad53 independent function of Rad9, which becomes crucial for genome maintenance in the absence of Sgs1. Despite this, our dissection of the MMS checkpoint response reveals parallel, but unequal pathways for Rad53 activation and highlights significant differences between MMS- and hydroxyurea (HU-induced checkpoint responses with relation to the requirement of the Sgs1 interacting partner Topoisomerase III (Top3. Thus, whereas earlier studies have documented a Top3-independent role of Sgs1 for an HU-induced checkpoint response, we show here that upon MMS treatment, Sgs1 and Top3 together define a minor but parallel pathway to that of Rad9.

Predictors of increasing BMI during the course of diabetes in children and adolescents with type 1 diabetes: data from the German/Austrian DPV multicentre survey.

Science.gov (United States)

Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W

2014-08-01

Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Adaptation to Elastic Loads and BMI Robot Controls During Rat Locomotion examined with Point-Process GLMs.

Directory of Open Access Journals (Sweden)

Weiguo eSong

2015-04-01

Full Text Available Currently little is known about how a mechanically coupled BMI system’s actions are integrated into ongoing body dynamics. We tested a locomotor task augmented with a BMI system driving a robot mechanically interacting with a rat under three conditions: control locomotion (BL, ‘simple elastic load’ (E and ‘BMI with elastic load’ (BMI/E. The effect of the BMI was to allow compensation of the elastic load as a function of the neural drive. Neurons recorded here were close to one another in cortex, all within a 200 micron diameter horizontal distance of one another. The interactions of these close assemblies of neurons may differ from those among neurons at longer distances in BMI tasks and thus are important to explore. A point process generalized linear model (GLM, was used to examine connectivity at two different binning timescales (1ms vs. 10ms. We used GLM models to fit non-Poisson neural dynamics solely using other neurons’ prior neural activity as covariates. Models at different timescales were compared based on Kolmogorov-Smirnov (KS goodness-of-fit and parsimony. About 15% of cells with non-Poisson firing were well fitted with the neuron-to-neuron models alone. More such cells were fitted at the 1ms binning than 10ms. Positive connection parameters (‘excitation’ ~70% exceeded negative parameters (‘inhibition’ ~30%. Significant connectivity changes in the GLM determined networks of well-fitted neurons occurred between the conditions. However, a common core of connections comprising at least ~15% of connections persisted between any two of the three conditions. Significantly almost twice as many connections were in common between the two load conditions (~27%, compared to between either load condition and the baseline. This local point process GLM identified neural correlation structure and the changes seen across task conditions in the rats in this neural subset may be intrinsic to cortex or due to feedback and input

Phase advance and β function measurements using model-independent analysis

OpenAIRE

Chun-xi Wang; Vadim Sajaev; Chih-Yuan Yao

2003-01-01

Phase advance and β function are basic lattice functions characterizing the linear properties of an accelerator lattice. Accurate and efficient measurements of these quantities are important for commissioning and operating a machine. For rings with little coupling, we report a new method to measure these lattice functions based on the model-independent analysis technique, which uses beam histories of excited betatron oscillations measured simultaneously at a large number of beam position moni...

Body mass index and buttock circumference are independent predictors of disintegration failure in extracorporeal shock wave lithotripsy for ureteral calculi.

Science.gov (United States)

Yang, Teng-Kai; Yang, Hung-Ju; Lee, Liang-Min; Liao, Chun-Hou

2013-07-01

Effective stone disintegration by extracorporeal shockwave lithotripsy (ESWL) may depend on patient- and stone-related factors. We investigated predictors of disintegration failure in ESWL for a solitary ureteral calculus. From July 2008 to May 2010, 203 patients who underwent ESWL for a solitary ureteral calculus were enrolled. Clinical and radiologic data were collected, and factors related to ESWL failure were analyzed. Fifty-two patients (25.6%) showed ESWL failure, with a mean follow-up of 41 days. Forty patients (19.7%) required retreatment, including 12 who underwent repeat ESWL and 28 who underwent curative ureteroscopy. Patients with ESWL failure had significantly higher body weight, body mass index (BMI), and buttock circumference (BC) than patients for whom ESWL was successful. Univariate analysis showed that stone burden (odds ratio [OR], 1.04; 95% confidence interval [CI], 1.03-1.06) and BC (OR, 1.06; 95% CI, 1.01-1.11) were predictors of ESWL failure, while BMI was a potential predictor with borderline significance (OR, 1.09; 95% CI, 0.99-1.20). Multivariate analysis showed that stone burden (OR, 1.04; 95% CI, 1.03-1.06) was a significant predictor for all patients. On stratifying patients according to the level of ureteral calculi, BC was found to be an independent predictor (OR, 1.35; 95% CI, 1.02-1.80) for ESWL failure for middle/lower ureteral calculi and BMI (OR, 1.47; 95% CI, 1.13-1.91) for upper ureteral calculi. Stone burden is the main predictor of ESWL failure for all patients with ureteral calculi. BC and BMI are independent predictors for ESWL failure for middle/lower and upper ureteral calculi, respectively. Copyright © 2012. Published by Elsevier B.V.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

Science.gov (United States)

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

2018-01-01

The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.

Amodal brain activation and functional connectivity in response to high-energy-density food cues in obesity.

Science.gov (United States)

Carnell, Susan; Benson, Leora; Pantazatos, Spiro P; Hirsch, Joy; Geliebter, Allan

2014-11-01

The obesogenic environment is pervasive, yet only some people become obese. The aim was to investigate whether obese individuals show differential neural responses to visual and auditory food cues, independent of cue modality. Obese (BMI 29-41, n = 10) and lean (BMI 20-24, n = 10) females underwent fMRI scanning during presentation of auditory (spoken word) and visual (photograph) cues representing high-energy-density (ED) and low-ED foods. The effect of obesity on whole-brain activation, and on functional connectivity with the midbrain/VTA, was examined. Obese compared with lean women showed greater modality-independent activation of the midbrain/VTA and putamen in response to high-ED (vs. low-ED) cues, as well as relatively greater functional connectivity between the midbrain/VTA and cerebellum (P food cues within the midbrain/VTA and putamen, and altered functional connectivity between the midbrain/VTA and cerebellum, could contribute to excessive food intake in obese individuals. © 2014 The Obesity Society.

The impact of sex and BMI on the clinical course of COPD and bronchial asthma

Directory of Open Access Journals (Sweden)

Krzysztof Wytrychowski

2016-09-01

Full Text Available Background. Bronchial asthma is a heterogeneous disease, and is one phenotype of asthma with obesity. Chronic obstructive pulmonary disease is the fourth most frequent cause of death in the world. Objectives. The aim of the study was to assess the influence of BMI and sex on the clinical course of uncontrolled asthma and COPD with moderate to severe airflow limitation. Material and methods . The study was performed on 2 groups. Group A: 72 adults suffering from asthma (38 F – females, 34 M – males with at least 1 exacerbation requiring treatment with systemic corticosteroids in the year before the study. Group B: 79 patients (34 F, 45 M with COPD Grades 2 and 3 according to GOLD. Data including age, gender, BMI, disease duration, treatment, concomitant diseases, pack-years, and number of exacerbations in the last year were collected. Asthma Control Questionnaire scores in group A and COPD Assessment Test scores in group B were collected. Pulmonary function tests were performed in both groups. Results . There were no differences between females and males in the analyzed variables in both groups. Obese patients (BMI > 30.0 kg/m2 were selected for analysis from group A (18 F, 10 M and from group B (13 F, 16 M. In group A, the number of exacerbations was significantly lower in males (M 1.3 vs. F 1.9; p = 0.01. In group B the age of obese patients was higher than in patients with BMI ≤ 30.0 (68.3 vs. 62.5; p = 0.002. Conclusion . Poorer control of asthma in obese patients was associated with the female gender. Age is a risk factor for obesity development in patients with COPD.

Apoptosis-Dependent and Apoptosis-Independent Functions of Bim in Prostate Cancer Cells

National Research Council Canada - National Science Library

Tang, Dean; Liu, Junwei

2005-01-01

... (death, survival, proliferation/division, etc.). Our hypothesis is that, under normal, unstimulated conditions, with its apoptotic function blocked, the upregulated Bim in PCa cells plays an apoptosis-independent function...

Eating behaviour patterns and BMI in Portuguese higher education students.

Science.gov (United States)

Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora

2013-12-01

Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations

DEFF Research Database (Denmark)

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria

2018-01-01

Objective The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during......, and 80% improved their lipid concentrations. Conclusion Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition...... childhood obesity treatment. Methods 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6±21.7), and median BMI SDS 2.8 (range 1.3±5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0...